Tethering IL2 to Its Receptor Il2rb Enhances Antitumor Activity and Expansion of Natural Killer NK92 Cells Youssef Jounaidi, Joseph F

Published OnlineFirst September 15, 2017; DOI: 10.1158/0008-5472.CAN-17-1007

Cancer Therapeutics, Targets, and Chemical Biology Research

Tethering IL2 to Its Receptor IL2Rb Enhances Antitumor Activity and Expansion of Natural Killer NK92 Cells Youssef Jounaidi, Joseph F. Cotten, Keith W. Miller, and Stuart A. Forman

Abstract

IL2 is an immunostimulatory cytokine for key immune cells of IL2 and its receptor IL2Rb joined via a peptide linker (CIRB). including T cells and natural killer (NK) cells. Systemic IL2 NK92 cells expressing CIRB (NK92CIRB) were highly activated and supplementation could enhance NK-mediated immunity in a expanded indeﬁnitely without exogenous IL2. When compared variety of diseases ranging from neoplasms to viral infection. with an IL2-secreting NK92 cell line, NK92CIRB were more acti- However, its systemic use is restricted by its serious side effects and vated, cytotoxic, and resistant to growth inhibition. Direct contact limited efﬁcacy due to activation of T regulatory cells (Tregs). IL2 with cancer cells enhanced the cytotoxic character of NK92CIRB signaling is mediated through interactions with a multi-subunit cells, which displayed superior in vivo antitumor effects in mice. receptor complex containing IL2Ra, IL2Rb, and IL2Rg. Adult Overall, our results showed how tethering IL2 to its receptor natural killer (NK) cells express only IL2Rb and IL2Rg subunits IL2Rb eliminates the need for IL2Ra and IL2Rb, offering a and are therefore relatively insensitive to IL2. To overcome these new tool to selectively activate and empower immune therapy. limitations, we created a novel chimeric IL2-IL2Rb fusion protein Cancer Res; 77(21); 5938–51. 2017 AACR.

Introduction in order for allogeneic NK cells to be effective, pretransfer lymphodepletion is required to reduce competition for growth Natural killer (NK) cells are lymphocytes endowed with the factors and cytokines (14, 15). Moreover, IL2 is needed to innate ability to attack malignant and virus infected cells (1–3). sustain NK cytotoxicity after in vivo transfer, exposing patients Several interleukins, and in particular IL2, activate and expand to systemic side effects. T cells and NK cells (4). Systemic IL2 supplementation could Past efforts to express endogenous IL2 in NK cells (16) or to therefore enhance immunity in cancer and viral infection. How- express membrane-bound endogenous IL2 (17) showed limited ever, tumor cells and their microenvironment (TME) often repress success with micrometastatic models and were not as efficacious NK cells antitumor activity by orchestrating a multitude of escape as NK cells stimulated with IL2 ex vivo. The limited success of mechanisms (5). strategies using NK cells could be explained by the failure of Clinical trials using high-dose IL2 infusions have met lim- activated NK cells to outcompete Tregs for cytokines in the host ited success due to severe side effects that mimic sepsis (6–8), and the immunosuppressive effect of the TME, which includes while low-dose IL2 efficacy is limited by the short half-life (less myeloid-derived suppressor cells (MDSC). Both MDSCs and than 10 minutes) of IL2 in vivo (9), and due to depletion of low Tregs suppress NK-cell functions either by direct contact or by IL2 doses by Tregs and other lymphoid cells (10). Several secretion of TGFb1 (18, 19). strategies based on IL2 have aimed to enhance NK cytotoxicity To selectively activate and expand NK cells without exo- while reducing toxicity in patients, with limited efficacy. Cul- genous IL2, while maintaining NK cytotoxicity and prolifera- tured ex vivo autologous NK cells activated and induced to tion both in vitro and in vivo, circumvent the requirement of proliferate by IL2 display less antitumor efficacy (11) than IL2Ra and its lack of expression in NK cells, thus avoiding allogeneic NK cells (12), because self-class I HLA signaling IL2 off-target effects, cytokine competition, and activation of suppresses NK cytotoxicity and cytokine release (13). However, downregulating lymphoid cells like Tregs. We created a novel chimeric IL2-IL2Rb (CIRB), consisting of IL2 tethered via a linker to IL2Rb, which functions like constitutively activated Department of Anesthesia, Critical Care and Pain Medicine, Massachusetts IL2Rb. NK92 cells expressing CIRB (NK92CIRB)produceanti- General Hospital and Harvard Medical School, Boston, Massachusetts. cancer effects in vitro that are equivalent to or better than Note: Supplementary data for this article are available at Cancer Research NK92IL2. Importantly, compared with IL2-stimulated NK92 Online (http://cancerres.aacrjournals.org/). and NK92IL2, the anticancer activity and growth of NK92CIRB Corresponding Author: Youssef Jounaidi, Department of Anesthesia, Critical cells were resistant to the immunosuppressive cytokine TGFb1 Care and Pain Medicine, Massachusetts General Hospital, 55 Fruit Street, Boston, and dexamethasone. Moreover, the in vivo anticancer activity of MA 02114. Phone: 617-726-1677; Fax: 617-724-8644; E-mail: NK92CIRB was significantly superior to that of NK92IL2. [email protected] NK92CIRB cells were also significantly more resistant to radia- doi: 10.1158/0008-5472.CAN-17-1007 tion and showed longer survival in tumor-bearing animals. CIRB IL2 2017 American Association for Cancer Research. Surprisingly, NK92 andtoalesserextentNK92 express

5938 Cancer Res; 77(21) November 1, 2017

Enhanced Activation and Expansion of Natural Killer Cells

CD16, while it was not detected in IL2-stimulated NK92. mutagenize IL2 wild-type, resulting in an IL2-IL2Ra chimera. To CD16 expression synergized with trastuzumab to exert sub- build CIRB final chimera construct, the IL2-IL2Ra chimera stantial antibody-dependent cellular cytotoxicity (ADCC). In was used to amplify IL2 with a C-terminal cMyc tag followed addition, NK92CIRB cells have higher expression of NKP30, by only the extracellular domain of IL2Ra and then followed NKP44, and perforin-1 than NK92IL2 andincontrasttoNK92IL2 by the N-terminal fragment of IL2Rb using forward 50-TGCAG- increased their production of granzyme-B, TNFa,andIFNg GATCCACTCACAGTAACCTCAACTCC-30 and reverse 50-GGGA- upon contact with cancer cells. In conclusion, the novel chi- AGTGCCATTCACCGCGCAGGAAGTCTCACTCTCAGGA-30. The mera CIRB endows NK92 cells with very useful attributes that product was then reamplified using the same forward primer could improve immune therapy of cancer and potentially viral and the reverse 50-GGCTCTCGAGTTGTAGAAGCATGTGAACTG- infections. GGAAGTGCC ATTCACCGC-30.AnXbaI site in IL2 was first removed by mutagenesis using primers forward 50-CATCTT- CAGTGCCTAGAAGAAGAACTC-30 and reverse 50-GAGTTCTTC- Materials and Methods TTCTAGGCACTGAAGATG-30. IL2Rb was then amplified using Reagents forward 50-TTCCCAGTTCACATGCTTCTACAAGTCGACAGCCA- Dexamethasone, chloroquine, Matrigel (catalog no. 126-2.5), ACATCTCCTG-30 and reverse 50-AGCTTCTAGACTCGAGTTAT- and human glycosylated IL2 were purchased from Sigma-Aldrich CACACCAAGTGAGTTGGGTCCTGACCCTGG -30. Next, the frag- Co; horse serum (HS), DMEM/F12, Lipofectamine 2000, and ment IL2-cMyc-IL2Ra was open Xho-XbaI and IL2Rb was added TRIzol from Life Technologies; FBS from Atlanta Biologicals; as SalI-XbaI fragment to form the chimera CIRB. Both IL2 and RPMI1640 from Lonza; Smartscribe and Blueprint Onestep CIRB were transferred from pcDNA4-TO using SpeI (blunt end) RT-PCR Takara kit from Clontech Laboratories; platinum SYBR and XhoI to CSCW-mCherry digested with BamHI (blunt end) and Green qPCR from Invitrogen; PfuUltra DNA polymerase from XhoI. All constructs were sequenced. Stratagene; and human TGFb1 from Antigenix America Inc. IL2 was from MGH-DF/HCC Recombinant Protein Core; human IL4 Lentivirus production and NK-cell line transduction from Shenandoah Biotechnology Inc; and anti-HER2 (trastuzu- HEK293T cells were transfected using Lipofectamine 2000 with mab), humanized antibody (BioVision Inc.), and PNGase F from 2.4 mg DNA of pVSV, (Clontech Laboratories), pCMVdr8.2dvrp New England Biolabs. Addgene (plasmid # 8455), and the lentiviral construct CSCW- GFP or CSCW-mCherry vectors (MGH Vector Core, Boston, MA) Cells to express either CIRB or IL2 constructs, using the ratios 1:0.4:1, HEK293T, NK92, NK92-MI, PC-3, HepG2, MDA-MB-231, respectively, with 25 mmol/L chloroquine. Six hours posttransfec- Panc-1, BT474, and U266 cells were from ATCC, and U251GM tion, media were changed and lentiviral supernatant was collected was a gift from Dr. Samuel Rabkin (Massachusetts General Hos- 3 days later, filtered through a 0.45-mm syringe. NK92 cells were pital, Boston MA). U266-GFP-Luc cells were generated by lenti- infected by spinoculation at 1,800 g for 45 minutes at an viral transduction using CSCW-GFP lentiviral vectors. Tumor cell optimal multiplicity of infection (MOI) of 46 lentiviral particles lines PC-3, U251GM, U266, Panc-1, BT474, and MDA-MB-231 per cell in a 2 mL Eppendorf tube containing 2 105 cells. Infected were cultured in complete RPMI1640 medium, HEK293T and cells were plated with IL2 (100 IU/mL) for two days, then weaned HepG2 in complete DMEM/F12, and NK92 and derived cell lines of exogenous IL2. in RPMI1640 as described previously (20) with 100 IU/mL IL2. All cell lines and assay cultures were maintained at 37C and 5% Western blot analysis CO2. All cell lines were obtained between 2015 and 2016 and Phosphorylated Stat 5 was detected using rabbit anti-STAT5 were used until a maximum passage of 20 when they were phospho (Tyr694) antibody (BioLegend) while the chimera CIRB replaced with a fresh passage. Monitoring for mycoplasma con- was detected by mouse anti-human IL2 antibody (PeproTech), in tamination was done using MycoFluor mycoplasma detection kit 40 mg cell lysates obtained using RIPA lysis buffer (Santa Cruz (Molecular Probes). Biotechnology). Secondary donkey anti-mouse IRDye 800CW and goat anti-rabbit IRDye 680RD antibodies were from LI-COR Chimera CIRB construction Biosciences. IL2 cDNA was amplified from human brain total RNA by RT-PCR using forward primer 50-TGCAGGATCCACTCACAG- Flow cytometry TAACCTCAACTCC-30 and reverse primer 50-TGCACTCGAGAG- NK-cell markers' expression was verified using mouse anti- TGAAACCATTTTAGAGCC-30 and cloned in BamHI-XhoIin human antibodies to CD45-APC-CY7, CD25-FITC, CD16-PE, pCDNA4-TO. To build the CIRB chimera, we first fused IL2 and CD3-PE-CY7, CD56-PAC BLUE, and CD122-PE, were from BD the extracellular domain of its receptor IL2Ra, which was ampli- Biosciences. Anti-human antibodies to NKG2D-APC, MHC-1 fied by RT-PCR from NK92 total RNA using forward oligonu- HLA-A2-APC, NKP30-PE, NKP44-PE-CY7, NKP46-FITC, Gran- cleotide 50-GGATTACCTTTTGTCAAAGCATCATCTCAACACTGA- zyme B-FITC, perforin1-PE, IFNg-APC, TNF-a1- APC-CY7, were CTGAGCAGAAGCTCATTTCGGAAGAAGACCTTGAAATGGAGA- from BioLegend, DAPI from Invitrogen, mouse anti-cMyc: sure- CCAGTCAGTTTCCAGG-30, bridging IL2 C-terminal (12 amino Light APC was from Columbia Biosciences. Cells were sorted at acids before the stop codon), and contains the cMyc Tag, the MGH Flow Cytometry Core facility using a BD 5 laser SORP FACS sequence between amino acids 187–194 of IL2Ra as well as and PVantage SE Diva system (BD Biosciences). FACS data and the noncoding 30 sequence of IL2 plasmid. This primer was used Median statistics were analyzed using FlowJo Software (Tree with reverse oligonucleotide 50-CCTGATATGTTTTAAGTGGGA- Star, Inc.). Human primary NK (hNK) cells were extracted from AGCACTTAATTATCAGATTGTTCTTCTACTC TTCCTCTGTCTCC peripheral blood of healthy donors using the Rosettesep human -30. The amplified fragment was used as an oligonucleotide to enrichment kit (StemCell Technologies).

