TOX3 Regulates Calcium-Dependent Transcription in Neurons

TOX3 regulates calcium-dependent transcription in neurons

Shauna H. Yuana, Zilong Qiub, and Anirvan Ghoshb,1

aDepartment of Neuroscience and bNeurobiology Section, Division of Biological Sciences, University of California at San Diego, La Jolla, CA 92093-0366

Edited by Richard H. Goodman, Oregon Health & Science University, Portland, OR, and approved December 30, 2008 (received for review June 7, 2008) We report the cloning and characterization of TOX3, a high mobility (DNA-binding domain) can recognize the upstream activating group box protein involved in mediating calcium-dependent tran- sequence (UAS) and drive expression of a reporter. In our scription. TOX3 was identified as a calcium-dependent transactivator experiments, a postnatal day 1 (P1) rat cortical cDNA library was using the Transactivator Trap screen. We find that TOX3 interacts fused to Gal4DBD and broken down into 200 pools. Each pool with both cAMP response element (CRE)-binding protein (CREB) and was transfected along with a UAS-CAT (chloramphenicol CREB-binding protein (CBP), and knockdown of the endogenous acetyltransferase) reporter into embryonic day 18 (E18) cortical TOX3 by RNAi leads to significant reduction of calcium-induced c-fos cultures. Pools containing a putative calcium-regulated transac- expression and complete inhibition of calcium activation of the c-fos tivator were identified by comparing the number of CAT- promoter. The effects of TOX3 on calcium-dependent transcription positive neurons in unstimulated and KCl-stimulated wells (Fig. require the CRE elements. These observations identify TOX3 as an 1 A and B). The cDNA that conferred KCl-dependent transac- important regulator of calcium-dependent transcription and suggest tivation in 1 of the pools was found to encode an HMG that TOX3 exerts its effect on CRE-mediated transcription via its box-containing protein. A partial sequence of the gene has association with the CREB–CBP complex. previously been posted with the National Center for Biotech- nology Information (NCBI) as TNRC9 and CAGF9 (17) and CBP ͉ CREB ͉ c-fos ͉ activity renamed TOX3 on the basis of its homology to the HMG box protein, TOX (NCBI Reference Sequence). We isolated and sequenced a full-length clone of TOX3 from a P1 rat cortical euronal activity plays an important role in the development NEUROSCIENCE Nof the nervous system and regulates cell survival, axonal and cDNA library. The coding region of TOX3 is 1,734 nucleotides dendritic growth, and synaptic plasticity. Many of these effects long, which translates into 578 aa residues (supporting informa- are mediated by calcium-dependent transcription (1). To iden- tion Fig. S1). The sequence has been deposited to GenBank tify factors that mediate calcium-dependent transcription in (accession no. EU194254). neurons, our laboratory developed a screening strategy called Structurally, TOX3 contains an HMG box near the middle of Transactivator Trap (2). We have previously described the the protein and has a glutamine-rich domain near the C terminus cloning of CREST (2), NeuroD2 (3), and LMO4 (4) as calcium- (Fig. 1D). Sequence comparison shows that rat TOX3 is closely dependent transcription using the Transactivator Trap strategy. related to mouse and human TOX3, although homologues in Here we report the cloning and characterization of TOX3, a zebrafish and yeast can also be identified (Fig. S1 B and C). The cAMP response element (CRE)-binding protein (CREB) and sequence similarity of TOX3 with other TOX family HMG box CREB-binding protein (CBP) interacting protein that plays a proteins is shown in Fig. S1D. The HMG box of TOX family critical role in regulating calcium-dependent transcription. proteins is highly conserved and is closely related to the HMG TOX3 is a high mobility group (HMG) box protein related to box of the mouse HMGB1 gene (Fig. S1D). TOX, a protein that has been implicated in the regulation of To characterize calcium activation of TOX3-mediated tran- thymocyte selection (5). HMG box proteins bind to the minor scription, we transfected E18 cortical cultures with Gal4.TOX3 groove of DNA and are nonchromosomal nuclear proteins that and UAS-CAT and examined depolarization-induced activation help to remodel the nucleosome (6). Our investigation of TOX3 was of the UAS-CAT reporter. Membrane depolarization with ele- driven by its calcium-activation properties and its association with vated extracellular KCl leads to an influx of calcium via voltage- CREB. CREB has long been known to be the major mediator of gated calcium channels and has been shown to induce calcium- stimulus-induced transcription activation in neurons. CREB was dependent transcription (10). Stimulation with 50 mM KCl to first discovered as a protein that binds to the cAMP-responsive depolarize the neurons did not lead to reporter activity in the element and mediates cAMP-dependent transcription (7, 8). absence of Gal4.TOX3 (Fig. 1C). In contrast, transfection of CREB-dependent transcription was subsequently found to be Gal4.TOX3 led to a significant increase in reporter activity, inducible by calcium and growth factors (9, 10). Calcium regulation which was further increased by KCl stimulation (Fig. 1C). KCl of CREB-mediated transcription requires phosphorylation of stimulation did not lead to an increase in Gal4.TOX3 levels (Fig. CREB at Ser-133. Phosphorylation of Ser-133 allows CREB to S2D). In addition, stimulation with the neurotransmitter gluta- bind to CREB-binding protein (CBP) (11). CBP itself can be mate, or increasing activity in culture by blocking GABAergic phosphorylated by CaMKIV (12–16), and it is a critical mediator of signaling with bicuculline, led to an increase in Gal4.TOX3- CREB-dependent transcription. We find that TOX3 interacts with both CREB and CBP and plays a critical role in mediating calcium-dependent transcription in neurons. Author contributions: S.H.Y. and A.G. designed research; S.H.Y. and Z.Q. performed research; S.H.Y., Z.Q., and A.G. analyzed data; and S.H.Y. and A.G. wrote the paper. Results The authors declare no conflict of interest. Identification of TOX3 as a Calcium-Dependent Transactivator. We This article is a PNAS Direct Submission. used the Transactivator Trap screen (2) to search for novel Data deposition: The sequence reported in this paper has been deposited in the GenBank mediators of calcium-dependent transcription. Briefly, the database [accession no. EU194254 (rat TOX3)]. screen uses the modular nature of transcription factors that 1To whom correspondence should be addressed. E-mail: [email protected]. enables the transactivation domain to function without the This article contains supporting information online at www.pnas.org/cgi/content/full/ DNA-binding domain. In addition, the screen takes advantage of 0805555106/DCSupplemental. the fact that a transcription factor fused to the yeast Gal4DBD © 2009 by The National Academy of Sciences of the USA

