Supporting Information Figure S1. a Field Survey Was Conducted From

Supporting information

Figure S1. A field survey was conducted from Dauphin Island to West Point Island, AL, at five sites in the order indicated. Oil and paired visibly contaminated and uncontaminated sand samples were collected representative of ball and sheet geometries. Location 4 had highest visible oil contamination [1].

Figure S2 Representative chromatograms of field samples collected following the Deepwater

Horizon oil spill obtained by GC-MS. a: Chromatogram of sample from an oil sheet, b:

Chromatogram of sample from a ball.

Figure S3. Comparison of composition of oil samples from sheet and ball geometries determined by GC/MS. Bars are plotted as average and standard deviation of each fraction. a) Comparison

of six field-collected sheet and tar ball geometries. The amount of hydrocarbons detected were normalized to the mass of the sample of oil deposit and associated material from the field. No significant difference in oil composition was found between the two geometries according to a

Hotelling’s t-squared test. b) GC MS analysis of the oil deposits from the duplicate sand columns after sacrifice.

Figure S4. Hierarchical cluster of the sub-samples with depth from blank column core. Depths correspond to those sub-sampled from oiled columns. Red dashed lines indicate that the difference between the clustered samples is not significant. y-axis is indicative of Bray-Curtis similarity at which a cluster is formed. Hierarchical clustering was conducted using ‘Group average’ method [2].

Figure S5. Hierarchical cluster of the samples from the sheet column. Depths correspond to those sub-sampled from oiled columns. Red dashed lines indicate that the difference between the clustered samples is not significant. Y-axis is indicative of Bray-Curtis similarity at which a cluster is formed. Hierarchical clustering was conducted using ‘Group average’ method [2].

Figure S6. Hierarchical cluster of the samples from the duplicate ball columns. Depths correspond to those sub-sampled from oiled columns. Red dashed lines indicate that the difference between the clustered samples is not significant. Y-axis is indicative of Bray-Curtis similarity at which a cluster is formed. Hierarchical clustering was conducted using ‘Group average’ method [2].

Figure S7. 16S rRNA gene copies per gram of sub-sample of column cores with depth. Data for ball columns is average of duplicate columns. Error bars represent the standard deviation of triplicate qPCR measurements of each sample.

Table S1. Primer sequences and annealing temperatures employed for PCR and qPCR assays.

Target Annealing Reference Primer a Primer (5’-3’) gene Temp. ( °C) 8F AGAGTTTGATCCTGGCTCAG [3] 16S rRNA b 50 1492R GGTTACCTTGTTACGACTT CGCCCGCCGCGCGCGGCGGGCGG I-341 F GC V3 16S GGCGGGGGCACGGGGGGCCTAC [4] 47 rRNA GGGAGGCAGCAG I-533 R TIACCGIIICTICTGGCAC CGGCGTTGCGCATTTYCAYACVV dsrA_290F T [5] dsrA 60 GCCGGACGATGCAGHTCRTCCTG dsrA_660R RWA GGTGGTGTMGGATTCACACARTA mcrA_1035F [5] mcrA 56 YGCWACAGC mcrA_1530R TTCATTGCRTAGTTWGGRTAGTT cat23 F CGACCTGATCTCCATGACCGA [6] cat23 66 cat23 R TCAGGTCAGCACGGTCA 1369F CGACCTGATCTCCATGACCGA [7] 16S rRNA b 60 1492R TCAGGTCAGCACGGTCA a Integrated DNA Technologies Inc (Coralville, IA.) b Primer set 8F and 1492R was used for PCR applications, whereas primer set 1369F and 1492R was used for qPCR. c Touchdown PCR was done for DGGE applications using primer set I-341 F GC and I-533 R.

The annealing temperature for first two cycles was 52 °C and was brought down to 47 °C, reducing by 1 °C after every two cycles.

