DOCSLIB.ORG

Tethering IL2 to Its Receptor Il2rb Enhances Antitumor Activity and Expansion of Natural Killer NK92 Cells Youssef Jounaidi, Joseph F

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Tethering IL2 to Its Receptor Il2rb Enhances Antitumor Activity and Expansion of Natural Killer NK92 Cells Youssef Jounaidi, Joseph F Published OnlineFirst September 15, 2017; DOI: 10.1158/0008-5472.CAN-17-1007 Cancer Therapeutics, Targets, and Chemical Biology Research Tethering IL2 to Its Receptor IL2Rb Enhances Antitumor Activity and Expansion of Natural Killer NK92 Cells Youssef Jounaidi, Joseph F. Cotten, Keith W. Miller, and Stuart A. Forman Abstract IL2 is an immunostimulatory cytokine for key immune cells of IL2 and its receptor IL2Rb joined via a peptide linker (CIRB). including T cells and natural killer (NK) cells. Systemic IL2 NK92 cells expressing CIRB (NK92CIRB) were highly activated and supplementation could enhance NK-mediated immunity in a expanded indefinitely without exogenous IL2. When compared variety of diseases ranging from neoplasms to viral infection. with an IL2-secreting NK92 cell line, NK92CIRB were more acti- However, its systemic use is restricted by its serious side effects and vated, cytotoxic, and resistant to growth inhibition. Direct contact limited efficacy due to activation of T regulatory cells (Tregs). IL2 with cancer cells enhanced the cytotoxic character of NK92CIRB signaling is mediated through interactions with a multi-subunit cells, which displayed superior in vivo antitumor effects in mice. receptor complex containing IL2Ra, IL2Rb, and IL2Rg. Adult Overall, our results showed how tethering IL2 to its receptor natural killer (NK) cells express only IL2Rb and IL2Rg subunits IL2Rb eliminates the need for IL2Ra and IL2Rb, offering a and are therefore relatively insensitive to IL2. To overcome these new tool to selectively activate and empower immune therapy. limitations, we created a novel chimeric IL2-IL2Rb fusion protein Cancer Res; 77(21); 5938–51. Ó2017 AACR. Introduction in order for allogeneic NK cells to be effective, pretransfer lymphodepletion is required to reduce competition for growth Natural killer (NK) cells are lymphocytes endowed with the factors and cytokines (14, 15). Moreover, IL2 is needed to innate ability to attack malignant and virus infected cells (1–3). sustain NK cytotoxicity after in vivo transfer, exposing patients Several interleukins, and in particular IL2, activate and expand to systemic side effects. T cells and NK cells (4). Systemic IL2 supplementation could Past efforts to express endogenous IL2 in NK cells (16) or to therefore enhance immunity in cancer and viral infection. How- express membrane-bound endogenous IL2 (17) showed limited ever, tumor cells and their microenvironment (TME) often repress success with micrometastatic models and were not as efficacious NK cells antitumor activity by orchestrating a multitude of escape as NK cells stimulated with IL2 ex vivo. The limited success of mechanisms (5). strategies using NK cells could be explained by the failure of Clinical trials using high-dose IL2 infusions have met lim- activated NK cells to outcompete Tregs for cytokines in the host ited success due to severe side effects that mimic sepsis (6–8), and the immunosuppressive effect of the TME, which includes while low-dose IL2 efficacy is limited by the short half-life (less myeloid-derived suppressor cells (MDSC). Both MDSCs and than 10 minutes) of IL2 in vivo (9), and due to depletion of low Tregs suppress NK-cell functions either by direct contact or by IL2 doses by Tregs and other lymphoid cells (10). Several secretion of TGFb1 (18, 19). strategies based on IL2 have aimed to enhance NK cytotoxicity To selectively activate and expand NK cells without exo- while reducing toxicity in patients, with limited efficacy. Cul- genous IL2, while maintaining NK cytotoxicity and prolifera- tured ex vivo autologous NK cells activated