FINAL THESIS 2014 for PRINT And
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Aurora Kinase a in Gastrointestinal Cancers: Time to Target Ahmed Katsha1, Abbes Belkhiri1, Laura Goff3 and Wael El-Rifai1,2,4*
Katsha et al. Molecular Cancer (2015) 14:106 DOI 10.1186/s12943-015-0375-4 REVIEW Open Access Aurora kinase A in gastrointestinal cancers: time to target Ahmed Katsha1, Abbes Belkhiri1, Laura Goff3 and Wael El-Rifai1,2,4* Abstract Gastrointestinal (GI) cancers are a major cause of cancer-related deaths. During the last two decades, several studies have shown amplification and overexpression of Aurora kinase A (AURKA) in several GI malignancies. These studies demonstrated that AURKA not only plays a role in regulating cell cycle and mitosis, but also regulates a number of key oncogenic signaling pathways. Although AURKA inhibitors have moved to phase III clinical trials in lymphomas, there has been slower progress in GI cancers and solid tumors. Ongoing clinical trials testing AURKA inhibitors as a single agent or in combination with conventional chemotherapies are expected to provide important clinical information for targeting AURKA in GI cancers. It is, therefore, imperative to consider investigations of molecular determinants of response and resistance to this class of inhibitors. This will improve evaluation of the efficacy of these drugs and establish biomarker based strategies for enrollment into clinical trials, which hold the future direction for personalized cancer therapy. In this review, we will discuss the available data on AURKA in GI cancers. We will also summarize the major AURKA inhibitors that have been developed and tested in pre-clinical and clinical settings. Keywords: Aurora kinases, Therapy, AURKA inhibitors, MNL8237, Alisertib, Gastrointestinal, Cancer, Signaling pathways Introduction stage [9-11]. Furthermore, AURKA is critical for Mitotic kinases are the main proteins that coordinate ac- bipolar-spindle assembly where it interacts with Ran- curate mitotic processing [1]. -
Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P. -
Gene Symbol Gene Description ACVR1B Activin a Receptor, Type IB
Table S1. Kinase clones included in human kinase cDNA library for yeast two-hybrid screening Gene Symbol Gene Description ACVR1B activin A receptor, type IB ADCK2 aarF domain containing kinase 2 ADCK4 aarF domain containing kinase 4 AGK multiple substrate lipid kinase;MULK AK1 adenylate kinase 1 AK3 adenylate kinase 3 like 1 AK3L1 adenylate kinase 3 ALDH18A1 aldehyde dehydrogenase 18 family, member A1;ALDH18A1 ALK anaplastic lymphoma kinase (Ki-1) ALPK1 alpha-kinase 1 ALPK2 alpha-kinase 2 AMHR2 anti-Mullerian hormone receptor, type II ARAF v-raf murine sarcoma 3611 viral oncogene homolog 1 ARSG arylsulfatase G;ARSG AURKB aurora kinase B AURKC aurora kinase C BCKDK branched chain alpha-ketoacid dehydrogenase kinase BMPR1A bone morphogenetic protein receptor, type IA BMPR2 bone morphogenetic protein receptor, type II (serine/threonine kinase) BRAF v-raf murine sarcoma viral oncogene homolog B1 BRD3 bromodomain containing 3 BRD4 bromodomain containing 4 BTK Bruton agammaglobulinemia tyrosine kinase BUB1 BUB1 budding uninhibited by benzimidazoles 1 homolog (yeast) BUB1B BUB1 budding uninhibited by benzimidazoles 1 homolog beta (yeast) C9orf98 chromosome 9 open reading frame 98;C9orf98 CABC1 chaperone, ABC1 activity of bc1 complex like (S. pombe) CALM1 calmodulin 1 (phosphorylase kinase, delta) CALM2 calmodulin 2 (phosphorylase kinase, delta) CALM3 calmodulin 3 (phosphorylase kinase, delta) CAMK1 calcium/calmodulin-dependent protein kinase I CAMK2A calcium/calmodulin-dependent protein kinase (CaM kinase) II alpha CAMK2B calcium/calmodulin-dependent -