Table S2. PCR reaction matrix a

Reagent Amount or concentration in 25 µµµl master mix

10 ××× PCR buffer d 2.5 µl

5××× PCR buffer d 5 µl

dNTPs e 0.2 mM

Forward and reverse primer a 0.25 µM

Taq DNA polymerase f 1.75 U

Formamide g 0.25 µl

DNA template 1 µl

Mg 2+ d 2mM a Integrated DNA Technologies Inc (Coralville, IA.) d MasterTaq kit (Eppendorf, Westbury, NY) was used for PCR assays. e (Promega Corporation, Madison, WI) f TAQ DNA POL (5U/ µl) (MP Biomedicals, Solon, OH) g Formamide Mol Bio Grade (Fisher Scientific Company LLC, Suwanee, GA.)

Table S3. qPCR reaction matrix

Reagent Concentration in 20 µµµl master mix

Forward and reverse primer a 0.3 µM

SsoFast EvaGreen Supermix 1×

iTaq h 0.1 µl a Integrated DNA Technologies Inc (Coralville, IA.) h (Bio-Rad, Hercules, CA); iTaq was only used for amplifying gene specific to alpha subunit dissimilatory sulfite reductase using dsrA_ 290F and dsrA_ 660R primer set. a

All standard curves of qPCR were constructed from serial dilutions of cloned positive controls ranging from 10 8 to 10 2 gene copies per µL. Potential effects of inhibitors were assessed by serially diluting select samples and comparing PCR efficiencies with that of standards. It was found that a dilution of 1:50 effectively minimized inhibitory effects and was applied across samples. Samples were analyzed in triplicate with a standard curve and negative control included in each run.

Tabel S4. Clonal sequences of the qPCR product.

mcr A

Highest Match (GenBank Closest cultured relative (GenBank accession accession number) number)

Uncultured Methanococcus Methanococcus maripaludis X1 (CP002913) sp. (AY454745)

Methanococcus Methanococcus maripaludis strain S2 (BX950229) maripaludis (AF298223)

Uncultured methanogenic Methanothermococcus okinawensis strain DSM archaeon clone 14208 (AY354033) (HQ635384)

Methanobacterium Methanobacterium aarhusense methyl-coenzyme M aarhusense (AY386125) reductase alpha subunit ( mcr A) gene, partial cds.(AY386125)

Uncultured methanogenic Methanothermococcus thermolithotrophicus mcrA archaeon clone gene for methyl CoM reductase subunit alpha, (AY354026) partial cds. (AB353226)

Uncultured archaeon clone Methanobrevibacter smithii ATCC (GQ120965) 35061(CP000678)

Uncultured methanogenic Methanosphaera stadtmanae DSM 3091 archaeon clone (CP000102) (DQ260943)

Uncultured archaeon Methanothermococcus thermolithotrophicus mcrA (FN650317) gene for methyl CoM reductase subunit alpha, partial cds. (AB353226)

Uncultured archaeon clone Methanothermococcus okinawensis IH1 (CP002792) ( EU495427)

Methanosarcina mazei Methanosarcina mazei strain Goe1 (AE008384) strain Goe1 (AE008384)

Uncultured archaeon clone Methanothermobacter thermautotrophicus str. Delta (GU357471) H (AE000666) dsr A

Highest Match (GenBank Closest cultured relative (GenBank accession accession number) number)

Uncultured bacterium clone Desulfovibrio burkinensis DSM 6830 dissimilatory (EU192621) sulfite reductase alpha subunit ( dsr A) and dissimilatory sulfite reductase beta subunit ( dsr B) genes, partial cds. (AF418186)

Uncultured bacterium clone Desulfovibrio burkinensis DSM 6830 dissimilatory 13_43 dissimilatory sulfite sulfite reductase alpha subunit ( dsr A) and reductase ( dsr A) gene, dissimilatory sulfite reductase beta subunit ( dsr B) partial cds. (EU192417) genes, partial cds. (AF418186)

Uncultured sulfate- Desulfovibrio burkinensis dsr A, dsr B genes for reducing bacterium sulfite reductase alpha and beta subunits, partial cds. (AM494487) (B061536)

Uncultured bacterium clone Olavius ilvae Delta 1 endosymbiont clone OIOsp2- (EU192588) 1-7 dissimilatory (bi)sulfite reductase alpha ( dsr A) and dissimilatory (bi)sulfite reductase beta ( dsr B) genes, partial cds. (DQ058671)