and induced to tion both in vitro and in vivo, circumvent the requirement of proliferate by IL2 display less antitumor efficacy (11) than IL2Ra and its lack of expression in NK cells, thus avoiding allogeneic NK cells (12), because self-class I HLA signaling IL2 off-target effects, cytokine competition, and activation of suppresses NK cytotoxicity and cytokine release (13). However, downregulating lymphoid cells like Tregs. We created a novel chimeric IL2-IL2Rb (CIRB), consisting of IL2 tethered via a linker to IL2Rb, which functions like constitutively activated Department of Anesthesia, Critical Care and Pain Medicine, Massachusetts IL2Rb. NK92 cells expressing CIRB (NK92CIRB)produceanti- General Hospital and Harvard Medical School, Boston, Massachusetts. cancer effects in vitro that are equivalent to or better than Note: Supplementary data for this article are available at Cancer Research NK92IL2. Importantly, compared with IL2-stimulated NK92 Online (http://cancerres.aacrjournals.org/). and NK92IL2, the anticancer activity and growth of NK92CIRB Corresponding Author: Youssef Jounaidi, Department of Anesthesia, Critical cells were resistant to the immunosuppressive cytokine TGFb1 Care and Pain Medicine, Massachusetts General Hospital, 55 Fruit Street, Boston, and dexamethasone. Moreover, the in vivo anticancer activity of MA 02114. Phone: 617-726-1677; Fax: 617-724-8644; E-mail: NK92CIRB was significantly superior to that of NK92IL2. [email protected] NK92CIRB cells were also significantly more resistant to radia- doi: 10.1158/0008-5472.CAN-17-1007 tion and showed longer survival in tumor-bearing animals. CIRB IL2 Ó2017 American Association for Cancer Research. Surprisingly, NK92 andtoalesserextentNK92 express 5938 Cancer Res; 77(21) November 1, 2017 Downloaded from cancerres.aacrjournals.org on September 28, 2021. © 2017 American Association for Cancer Research. Published OnlineFirst September 15, 2017; DOI: 10.1158/0008-5472.CAN-17-1007 Enhanced Activation and Expansion of Natural Killer Cells CD16, while it was not detected in IL2-stimulated NK92. mutagenize IL2 wild-type, resulting in an IL2-IL2Ra chimera. To CD16 expression synergized with trastuzumab to exert sub- build CIRB final chimera construct, the IL2-IL2Ra chimera stantial antibody-dependent cellular cytotoxicity (ADCC). In was used to amplify IL2 with a C-terminal cMyc tag followed addition, NK92CIRB cells have higher expression of NKP30, by only the extracellular domain of IL2Ra and then followed NKP44, and perforin-1 than NK92IL2 andincontrasttoNK92IL2 by the N-terminal fragment of IL2Rb using forward 50-TGCAG- increased their production of granzyme-B, TNFa,andIFNg GATCCACTCACAGTAACCTCAACTCC-30 and reverse 50-GGGA- upon contact with cancer cells. In conclusion, the novel chi- AGTGCCATTCACCGCGCAGGAAGTCTCACTCTCAGGA-30. The mera CIRB endows NK92 cells with very useful attributes that product was then reamplified using the same forward primer could improve immune therapy of cancer and potentially viral and the reverse 50-GGCTCTCGAGTTGTAGAAGCATGTGAACTG- infections. GGAAGTGCC ATTCACCGC-30.AnXbaI site in IL2 was first removed by mutagenesis using primers forward 50-CATCTT- CAGTGCCTAGAAGAAGAACTC-30 and reverse 50-GAGTTCTTC- Materials and Methods TTCTAGGCACTGAAGATG-30. IL2Rb was then amplified using Reagents forward 50-TTCCCAGTTCACATGCTTCTACAAGTCGACAGCCA- Dexamethasone, chloroquine, Matrigel (catalog no. 126-2.5), ACATCTCCTG-30 and reverse 50-AGCTTCTAGACTCGAGTTAT- and human glycosylated IL2 were purchased from Sigma-Aldrich CACACCAAGTGAGTTGGGTCCTGACCCTGG -30. Next, the frag- Co; horse serum (HS), DMEM/F12, Lipofectamine 2000, and ment IL2-cMyc-IL2Ra was open Xho-XbaI and IL2Rb was added TRIzol from Life Technologies; FBS from Atlanta Biologicals; as SalI-XbaI fragment to form the chimera CIRB. Both IL2 and RPMI1640 from Lonza; Smartscribe and Blueprint Onestep CIRB were transferred from pcDNA4-TO using SpeI (blunt end) RT-PCR Takara kit from