Regulation of B Lymphopoiesis: the Role of IL-7, SOCS-1, Heparan Sulfate and CD19 in Mediating B Cell Development

Home , IGLL1, Lymphopoiesis

Regulation of B Lymphopoiesis:

The Role of IL-7, SOCS-1, Heparan Sulfate and CD19 in Mediating B Cell Development

Steven Alexander Corfe

A thesis submitted in conformity with the requirements for the degree of Doctor of Philosophy

Department of Immunology University of Toronto

Abstract

Regulation of B Lymphopoiesis: The Role of IL-7, SOCS-1, Heparan Sulfate and CD19 in Mediating B Cell Development

Degree of Doctor of Philosophy Steven Alexander Corfe Graduate Department of Immunology, University of Toronto

B lymphopoiesis is regulated by cytokines, chemokines and cell surface proteins that initiate signal transduction pathways necessary for maturation to proceed. Many of these factors are expressed by cells in the surrounding bone marrow (BM) microenvironment, which also form the niches that support development. Interleukin-7 (IL-7) is an essential cytokine for progenitor B cells and is important in providing survival, proliferation and maturation signals.

By growing BM B cells for extended periods of time in vitro with IL-7 it is possible to select for cells that possess the ability to grow indefinitely, and these cultures can be used to generate cell lines. Data presented herein describe the generation and characterization of

IL-7-dependent B cell lines as well as their utility in investigating aspects of B cell development. As B cells mature they lose responsiveness to IL-7, yet retain IL-7 receptor expression. I demonstrate that a B cell’s ability to respond to IL-7 is controlled by the expression of suppressor of cytokine signaling (SOCS) proteins, which are regulated by a variety of signaling pathways including those initiated by IL-7. Development of progenitor B cells to mature immunoglobulin secreting B cells is mediated in part by surface proteins present on stromal cells as well as on B cells themselves. Heparan sulfate and CD19 play important roles in regulating this transition and I provide data that demonstrates how their ability to regulate Erk activation downstream of the pre-B cell receptor (pre-BCR) alters the proliferation and maturation of developing B cells.

Acknowledgments

Sometimes in life, you really just don’t know what you are getting yourself into. I don’t think that I have ever found this to be truer than with my PhD. What began as a purely academic pursuit became something so much more; a journey. And, as with most of life’s journeys, it had its trials and tribulations, and at times I wasn’t sure how it would all come together, but merely that it would. Through this process I have come to realize a few things:

Your colleagues are critical. These are the people that you spend the majority of your working days with and over time become your second family. If they are bad, it makes you dread going into work, if they are good, then it can make your day that much more pleasant, even when your experiments don’t work or your paper gets rejected. I was fortunate enough to have met some of the nicest, smartest and funniest people during my time in the Paige lab, which will be friends for life. This sense of camaraderie is a direct reflection of my supervisor Dr. Christopher Paige, who along with his wife Colleen, have always cared enough to welcome me into their home and share in my successes, both professional and personal. I won’t soon forget all those memorable feasts, flowing wine and lively nights.

Mentorship is key. Chris allows students to find their own path and become independent critical thinking scientists. He was there to keep me on track when I struggled and I will always be thankful for his patience, optimism and intellectual guidance.

Without the unconditional love and support of friends and family you won’t get very far. I want to thank my mom, for her unwavering confidence in my abilities and encouragement to always try and make a difference in the world. To my dad, for showing me through example what a strong work ethic is and giving me something to aspire toward. To the O’Brien family, for always making feel at home and treating as their own. We SHOUT with love! To my best friend Oliver, who I knew would always understand and could count on to put things in perspective. And to my wonderful wife Johanna, who has endured this process with grace, compassion and love. I am ever grateful that we found each other and look forward to our next steps together. BF!

Finally, you can’t do anything alone. To all those other friends and family who helped me along the way I would like to say THANK YOU, I couldn’t have done it without you.

In the end it was much more about the journey than the destination.

iii

Table of Contents

ABSTRACT ...... II

ACKNOWLEDGMENTS ...... III

TABLE OF CONTENTS ...... IV

LIST OF ABBREVIATIONS ...... VIII

LIST OF TABLES ...... X

LIST OF FIGURES ...... XI

CHAPTER 1 ...... 1

1 INTRODUCTION ...... 1 1.1 B CELL DEVELOPMENT AND FUNCTION ...... 2 1.2 B CELL ONTOGENY ...... 5 1.3 MARKERS OF B CELL DIFFERENTIATION ...... 6 1.4 MECHANISMS OF ANTIBODY DIVERSITY ...... 8 1.5 TRANSCRIPTION FACTOR REGULATION OF B CELL COMMITMENT ...... 9 1.6 TRANSCRIPTION FACTOR REGULATION OF B CELL DIFFERENTIATION ...... 13 1.7 ENVIRONMENTAL REGULATION OF IN VIVO AND IN VITRO B CELL DEVELOPMENT ...... 14 1.8 IL-7 REGULATION OF B CELL DEVELOPMENT ...... 16 1.9 IL-7 RECEPTOR SIGNALING IN B CELLS ...... 18 1.10 TROPHIC VERSUS INSTRUCTIVE ROLES OF IL-7 ...... 23 1.11 IL-7 REGULATION OF B CELL SURVIVAL, PROLIFERATION AND MATURATION ...... 24 1.12 THE ROLE OF IL-7 IN V(D)J RECOMBINATION ...... 26 1.13 PRE-BCR AND BCR REGULATION OF B CELL DEVELOPMENT ...... 29 1.14 PRE-BCR ACTIVATION ...... 30 1.15 PRE-BCR SIGNALING ...... 32 1.16 PRE-BCR MEDITATED EVENTS ...... 34 1.17 SURFACE PROTEIN REGULATION OF RECEPTOR SIGNALING ...... 35 1.18 SELECTION OF B CELLS ...... 37 1.19 DEVELOPMENT AND FUNCTION OF MATURE B CELLS ...... 38 1.20 THESIS OUTLINE ...... 41

CHAPTER 2 ...... 44

2 MATERIALS AND METHODS ...... 44 2.1 MICE ...... 45 2.2 ISOLATION OF B CELLS ...... 45 2.3 MAGNETIC ACTIVATED CELL SORTING (MACS) ...... 45 2.4 FLUORESCENCE ACTIVATED CELL SORTING (FACS) ...... 46 2.5 CELL CULTURING WITH IL-7 ...... 48 2.6 LPS CULTURES ...... 48 2.7 GENERATION OF IL-7-DEPENDENT CELL LINES ...... 49 2.8 CLONING OF CELL LINES ...... 51 2.9 IMMUNOFLUORESCENCE STAINING AND FLOW CYTOMETRY ...... 51 2.10 CELL STIMULATION AND WESTERN ANALYSIS ...... 52 2.11 IL-7-RESPONSIVENESS (LIMITING DILUTION ASSAY) ...... 53 2.12 ENZYME LABELED IMMUNOSORBENT ASSAY (ELISA) ...... 53 2.13 3H-THYMIDINE INCORPORATION ASSAY ...... 54 2.14 RT-PCR AND REAL-TIME PCR ...... 55 2.15 VIRAL INFECTIONS ...... 57

CHAPTER 3 ...... 58

3 GENERATION AND CHARACTERIZATION OF STROMAL CELL- INDEPENDENT IL-7-DEPENDENT B CELL LINES ...... 58 3.1 INTRODUCTION ...... 59 3.2 RESULTS ...... 60 3.2.1 Frequency of Generation of IL-7-Dependent B Cell Cultures ...... 60 3.2.2 IL-7-Dependent B Cell Culture Phenotypes Prior to Freezing ...... 63 3.2.3 Duplicate Plate Results ...... 65 3.2.4 Phenotype Comparison Before and After Cloning ...... 67 3.2.5 Clonal Responsiveness of IL-7-Dependent B Cell Lines ...... 67 3.2.6 Pre-BCR and IL-7R Signaling in IL-7-Dependent B Cell Lines ...... 70 3.3 DISCUSSION ...... 72

CHAPTER 4 ...... 76

4 MODULATION OF IL-7 THRESHOLDS BY SOCS PROTEINS IN DEVELOPING B LINEAGE CELLS ...... 76

4.1 INTRODUCTION ...... 77

4.2 RESULTS ...... 79 4.2.1 As B Lineage Cells Mature to the CD2+ Stage They Fail to Signal or Respond to IL-7 ...... 79 4.2.2 Enforced Expression of SOCS-1 in B Cell Lines Inhibits IL-7R Signaling and IL-7-Induced Proliferation ...... 82 4.2.3 Expression of Socs-1 and Socs-3 in Developing B Lineage Cells ...... 85 4.2.4 IL-7 Induces Socs-1 and Socs-3 Expression in B Cell Lines ...... 85 4.2.5 In Vitro Maturation of Primary B Lineage Cells Expressing SOCS-1 ...... 87 4.2.6 IFN-γ is Expressed in BM Cells and Inhibits IL-7-Induced Proliferation in B Cell Lines ...... 89 4.2.7 IFN-γ and IL-7 Induce Socs-1 and Socs-3 in B Cell Lines ...... 92 4.2.8 In vitro Maturation of Primary B Lineage Cells Treated with IFN-γ ...... 92 4.2.9 IL-21 Inhibits IL-7-Induced Proliferation and Induces Socs-1 Expression in B Cell Lines at High Concentrations of IL-7 ...... 94 4.2.10 Effects of CXCL12 and Anti-µ on B Cell Proliferation and SOCS Expression ...... 96 4.2.11 Expression and Function of Gfi-1b in Developing B Lineage Cells and B Cell Lines ...... 99 4.3 DISCUSSION ...... 103

CHAPTER 5 ...... 108

5 HEPARIN, HEPARAN SULFATE, AND CD19 REGULATION OF ERK PHOSPHORYLATION AND B CELL DEVELOPMENT ...... 108 5.1 INTRODUCTION ...... 109 5.2 RESULTS ...... 111 5.2.1 The Influence of Heparin, Heparan Sulfate and Heparitinase on B Cell Development in Cultures Containing IL-7 ...... 111 5.2.2 Heparin, Heparan Sulfate and Anti-CD19 Increase Signaling Via the Pre-BCR ...... 114 5.2.3 Heparin and Heparan Sulfate Affect Proliferation of Pre-BCR+ Cells ...... 117 5.2.4 CD19 Deficiency Alters the Maturation of B Cells in IL-7 But Does Not Alter the Affect of Heparin, Heparan Sulfate or Heparitinase ...... 119 5.2.5 CD19 Deficiency Inhibits the Development of B Cells to the IgM Secreting Stage But Does Not Alter the Affect of Heparin, Heparan Sulfate or Heparitinase ...... 121 5.2.6 CD19 Deficient Cells Display a Reduced Capacity to Activate Erk, But Normal Ability to Induce STAT5 and JAK1 ...... 123 5.2.7 CD19 Deficient Pre-BCR+ and BCR+ Cells Exhibit a Reduced Ability to Proliferate in Low Concentrations of IL-7 ...... 125 5.3 DISCUSSION ...... 127

