DOCSLIB.ORG

Supporting Information Figure S1. a Field Survey Was Conducted From

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Supporting Information Figure S1. a Field Survey Was Conducted From Supporting information Figure S1. A field survey was conducted from Dauphin Island to West Point Island, AL, at five sites in the order indicated. Oil and paired visibly contaminated and uncontaminated sand samples were collected representative of ball and sheet geometries. Location 4 had highest visible oil contamination [1]. 1 Figure S2 Representative chromatograms of field samples collected following the Deepwater Horizon oil spill obtained by GC-MS. a: Chromatogram of sample from an oil sheet, b: Chromatogram of sample from a ball. 2 Figure S3. Comparison of composition of oil samples from sheet and ball geometries determined by GC/MS. Bars are plotted as average and standard deviation of each fraction. a) Comparison 3 of six field-collected sheet and tar ball geometries. The amount of hydrocarbons detected were normalized to the mass of the sample of oil deposit and associated material from the field. No significant difference in oil composition was found between the two geometries according to a Hotelling’s t-squared test. b) GC MS analysis of the oil deposits from the duplicate sand columns after sacrifice. 4 Figure S4. Hierarchical cluster of the sub-samples with depth from blank column core. Depths correspond to those sub-sampled from oiled columns. Red dashed lines indicate that the difference between the clustered samples is not significant. y-axis is indicative of Bray-Curtis similarity at which a cluster is formed. Hierarchical clustering was conducted using ‘Group average’ method [2]. 5 Figure S5. Hierarchical cluster of the samples from the sheet column. Depths correspond to those sub-sampled from oiled columns. Red dashed lines indicate that the difference between the clustered samples is not significant. Y-axis is indicative of Bray-Curtis similarity at which a cluster is formed. Hierarchical clustering was conducted using ‘Group average’ method [2]. 6 Figure S6. Hierarchical cluster of the samples from the duplicate ball columns. Depths correspond to those sub-sampled from oiled columns. Red dashed lines indicate that the difference between the clustered samples is not significant. Y-axis is indicative of Bray-Curtis similarity at which a cluster is formed. Hierarchical clustering was conducted using ‘Group average’ method [2]. 7 Figure S7. 16S rRNA gene copies per gram of sub-sample of column cores with depth. Data for ball columns is average of duplicate columns. Error bars represent the standard deviation of triplicate qPCR measurements of each sample. 8 Table S1. Primer sequences and annealing temperatures employed for PCR and qPCR assays. Target Annealing Reference Primer a Primer (5’-3’) gene Temp. ( °C) 8F AGAGTTTGATCCTGGCTCAG [3] 16S rRNA b 50 1492R GGTTACCTTGTTACGACTT CGCCCGCCGCGCGCGGCGGGCGG I-341 F GC V3 16S GGCGGGGGCACGGGGGGCCTAC [4] 47 rRNA GGGAGGCAGCAG I-533 R TIACCGIIICTICTGGCAC CGGCGTTGCGCATTTYCAYACVV dsrA_290F T [5] dsrA 60 GCCGGACGATGCAGHTCRTCCTG dsrA_660R RWA GGTGGTGTMGGATTCACACARTA mcrA_1035F [5] mcrA 56 YGCWACAGC mcrA_1530R TTCATTGCRTAGTTWGGRTAGTT cat23 F CGACCTGATCTCCATGACCGA [6] cat23 66 cat23 R TCAGGTCAGCACGGTCA 1369F CGACCTGATCTCCATGACCGA [7] 16S rRNA b 60 1492R TCAGGTCAGCACGGTCA a Integrated DNA Technologies Inc (Coralville, IA.) b Primer set 8F and 1492R was used for PCR applications, whereas primer set 1369F and 1492R was used for qPCR. c Touchdown PCR was done for DGGE applications using primer set I-341 F GC and I-533 R. The annealing temperature for first two cycles was 52 °C and was brought down to 47 °C, reducing by 1 °C after every two cycles. 