Clontech Laboratories; platinum SYBR and XhoI to CSCW-mCherry digested with BamHI (blunt end) and Green qPCR from Invitrogen; PfuUltra DNA polymerase from XhoI. All constructs were sequenced. Stratagene; and human TGFb1 from Antigenix America Inc. IL2 was from MGH-DF/HCC Recombinant Protein Core; human IL4 Lentivirus production and NK-cell line transduction from Shenandoah Biotechnology Inc; and anti-HER2 (trastuzu- HEK293T cells were transfected using Lipofectamine 2000 with mab), humanized antibody (BioVision Inc.), and PNGase F from 2.4 mg DNA of pVSV, (Clontech Laboratories), pCMVdr8.2dvrp New England Biolabs. Addgene (plasmid # 8455), and the lentiviral construct CSCW- GFP or CSCW-mCherry vectors (MGH Vector Core, Boston, MA) Cells to express either CIRB or IL2 constructs, using the ratios 1:0.4:1, HEK293T, NK92, NK92-MI, PC-3, HepG2, MDA-MB-231, respectively, with 25 mmol/L chloroquine. Six hours posttransfec- Panc-1, BT474, and U266 cells were from ATCC, and U251GM tion, media were changed and lentiviral supernatant was collected was a gift from Dr. Samuel Rabkin (Massachusetts General Hos- 3 days later, filtered through a 0.45-mm syringe. NK92 cells were pital, Boston MA). U266-GFP-Luc cells were generated by lenti- infected by spinoculation at 1,800 Â g for 45 minutes at an viral transduction using CSCW-GFP lentiviral vectors. Tumor cell optimal multiplicity of infection (MOI) of 46 lentiviral particles lines PC-3, U251GM, U266, Panc-1, BT474, and MDA-MB-231 per cell in a 2 mL Eppendorf tube containing 2 Â 105 cells. Infected were cultured in complete RPMI1640 medium, HEK293T and cells were plated with IL2 (100 IU/mL) for two days, then weaned HepG2 in complete DMEM/F12, and NK92 and derived cell lines of exogenous IL2. in RPMI1640 as described previously (20) with 100 IU/mL IL2. All cell lines and assay cultures were maintained at 37C and 5% Western blot analysis CO2. All cell lines were obtained between 2015 and 2016 and Phosphorylated Stat 5 was
Load more

Recommended publications
  • Multistage Analysis of Variants in the Inflammation Pathway and Lung Cancer Risk in Smokers
    Published OnlineFirst May 9, 2012; DOI: 10.1158/1055-9965.EPI-12-0352-T Cancer Epidemiology, Research Article Biomarkers & Prevention Multistage Analysis of Variants in the Inflammation Pathway and Lung Cancer Risk in Smokers Margaret R. Spitz1, Ivan P. Gorlov2, Qiong Dong3, Xifeng Wu3, Wei Chen4, David W. Chang3, Carol J. Etzel3, Neil E. Caporaso5, Yang Zhao8, David C. Christiani8, Paul Brennan9, Demetrius Albanes7, Jianxin Shi6, Michael Thun10, Maria Teresa Landi5, and Christopher I. Amos4 Abstract Background: Tobacco-induced lung cancer is characterized by a deregulated inflammatory microenviron- ment. Variants in multiple genes in inflammation pathways may contribute to risk of lung cancer. Methods: We therefore conducted a three-stage comprehensive pathway analysis (discovery, replication, and meta-analysis) of inflammation gene variants in ever-smoking lung cancer cases and controls. A discovery set (1,096 cases and 727 controls) and an independent and nonoverlapping internal replication set (1,154 cases and 1,137 controls) were derived from an ongoing case–control study. For discovery, we used an iSelect BeadChip to interrogate a comprehensive panel of 11,737 inflammation pathway single-nucleotide poly- morphisms (SNP) and selected nominally significant (P < 0.05) SNPs for internal replication. Results: There were six SNPs that achieved statistical significance (P < 0.05) in the internal replication data set with concordant risk estimates for former smokers and five concordant and replicated SNPs in current smokers. Replicated hits were further tested in a subsequent meta-analysis using external data derived from two published genome-wide association studies (GWAS) and a case–control study. Two of these variants (a BCL2L14 SNP in former smokers and an SNP in IL2RB in current smokers) were further validated.