TRIB2 Functions As Novel Oncogene in Colorectal Cancer by Blocking
Hou et al. Molecular Cancer (2018) 17:172 https://doi.org/10.1186/s12943-018-0922-x RESEARCH Open Access TRIB2 functions as novel oncogene in colorectal cancer by blocking cellular senescence through AP4/p21 signaling Zhenlin Hou1, Kaixuan Guo1, Xuling Sun1, Fuqing Hu1, Qianzhi Chen1, Xuelai Luo1, Guihua Wang1, Junbo Hu1 and Li Sun2* Abstract Background: Cellular senescence is a state of irreversible cell growth arrest and senescence cells permanently lose proliferation potential. Induction of cellular senescence might be a novel therapy for cancer cells. TRIB2 has been reported to participate in regulating proliferation and drug resistance of various cancer cells. However, the role of TRIB2 in cellular senescence of colorectal cancer (CRC) and its molecular mechanism remains unclear. Methods: The expression of TRIB2 in colorectal cancer tissues and adjacent tissues was detected by immunohistochemistry and RT-PCR. The growth, cell cycle distribution and cellular senescence of colorectal cancer cells were evaluated by Cell Counting Kit-8 (CCK8) assay, flow cytometry detection and senescence- associated β-galactosidase staining, respectively. Western blot, RT-PCR and luciferase assay were performed to determine how TRIB2 regulates p21. Immunoprecipitation (IP) and chromatin-immunoprecipitation (ChIP) were used to investigate the molecular mechanisms. Results: We found that TRIB2 expression was elevated in CRC tissues compared to normal adjacent tissues and high TRIB2 expression indicated poor prognosis of CRC patients. Functionally, depletion of TRIB2 inhibited cancer cells proliferation, induced cell cycle arrest and promoted cellular senescence, whereas overexpression of TRIB2 accelerated cell growth, cell cycle progression and blocked cellular senescence. Further studies showed that TRIB2 physically interacted with AP4 and inhibited p21 expression through enhancing transcription activities of AP4. -
RASSF1A Interacts with and Activates the Mitotic Kinase Aurora-A
Oncogene (2008) 27, 6175–6186 & 2008 Macmillan Publishers Limited All rights reserved 0950-9232/08 $32.00 www.nature.com/onc ORIGINAL ARTICLE RASSF1A interacts with and activates the mitotic kinase Aurora-A L Liu1, C Guo1, R Dammann2, S Tommasi1 and GP Pfeifer1 1Division of Biology, Beckman Research Institute, City of Hope Cancer Center, Duarte, CA, USA and 2Institute of Genetics, University of Giessen, Giessen, Germany The RAS association domain family 1A (RASSF1A) gene tumorigenesis and carcinogen-induced tumorigenesis is located at chromosome 3p21.3 within a specific area of (Tommasi et al., 2005; van der Weyden et al., 2005), common heterozygous and homozygous deletions. RASS- supporting the notion that RASSF1A is a bona fide F1A frequently undergoes promoter methylation-asso- tumor suppressor. However, it is not fully understood ciated inactivation in human cancers. Rassf1aÀ/À mice how RASSF1A is involved in tumor suppression. are prone to both spontaneous and carcinogen-induced The biochemical function of the RASSF1A protein is tumorigenesis, supporting the notion that RASSF1A is a largely unknown. The homology of RASSF1A with the tumor suppressor. However, it is not fully understood how mammalian Ras effector novel Ras effector (NORE)1 RASSF1A is involved in tumor suppression pathways. suggests that the RASSF1A gene product may function Here we show that overexpression of RASSF1A inhibits in signal transduction pathways involving Ras-like centrosome separation. RASSF1A interacts with Aurora-A, proteins. However, recent data indicate that RASSF1A a mitotic kinase. Surprisingly, knockdown of RASS- itself binds to RAS only weakly and that binding to F1A by siRNA led to reduced activation of Aurora-A, RAS may require heterodimerization of RASSF1A and whereas overexpression of RASSF1A resulted in in- NORE1 (Ortiz-Vega et al., 2002). -