9 Table S2. PCR reaction matrix a Reagent Amount or concentration in 25 µµµl master mix 10 ××× PCR buffer d 2.5 µl 5××× PCR buffer d 5 µl dNTPs e 0.2 mM Forward and reverse primer a 0.25 µM Taq DNA polymerase f 1.75 U Formamide g 0.25 µl DNA template 1 µl Mg 2+ d 2mM a Integrated DNA Technologies Inc (Coralville, IA.) d MasterTaq kit (Eppendorf, Westbury, NY) was used for PCR assays. e (Promega Corporation, Madison, WI) f TAQ DNA POL (5U/ µl) (MP Biomedicals, Solon, OH) g Formamide Mol Bio Grade (Fisher Scientific Company LLC, Suwanee, GA.) 10 Table S3. qPCR reaction matrix Reagent Concentration in 20 µµµl master mix Forward and reverse primer a 0.3 µM SsoFast EvaGreen Supermix 1× iTaq h 0.1 µl a Integrated DNA Technologies Inc (Coralville, IA.) h (Bio-Rad, Hercules, CA); iTaq was only used for amplifying gene specific to alpha subunit dissimilatory sulfite reductase using dsrA_ 290F and dsrA_ 660R primer set. a All standard curves of qPCR were constructed from serial dilutions of cloned positive controls ranging from 10 8 to 10 2 gene copies per µL. Potential effects of inhibitors were assessed by serially diluting select samples and comparing PCR efficiencies with that of standards. It was found that a dilution of 1:50 effectively minimized inhibitory effects and was applied across samples. Samples were analyzed in triplicate with a standard curve and negative control included in each run. 11 Tabel S4. Clonal sequences of the qPCR product. mcr A Highest Match (GenBank Closest cultured relative (GenBank accession accession number) number) Uncultured Methanococcus Methanococcus maripaludis X1 (CP002913) sp. (AY454745) Methanococcus Methanococcus maripaludis strain S2 (BX950229) maripaludis (AF298223) Uncultured methanogenic Methanothermococcus okinawensis strain DSM archaeon clone 14208 (AY354033) (HQ635384) Methanobacterium Methanobacterium aarhusense methyl-coenzyme M aarhusense (AY386125) reductase alpha subunit ( mcr A) gene, partial cds.(AY386125) Uncultured methanogenic Methanothermococcus thermolithotrophicus mcrA archaeon clone gene for methyl CoM reductase subunit alpha, (AY354026) partial cds. (AB353226) Uncultured archaeon clone Methanobrevibacter smithii ATCC (GQ120965) 35061(CP000678) Uncultured methanogenic Methanosphaera stadtmanae DSM 3091 archaeon clone (CP000102) (DQ260943) Uncultured archaeon Methanothermococcus thermolithotrophicus mcrA (FN650317) gene for methyl CoM reductase subunit alpha, partial cds. (AB353226) Uncultured archaeon clone Methanothermococcus okinawensis IH1 (CP002792) ( EU495427) 12 Methanosarcina mazei Methanosarcina mazei strain Goe1 (AE008384) strain Goe1 (AE008384) Uncultured archaeon clone Methanothermobacter thermautotrophicus str. Delta (GU357471) H (AE000666) dsr A Highest Match (GenBank Closest cultured relative (GenBank accession accession number) number) Uncultured bacterium clone Desulfovibrio burkinensis DSM 6830 dissimilatory (EU192621) sulfite reductase alpha subunit ( dsr A) and dissimilatory sulfite reductase beta subunit ( dsr B) genes, partial cds. (AF418186) Uncultured bacterium clone Desulfovibrio burkinensis DSM 6830 dissimilatory 13_43 dissimilatory sulfite sulfite reductase alpha subunit ( dsr A) and reductase ( dsr A) gene, dissimilatory sulfite reductase beta subunit ( dsr B) partial cds. (EU192417) genes, partial cds. (AF418186) Uncultured sulfate- Desulfovibrio burkinensis dsr A, dsr B genes for reducing bacterium sulfite reductase alpha and beta subunits, partial cds. (AM494487) (B061536) Uncultured bacterium clone Olavius ilvae Delta 1 endosymbiont clone OIOsp2- (EU192588) 1-7 dissimilatory (bi)sulfite reductase alpha ( dsr A) and dissimilatory (bi)sulfite reductase beta ( dsr B) genes, partial cds. (DQ058671) Uncultured bacterium clone Desulfovibrio burkinensis DSM 6830 dissimilatory 12_23 dissimilatory sulfite sulfite reductase alpha subunit ( dsr A) and reductase ( dsr A) gene, dissimilatory sulfite reductase beta subunit ( dsr B) partial cds. (EU192450) genes, partial cds. (AF418186) Uncultured bacterium clone Desulfosalsimonas propionicica strain PropA Chap_PS2_18 dissimilatory dissimilatory sulfite reductase alpha subunit ( dsr A) sulfite reductase alpha and dissimilatory sulfite reductase beta subunit subunit ( dsr A) gene, partial (dsr B) genes, partial cds. (DQ386237) cds. (HM562943) 13 Uncultured bacterium clone NA CF3 dissimilatory sulfite reductase (AF442719) Desulfohalobium utahense Desulfohalobium utahen se strain EtOH3 strain EtOH3 dissimilatory dissimilatory sulfite reductase alpha subunit (dsrA) sulfite reductase alpha and dissimilatory sulfite reductase beta subunit subunit ( dsr A) and (dsr B) genes, partial cds. (DQ386236) dissimilatory sulfite reductase beta subunit (dsr B) genes, partial cds. (DQ386236) Uncultured sulfate- Olavius ilvae Delta 1 endosymbiont clone OIOsp2- reducing bacterium dsr A, 1-7 dissimilatory (bi)sulfite reductase alpha ( dsr A) dsr B genes for and dissimilatory (bi)sulfite