Uncultured bacterium clone Desulfovibrio burkinensis DSM 6830 dissimilatory 12_23 dissimilatory sulfite sulfite reductase alpha subunit ( dsr A) and reductase ( dsr A) gene, dissimilatory sulfite reductase beta subunit ( dsr B) partial cds. (EU192450) genes, partial cds. (AF418186)

Uncultured bacterium clone Desulfosalsimonas propionicica strain PropA Chap_PS2_18 dissimilatory dissimilatory sulfite reductase alpha subunit ( dsr A) sulfite reductase alpha and dissimilatory sulfite reductase beta subunit subunit ( dsr A) gene, partial (dsr B) genes, partial cds. (DQ386237) cds. (HM562943)

Uncultured bacterium clone NA CF3 dissimilatory sulfite reductase (AF442719)

Desulfohalobium utahense Desulfohalobium utahen se strain EtOH3 strain EtOH3 dissimilatory dissimilatory sulfite reductase alpha subunit (dsrA) sulfite reductase alpha and dissimilatory sulfite reductase beta subunit subunit ( dsr A) and (dsr B) genes, partial cds. (DQ386236) dissimilatory sulfite reductase beta subunit (dsr B) genes, partial cds. (DQ386236)

Uncultured sulfate- Olavius ilvae Delta 1 endosymbiont clone OIOsp2- reducing bacterium dsr A, 1-7 dissimilatory (bi)sulfite reductase alpha ( dsr A) dsr B genes for and dissimilatory (bi)sulfite reductase beta ( dsr B) dissimilatory sulfite genes, partial cds. (DQ058671) reductase alpha subunit, dissimilatory sulfite reductase beta subunit, partial cds (AB263151)

Uncultured prokaryote Desulfosalsimonas propionicica strain PropA clone GSL_27_55 dissimilatory sulfite reductase alpha subunit ( dsr A) dissimilatory sulfite and dissimilatory sulfite reductase beta subunit reductase alpha subunit (dsr B) genes, partial cds (DQ386237) (dsr A) gene, partial cds. (DQ386256) cat23

Highest Match (GenBank Closest cultured relative (GenBank accession accession number) number)

Uncultured bacterium clone Pseudomonas sp. IC catechol 2,3-dioxygenase C23O-2 catechol-2,3- (bph E) gene, complete cds, and 2-hydroxymuconic dioxygenase gene, semialdehyde dehydrogenase ( bph G) gene, partial complete cds. (DQ408374) cds. (U01825)

Pseudomonas sp. KB35B Pseudomonas sp. KB35B catechol-degrading gene catechol-degrading gene cluster, complete sequence. (DQ265742)

cluster, complete sequence. (DQ265742)

Pseudomonas sp. KB35B Pseudomonas sp. KB35B catechol-degrading gene catechol-degrading gene cluster, complete sequence. (DQ265742) cluster, complete sequence. (DQ265742)

Pseudomonas putida Pseudomonas putida plasmid pWW53 DNA, plasmid pWW53 DNA, complete sequence, strain: MT53. (AB238971) complete sequence, strain: MT53. (AB238971)

Uncultured bacterium Pseudomonas sp. 5K-VPa putative catechol 2,3- partial C23O gene for dioxygenase ( xyl E) gene, partial cds. (JF520637) catechol 2,3 dioxygenase, band SS_J_23_A1Y. (AJ545005)

Uncultured bacterium gene Pseudomonas mendocina strain PC11 catechol 2,3- for catechol 2,3- dioxygenase gene, complete cds. (AY887959) dioxygenase, complete cds, clone:NY8. (AB074512)

Uncultured bacterium clone Pseudomonas sp. 1YdBTEX2 C23O gene for Na-5 catechol 2,3- catechol 2,3 dioxygenase, strain 1YdBTEX2. dioxygenase gene, (AJ544930) complete cds. (EF607044)

Uncultured organism clone Achromobacter xylosoxidans strain LHB21 catechol VasxylE catechol 2,3- 2,3-dioxygenase gene, complete cds. (GU199432 ) dioxygenase ( xyl E) gene, partial cds. (EU251477)

Cloned 16S rRNA gene inserts (Table S5) and the excised bands from DGGE gel (Table S6) were sequenced by The Virginia Bioinformatics Institute (Blacksburg, VA). Known microorganisms sharing the highest sequence similarity were determined using the BLAST alignment tool at the National Center for Biotechnology Information Web site ( http://www . ncbi.nlm.nih.gov/BLAST/).