www.aacrjournals.org Cancer Res; 77(21) November 1, 2017 5939

Jounaidi et al.

Cytotoxic activity of NK92, NK92IL2, and NK92CIRB cells and tumor volumes were calculated on the basis of: volume ¼ A total of 8 103 U266GFP cells (selected for firm adherence) p/6 (length width)3/2. Treatment with NK92CIRB or NK92IL2 were plated in triplicate in 96-well plates. Twenty-four hours later was initiated when the average tumor volume reached approxi- NK92IL2, NK92CIRB, and NK92 (prestimulated for 24 hours with mately 200 mm3 for PC-3 or approximately 160 mm3 for U251. IL2, 100 IU/mL) were added at effector:target cells ratios (E:T) of For animals bearing PC-3 tumors, freshly prepared NK cells 1:8, 1:4, 1:2, 1:1, and 2:1. After two days of coculture, NK cells were suspended in PBS irradiated with 500 cGy and adminis- were suspended to allow further killing of U266GFP cells. After a tered as 4 weekly injections (15 106 cells in 200 mLper total 4 days of coculture, survival of U266GFP cells was quantified mouse), via the tail vein. For animals bearing U251 cells, by GFP-emitted fluorescence. NK92CIRB or NK92IL2 were not irradiated. In other experiments, we evaluated NK-cell lines' anticancer CIRB IL2 effect against U251GM, PC-3, Panc-1, MDA-MB-231, and HepG2 Detection of NK92 and NK92 in peripheral blood cells. A total of 3.2 104 cancer cells were first plated in a 24-well U251MG tumor cells were grown subcutaneously in Nod/scid 3 IL2 plate for either 24 hours prior to adding NK92 (prestimulated mice to approximately 160 mm . Nonirradiated NK92 and CIRB 7 with IL2, 100 IU/mL), NK92IL2, or NK92CIRB at E:T ratio of 2:1 NK92 (10 cells), were injected, via the tail vein. A second 6 target cancer cell, or only 5 hours before adding NK92IL2 or injection of nonirradiated NK cells (5 10 cells) was carried out NK92CIRB at E:T ratios of 0:1, 1:1, 2:1, and 3:1 for each cancer 4 days later. Seventeen days later, animals were killed and cardiac cell line. Cocultured cells were then incubated for 4 days. Viability blood was collected, processed, and analyzed by flow cytometry of cancer cells was determined using a 0.1% Crystal violet in a10% using human-specific anti-CD45 and mCherry fluorescent alcohol solution followed by extraction using 70% ethanol and protein. reading absorbance at 595 nm. Survival of irradiated NK92CIRB and NK92IL2 cells CIRB IL2 CIRB After irradiation at 10 Gy (0.83 Gy for 12 minutes), NK92 ADCC of NK92 and NK92 against HER2-positive breast IL2 cancer cell line and NK92 were cultured and their survival was determined, BT474 (8 103 cells) were plated in 96-well plates. Twenty- using Trypan blue exclusion every 24 hours for 3 days. four hours later, cells were incubated for 20 minutes at room fi IL2 m Expression pro les of cytotoxicity effectors in NK92, NK92 , temperature with 1 g/mL trastuzumab before the addition of NK CIRB cells at an E:T ratio of 2:1. After 3 days of incubation, viability of and NK92 cancer cells was determined using Crystal violet staining. Natural cytotoxicity receptors NKP30, NKP44, NKP46, cytolyt- ic enzymes perforin-1 and granzyme-B, and cytokines TNFa and INFg were quantified by qRT-PCR using the primers listed in Impact of preexposure to immunosuppressors on NK cells' Supplementary Table S1. Protein expression profiles were also cytotoxicity and viability determined in NK cells by flow cytometry under TGFb1 and IL2 CIRB 4 NK92, NK92 , and NK92 (6.4 10 cells), were plated dexamethasone treatments as well as under activation by contact and exposed for 24 hours to TGFb1 (20 ng/mL), or dexameth- with PC-3 cells asone (0.5 mmol/L). During this time, NK92 cells were incubated with IL2 at 20 IU/mL. U251GM, PC-3, Panc-1, MDA-MB-231, and Statistical analysis HepG2 cells (3.2 104 cells) were then added to NK cells at an E:T Statistical significance of differences was determined by two- ratio of 2:1. Cocultured cells were incubated for 4 days and cell tailed Student test, one-way ANOVA, paired Tukey multiple viability of cancer cells was determined using Crystal violet comparison test. All tests included comparisons to untreated staining. samples or as indicated in the text. Statistical significance is To determine the impact of immunosuppressors TGFb1, IL4, indicated by , P < 0.05; , P < 0.01; , P < 0.001; , P < and dexamethasone on the growth of NK92IL2 and NK92CIRB 0.001. Analyses were performed using Prism software version 6 (3.0 104 cells), were plated in triplicate in a 12-well plate, (GraphPad Software). grown under TGFb1(10ng/mL),IL4(10ng/mL),ordexa- methasone (1 mmol/L) for 3 days, and then refreshed for another 3 days of growth under the same conditions for a Results total of 6 days. The viability and growth of cells were deter- Design and construction of the CIRB chimera mined with Trypan blue exclusion using a Bio-Rad TC20 auto- The quaternary crystal structure of IL2 receptor complex (21) mated cell counter. shows that the C-terminal end of IL2 and the N-terminal residue of IL2Rb are separated by 41Å. For a linker between Tumor growth delay experiments IL2 and the N-terminus of IL2Rb, we choose the extracellular All experiments involving animals were approved by the domain of IL2Ra. A cMyc tag was added between IL2 and the Institutional Animal Care and Use Committee at Massachusetts linker. The linker fold was predicted computationally to be a General Hospital (Boston, MA). U251GM or PC-3 cells were helix-dominated structure (Supplementary Fig. S1). Linker suspended in serum-free RPMI1640 containing 20% Matrigel flexibility was assessed using the computational method of and injected subcutaneously as 4 106 cells for PC-3 or 3 106 Karplus and Shultz method (22), which indicates better than cells for U251GM in a volume of 0.5 mL using a 0.5-inch 29- average flexibility (1 or greater on a 0–2 scale) at all the peptide gauge needle and a 1-mL insulin syringe in 1-week-old (24–25 linkages. The mature receptor IL2Rb protein without signal g) male NOD.Cg-Prkdcscid Il2rgtm1Wjl/SzJ immunodeficient peptide was placed after the linker to yield the chimera CIRB. mice (Jackson Laboratory). Tumor areas (length width) were CIRB and IL2 were separately cloned in lentiviral vector coex- measured twice a week using Vernier calipers (Manostat Corp.) pressing mCherry (Fig. 1A).