CHAPTER 6 ...... 131

6 DISCUSSION ...... 131 6.1 INTRODUCTION ...... 132 6.2 GENERATION AND CHARACTERIZATION OF IL-7-DEPENDENT CELL LINES ...... 132 6.3 ESTABLISHMENT OF IL-7-DEPENDENT B CELL LINES ...... 135 6.4 IN VITRO DEVELOPMENT OF IL-7-DEPENDENT B CELL LINES ...... 137 6.5 GENERATING PRE-BCR+ AND BCR+ IL-7-DEPENDENT B CELL LINES ...... 139 6.6 IL-7-INDEPENDENT B CELL LINES ...... 140 6.7 REGULATION OF IL-7R SIGNALING IN DEVELOPING B CELLS ...... 143 6.8 EXPRESSION OF THE IL-7R DURING B CELL DEVELOPMENT ...... 143 6.9 REGULATION OF IL-7 AVAILABILITY DURING B CELL DEVELOPMENT ...... 145 6.10 REGULATION OF IL-7R SIGNALING DURING THE PRO-B TO PRE-B CELL TRANSITION ...... 146 6.11 REGULATION OF SOCS PROTEIN EXPRESSION ...... 149

6.12 IFN-γ REGULATION OF IL-7R SIGNALING IN DEVELOPING B CELLS ...... 152 6.13 IMPORTANCE OF CELL-CELL CONTACT IN MEDIATING B CELL DEVELOPMENT ...... 156 6.14 REGULATION OF B CELL DEVELOPMENT BY HEPARAN SULFATE ...... 157 6.15 CD19 REGULATION OF HEPARAN SULFATE ACTIVITY ...... 163 6.16 REGULATION OF B CELL DEVELOPMENT BY CD19 ...... 164 6.17 CONCLUSION...... 166

REFERENCES ...... 168

vii

List of Abbreviations

AB-MuLV Abelson murine leukemia virus AID activation induced cytidine deaminase BCR B cell receptor BLNK B cell linker protein BM bone marrow Btk Bruton's tyrosine kinase CD cluster of differentiation Cdk cyclin-dependent kinase CDR complimentary determining region CLP common lymphoid progenitor CMP common myeloid progenitor CPM counts per minute cµ cytoplasmic µ CXC C-X-C chemokine D diversity region DAG diacylglycerol DC dendritic cell DNA deoxyribonucleic acid EBF early B cell factor EBV Epstein-Barr virus ELISA enzyme labeled immunosorbent assay ELP early lymphoid progenitor FACS fluorescence activated cell sorting FCS fetal calf serum FITC fluorescein isothiocyanate FL fetal liver FLI fluorochrome Intensity Flt-3 fms-related tyrosine kinase 3 Fo follicular B cell FoxO forkhead box γc common γ chain GC germinal Centre Gfi growth factor independence GFP green fluorescent protein HC heavy chain HSA heat stable antigen HSPG heparan sulfate proteoglycan HSC hematopoietic stem cell IFN interferon Ig immunoglobulin IL interleukin IP3 inositoltriphosphate IRES internal ribosome entry site IRF interferon-regulatory factor ITAM immunoreceptor tyrosine activation motif

viii

ITIM immunoreceptor tyrosine inhibition motif J joining region JAK janus kinase L ligand LC light chain LMPP lymphoid primed multipotent progenitor LN lymph node LPS lipopolysaccharide LSK lin-Sca-1+c-Kit+ MACS magnetic-activated cell sorting MCSFR macrophage colony stimulating factor receptor MPO myeloperoxidase MPP multipotent progenitor MZ marginal zone B cell NHEJ non-homologous end joining NK natural killer cell OBF Oct binding factor PBS phosphate buffered saline PCR polymerase chain reaction PH pleckstrin homology PI3K phosphatidylinositol 3-kinase PIP2 phosphatidylinositol 4, 5-bisphosphate PIP3 phosphatidylinositol 3, 4, 5-triphosphate PKB protein kinase B PKC protein kinase C PLC phospholipase C Pre-BCR pre-B cell receptor Pre-TCR pre-T cell receptor R receptor Rag recombinase activating gene RNA ribonucleic acid RT-PCR reverse transcriptase PCR SCA stem cell antigen SCF stem cell factor SCID severe combined immunodeficiency SLC surrogate light chain SOCS suppressor of cytokine signaling STAT signal transducer and activator of transcription TCR T cell receptor TC-PTP T cell protein tyrosine phosphatase TD T cell-dependent TdT terminal dideoxy-transferase TF transcription factor TI T cell-independent TNF tumour necrosis factor TSLP thymic stromal lymphopoietin Tyr tyrosine V variable region ix

List of Tables

TABLE 2.1 PRIMER SEQUENCES ...... 56 TABLE 3.1 NUMBER AND FREQUENCY OF WELLS RESULTING IN POSITIVE CULTURES ...... 62 TABLE 3.2 PHENOTYPE OF IL-7-DEPENDENT B CELL CULTURES AFTER LONG-TERM CULTURING ...... 64 TABLE 3.3 COMPARISON OF DUPLICATE PLATES ...... 66 TABLE 4.1 CELL NUMBERS FOR THE IN VITRO MATURATION OF INFECTED B CELLS ...... 88

TABLE 4.2 ABSOLUTE CELL NUMBERS FOR THE IN VITRO MATURATION OF IFN-γ TREATED B LINEAGE CELLS ...... 93

List of Figures

FIGURE 1.1 B CELL DEVELOPMENT SCHEME ...... 4 FIGURE 1.2 SIGNALING PATHWAYS IN DEVELOPING B CELLS ...... 22 FIGURE 2.1 SORTING STRATEGY AND POST SORT PURITIES FOR B CELL SUBSETS ...... 47 FIGURE 2.2 SCHEMATIC FOR THE GENERATION OF IL-7-DEPENDENT CELL LINES ...... 50 FIGURE 3.1 ANALYSIS OF SURFACE MARKER CHANGES IN IL-7-DEPENDENT B CELL LINES ...... 68 FIGURE 3.2 FREQUENCY OF IL-7-RESPONDING CELLS IN IL-7-DEPENDENT B CELL LINES ...... 69 FIGURE 3.3 IL-7R AND PRE-BCR SIGNALING IN B CELL LINES AND EX VIVO B CELLS ...... 71 FIGURE 4.1 IL-7R SURFACE EXPRESSION AND DOWNSTREAM SIGNALING IN B LINEAGE CELLS ...... 81

FIGURE 4.2 PROLIFERATION AND DOWNSTREAM SIGNALING IN RESPONSE TO IL-7 IN B CELL LINES EXPRESSING

NATURAL OR MUTATED SOCS-1 ...... 84 FIGURE 4.3 ENDOGENOUS OR INDUCED EXPRESSION OF SOCS-1 / SOCS-3 IN B LINEAGE CELLS AND B CELL LINES ...... 86 FIGURE 4.4 IN VITRO MATURATION OF B LINEAGE CELLS EXPRESSING SOCS-1 ...... 88

FIGURE 4.5 PROLIFERATIVE RESPONSE AND INDUCED EXPRESSION OF SOCS-1 AND SOCS-3 IN B CELL LINES AFTER

TREATMENT WITH IL-7 AND/OR IFN-γ ...... 91

FIGURE 4.6 IN VITRO MATURATION OF B LINEAGE CELLS TREATED WITH IFN-γ ...... 93

FIGURE 4.7 PROLIFERATIVE RESPONSES AND INDUCED EXPRESSION OF SOCS-1 AND SOCS-1 IN B CELL LINES AFTER TREATMENT WITH IL-7 AND/OR IL-21 ...... 95

FIGURE 4.8 PROLIFERATIVE RESPONSES AND INDUCED EXPRESSION OF SOCS-1 AND SOCS-3 IN B CELL LINES AFTER

TREATMENT WITH ANTI-µ OR CXCL12 ...... 98 FIGURE 4.9 ENDOGENOUS OR ENFORCED EXPRESSION OF GFI-1B IN B LINEAGE CELLS AND B CELL LINES ...... 102

FIGURE 5.1 HEPARIN AND HEPARAN SULFATE INFLUENCE THE IN VITRO DEVELOPMENT OF B CELLS IN CULTURES

CONTAINING IL-7 ...... 113 FIGURE 5.2 HEPARIN, HEPARAN SULFATE AND ANTI-CD19 INCREASE SIGNALING THROUGH THE PRE-BCR ...... 116 FIGURE 5.3 HEPARIN AND HEPARAN SULFATE INFLUENCE THE PROLIFERATION OF PRE-BCR+ CELLS ...... 118

FIGURE 5.4 CD19 DEFICIENCY INFLUENCES THE NUMBER OF CD2+ CELLS EMERGING IN CULTURES CONTAINING IL-7,

BUT DOES NOT ALTER THE AFFECT OF HEPARIN, HEPARAN SULFATE OR HEPARITINASE ...... 120 FIGURE 5.5 CD19-/- CELLS DISPLAY A DEFICIENCY IN MATURATION TO THE IG SECRETING STAGE, BUT STILL RESPOND

TO HEPARIN, HEPARAN SULFATE AND HEPARITINASE ...... 122 FIGURE 5.6 CD19-/- B CELLS DISPLAY NORMAL IL-7R ACTIVATION, BUT DEFICIENT PRE-BCR ACTIVATION ...... 124 FIGURE 5.7 CD19-/- CELLS DISPLAY A REDUCED CAPACITY TO PROLIFERATE IN LOW CONCENTRATIONS OF IL-7 ..... 126 FIGURE 6.1 GENERATION OF IL-7-DEPENDENT AND IL-7-INDEPENDENT CELL LINES ...... 142 FIGURE 6.2 REGULATION OF IL-7R SIGNALING ...... 155 FIGURE 6.3 STROMAL CELL-DEPENDENT AND -INDEPENDENT B CELL DEVELOPMENT ...... 162

xi 1

Chapter 1

1 Introduction1

1 Sections of this chapter appear in Molecular Basis of Hematopoiesis; Springer (Book Chapter) 2009. Corfe SA,

1.1 B Cell Development and Function

B cells are central components of the humoral arm of the immune system and are essential in protecting against infection and disease. They mediate their effector functions through the production of neutralizing antibody, induction of antibody-dependent cell-mediated cytotoxicity, and activation of the complement system. B cells are continually produced throughout life, and the efficiency with which they are generated is controlled by extrinsic and intrinsic factors including chemokines, cytokines and transcription factors (TFs). Severe immunodeficiency is observed in cases where B cell development is reduced or absent and results in persistent infection.1

