Histone H1 and the Origin of Protamines
Total Page：16
File Type：pdf, Size：1020Kb
Histone H1 and the origin of protamines John D. Lewis*†,Nu´ ria Saperas†‡, Yue Song*, Maria Jose Zamora§, Manel Chiva§, and Juan Ausio´ *¶ *Department of Biochemistry and Microbiology, University of Victoria, P.O. Box 3055, Petch Building, Victoria, BC, Canada V8W 3P6; ‡Departament d’Enginyeria Quı´mica,Escola Te`cnica Superior d’Enginyers Industrials de Barcelona, Universitat Polite`cnica de Catalunya, Diagonal 647, E-08028 Barcelona, Spain; and §Departament de Cie`ncies Fisiolo`giques II, Facultat de Medicina, Campus de Bellvitge, Universitat de Barcelona, L’Hospitalet de Llobregat, E-08907 Barcelona, Spain Communicated by K. E. van Holde, Oregon State University, Corvallis, OR, December 30, 2003 (received for review August 11, 2003) We present evidence that chordate protamines have evolved from point mutations, driven by the selective advantage conferred by histone H1. During the final stages of spermatogenesis, the com- the increased efficiency of highly basic molecules to screen the paction of DNA in many organisms is accomplished by the replace- charge of DNA and thus achieve a more compact chromatin ment of histones with a class of arginine-rich proteins called structure. The relatively quick specialization of histone H1 for protamines. In other organisms, however, condensation of sperm sperm chromatin compaction is not unexpected, because sperm DNA can occur with comparable efficiency in the presence of nuclear basic proteins (SNBPs), like many of the reproductive somatic-type histones or, alternatively, an intermediate class of proteins, are among the most rapidly evolving proteins in the proteins called protamine-like proteins. The idea that the highly animal kingdom (14, 15). specialized sperm chromosomal proteins (protamines) and somatic It has been suggested that protamines did not arise from an chromosomal proteins (histones) could be related dates back al- ancient eukaryotic protein but instead have a retroviral origin most to the discovery of these proteins. Although this notion has (16). The hypothesis of retroviral horizontal transmission was frequently been revisited since that time, there has been a com- proposed to account for the apparently random distribution of plete lack of supporting experimental evidence. Here we show that protamines in fish and was based on the observation that the the emergence of protamines in chordates occurred very quickly, as flanking regions of the protamine genes from rainbow trout a result of the conversion of a lysine-rich histone H1 to an exhibit a large degree of similarity to the long terminal repeats arginine-rich protamine. We have characterized the sperm nuclear of avian retroviruses (16). However, a detailed systematic anal- basic proteins of the tunicate Styela montereyensis, which we ysis of the distribution of SNBPs in fish provided additional show consists of both a protamine and a sperm-specific histone H1 support for the vertical evolution hypothesis by revealing that the with a protamine tail. Comparison of the genes encoding these sporadic distribution of protamines was not random and could be proteins to that of a sister protochordate, Ciona intestinalis, has traced phylogenetically (17). The principal difficulty with the indicated this rapid and dramatic change is most likely the result of theory of vertical evolution of protamines, however, was the frameshift mutations in the tail of the sperm-specific histone H1. By absence of a mechanism by which a mainly lysine-rich histone H1 establishing an evolutionary link between the chromatin-condens- could be converted to an extremely arginine-rich protamine. ing histone H1s of somatic tissues and the chromatin-condensing To address this difficulty, we have examined the SNBPs of the proteins of the sperm, these results provide unequivocal support to primitive chordates Styela montereyensis and Styela plicata, re- the notion that vertebrate protamines evolved from histones. vealing that each possesses both an arginine-rich protamine and a histone H1 with an extremely arginine-rich protamine tail. he canonical structure of histone H1 consists of a tripartite Another tunicate, Ciona intestinalis, was found to possess a single Torganization, with a globular core containing a conserved major SNBP, a lysine-rich sperm-specific histone H1. The sur- winged helix motif, flanked by less well conserved lysine-rich N- prising result of a sequence comparison of the genes encoding and C-terminal tails. Somatic histone H1s typically contain little these proteins has indicated that this wholesale compositional or no arginine. In contrast, protamines are relatively small change is the result not of a gene fusion event (retroviral or (4,000–12,000 Da), are composed of Ͼ50% arginine, and con- otherwise) but rather of a frameshift mutation in the tail of the tain little or no lysine (1). From the time that these nuclear sperm-specific histone H1. This observation provides direct proteins were first characterized, it was suggested that histones evidence for an evolutionary mechanism linking the