5940 Cancer Res; 77(21) November 1, 2017 Cancer Research

Enhanced Activation and Expansion of Natural Killer Cells

A cMyc tag CIRB N IL2 L IL2Rβ C

IL2 NCIL2 Figure 1.

CIRB, a novel cytokine–cytokine { receptor chimera. A, Diagram of the human IL2 and the chimera IL2 fused CMV R U5 gag RRE cPPT CMV IRES mCherry WPRE U3 R U5 with receptor IL2Rb (CIRB) in lentiviral constructs. A linker (L) composed of the cMyc tag (EQKLISEEDL) and a B CD fragment of the extracellular domain HEK293IL2 HEK293CIRB NK92IL2 NK92CIRB NK92CIRBNeg NK92IL2 NK92CIRB of IL2Ra (EMETSQFPGEEKPQAS- 100 100 100 PEGRPESETSC), joins IL2 and its 80 receptor IL2Rb. B and C, Detection by 80 80 anti-cMyc mAb of CIRB expression at 60 60 the surface of transiently transfected 60 HEK293 cells (B) and in lentivirus- 40 40 40 transduced NK92 cells (C). D, CD122 expression detected using an anti- 20 20 20 CD122 mAb, which recognizes the 0 0

native IL2Rb (CD122) as well as the Cell count (% of Max) 0 2 3 4 5 2 3 4 5 chimera. CD122 is present in NK92IL2 0102 103 104 105 010 10 10 10 010 10 10 10 cells and as expected, much higher in Anti-C-Myc: HEK293 Anti-C-Myc: NK cells Anti-CD122: NK cells NK92CIRB due to the additional expression of CIRB. Expression was higher than the background detected E IL2 CIRB IL2 CIRB in the absence of antibody (Neg). F Kda MW NK92 NK92 NK92 NK92 NK92 NK92 E, CIRB was further detected by Western blot analysis using 40 mg cell 170

lysates and monoclonal anti-human 130 95 IL2. CIRB is heavily glycosylated. CIRB F, RT-PCR detection of IL2 and CIRB 2,200 bp transcripts in NK92IL2 and NK92CIRB. UT PNGase For primer sequences, see G Supplementary Table S1. G, Only IL2 2107 IL2 680 bp NK92 cells secrete soluble IL2 that 1107 could support the growth of 150,000 cocultured NK92 cells. Experiment done in 6-well plate with inserts containing 100 K cells of bystander 100,000 NK92 in the bottom chamber and IL2 CIRB 100 K cells of NK92 ,NK92 , 50,000 NK92, or NK92 in the presence of IL2 (20 IU/mL). 0

IL2 CIRB Bystander NK92 cell number NK92 NK92 NK92 NK92+IL2 Cells affecting NK92 growth

Cell surface expression of the chimera CIRB cells, as expected, but at levels lower than in NK92CIRB,which NK92IL2 and NK92CIRB cell lines established with lentiviral express both IL2Rb and CIRB. The expression of the full-length infection at an identical MOI of 46 acquire IL2 independence chimera CIRB was further detected by Western blot analysis and proliferate indeﬁnitely. Both cell lines showed similar using monoclonal anti-human IL2. Figure 1E shows a full- growth during a 6-day period, faster than NK92-MI, another length size of 95 kDa, which is higher than the predicted size IL2-independent cell line (Supplementary Fig. S2), with robust of 80 kDa due to posttranslational glycosylation. Indeed survival after subjection to multiple freezing and plating upon deglycosylation treatment with PNGase F, the chimera cycles in culture, comparatively to NK92 and NK92-MI. Using molecular weight was reduced to approximately 80 kDa. an anti-cMyc mAb, we next examined the expression of CIRB at Although IL2 produced by NK92IL2 couldbedetectedby the cell surface of transiently transfected HEK293 (Fig. 1B) and RT-PCR (Fig. 1F) and its secretion in the media could support stable NK92CIRB (Fig.1C).Wefoundclearevidenceofthe the growth of bystander NK92 (Fig. 1G) it could not, however, surface expression of cMyc in NK92CIRB, but not in NK92IL2. be detected by Western blot analysis, as the limit of detection CIRB expression was further conﬁrmed using an anti-CD122 for anti-IL2 antibody is 3 ng/lane. In fact, the IL2-producing mAb, which recognizes the native IL2Rb as well as the chimera. NK92-MI was reported to express 19.4 pg/mL, an amount that Figure 1D shows the endogenous CD122 present in NK92IL2 couldbedetectedonlybyELISA(20).

www.aacrjournals.org Cancer Res; 77(21) November 1, 2017 5941

Jounaidi et al.

Cytotoxicity of parental NK-92 and modified cell lines IL2 presence in the media. Overall immunosuppression of We first compared cytotoxicity of NK92, NK92IL2,and NK92CIRB wasweakerthanintheNK92andNK92IL2 lines and NK92CIRB cells against an adherent multiple myeloma cell line was also dependent on the target cancer cell line. Flow cyto- U266GFP. Figure 2A shows that NK92 cell line, although metry analysis shows both dexamethasone (1 mmol/L) and prestimulated with 100 IU/mL of IL2, was far less cytotoxic TGFb1 (10 ng/mL) affected NKP30 expression dramatically in than NK92IL2 or NK92CIRB.NK92IL2 and NK92CIRB cells showed NK92IL2 (Fig. 3D), whereas NK92CIRB resisted dexamethasone equivalent cytotoxicity toward U266GFP, suggesting compara- and experienced a marginal effect under TGFb1. NKP44 expres- ble levels of activation in vitro. NK92 cell line uniquely lacks sion was equally but marginally reduced, whereas NKP46 was killer immunoglobulin receptor (KIR). As a result, the cell not affected in both cell lines. Annexin V staining shows that surface expression of MHC-I in tumor cell lines should not only dexamethasone induced moderate apoptosis in NK92IL2 account for a better or worse susceptibility to NK-cell–mediated (11.5% cell death), whereas NK92CIRB apoptotic cells repre- killing. We sought to confirm this for NK92CIRB by first deter- sented approximately 5%–6%. Therefore, in NK92IL2,the mining the levels of the dominant MHC-1 antigen HLA-A2 in a reduced cell growth under TGFb1 and dexamethasone is prob- panel of five human cancer cell lines. Figure 2B shows that, ably caused by slow cell growth to which NK92CIRB cells are except for PC-3, the tumor cell lines we used in this study all resistant. express high HLA-A2 levels. We then compared anticancer activity of NK-cell lines against CD16 is substantially induced by endogenous expression of five human cancer cell lines. In one experiment (Fig. 2C) cells the chimera CIRB were plated 24 hours prior to adding NK-cell lines. At an E:T In accordance with their original characterization (26), þ þ ratio of 2:1, the cytotoxicity of NK92IL2 and NK92CIRB were NK92 cells were found CD56 ,CD3,CD16,CD25, þ generally equivalent with a slight edge to NK92CIRB and super- CD45 ,andNKg2D (Fig.4A).NK92CIRB cells expressed ior to NK92. In other experiments, cancer cells were plated only higher amount of CD16 and lower amounts of CD25 than 5 hours prior to adding NK cells (Fig. 2D). Under these both IL2-stimulated NK92 and NK92IL2.Wealsoexamined conditions, the cytotoxicity of all NK-cell lines was greater NK92-MI, and in accordance with a previous report (20), did than in cells plated for 24 hours. However, NK92CIRB showed not find any expression of CD16 (Fig. 4B). Similarly, CD16 was more cytotoxicity than NK92IL2, at most E:T ratios. This differ- undetectable in NK92 treated with either glycosylated or non- ence was more evident with the most resistant cancer cell lines glycosylated IL2 (Fig. 4C). Freshly isolated human NK (hNK) U251GM and Panc-1. As expected, MHC-1 antigen HLA-A2 cells displayed different patterns of marker expression. Unlike expression is irrelevant to NK92CIRB-mediated cytotoxicity. NK92, the cell lines NK92IL2,NK92CIRB,andhNKcellsareall þ CD16 , with expression levels of hNK > NK92CIRB > NK92IL2 NK92CIRB resistance to TGFb1, IL4, and dexamethasone (Fig. 4D). hNK cells express much higher levels of CD16 and immunosuppression NKG2D than all NK92 cell lines and are virtually CD25 .Of TGFb1 is an immunosuppressor overexpressed in the TME, the NK92 cell lines, NK92CIRB expression for CD25 and CD16 known to inhibit NK cells' functions by destabilizing several were most similar to hNK. activation signals (23). The glucocorticoid dexamethasone IL2 CIRB impairs the function of lymphocytes in part by suppressing IL2 ADCC of NK92 and NK92 against HER2-positive breast þ production from CD4 T cells (24). IL4 was reported to inhibit cancer cell line BT474 the proliferation of NK cells (25). We tested the effects of these We next examined the impact of CD16 expression on ADCC immunosuppressors on NK92IL2 and NK92CIRB by culturing using trastuzumab against an HER2-positive breast cancer cell line cells for 6 days in the presence of TGFb1 (10 ng/mL), IL4 BT474. Figure 4E shows that in the absence trastuzumab and (10 ng/mL), or dexamethasone (1 mmol/L). Figure 3A shows that when using an E:T ratio of 2:1, BT474 cells were not affected NK92IL2 did not survive the exposure to dexamethasone. Their by the direct cytotoxicity of NK cells. However, in the presence CIRB IL2 proliferation was inhibited strongly by TGFb1 and to some of 1 mg/mL trastuzumab, both NK92 and NK92 exerted extent by IL4. In contrast, NK92CIRB proliferation was not signif- substantial cytotoxicity of about 60% and 50%, respectively. icantly affected by TGFb1 or IL4 and was weakly inhibited by Trastuzumab alone at 1 mg/mL did not affect BT474 survival dexamethasone (Fig. 3B). significantly. Similarly, NK92 did not provoke any significant The effects of TGFb1 (20 ng/mL), and dexamethasone cytotoxicity against BT474 in the presence of trastuzumab. (0.5 mmol/L) pretreatments for 24 hours on NK-cell cytotoxicity were then evaluated against five cancer cell lines at an E:T Activation and expression profiles of cytotoxicity effectors in ratio of 2:1 (Fig. 3C). NK cells affected more killing in these NK92, NK92IL2, and NK92CIRB experimental conditions as cancer cells were added to already Stat 5 phosphorylation, a downstream signaling associated plated NK92 cells and are more vulnerable if not already with IL2 receptor activation, was nearly identical between IL2- attached. In addition, NK92 cells were plated with IL2 in the stimulated NK92 (100 IU/mL) and NK92CIRB and modestly media(20IU/mL)andarethereforemoreactivethaninother higher by 17% in NK92IL2, suggesting an equivalency in activation experiments. NK92CIRB cytotoxicity against MDA-MB-231, PC- signaling (Fig. 5A). However, qRT-PCR analysis (Fig. 5B) of 3, and HepG2 was not affected. Dexamethasone severely re- NK92CIRB revealed differences in the expression of natural cyto- duced cytotoxicity of NK92IL2 toward all cancer cell lines. Simi- toxicity receptors NKP30 (1.7-fold), NKP44 (9-fold), and NKP46 larly, TGFb1significantly reduced NK92IL2 cytotoxicity against (1.4-fold) compared with NK92IL2 and NK92 stimulated with IL2 most cancer cell lines except for MDA-MB-231 and HepG2. for 48 hours. In NK92IL2, NKP44 expression also increased (3.3- Surprisingly, NK92 cells also showed resistance to dexameth- fold). While perforin-1 expression was similar in all cell lines, asone inhibition in MDA-MB-231 and HepG2, probably due to granzyme-B expression declined and TNFa increased in NK92IL2