reductase beta ( dsr B) dissimilatory sulfite genes, partial cds. (DQ058671) reductase alpha subunit, dissimilatory sulfite reductase beta subunit, partial cds (AB263151) Uncultured prokaryote Desulfosalsimonas propionicica strain PropA clone GSL_27_55 dissimilatory sulfite reductase alpha subunit ( dsr A) dissimilatory sulfite and dissimilatory sulfite reductase beta subunit reductase alpha subunit (dsr B) genes, partial cds (DQ386237) (dsr A) gene, partial cds. (DQ386256) cat23 Highest Match (GenBank Closest cultured relative (GenBank accession accession number) number) Uncultured bacterium clone Pseudomonas sp. IC catechol 2,3-dioxygenase C23O-2 catechol-2,3- (bph E) gene, complete cds, and 2-hydroxymuconic dioxygenase gene, semialdehyde dehydrogenase ( bph G) gene, partial complete cds. (DQ408374) cds. (U01825) Pseudomonas sp. KB35B Pseudomonas sp. KB35B catechol-degrading gene catechol-degrading gene cluster, complete sequence. (DQ265742) 14 cluster, complete sequence. (DQ265742) Pseudomonas sp. KB35B Pseudomonas sp. KB35B catechol-degrading gene
Load more

Recommended publications
  • Tesis Doctoral 2014 Filogenia Y Evolución De Las Poblaciones Ambientales Y Clínicas De Pseudomonas Stutzeri Y Otras Especies
    TESIS DOCTORAL 2014 FILOGENIA Y EVOLUCIÓN DE LAS POBLACIONES AMBIENTALES Y CLÍNICAS DE PSEUDOMONAS STUTZERI Y OTRAS ESPECIES RELACIONADAS Claudia A. Scotta Botta TESIS DOCTORAL 2014 Programa de Doctorado de Microbiología Ambiental y Biotecnología FILOGENIA Y EVOLUCIÓN DE LAS POBLACIONES AMBIENTALES Y CLÍNICAS DE PSEUDOMONAS STUTZERI Y OTRAS ESPECIES RELACIONADAS Claudia A. Scotta Botta Director/a: Jorge Lalucat Jo Director/a: Margarita Gomila Ribas Director/a: Antonio Bennasar Figueras Doctor/a por la Universitat de les Illes Balears Index Index ……………………………………………………………………………..... 5 Acknowledgments ………………………………………………………………... 7 Abstract/Resumen/Resum ……………………………………………………….. 9 Introduction ………………………………………………………………………. 15 I.1. The genus Pseudomonas ………………………………………………….. 17 I.2. The species P. stutzeri ………………………………………………......... 23 I.2.1. Definition of the species …………………………………………… 23 I.2.2. Phenotypic properties ………………………………………………. 23 I.2.3. Genomic characterization and phylogeny ………………………….. 24 I.2.4. Polyphasic identification …………………………………………… 25 I.2.5. Natural transformation ……………………………………………... 26 I.2.6. Pathogenicity and antibiotic resistance …………………………….. 26 I.3. Habitats and ecological relevance ………………………………………… 28 I.3.1. Role of mobile genetic elements …………………………………… 28 I.4. Methods for studying Pseudomonas taxonomy …………………………... 29 I.4.1. Biochemical test-based identification ……………………………… 30 I.4.2. Gas Chromatography of Cellular Fatty Acids ................................ 32 I.4.3. Matrix Assisted Laser-Desorption Ionization Time-Of-Flight
    [Show full text]
  • 2019 ASEAN-FEN 9Th International Fisheries Symposium BOOK of ABSTRACTS
    2019 ASEAN-FEN 9th International Fisheries Symposium BOOK OF ABSTRACTS A New Horizon in Fisheries and Aquaculture Through Education, Research and Innovation 18-21 November 2019 Seri Pacific Hotel Kuala Lumpur Malaysia Contents Oral Session Location… .................................................................... 1 Poster Session ...................................................................................... 2 Special Session… ................................................................................ 3 Special Session 1: ....................................................................... 4 Special Session 2: ..................................................................... 10 Special Session 3: ..................................................................... 16 Oral Presentation… ......................................................................... 26 Session 1: Fisheries Biology and Resource Management 1 ………………………………………………………………….…...27 Session 2: Fisheries Biology and Resource Management 2 …………………………………………………………...........….…62 Session 3: Nutrition and Feed........................................................ 107 Session 4: Aquatic Animal Health ................................................ 146 Session 5: Fisheries Socio-economies, Gender, Extension and Education… ..................................................................................... 196 Session 6: Information Technology and Engineering .................. 213 Session 7: Postharvest, Fish Products and Food Safety… ......... 219 Session