B lymphopoiesis occurs in a series of steps, whereby progenitor cells undergo rearrangement of their immunoglobulin (Ig) loci, leading to the eventual expression of a functional B cell receptor (BCR) that is capable of responding to antigen (Figure 1.1).2 Expression of the pre-B cell receptor (pre-BCR) and the mature BCR are critical events during maturation and mediate the transition through checkpoints that select for functional cells that are not self reactive.3 Ig recombination is initiated at the heavy chain (HC) locus in committed B cell progenitors (pro-B cells) and results in the generation of the µHC proteins. µHCs associate

with surrogate light chain (SLC) proteins VpreB and λ5 to form the pre-BCR, which is expressed on the surface of newly formed pre-B cells.4 Pre-B cells express µHCs on their cell surface with only one specificity and further rearrangement at the HC locus is prevented by a process referred to as allelic exclusion. Successful pre-BCR expression and signaling activates survival, proliferation, and differentiation pathways that lead to the selection and expansion of large pre-B cells. Proliferating large pre-B cells exit the cell cycle and become resting small pre-B cells that begin rearrangement of the light chain (LC) proteins. LC

3 proteins associate with µHC proteins to form the BCR, which is first expressed on immature B cells in the bone marrow (BM). Immature B cells are positively and negatively selected based on their antigen specificity and migrate from the BM to the spleen. Immature

B cells arriving in the spleen pass through a series of transitional stages prior to developing into mature follicular (Fo), marginal zone (MZ), or B-1 B cells.5

Mature B cells circulate throughout the periphery and localize in the BM, spleen, lymph nodes (LN), and peritoneal cavities. Antigen-activated mature B cells proliferate and differentiate into plasmablasts, which secrete high levels of antibodies. Antibodies can coat pathogens and cause them to agglutinate, which limits their mobility and replication, and prevents their entry into host cells. Antibody-bound pathogens can also be recognized by complement, which initiates the complement cascade. This cascade can result in both opsonization, whereby a pathogen is ingested and destroyed by phagocytes, and direct killing by means of the complement membrane attack complex. Antibody binding can also trigger antibody-dependent cell-mediated cytotoxicity, a mechanism by which natural killer (NK) cells, monocytes, and/or eosinophils release compounds such as granzymes, IFN-γ, major basic protein, and perforin, all of which can lyse infected cells and kill invading pathogens. In addition to fighting off immediate infection, B cells also develop into long-lived memory B cells that remain in the body to protect against future infections.

IL-7R-/- mMT IL-7-/- ID1 Tg Ikaros-/- EBF-/- SCID Btk-/-/BLNK-/- -/- PU.1-/- E2A-/- Rag1/2-/- IRF-4/8-/- Aiolos Bcl11a-/- gc-/- Igb-/- Aiolos/Oct-1-/- -/- Iga-/- Gfi-1-/- Miz-1-/- Pax-5 Lyn/Fyn/Blk -/- SOCS-1-/- Syk/Zap-70 -/-

D -J H H VH-DJH VL-JL

CLP Pre-Pro-B Early Pro-B Late Pro-B Large Pre-B Small Pre-B Immature Transitional MZ Fo Hardy Fr. A Fr. B Fr. C Fr. C’ Fr. D Fr. E (T1-T3) Fr. F Basel Pro-B Early Pre-BI Late Pre-BI Large Pre-BII Small Pre-BII IL-11 FLT-3 SCF IL-7 CXCL12 Stroma LPS AA4.1 c-kit IL-7R TdT Rag 1/2 Iga/b VpreB / l5 cm IgM B220 CD19 CD43 HSA BP.1 CD2 CD22 CD25 IgD k / l CD21/CD35 CD23

Figure 1.1 B Cell Development Scheme: Developmental progression of B lineage cells from CLPs to mature B cells in mice. Hatched bars denote growth factor and

stroma-dependent stages. Solid lines represent expression of cell phenotype markers, with line thickness indicating relative expression levels. Developmental blocks 4 arising from mutant or transgenic gene expression are denoted at appropriate stages. 5

1.2 B Cell Ontogeny

As with all hematopoietic lineages, B cells are derived from self-renewing hematopoietic stem cells (HSCs). B cells can first be detected in the fetal liver (FL) of mice and humans on day 14 and week 8 of gestation, respectively.6,7 Development continues in the fetal BM, which is seeded with progenitor cells from the FL. BM is the predominant site of post-natal hematopoietic B lymphopoiesis, where developing cells are closely associated with stromal cells, a family of large adherent BM cells that include fibroblasts, reticular cells, preadipocytes, endothelial cells, and macrophages. This microenvironment provides essential support for hematopoiesis, and development is severely inhibited in cases where bone structure is abnormal.8

In the BM, progression from HSC to committed B cell follows a path in which a series of stochastic decisions result in cells that progressively develop B cell traits while repressing traits of other lineages. Cells are primed to follow a certain lineage fate by the expression and interaction of TFs in a process referred to as specification. However, final commitment occurs only after all other lineage potential is fully arrested. During murine development,

HSCs are characterized by their lineage (lin-), Sca-1+, c-Kithi (LSK) phenotype as well as self- renewing capacity, and transition into non-self-renewing multipotent progenitors (MPP).9 A subset of these LSK cells express high levels of the fms-related tyrosine kinase 3 (Flt-3) and are designated lymphoid primed MPPs (LMPP). Expression of the recombinase activating genes (Rag1/2), as well as terminal deoxynucleotidyltransferase (TdT) denotes the gradual transition of cells to early lymphoid progenitors (ELPs), which subsequently give rise to common lymphoid progenitors (CLPs).9 CLPs are the first cells to express the interleukin-7 receptor (IL-7R) and possess B, T, NK and dendritic cell (DC) potential in vivo. AA4.1

(CD93) expression on progenitor cells has led to further distinction between AA4.1- (A1)

6 and AA4.1+ (A2) populations, which differ in their response to interleukin-7 (IL-7). AA4.1+ cells express Rag proteins and are IL-7-responsive, and it this population that is believed to represent true B cell precursors.10 B220+ (CD45) pre-pro-B cells develop from CLPs and are the first cells specified to the B cell fate. Pro-B cells, identified by CD19 expression and increased levels of Pax-5, are fully committed to the B lineage and are dependent on IL-7 for their proliferation and survival.

While the aforementioned pathway is the predominant manner by which B cells are generated, alternative routes exist. Common myeloid progenitors (CMPs), which were originally believed to only produce myeloid cells have been reported to retain B cell potential, but this ability is restricted to the Flt-3+ fraction.11,12 A bi-potential B cell- macrophage progenitor has also been identified in both FL and adult BM, however where this intermediate fits in the developmental scheme has yet to be elucidated.13-15

1.3 Markers of B Cell Differentiation

B cell development has been described by various conventions that identify similar B cell populations but differ in nomenclature (Figure 1.1).16,17 Described by the Basel nomenclature,

Ig recombination is initiated by Rag proteins in c-Kit+ pro-B cells that subsequently develop into pre-BI cells, which are rearranging their HC genes and express SLC proteins. Large cycling pre-BII cells express the pre-BCR, down-regulate c-Kit and begin to express the IL-

2α receptor (CD25). Pre-BCR expression is difficult to detect on the cell surface and thus it is convenient to use CD25 in conjunction with other B cell markers to identify pre-B cells.

Small pre-B cells re-express Rag proteins that allow LC rearrangement to begin. Detailed examination of the surface of small pre-B cells suggest that the pre-BCR is down-regulated

7 and internalized during the large pre-B to small pre-B cell transition.18 The mature BCR is first expressed on the surface of CD25 negative immature B cells.

Hardy et al. constructed a developmental scheme that distinguishes B cell fractions based on their expression of surface markers CD43, B220, BP.1, HSA (CD24) and IgM (Figure 1.1).

Early B cell populations (Fr. A-C’) are identified as B220+ CD43+ cells, and are further subdivided by increased expression of HSA and BP.1 as they develop from the pre-pro-B stage (Fr. A) to the large pre-B stage (Fr. C’). Maturation to the small pre-B (Fr. D) stage coincides with loss of CD43, and immature B cells (Fr. E) are distinguished by their expression of surface IgM. Mature re-circulating B cells (Fr. F) in the BM can be identified by their co-expression of IgD and IgM. It should be noted that the aforementioned classification systems define stages of development as “textbook ready” snapshots of a continual process, while in fact population phenotypes are much more dynamic.

Human hematopoietic precursors can be identified by the expression of CD34 and, similar to development in mice, human HSCs pass through lineage restriction stages that bias them toward either myeloid or lymphoid fate. CD45RA+CD10+CD19-IL-7R+ cells are specified B

cell progenitors that possess DJH rearrangements and express components of the pre-BCR

19 + + (Igα/β, VpreB), events similarly observed in specified murine B cell progenitors. CD34 CD10 human pro-B cells that express CD19 are committed to the B lineage. Subsequent stages of human B cell development closely follow those characterized in mice, with pro-B cells developing into large cycling pre-B cells (CD34-CD10+CD19+), small pre-B cells (also CD34-

CD10+CD19+), and immature B cells (CD34-CD10+CD19+CD40+sIgM+).

In mice and humans, immature B cells exiting the BM go through a series of transitional stages before becoming mature functional B cells. These cells all express AA4.1 and

8 low/intermediate levels of CD21/CD35. Transitional cells can be further subdivided into recent splenic emigrants, termed T1 cells (IgMhiIgDloCD23-), which give rise to T2 cells

(IgMhiIgDhiCD23+) that subsequently develop either directly into Fo and MZ cells or go through a T3 (IgMloIgDhiCD23+) intermediate stage.20 Mature B cells lose expression of AA4.1 and can be distinguished by their IgMloIgDhiCD21intCD23hi (Fo) or IgMhiIgDloCD21hiCD23lo/-

(MZ) phenotypes.5

1.4 Mechanisms of Antibody Diversity

The BCR is composed of two identical disulphide-linked HCs, each of which is disulphide linked to identical kappa (κ) or lambda (λ) LCs. Both HCs and LCs consist of C-terminal constant regions and N-terminal variable regions. The constant region determines the class

(IgM, IgD, IgG, IgA and IgE for HC, and Igκ or Igλ for LC) and effector function of the receptor. The variable region, which is composed of three complimentary determining regions (CDRs) determines the receptor specificity. The variable regions of the receptor

HCs are formed by the joining of variable (V), diversity (D) and joining (J) gene segments in a process known as V(D)J recombination.21 LC rearrangement occurs at either the κ or λ locus in a similar fashion, except there are no diversity gene segments. κ rearrangement normally precedes that of λ and individual cells exhibit isotypic exclusion, meaning that they express only κ or λ LCs. Expression of κ/λ is not represented equally on B cells or in serum

Ig, and in the majority of cases κ is favoured.22

Ig gene segments are spaced out along the same chromosome (12 for mice and 14 for human

HCs; 6 and 16 for mice κ and λ LCs; 2 and 22 for human κ and λ LCs) in such a manner as to allow recombination machinery to bind two coding segments and join them together. This

process occurs in a reproducible manner, with DH and JH joining preceding VH to DJH joining.