5942 Cancer Res; 77(21) November 1, 2017 Cancer Research

Downloaded from cancerres.aacrjournals.org on September 28, 2021. © 2017 American Association for Cancer Research. Downloaded from www.aacrjournals.org NK92 yoer hw h ako orlto ewe h xrsino HLA-A2 of expression the between correlation of lack the shows cytometry loo xrcinasy aaaepeetda elnme eaiet Kcell NK to relative number cell as presented are Data assay. extraction alcohol yooiiyo Kcl lines. NK-cell of Cytotoxicity 2. Figure el.Clswr ltd2 or ro oadn Kcl ie tETrtoo :.Wiein While 2:1. of ratio E:T at lines NK92 NK-cell of adding ratios to E:T prior increasing hours to 24 exposure plated were Cells cells. ﬂ ro occlue nrae : aiso Kc NK of ratios E:T Increased coculture. to prior oecnerae MlclrDvcs ihectto t45n n msina 1 nm. 515 at emission and nm 485 at excitation with Devices) (Molecular reader uorescence CIRB

eotdi i.3C. Fig. in reported D C A

Cells survival % of control Cells survival % of control100 Cells survival % of control 50 100 20 40 60 80 0 0

UT 100 120 0:1 20 40 60 80 0 cancerres.aacrjournals.org NK92 Published OnlineFirstSeptember15,2017;DOI:10.1158/0008-5472.CAN-17-1007 E:T Ratio

NK92 NK Cells:U266GFP ratio : : : : : 2:1 1:1 1:2 1:4 1:8 0:1 : 2:1 1:1 U251

NK92 IL2 U251 A, C,

CIRB yooiiyasy fNK92 of assays Cytotoxicity yooiiyasyaantapnlof panel a against assay Cytotoxicity 3:1

100 50 100 0 20 40 60 80 IL2 0 UT NK92 NK92 NK92 : : 2:1 1:1 0:1 ( MDA-MB-231 *

lsidcdmr 26F eldah 26F ce U266GFP death. cell U266GFP more induced ells NK92 E:T Ratio )orNK92 MDA-MB-231 NK92 CIRB IL2

CIRB CIRB

IL2 3:1 ,NK92 (

el.Rmiigclsatrti iew time this after cells Remaining cells. &) 100 100 50 20 40 60 80 0 0 Cell count (% of Max) 100 CIRB 100 20 40 60 80 B 20 40 60 80 UT 0 0 0:1 ﬁ ehmncne ellns 21M PC U251GM, lines: cell cancer human ve n K2cl ie gis utpemeoaU6GPclspae 4hours 24 plated cells U266GFP myeloma multiple against lines cell NK92 and , NK92 010 010 E:T Ratio PC-3

: 2:1 1:1 NK92 2 2 nalcne ellnsue n hi ereo estvt oNK92 to sensitivity of degree their and used lines cell cancer all in Panc-1 PC-3

– NK92 IL2 10 U251 10 recnrl;mean controls; free 3 3

CIRB 10 10

3:1 4 4 nacdAtvto n xaso fNtrlKle Cells Killer Natural of Expansion and Activation Enhanced 10 10 D, Negative HLA-A2 Antibody 100 5 5 50 100 B, 100 100 20 40 60 80 0 acrclswr ltdol or ro to prior hours 5 only plated were cells cancer 20 40 60 80 20 40 60 80 0 0 0

sn nihmnHAA-P antibody HLA-A2-APC anti-human Using UT 0:1 010 NK92 010 MDA-MB-231 NK92 E:T Ratio lsria a vlae sn pcrMxM2 SpectraMax a using evaluated was survival ll Panc-1 HLA-A2 2 NK92 2 : 2:1 1:1 Panc-1 HepG2 Evle o rpiaesamples. triplicate for values SE

10 NK92 IL2 10 3 3 IL2 r eemnduigaCytlviolet/ Crystal a using determined ere CIRB 10 10 4 4 3:1 acrRs 72)Nvme ,2017 1, November 77(21) Res; Cancer 3 ac1 D-B21 n HepG2 and MDA-MB-231, Panc-1, -3, 10 10 5 5 100 50 100 20 40 60 80 0 100 20 40 60 80 0 UT 0 : : : 3:1 2:1 1:1 0:1

NK92 010 NK92

E:T Ratio HepG2 NK92 HepG2 2 NK92

IL2 10 PC-3 CIRB 3 CIRB 10 4 ﬂ 10 ow 5 IL2 or 5943 Published OnlineFirst September 15, 2017; DOI: 10.1158/0008-5472.CAN-17-1007

Jounaidi et al.

A B NS UT UT β 3 β TGF 1 10 ng/mL

) TGF 1 10 ng/mL

) 3

5 IL4 10 ng/mL IL4 10 ng/mL 5 Dex 1 μmol/L Dex 1 μmol/L 2 NS * 2 *

1 * 1

*** Live cell counts (10 0 Live cell counts (10 0 NK92IL2 NK92CIRB C TGFβ1 (20 ng/mL ), Dex (0.5 μmol/L ) No drug (UT )

U251 MDA-MB-231 PC-3 Panc-1120 HepG2 140 100 100 100 100 120 80 80 100 80 80 80 60 60 60 60 60 40 40 40 40 40 20 20 20 20 20 0 0 0 0 0

IL2 IL2 IL2 IL2 IL2 RB UT CIRB UT CIRB UT CIRB UT CIRB UT CI NK92 NK92 NK92 NK92 NK92 NK92 NK92 NK92 NK92 NK92 NK92 NK92 NK92 NK92 NK92 Cells survival % of control

CIRB IL2 D NK92 NK92 Untreated DTxe GFβ1 xeD TGFβ1 TGFβ1 10 ng/mL or Dex 1 μmol/L 100

60 NKP30

0 100

60 NKP44

0 100

Cell count (% of Max) 60 NKP46

0 250K

200K 150K Annexin V 100K

50K FSC-H 0 2 3 4 5 2 3 4 5 010 10 10 10 010 10 10 10 0102 103 104 105 0102 103 104 105

Figure 3. Impact of TGFb1, IL4, and dexamethasone on NK cells. A total of 6.4 104 NK92IL2 (A)andNK92CIRB cells were plated with TGFb1 (10 ng/mL), IL4 (10 ng/mL), or dexamethasone (1 mmol/L) for 6 days of growth (B). Viable cells were counted using Trypan blue exclusion assay. Data are presented as live cell count (105 cells/mL); mean SE values for triplicate samples. NS, nonsigniﬁcant. C, NK92, NK92IL2,andNK92CIRB cell lines exposed for 24 hours to TGFb1 (&, 20 ng/mL), dexamethasone (~,0.5mmol/L), or no drug (*, UT). NK92 cells were incubated with IL2 at 20 IU/mL. Cancer cells (3.2 104 cells) were then added to NK cells at E:T ratio of 2:1 and then incubated for 4 days. Cancer cells viability was determined using a Crystal violet extraction assay. Data are presented as mean percentage cell number relative to NK cell–free controls (UT). D, Natural cytotoxicity receptors and AnnexinV expression in NK92IL2 and NK92CIRB treated with dexamethasone (1 mmol/L) or TGFb1(10ng/mL).