    [Show full text]
  • Respiratory Disorders of Fish
    This article appeared in a journal published by Elsevier. The attached copy is furnished to the author for internal non-commercial research and education use, including for instruction at the authors institution and sharing with colleagues. Other uses, including reproduction and distribution, or selling or licensing copies, or posting to personal, institutional or third party websites are prohibited. In most cases authors are permitted to post their version of the article (e.g. in Word or Tex form) to their personal website or institutional repository. Authors requiring further information regarding Elsevier’s archiving and manuscript policies are encouraged to visit: http://www.elsevier.com/copyright Author's personal copy Disorders of the Respiratory System in Pet and Ornamental Fish a, b Helen E. Roberts, DVM *, Stephen A. Smith, DVM, PhD KEYWORDS Pet fish Ornamental fish Branchitis Gill Wet mount cytology Hypoxia Respiratory disorders Pathology Living in an aquatic environment where oxygen is in less supply and harder to extract than in a terrestrial one, fish have developed a respiratory system that is much more efficient than terrestrial vertebrates. The gills of fish are a unique organ system and serve several functions including respiration, osmoregulation, excretion of nitroge- nous wastes, and acid-base regulation.1 The gills are the primary site of oxygen exchange in fish and are in intimate contact with the aquatic environment. In most cases, the separation between the water and the tissues of the fish is only a few cell layers thick. Gills are a common target for assault by infectious and noninfectious disease processes.2 Nonlethal diagnostic biopsy of the gills can identify pathologic changes, provide samples for bacterial culture/identification/sensitivity testing, aid in fungal element identification, provide samples for viral testing, and provide parasitic organisms for identification.3–6 This diagnostic test is so important that it should be included as part of every diagnostic workup performed on a fish.
    [Show full text]
  • Muricauda Ruestringensis Type Strain (B1T)
    Standards in Genomic Sciences (2012) 6:185-193 DOI:10.4056/sigs.2786069 Complete genome sequence of the facultatively anaerobic, appendaged bacterium Muricauda T ruestringensis type strain (B1 ) Marcel Huntemann1, Hazuki Teshima1,2, Alla Lapidus1, Matt Nolan1, Susan Lucas1, Nancy Hammon1, Shweta Deshpande1, Jan-Fang Cheng1, Roxanne Tapia1,2, Lynne A. Goodwin1,2, Sam Pitluck1, Konstantinos Liolios1, Ioanna Pagani1, Natalia Ivanova1, Konstantinos Mavromatis1, Natalia Mikhailova1, Amrita Pati1, Amy Chen3, Krishna Palaniappan3, Miriam Land1,4 Loren Hauser1,4, Chongle Pan1,4, Evelyne-Marie Brambilla5, Manfred Rohde6, Stefan Spring5, Markus Göker5, John C. Detter1,2, James Bristow1, Jonathan A. Eisen1,7, Victor Markowitz3, Philip Hugenholtz1,8, Nikos C. Kyrpides1, Hans-Peter Klenk5*, and Tanja Woyke1 1 DOE Joint Genome Institute, Walnut Creek, California, USA 2 Los Alamos National Laboratory, Bioscience Division, Los Alamos, New Mexico, USA 3 Biological Data Management and Technology Center, Lawrence Berkeley National Laboratory, Berkeley, California, USA 4 Oak Ridge National Laboratory, Oak Ridge, Tennessee, USA 5 Leibniz Institute DSMZ - German Collection of Microorganisms and Cell Cultures, Braunschweig, Germany 6 HZI – Helmholtz Centre for Infection Research, Braunschweig, Germany 7 University of California Davis Genome Center, Davis, California, USA 8 Australian Centre for Ecogenomics, School of Chemistry and Molecular Biosciences, The University of Queensland, Brisbane, Australia *Corresponding author: Hans-Peter Klenk ([email protected]) Keywords: facultatively anaerobic, non-motile, Gram-negative, mesophilic, marine, chemo- heterotrophic, Flavobacteriaceae, GEBA Muricauda ruestringensis Bruns et al. 2001 is the type species of the genus Muricauda, which belongs to the family Flavobacteriaceae in the phylum Bacteroidetes. The species is of inter- est because of its isolated position in the genomically unexplored genus Muricauda, which is located in a part of the tree of life containing not many organisms with sequenced genomes.