Rag proteins initiate recombination by catalyzing double strand DNA breaks, which lead to the generation of a hairpin coding end and a blunt signal end. The nuclease Artemis opens the hairpin coding end allowing for the binding of the non-homologous end joining (NHEJ) machinery (DNA-PK, Ku-70, Ku-86, ligase IV and XRCC4), which ligates the gene segments to yield a new coding sequence.23 Mutations in components of the recombination machinery result in severe combined immunodeficiency disease (SCID) in mice and humans, whereby most or all lymphoid cells are absent.24

The diversity of the antibody repertoire observed in the periphery is the result of several layers of complexity. Germline-encoded diversity is achieved by the random selection of V gene germline sequences, which directly encode the first two CDRs. The third CDR is encoded by the random assortment of the aforementioned V (~150 options), D (12-13 options) and J (4 options) gene segments and results in combinatorial somatic diversity.

Finally, the joining of these gene segments is imprecise by nature, such that addition or deletion of nucleotides occurs and changes the specificity of receptors encoded by identical

V, D and J segments. The DNA polymerase TdT is important in contributing to this final level of antigen receptor diversity as it functions by adding non-templated (N) nucleotides to the coding junctions. TdT is only expressed in adult life and can increase the diversity of the genome almost infinitely, but is not essential for receptor formation.

1.5 Transcription Factor Regulation of B Cell Commitment

The development of non-committed progenitor cells is influenced by both environmental conditions and cell-intrinsic factors. TFs are DNA binding proteins, which by induction or repression of target genes, control many of the events leading to lineage specification and commitment. These factors can be shared or lineage-specific and typically no factor alone

10 results in lineage commitment. Instead it is the quantity, combination, and cross competition between TFs that regulate the gene expression patterns that activate lineage-directed programs. TFs are regulated by growth factors, cytokines, and chemokines, which are produced by supportive cells in developmental niches such as the FL, BM, spleen and thymus.

Prior to embarking down the B cell developmental pathway, MPPs express a variety of TFs that prime cells for lineage commitment, including the zinc-fingered domain proteins Bcl11a,

Ikaros, and Gfi-1, as well as the ETS family member PU.1.25 Mice deficient for any of these factors display a defect in B cell development at the CLP stage, partially due to the failed expression of Flt-3 and/or IL-7Rα, as well as the inappropriate expression of alternative lineage specific genes. PU.1 works together with signals downstream of Flt-3 to initiate expression of the IL-7Rα chain, however, ectopic expression of IL-7Rα in PU.1-/- progenitors does not fully rescue B lymphopoiesis, demonstrating that PU.1 has alternative roles during B cell development, including the repression of T cell and NK cell development.26,27 Studies in which levels of PU.1 were manipulated showed that high levels of PU.1 expression correlated with the development of myeloid cells at the expense of B cells, while low levels failed to support myeloid development and led to increased generation of B cells.28 Lymphoid versus myeloid cell fate does not appear to be this straightforward though, and subsequent studies have shown that PU.1 levels are similar in precursor populations, with elevated levels of PU.1 being required for both myeloid and B cell development.29 While PU.1 is necessary for B cell development, enhanced expression of this factor can also be detrimental to lymphopoiesis and its levels are kept in check, in part, by the transcriptional repressor Gfi-1.30 Gfi-1-/- mice contain defective CLPs and exhibit a block in development prior to B cell commitment that is the result of imbalanced IL-7R signaling.31 Further commitment or differentiation of B cells is

11 not dependent on PU.1, as conditional knockout of PU.1 at the pro-B stage does not alter subsequent B cell development.32

Upon expressing the IL-7R, CLPs begin the process of specification and eventual commitment to the B lineage, which is governed by a network of TFs including E2A, EBF, and

Pax-5.33 Defects in the helix-loop-helix domain family members E2A or EBF block development prior to B cell commitment, with cells having yet to begin Ig recombination.34,35

E2A is composed of E-protein splice variants E12 and E47 that homo- or heterodimerize prior to binding the consensus DNA sequence CANNTG, denoted the E-box motif. E proteins regulate the expression of several important factors during B cell development including the IgH enhancer and EBF.36 The other E-box proteins (E2-2 and HEB) possess both redundant and independent functions during B cell development. Deletion of either decreases pro-B cells by about half, and mice heterozygous for any two E-protein family members display enhanced B cell defects.37 E-proteins can also bind inhibitors of DNA binding proteins (ID 1-4), which are structurally similar to E-proteins but lack the DNA binding domain. Dimerization of ID and E-proteins abolishes E-protein DNA binding potential inactivating its function and has been shown to regulate transcriptional networks in developing lymphoid cells.38 Experimentally, over-expression of ID1 leads to a block at the pro-B stage of development, while ID1 deficient progenitors display an enhanced ability to develop to the pre-B cell stage, highlighting that ID proteins work to regulate the function of

E-proteins during B lymphopoiesis.39,40

The ability of EBF to control B cell specification has been demonstrated in studies where ectopic expression skewed the differentiation of HSCs toward the B lineage.41 Ectopic expression of EBF can also partially or fully rescue B cell development in mice deficient for

PU.1, E2A, IL-7 or IL-7Rα.42 One mechanism by which EBF mediates this effect is by repressing ID2 and ID3, resulting in increased E2A activity.43 EBF also partners with E2A to specify cells to the B cell lineage through the induction of Ig rearrangement and the

44 regulation of Igα, Igβ, VpreB, and λ5. Another critical target of EBF is Pax-5, a paired homeodomain TF necessary for B lineage commitment. Numerous factors regulate EBF expression, including PU.1, E2A, IL-7, Pax-5 and even EBF itself.42 This multileveled regulation allows for tight control of EBF expression and provides positive feedback loops to maintain its expression.

Pax-5 functions not only to induce gene expression patterns leading to B cell commitment, but also to repress other lineage options. The N-terminal paired domain motif of Pax-5 binds

DNA and positively regulates gene transcription. Pax5 targets include mb-1 (Igα), BLNK

(BASH/Slp-65), CD19, Igll1 (λ5), as well as numerous TFs such as interferon-regulatory factors 4 and 8 (IRF-4/8) and Aiolos.45 Pax-5 also represses non-B lineage genes myeloperoxidase (MPO), Notch-1, and Macrophage Colony Stimulating Factor Receptor (M-

CSFR), which is important for maintaining B cell commitment. Injection of Pax-5-/- pro-B cells into Rag-2-/- mice led to reconstitution of the thymus and generation of T cells.46 This T cell development is likely due to the failure to repress Notch-1, a critical T cell TF. Continual expression of Pax-5 is necessary throughout B cell development, as conditional deletion of

Pax-5 in pro-B or later stage mature B cells leads to the reactivation of many repressed genes and reversion to other lineage types.47,48 While Pax-5 maintains cells in the B lineage, recent work has identified novel roles for EBF in B cell commitment independent of Pax-5.

Sustained expression of EBF in Pax-5-/- hematopoietic progenitor cells restricted their ability to differentiate into myeloid or T cells in vivo and, in vitro, EBF repressed myeloid and T cell

13 genes in Pax-5-/- pro-B cells.49 In light of these observations it has been proposed that the lack of lineage commitment observed in Pax-5-/- B cells may be the result of a failure of these cells to maintain EBF expression.

1.6 Transcription Factor Regulation of B Cell Differentiation

In addition to directing lymphoid specification, Ikaros also influences later stages of B lineage development. In contrast to fully deficient animals, mice expressing reduced levels of Ikaros develop normally past the CLP stage, but are impaired at the pro-B to pre-B cell transition.50

While E2A and EBF work together to positively regulate Igll1 (λ5) expression, Aiolos and

Ikaros function to down-regulate it.51 Aiolos is a zinc-finger TF of the Ikaros family, whose protein levels are significantly increased at the pre-B cell stage. Aiolos is induced by pre-BCR signaling via IRF4/8 and the adaptor protein BLNK.52,53 In the absence of Aiolos, suppression of Igll1 (λ5) is initiated but full repression does not occur. Aiolos also works with Oct binding factor-1 (OBF-1) to regulate BM and peripheral B cell development. Aiolos-/-/OBF-1-/- mice display a block at the pre-B cell stage that results in almost complete absence of immature B cells.54 In the periphery, Aiolos-/- mice exhibit reduced thresholds of receptor activation. This leads to spontaneous formation of germinal centres and failure to generate MZ B cells.55 This defect is lost in Aiolos-/-/OBF-1-/- mice suggesting that, in the periphery, these factors may play opposing roles in regulating the threshold of BCR activation.

IRF-4 and IRF-8 are structurally related and partially redundant proteins that are expressed during both lymphoid and myeloid development.56 IRF-4 and IRF-8 exhibit little direct DNA binding activity, but rather work in a complex with other factors such as PU.1 and E2A to regulate the expression of B cell genes. IRF-4-/-/8-/- mice exhibit a block in development at the large pre-B cell stage and these cells continue to cycle, exhibit increased expression of the

14 pre-BCR, and fail to initiate LC recombination.57 These defects are partially due to sustained

production of the SLC proteins VpreB and λ5, which are normally down-regulated by IRF-4/8 induction of Ikaros and Aiolos. IRF-4 and IRF-8 regulate LC rearrangement by targeting κ and

λ enhancers and also have been implicated in the indirect promotion of Rag expression and

E2A activity.58 IRF-4-/- mice also exhibit defects in LC receptor editing, class switch recombination, and plasma cell differentiation due to sub-optimal expression of activation induced cytidine deaminase (AID).59

1.7 Environmental Regulation of In Vivo and In Vitro B Cell Development

The distribution of B cells in the BM is dependent on their interaction with stromal cells, which utilize chemokines, such as C-X-C chemokine ligand 12 (CXCL12/SDF-1), to attract cells to distinct cellular niches.8 CXCR4, the receptor for CXCL12, is expressed on subsets of developing B cells and both CXCR4 and CXCL12 are essential for B lymphopoiesis at the earliest stages of development.60 Different classes of stromal cells produce varying levels of

IL-7 and CXCL12, and expression of these factors has been shown to vary under certain conditions, such as cytokine stimulation, pregnancy and ageing.61-64 In vivo, pre-pro-B cells were found to be associated with CXCL12hi expressing cells, while pro-B cells associated with IL-7 producing stromal cells that expressed low levels of CXCL12.65 Small pre-B cells have been shown to up-regulate CXCR4, and this expression has been proposed to initiate cell migration away from IL-7 producing stromal cells.58,66 Immature B cells were found not to be associated with CXCL12 or IL-7 producing cells, thus allowing for their emigration out of the BM and into the periphery.65 Antigen-induced activation of mature peripheral B cells in secondary lymphoid tissues (spleen, LNs, and Peyer’s patches) results in their differentiation

15 into plasma and memory B cells that re-express CXCR4. This expression results in cell homing to and retention in the BM, where mature cells can be found associated with

CXCL12hi reticular cells.67 The localization of B cell precursors to specific niches and cell types provides them with the necessary growth factors and cell-cell interactions as well as shields them from factors that would support their development toward other lineage fates.