5944 Cancer Res; 77(21) November 1, 2017 Cancer Research

Enhanced Activation and Expansion of Natural Killer Cells

A B NK92 NK92-MI IL2 CIRB NK92 NK92 NK92 100 100 100 100

80 80 80 80

60 60 60 60 40 40 40

20 20 20 40

0 0 0 2 3 4 5 2 3 4 5 2 3 4 5 010 10 10 10 010 10 10 10 010 10 10 10 20 CD56 CD16 NK2GD Cell count (% of Max) 100 100 100 0 2 3 4 5 80 80 80 010 10 10 10

60 60 60 CD16 Cell count (% of Max) 40 40 40 C 20 20 20 100 NK92 0 0 0 2 3 4 5 2 3 4 5 2 3 4 5 100 IU 010 10 10 10 010 10 10 10 010 10 10 10 80 NK92+IL2 CD3 CD25 CD45 NK92+IL2 1,000 IU D 60 NK92+IL2G 100 IU NK92 NK92IL2 NK92CIRB hNK NK92+IL2G 1,000 IU 40 100 100 100

80 80 80 20 60 60 60 Cell count (% of Max) 40 40 40 0 2 3 4 5 20 20 20 010 10 10 10

0 0 0 CD16 2 3 4 5 2 3 4 5 010 10 10 10 010 10 10 10 0102 103 104 105 Cell count (% of Max) CD16 NK2GD CD25 E IL2 CIRB 120 BT474 NK92 NK92 NK92 * 100 *

BT474 Cancer cells’ survival (%) 0 No mAb Trastuzumab

Figure 4. NK92, NK92IL2,andNK92CIRB cell lines phenotype. A, Flow cytometry shows the increased cell surface density of CD16 in NK92IL2 and NK92CIRB and the low expression of CD25 in NK92CIRB. B, Flow cytometry conﬁrms the lack of expression of CD16 in NK92 and NK92-MI cell lines. C, The lack of expression of CD16 in NK92 activated with 100 or 1,000 IU/mL of glycosylated (IL2G) and nonglycosylated IL2. D, Human primary NK cell (hNK) phenotypic expression of NKG2D, CD25, and CD16 in comparison with NK92, NK92IL2,andNK92CIRB. E, Direct cytotoxicity and ADCC activity mediated by effector NK92, NK92IL2,andNK92CIRB cells against HER2-positive BT474 cell line at E:T ratio of 2:1 when incubated with trastuzumab (1 mg/mL). Data are presented as cell number percentage relative to NK cell–free controls, mean SE values for triplicate samples. Statistical differences were determined by one-way ANOVA test (, P < 0.05).

www.aacrjournals.org Cancer Res; 77(21) November 1, 2017 5945

Jounaidi et al.

B 9 **** 8 4 **** CIRB A IL2 MW 3 Kda NK92 NK92 NK92 NK92 NK92IL2 NK92CIRB 170 130 2 95 *** *** * * ** 1 * Figure 5. *** Natural cytotoxicity receptors and 0 effectors in NK-cell lines. A, Stat 5 phosphorylation is equivalent in NK92 6 and NK92CIRB cells and higher by 17%

RNA Fold expression relative to NK92 α IFNγ IL2 C NKP30 NKP44 NKP4 PRF-1 GzmB TNF in NK92 as determined by ImageJ software. B, Gene expression proﬁles 100 100 100 Neg of NKP30, NKP44, NKP46, granzyme- 80 80 80 NK92 B, perforin-1, TNFa, and IFNg in NK 60 60 60 NK92IL2 cells lines determined by qRT-PCR. 40 40 40 NK92CIRB Primers sequences are listed in Supplementary Table S1. Results were 20 20 20 analyzed using comparative Ct (DDCt) 0 0 0 2 3 4 5 2 3 4 5 0102 103 104 105 010 10 10 10 010 10 10 10 method and are presented as RNA Cell count (% of Max) Cell count (% of Max) NKP30 NKP44 NKP46 folds relative to NK92 after D normalization to the GAPDH RNA 100 100 100 100 content of each sample. Data are presented as mean SE values for 80 80 80 80 triplicate samples. Two-tailed t test 60 60 60 60 analysis was used to evaluate 40 40 40 40 statistical differences. Surface ﬂ 20 20 20 20 expression by ow cytometry of NKP30, NKP44, and NKP46 (C)and 0 0 0 0 2 3 4 5 2 3 4 5 0102 103 104 105 0102 103 104 105 010 10 10 10 010 10 10 10 granzyme-B, perforin-1, TNFa, and

Cell count (% of Max) Cell count (% of Max) P Perforin-1 Granzyme-B TNFα IFNγ IFNg (D). E, Statistical Median values derived from data in C and D E F % Proteins increase between cell lines using FlowJo statistical module for 3 105 cells analyzed. F, Visualization NK92CIRB/NK92 NK92IL2/NK92 NK92CIRB/NK92IL2 9 NK92 NK92IL2 NK92CIRB of the percentage increase of markers 8 expression between NK cell line pairs. 4

0 NKP30 NKP44 PRF1

4 1

Protein fold expression to NK92 α IFNγ NKP30NKP4 NKP46 PRF- GzmB TNF

and both declined marginally while IFNg increased in NK92CIRB. dering these cells less potent against cancer cells (Fig. 3D). There- We sought to validate these data by investigating the protein fore, we deduce that NKP30, NKP44, and perforin-1 are distin- expression of NK receptors (Fig. 5C) and effectors (Fig. 5D) by guishing features of NK92CIRB from NK92 and NK92IL2. ﬂow cytometry. A robust FlowJo statistic module revealed striking IL2 CIRB correlationsP between the RNA levels seen in Fig. 5B and the In vivo detection of circulating NK92 and NK92 cells histograms' median protein expression calculated in Fig. 5E. The survival and systemic circulation of nonirradiated NK92IL2 To further delineate the major contributor(s) to NK-cell lines' and NK92CIRBin vivo were evaluated in the context of U251MG cytotoxicity against cancer cells, we determined the excess ratio of tumor-bearing animals. Figure 6A shows that within 24 hours of each protein between cell line pairs. Figure 5F shows that NKP44 the ﬁrst injection of live NK92CIRB cells, rapid tumor volume and NKP30 are the main differentiators between NK92IL2 and regression of 46% was observed, while NK92IL2 cells caused 35% NK92 with an excess of 202% and 24% respectively. In NK92CIRB, reduction. In contrast, tumors continued to grow in untreated this excess over NK92 is 303% and 61%. However, an excess of animals to reach a maximal limit size nearing 200 mm3 before perforin-1 (21%) makes NK92CIRB far more potent than NK92IL2. regressing. This size-dependent limited growth is due to the poor Indeed, a direct comparison of NK92IL2 and NK92CIRB shows the angiogenesis of these tumors, which can be improved by VEGF latter to contain about 30% more of NKP30, 34% of NKP44, and expression (27). Tumor regression for NK92CIRB-treated group 28% of perforin-1. We also note that NKP30 expression was continued after the second injection while the tumors in NK92IL2- downregulated by dexamethasone and TGFb1 in NK92IL2 ren- treated animals resumed growth and did not respond until day 18.