    [Show full text]
  • Detection and Identification of Fish Pathogens: What Is the Future?
    The Israeli Journal of Aquaculture – Bamidgeh 60(4), 2008, 213-229. 213 Detection and Identification of Fish Pathogens: What is the Future? A Review I. Frans1,2†, B. Lievens1,2*†, C. Heusdens1,2 and K.A. Willems1,2 1 Scientia Terrae Research Institute, B-2860 Sint-Katelijne-Waver, Belgium 2 Research Group Process Microbial Ecology and Management, Department Microbial and Molecular Systems, Katholieke Universiteit Leuven Association, De Nayer Campus, B-2860 Sint-Katelijne-Waver, Belgium, and Leuven Food Science and Nutrition Research Centre (LfoRCe), Katholieke Universiteit Leuven, B-3001 Heverlee-Leuven, Belgium (Received 1.8.08, Accepted 20.8.08) Key words: biosecurity, diagnosis, DNA array, multiplexing, real-time PCR Abstract Fish diseases pose a universal threat to the ornamental fish industry, aquaculture, and public health. They can be caused by many organisms, including bacteria, fungi, viruses, and protozoa. The lack of rapid, accurate, and reliable means of detecting and identifying fish pathogens is one of the main limitations in fish pathogen diagnosis and disease management and has triggered the search for alternative diagnostic techniques. In this regard, the advent of molecular biology, especially polymerase chain reaction (PCR), provides alternative means for detecting and iden- tifying fish pathogens. Many techniques have been developed, each requiring its own protocol, equipment, and expertise. A major challenge at the moment is the development of multiplex assays that allow accurate detection, identification, and quantification of multiple pathogens in a single assay, even if they belong to different superkingdoms. In this review, recent advances in molecular fish pathogen diagnosis are discussed with an emphasis on nucleic acid-based detec- tion and identification techniques.
    [Show full text]
  • Table S5. the Information of the Bacteria Annotated in the Soil Community at Species Level
    Table S5. The information of the bacteria annotated in the soil community at species level No. Phylum Class Order Family Genus Species The number of contigs Abundance(%) 1 Firmicutes Bacilli Bacillales Bacillaceae Bacillus Bacillus cereus 1749 5.145782459 2 Bacteroidetes Cytophagia Cytophagales Hymenobacteraceae Hymenobacter Hymenobacter sedentarius 1538 4.52499338 3 Gemmatimonadetes Gemmatimonadetes Gemmatimonadales Gemmatimonadaceae Gemmatirosa Gemmatirosa kalamazoonesis 1020 3.000970902 4 Proteobacteria Alphaproteobacteria Sphingomonadales Sphingomonadaceae Sphingomonas Sphingomonas indica 797 2.344876284 5 Firmicutes Bacilli Lactobacillales Streptococcaceae Lactococcus Lactococcus piscium 542 1.594633558 6 Actinobacteria Thermoleophilia Solirubrobacterales Conexibacteraceae Conexibacter Conexibacter woesei 471 1.385742446 7 Proteobacteria Alphaproteobacteria Sphingomonadales Sphingomonadaceae Sphingomonas Sphingomonas taxi 430 1.265115184 8 Proteobacteria Alphaproteobacteria Sphingomonadales Sphingomonadaceae Sphingomonas Sphingomonas wittichii 388 1.141545794 9 Proteobacteria Alphaproteobacteria Sphingomonadales Sphingomonadaceae Sphingomonas Sphingomonas sp. FARSPH 298 0.876754244 10 Proteobacteria Alphaproteobacteria Sphingomonadales Sphingomonadaceae Sphingomonas Sorangium cellulosum 260 0.764953367 11 Proteobacteria Deltaproteobacteria Myxococcales Polyangiaceae Sorangium Sphingomonas sp. Cra20 260 0.764953367 12 Proteobacteria Alphaproteobacteria Sphingomonadales Sphingomonadaceae Sphingomonas Sphingomonas panacis 252 0.741416341
    [Show full text]
  • AQUATIC SCIENCES and ENGINEERING