www.pnas.org͞cgi͞doi͞10.1073͞pnas.0805555106 PNAS Early Edition ͉ 1of6 Downloaded by guest on September 25, 2021 A B C * Relative CAT Activity Relative CAT

- KCl + KCl KCl - + - + UAS-CAT + + + + Gal4.TOX3 + + - - D E

HMG box Q rich

1 1734 1 870 1 711 712 1734

KCl -+++ -+ - - ++ ++ + + ++ UAS-CAT ______Gal4.TOX3 FL 1-870 1-711 712-1734

F G Cortex Cerebellum E18 P0 P7 P14 P21 Adult E18 P0 P7 P14 P21 kD FL 1 - 870 1 - 711 712 - 1734 5 kb 98 -

64 - 3 kb

50 - GAPDH

Fig. 1. Characterization of TOX3-mediated transcription. (A and B) Immunocytochemistry of rat E18 neurons transfected with the pool containing Gal4.TOX3. The images show CAT-immunoreactivity in unstimulated (A) and 50 mM KCl-stimulated (B) cells transfected with the Gal4.TOX3-containing pool together with UAS-CAT. The arrows point to the CAT-positive cells. (C) Relative CAT activity in rat E18 cortical neuronal cultures transfected with UAS-CAT and either Gal4.TOX3 or vector on DIV3 and assayed for CAT activity on DIV 5. Cultures were treated either with 50 mM KCl or PBS on DIV4 for 16 h. *, P Ͻ 0.05. (D) Diagrammatic representation of the various deletion constructs of TOX3. (E) Relative CAT activity in rat E18 cortical neuronal cultures transfected with full-length Gal4.TOX3 (FL), Gal4.TOX3 base pairs 1–870, Gal4.TOX3 base pairs 1–711, or Gal4.TOX3 base pairs 712-1734 and UAS-CAT, stimulated as indicated and assayed for CAT activity on DIV5. (F) Expression of the deletion constructs shown by Western blot. Equivalent amounts of whole-cell lysates of HEK293 cells transfected with full-length Gal4.TOX3 (FL) or Gal4.TOX3 base pairs 1–870, 1–711, or 712-1734 were probed with anti-Gal4 antibody. (G) Northern blot of RNA isolated from rat cortices and cerebella at different developmental ages and hybridized with a probe to TOX3. The same blots were stripped and reprobed with GAPDH. Error bars represent ϩSEM.

