A Low Interleukin-2 Receptor Signaling Threshold Supports the Development and Homeostasis of T Regulatory Cells
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Multistage Analysis of Variants in the Inflammation Pathway and Lung Cancer Risk in Smokers
Published OnlineFirst May 9, 2012; DOI: 10.1158/1055-9965.EPI-12-0352-T Cancer Epidemiology, Research Article Biomarkers & Prevention Multistage Analysis of Variants in the Inflammation Pathway and Lung Cancer Risk in Smokers Margaret R. Spitz1, Ivan P. Gorlov2, Qiong Dong3, Xifeng Wu3, Wei Chen4, David W. Chang3, Carol J. Etzel3, Neil E. Caporaso5, Yang Zhao8, David C. Christiani8, Paul Brennan9, Demetrius Albanes7, Jianxin Shi6, Michael Thun10, Maria Teresa Landi5, and Christopher I. Amos4 Abstract Background: Tobacco-induced lung cancer is characterized by a deregulated inflammatory microenviron- ment. Variants in multiple genes in inflammation pathways may contribute to risk of lung cancer. Methods: We therefore conducted a three-stage comprehensive pathway analysis (discovery, replication, and meta-analysis) of inflammation gene variants in ever-smoking lung cancer cases and controls. A discovery set (1,096 cases and 727 controls) and an independent and nonoverlapping internal replication set (1,154 cases and 1,137 controls) were derived from an ongoing case–control study. For discovery, we used an iSelect BeadChip to interrogate a comprehensive panel of 11,737 inflammation pathway single-nucleotide poly- morphisms (SNP) and selected nominally significant (P < 0.05) SNPs for internal replication. Results: There were six SNPs that achieved statistical significance (P < 0.05) in the internal replication data set with concordant risk estimates for former smokers and five concordant and replicated SNPs in current smokers. Replicated hits were further tested in a subsequent meta-analysis using external data derived from two published genome-wide association studies (GWAS) and a case–control study. Two of these variants (a BCL2L14 SNP in former smokers and an SNP in IL2RB in current smokers) were further validated. -
Tumor-Associated Macrophage Polarization Promotes the Progression of Esophageal Carcinoma
www.aging-us.com AGING 2021, Vol. 13, No. 2 Research Paper Tumor-associated macrophage polarization promotes the progression of esophageal carcinoma Xin Yuan1, Ya Li1, An Zhi Zhang1, Chen Hao Jiang1, Fan Ping Li1, Yu Fang Xie1, Jiang Fen Li1, Wei Hua Liang1, Hai Jun Zhang1, Chun Xia Liu1, Li Juan Pang1, Xi Hua Shen1, Feng Li1,2, Jian Ming Hu1 1Department of Pathology and Key Laboratory for Xinjiang Endemic and Ethnic Diseases (Ministry of Education), Department of Pathology, The First Affiliated Hospital, Shihezi University School of Medicine, Xinjiang 832000, China 2Department of Pathology, Beijing Chaoyang Hospital, Capital Medical University, Beijing 100020, China Correspondence to: Jian Ming Hu; email: [email protected], https://orcid.org/0000-0001-7790-7979 Keywords: tumour-associated macrophage, FGL2, esophageal carcinoma, immunotherapy, tumour-infiltrating Received: July 17, 2020 Accepted: October 22, 2020 Published: December 15, 2020 Copyright: © 2020 Yuan et al. This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 3.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. ABSTRACT The immune response facilitated by tumor-associated macrophages is a vital determinant of tumor progression. We identified differentially expressed genes between various macrophage phenotypes in the Gene Expression Omnibus, and used Kaplan-Meier Plotter to determine which of them altered the prognosis of esophageal carcinoma patients. Fibrinogen-like protein 2 (FGL2), an immunosuppressive factor in the tumor microenvironment of various cancers, was upregulated in M2 macrophages, and higher FGL2 expression was associated with poorer survival in esophageal carcinoma patients. -
Contribution of IL9, IL2RA and IL2RB Genetic Polymorphisms in Coronary Heart Disease in Chinese Han Population