    AQUATIC SCIENCES and ENGINEERING VOLUME: 33 ISSUE: 3 2018 EISSN 2602-473X AQUATIC SCIENCES and ENGINEERING OWNER OF JOURNAL INTERNATIONAL EDITORIAL BOARD İstanbul University Faculty of Aquatic Sciences Prof. Genario Belmonte University of Salento, Italy EDITOR IN CHIEF Prof. Carsten Harms Prof. Devrim Memiş Applied University Bremerhaven, Germany İstanbul University Faculty of Aquatic Sciences, Turkey Prof. Konstantinos Kormas University of Thessaly, Greece DEAN Prof. Sergi Sabater Prof. Dr. Meriç Albay Institute of Aquatic Ecology, Spain Prof. Maya Petrova Stoyneva-Gaertner CO EDITOR IN CHIEF Sofia University “St Kliment Ohridski”, Bulgaria Prof. Özkan Özden Prof. Nuray Erkan İstanbul University Faculty of Aquatic Sciences, Turkey İstanbul University Faculty of Aquatic Sciences, Turkey LANGUAGE EDITOR Prof. Reyhan Akçaalan İstanbul University Faculty of Aquatic Sciences, Turkey Joanne Bates Department of Foreign Languages, İstanbul University, Prof. Saadet Karakulak İstanbul, Turkey İstanbul University Faculty of Aquatic Sciences, Turkey Prof. Sühendan Mol Tokay İstanbul University Faculty of Aquatic Sciences, Turkey Assoc. Prof. Lukas Kalous Czech University of Life Sciences, Czech Dr. Klaus Kohlmann Leibniz-Institute of Freshwater Ecology and Inland Fisheries, Germany Dr. Piero Addis University of Cagliari, Italy Dr. Nico Salmaso Research and Innovation Centre, Italy Dr. Petra Viser University of Amsterdam, Netherlands Publisher Copyright © 2018 İstanbul University Press Journal Adress: İstanbul University Faculty Aquatic Sciences, Ordu Caddesi No:8 34134 Laleli Fatih/İstanbul Turkey E-mail: [email protected] for submussion instructions, subcription and all other information visit http://dergipark.gov.tr/tjas Publication Services Publisher Publication Coordinators Graphics Department İbrahim KARA Betül ÇİMEN Ünal ÖZER Özlem ÇAKMAK Neslihan YAMAN Publication Director Ali ŞAHİN Okan AYDOĞAN Deniz DURAN Merve SAĞLAMER Finance and Administration İrem DELİÇAY Contact Zeynep YAKIŞIRER Elif İLKKURŞUN Address: Büyükdere Cad.
    [Show full text]
  • Bacterial Oxygen Production in the Dark
    HYPOTHESIS AND THEORY ARTICLE published: 07 August 2012 doi: 10.3389/fmicb.2012.00273 Bacterial oxygen production in the dark Katharina F. Ettwig*, Daan R. Speth, Joachim Reimann, Ming L. Wu, Mike S. M. Jetten and JanT. Keltjens Department of Microbiology, Institute for Water and Wetland Research, Radboud University Nijmegen, Nijmegen, Netherlands Edited by: Nitric oxide (NO) and nitrous oxide (N2O) are among nature’s most powerful electron Boran Kartal, Radboud University, acceptors. In recent years it became clear that microorganisms can take advantage of Netherlands the oxidizing power of these compounds to degrade aliphatic and aromatic hydrocar- Reviewed by: bons. For two unrelated bacterial species, the “NC10” phylum bacterium “Candidatus Natalia Ivanova, Lawrence Berkeley National Laboratory, USA Methylomirabilis oxyfera” and the γ-proteobacterial strain HdN1 it has been suggested Carl James Yeoman, Montana State that under anoxic conditions with nitrate and/or nitrite, monooxygenases are used for University, USA methane and hexadecane oxidation, respectively. No degradation was observed with *Correspondence: nitrous oxide only. Similarly, “aerobic” pathways for hydrocarbon degradation are employed − Katharina F.Ettwig, Department of by (per)chlorate-reducing bacteria, which are known to produce oxygen from chlorite (ClO ). Microbiology, Institute for Water and 2 Wetland Research, Radboud In the anaerobic methanotroph M. oxyfera, which lacks identifiable enzymes for nitrogen University Nijmegen, formation, substrate activation in the presence of nitrite was directly associated with both Heyendaalseweg 135, 6525 AJ oxygen and nitrogen formation. These findings strongly argue for the role of NO, or an Nijmegen, Netherlands. e-mail: [email protected] oxygen species derived from it, in the activation reaction of methane.