5946 Cancer Res; 77(21) November 1, 2017 Cancer Research

Enhanced Activation and Expansion of Natural Killer Cells

B Figure 6. A 105 250 CIRB UT NK92IL2 and NK92CIRB cells' evaluation in UT NK92IL2 NK92 104 vivo. A, When U251 tumor volume ) 3 reached approximately 160 mm3, 200 103 nonirradiated NK92IL2, and NK92CIRB CD45 7 cells (10 cells in 200 mL per mouse) were 102 injected into mice (arrows) via the tail 150 0 vein. A second injection of nonirradiated 2 3 4 5 010 10 10 10 NK cells (5 106 cells) was carried out 105 NK92IL2 4 days later. Tumor sizes were monitored 100 until 31 days after tumor implantation. u mor volume (mm 104 T ns

B, Seventeen days after the last NK cell M 103 G ﬁ CD45 injection, animals were sacri ced, and 1 50 5

blood was collected from three animals 2 2 ** 10 in each group. Blood samples (0.5 mL) U 0 were processed and analyzed by flow 0 0102 103 104 10 5 cytometry using human-specific marker 0 2 4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 5 CIRB CD45 and the mCherry fluorescence 10 NK92 Days post inocculation marker, which is coexpressed with IL2 or 104 CIRB in NK92IL2 and NK92CIRB, CIRB C 103 respectively. NK92 cells detected CD45

(circled). C, Cell survival of NK cells 100 2 in vitro 10 irradiated at 10 Gy (0.83 Gy for 0 CIRB 12 minutes) and then plated in complete NK92 IR 80 IL2 0102 103 104 105 NK92 media was determined using NK92 IR mCherry Trypan blue exclusion every 24 hours. CIRB * D The survival advantage of NK92 cells 60 2 ﬁ was statistically signi cant at days 1 and 2 UT (one-way ANOVA test, , P 0.05). < 40 * D, Antitumor efﬁcacy of irradiated NK92IL2 **

IL2 CIRB ) * ** NK92 and NK92 cells in vivo 3 1.5 against PC-3 tumors grown in 5-week- 20 NK92CIRB old male Nod/Scid mice. When tumor 3 size reached approximately 200 mm , 0 NK cells were irradiated with 500 cGy Irradiated NK cells’ survival (%) 0123 1 and were administered as four weekly Days post irradiation injections of 1.5 107 cells in 200 mLper

mouse via the tail vein (arrows). After the u mor volume (cm

CIRB T last NK92 cells' injection, a signiﬁcant 3 - 0.5

tumor growth delay of 17 days was C recorded (, P < 0.01), comparatively to P the untreated group. NK92IL2-treated group tumors produced a tumor delay of only 7 days (, P < 0.05). Statistical 0 0 7 14 21 28 35 42 49 56 differences were determined using one-way ANOVA test. Days post inocculation

Three weeks later, the untreated and NK92IL2 groups showed a Antitumor efficacy of irradiated NK92IL2 and NK92CIRB cells similar tumor size. In comparison, the NK92CIRB-treated group Androgen receptor and PSA-negative PC-3 cells (28) form displayed a significant tumor volume reduction of 86%. Seven- very aggressive tumors in Nod/Scid mice. When tumor volumes teen days after NK-cell injections, blood from mice was analyzed reached approximately 200 mm3 (day 28), irradiated NK cells by flow cytometry for cells expressing mCherry and human (500 cGy) were administered as 4 weekly injections via the tail CD45. Figure 6B shows that only NK cells expressing CIRB, but vein. Figure 6D shows that the growth of PC-3 tumors in the not IL2, can persist in tumor-bearing animals. NK92CIRB-treated group was slowed after the first injection. After the last NK92CIRB injection, a significant tumor growth delay of about 17 days was recorded in the period between Survival of irradiated NK92IL2 and NK92CIRB cells first and fourth NK92CIRB injections (, P < 0.01), compara- FDA requires NK92 cell irradiation between 5 and 10 Gy prior tively to the untreated group. In contrast, the NK92IL2-treated to infusion to prevent proliferation. The irradiated NK92 cells' group tumors produced only a tumor delay of 7 days from the viability declines dramatically within 2 days. NK92IL2 and untreated tumor group (, P < 0.05). NK92CIRBwere irradiated at 10 Gy (0.83 Gy for 12 minutes) and then plated in complete NK92 media to determine their survival NK92CIRB cell activation by direct contact with cancer cells using Trypan blue every 24 hours. Figure 6C shows that 24 hours To better understand the events occurring during NK92CIRB postirradiation, 57% of NK92CIRB and 45% of NK92IL2 cells andNK92IL2 contact with cancer cells, NK cells were cocultured survive. The survival advantage of NK92CIRB was statistically with PC-3 cells for 3 hours, after which, their expression profiles significant at days 1 and 2 (, P < 0.05). for NKP30, NKP44, NKP46 (Fig. 7A), perforin-1, granzyme-B,

www.aacrjournals.org Cancer Res; 77(21) November 1, 2017 5947

Jounaidi et al.

A NKP30 NKP44 NKP46 Neg 100 100 100 IL2 80 80 80 NK92

60 60 60 No exposure NK92CIRB 40 40 40

20 20 20

0 0 0 2 3 4 5 2 3 4 5 010 10 10 10 010 10 10 10 0102 103 104 105

100 100 100

80 80 80

60 60 60 Cell count (% of Max) Exposure to PC-3 Figure 7. 40 40 40 NK92CIRB and NK92IL2 cells' 20 20 20 activation by direct contact with PC-

0 0 0 3 cancer cells. NK cells and PC-3 cells 2 3 4 5 2 3 4 5 2 3 4 5 010 10 10 10 010 10 10 10 010 10 10 10 were cocultured for a duration of 3 hours, after which, their expression B Perforin-1 Granzyme-B TNFα IFNγ proﬁles of NKP30, NKP44, NKP46 100 100 100 100 (A) and perforin-1, granzyme-B,

80 80 80 80 TNFa, and IFNg (B) were compared with NK cells grown alone. C, 60 60 P 60 60 No exposure Median expression of histograms 40 40 40 40 by FlowJo software of the data in A,

20 20 20 20 B, and Supplementary Table S2. Data show the reduction in surface 0 0 0 0 2 3 4 5 2 3 4 5 0102 103 104 105 0102 103 104 105 010 10 10 10 010 10 10 10 expression for NKP30, NKP44, and IL2 100 100 100 100 NKP46. In NK92 , perforin-1,

80 80 80 80 granzyme-B, TNFa, and IFNg decreased, suggesting release while 60 60 60 60 CIRB Exposure to PC-3 they increased in NK92 (36%, 21% 40 40 40 40 Cell count (% of Max) Cell count (% of Max) and 16%, respectively), implying 20 20 20 20 replenishment of these effectors.

0 0 0 0 After 3 hours of contact with cancer 2 3 4 5 2 3 4 5 010 10 10 10 0102 103 104 105 010 10 10 10 0102 103 104 105 cells, NK92CIRB cells still retained a distinct advantage by harboring all C receptors and effectors in excess IL2 40 over NK92 (Supplementary IL2 NK92 Table S2). NK92CIRB 20

-20 ∑Median change (%)

-40 NKP30 NKP44 NKP46 Perf-1 gzmB TNFα IFNγ

IL2 TNFa and IFNg (Fig. 7B), were compared with those inP NK cells tively, but only by 7% and 11% in NK92 . This reduction in grown alone. A robust statistical analysis of histograms Median surface markers upon contact with cancer cells suggests receptor expression using FlowJo software revealed striking differences in internalization that occurs upon their activation by ligands on activation between NK92IL2 andNK92CIRB (Fig. 7C; Supplemen- cancer cells. The overexpression of NKP30 and NKP44 on tary Table S2). While both cell lines have within 3 hours dis- NK92CIRB compared with NK92IL2 could drive a stronger activa- charged 17.5% of their perforin-1 content into PC-3 cells, gran- tion that would explain granzyme-B, TNFa, and IFNg high levels zyme-B, TNFa and IFNg, were reduced in NK92IL2, suggesting compared with NK92IL2. After 3 hours of contact with cancer cells, release, while they increased in NK92CIRB by 36%, 21%, and 16%, NK92CIRB cells still harbored all receptors and effectors in excess respectively. As NK92CIRB released perforin-1 and because gran- over NK92IL2 (Supplementary Table S2). zyme-B is codelivered with perforin-1 (29), this increase suggests replenishment of these effectors, which are usually released within minutes of contact with cancer cells. NKP46 remained Discussion unchanged in NK92CIRB, whereas surface expression of NKP30 IL2 can bind to receptor IL2Ra (CD25) with low afﬁnity (30), and NKP44 were dramatically reduced by 23% and 18%, respec- or with an intermediary afﬁnity to IL2Rb (CD122) when