Contribution of IL9, IL2RA and IL2RB genetic polymorphisms in coronary heart disease in Chinese Han population Xianghong Chen The Second Aliated Hospital of Hainan Medical University Xingfan Wang The Second Aliated Hospital of Hainan Medical University Zaozhang q Zhang The second Aliated Hospital of Hainan Medical University Yuewu Chen The Second Aliated Hospital of Hainan Medical University Chao Wang ( [email protected] ) The Second Aliated Hospital of Hainan Medical Universiy https://orcid.org/0000-0001-5632-9778 Research article Keywords: Posted Date: December 9th, 2019 DOI: https://doi.org/10.21203/rs.2.18401/v1 License: This work is licensed under a Creative Commons Attribution 4.0 International License. Read Full License Page 1/11 Abstract Background: Coronary heart disease (CHD) is one of the leading causes of disability and death worldwide. In the pathogenesis of CHD, inammatory cytokines take an essential part. This study was designed to detect the potential association between IL-9, IL-2RA and IL-2RB variants and CHD in Chinese Han population. Methods: This case-control study conducted 499 CHD patients and 496 healthy controls. Seven selected SNPs were genotyped to investigate the possible association between the polymorphisms and the CHD risk. The interaction of SNP-SNP in the CHD risk was analyzed by Multifactor dimensionality reduction (MDR). Results: We observed an association between IL-9 rs55692658 (OR = 1.72, p = 0.003) and the increased CHD risk. The stratication analysis by age indicated that no matter participants who were older or younger than 61 years, IL-9 rs55692658 and IL-2RB rs1573673 contributed to the CHD susceptibility signicantly (p < 0.05, respectively). -
Tethering IL2 to Its Receptor Il2rb Enhances Antitumor Activity and Expansion of Natural Killer NK92 Cells Youssef Jounaidi, Joseph F
Published OnlineFirst September 15, 2017; DOI: 10.1158/0008-5472.CAN-17-1007 Cancer Therapeutics, Targets, and Chemical Biology Research Tethering IL2 to Its Receptor IL2Rb Enhances Antitumor Activity and Expansion of Natural Killer NK92 Cells Youssef Jounaidi, Joseph F. Cotten, Keith W. Miller, and Stuart A. Forman Abstract IL2 is an immunostimulatory cytokine for key immune cells of IL2 and its receptor IL2Rb joined via a peptide linker (CIRB). including T cells and natural killer (NK) cells. Systemic IL2 NK92 cells expressing CIRB (NK92CIRB) were highly activated and supplementation could enhance NK-mediated immunity in a expanded indefinitely without exogenous IL2. When compared variety of diseases ranging from neoplasms to viral infection. with an IL2-secreting NK92 cell line, NK92CIRB were more acti- However, its systemic use is restricted by its serious side effects and vated, cytotoxic, and resistant to growth inhibition. Direct contact limited efficacy due to activation of T regulatory cells (Tregs). IL2 with cancer cells enhanced the cytotoxic character of NK92CIRB signaling is mediated through interactions with a multi-subunit cells, which displayed superior in vivo antitumor effects in mice. receptor complex containing IL2Ra, IL2Rb, and IL2Rg. Adult Overall, our results showed how tethering IL2 to its receptor natural killer (NK) cells express only IL2Rb and IL2Rg subunits IL2Rb eliminates the need for IL2Ra and IL2Rb, offering a and are therefore relatively insensitive to IL2. To overcome these new tool to selectively activate and empower immune therapy. limitations, we created a novel chimeric IL2-IL2Rb fusion protein Cancer Res; 77(21); 5938–51. Ó2017 AACR. Introduction in order for allogeneic NK cells to be effective, pretransfer lymphodepletion is required to reduce competition for growth Natural killer (NK) cells are lymphocytes endowed with the factors and cytokines (14, 15). -
Multiple QTL Underlie Milk Phenotypes at the CSF2RB Locus Thomas J
Lopdell et al. Genet Sel Evol (2019) 51:3 https://doi.org/10.1186/s12711-019-0446-x Genetics Selection Evolution RESEARCH ARTICLE Open Access Multiple QTL underlie milk phenotypes at the CSF2RB locus Thomas J. Lopdell1,2*, Kathryn Tiplady1, Christine Couldrey1, Thomas J. J. Johnson1, Michael Keehan1, Stephen R. Davis1, Bevin L. Harris1, Richard J. Spelman1, Russell G. Snell2 and Mathew D. Littlejohn1 Abstract Background: Over many years, artifcial selection has substantially improved milk production by cows. However, the genes that underlie milk production quantitative trait loci (QTL) remain relatively poorly characterised. Here, we investigate a previously reported QTL located at the CSF2RB locus on chromosome 5, for several milk production phe- notypes, to better understand its underlying genetic and molecular causes. Results: Using a