mediated transcription (Fig. S2 B and C). These observations expressed in the cortex and the cerebellum as 2 separate indicate that membrane depolarization regulates TOX3- isoforms, 5 kb and 3 kb (Fig. 1G). In the cortex, the 5-kb isoform mediated transcription. was expressed embryonically, and its expression remained stable To identify the domains of TOX3 that mediate activity- through adulthood. However, expression of the 3-kb isoform was dependent transcription, we generated the deletion constructs tightly regulated during development. The 3-kb isoform was shown in Fig. 1D. Gal4 fusions of these constructs were cotrans- already expressed at high levels at E18 and declined to baseline fected into E18 cortical neurons with UAS-CAT, and transac- levels between P7 and P14. In the cerebellum, the 5-kb isoform tivation of the reporter after KCl stimulation was measured using was first detected at P0 and remained at high levels thereafter. CAT assays (Fig. 1E). We found that the constructs lacking the The expression of the 3-kb isoform in the cerebellum peaked C terminus retained their basal transactivation activity but lost between P7 and P14. The developmental regulation of TOX3 their calcium responsiveness. In contrast, constructs lacking the isoforms suggests that the different isoforms might serve distinct N terminus were transcriptionally inactive (Fig. 1E). Western functions in the developing and adult brain. It is not known blot analysis confirmed that each of the constructs was expressed whether both of the isoforms encode the same protein or (Fig. 1F). These observations suggest that multiple domains of represent splice variants. TOX3 contribute to transcriptional activation. The N terminus is absolutely necessary for transcription; the C terminus is not Contribution of TOX3 to Depolarization-Induced c-Fos Expression. required for basal transactivation but is required for calcium Among the principal targets of calcium signaling in neurons are responsiveness. the immediate early genes (1). The prototypical immediate early We carried out Northern blot analysis to determine the gene is c-fos, which is rapidly induced upon calcium influx (10). expression pattern of TOX3 in the developing brain. TOX3 is To determine whether TOX3 contributes to calcium activation

2of6 ͉ www.pnas.org͞cgi͞doi͞10.1073͞pnas.0805555106 Yuan et al. Downloaded by guest on September 25, 2021 A C * * Myc.TOX3 Myc.TOX3R μ m) RNAi#1 RNAi#1 RNAi#2 Scr.RNAi Scr.RNAi

anti-Myc Intensity (pixels/

anti-α-tubulin scrRNAi RNAi #1 RNAi #2 Myc.TOX3R KCl - + - + - + - + B

eGFP

c-Fos

Merge NEUROSCIENCE

scrRNAi no KCl Stim scrRNAi 2hr KCl Stim RNAi no KCl Stim RNAi 2hr KCl Stim

Fig. 2. Calcium-dependent c-Fos expression is regulated by TOX3. Western blot of whole-cell lysates of HEK293 cells transfected with either Myc.TOX3 and scrambled RNAi (Scr.RNAi), TOX3 RNAi#1, or RNAi#2, or Myc.TOX3R and scrambled RNAi or RNAi#1. The blot was probed with anti-Myc and anti-␣-tubulin antibodies. (B) E18 neuronal cultures were cotransfected with pBos.eGFP and scrambled RNAi (scrRNAi) or TOX3 RNAi#1 on DIV3. Cells were ﬁxed on DIV4 after stimulation with KCl for 2 h and stained with c-Fos antibody. Arrows indicate TOX3 knockdown cells. (Scale bar, 50 ␮m.) (C) Quantiﬁcation of the c-Fos staining of E18 neuronal cultures cotransfected with either pBos.eGFP and scrambled RNAi (scrRNAi), RNAi#1, or RNAi#2, or Myc.TOX3R and RNAi#1. *, P Ͻ 0.05.