Much of our understanding regarding the functional mechanisms of B cell development has come from in vitro studies, which originally made use of adherent layers from hematopoietic tissues.68-70 The creation of clonal stromal cell lines significantly improved the ability to culture B cells in vitro and also led to the identification of important factors that regulate B cell development, including IL-7, stem cell factor (SCF, c-Kit-L) and Flt-3L.71-79 SCF exists in soluble or membrane bound forms and binds the surface expressed tyrosine kinase receptor

KIT (c-Kit). SCF is required during the earliest stages of hematopoietic development and

SCF-/- or c-Kit-/- mice die within a week of birth due to anaemia.80-82 In Vicked mice (viable c- kit deficient) or Wepo mice (rescued by erythropoietin over-expression), B cell development is normal during fetal life, but numbers of pro-B and pre-B cells greatly diminish as mice age.83

SCF acts directly on developing B cells and, in vitro, worked synergistically with IL-7 to increase the numbers of pro-B cells in culture.84 This observation explains the decreased number of B cells observed in knockout mice; however, the increase in B cell populations in vitro is more likely due to the fact that SCF promotes the survival and proliferation of B cell progenitors in culture, and thus increases the input of IL-7-responsive pro-B cells.

Flt-3L, and its receptor Flt-3, also play critical roles in enhancing the survival and proliferation of early progenitors. In Flt-3-/- mice, pre-pro-B and pro-B cell numbers are significantly reduced while more mature pre-B and immature populations remain relatively normal.85

Addition of Flt-3 and IL-7 to hematopoietic progenitor cells resulted in the synergistic activation of the MAPK/Erk and PI3K/Akt signaling pathways, which led to increased survival and proliferation of pre-pro-B cells.86 By experimenting with different combinations of cytokines in culture, it was discovered that IL-11 and SCF could support B cell development from day 12 FL independent of stromal cells (Figure 1.1).87 The addition of Flt-3L made this combination even more potent and could support stromal-free development of B cells from day 10 yolk sac.88 IL-11, SCF, and Flt-3L all play important roles in enhancing B lymphopoiesis, however, only IL-7 is essential, and once a progenitor cell is capable of responding to IL-7 these other factors are no longer required for cell survival, proliferation, or development toward the B lineage.

Stromal cells are important for later IL-7-independent stages of B cell development and no combination of cytokines that mediate this transition have been discovered. However, maturation to the antibody secreting stage can occur independently of stromal cell support when IL-7-expanded B cell precursors are cultured with mitogenic stimulus under conditions that facilitate homotypic interactions between progenitors.89 Addition of blocking antibodies to these cultures led to the discovery that components of the pre-BCR were critical for this development, either by preventing ligand binding or receptor oligomerization.90

1.8 IL-7 Regulation of B Cell Development

Developing B cells rely on a variety of factors that provide signals necessary for their survival, proliferation, and differentiation. IL-7 is a key cytokine during B lymphopoiesis and is produced by stromal cells in the FL, BM, spleen and thymus. IL-7R signaling leads to the proliferation and survival of B cell progenitors as well as aids in the commitment of cells to the B lineage.91 IL-7 transgenic mice displayed increased numbers of immature and mature B

17 cells in the BM, as well as extramedullary B lymphopoiesis, whereby pro-B and pre-B cells were observed in the spleen, blood, and LNs, and ultimately lead to lymphoproliferative disorders.92 Mice with targeted deletions of IL-7 or the IL-7R display a severe block at the early pro-B cell stage of development.93,94 The peripheral B cells that do exist in these mice appear to have originated during fetal development, a time during which B lymphopoiesis is not absolutely dependent on IL-7. Thymic stromal lymphopoietin (TSLP) is a cytokine that possesses a number of characteristics in common with IL-7 and its receptor is composed of the IL-7Rα chain and TSLPR chain. Fetal derived pro-B and pre-B cells respond to TSLP, while in adult BM, only pre-B cells are TSLP-responsive.95,96 TSLP was thought to substitute for IL-7 during fetal development, because transgenic expression of TSLP in IL-7-/- mice restored B cell development during fetal and adult life.97 However, IL-7-/-/TSLP-/- mice did not show enhanced defects during fetal B cell development and, instead, it was the absence of IL-

7 and Flt-3L that completely abolished both fetal and adult development of B cells.98,99 Flt-3L was able to recover the development of residual B cells present in IL-7Rα deficient mice.95

IL-7 is absolutely essential for murine B cell development, however, in humans it was thought that this was not the case. Genetic mutations in humans that disrupt the IL-7R lead to X- linked severe combined immunodeficiency disease (X-SCID), which is characterised by the absence of T and natural killer (NK) cells but normal B cell numbers.100 However, similar to mice, these B cells appear to be the result of fetal or neonatal development. In vitro, human B cells can be generated from fetal BM as well as cord blood (CB) in the absence of IL-7.101,102

Human B cell precursors express the IL-7R and displayed increased proliferation and survival in response to IL-7 that was mediated by Signal Transducer and Activator of Transcription-5

(STAT5).103 IL-7 also greatly increased the production of B cells in co-cultures containing

18 human BM stroma and either CB or adult BM HSCs, while only neonatal CB was able to give rise to B cell progenitors independent of IL-7.101 In humans, TSLP cannot substitute for IL-7, while Flt-3L is able to support IL-7-independent B lymphopoiesis from neonatal CB.101,104

As important as the signaling pathways initiated by IL-7 and other cytokines, are the mechanisms that exist to regulate and terminate these signals. The suppressor of cytokine signaling (SOCS) family of proteins are key regulators of cytokine signals and are essential for the development and function of a variety of hematopoietic lineages.105 SOCS proteins contain three functional domains: a central SH2 domain that is necessary for binding to phosphotyrosine residues on target proteins; a C-terminal domain, termed the SOCS box, which is involved in ubiquitin-mediated proteasomal degradation via elongins B and C; and an

N-terminal domain whose function remains largely undefined. SOCS proteins bind directly to

JAnus Kinase (JAK) and STAT proteins as well as cytokine receptor chains and prevent their phosphorylation and interaction as well as target them for destruction. SOCS proteins are often induced by the same signaling pathway that they inhibit, providing a negative feedback loop that functions to limit receptor activation.

1.9 IL-7 Receptor Signaling in B Cells

The IL-7R is a heterodimer composed of the IL-7Rα chain and the common γ (γc) chain. The

γc chain is a shared component of the receptors for IL-2, IL-4, IL-9, IL-15 and IL-21, while the

IL-7Rα chain can also dimerize with the TSLPR chain to form the receptor for TSLP. The γc chain is expressed by a variety of hematopoietic cells and is essential for initiating signals downstream of the IL-7R; however, it is the α chain, which is predominantly expressed by lymphoid cells, that confers receptor specificity for binding to IL-7.106

Both the α and γc chains lack intrinsic tyrosine kinase activity and thus rely on non-receptor kinases and adaptors to mediate downstream signaling. The JAK family consists of four members (JAK1, 2, 3 and Tyk2), with JAK3 expression being confined predominantly to cells of hematopoietic origin. For the IL-7R, JAK3 is constitutively associated with the γc chain, while JAK1 associates with the α chain. Binding of IL-7 to the IL-7R leads to heterodimerization of the α and γc chains, which brings JAK1 and JAK3 in close proximity and allows for their trans-phosphorylation and increased kinase activity (Figure 1.2).

Activated JAK kinases are then able to phosphorylate tyrosine residues on the IL-7Rα chain that in turn creates docking sites for SH2 containing proteins, which themselves are JAK substrates. Mice deficient for JAK3 or the γc chain exhibit similar phenotypes that closely resemble defects observed in IL-7 and IL-7R knockout mice; while in humans, mutations in

JAK3 and the γc chain result in a T-NK-B+ SCID phenotype.100,107-110 JAK1-/- mice are runted at birth and die perinatally exhibiting a severe reduction in both B and T cell numbers, while in humans no cases of JAK1 deficiency have been described.111

Phosphorylation of the IL-7Rα chain is a critical step in initiating downstream signaling because it allows for the recruitment of STAT proteins (Figure 1.2). Phosphorylation of

STAT proteins allow them to dimerize and translocate to the nucleus where they act as TFs for a variety of target genes by binding to specific promoter elements.112 A total of seven

STAT family members exist (STAT 1, 2, 3, 4, 5a, 5b and STAT6); however, only STAT1,

STAT3, STAT5a and STAT5b are activated after IL-7 stimulation in B cells.113,114 While STAT1 does not appear to play an important role in B lymphopoiesis, STAT3 is required. STAT3-/- mice displayed a reduction in pro-B, pre-B, immature and mature B cells, and pro-B cells from these mice exhibited a decreased proliferative response to IL-7.113 STAT5 is the

20 predominant STAT protein activated by IL-7 and carries out the majority of STAT-mediated responses in developing B cells, including the activation of ccnd2, ccnd3, Bcl-2, Bcl-xL, and

Mcl-1.115,116 STAT5 is recruited to Tyr449 of the IL-7Rα chain where it is subsequently phosphorylated by JAK and Src kinases. STAT5a and STAT5b have redundant roles during B cell development but are absolutely essential, as B cells in STAT5a/b double deficient mice are arrested at the pre-pro-B cell stage, similar to that observed in IL-7R-/- mice.117-119

Additionally, constitutive activation of STAT5b in mice overcame IL-7R deficiency and significantly increased pro-B cell numbers.120 Recently, the use of Rag1-Cre knock-in mice allowed for the conditional mutagenesis of STAT5. This resulted in the complete inactivation of STAT5 in pro-B cells and caused severe defects in the further development of B cells.121

The transgenic expression of Bcl-2 restored the development of STAT5-/- B cells in these mice, suggesting that a predominant role of STAT5 during B cell development under these conditions is survival.