    [Show full text]
  • (12) Patent Application Publication (10) Pub. No.: US 2012/0070450 A1 Ishikawa Et Al
    US 20120070450A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2012/0070450 A1 Ishikawa et al. (43) Pub. Date: Mar. 22, 2012 (54) LEUKEMA STEM CELLMARKERS Publication Classification (51) Int. Cl. A 6LX 39/395 (2006.01) (75) Inventors: Fumihiko Ishikawa, Kanagawa CI2O I/68 (2006.01) (JP): Osamu Ohara, Kanagawa GOIN 2L/64 (2006.01) (JP); Yoriko Saito, Kanagawa (JP); A6IP35/02 (2006.01) Hiroshi Kitamura, Kanagawa (JP); C40B 30/04 (2006.01) Atsushi Hijikata, Kanagawa (JP); A63L/7088 (2006.01) Hidetoshi Ozawa, Kanagawa (JP); C07K 6/8 (2006.01) Leonard D. Shultz, Bar Harbor, C7H 2L/00 (2006.01) A6II 35/12 (2006.01) ME (US) CI2N 5/078 (2010.01) (52) U.S. Cl. .................. 424/173.1; 424/178.1; 424/93.7: (73) Assignee: RIKEN, Wako-shi (JP) 435/6.14; 435/723; 435/375; 506/9: 514/44 A: 530/389.6; 530/391.7:536/24.5 (57) ABSTRACT (21) Appl. No.: 13/258,993 The invention provides a test method for predicting the initial onset or a recurrence of acute myeloid leukemia (AML) com PCT Fled: prising (1) measuring the expression level of human leukemic (22) Mar. 24, 2010 stem cell (LSC) marker genes in a biological sample collected from a Subject for a transcription product or translation prod uct of the gene as an analyte and (2) comparing the expression (86) PCT NO.: PCT/UP2010/0551.31 level with a reference value; an LSC-targeting therapeutic agent for AML capable of Suppressing the expression of a S371 (c)(1), gene selected from among LSC marker genes or a Substance (2), (4) Date: Dec.
    [Show full text]
  • Role of IL-4 Receptor &Alpha
    Role of IL-4 receptor a–positive CD41 T cells in chronic airway hyperresponsiveness Frank Kirstein, PhD, Natalie E. Nieuwenhuizen, PhD,* Jaisubash Jayakumar, PhD, William G. C. Horsnell, PhD, and Frank Brombacher, PhD Cape Town, South Africa, and Berlin, Germany Background: TH2 cells and their cytokines are associated with IL-17–producing T cells and, consequently, increased airway allergic asthma in human subjects and with mouse models of neutrophilia. allergic airway disease. IL-4 signaling through the IL-4 receptor Conclusion: IL-4–responsive T helper cells are dispensable for 1 a (IL-4Ra) chain on CD4 T cells leads to TH2 cell acute OVA-induced airway disease but crucial in maintaining differentiation in vitro, implying that IL-4Ra–responsive CD41 chronic asthmatic pathology. (J Allergy Clin Immunol T cells are critical for the induction of allergic asthma. However, 2016;137:1852-62.) mechanisms regulating acute and chronic allergen-specific T 2 H Key words: responses in vivo remain incompletely understood. TH2 cell, acute allergic airway disease, chronic asthma, Objective: This study defines the requirements for IL-4Ra– cytokine receptors, IL-4, IL-13, gene-deficient mice responsive CD41 T cells and the IL-4Ra ligands IL-4 and IL-13 in the development of allergen-specific TH2 responses during the Allergic asthma is a chronic inflammatory disease of the airways onset and chronic phase of experimental allergic airway disease. characterized by an inappropriate immune response to harmless Methods: Development of acute and chronic ovalbumin environmental antigens. T 2 cells regulate adaptive immune 1 H (OVA)–induced allergic asthma was assessed weekly in CD4 T responses to allergens, and their presence correlates with disease 2 cell–specific IL-4Ra–deficient BALB/c mice (LckcreIL-4Ra /lox) symptoms in human subjects and mice.1 IL-4 plays a crucial role and respective control mice in the presence or absence of IL-4 in the in vitro and in vivo differentiation of TH2 cells, suggesting or IL-13.