Table S5. DNA sequence analysis of cloned 16S rRNA gene inserts from oiled (O) and unoiled

(U) beach samples.

O/ Closest cultured relative (GenBank #a Taxa U accession number) % Match Bacteria; Proteobacteria; Steroidobacter denitrificans strain FS O 7 Gammaproteobacteria; Xanthomonadales; (NR 044309) 77 Sinobacteraceae; Steroidibacter. Bacteria; Gemmatimonas aurantiaca strain T-27 Gemmatimonadetes; Gemmatimonadetes; O 1 (NR 027529) 95 Gemmatimonadales; Gemmatimonadacea e Bacteroides capillosus strain ATCC Bacteria; Firmicutes; Clostridia; O 2 29799 (NR 025670) 94 Clostridiales; Pseudoflavonifractor. Sinobacter flavus strain CW-KD 4 16S Bacteria; Proteobacteria; O 2 ribosomal partial sequence (NR Gammaproteobacteria; Xanthomonadales; 044123.1) 99 Sinobacteraceae; Sinobacter. Bacteria; Acidobacteria; Holophageae; Holophaga foetida strain TMBS4 (NR O 6 Holophagales; Holophagaceae; 036891.1) 98 Holophaga. Prochlorococcus marine subsp. Bacteria; Cyanobacteria; Prochlorales; O 8 Pastoris str. PCC 9511 (NR 028762) Prochlorococcaceae; Prochlorococcus. 99 Nitrospira moscoviensis strain NSP Bacteria; Nitrospirae; Nitrospirales; O 2 M-1 (NR 029287) 97 Nitrospira. Bacteria; Actinobacteria; Iamia majanohamensis strain NBRC O Acidimicrobidae; Acidimicrobiales; 102561 (NR 041634) 94 10 Acidimicrobineae; Iamiaceae; Iamia. Bacteria; Proteobacteria; Marinobacter lutaoensis strain T5054 O 4 Gammaproteobacteria; Alteromonadales; (NR 025116.1) 96 Alteromonadaceae; Marinobacter.