5948 Cancer Res; 77(21) November 1, 2017 Cancer Research

Enhanced Activation and Expansion of Natural Killer Cells

associated with the common IL2Rg chain (CD132; refs. 31, 32). Furthermore, upon contact with PC-3 cancer cells, NK92CIRB However, this binding affinity is higher when all three receptors cells experienced an increase in granzyme-B, TNFa, and IFNg, are combined (33). Adult NK cells may express only IL2Rb and whereas NKP30, NKP44, and perforin-1 contents decreased, IL2Rg subunits (34) and are, therefore, relatively insensitive to suggesting activation and internalization of these receptors with low doses of IL2, but acquire sensitivity upon IL2Ra expression release of perforin-1. These features might explain the superior (35). A recently developed IL2 "superkine" (36) that bypasses anticancer effect of NK92CIRBin vivo. We note that NKP30 was IL2Ra by binding directly and with high affinity to IL2Rb pro- downregulated in NK92IL2 treated with dexamethasone and duced better antitumor effects than wild-type IL2 in mice. How- TGFb1 (Fig. 3D), which led to a reduced anticancer activity (Fig. ever, it still causes some form of pulmonary edema. 3C). This could suggest a prominent role for NKP30 in NK92CIRB We created a novel chimera CIRB made of IL2 and its where it is overexpressed and might offer resistance against the receptor IL2Rb , joined by a peptide linker derived from the action of dexamethasone and TGFb1. extracellular domain of IL2Ra. The linker was computationally Genetic modifications introducing CD16 in NK cells were determined as reasonably flexible, without adversely affecting shown to increase NK-cell–mediated ADCC against multiple the chimera stability, which is generally inversely correlated myeloma when combined with elotuzumab (45). CD16 induc- to flexibility (37). CIRB induces indefinite cell expansion and tion only in NK92CIRB and NK92IL2, but not in NK92-MI or NK92 conferred an in vitro cytotoxicitysimilarorhigherthanthat stimulated with IL2, could be explained by the persistent IL2 elicited by IL2 expression. In vivo, the anticancer activity of signaling that somehow translates into stronger activation and NK92CIRB against solid tumors was superior to that elicited by growth of NK92CIRB and NK92IL2. In fact, the growth rates of both NK92IL2. In addition, CIRB confers, in contrast to IL2, sub- NK92CIRB and NK92IL2 were 2-fold that of NK92-MI (Supple- stantial resilience to TGFb1, dexamethasone, and IL4. This mentary Fig. S2). Another indication of higher activation of advantage could be crucial in the TME where TGFb1issecreted NK92CIRB and NK92IL2 is the dramatic induction of NKP44, by a variety of cells including cancer-associated fibroblasts compared with NK92 stimulated with IL2 for 48 hours. In (38), and exists in a membrane-bound form on Tregs to addition, NK92CIRB can proliferate in vivo far longer and also have induce NK cells' anergy (39), or by MDSCs to inhibit NKG2D a better survival after irradiation than NK92IL2 cells. They also expression, and IFNg production in NK cells (40). Cancer cells surpass that of NK92-MI when exposed to similar conditions (20). also regularly shed tumor-derived exosomes containing mem- In vitro, NK92IL2 cells secrete sufficient IL2 to sustain their acti- brane-bound TGFb1 that downregulate NKG2D (41), and vation and proliferation. In vivo, however, they may not be able to inhibit IL2 signaling (42). TGFb1 mediates NK inhibition by produce enough IL2 extracellular concentrations to sustain pro- an induced miR-183 that represses the coactivator/adapter liferation. This could be compounded by the competition for IL2 DAP12 expression, thus destabilizing several activation signals by Tregs and other immune cells in an immunocompetent inNKcells(23).CIRBexpressioninNK92CIRB cells also animal. provides resistance to dexamethasone, whereas NK92IL2 cells' Many encouraging advances have been achieved in NK-cell– growth was halted. Dexamethasone impairs the function of directed immunotherapy (46). However, the increasing lymphocytes in part by suppressing IL2 production from demand for NK cells' expansion ex vivo requires both highly þ CD4 T cells, and reducing the activation receptors NKG2D activated cells and reduced costs of cell expansion. Cellular and Nkp46 in NK cells (24). Glucocorticoid hormones can immunotherapy using donor NK cells is an emerging field interfere with macrophage activation and antigen presenta- that could achieve significant anticancer effects, safely and tion, and repress the transcription of several proinflammatory without the risk of inducing graft-versus-host disease. This cytokines, chemokines, cell adhesion molecules, and enzymes safety feature as well as the off-tumor/on-target toxicity are involved in the inflammatory response (43). The extreme currently hindering the success of CAR-T technology (47). sensitivity of NK92IL2 to dexamethasone, could be explained Several NK-cell lines (Khyg-1, NKL, NKG, NK-YS, YT, YTS, by the reported destabilization of IL2 RNA (44), which could and HANK-1 cells) are currently used in preclinical studies. potentially occur in NK92IL2 but not when IL2 is fused with However, only NK92 was extensively evaluated for its safety IL2Rb RNA as in NK92CIRB. and efficacy in clinical settings (48, 49). Unlike primary hNK CIRB, and to a lesser degree the stable expression of IL2, cells, NK92 cells constitute a stable and homogenous popu- allowed substantial CD16 expression in NK92. However, lation, amenable to genetic modification by lentiviruses, a exogenous recombinant IL2 was not able to mediate such gene transfer platform that has shown a good safety profile for expression. Similarly, NK92-MI, which produces and secretes lymphocytes (50). Our novel strategy of fusing interleukins to IL2, was found deficient in CD16, as reported previously (20). their receptors is a novel platform that can achieve a far better When combined with trastuzumab CD16 expression further cytokine activation, with specificity, and without systemic enhanced NK92CIRB andNK92IL2 cytotoxicity by ADCC. Inter- toxicity or competition by other cellular components of the estingly, CD25 expression declined dramatically in NK92CIRB immune system. Self-activation of NK cells provides several (Fig. 4A). This unique phenotype of substantial CD16 and low distinguishing features, such as resilience to TGFb1orgluco- CD25 expression can synergize with the ADCC-mediated corticoid hormones, substantial expression of CD16, higher action of approved therapeutic antibodies. CIRB induced survival after irradiation, and a superior antitumor activity in substantial RNA expression of NKP44 (9-fold), NKP46 (1.4- vivo.Thisnewcytokine–cytokine receptor platform may be fold), and NKP30 (1.7-fold) as well as a modest but signif- further improved to enhance NK cells' anticancer and possibly icant increase in IFNg. As expected, CIRB induced protein antiviral activity. expression increase for NKP44 (4-fold) and NKP30 (1.6-fold). Finally, perforin-1 expression increased slightly by 21% in Disclosure of Potential Conflicts of Interest NK92CIRB. No potential conflicts of interest were disclosed.

www.aacrjournals.org Cancer Res; 77(21) November 1, 2017 5949

Jounaidi et al.

Authors' Contributions Myeloma, Massachusetts General Hospital Cancer Center for her very helpful Conception and design: Y. Jounaidi, J.F. Cotton, K.W. Miller, S.A. Forman advice and suggestions. Development of methodology: Y. Jounaidi, J.F. Cotton, S.A. Forman Acquisition of data (provided animals, acquired and managed patients, provided facilities, etc.): Y. Jounaidi, J.F. Cotten Grant Support Analysis and interpretation of data (e.g., statistical analysis, biostatistics, This work was supported in part by a DAPPCM Innovation Grant 226026 (to computational analysis): Y. Jounaidi, S.A. Forman Y. Jounaidi), NIH grant GM089745 (to S.A. Forman), and NIH grants Writing, review, and/or revision of the manuscript: Y. Jounaidi, J.F. Cotton, GM058448 (to K.W. Miller) and HL117871 (to J.F. Cotten). K.W. Miller, S.A. Forman The costs of publication of this article were defrayed in part by the Administrative, technical, or material support (i.e., reporting or organizing payment of page charges. This article must therefore be hereby marked data, constructing databases): Y. Jounaidi advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate Study supervision: Y. Jounaidi this fact. Acknowledgments The authors wish to thank Dr. Rooma Desai of this laboratory for helpful Received April 5, 2017; revised August 1, 2017; accepted September 8, 2017; comments and suggestions and Prof. Raje Nopoor from the Center for Multiple published OnlineFirst September 15, 2017.