    [Show full text]
  • List of Genes Used in Cell Type Enrichment Analysis
    List of genes used in cell type enrichment analysis Metagene Cell type Immunity ADAM28 Activated B cell Adaptive CD180 Activated B cell Adaptive CD79B Activated B cell Adaptive BLK Activated B cell Adaptive CD19 Activated B cell Adaptive MS4A1 Activated B cell Adaptive TNFRSF17 Activated B cell Adaptive IGHM Activated B cell Adaptive GNG7 Activated B cell Adaptive MICAL3 Activated B cell Adaptive SPIB Activated B cell Adaptive HLA-DOB Activated B cell Adaptive IGKC Activated B cell Adaptive PNOC Activated B cell Adaptive FCRL2 Activated B cell Adaptive BACH2 Activated B cell Adaptive CR2 Activated B cell Adaptive TCL1A Activated B cell Adaptive AKNA Activated B cell Adaptive ARHGAP25 Activated B cell Adaptive CCL21 Activated B cell Adaptive CD27 Activated B cell Adaptive CD38 Activated B cell Adaptive CLEC17A Activated B cell Adaptive CLEC9A Activated B cell Adaptive CLECL1 Activated B cell Adaptive AIM2 Activated CD4 T cell Adaptive BIRC3 Activated CD4 T cell Adaptive BRIP1 Activated CD4 T cell Adaptive CCL20 Activated CD4 T cell Adaptive CCL4 Activated CD4 T cell Adaptive CCL5 Activated CD4 T cell Adaptive CCNB1 Activated CD4 T cell Adaptive CCR7 Activated CD4 T cell Adaptive DUSP2 Activated CD4 T cell Adaptive ESCO2 Activated CD4 T cell Adaptive ETS1 Activated CD4 T cell Adaptive EXO1 Activated CD4 T cell Adaptive EXOC6 Activated CD4 T cell Adaptive IARS Activated CD4 T cell Adaptive ITK Activated CD4 T cell Adaptive KIF11 Activated CD4 T cell Adaptive KNTC1 Activated CD4 T cell Adaptive NUF2 Activated CD4 T cell Adaptive PRC1 Activated
    [Show full text]
  • Contribution of IL9, IL2RA and IL2RB Genetic Polymorphisms in Coronary Heart Disease in Chinese Han Population
    Contribution of IL9, IL2RA and IL2RB genetic polymorphisms in coronary heart disease in Chinese Han population Xianghong Chen The Second Aliated Hospital of Hainan Medical University Xingfan Wang The Second Aliated Hospital of Hainan Medical University Zaozhang q Zhang The second Aliated Hospital of Hainan Medical University Yuewu Chen The Second Aliated Hospital of Hainan Medical University Chao Wang ( [email protected] ) The Second Aliated Hospital of Hainan Medical Universiy https://orcid.org/0000-0001-5632-9778 Research article Keywords: Posted Date: December 9th, 2019 DOI: https://doi.org/10.21203/rs.2.18401/v1 License: This work is licensed under a Creative Commons Attribution 4.0 International License. Read Full License Page 1/11 Abstract Background: Coronary heart disease (CHD) is one of the leading causes of disability and death worldwide. In the pathogenesis of CHD, inammatory cytokines take an essential part. This study was designed to detect the potential association between IL-9, IL-2RA and IL-2RB variants and CHD in Chinese Han population. Methods: This case-control study conducted 499 CHD patients and 496 healthy controls. Seven selected SNPs were genotyped to investigate the possible association between the polymorphisms and the CHD risk. The interaction of SNP-SNP in the CHD risk was analyzed by Multifactor dimensionality reduction (MDR). Results: We observed an association between IL-9 rs55692658 (OR = 1.72, p = 0.003) and the increased CHD risk. The stratication analysis by age indicated that no matter participants who were older or younger than 61 years, IL-9 rs55692658 and IL-2RB rs1573673 contributed to the CHD susceptibility signicantly (p < 0.05, respectively).