Src family kinases are also recruited to the IL-7Rα chain and are activated by IL-7 binding. IL-

7 induces the activation of both p59Fyn and p53Lyn in pre-B cell lines, and a Src kinase inhibitor impaired proliferative responses to IL-7.122,123 Src family kinases have redundant roles during B cell development and their function in IL-7 signaling has yet to be fully elucidated. One potential role is to help activate STAT proteins, as Src kinases can directly phosphorylate STAT proteins independently or in conjunction with JAK proteins.124

Phosphatidylinositol 3-kinase (PI3K) activation is another important consequence of IL-7- induced signaling. PI3K is composed of a smaller regulatory subunit (p50α, p55α or p85α) and a larger catalytic subunit (p110α, p110β or p110δ). IL-7R signaling leads to the recruitment of the p85 subunit to Tyr449 on the IL-7Rα chain, via its SH2 domain (Figure

1.2).125 Mutation of this site or the p85 subunit, as well as treatment of B cells with PI3K inhibitors, led to a loss of IL-7-induced proliferation and impaired B cell development.126-128

The p110α and p110δ subunits play essential but redundant roles during B lymphopoiesis, as evidenced by the fact that double deficient mice are arrested at the pre-B stage and display impaired proliferative responses to IL-7.129 One key downstream mediator of PI3K signaling is the serine/threonine kinase Akt (PKB). Akt regulates a variety of pro- and anti-apoptotic factors and also targets the Forkhead box (FoxO) family of TFs.130 Akt phosphorylation of

FoxO proteins causes them to bind 14-3-3 proteins, which retains them in the cytosol where they remain inactive and unable to regulate gene transcription.

IL-7 stimulation in B cells also leads to the activation of the MAPK/Erk pathway. Erk is a critical target of IL-7 and pre-BCR signaling, as demonstrated by the observation that treatment of cells with Erk inhibitors or deletion of Erk1/2 in mice resulted in a block at the pro-B to pre-B cell transition as well as ablated IL-7-induced pro-B/pre-B cell survival and proliferation.127,131 While the full mechanism of activation of the MAPK/Erk pathway has yet to be described in B cells, the adaptor protein Shc may be an important mediator, similar to that observed for T cells.132,133 In B cells, Shc was phosphorylated after IL-7 stimulation, and pro-B cells containing a defective Shc protein displayed increased apoptosis.134 Additionally, conditional mutation of Shc proteins led to a defect in development at the pre-pro-B to pro-

B stage, as well as a significant reduction in pre-B cell numbers.

VpreB

l5 { SLC CD45 mHC CD19

IL-7 Iga/b g { IL-7Ra c

PIP 3 PIP 3 PIP 3 PIP 3 PIP 3 P P - - Zap-70 + P JAK1 JAK3 Lyn Lyn P Y P Y Y P P PI3K p110 Akt Blk Blk P Akt Syk P P P Y P PI3K P P Btk p85 PI3K Fyn Fyn Tec P p85 P P PLCg2 PI3K STAT PLCg1 PIP 2 p110 P BLNK Slp-76 LAT

P P P Btk IP 3 PKCl Tec DAG FoxO p27Kip P P Ras P P STAT FoxO p27Kip STAT P P Raf 2+ P NFkB PKC Ca MEK

P ERK1/2

Figure 1.2 Signaling Pathways in Developing B Cells: Signaling cascades initiated during the pro-B to pre-B cell transition. Black lines denote activating actions, red lines inhibitory actions and dashed lines a multistep pathway. See text for details. 22 23

1.10 Trophic Versus Instructive Roles of IL-7

IL-7R signaling provides trophic survival signals during B cell development, however, constitutive expression of Bcl-2 is unable to compensate for loss of IL-7 in IL-7Rα-/- or γc-/- mice, suggesting that IL-7 also provides instructive signals.135,136 CLPs from IL-7-/- mice have a greatly reduced ability to generate B cells that is likely the result of ineffective activation of

EBF and Pax-5, both of which are essential for the initiation and maintenance of B lineage commitment.137 Ectopic expression of EBF or constitutive STAT5 expression in IL-7-/- mice restored B cell development, signifying that they are both downstream mediators of IL-7R signaling.137,138 A potential mechanism for IL-7R signaling in directing B cell commitment comes from the observation that STAT5 signaling enhances the expression of EBF and Pax-

5.138-141 This activation appears not to be direct though and likely requires priming or assistance from other TFs. The conditional deletion of Pax-5 at various stages of B cell development allowed cells to revert to a non-committed state and develop into alternative lineages.142 This lineage reversion only occurred in the absence of IL-7 though, and when cells were cultured with IL-7 they maintained a pro-B cell phenotype, indicating that IL-7 is able to keep cells committed to the B cell fate.

Recently the TF Miz-1 was identified as an important player during B cell commitment, as evidenced by the fact that Miz-1-/- mice displayed a block at the pre-pro-B to pro-B cell stage of development.143 This defect occurred due to a lack of IL-7R signaling, resulting from high expression of SOCS-1 as well as decreased Bcl-2 expression. Interestingly, in Miz-1-/- mice, B cell development could only be recovered by the combined ectopic expression of both Bcl-2 and EBF, demonstrating that in the absence of IL-7 signaling both trophic and instructive signals were required. In contrast to these studies demonstrating an instructive role for IL-7,

24 conditional deletion of STAT5a/b at the onset on Rag expression did not result in decreased expression of EBF and Pax-5 in pro-B cells, suggesting that IL-7R signaling may not be absolutely required for their expression.121 In addition, the developmental defect observed in

STAT5a/b double deficient mice could be partially overcome by Bcl-2 expression, implying that IL-7 plays a permissive role during commitment. Further studies investigating whether transient STAT activation prior to its deletion is sufficient to initiate the activation of other factors that then regulate B cell commitment will help address these contradictory findings.

1.11 IL-7 Regulation of B Cell Survival, Proliferation and Maturation

One main function of IL-7R signaling during B cell development is to promote cell survival by regulating the localization and interaction of anti-apoptotic (Bcl-2, Bcl-xL and Mcl-1) and pro- apoptotic (Bax, Bad and Bim) factors. Both the JAK/STAT and PI3K/Akt pathways play key roles in mediating survival responses. IL-7R signaling enhances pro-B cell survival by increasing the ratio of Bcl-2 to Bax and, correspondingly, mice deficient for the IL-7R or

JAK3 displayed increased levels of Bax.144,145 Mcl-1 is another key mediator of B cell survival and its expression is directly regulated by STAT5.121 Mice deficient for Mcl-1 displayed a severe reduction in B lymphocytes as well as a block at the pro-B stage of development.146

Akt regulates cell survival through the induction of Bcl-2 and Bcl-xL, while also inhibiting Bad, by phosphorylating it and causing it to be retained in the cytosol where it remains inactive.147

Finally, Bim has recently been shown to play a role in B cell survival, as Bim deficiency allowed for the partial recovery of B cell development in the absence of IL-7.148,149

Cell proliferation is another consequence of IL-7R signaling and is regulated through the induction and inhibition of positive and negative cell cycle regulators. p27Kip is a negative regulator of cell cycle activity and stimulation with IL-7 causes a reduction in its levels of

25 expression.150 Inhibition of p27Kip function is brought about by distinct but overlapping mechanisms: Akt can directly phosphorylate p27Kip causing it to be retained in the cytoplasm where it is subsequently ubiquitinated and degraded, while Akt phosphorylation and inactivation of FoxO proteins prevent further transcription of p27Kip, which is a direct

FoxO target.151,152 IL-7 stimulation also regulates cell proliferation by inducing activators of cell cycle. As previously described, Erk activation downstream of IL-7 signaling is important for pro-B and pre-B cell proliferation. Activated Erk proteins are able to translocate to the nucleus where they phosphorylate a variety of TFs including Elk and CREB, which in turn induce the expression of proliferation associated targets llf2, Mef2c, Mef2d and myc.131 Myc proteins are key transcriptional regulators that induce cell cycle progression by stimulating cyclin-dependent kinase (cdk) activity. N-myc and c-myc were both induced by IL-7 stimulation and required E2A activity for full function.153,154 Additionally, B cell specific deletion of N-myc and/or c-myc led to a block at the pro-B and pre-B cell stages of development, while co-expression of IgH and Eµ-myc transgenes partially restored B cell development in JAK3-/- mice.155-157 IL-7R signaling or constitutive STAT5 expression also induced the transcription of the ccnd2 and ccnd3 genes, leading to cyclin D2 and cyclin D3 protein expression, which function to promote cell cycle progression by activating cdks.116,120

In addition to providing survival and proliferation signals, IL-7 has also been implicated in promoting B cell maturation. Much of our understanding regarding the functional mechanisms of B cell development has come from in vitro studies, which utilize IL-7 to sustain and propagate B lineage cells in culture. Initial reports investigating the development of B cells in IL-7 cultures described a phenomenon in which withdrawal of IL-7 led to increased

RAG expression, LC rearrangement, and percentage of IgM+ cells in culture.158-161 These observations led to a hypothesis that IL-7 inhibited the further development of pro-B cells

26 into pre-B cells by keeping them in a proliferative state and that maturation was induced upon withdrawal of IL-7 from culture. However, these studies failed to appreciate the highly dynamic and heterogeneous nature of in vitro B cell cultures. By carefully monitoring cell maturation in culture and counting absolute cell numbers, our lab determined that the absolute number of IgM+ cells that arose in culture was the same in the presence or absence of IL-7.162 Therefore, in culture, IL-7 does not prevent the maturation of pro-B/large pre-B cells but rather selectively enhances their survival and proliferation. Consequently, withdrawal of IL-7 leads to the death of pro-B/large pre-B cells, which results in a relative, but not absolute, increase in small pre-B and immature B cells, suggestive of increased maturation. While IL-7 did not inhibit the maturation of pro-B cells into small pre-B and immature B cells, it also did not lead to the survival or proliferation of these more mature populations.162

1.12 The Role of IL-7 in V(D)J Recombination

Additional roles for IL-7 in promoting B cell development have been proposed based on studies that demonstrated that IL-7R signaling can affect both HC and LC recombination.