References 1. Caligiuri MA. Human natural killer cells. Blood 2008;112:461–9. 18. Mao Y, Sarhan D, Steven A, Seliger B, Kiessling R, Lundqvist A. Inhibition of 2. Vidal SM, Khakoo SI, Biron CA. Natural killer cell responses during viral tumor-derived prostaglandin-e2 blocks the induction of myeloid-derived infections: flexibility and conditioning of innate immunity by experience. suppressor cells and recovers natural killer cell activity. Clin Cancer Res Curr Opin Virol 2011;1:497–512. 2014;20:4096–106. 3. Orr MT, Lanier LL. Natural killer cell education and tolerance. Cell 2010; 19. Bluestone JA, Abbas AK. Natural versus adaptive regulatory T cells. Nat Rev 142:847–56. Immunol 2003;3:253–7. 4. Malek TR. The biology of interleukin-2. Annu Rev Immunol 2008; 20. Tam YK, Maki G, Miyagawa B, Hennemann B, Tonn T, Klingemann HG. 26:453–79. Characterization of genetically altered, interleukin 2-independent natural 5. Dahlberg CI, Sarhan D, Chrobok M, Duru AD, Alici E. Natural killer cell- killer cell lines suitable for adoptive cellular immunotherapy. Hum Gene based therapies targeting cancer: possible strategies to gain and sustain anti- Ther 1999;10:1359–73. tumor activity. Front Immunol 2015;6:605. 21. Rickert M, Wang X, Boulanger MJ, Goriatcheva N, Garcia KC. The structure 6. Maas RA, Dullens HF, Den Otter W. Interleukin-2 in cancer treatment: of interleukin-2 complexed with its alpha receptor. Science 2005;308: disappointing or (still) promising? A review. Cancer Immunol Immun- 1477–80. other 1993;36:141–8. 22. Vihinen M, Torkkila E, Riikonen P. Accuracy of protein flexibility predic- 7. Glauser FL, DeBlois G, Bechard D, Fowler AA, Merchant R, Fairman RP. tions. Proteins 1994;19:141–9. Cardiopulmonary toxicity of adoptive immunotherapy. Am J Med Sci 23. Donatelli SS, Zhou JM, Gilvary DL, Eksioglu EA, Chen X, Cress WD, et al. 1988;296:406–12. TGF-beta-inducible microRNA-183 silences tumor-associated natural 8. Ardizzoni A, Bonavia M, Viale M, Baldini E, Mereu C, Verna A, et al. Biologic killer cells. Proc Natl Acad Sci U S A 2014;111:4203–8. and clinical effects of continuous infusion interleukin-2 in patients with 24. Hsu AK, Quach H, Tai T, Prince HM, Harrison SJ, Trapani JA, et al. The non-small cell lung cancer. Cancer 1994;73:1353–60. immunostimulatory effect of lenalidomide on NK-cell function is pro- 9. Donohue JH, Rosenberg SA. The fate of interleukin-2 after in vivo admin- foundly inhibited by concurrent dexamethasone therapy. Blood 2011; istration. J Immunol 1983;130:2203–8. 117:1605–13. 10. Shevach EM. Regulatory T cells in autoimmmunity. Annu Rev Immunol 25. Nagler A, Lanier LL, Phillips JH. The effects of IL-4 on human natural killer 2000;18:423–49. cells. A potent regulator of IL-2 activation and proliferation. J Immunol 11. Parkhurst MR, Riley JP, Dudley ME, Rosenberg SA. Adoptive transfer of 1988;141:2349–51. autologous natural killer cells leads to high levels of circulating natural 26. Gong JH, Maki G, Klingemann HG. Characterization of a human cell line killer cells but does not mediate tumor regression. Clin Cancer Res (NK-92) with phenotypical and functional characteristics of activated 2011;17:6287–97. natural killer cells. Leukemia 1994;8:652–8. 12. Rubnitz JE, Inaba H, Ribeiro RC, Pounds S, Rooney B, Bell T, et al. NKAML: 27. Ke LD, Shi YX, Yung WK. VEGF(121), VEGF(165) overexpression enhances a pilot study to determine the safety and feasibility of haploidentical tumorigenicity in U251 MG but not in NG-1 glioma cells. Cancer Res natural killer cell transplantation in childhood acute myeloid leukemia. 2002;62:1854–61. J Clin Oncol 2010;28:955–9. 28. Kaighn ME, Narayan KS, Ohnuki Y, Lechner JF, Jones LW. Establishment 13. Vales-Gomez M, Reyburn HT, Mandelboim M, Strominger JL. Kinetics of and characterization of a human prostatic carcinoma cell line (PC-3). interaction of HLA-C ligands with natural killer cell inhibitory receptors. Invest Urol 1979;17:16–23. Immunity 1998;9:337–44. 29. Lopez JA, Susanto O, Jenkins MR, Lukoyanova N, Sutton VR, Law RH, et al. 14. Miller JS, Soignier Y, Panoskaltsis-Mortari A, McNearney SA, Yun GH, Perforin forms transient pores on the target cell plasma membrane to Fautsch SK, et al. Successful adoptive transfer and in vivo expansion of facilitate rapid access of granzymes during killer cell attack. Blood 2013; human haploidentical NK cells in patients with cancer. Blood 2005;105: 121:2659–68. 3051–7. 30. Leonard WJ, Depper JM, Crabtree GR, Rudikoff S, Pumphrey J, Robb RJ, 15. Geller MA, Cooley S, Judson PL, Ghebre R, Carson LF, Argenta PA, et al. Molecular cloning and expression of cDNAs for the human interleu- et al. A phase II study of allogeneic natural killer cell therapy to treat kin-2 receptor. Nature 1984;311:626–31. patients with recurrent ovarian and breast cancer. Cytotherapy 31. Hatakeyama M, Tsudo M, Minamoto S, Kono T, Doi T, Miyata T, et al. 2011;13:98–107. Interleukin-2 receptor beta chain gene: generation of three receptor 16. Nagashima S, Mailliard R, Kashii Y, Reichert TE, Herberman RB, Robbins P, forms by cloned human alpha and beta chain cDNA's. Science 1989; et al. Stable transduction of the interleukin-2 gene into human natural 244:551–6. killer cell lines and their phenotypic and functional characterization in 32. Takeshita T, Asao H, Ohtani K, Ishii N, Kumaki S, Tanaka N, et al. Cloning vitro and in vivo. Blood 1998;91:3850–61. of the gamma chain of the human IL-2 receptor. Science 1992;257:379–82. 17. Konstantinidis KV, Alici E, Aints A, Christensson B, Ljunggren HG, Dilber 33. Stauber DJ, Debler EW, Horton PA, Smith KA, Wilson IA. Crystal structure MS. Targeting IL-2 to the endoplasmic reticulum confines autocrine of the IL-2 signaling complex: paradigm for a heterotrimeric cytokine growth stimulation to NK-92 cells. Exp Hematol 2005;33:159–64. receptor. Proc Natl Acad Sci U S A 2006;103:2788–93.

5950 Cancer Res; 77(21) November 1, 2017 Cancer Research

Enhanced Activation and Expansion of Natural Killer Cells

34. Voss SD, Sondel PM, Robb RJ. Characterization of the interleukin 2 42. Clayton A, Mitchell JP, Court J, Mason MD, Tabi Z. Human tumor-derived receptors (IL-2R) expressed on human natural killer cells activated in exosomes selectively impair lymphocyte responses to interleukin-2. Cancer vivo by IL-2: association of the p64 IL-2R gamma chain with the IL-2R Res 2007;67:7458–66. betachaininfunctionalintermediate-affinity IL-2R. J Exp Med 1992; 43. Barnes PJ. Anti-inflammatory actions of glucocorticoids: molecular 176:531–41. mechanisms. Clin Sci 1998;94:557–72. 35. Caligiuri MA, Zmuidzinas A, Manley TJ, Levine H, Smith KA, Ritz J. 44. Boumpas DT, Anastassiou ED, Older SA, Tsokos GC, Nelson DL, Balow JE. Functional consequences of interleukin 2 receptor expression on resting Dexamethasone inhibits human interleukin 2 but not interleukin 2 recep- human lymphocytes. Identification of a novel natural killer cell subset tor gene expression in vitro at the level of nuclear transcription. J Clin Invest with high affinity receptors. J Exp Med 1990;171:1509–26. 1991;87:1739–47. 36. Levin AM, Bates DL, Ring AM, Krieg C, Lin JT, Su L, et al. Exploiting a natural 45. Tai YT, Dillon M, Song W, Leiba M, Li XF, Burger P, et al. Anti-CS1 conformational switch to engineer an interleukin-2 'superkine'. Nature humanized monoclonal antibody HuLuc63 inhibits myeloma cell adhe- 2012;484:529–33. sion and induces antibody-dependent cellular cytotoxicity in the bone 37. Vihinen M. Relationship of protein flexibility to thermostability. Protein marrow milieu. Blood 2008;112:1329–37. Eng 1987;1:477–80. 46. Terme M, Ullrich E, Delahaye NF, Chaput N, Zitvogel L. Natural killer cell- 38. Lohr M, Schmidt C, Ringel J, Kluth M, Muller P, Nizze H, et al. Transforming directed therapies: moving from unexpected results to successful strategies. growth factor-beta1 induces desmoplasia in an experimental model of Nat Immunol 2008;9:486–94. human pancreatic carcinoma. Cancer Res 2001;61:550–5. 47. Glienke W, Esser R, Priesner C, Suerth JD, Schambach A, Wels WS, et al. 39. Ghiringhelli F, Menard C, Terme M, Flament C, Taieb J, Chaput N, et al. Advantages and applications of CAR-expressing natural killer cells. Front CD4þCD25þ regulatory T cells inhibit natural killer cell functions in a Pharmacol 2015;6:21. transforming growth factor-beta-dependent manner. J Exp Med 2005; 48. Tonn T, Schwabe D, Klingemann HG, Becker S, Esser R, Koehl U, et al. 202:1075–85. Treatment of patients with advanced cancer with the natural killer cell 40. Li H, Han Y, Guo Q, Zhang M, Cao X. Cancer-expanded myeloid-derived line NK-92. Cytotherapy 2013;15:1563–70. suppressor cells induce anergy of NK cells through membrane-bound 49. Arai S, Meagher R, Swearingen M, Myint H, Rich E, Martinson J, et al. TGF-beta 1. J Immunol 2009;182:240–9. Infusion of the allogeneic cell line NK-92 in patients with advanced renal 41. Clayton A, Mitchell JP, Court J, Linnane S, Mason MD, Tabi Z. Human cell cancer or melanoma: a phase I trial. Cytotherapy 2008;10:625–32. tumor-derived exosomes down-modulate NKG2D expression. J Immunol 50. Suerth JD, Schambach A, Baum C. Genetic modification of lymphocytes 2008;180:7249–58. by retrovirus-based vectors. Curr Opin Immunol 2012;24:598–608.

www.aacrjournals.org Cancer Res; 77(21) November 1, 2017 5951

Tethering IL2 to Its Receptor IL2Rβ Enhances Antitumor Activity and Expansion of Natural Killer NK92 Cells

Youssef Jounaidi, Joseph F. Cotten, Keith W. Miller, et al.

Cancer Res 2017;77:5938-5951. Published OnlineFirst September 15, 2017.

Updated version Access the most recent version of this article at: doi:10.1158/0008-5472.CAN-17-1007

Supplementary Access the most recent supplemental material at: Material http://cancerres.aacrjournals.org/content/suppl/2017/09/15/0008-5472.CAN-17-1007.DC1

Cited articles This article cites 50 articles, 24 of which you can access for free at: http://cancerres.aacrjournals.org/content/77/21/5938.full#ref-list-1

Citing articles This article has been cited by 2 HighWire-hosted articles. Access the articles at: http://cancerres.aacrjournals.org/content/77/21/5938.full#related-urls

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Department at Subscriptions [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://cancerres.aacrjournals.org/content/77/21/5938. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.