    [Show full text]
  • Single-Cell RNA Sequencing Demonstrates the Molecular and Cellular Reprogramming of Metastatic Lung Adenocarcinoma
    ARTICLE https://doi.org/10.1038/s41467-020-16164-1 OPEN Single-cell RNA sequencing demonstrates the molecular and cellular reprogramming of metastatic lung adenocarcinoma Nayoung Kim 1,2,3,13, Hong Kwan Kim4,13, Kyungjong Lee 5,13, Yourae Hong 1,6, Jong Ho Cho4, Jung Won Choi7, Jung-Il Lee7, Yeon-Lim Suh8,BoMiKu9, Hye Hyeon Eum 1,2,3, Soyean Choi 1, Yoon-La Choi6,10,11, Je-Gun Joung1, Woong-Yang Park 1,2,6, Hyun Ae Jung12, Jong-Mu Sun12, Se-Hoon Lee12, ✉ ✉ Jin Seok Ahn12, Keunchil Park12, Myung-Ju Ahn 12 & Hae-Ock Lee 1,2,3,6 1234567890():,; Advanced metastatic cancer poses utmost clinical challenges and may present molecular and cellular features distinct from an early-stage cancer. Herein, we present single-cell tran- scriptome profiling of metastatic lung adenocarcinoma, the most prevalent histological lung cancer type diagnosed at stage IV in over 40% of all cases. From 208,506 cells populating the normal tissues or early to metastatic stage cancer in 44 patients, we identify a cancer cell subtype deviating from the normal differentiation trajectory and dominating the metastatic stage. In all stages, the stromal and immune cell dynamics reveal ontological and functional changes that create a pro-tumoral and immunosuppressive microenvironment. Normal resident myeloid cell populations are gradually replaced with monocyte-derived macrophages and dendritic cells, along with T-cell exhaustion. This extensive single-cell analysis enhances our understanding of molecular and cellular dynamics in metastatic lung cancer and reveals potential diagnostic and therapeutic targets in cancer-microenvironment interactions. 1 Samsung Genome Institute, Samsung Medical Center, Seoul 06351, Korea.
    [Show full text]
  • An Ontogenetic Switch Drives the Positive and Negative Selection of B Cells
    An ontogenetic switch drives the positive and negative selection of B cells Xijin Xua, Mukta Deobagkar-Lelea, Katherine R. Bulla, Tanya L. Crockforda, Adam J. Meadb, Adam P. Cribbsc, David Simsc, Consuelo Anzilottia, and Richard J. Cornalla,1 aMedical Research Council Human Immunology Unit, Weatherall Institute of Molecular Medicine, University of Oxford, OX3 9DS Oxford, United Kingdom; bMedical Research Council Molecular Haematology Unit, Weatherall Institute of Molecular Medicine, University of Oxford, OX3 9DS Oxford, United Kingdom; and cMedical Research Council, Weatherall Institute of Molecular Medicine, Centre for Computational Biology, Weatherall Institute of Molecular Medicine, University of Oxford, OX3 9DS Oxford, United Kingdom Edited by Michael Reth, University of Freiburg, Freiburg, Germany, and approved January 6, 2020 (received for review September 3, 2019) + Developing B cells can be positively or negatively selected by self- BM HSCs increased CD5 B-1a B cell development (15), while antigens, but the mechanisms that determine these outcomes are expression of let-7b in FL pro-B cells blocked the development of incompletely understood. Here, we show that a B cell intrinsic B-1 B cells (17). These findings support the notion of hard-wired switch between positive and negative selection during ontogeny differences during ontogeny, but possibly downstream of the HSC is determined by a change from Lin28b to let-7 gene expression. commitment stage. Ectopic expression of a Lin28b transgene in murine B cells restored Several lines of evidence also suggest that B-1 B cells can un- the positive selection of autoreactive B-1 B cells by self-antigen in dergo positive selection, which is linked to their B cell receptor adult bone marrow.