of the c-fos promoter, we examined the effect of inhibiting TOX3 anti-HA Western blot revealed that the 2 proteins are indeed in the on the expression of c-fos. We designed 2 RNAi constructs same complex (Fig. 3A). The association of CREB with TOX3 was targeting different regions of TOX3 (see Materials and Methods). confirmed in experiments in which the tags in the transfected The TOX3 RNAi constructs were very effective in knocking proteins were reversed (Fig. 3C). In these experiments, we could down expression of cotransfected TOX3 (Fig. 2A). To examine immunoprecipitate Myc.CREB and pull down HA.TOX3, or im- the contribution of TOX3 to depolarization-induced expression munoprecipitate HA.TOX3 and pull down Myc.CREB (Fig. 3 B of c-fos, we knocked down TOX3 by cotransfecting the TOX3 and C). To further examine the interaction of CREB and TOX3, RNAi constructs along with a pBos.eGFP plasmid into rat E18 we transfected neurons with Myc.TOX3 and could pull down neuronal culture on day in vitro 3 (DIV3). When the neurons endogenous CREB with anti-Myc immunoprecipitation (Fig. 3D). were depolarized with 50 mM KCl for2honDIV4,the The association of transfected TOX3 and endogenous CREB in enhancement of the endogenous c-fos expression was clearly neuron was not affected by KCl stimulation (Fig. 3E). Immuno- detected by immunofluorescence (Fig. 2B). However, KCl- precipitation of endogenous TOX3 in neurons also coprecipitated induced c-fos expression was greatly reduced in the TOX3 endogenous CREB (Fig. 3F). These experiments indicate that knockdown cells (Fig. 2C). The effect of RNAi-mediated knock- TOX3 interacts with CREB, and the interaction is not depolariza- down of c-Fos expression could be reversed by cotransfecting an tion dependent. RNAi-insensitive TOX3 construct carrying same-sense muta- We next investigated whether TOX3 could also associate with tion in TOX3. These observations indicate that endogenous CBP by cotransfecting HEK293T cells with HA-tagged CBP and TOX3 contributes significantly to depolarization-induced ex- Myc-tagged TOX3. As shown in Fig. 3G, HA.CBP could be pression of c-fos in neurons. coprecipitated with Myc.TOX3, indicating that TOX3 and CBP Association of TOX3 with CREB and CBP. Previous studies have are likely to be in the same complex also the degree of copre- identified the CREB–CBP complex as a key regulator of calcium- cipitation was generally less than TOX3 and CREB. To map the dependent c-fos expression. We therefore decided to explore the domain of TOX3 that mediates association with CBP, we possibility that TOX3 might influence calcium-dependent tran- transfected HEK293T cells with HA.CBP along with Myc- scription by exerting an effect on CREB and/or CBP. To determine tagged deletion constructs of TOX3. These experiments showed whether TOX3 and CREB were in a complex together, we co- that the N terminus (1–870) domain alone did not interact with transfected Myc.TOX3 and HA.CREB into HEK293T cells and CBP but that the C-terminal domain (1174–1734) could be evaluated whether the 2 proteins could be coimmunoprecipitated. coprecipitated with CBP. Thus, TOX3 seems to interact with Immunoprecipitation with anti-Myc antibodies followed by an CBP through its C terminus (Fig. 3 H and I).

Yuan et al. PNAS Early Edition ͉ 3of6 Downloaded by guest on September 25, 2021 ABMyc.TOX3 -- HA.TOX3 C HA.TOX3 -- HA.CREB HA.CREB Myc.CREB Myc.CREB Myc.CREB

IP IP IP IP IP IgG anti-Myc anti-Myc Input IgG anti-CREB IgG anti-HA anti-HA Input

50 kD -

Input

WB: anti-HA WB: anti-HA WB: anti-HA WB: anti-Myc WB: anti-Myc

D IP E IP F IP IgG anti-Myc IgG anti-HA IgG anti-TOX3 - KCl + KCl WB: anti-CREB WB: anti-CREB

WB: anti-Myc WB: anti-HA WB: anti-CREB

G Myc.TOX3 H IP: anti-HA I Input: (whole cell extract) HA.CBP kD kD 50 - 50 - IP

IgG anti-HA 80 kD 36 - 36 - Input: anti-Myc 80 kD

WB: anti-Myc 734 734 1 - 870 1 74 - 1734 1 - 870 - 712 - 1734871 - 1 11 712 - 1734871 - 1734 1174 TOX3 domains TOX3 domains

WB: anti-Myc WB: anti-Myc

Fig. 3. TOX3 associates with CREB and CBP. HEK 293T cells were transfected with (A) Myc.TOX3 and HA.CREB or HA.CREB alone, or (B and C) HA.TOX3 and Myc.CREB or Myc.CREB alone. (A) Immunoprecipitation (IP) with anti-Myc antibody, Western blot (WB) with anti-HA antibody. (B) IP with anti-CREB antibody, WB with anti-HA antibody. (C) IP with anti-HA antibody, WB with anti-Myc antibody. (D) Cortical neurons were transfected with Myc.TOX3. IP performed with Myc antibody, WB with anti-CREB and anti-Myc antibodies. (E) Cortical neurons transfected with HA.TOX3 and treated with 50 mM KCl for 10 min before IP. IP with anti-HA antibody, WB with anti-CREB and anti-HA antibodies. (F) IP of the E18 cortical lysate with TOX3 antiserum and WB with anti-CREB antibody. (G) HEK 293T cells were cotransfected with Myc.TOX3 and HA.CBP. IP with anti-HA antibody and WB with anti-Myc antibody. (H and I) HEK 293T cells were cotransfected with Myc.TOX3 base pairs 1–870, 712-1734, 871-1734, or 1174–1734 and full-length CBP. (H) IP with anti-HA antibody and WB with anti-Myc antibody. (I) Western blot of the input with anti-Myc antibody.