Characterization of TRIB2-Mediated Resistance to Pharmacological Inhibition of MEK
VANESSA MENDES HENRIQUES Characterization of TRIB2-mediated resistance to pharmacological inhibition of MEK Oncobiology Master Thesis Faro, 2017 VANESSA MENDES HENRIQUES Characterization of TRIB2-mediated resistance to pharmacological inhibition of MEK Supervisors: Dr. Wolfgang Link Dr. Bibiana Ferreira Oncobiology Master Thesis Faro, 2017 Título: “Characterization of TRIB2-mediated resistance to pharmacological inhibition of MEK” Declaração de autoria do trabalho Declaro ser a autora deste trabalho, que é original e inédito. Autores e trabalhos consultados estão devidamente citados no texto e constam da listagem de referências incluída. Copyright Vanessa Mendes Henriques _____________________________ A Universidade do Algarve tem o direito, perpétuo e sem limites geográficos, de arquivar e publicitar este trabalho através de exemplares impressos reproduzidos em papel ou de forma digital, ou por qualquer outro meio conhecido ou que venha a ser inventado, de o divulgar através de repositórios científicos e de admitir a sua cópia e distribuição com objetivos educacionais ou de investigação, não comerciais, desde que seja dado crédito ao autor e editor. i Acknowledgements First, I would like to thank the greatest opportunity given by professor doctor Wolfgang Link to accepting me into his team, contributing to my scientific and personal progress. Thank You for all Your knowledge and help across the year. A special thanks to Bibiana Ferreira who stayed by me all year and trained me. Thank You for all you taught me, thank you for all your patience and time and all the support. Thank you for all the great times that You provided me. It was an amazing experience to learn and work with You, which made me grow as a scientist and also as a person. -
Therapeutic Implications for Ovarian Cancer Emerging from the Tumor Cancer Genome Atlas
Review Article Therapeutic implications for ovarian cancer emerging from the Tumor Cancer Genome Atlas Claire Verschraegen, Karen Lounsbury, Alan Howe, Marc Greenblatt University of Vermont Cancer Center, Burlington, VT 05405, USA Correspondence to: Claire Verschraegen, MD. University of Vermont Cancer Center, 89 Beaumont Avenue, Given E 214, Burlington, VT 05405, USA. Email: [email protected] Abstract: With increasing insights into the molecular landscape of ovarian cancer, subtypes are emerging that might require differential targeted therapies. While the combination of a platinum and a taxane remains the standard of care, newer therapies, specifically targeted to molecular anomalies, are rapidly being tested in various cancers. A major effort to better understand ovarian cancer occurred through the Cancer Atlas Project. The Catalogue of Somatic Mutations in Cancer (COSMIC) is a database that collates mutation data and associated information extracted from the primary literature. The information from the Cancer Genome Atlas (TCGA) and the International Cancer Genome Consortium (ICGC), which systematically analyzed hundreds of ovarian cancer, are included in COSMIC, sometimes with discordant results. In this manuscript, the published data (mainly from TCGA) on somatic high grade papillary serous ovarian cancer (HGSOC) mutations has been used as the basis to propose a more granular approach to ovarian cancer treatment, already a reality for tumors such as lung and breast cancers. TP53 mutations are the most common molecular anomaly in HGSOC, and lead to genomic instability, perhaps through the FOXM1 node. Normalizing P53 has been a therapeutic challenge, and is being extensively studied. BRCAness is found an about 50% of HGSOC and can be targeted with poly (ADP-ribose) polymerase (PARP) inhibitors, such as olaparib, recently approved for ovarian cancer treatment. -