    [Show full text]
  • B Cell Checkpoints in Autoimmune Rheumatic Diseases
    REVIEWS B cell checkpoints in autoimmune rheumatic diseases Samuel J. S. Rubin1,2,3, Michelle S. Bloom1,2,3 and William H. Robinson1,2,3* Abstract | B cells have important functions in the pathogenesis of autoimmune diseases, including autoimmune rheumatic diseases. In addition to producing autoantibodies, B cells contribute to autoimmunity by serving as professional antigen- presenting cells (APCs), producing cytokines, and through additional mechanisms. B cell activation and effector functions are regulated by immune checkpoints, including both activating and inhibitory checkpoint receptors that contribute to the regulation of B cell tolerance, activation, antigen presentation, T cell help, class switching, antibody production and cytokine production. The various activating checkpoint receptors include B cell activating receptors that engage with cognate receptors on T cells or other cells, as well as Toll-like receptors that can provide dual stimulation to B cells via co- engagement with the B cell receptor. Furthermore, various inhibitory checkpoint receptors, including B cell inhibitory receptors, have important functions in regulating B cell development, activation and effector functions. Therapeutically targeting B cell checkpoints represents a promising strategy for the treatment of a variety of autoimmune rheumatic diseases. Antibody- dependent B cells are multifunctional lymphocytes that contribute that serve as precursors to and thereby give rise to acti- cell- mediated cytotoxicity to the pathogenesis of autoimmune diseases
    [Show full text]
  • Cd4/Cd8 Panel, Blood
    Lab Dept: Flow and Immunology Test Name: CD4/CD8 PANEL, BLOOD General Information Lab Order Codes: C48P Synonyms: Helper/Suppressor Ratio; T- cells; T-cell subsets; T-cell phenotyping See also: Immune Status Panel and Comprehensive Immune Status Panel CPT Codes: 86359 – T cells, total count 86360 – T cells; absolute CD4 and CD8 count, including ratio Test Includes: CD4(CD3+) and CD8(CD3+) relative percentages, absolute values and a calculated Helper/Suppressor ratio. Logistics Test Indications: This is a minimal antibody panel to monitor immune status. Lab Testing Sections: Flow Cytometry Phone Numbers: MIN Lab: 612-813-6280 STP Lab: 651-220-6550 Test Availability: 3 times weekly determined by volume. Transport collected specimen immediately to Flow Cytometry. Routine testing is not available on weekends or holidays. Therefore, specimens cannot be used if drawn the day before a 3 day weekend such as Memorial Day, Labor Day or major holiday that falls on a Monday or Friday. Turnaround Time: 1 – 3 days Special Instructions: See Test Availability Specimen Specimen Type: Whole blood Container: Lavender top (EDTA) tube Draw Volume: 2 mL blood in a 2 mL Lavender (EDTA) tube Minimum volume: 0.5 mL in an EDTA microtainer Collection: Routine venipuncture Special Processing: Keep sample at room temperature and forward promptly to the laboratory. Do not centrifuge, refrigerate, or freeze sample. Patient Preparation: None Sample Rejection: Specimens will not be processed that are clotted; hemolyzed; greater than 72 hours old; collected in the wrong tube type (0.5 mL in a 2 mL tube), or that have been held or handled at a temperature other than room temperature Interpretive Reference Range: Age-dependant reference ranges provided with results.