Bacteria; Planctomycetes; Rhodopirellula batica SH 1 strain 1 O 6 Planctomycetia; Planctomycetales; (NR 043384.1) 98 Planctomycetaceae; Rhodopirellula. Bacteria; Proteobacteria; Singularimonas variicoloris strain O 2 Gammaproteobacteria; Xanthomonadales; MN28 (NR 042175) 98 Sinobacteraceae; Singularimonas. Bacteria; Proteobacteria; Ectothiorhodosinua mongolicus strain Gammaproteobacteria; Chromatiales; O 5 M9 (NR 042831) 98 Ectothiorhodospiraceae; Ectothiorhodosinus. Bacteria; Proteobacteria; Amaricoccus kaplicensis strain O 1 Alphaproteobacteria; Rhodobacterales; Ben101 (NR 029201) 98 Rhodobacteraceae; Amaricoccus . Bacteria; Deinococcus-Thermus; Truepera radiovictrix DSM 17093 O 4 Deinococci; Deinococcales; strain RQ-24 (NR 043482) 99 Trueperaceae; Truepera . Bacteria; Chloroflexi; Anaerolineae; Anaerolinea thermophila strain UNI-1 O 2 Anaerolineales; Anaerolineaceae; (NR 036818) 90 Anaerolinea . Bacteria; Proteobacteria; Burkholderia terrae strain KMY02 O Betaproteobacteria; Burkholderiales; (NR 041287) 94 3 Burkholderiaceae; Burkholderia . Bacteria; Proteobacteria; Denitratisoma oestradiolicum strain O 1 Betaproteobacteria; Rhodocyclales; AcBE2-1(NR 043249) 94 Rhodocyclaceae; Denitratisoma . Bacteria; Proteobacteria; Thiobacter subterraneus strain C55 O 1 Betaproteobacteria; Burkholderiales; (NR 024834) 99 Thiobacter . Paenisporosarcina quisquiliarum Bacteria; Firmicutes; Bacillales; O 8 strain SK 55 (NR 043720) 99 Planococcaceae; Paenisporosarcina . Bacteria; Proteobacteria; Rhodospirillaceae bacterium YIM O 3 Alphaproteobacteria; Rhodospirillales; D812 (NR 044596.1) 94 Rhodospirillaceae; Fodinicurvata . Bacteria; Proteobacteria; Brevundimonas terrae strain KSL-145 Alphaproteobacteria; Caulobacterales; (NR 043726) 97 O 2 Caulobacteraceae; Bervundimonas . Bacteria; Proteobacteria; Thiobacter subterraneus strain C55 Betaproteobacteria; Burkholderiales; (NR 024834.1) 97 O 1 Thiobacter . Bacteria; Proteobacteria; Desulfomonile limimaris strain DCB- Deltaproteobacteria; Syntrophobacterales; M (NR 025079) 94 O 2 Syntrophaceae; Desulfomonile . Salegentibacter sp. PR54-18 Bacteria; Bacteroidetes; Flavobacteriia. O 1 (EU440974) 99 O 5 Flavobacterium sp. KJ017 (JF904880) Bacteria; Bacteroidetes; Flavobacteriia; 17

98 Flavobacteriales; Flavobacteriaceae; Flavobacterium . Psychroflexus sp. COL-60 Bacteria; Bacteroidetes; Flavobacteriia. O 2 (HQ534335) 94 Bacteria; Bacteroidetes; Flavobacteriia; Flavobacterium columnare strain Flavobacteriales; O 6 RDC-1 (JN825736) 99 Flavobacteriaceae; Flavobacterium . Bacteria; Bacteroidetes; Flavobacteriia; Flavobacterium sp. CKC03 Flavobacteriales; O 4 (JN032579) 98 Flavobacteriaceae; Flavobacterium . Bacteria; Actinobacteria; Actinobacteridae; Verrucosispora sp. enrichment culture Actinomycetales;Micromonosporineae; clone SEQ24_3AClone_AER Micromonosporaceae; environmental O 6 (HM059747) 98 samples. Bacteria; Proteobacteria; Denitratisoma oestradiolicum strain Betaproteobacteria; Rhodocyclales; AcBE2-1(NR 043249) 94 U 8 Rhodocyclaceae; Denitratisoma . Bacteria; Verrucomicrobia; Luteolibacter pohnpeiensis strain Verrucomicrobiae; Verrucomicrobiales; A4T-83 (NR 041625) 93 U 6 Verrucomicrobiaceae; Luteolibacter . Bacteria; Proteobacteria; Marinobacter lutaoensis strain T5054 Gammaproteobacteria; Alteromonadales; (NR 025116.1) 89 U 4 Alteromonadaceae; Marinobacter . Bacteria; Proteobacteria; Desulfomonile limimaris strain DCB- Deltaproteobacteria; Syntrophobacterales; M (NR 025079) 94 U 8 Syntrophaceae; Desulfomonile . Bacteria; Firmicutes; Clostridia; Heliorestis baculata strain OS H1(NR U Clostridiales; Heliobacteriaceae; 028782.1) 94 9 Heliorestis . Bacteria; Bacteroidetes; Flavobacteriia; U Psychroflexus sp. COL-60(HQ534335) Flavobacteriales; Flavobacteriaceae; 5 89 Flavobacterium . Flavobacterium columnare strain U Bacteria; Bacteroidetes; Flavobacteria. 6 RDC-1 (JN825736) 95 Bacteria; Bacteroidetes; Flavobacteriia; U Flavobacterium sp. CKC03 Flavobacteriales; Flavobacteriaceae; 1 (JN032579) 98 Flavobacterium . Bacteria; Bacteroidetes; Flavobacteriia; U Flavobacterium sp. FCS-5 (JF830803) Flavobacteriales; Flavobacteriaceae; 9 92 Flavobacterium . Flavobacteriaceae bacterium D11- Bacteria; Bacteroidetes; Flavobacteriia; U 3 24b1 (AM403225) 95 Flavobacteriales; Flavobacteriaceae. Flavobacterium filum strain EMB34 Bacteria; Bacteroidetes; Flavobacteriia; U 5 (NR 043767.1) 98 Flavobacteriales; Flavobacteriaceae; 18