population of 29,350 taurine dairy cows, we conducted association analyses for milk yield and composition traits, and identifed highly signifcant QTL for milk yield, milk fat concentration, and milk protein con- centration. Strikingly, protein concentration and milk yield appear to show co-located yet genetically distinct QTL. To attempt to understand the molecular mechanisms that might be mediating these efects, gene expression data were used to investigate eQTL for 11 genes in the broader interval. This analysis highlighted genetic impacts on CSF2RB and NCF4 expression that share similar association signatures to those observed for lactation QTL, strongly implicating one or both of these genes as responsible for these efects. Using the same gene expression dataset representing 357 lactating cows, we also identifed 38 novel RNA editing sites in the 3′ UTR of CSF2RB transcripts. -
Calcium-Mediated Shaping of Naive CD4 T-Cell Phenotype and Function
RESEARCH ARTICLE Calcium-mediated shaping of naive CD4 T-cell phenotype and function Vincent Guichard1,2, Nelly Bonilla1, Aure´ lie Durand1, Alexandra Audemard-Verger1, Thomas Guilbert1, Bruno Martin1, Bruno Lucas1†, Ce´ dric Auffray1†* 1Institut Cochin, Paris Descartes Universite´, CNRS UMR8104, INSERM U1016, Paris, France; 2Paris Diderot Universite´, Paris, France Abstract Continuous contact with self-major histocompatibility complex ligands is essential for the survival of naive CD4 T cells. We have previously shown that the resulting tonic TCR signaling also influences their fate upon activation by increasing their ability to differentiate into induced/ peripheral regulatory T cells. To decipher the molecular mechanisms governing this process, we here focus on the TCR signaling cascade and demonstrate that a rise in intracellular calcium levels is sufficient to modulate the phenotype of mouse naive CD4 T cells and to increase their sensitivity to regulatory T-cell polarization signals, both processes relying on calcineurin activation. Accordingly, in vivo calcineurin inhibition leads the most self-reactive naive CD4 T cells to adopt the phenotype of their less self-reactive cell-counterparts. Collectively, our findings demonstrate that calcium- mediated activation of the calcineurin pathway acts as a rheostat to shape both the phenotype and effector potential of naive CD4 T cells in the steady-state. DOI: https://doi.org/10.7554/eLife.27215.001 *For correspondence: Introduction [email protected] T-cell precursors originate in the bone-marrow and are educated in the thymus through processes † called positive and negative selections, which result in MHC-restriction and self-tolerance, respec- These authors contributed equally to this work tively (Stritesky et al., 2012). -
IL2 Receptor Alpha (IL2RA) (NM 000417) Human Tagged ORF Clone Product Data
OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RG215768 IL2 Receptor alpha (IL2RA) (NM_000417) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: IL2 Receptor alpha (IL2RA) (NM_000417) Human Tagged ORF Clone Tag: TurboGFP Symbol: IL2RA Synonyms: CD25; IDDM10; IL2R; IMD41; p55; TCGFR Vector: pCMV6-AC-GFP (PS100010) E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: Neomycin ORF Nucleotide >RG215768 representing NM_000417 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGATTCATACCTGCTGATGTGGGGACTGCTCACGTTCATCATGGTGCCTGGCTGCCAGGCAGAGCTCT GTGACGATGACCCGCCAGAGATCCCACACGCCACATTCAAAGCCATGGCCTACAAGGAAGGAACCATGTT GAACTGTGAATGCAAGAGAGGTTTCCGCAGAATAAAAAGCGGGTCACTCTATATGCTCTGTACAGGAAAC TCTAGCCACTCGTCCTGGGACAACCAATGTCAATGCACAAGCTCTGCCACTCGGAACACAACGAAACAAG TGACACCTCAACCTGAAGAACAGAAAGAAAGGAAAACCACAGAAATGCAAAGTCCAATGCAGCCAGTGGA CCAAGCGAGCCTTCCAGGTCACTGCAGGGAACCTCCACCATGGGAAAATGAAGCCACAGAGAGAATTTAT CATTTCGTGGTGGGGCAGATGGTTTATTATCAGTGCGTCCAGGGATACAGGGCTCTACACAGAGGTCCTG CTGAGAGCGTCTGCAAAATGACCCACGGGAAGACAAGGTGGACCCAGCCCCAGCTCATATGCACAGGTGA AATGGAGACCAGTCAGTTTCCAGGTGAAGAGAAGCCTCAGGCAAGCCCCGAAGGCCGTCCTGAGAGTGAG ACTTCCTGCCTCGTCACAACAACAGATTTTCAAATACAGACAGAAATGGCTGCAACCATGGAGACGTCCA TATTTACAACAGAGTACCAGGTAGCAGTGGCCGGCTGTGTTTTCCTGCTGATCAGCGTCCTCCTCCTGAG TGGGCTCACCTGGCAGCGGAGACAGAGGAAGAGTAGAAGAACAATC -
Investigation of the Association Between FGL1 Expression and Prognosis in Gastric Cancer Patients Mahnaz Saremi1*, Leila Moezzi2