Effect of TOX3 on CREB- and CRE-Mediated Transcription. To deter- 4E, this promoter construct is weakly calcium responsive. We mine whether TOX3 contributed to depolarization-induced ac- found that Myc.TOX3 expression did not increase expression of tivation of CREB- and CBP-mediated transcription, we trans- the m2G/fosCAT reporter (Fig. 4E), suggesting that TOX3 fected neurons with Gal4-CREB and UAS-CAT, along with a exerts its effects via the CRE sites. scrambled RNAi or a TOX3 RNAi. As shown in Fig. 4 A and B, Finally, to determine whether endogenous TOX3 contributes KCl-induced transcription mediated both by Gal4-CREB and to calcium activation of the c-fos promoter, we examined the Gal4-CBP was attenuated by the TOX3 RNAi. Gal4-CREST- effect of 2 different TOX3 RNAi constructs on KCl activation mediated transcription was not affected by TOX3 RNAi, indi- of c-fos-CAT. As shown in Fig. 4F, the induction of c-fos-CAT cating that TOX3 is not involved in all calcium-dependent expression was completely blocked by both TOX3 RNAi con- transcription (Fig. 4C). The association of TOX3 with CREB structs, indicating that TOX3 is required for depolarization- and CBP suggested that TOX3 might influence transcription via induced activation of the c-fos promoter. These observations CRE, because transcription via this element is regulated by the suggest that TOX3 is a key regulator of CRE-mediated tran- CREB–CBP complex. To explore this possibility, we examined scription and likely exerts its effect via interaction with the the effect of TOX3 on the expression of a c-fos-CAT reporter. CREB–CBP complex. As shown in Fig. 4D, stimulation with 50 mM KCl leads to a significant increase in the expression of the c-fos-CAT reporter. Discussion Coexpression of TOX3 increased the c-fos-CAT reporter activity Our experiments identify TOX3 as a novel regulator of calcium- both at baseline and after stimulation (Fig. 4D). dependent transcription. The importance of TOX3 in calcium- To determine whether TOX3 acts at the CRE sites, we used dependent transcription is underscored by the observation that the m2G/fosCAT reporter construct, which consisted of the c-fos knockdown of TOX3 attenuates endogenous c-fos expression promoter but with all 3 CRE sites mutated (18). As shown in Fig. and completely blocks KCl-induced activation of the c-fos pro-

4of6 ͉ www.pnas.org͞cgi͞doi͞10.1073͞pnas.0805555106 Yuan et al. Downloaded by guest on September 25, 2021 *

AB* C

ity

CAT Activ CAT

Relative CAT Activity CAT Relative

Relative Relative CAT Activity CAT Relative

Gal4.CREB +++ + Gal4.CBP +++ + Gal4.CREST +++ + UAS.CAT ++++ UAS.CAT ++++ UAS.CAT ++++ scrRNAi ++ - - scrRNAi +-+ - scrRNAi +-+ - RNAi #1 --+ + RNAi #1 --+ + RNAi #1 --+ + KCl +- - + KCl -++ - KCl -++ -

* D E F * * Relative CAT Activity Relative CAT Relative CAT Activity Relative CAT Relative CAT Activity Relative CAT

c-fos-CAT +++ + m2G/fosCAT + + + + c-fos-CAT +++ ++++ + pBos ++- - pBos ++ - - RNAi.scr ++------Myc.TOX3 --+ + Myc.TOX3 - -++ RNAi #1 ---+++ - + KCl -++ - KCl -++ - RNAi #2 --+--- + - Myc.TOX3R -----+ - + pBos +++++- + - KCl -+--++ + - NEUROSCIENCE