Flavobacterium . Bacteria; Chloroflexi; Anaerolineae; Leptolinea sp. enrichment culture U 7 Anaerolineales; Anaerolineaceae; clone Y223 (JF345340) 87 Leptolinea; environmental samples. Prochlorococcus marine subsp. Bacteria; Cyanobacteria; Prochlorales; U 11 Pastoris str. PCC 9511 (NR 028762) Prochlorococcaceae; Prochlorococcus. Bacteria; Actinobacteria; U Iamia majanohamensis strain NBRC Acidimicrobidae; Acidimicrobiales; 4 102561 (NR 041634) 94 Acidimicrobineae; Iamiaceae; Iamia. Bacteria; Proteobacteria; Alphaproteobacteria; U Sphingomonas sp. strain Pseudomonas Sphingomonadales;Sphingomonadaceae; 2 paucimobilis Q1. (X87167) 96 Sphingomonas . Bacteria; Bacteroidetes; Cytophagia; U Cytophagales; 6 Cytophaga sp. N05VI (AJ786088) 97 Cytophagaceae;Cytophaga. Bacteria; Bacteroidetes; Bacteroidia; U Bacteroidales; Marinilabiaceae; 4 Marinilabilia sp. AK2 (FN994992) Marinilabilia . Bacteria; Planctomycetes; U Rhodospirillaceae bacterium YIM Planctomycetia; Planctomycetales; 2 D812 (NR 044596.1) Planctomycetaceae; Rhodopirellula . #a: Number of similar clones in the restriction digest image of 100 clones of U and O samples each.

Table S6. Details of sequences obtained from excising the bands from DGGE of the sand columns. The corresponding index numbers are highlighted in Figure 5 in the text, and the depth is with respect to the position of oil deposit as in Figure 1.

Column/ Closest cultured relative Highest Match (GenBank % Index (GenBank accession number) % accession number) Match number/Depth Match Uncultured bacterium clone Flavobacterium sp. CKC03 Sheet/1/+2.5 F776O8Q01AQKGB 100 (JN032579) 97 (GU764001) Uncultured bacterium clone Balneola sp. MOLA 132 Sheet/2/+2.5 98 REP5-27 (JF769674) (AM990906) 98 Uncultured gamma Pseudospirillum japonicum (NR Sheet/3/+2.5 100 proteobacterium (AM050724) 024654) 100 Sheet/4/+2.5 Uncultured bacterium isolate 100 Flavobacterium sp. FCS-5