http://pmjournal.ir Original Article Autumn 2020, Volume 5, Issue 19 (7-9) Investigation of the Association between FGL1 Expression and Prognosis in Gastric Cancer Patients Mahnaz Saremi1*, Leila Moezzi2 1 Reference Health Laboratory, Ministry of Health and Medical Education 2 Department of Cellular and Molecular, Faculty of Life Sciences, North Tehran Branch, Islamic Azad University, Faculty of Biological Sciences, Tehran, Iran 2 Personalized Medicine Research Center of AmitisGen, Tehran, Iran *Corresponding author: Mahnaz Saremi, Reference Health Laboratory, Ministry of Health and Medical DOI: 10.22034/pmj.2020.240044 Education. Email: :[email protected] Submitted: 2020/05/23 Abstract Accepted: 2020/07/19 Gastric cancer is the fourth most common cancer worldwide, and it ranks second leading Keywords: cause of cancer deaths. Several studies have shown that FGL2 contributes to the patho- Gastric cancer genesis of a number of infectious diseases. However, little is known about its biological FGL2 gene functions in cancer development and metastasis. In this study, the association between gene expression FGL1 expression and prognosis was investigated in GC patients. Gastric cancer and ad- qPCR jacent normal tissues (n=20) were obtained from patients diagnosed with gastric cancer aged between 30 and 50. Total RNA was extracted, reverse transcription and qPCR were ©2020.Personalized Medicine Journal performed, and Relative expression level was calculated using the 2-∆∆Cq method. It was found that FGL1 expression in gastric cancer tissues was obviously higher than adjacent tissues at mRNA levels (P<0.003). IntroductIon effector molecule of Treg cells and plays a critical Gastric cancer is the fourth most common role in regulating innate immunity and adaptive cancer worldwide, and it ranks as the second immunity [7]. -
Endocytosis of Interleukin 2 Receptors in Human T
Endocytosis of Interleukin 2 Receptors in Human T Lymphocytes: Distinct Intracellular Localization and Fate of the Receptor a,/3, and -y Chains Agn~s H6mar,* Agathe Subtil, Mich~le Lieb, Emmanuel Morelon, Raymond HeUio,* and Alice Dautry-Varsat Unit6 de Biologie des Interactions Cellulaires, URA CNRS 1960, Institut Pasteur, 75724 Paris Cedex 15, France; * Service de Microscopie Confocale, Institut Pasteur, Paris, France; and ePresent address: EMBL, Postfach 10.2209, D 69012 Heidelberg, Germany Abstract. Members of the cytokine receptor family rab7-positive compartments (late endosomes). On the are composed of several noncovalently linked chains other hand, at late internalization times, the/3 and 3, with sequence and structure homologies in their ex- chains were excluded from transferrin-positive or- tracellular domain. Receptor subfamily members share ganelles and did not colocalize with ~. Furthermore, at least one component: thus the receptors for inter- /3 could be found in rab7-positive vesicles. These leukin (IL) 2 and ILl5 have common ~ and 3" chains, differences suggest that the ot chain recycles to the while those for IL2, 4, 7, and 9 have a common 3' plasma membrane, while the ~ and 3' chains are chain. The intracellular pathway followed by IL2 sorted towards the degradation pathway. The half-lives receptors after ligand binding and endocytosis was of these three chains on the cell surface also reflect analyzed by immunofluorescence and confocal micros- their different intracellular fates after endocytosis. The copy in a human T lymphocytic cell line. Surprisingly, and 3' chains are very short-lived polypeptides since the a, ~, and 3' chains had different intracellular their half-life on the surface is only =1 h, whereas c~ localizations after being endocytosed together. -
The Role of Fibrinogen-Like Proteins in Cancer