Several studies have noted that IL-7R activation of STAT5 promoted chromatin accessibility

163,164 through histone acetylation of the distal VH genes in pro-B cells. In small pre-B cells, which are non-responsive to IL-7, distal VH sites were hypoacetylated and thus non- accessible, providing a possible IL-7-mediated mechanism for the allelic exclusion of the HC locus by restricting recombinase access. Additionally, STAT5-/- mice displayed reduced

germline transcription and rearrangement of the VHJ558 genes, while pre-B cells from mice expressing a constitutively active STAT5 displayed increased distal VH recombination, a failure to “decontract” the IgHC locus, and a lack of IgHC and IgLC association.163-165

Conversely, rearrangement of the distal VH genes was found to be normal in Bcl-2 rescued

STAT5-/- pro-B cells, suggesting that STAT5 may not be absolutely essential in this process.121

Clarification regarding these contradictory findings will require further investigation into the possibility of early activity of STAT5 in CLPs, prior to its Cre-Rag-mediated deletion, might

allow for subsequent VH rearrangement and development to proceed.

It has also been proposed that IL-7 can function to regulate LC rearrangement. While it has been demonstrated that LC rearrangement and the production of µ+ cells occurs in the presence of IL-7, a potential role for IL-7 in regulating the efficiency of this process remains.

Decreased concentrations of IL-7 in cultures containing IRF4-/-IRF8-/- cells, or IRF4-/-/IRF8-/- cells in which IRF4 was reintroduced, resulted in an increased percentage of µ+ cells.58

Increased recombination was also observed in BLNK-/- cell cultures upon removal of IL-7 or treatment with a PI3K inhibitor.166 In both of these studies cell cycle arrest was insufficient to initiate LC recombination, suggesting that the activation of, or the removal of inhibition of other signaling pathways was necessary. It should be noted that in these studies the measurement of recombination was determined by percentage and was thus relative. Also, the loss of IL-7-responsive µ- pro-B/large pre-B cells that normally expand in culture when

IL-7 is present must be considered and accounted for when attributing observed changes in development solely to the absence of IL-7. In both situations low levels of LC rearrangement were observed in the presence of high concentrations of IL-7, demonstrating that IL-7 is not completely inhibitory to LC recombination. In the case of BLNK-/- cells, sustained PI3K activation led to Akt phosphorylation of FoxO proteins, which decreased the efficiency of recombination.166 Reintroduction of an inducible BLNK protein, or a mutated FoxO3a protein unable to be phosphorylated by Akt, resulted in an increased proportion of κ+ cells.

Correspondingly, mice deficient for FoxO3 display a reduced frequency of pre-B cells in the

BM as well as reduced recirculating B cells in the blood and BM.167

The Igk locus is regulated by two enhancers, the intronic enhancer (iEκ) and the 3’ enhancer

(3’Eκ). Deletion of either enhancer resulted in reduced Igκ rearrangement, while deletion of both enhancers completely abolished recombination.168 Increased recombination in the absence of IL-7 in IRF4-/-IRF8-/- cell cultures was shown to be independent of signals from the pre-BCR and, instead, was the result of increased Rag expression as well as histone H4 hyperacetylation and increased binding of E2A at the iEκ enhancer.58 It should be noted that in these studies the IL-7 concentration was merely reduced and not fully removed. In other studies in which IL-7 was completely removed from IRF4-/-IRF8-/- cell cultures no increase in κ expressing cells was observed.169 We have also previously shown that even at picogram concentrations, IL-7 is still able to exert physiological effects on receptive cells and work in conjunction with signals from the pre-BCR to affect downstream targets.127 Further evidence that IL-7R signaling normally regulates LC recombination was provided when it was shown that Bcl-2 rescued STAT5 deficient pro-B cells displayed a six-fold induction of Vκ-Jκ recombination as well as increased κ0 germline transcripts.116 A potential mechanism for this inhibition came from studies that showed that STAT5 bound directly to the iEκ enhancer in an IL-7-dependent manner and limited E2A accessibility.116,121

Rag1 and Rag2 are expressed at distinct stages during B cell development and are absolutely essential for antigen receptor rearrangement. A number of TFs regulate the expression of

Rag genes, including Pax5, and mice deficient for E2A, Ikaros, or FoxO1 all display a deficiency in Rag expression.170 FoxO1 is a key factor in this system, as it directly regulates

Rag1 and Rag2 expression and conditional deletion of FoxO1 resulted in impaired B cell development at the early pro-B and small pre-B cell stages, precisely when Rag activity is necessary.171,172 Furthermore, deletion of the mTORC2 subunit Sin-1, which is required for

Akt phosphorylation of FoxO1, resulted in increased IL-7R and Rag expression.173 Therefore,

IL-7R and pre-BCR regulation of FoxO1 activity is of critical importance during B cell development. Activation of the MAPK/Erk pathway downstream of BCR activation has also been shown to reduce Rag transcription by phosphorylating E47, which inhibited its binding to the Rag enhancer regions.174 While it has yet to be shown if activation of Erk downstream of the pre-BCR or IL-7R utilize this mechanism, it could provide and additional level of regulation of Rag expression that may work in synergy between these receptors. Turnover of Rag proteins is also important, because Rag2 stability is cell cycle regulated and accumulates in G0 and G1 phases, but is degraded during S phase.175,176 Therefore, IL-7R signals that keep cells in a proliferative state by inducing cell cycle progression would indirectly reduce Rag2 levels.

1.13 Pre-BCR and BCR Regulation of B Cell Development

Expression of the pre-BCR and mature BCR are critical events during B lymphopoiesis. In mice in which the pre-BCR is either unable to form or insert into a lipid bilayer (Rag1/2-/-,

µMT, and SCID), B cell development is fully arrested at the pro-B cell stage.177-180 Naturally occurring human mutations of various receptor components (Igα, Igβ, µHC or λ5) also lead to a block development at the pro-B cell stage and result in hypo- or agammaglobulinemia.1

The pre-BCR is very similar in structure to the mature BCR and makes use of HC proteins

with the same rearrangement. Pre-BCR components, VpreB and λ5, possess structural similarities to the variable and constant domains of IgLC respectively; however, they contain

-/- -/- non-Ig chain tails instead of a CDR3 region (Figure 1.2). VpreB and λ5 single or double deficient mice display an incomplete block in development at the pro-B to pre-B cell transition.181 Early LC rearrangement in SLC-/- pro-B cells is possible, and LC pairing with

µHCs may occur to provide a mechanism for cells to bypass the pre-BCR checkpoint.182

Alternatively, it has been suggested that escape of µHCs to the cell surface, either alone or in conjunction with an unknown binding partner, could also initiate signals that allow for development.183 The pre-BCR complex also contains the transmembrane proteins Igα and

Igβ, which non-covalently associate with µHCs. The cytoplasmic tails of Igα/β contain immunoreceptor tyrosine activation motifs (ITAMs), which are the critical regions that mediate signal transduction and act as docking sites for SH2 containing proteins. Prior to expression with the pre-BCR, Igα/β can be detected on the surface of pro-B cells in a structure referred to as the pro-BCR. This complex contains Igα/β associated with either the ER chaperone calnexin and SLC, or cadherin-17.184,185 The functional role of the pro-BCR during development remains unclear, as disruption of the genes encoding Igα and Igβ (mb1 and B29 respectively) do not alter pro-B cell development. Instead, deletion of B29 results in

a block at the pro-B to pre-B cell transition with cells containing DJH rearrangements but few

186 VDJH rearrangements. The observation that mb1 deficiency results in a block at the immature B cell stage demonstrates that both Igα and Igβ are important during B cell development, but they mediate different effects.187

1.14 Pre-BCR Activation

It is currently unknown whether ligand binding is required to initiate pre-BCR signal transduction. Studies supporting the ligand-independent model have shown that cells expressing a truncated extracellular domain µHC still carry out allelic exclusion, surface marker change, and LC gene transcription.188 Surface pre-BCR expression can also be bypassed by transgenic expression of LMP2A, an EBV virally encoded protein that contains an

ITAM, or by direct targeting of the cytoplasmic domain of Igα/β to the cell surface.189,190

These observations led to the hypothesis that signaling is initiated either through lipid raft

31 localization or through ligand-independent receptor aggregation. Lipid rafts are glycosphingolipid- and cholesterol-enriched plasma membrane microdomains that either include or exclude signaling proteins and act as signaling platforms that stabilize protein complexes. For the BCR, it has been observed that the Src protein tyrosine Lyn is constitutively associated in the raft domain while CD45 is excluded.191 Src is a positive regulator of pre-BCR signaling and CD45 can negatively regulate the activation of Src. Hence, it is predicted that the inclusion and exclusion of these proteins in pre-BCR lipid rafts would allow for ligand-independent receptor phosphorylation that leads to signal transduction.

Additionally, in humans it has been observed that the pre-BCR is constitutively associated within the lipid raft fraction.192 In contrast to the lipid raft model, targeting of Igα/β to either raft or non-raft domains initiated pre-BCR signaling and B cell development equally well.193

Evidence demonstrating that truncated or modified receptors can mediate the pro-B to pre-

B cell transition does not exclude the possibility that ligand engagement of the pre-BCR is important. Levels of surface expression of the aforementioned mutated/modified receptors often far exceed those of physiological conditions and may result in unnatural aggregation and activation. Additionally, many of these modifications bypass pre-BCR and BCR checkpoints, which is suggestive of constitutive signaling. Support for the ligand-dependent model comes from studies that have isolated molecules capable of binding to the pre-BCR.

Experiments that used a soluble pre-BCR-like-molecule to screen stromal cell lysates led to the discovery that heparan sulfate binds to the unique tail of λ5.194 Another pre-BCR ligand, human stromal cell molecule galectin-1, also binds through its interaction with the unique tail of λ5 on the human pre-BCR.195 The pre-BCR may also be its own ligand, as mutations of the unique tail of λ5 on the B cell surface reduced aggregation of the pre-BCR and impaired pre-

BCR internalization.196

1.15 Pre-BCR Signaling

Regardless of the method of activation, pre-BCR signal transduction is dependent on receptor aggregation and leads to the formation of the surface signaling complex. The complex includes the pre-BCR and co-receptors, such as CD19 and CD45 (Figure 1.2).197

Signaling intermediates are recruited to the complex through their interaction with ITAMs and immunoreceptor tyrosine inhibition motifs (ITIMs), which are contained within the cytoplasmic tails of surface molecules. Signal transduction is mediated by kinases and phosphatases, which function to phosphorylate and dephosphorylate proteins, and by adaptors that lack intrinsic kinase activity but instead operate to bring molecules together and allow for their interaction.