DGGE gel band 4202 (JF830803) 100 (JN698231) Uncultured bacterium clone Anaerophaga thermohalophila Sheet/5/0 97 PC2_P17 (HQ688408 ) strain Fru22 (NR_028963) 97 Uncultured bacterium clone Bacteroidales bacterium P2 Sheet/6/0 100 HDBW-WB34 (AB237697) (HQ697914) 97 Uncultured Anaerophaga sp. Anaerophaga sp. HS1 Sheet/7/0 99 clone TCB 123x (DQ647179) (DQ517535) 96 Uncultured bacterium clone Marinilabilia salmonicolor Sheet/8/0 93 G66 (DQ521123) (AB680721) 89 Uncultured bacterium clone Flavobacterium columnare strain Sheet/9/0 F776O8Q01AQKGB 100 RDC-1 (JN825736.1) 99 (GU764001) Muricauda ruestringensis Muricauda ruestringensis DSM Sheet/10/0 100 DSM 13258 (CP002999) 13258 (CP002999) 97 Uncultured bacterium gene Psychroflexus sp. COL- Sheet/11/-2.5 97 (AB671517) 60(HQ534335) 96 Uncultured bacterium clone Anaerophaga thermohalophila Sheet/12/-2.5 100 PC2_P17 (HQ688408) strain Fru22 (NR_028963) 96 Uncultured bacterium clone Flavobacterium filum strain Sheet/13/-2.5 89 dcpa4-72 (HM050729 ) EMB34 (NR 043767.1) 88 Uncultured bacterium clone Arenibacter sp. HP12 (JF751052) Sheet/14/-2.5 96 C71 (DQ521178) 95 Uncultured bacterium clone C3 Bacteroidetes sp. OL02 Sheet/15/-2.5 99 (DQ521168) (JN791391) 97 DE Marinobacter DE Marinobacter Sheet/16/-2.5 hydrocarbonoclasticus 82 hydrocarbonoclasticus (FP475901) (FP475901) 82 Flavobacteriaceae bacterium Flavobacteriaceae bacterium D11- Sheet/17/-5 100 D11-24b1(AM403225.1) 24b1 (AM403225) 92 Petrotoga sp. enrichment culture Uncultured bacterium clone Sheet/18/-5 98 clone SEQ61_Clone3BP1_ANA G113 (DQ521092.1) (HM059784) 98 Uncultured bacterium clone: E140-Bac- Psychroflexus sp. Antwl407 Sheet/19/-5 100 G1_27F_1_G01_003. (JF811035) 100 (AB671517) Anaerophaga thermohalophila Anaerophaga thermohalophila Sheet/20/-5 97 strain Fru22 (NR 028963) strain Fru22 (NR 028963) 97 Uncultured Flavobacteriaceae Salegentibacter sp. PR54-18 Sheet/21/-5 bacterium clone BPS_L271 100 (EU440974) 98 (HQ857727) Uncultured bacterium clone C3 Cytophaga sp. cu1i-10 Sheet/22/-5 96 (DQ521168) (JN594610) 94 Sheet/23/-5 Uncultured Nitrospirales 84 Nitrospira moscoviensis strain 20

bacterium (FJ535100) NSP M-1 (NR 029287) 84 Uncultured bacterium clone Flavobacterium sp. KJ017 Sheet/24/-7.5 F776O8Q01AQKGB 100 (JF904880) 91 (GU764001) Uncultured soil bacterium Sphingomonas sp. strain Sheet/25/-7.5 clone GO0VNXF07H3IDI 96 Pseudomonas paucimobilis Q1. (JF383890) (X87167) 96 Uncultured bacterium clone Psychroflexus sp. COL-60 Sheet/26/-7.5 Tat-08-015_51_119 97 (HQ534335) 96 (GU437616) Uncultured bacterium clone Anaerophaga thermohalophila Sheet/27/-7.5 91 SGUS584 (FJ202346.1) strain Fru22 (NR_028963) 93 Uncultured Verruscosispora Verrucosispora gifhornensis strain Sheet/28/-7.5 91 sp. clone DB5 (FJ465003) HR1-2 (NR 026445) 87 Uncultured bacterium clone Roseovarius sp. AMV6 Sheet/29/-7.5 99 STU1 (EU700143) (FN376425) 92 Uncultured bacterium clone Sheet/30/-7.5 99 Nitrospira sp. (AF035813) 93 GBL17O37 (HM445127) Uncultured bacterium clone Psychroflexus sp. COL-60 Ball I/31/+2.5 97 SINH706 (HM128204) (HQ534335.1) 91 Uncultured bacterium clone Psychroflexus sp. COL-60 Ball I/32/+2.5 97 SINH706 (HM128204) (HQ534335.1) 93 Uncultured bacterium clone Marinilabilia sp. AK2 Ball I/33/+2.5 100 G66 (DQ521123) (FN994992) 98 Uncultured bacterium clone Colwellia sp. SW2-3E Ball I/34/0 98 ABRB61 (HQ224849) (FR744837.1) 98 Uncultured bacterium clone Alpha proteobacterium SCGC Ball I/35/0 93 BXHB42 (GQ480088) AAA041-L04 (HQ663353) 92 Uncultured bacterium clone Flavobacterium columnare strain Ball I/36/-5 F776O8Q01AQKGB 99 RDC-1 (JN825736) 97 (GU764001.1) Uncultured bacterium clone Marinilabilia sp. AK2 Ball I/37/-5 96 G66 ( DQ521123 ) (FN994992) 96 Uncultured bacterium isolate Marinilabilia sp. AK2 Ball II/38/+2.5 100 PW-52 (JN865727 ) (FN994992) 100 Uncultured bacterium clone Leptolinea sp. enrichment culture Ball II/39/0 100 B3-55 (HQ636195 ) clone Y223 (JF345340) 100 Ball II/40/- Uncultured bacterium clone Marinilabilia sp. AK2 99 2.5cm G66 ( DQ521123 ) (FN994992) 96 Uncultured bacterium clone Psychroflexus sp. COL-60 Ball II/41/-2.5 Tat-08-015_51_119 97 (HQ534335.1) 94 (GU437616 ) Uncultured bacterium clone Colwellia sp. SW2-3E Ball II/42/-5 GDIC2IK01EQ34N 96 (FR744837) 92 (JF577442.1) 21