    [Show full text]
  • Rational Design of a CD4 Mimic That Inhibits HIV-1 Entry and Exposes Cryptic Neutralization Epitopes
    RESEARCH ARTICLE Rational design of a CD4 mimic that inhibits HIV-1 entry and exposes cryptic neutralization epitopes Loïc Martin1, François Stricher1, Dorothée Missé2, Francesca Sironi3, Martine Pugnière4, Philippe Barthe5, Rafael Prado-Gotor5, Isabelle Freulon1, Xavier Magne2, Christian Roumestand5, André Ménez1, Paolo Lusso3, Francisco Veas2, and Claudio Vita1* Published online 16 December 2002; doi:10.1038/nbt768 The conserved surfaces of the human immunodeficiency virus (HIV)-1 envelope involved in receptor binding represent potential targets for the development of entry inhibitors and neutralizing antibodies. Using structural information on a CD4-gp120-17b antibody complex, we have designed a 27-amino acid CD4 mimic, CD4M33, that presents optimal interactions with gp120 and binds to viral particles and diverse HIV-1 envelopes with CD4-like affinity.This mini-CD4 inhibits infection of both immortalized and primary cells by HIV-1, including pri- http://www.nature.com/naturebiotechnology mary patient isolates that are generally resistant to inhibition by soluble CD4. Furthermore, CD4M33 pos- sesses functional properties of CD4, including the ability to unmask conserved neutralization epitopes of gp120 that are cryptic on the unbound glycoprotein. CD4M33 is a prototype of inhibitors of HIV-1 entry and, in complex with envelope proteins, a potential component of vaccine formulations, or a molecular target in phage display technology to develop broad-spectrum neutralizing antibodies. HIV-1 avoids the host immune surveillance by exposing
    [Show full text]
  • Evaluation of the IL2/IL21, IL2RA and IL2RB Genetic Variants Influence On
    Cénit et al. BMC Medical Genetics 2013, 14:52 http://www.biomedcentral.com/1471-2350/14/52 RESEARCH ARTICLE Open Access Evaluation of the IL2/IL21, IL2RA and IL2RB genetic variants influence on the endogenous non-anterior uveitis genetic predisposition María Carmen Cénit1*†, Ana Márquez1†, Miguel Cordero-Coma2, Alejandro Fonollosa3, Alfredo Adán4, Agustín Martínez-Berriotxoa3, Victor Llorenç4, David Díaz Valle5, Ricardo Blanco6, Joaquín Cañal7, Manuel Díaz-Llopis8, José Luis García Serrano9, Enrique de Ramón10, María José del Rio11, Marina Begoña Gorroño- Echebarría12, José Manuel Martín-Villa13, Norberto Ortego-Centeno14 and Javier Martín1 Abstract Background: Recently, different genetic variants located within the IL2/IL21 genetic region as well as within both IL2RA and IL2RB loci have been associated to multiple autoimmune disorders. We aimed to investigate for the first time the potential influence of the IL2/IL21, IL2RA and IL2RB most associated polymorphisms with autoimmunity on the endogenous non-anterior uveitis genetic predisposition. Methods: A total of 196 patients with endogenous non-anterior uveitis and 760 healthy controls, all of them from Caucasian population, were included in the current study. The IL2/IL21 (rs2069762, rs6822844 and rs907715), IL2RA (2104286, rs11594656 and rs12722495) and IL2RB (rs743777) genetic variants were genotyped using TaqMan® allelic discrimination assays. Results: A statistically significant difference was found for the rs6822844 (IL2/IL21 region) minor allele frequency in the group of uveitis patients compared with controls (P-value=0.02, OR=0.64 CI 95%=0.43-0.94) although the significance was lost after multiple testing correction. Furthermore, no evidence of association with uveitis was detected for the analyzed genetic variants of the IL2RA or IL2RB loci.
    [Show full text]
  • Identification of Stage-Specific Surface Markers in Early B Cell
    Identification of Stage-Specific Surface Markers in Early B Cell Development Provides Novel Tools for Identification of Progenitor Populations This information is current as of September 28, 2021. Christina T. Jensen, Stefan Lang, Rajesh Somasundaram, Shamit Soneji and Mikael Sigvardsson J Immunol published online 25 July 2016 http://www.jimmunol.org/content/early/2016/07/23/jimmun ol.1600297 Downloaded from Supplementary http://www.jimmunol.org/content/suppl/2016/07/23/jimmunol.160029 Material 7.DCSupplemental http://www.jimmunol.org/ Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication by guest on September 28, 2021 *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2016 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. Published July 25, 2016, doi:10.4049/jimmunol.1600297 The Journal of Immunology Identification of Stage-Specific Surface Markers in Early B Cell Development Provides Novel Tools for Identification of Progenitor Populations Christina T. Jensen,* Stefan Lang,* Rajesh Somasundaram,† Shamit Soneji,* and Mikael Sigvardsson*,† Whereas the characterization of B lymphoid progenitors has been facilitated by the identification of lineage- and stage-specific surface markers, the continued identification of differentially expressed proteins increases our capacity to explore normal and malignant B cell development.
    [Show full text]