Fig. 4. Effect of TOX3 on CRE-mediated transcription. (A) Relative CAT activity in rat E18 cortical neuronal cultures transfected with Gal4.CREB, UAS.CAT, and scrambled RNAi (scrRNAi) or TOX3 RNAi#1 on DIV3 and assayed for CAT activity on DIV5. Cultures were treated either with 50 mM KCl or PBS on DIV4 for 12 h. (B) Relative CAT activity in rat E18 cortical neuronal cultures transfected with Gal4.CBP, UAS.CAT, and scrambled RNAi (scrRNAi) or TOX3 RNAi#1 on DIV3 and assayed for CAT activity on DIV 5. Cultures were treated with either 50 mM KCl or PBS on DIV4 for 12 h. (C) Relative CAT activity in rat E18 cortical neuronal cultures transfected with Gal4.CREST, UAS.CAT, and scrambled RNAi (scrRNAi) or TOX3 RNAi#1 on DIV3 and assayed for CAT activity on DIV5. Cultures were treated with either 50 mM KCl or PBS on DIV4 for 12 h. (D) Relative CAT activity in rat E18 cortical neuronal cultures transfected with c-fos-CAT and either vector (pBos) or Myc.TOX3 on DIV3 and assayed for CAT activity on DIV5. Cultures were treated with either 50 mM KCl or PBS on DIV4 for 12 h. (E) Relative CAT activity in rat E18 cortical neuronal cultures transfected with m2G/foscat and vector (pBos) or Myc.TOX3 on DIV3 and assayed for CAT activity on DIV5. Cultures were treated with either 50 mM KCl or PBS on DIV4 for 12 h. (F) Relative CAT activity in rat E18 cortical neuronal cultures transfected with c-fos-CAT and either scrambled RNAi (RNAi.scr), TOX3 RNAi#1, RNAi#2, or Myc.TOX3R and RNAi#1 on DIV3 and assayed for CAT activity on DIV5. Cultures were treated with either 50 mM KCl or PBS on DIV4 for 12 h. *, P Ͻ 0.05.

moter. It has long been known that the CREB–CBP complex TOX3 is an HMG box protein, which are nonhistone chro- mediated transcription via CRE sites on calcium responsive mosomal proteins that have been demonstrated to bend DNA by promoters. We find that TOX3 interacts with this complex, interacting with the minor grooves of the DNA helix (6). For suggesting that this interaction is important for the effects of example, LEF, an HMG box transcription factor involved in TOX3 on mediating calcium-dependent gene expression. Cal- mediating the effects of Wnt signaling, is thought to activate cium signaling regulates expression of a number of different transcription via its DNA-bending activity (20). The putative genes, and calcium-dependent transcription has been implicated DNA-bending activity of TOX3 might facilitate CRE-mediated in a wide range of neuronal adaptive responses, such as activity- transcription by bringing the CREB–CBP complex close to the dependent dendritic development, long-term memory, and ad- transcription start site. The DNA-bending activity of HMG box diction [reviewed in Qiu and Ghosh (19)]. It will be interesting proteins, together with the interaction with sequence-specific to determine whether these biologic responses depend on TOX3 transcription factors as demonstrated for TOX3, might allow function. HMG box proteins to mediate stimulus-dependent transcription The effect of TOX3 on transcription depends on a functional via specific regulatory elements. interaction with CREB. This is supported by the observation that the ability of TOX3 to confer calcium responsiveness to the Materials and Methods c-fos-CAT reporter is abolished when the CRE sites are re- Cell Culture and Transfection. Timed-pregnant Long Evans rats were purchased moved. The fact that TOX3 associates with CBP via its C from Charles River. Animals were housed and handled according to animal terminus, which is also required for calcium-dependent activa- protocols approved by the University of California, San Diego Animal Care tion of Gal4-TOX3, suggests that the interaction with CBP is Program. Cortical neurons from E18 rat embryos were cultured as previously ϫ 6 important for calcium-dependent activation of TOX3-mediated described (21). Brieﬂy, E18 rat cortical neurons were plated at 1 10 cells/mL transcription. We should emphasize that although our experi- on coverslips coated with poly-D-lysine and laminin. On DIV3, neurons were transfected with DNA using lipofectamine 2000 (Invitrogen). HEK293T cells ments support the association of TOX3 with both CREB and were transfected with Fugene6 (Invitrogen) according to the manufacturer’s CBP, we do not yet know whether all 3 proteins are in fact instructions. present in 1 complex and whether the interaction of TOX3 with CREB and CBP are direct. A definitive resolution of this will Constructs. A partial sequence of TOX3 was initially cloned out from the P1 rat require purification of the endogenous complexes, as well as cDNA library through the Transactivator Trap screen. Subsequently, primers binding assay with purified proteins. were designed to clone the full length of TOX3 from E18 rat brain cDNA by PCR