histones of of somatic cells and protamines of germ cells were evolutionarily somatic tissues with protamines. related (2, 3). It was hypothesized in 1973 (4), based on com- positional amino acid analysis, that protamines had evolved from Materials and Methods a primitive somatic-like histone precursor via a protamine-like Protein Extraction and Sequencing. Chromosomal sperm proteins (PL) intermediate through a mechanism of vertical evolution. were extracted and isolated as described (18). Buffers used This is supported by the observation that organisms that replace during the isolation of proteins contained Complete protease histones with protamines in the mature sperm are always found inhibitor mixture tablets (Boehringer). The dried pellets were at the furthermost tips of the evolutionary branches (5), whereas stored at Ϫ80°C. Protein sequencing was performed on an ABI organisms that retain sperm-specific germinal histones are found Model 473 gas-phase protein sequenator at the Protein Micro- in the sperm of more primitive organisms such as the sponge chemistry Center of the University of Victoria, British Columbia, Neofibularia (6) and the sea urchin (7). as described (18). Histone H1-like sperm nuclear proteins have been identified in a diverse range of organisms, including marine invertebrates Gel Electrophoresis. Acetic acid (5%)͞urea (2.5 M)͞polyacryl- (8), amphibians (9, 10), and fish (11, 12). In comparison to their amide gels were prepared as described in ref. 18. somatic counterparts, histone H1s that mediate sperm-specific chromatin compaction contain elevated amounts of the charged amino acids lysine and arginine. Although the C-terminal tails of Abbreviations: SNBP, sperm nuclear basic protein; PL, protamine-like. somatic H1s are composed of 30–40% lysine and no arginine, Data deposition: The sequences reported in this paper have been deposited in the GenBank the C-terminal tail of the sperm-specific histone H1 of sea urchin database (accession no. AY332242). (13) contains 44.3% lysine and 8.4% arginine (Arg ϩ Lys ϭ †J.D.L. and N.S. contributed equally to this work. 52.7%). The mechanism responsible for this increase in both ¶To whom correspondence should be addressed. E-mail: [email protected]. lysine and arginine content is most certainly an accumulation of © 2004 by The National Academy of Sciences of the USA 4148–4152 ͉ PNAS ͉ March 23, 2004 ͉ vol. 101 ͉ no. 12 www.pnas.org͞cgi͞doi͞10.1073͞pnas.0308721101 Downloaded by guest on October 5, 2021 tained from degenerate PCR. The primers were CCTTCGA- ATACGACCTACTATAGGGCG (5Ј primer) and GCGGC- CTCTTCGCTATTACGCCAGC (3Ј primer). Results The sperm of the ascidians, S. montereyensis and S. plicata, contains two major nuclear basic proteins (Fig. 1A) (19). These proteins coexist in the mature sperm with 20–25% of a full somatic-type histone complement. Early in this project, we were interested in obtaining the primary amino acid sequence of the SNBPs of S. plicata. Protein microsequencing of the smaller of the two proteins established its identity as a protamine of 91 aa (Styela P2) (Fig. 1B). Containing 51.6% arginine residues ar- ranged in tracts of four to eight residues each, the Styela protamine also displays an unusually high lysine content (20.4%) in comparison with other protamines. Unlike the human pro- Fig. 1. (A) Acetic acid (5%)͞urea (2.5 M)͞polyacrylamide gel electrophoresis tamines P1 and P2, it does not contain cysteine or histidine, of sperm nuclear proteins extracted from testes from Mytilus californianus respectively (1). Protein microsequencing proved to be extremely (Mc), California mussel, used as a protein marker. Mytilus PL proteins are difficult and time-consuming for the second major SNBP (Styela indicated by the orange bars. Sm, S. montereyensis; Ci, C. intestinalis. Somatic- P1), a PL protein that is a much larger 165 aa and consists of two type histones are indicated by bars; sperm nuclear proteins referred to in the distinct domains (Fig. 1C). The leading 78 residues of S. plicata text are indicated by arrows. (B) Amino acid microsequencing results for the S. plicata P2 protein. (C) Amino acid microsequencing results for the S. plicata P1 show a remarkable similarity to the N-terminal tail and P1 protein. globular region of histone H1 (Fig. 3B) and to the sperm-specific H1s and PL H1 proteins of other invertebrates (20, 21). The C-terminal tail, surprisingly, is comprised of a 91-aa sequence Degenerate PCR and RACE. Degenerate primers for PCR were (amino acids 75–165) identical to that of the protamine (P2) (Fig. created based on the amino acid sequence of the P1 protein from 2B). This protein therefore represents a previously undescribed S. plicata, with the sequences TAYAAYGTHATGGTH- direct evolutionary link between histone H1 and protamines. AARMG (5Ј primer) and TTRTTYTTRTADATRAANCC- Using degenerate primers based on the amino acid sequence NCC (3Ј primer). PCR was performed on genomic DNA from from S. plicata, a genomic fragment of the larger sperm nuclear S. montereyensis by using the PCRSprint thermal cycler (Hybaid, protein (P1) was obtained from the very closely related S.