A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated. -
Advancing a Clinically Relevant Perspective of the Clonal Nature of Cancer
Advancing a clinically relevant perspective of the clonal nature of cancer Christian Ruiza,b, Elizabeth Lenkiewicza, Lisa Eversa, Tara Holleya, Alex Robesona, Jeffrey Kieferc, Michael J. Demeurea,d, Michael A. Hollingsworthe, Michael Shenf, Donna Prunkardf, Peter S. Rabinovitchf, Tobias Zellwegerg, Spyro Moussesc, Jeffrey M. Trenta,h, John D. Carpteni, Lukas Bubendorfb, Daniel Von Hoffa,d, and Michael T. Barretta,1 aClinical Translational Research Division, Translational Genomics Research Institute, Scottsdale, AZ 85259; bInstitute for Pathology, University Hospital Basel, University of Basel, 4031 Basel, Switzerland; cGenetic Basis of Human Disease, Translational Genomics Research Institute, Phoenix, AZ 85004; dVirginia G. Piper Cancer Center, Scottsdale Healthcare, Scottsdale, AZ 85258; eEppley Institute for Research in Cancer and Allied Diseases, Nebraska Medical Center, Omaha, NE 68198; fDepartment of Pathology, University of Washington, Seattle, WA 98105; gDivision of Urology, St. Claraspital and University of Basel, 4058 Basel, Switzerland; hVan Andel Research Institute, Grand Rapids, MI 49503; and iIntegrated Cancer Genomics Division, Translational Genomics Research Institute, Phoenix, AZ 85004 Edited* by George F. Vande Woude, Van Andel Research Institute, Grand Rapids, MI, and approved June 10, 2011 (received for review March 11, 2011) Cancers frequently arise as a result of an acquired genomic insta- on the basis of morphology alone (8). Thus, the application of bility and the subsequent clonal evolution of neoplastic cells with purification methods such as laser capture microdissection does variable patterns of genetic aberrations. Thus, the presence and not resolve the complexities of many samples. A second approach behaviors of distinct clonal populations in each patient’s tumor is to passage tumor biopsies in tissue culture or in xenografts (4, 9– may underlie multiple clinical phenotypes in cancers. -
Profiling Data
Compound Name DiscoveRx Gene Symbol Entrez Gene Percent Compound Symbol Control Concentration (nM) JNK-IN-8 AAK1 AAK1 69 1000 JNK-IN-8 ABL1(E255K)-phosphorylated ABL1 100 1000 JNK-IN-8 ABL1(F317I)-nonphosphorylated ABL1 87 1000 JNK-IN-8 ABL1(F317I)-phosphorylated ABL1 100 1000 JNK-IN-8 ABL1(F317L)-nonphosphorylated ABL1 65 1000 JNK-IN-8 ABL1(F317L)-phosphorylated ABL1 61 1000 JNK-IN-8 ABL1(H396P)-nonphosphorylated ABL1 42 1000 JNK-IN-8 ABL1(H396P)-phosphorylated ABL1 60 1000 JNK-IN-8 ABL1(M351T)-phosphorylated ABL1 81 1000 JNK-IN-8 ABL1(Q252H)-nonphosphorylated ABL1 100 1000 JNK-IN-8 ABL1(Q252H)-phosphorylated ABL1 56 1000 JNK-IN-8 ABL1(T315I)-nonphosphorylated ABL1 100 1000 JNK-IN-8 ABL1(T315I)-phosphorylated ABL1 92 1000 JNK-IN-8 ABL1(Y253F)-phosphorylated ABL1 71 1000 JNK-IN-8 ABL1-nonphosphorylated ABL1 97 1000 JNK-IN-8 ABL1-phosphorylated ABL1 100 1000 JNK-IN-8 ABL2 ABL2 97 1000 JNK-IN-8 ACVR1 ACVR1 100 1000 JNK-IN-8 ACVR1B ACVR1B 88 1000 JNK-IN-8 ACVR2A ACVR2A 100 1000 JNK-IN-8 ACVR2B ACVR2B 100 1000 JNK-IN-8 ACVRL1 ACVRL1 96 1000 JNK-IN-8 ADCK3 CABC1 100 1000 JNK-IN-8 ADCK4 ADCK4 93 1000 JNK-IN-8 AKT1 AKT1 100 1000 JNK-IN-8 AKT2 AKT2 100 1000 JNK-IN-8 AKT3 AKT3 100 1000 JNK-IN-8 ALK ALK 85 1000 JNK-IN-8 AMPK-alpha1 PRKAA1 100 1000 JNK-IN-8 AMPK-alpha2 PRKAA2 84 1000 JNK-IN-8 ANKK1 ANKK1 75 1000 JNK-IN-8 ARK5 NUAK1 100 1000 JNK-IN-8 ASK1 MAP3K5 100 1000 JNK-IN-8 ASK2 MAP3K6 93 1000 JNK-IN-8 AURKA AURKA 100 1000 JNK-IN-8 AURKA AURKA 84 1000 JNK-IN-8 AURKB AURKB 83 1000 JNK-IN-8 AURKB AURKB 96 1000 JNK-IN-8 AURKC AURKC 95 1000 JNK-IN-8 -