Yuan et al. PNAS Early Edition ͉ 5of6 Downloaded by guest on September 25, 2021 and cloned into the polylinker of the pBos vector (22). The PCR primers were were washed and resuspended in 1ϫ SDS buffer and loaded on a 10% SDS gel 20 bases long, each homologous to the 5Ј end beginning at the start codon after boiling. The protein was then transferred to nitrocellulose paper (In- and to the 3Ј end with the stop codon of the NCBI Reference Sequence vitrogen) for Western blot. The blot was detected by horseradish peroxidase predicted sequence. The RNA interference construct was made using NCBI at 1:5,000 dilution in blocking buffer. BLAST by first selecting the antisense sequence consisting of 21 nucleotides in the coding region of TOX3, according to the selection criteria described by Generation of TOX3 Antiserum. Full-length rat TOX3 cDNA was amplified and Ui-Tei et al. (23). Oligonucleotides containing the sense and antisense se- cloned into pQE70 (Novagen) for expression of His-tagged TOX3 in bacteria. quence with a loop in between were synthesized and annealed for cloning After isopropyl-␤-D-thiogalactopyranoside induction, the TOX3 recombinant into pSilencer1 (Ambion). The scrambled RNAi sequence was: sense, GACGAT- protein was collected in the inclusion body from the bacteria by treating with GTTCCAGTGCTGA; anti-sense, TCAGCACTGGAACATCGTC. The TOX3 RNAi#1 8 M urea, and subsequently was purified by passing through an Ni-NTA sequence was: sense, GTGTTACCGCAGGTCAGTATT; anti-sense, AATACTGAC- agarose column (Qiagen). The eluted protein was resolved on a 10% SDS- CTGCGGTAACAC. The TOX3 RNAi#2 sequence was: sense, CACGTCACTGTCT- polyacrylamide gel. After staining with Coomassie brilliant blue, the TOX3 CAACAT; anti-sense, ATGTTGAGACAGTGACGTG. PfuUltra (Stratagene) was band was excised and injected into rabbits to produce anti-TOX3 antiserum. used to clone out the TOX3 fragments into pBos. The rescue construct, pBos.myc.TOX3R, for RNAi#1, was constructed by using the QuikChange II Immunocytochemistry. Cells were grown on glass coverslips (North Carolina Site-Directed Mutagenesis Kit (Stratagene), for which 4 nucleotides were Biological) pretreated with Radiacwash. When the cells were ready to be changed, without changing the amino acids. The following constructs have fixed, they were incubated in 4% paraformaldehyde/4% sucrose for 20 min been described previously: HA-CBP (11), c-fos-CAT (18), and m2G/foscat (18). and then washed with PBS 3 times. Subsequently the coverslips were blocked with 3% BSA and 0.3% Triton X-100 for 30 min. They were incubated with CAT Reporter Assay. Plasmids were transfected into E18 rat neuronal culture primary antibody for 2 h and then secondary antibody for1hatroom on DIV3 by lipofectamine 2000 (Invitrogen). Cells were treated with 50 mM KCl temperature. The coverslips were mounted with Fluoromount (EMS). Dilu- or PBS for 12 h on DIV4 to observe transactivation induced by the influx of tions of antibody used were: c-fos (EMD, rabbit polyclonal 1:2,000); and eGFP calcium. Cells were collected at DIV5 with Tris-NaCl-EDTA (TNE) buffer, fol- (Abcam, goat polyclonal 1:3,000). lowed by lysis via repetitive freeze–thaw cycles. Lysates were collected and incubated with 14C-chloramphenicol for detection of the CAT activity. The Northern Blot. Cortices were dissected out from E18, P0, P7, P14, P21, and adult mixtures were then loaded on TLC plates and allowed to migrate in a glass rats. Total RNA was prepared with TRIZOL (Invitrogen). Ten to twenty nano- chamber equilibrated with 5% methanol and 95% chloroform. The TLC plate grams of RNA were resolved on a 20% formaldehyde agarose gel. Probe 32 was exposed to a phosphorimager cassette overnight. The signals were de- hybridizing to the first 700 nucleotides of TOX3 was labeled with P (Perkin- tected by PhosphoImager (Amersham-Pharmacia) and ImageQuant (Molecu- Elmer) using Ready-To-Go DNA Labeling Beads (-dCTP) (GE Healthcare). The lar Dynamics). blot was exposed to x-ray film (Kodak) for 2–5 days and then developed.