    [Show full text]
  • Assessing Disease Impacts of Hatcheries on Downstream Salmonids in the Willamette River Basin, Oregon
    AN ABSTRACT OF THE THESIS OF Michelle Jakaitis for the degree of Master of Science in Microbiology presented on November 4th, 2014. Title: Assessing Disease Impacts of Hatcheries on Downstream Salmonids in the Willamette River Basin, Oregon. Abstract approved: ____________________________________________________________ Jerri L. Bartholomew Hatcheries are often perceived as a source of pathogen amplification, potentially increasing disease risk to free-ranging populations; at the same time, free-ranging fishes may introduce pathogens into hatcheries through untreated water sources. Many pathogens exist naturally within the environment (with the exception of introduced pathogens) and the presence of a pathogen does not guarantee infection or disease (Naish, Taylor III, Levin, Quinn, Winton, Huppert & Hilborn 2007). Infections can be acute, chronic, or asymptomatic, fish may die, recover, or become carriers (Naish et al. 2007), and pathogens may be shed from any of these stages (Scottish Executive 2002). Most salmon and trout hatcheries along the Willamette River Basin, Oregon, USA, utilize an untreated river water supply for their rearing ponds and release this water, untreated, back into the river. This creates a potential for waterborne pathogens present in free-ranging hosts to be transmitted through the water supply to hatchery populations. Moreover, any hatchery epizootic can amplify pathogens and release these into the water, which could have a direct impact on free- ranging populations exposed to those pathogens in hatchery effluent. The goal of this thesis was to assess transmission of the pathogens Flavobacterium columnare, F. psychrophilum, Aeromonas salmonicida, Renibacterium salmonicida, and Infectious Hematopoietic Necrosis Virus (IHNV), at selected hatcheries in the Willamette River Basin. To accomplish this, I considered historical data and hatchery-specific and pathogen-specific factors involved in transmission and disease.
    [Show full text]
  • Culturable Aerobic and Facultative Bacteria from the Gut of the Polyphagic Dung Beetle Thorectes Lusitanicus
    Insect Science (2015) 22, 178–190, DOI 10.1111/1744-7917.12094 ORIGINAL ARTICLE Culturable aerobic and facultative bacteria from the gut of the polyphagic dung beetle Thorectes lusitanicus Noemi Hernandez´ 1,Jose´ A. Escudero1, Alvaro´ San Millan´ 1, Bruno Gonzalez-Zorn´ 1, Jorge M. Lobo2,Jose´ R. Verdu´ 3 and Monica´ Suarez´ 1 1Department Sanidad Animal, Facultad de Veterinaria, Universidad Complutense de Madrid, Avenida Puerta de Hierro s/n, Madrid, CP 28040, 2Department Biogeograf´ıa y Cambio Global, Museo Nacional de Ciencias Naturales, CSIC, JoseGuti´ errez´ Abascal 2, Madrid 28006, and 3I.U.I. CIBIO (Centro Iberoamericano de la Biodiversidad), Universidad de Alicante, Carretera de San Vicente del Raspeig s/n, Alicante 03080, Spain Abstract Unlike other dung beetles, the Iberian geotrupid, Thorectes lusitanicus, exhibits polyphagous behavior; for example, it is able to eat acorns, fungi, fruits, and carrion in addition to the dung of different mammals. This adaptation to digest a wider diet has physiological and developmental advantages and requires key changes in the composition and diversity of the beetle’s gut microbiota. In this study, we isolated aerobic, facultative anaerobic, and aerotolerant microbiota amenable to grow in culture from the gut contents of T. lusitanicus and resolved isolate identity to the species level by sequencing 16S rRNA gene fragments. Using BLAST similarity searches and maximum likelihood phylogenetic analyses, we were able to reveal that the analyzed fraction (culturable, aerobic, facultative anaerobic, and aerotolerant) of beetle gut microbiota is dominated by the phyla Pro- teobacteria, Firmicutes,andActinobacteria. Among Proteobacteria, members of the order Enterobacteriales (Gammaproteobacteria) were the most abundant.