Genome-Wide Sirna Screen for Mediators of NF-Κb Activation
Genome-wide siRNA screen for mediators SEE COMMENTARY of NF-κB activation Benjamin E. Gewurza, Fadi Towficb,c,1, Jessica C. Marb,d,1, Nicholas P. Shinnersa,1, Kaoru Takasakia, Bo Zhaoa, Ellen D. Cahir-McFarlanda, John Quackenbushe, Ramnik J. Xavierb,c, and Elliott Kieffa,2 aDepartment of Medicine and Microbiology and Molecular Genetics, Channing Laboratory, Brigham and Women’s Hospital and Harvard Medical School, Boston, MA 02115; bCenter for Computational and Integrative Biology, Massachusetts General Hospital, Harvard Medical School, Boston, MA 02114; cProgram in Medical and Population Genetics, The Broad Institute of Massachusetts Institute of Technology and Harvard, Cambridge, MA 02142; dDepartment of Biostatistics, Harvard School of Public Health, Boston, MA 02115; and eDepartment of Biostatistics and Computational Biology and Department of Cancer Biology, Dana-Farber Cancer Institute, Boston, MA 02115 Contributed by Elliott Kieff, December 16, 2011 (sent for review October 2, 2011) Although canonical NFκB is frequently critical for cell proliferation, (RIPK1). TRADD engages TNFR-associated factor 2 (TRAF2), survival, or differentiation, NFκB hyperactivation can cause malig- which recruits the ubiquitin (Ub) E2 ligase UBC5 and the E3 nant, inflammatory, or autoimmune disorders. Despite intensive ligases cIAP1 and cIAP2. CIAP1/2 polyubiquitinate RIPK1 and study, mammalian NFκB pathway loss-of-function RNAi analyses TRAF2, which recruit and activate the K63-Ub binding proteins have been limited to specific protein classes. We therefore under- TAB1, TAB2, and TAB3, as well as their associated kinase took a human genome-wide siRNA screen for novel NFκB activa- MAP3K7 (TAK1). TAK1 in turn phosphorylates IKKβ activa- tion pathway components. Using an Epstein Barr virus latent tion loop serines to promote IKK activity (4). -
Supplementary Table 1
SI Table S1. Broad protein kinase selectivity for PF-2771. Kinase, PF-2771 % Inhibition at 10 μM Service Kinase, PF-2771 % Inhibition at 1 μM Service rat RPS6KA1 (RSK1) 39 Dundee AURKA (AURA) 24 Invitrogen IKBKB (IKKb) 26 Dundee CDK2 /CyclinA 21 Invitrogen mouse LCK 25 Dundee rabbit MAP2K1 (MEK1) 19 Dundee AKT1 (AKT) 21 Dundee IKBKB (IKKb) 16 Dundee CAMK1 (CaMK1a) 19 Dundee PKN2 (PRK2) 14 Dundee RPS6KA5 (MSK1) 18 Dundee MAPKAPK5 14 Dundee PRKD1 (PKD1) 13 Dundee PIM3 12 Dundee MKNK2 (MNK2) 12 Dundee PRKD1 (PKD1) 12 Dundee MARK3 10 Dundee NTRK1 (TRKA) 12 Invitrogen SRPK1 9 Dundee MAPK12 (p38g) 11 Dundee MAPKAPK5 9 Dundee MAPK8 (JNK1a) 11 Dundee MAPK13 (p38d) 8 Dundee rat PRKAA2 (AMPKa2) 11 Dundee AURKB (AURB) 5 Dundee NEK2 11 Invitrogen CSK 5 Dundee CHEK2 (CHK2) 11 Invitrogen EEF2K (EEF-2 kinase) 4 Dundee MAPK9 (JNK2) 9 Dundee PRKCA (PKCa) 4 Dundee rat RPS6KA1 (RSK1) 8 Dundee rat PRKAA2 (AMPKa2) 4 Dundee DYRK2 7 Dundee rat CSNK1D (CKId) 3 Dundee AKT1 (AKT) 7 Dundee LYN 3 BioPrint PIM2 7 Invitrogen CSNK2A1 (CKIIa) 3 Dundee MAPK15 (ERK7) 6 Dundee CAMKK2 (CAMKKB) 1 Dundee mouse LCK 5 Dundee PIM3 1 Dundee PDPK1 (PDK1) (directed 5 Invitrogen rat DYRK1A (MNB) 1 Dundee RPS6KB1 (p70S6K) 5 Dundee PBK 0 Dundee CSNK2A1 (CKIIa) 4 Dundee PIM1 -1 Dundee CAMKK2 (CAMKKB) 4 Dundee DYRK2 -2 Dundee SRC 4 Invitrogen MAPK12 (p38g) -2 Dundee MYLK2 (MLCK_sk) 3 Invitrogen NEK6 -3 Dundee MKNK2 (MNK2) 2 Dundee RPS6KB1 (p70S6K) -3 Dundee SRPK1 2 Dundee AKT2 -3 Dundee MKNK1 (MNK1) 2 Dundee RPS6KA3 (RSK2) -3 Dundee CHEK1 (CHK1) 2 Invitrogen rabbit MAP2K1 (MEK1) -4 Dundee