Immunoprecipitation. HEK 293T cells or rat E18 cortical neurons were trans- ACKNOWLEDGMENTS. We thank David Ginty and Amir Kashani for constructs; Marc Montminy and members of the Ghosh Laboratory for comments fected with different constructs by lipofectamine at 50% conﬂuency. Cells and discussion; and Stephen LeSourd for manuscript preparation. This work were collected by nonionic detergent lysis buffer or modiﬁed RIPA buffer and was funded by a grant from the National Institute of Mental Health subsequently incubated overnight with agarose A/G beads (Santa Cruz Bio- (MH068578). S.H.Y was supported by a National Institute on Aging K12 technology) that had already been preincubated with antibodies. The beads training grant.

1. West AE, et al. (2001) Calcium regulation of neuronal gene expression. Proc Natl Acad 13. Chawla S, Hardingham GE, Quinn DR, Bading H (1998) CBP: A signal-regulated tran- Sci USA 98:11024–11031. scriptional coactivator controlled by nuclear calcium and CaM kinase IV. Science 2. Aizawa H, et al. (2004) Dendrite development regulated by CREST, a calcium-regulated 281:1505–1509. transcriptional activator. Science 303:197–202. 14. Hardingham GE, Chawla S, Cruzalegui FH, Bading H (1999) Control of recruitment and 3. Ince-Dunn G, et al. (2006) Regulation of thalamocortical patterning and synaptic transcription-activating function of CBP determines gene regulation by NMDA recep- maturation by NeuroD2. Neuron 49:683–695. tors and L-type calcium channels. Neuron 22:789–798. 4. Kashani AH, et al. (2006) Calcium activation of the LMO4 transcription complex and its 15. Impey S, et al. (2002) Phosphorylation of CBP mediates transcriptional activation by role in the patterning of thalamocortical connections. J Neurosci 26:8398–8408. neural activity and CaM kinase IV. Neuron 34:235–244. 5. Wilkinson B, et al. (2002) TOX: An HMG box protein implicated in the regulation of 16. Kitsos CM, et al. (2005) Calmodulin-dependent protein kinase IV regulates hemato- thymocyte selection. Nat Immunol 3:272–280. poietic stem cell maintenance. J Biol Chem 280:33101–33108. 6. Travers AA (2003) Priming the nucleosome: A role for HMGB proteins? EMBO Rep 17. Margolis RL, et al. (1997) cDNAs with long CAG trinucleotide repeats from human 4:131–136. brain. Hum Genet 100:114–122. 7. Montminy MR, Bilezikjian LM (1987) Binding of a nuclear protein to the cyclic-AMP 18. Ginty DD, Bonni A, Greenberg ME (1994) Nerve growth factor activates a Ras- response element of the somatostatin gene. Nature 328:175–178. dependent protein kinase that stimulates c-fos transcription via phosphorylation of 8. Gonzalez GA, Montminy MR (1989) Cyclic AMP stimulates somatostatin gene tran- CREB. Cell 77:713–725. scription by phosphorylation of CREB at serine 133. Cell 59:675–680. 19. Qiu Z, Ghosh A (2008) A brief history of neuronal gene expression: Regulatory mech- 9. Ginty DD, et al. (1993) Regulation of CREB phosphorylation in the suprachiasmatic anisms and cellular consequences. Neuron 60:449–455. nucleus by light and a circadian clock. Science 260:238–241. 20. Sheridan PL, et al. (1995) Activation of the HIV-1 enhancer by the LEF-1 HMG protein 10. Sheng M, Thompson MA, Greenberg ME (1991) CREB: A Ca(2ϩ)-regulated tran- on nucleosome-assembled DNA in vitro. Genes Dev 9:2090–2104. scription factor phosphorylated by calmodulin-dependent kinases. Science 21. Threadgill R, Bobb K, Ghosh A (1997) Regulation of dendritic growth and remodeling 252:1427–1430. by Rho, Rac, and Cdc42. Neuron 19:625–634. 11. Chrivia JC, et al. (1993) Phosphorylated CREB binds speciﬁcally to the nuclear protein 22. Mizushima S, Nagata S (1990) pEF-BOS, a powerful mammalian expression vector. CBP. Nature 365:855–859. Nucleic Acids Res 18:5322. 12. Hu SC, Chrivia J, Ghosh A (1999) Regulation of CBP-mediated transcription by neuronal 23. Ui-Tei K, et al. (2004) Guidelines for the selection of highly effective siRNA sequences calcium signaling. Neuron 22:799–808. for mammalian and chick RNA interference. Nucleic Acids Res 32:936–948.

6of6 ͉ www.pnas.org͞cgi͞doi͞10.1073͞pnas.0805555106 Yuan et al. Downloaded by guest on September 25, 2021