Ball II/43/-5, Uncultured bacterium clone Marinilabilia sp. AK2 100 Ball II/45/-7.5 G66 ( DQ521123 ) (FN994992.1) 97 Uncultured bacterium clone Bacteroidales bacterium P2 BalI Il/44/-7.5 94 G66 (DQ521123) (HQ697914) 90 Blank/46/+2.5, Uncultured bacterium clone C3 Bacteroidetes sp. OL02 99 Blank/47/-2.5 (DQ521168) (JN791391) 97 Uncultured bacterium clone Flavobacterium sp. CKC03 Blank/48/-5 F776O8Q01AQKGB 97 (JN032579) 92 (GU764001) Uncultured bacterium clone Bacteroidales bacterium P2 Blank/49/-5 94 G66 (DQ521123) (HQ697914) 87 Uncultured bacterium clone Colwellia sp. SW2-3E Blank/50/-7.5 GDIC2IK01EQ34N 91 (FR744837) 87 (JF577442.1) Uncultured bacterium clone Flavobacterium columnare strain Blank/51/-7.5 F776O8Q01AQKGB 94 RDC-1 (JN825736.1) 85 (GU764001)

References:

1. Google Earth 6. earth.google.com

2. Clarke, K. R. Non-parametric multivariate analyses of changes in community structure.

Australian Journal of Ecology 1993, 18 , 117-143.

3. Turner, S.; Pryer, K. M.; Miao, V. P. W.; Palmer, J. D. Investigating deep phylogenetic relationships among cyanobacteria and plastids by small submit rRNA sequence analysis. J.

Eukaryot. Microbiol. 1999, 46 , (4), 327-338.

4. Watanbe, K.; Kodama, Y.; Harayama, S. Design and evaluation of PCR primers to amplify bacterial 16S ribosomal DNA fragments used for community fingerprinting. J.

Microbiol. Methods 2001 , 44, (3), 253-262.

5. Pereyra, L. P.; Hiibel, S. R.; Prieto Riquelme, M. V.; Reardon, K. F.; Pruden, A.

Detection and quantification of functional genes of cellulose- degrading, fermentative, and

sulfate-reducing bacteria and methanogenic archaea. Appl. Environ. Microbiol. 2010, 76 , (7),

2192-202.

6. Baek, K.-H.; Yoon, B.-D.; Cho, D.-H.; Kim, B.-H.; Oh, H.-M.; Kim, H.-S. Monitoring bacterial population dynamics using real-time PCR during the bioremediation of crude-oil- contaminated soil. J. Microbiol. Biotechnol. 2009, 19,(4),339-45.

7. Suzuki, M. T.; Taylor, L. T.; DeLong, E. F. Quantitative analysis of small-subunit rRNA genes in mixed microbial populations via 5' - nuclease assays. In Appl. Environ. Microbiol. ,

2000, 66, 4605-4614.