    [Show full text]
  • 17-S. Prabhu Rekha.Indd
    Polish Journal of Microbiology 2014, Vol. 63, No 1, 115–119 SHORT COMMUNICATION Zeaxanthin Biosynthesis by Members of the Genus Muricauda SUDHARSHAN PRABHU, P.D. REKHA and A.B. ARUN* Yenepoya Research Centre, Yenepoya University, Deralakatte, Mangalore, Karnataka State, India Submitted 3 March 2013, revised 3 May 2013, accepted 16 November 2013 Abstract Zeaxanthin, a C40 xanthophyll carotenoid, has potential biological applications in nutrition and human health. In this study we characterized carotenoid composition in 5 taxonomically related marine bacterial isolates from the genus Muricauda. The pigment was characterized using high performance liquid chromatography (HPLC) and mass spectrometry, which confirmed the presence of all-trans-zeaxanthin. Muricauda strains produced zeaxanthin as a predominant carotenoid. M. flavescens JCM 11812T produced highest yield (4.4 ± 0.2 mg L–1) when cultured on marine broth at 32°C for 72 h. This is the first report on the presence of zeaxanthin among the majority of species from the genus Muricauda. K e y w o r d s: Flavobacteriaceae, Muricauda, marine bacteria, zeaxanthin Zeaxanthin is a potential biomolecule having anti- duce characteristic orange-yellow pigmented colonies oxidant, anticancer properties and is known to prevent (Lee et al., 2012; Arun et al., 2009; Hwang et al., 2009; age related macular degeneration (Krinsky et al., 2003). Lee et al., 2012). M. lutaonensis CC-HSB-11T isolated Apart from plant sources, microbes have been found as from a coastal hot-spring was first reported to produce an important source of carotenoids particularly zeaxan- high amounts of zeaxanthin (Hameed et al., 2011). thin (Hameed et al., 2011).
    [Show full text]
  • Flavobacterium Gliding Motility: from Protein Secretion to Cell Surface Adhesin Movements
    University of Wisconsin Milwaukee UWM Digital Commons Theses and Dissertations August 2019 Flavobacterium Gliding Motility: From Protein Secretion to Cell Surface Adhesin Movements Joseph Johnston University of Wisconsin-Milwaukee Follow this and additional works at: https://dc.uwm.edu/etd Part of the Biology Commons, Microbiology Commons, and the Molecular Biology Commons Recommended Citation Johnston, Joseph, "Flavobacterium Gliding Motility: From Protein Secretion to Cell Surface Adhesin Movements" (2019). Theses and Dissertations. 2202. https://dc.uwm.edu/etd/2202 This Dissertation is brought to you for free and open access by UWM Digital Commons. It has been accepted for inclusion in Theses and Dissertations by an authorized administrator of UWM Digital Commons. For more information, please contact [email protected]. FLAVOBACTERIUM GLIDING MOTILITY: FROM PROTEIN SECRETION TO CELL SURFACE ADHESIN MOVEMENTS by Joseph J. Johnston A Dissertation Submitted in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy in Biological Sciences at The University of Wisconsin-Milwaukee August 2019 ABSTRACT FLAVOBACTERIUM GLIDING MOTILITY: FROM PROTEIN SECRETION TO CELL SURFACE ADHESIN MOVEMENTS by Joseph J. Johnston The University of Wisconsin-Milwaukee, 2019 Under the Supervision of Dr. Mark J. McBride Flavobacterium johnsoniae exhibits rapid gliding motility over surfaces. At least twenty genes are involved in this process. Seven of these, gldK, gldL, gldM, gldN, sprA, sprE, and sprT encode proteins of the type IX protein secretion system (T9SS). The T9SS is required for surface localization of the motility adhesins SprB and RemA, and for secretion of the soluble chitinase ChiA. This thesis demonstrates that the gliding motility proteins GldA, GldB, GldD, GldF, GldH, GldI and GldJ are also essential for secretion.
    [Show full text]