The Role of Fibrinogen-Like Proteins in Cancer Jing Yu1,2#, Jing Li 3#, Jing Shen1,2, Fukuan Du1,2, Xu Wu1,2, Mingxing Li1,2, Yu Chen1,2, Chi Hin Cho1,2, Xiaobing Li1*, Zhangang Xiao1,2*, Yueshui Zhao1,2* 1. Laboratory of Molecular Pharmacology, Department of Pharmacology, School of Pharmacy, Southwest Medical University, Luzhou, Sichuan, China 2. South Sichuan Institute of Translational Medicine, Luzhou, Sichuan, China 3. Department of Oncology and Hematology, Hospital (T.C.M) Affiliated to Southwest Medical University, Luzhou, Sichuan, China. # These Authors Contributed Equally to This Work. *Addresses for Correspondent Authors: Yueshui Zhao, Laboratory of Molecular Pharmacology, Department of Pharmacology, School of Pharmacy, Southwest Medical University, Luzhou, Sichuan 646000, China; E-mail: [email protected] Zhangang Xiao, Laboratory of Molecular Pharmacology, Department of Pharmacology, School of Pharmacy, Southwest Medical University, Luzhou, Sichuan 646000, China; E-mail: [email protected] Xiaobing Li, Laboratory of Molecular Pharmacology, Department of Pharmacology, School of Pharmacy, Southwest Medical University, Luzhou, Sichuan 646000, China; E-mail: [email protected] 1 Abstract Fibrinogen-associated protein (FREP) family is a family of proteins with a fibrin domain at the carboxyl terminus. Recent investigations illustrated that two members of FREP family, fibrinogen-like protein-1 (FGL1) and fibrinogen-like protein-2 (FGL2), play crucial roles in cancer by regulating the proliferation, invasion, and migration of tumor cells, or regulating the functions of immune cells in tumor microenvironment. Meanwhile, they are potential targets for medical intervention of tumor development. In this review, we discussed the structure, and the roles of FGL1 and FGL2 in tumors, especially the roles in regulating immune cell functions. -
I TARGETED DELETIO of FIBRI OGE -LIKE PROTEI 2 (FGL2) E HA CES
TARGETED DELETIO OF FIBRIOGE-LIKE PROTEI 2 (FGL2) EHACES IMMUITY I A MURIE MODEL OF ACUTE VIRAL HEPATITIS CAUSED BY LYMPHOCYTIC CHORIOMEIGITIS VIRUS (LCMV) By Ramzi Khattar A thesis submitted in conformity with the requirements for the degree of Master of Science Graduate Department of Immunology University of Toronto © Copyright by Ramzi Khattar 2011 i Library and Archives Bibliothèque et Canada Archives Canada Published Heritage Direction du Branch Patrimoine de l'édition 395 Wellington Street 395, rue Wellington Ottawa ON K1A 0N4 Ottawa ON K1A 0N4 Canada Canada Your file Votre référence ISBN: 978-0-494-76778-8 Our file Notre référence ISBN: 978-0-494-76778-8 NOTICE: AVIS: The author has granted a non- L'auteur a accordé une licence non exclusive exclusive license allowing Library and permettant à la Bibliothèque et Archives Archives Canada to reproduce, Canada de reproduire, publier, archiver, publish, archive, preserve, conserve, sauvegarder, conserver, transmettre au public communicate to the public by par télécommunication ou par l'Internet, prêter, telecommunication or on the Internet, distribuer et vendre des thèses partout dans le loan, distrbute and sell theses monde, à des fins commerciales ou autres, sur worldwide, for commercial or non- support microforme, papier, électronique et/ou commercial purposes, in microform, autres formats. paper, electronic and/or any other formats. The author retains copyright L'auteur conserve la propriété du droit d'auteur ownership and moral rights in this et des droits moraux qui protege cette thèse. Ni thesis. Neither the thesis nor la thèse ni des extraits substantiels de celle-ci substantial extracts from it may be ne doivent être imprimés ou autrement printed or otherwise reproduced reproduits sans son autorisation. -
Single Cell Transcriptomics of Regulatory T Cells Reveals Trajectories of Tissue Adaptation
bioRxiv preprint doi: https://doi.org/10.1101/217489; this version posted November 22, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Single cell transcriptomics of regulatory T cells reveals trajectories of tissue adaptation Authors: 1,2,a 1,a 3,4 7 Ricardo J Miragaia , Tomás Gomes , Agnieszka Chomka , Laura Jardine , Angela 8 3,4,5 1,9 1 3,4,6 Riedel , Ahmed N. Hegazy , Ida Lindeman , Guy Emerton , Thomas Krausgruber , 8 7 3,4 1,10,11,* Jacqueline Shields , Muzlifah Haniffa , Fiona Powrie , Sarah A. Teichmann Affiliations: 1 Wellcome Trust Sanger Institute, Wellcome Trust Genome Campus, Hinxton, UK 2 Centre of Biological Engineering, University of Minho, Braga, Portugal 3 Kennedy Institute of Rheumatology, Nuffield Department of Orthopaedics, Rheumatology and Musculoskeletal Sciences, University of Oxford, Oxford, UK 4 Translational Gastroenterology Unit, Experimental Medicine Division Nuffield Department of Clinical Medicine, University of Oxford, John Radcliffe Hospital, Oxford, UK 5 Current affiliation: Charité – Universitätsmedizin Berlin, corporate member of Freie Universität Berlin, Humboldt-Universität zu Berlin, and Berlin Institute of Health,