Pre-BCR signals are thought to be initiated by Src kinase phosphorylation of the ITAM regions of Igα/β (Figure 1.2).198 Src kinases also induce NF-κB signaling via PKCλ and phosphorylate the tyrosine kinase Btk, which leads to its subsequent auto-phosphorylation and activation. The Src family of kinases contain members including Src, Lyn, Blk, and Fyn, with Blk being the only B cell exclusive member. Due to the redundant nature of these molecules, mice deficient for any one member show no defect in signaling, however,

Lyn/Fyn/Blk triple-deficient mice displayed a dramatic decrease in pre-B cell numbers but normal numbers of pro-B cells.199 Phosphorylated Igα/β ITAMs serve as docking sites for the

SH2-containing Syk kinase, which is subsequently able to activate several downstream pathways through signaling mediators PI3K, Btk and BLNK.200 Deletion of Syk revealed that it was not the only family member that mediates signal transduction in developing B cells; Zap-

70 can compensate for its loss and a full block in B cell development was observed when both of these family members were deleted.201 This was surprising, since it had previously

33 been reported that Zap-70 was only expressed in T and NK cells.201 Similar redundancy was observed for BLNK, Btk and PLCγ2; LAT and SLP-76 could compensate for BLNK; Tec could partially compensate for Btk; and PLCγ1 performed a similar role as PLCγ2 (Figure 1.2).202-204

Signaling intermediates are recruited to the receptor complex by way of receptor motifs and adaptors. They can also be targeted to the complex through interaction of their pleckstrin homology (PH) domains with phosphatidylinositol lipids present in biological membranes.

Phosphatidylinositol 3, 4, 5-triphosphate (PIP3) is a key mediator of membrane localization and is generated by PI3K, which converts phosphatidylinositol 4, 5-bisphosphate (PIP2) to

PIP3.205,206 PI3K is a dimer composed of a p110 subunit that possesses catalytic activity, and a

SH2-containing p85 subunit that is important in targeting the kinase to the signaling complex.130 Mice deficient for either subunit display an incomplete block in development at the pre-B stage and a significant reduction in mature splenocytes.129,207 This B cell defect is partially due to the ineffective targeting of signaling molecules Btk, PLCγ2, and Akt to the receptor complex. PIP2 also functions as a substrate for PLCγ2, which converts PIP2 into diacylglycerol (DAG) and inositoltriphosphate (IP3).208 DAG and IP3 are secondary messengers that lead to protein kinase C (PKC) activation and calcium (Ca2+) mobilization respectively. PLCγ2 and Btk are both recruited to the receptor complex by the adaptor protein BLNK. This protein assembly allows Btk to phosphorylate PLCγ2, and leads to its full activation. BLNK has also been shown to be a binding partner for Syk in mature B cells.209

This association results in a positive feedback loop that is necessary for Erk, NFκB, and Ca2+ responses but not Akt activation.

1.16 Pre-BCR Meditated Events

Pre-BCR regulation of apoptotic factors is mediated through the PI3K/Akt and

Ras/Raf/MEK/Erk pathways. Mice deficient for, or over-expressing, the anti-apoptotic protein

Bcl-xL display reduced or elevated numbers of pre-B cells respectively.210 While Bcl-xL provides survival signals to pre-B cells, Bcl-2 exerts its affect on immature cells and Bcl-2 transgenic mice have increased IgM+ cell numbers.211

Cell proliferation, another outcome of pre-BCR signaling, is mediated in large part through the activation of the Ras-Erk pathway. The importance of this pathway in B cell development has been highlighted in Erk1/2-/- mice, which exhibit diminished pre-BCR-mediated expansion and a block at the pro-B to pre-B cell stage of development.131 As described earlier, Erk is phosphorylated downstream of both the IL-7R and the pre-BCR, which allows for enhanced proliferation and survival in picogram concentrations of IL-7.127 Further evidence demonstrating the importance of signals emanating from both of these receptors was provided when it was observed that mice lacking the IL-7R displayed a decrease in the large pre-B cell population due to defective expansion, while mice deficient for both the IL-7R and pre-BCR displayed a defect greater than observed with the loss of either alone.212 Signals emanating from the pre-BCR have also been proposed to subsequently limit pre-BCR and IL-

7 proliferation.

Pre-BCR activation of BLNK and Btk limit the proliferation of large pre-B cells and allow for further maturation. BLNK-/- or Btk-/- mice show a partial block in development at the large pre-B stage with increased expression of SLC components, increased surface pre-BCR expression, and enhanced proliferative capacity.213,214 Transcriptional down-regulation of SLC expression via BLNK, Btk, and IRF-4/8 is believed to diminish individual cell surface pre-BCR

35 expression and thus limit large pre-B cell signaling and proliferation. However, over- expression studies have demonstrated that SLC silencing is not absolutely required to limit the expansion of pre-B cells but is necessary to prevent constitutive B cell activation.215

Activation of Ikaros and Aiolos, via IRF-4/8, was shown to bind directly to the c-myc promoter and repress c-myc expression, which subsequently resulted in induced expression of p27Kip and repression of ccnd3.216,217 Large pre-B cells must come out of cell cycle prior to rearranging their LC genes, and pre-BCR activation of Ikaros and Aiolos is one mechanism by which that outcome is accomplished.

BLNK-/- or Btk-/- pre-B cells exhibit normal allelic exclusion and reduction of Rag and TdT expression, which suggests that these effects are mediated by Btk- and BLNK-independent mechanisms and possibly are not even pre-BCR-dependent events.214,218 This theory is strengthened by the observation that allelic exclusion is observed in SLC-/- mice.219 However, studies using µMT mice have shown that insertion of the µHC into the lipid bilayer is essential.179 The signaling mechanisms that result in allelic exclusion have not been fully elucidated, but it has been demonstrated that Syk-/-/Zap-70-/- and PLCγ1-/-PLCγ2-/- mice do not display allelic exclusion while BLNK-/- mice retain this ability.201,220 Consequently, allelic exclusion at the HC locus is initiated only after membrane expression of a productively rearranged µHC protein initiates downstream signals through Syk and PLCγ family members.

1.17 Surface Protein Regulation of Receptor Signaling

B220 is the 220-kDa isoform of CD45 that is present on all mouse B cells, except terminally differentiated plasmablasts. Two molecular weight isoforms of B220 exist, CD45R and

CD45RA, which differ in their glycosylation patterns and recognize slightly different cell subsets.221 CD45 is expressed on the earliest B cell precursors, as well as in varying isoforms

36 on DCs, T cells, macrophages and NK cells. CD45-/- mice exhibit reduced proliferation of mature B cells in response to foreign antigens but not to mitogens such as lipopolysaccharide

(LPS).222 CD45 dephosphorylates Src kinases, leading to their activation or inhibition depending on the tyrosine residue targeted and in its absence, Lyn is constitutively phosphorylated.223-225 Thus, CD45 appears to play both positive and negative roles during receptor signaling and functions as a modulator of signaling thresholds (Figure 1.2).225

Supporting this idea, our lab has demonstrated that CD45 can regulate the IL-7 signaling threshold for pro-B cells. Increased numbers of early pro-B cells were observed in CD45-/- mice and this population was also elevated in in vitro cultures initiated with CD45-/- precursors.226 This result was due to increased survival of pro-B cells, which displayed prolonged JAK and STAT phosphorylation in response to IL-7. These facts highlight that IL-

7R signaling is normally kept in check and that one function of CD45 in developing B cells is to limit IL-7R signaling.

CD19 is a B cell specific marker that is expressed on pro-B cells and all subsequent B cell populations except plasma cells. It is an accessory molecule that reduces the signaling threshold for the BCR by recruiting PI3K to the signaling complex, which in turn allows for the activation of Btk and Akt (Figure 1.2).227-231 Mice deficient for CD19 exhibit impaired BCR signaling and decreased peripheral B cell numbers.232-234 During B cell development, CD19 functions to regulate pre-BCR signaling and CD19-/- mice display defects in the transition from the pre-B to immature B cell stage of development that is partially due to deficient phosphorylation of Btk and the MAP kinase Erk.235

1.18 Selection of B Cells

It has been estimated that 108 B cells are produced in the murine BM every day, however, only a small percentage of these precursors ever develop into functional mature B cells.236

Approximately 75% of cells fail to transit past the pre-B cell checkpoint and only 10% of immature cells make it into the periphery.237 Cell apoptosis is usually the result of unsuccessful HC or LC rearrangement, or inefficient SLC-HC or LC–HC pairing, as it has also been estimated that only one-third of pro-B cells undergo productive HC recombination and that half of the µHCs generated cannot associate with SLCs.238,239 This selective binding is believed to act as a mechanism to test the capacity of µHCs to pair with potential LCs and thus maximize the formation of mature receptors.181 Failure of µHCs to pair with SLCs results in further rearrangement at the HC locus until a functional µHC, capable of combining with SLC to produce a functional pre-BCR, is generated. While all pre-BCR+ cells enter the cell cycle, individual cell expansion may not be uniform. It has been proposed that the relative binding strength between SLC and µHCs may alter signal intensity and result in greater proliferation and selection of cells possessing ideal receptor pairing.240 The clonal expansion of pre-B cells with the same productive HC allows independent daughter cells to generate different LCs and thus increase receptor diversity in the periphery.

Approximately half of all immature B cells possess self-reactive BCRs and must be prevented from exiting into the periphery.241 Several studies have shown that a high-affinity receptor interactions on immature B cells lead to deletion or anergy.242 However, ligation of the BCR by self-antigen on immature B cells can also result in receptor editing, which can occur at both the HC and LC locus, which allows for the possibility of generating alternative receptors that are not self-reactive.243 BCR engagement on transitional cells no longer leads

38 to deletion or anergy, and instead signal intensity is believed to direct cells toward Fo, MZ, and B-1 B cell fates.

1.19 Development and Function of Mature B Cells

B cells are classically defined as adaptive immune cells that mediate their effects through the recognition of specific antigenic epitopes. Fo B cells are the main effector cells of adaptive B cell immunity. Fo B cells are relatively long lived (~5 months), make up the majority of the peripheral B cell pool, and express highly diverse receptors that typically respond to T-cell dependent (TD) protein antigens. The engagement of the BCR on these cells, in conjunction with signals from helper T cells, lead to the generation of germinal centres (GC), which are temporary structures that provide the microenvironment for B cells to develop through their interaction with antigen-presenting follicular DCs.244 During this maturation, Fo B cells begin the process of somatic hypermutation, which causes mutations in HC and LC proteins and results in the formation of higher- and lower-affinity BCRs. Newly specified receptors then go through a process of affinity maturation, which allows for the selection of cells with increased BCR specificity leading to a more robust response to foreign antigen.245 These mature B cells can also switch their effector function by converting to other antibody isotypes (IgA, IgE and IgG). Class switched Fo B cells express the same BCR specificity as their IgM parent cells and migrate throughout the periphery where they become plasmablasts and long-lived memory cells. Plasmablasts produce large amounts of antibody, which is a secreted version of the BCR.

The majority of antibodies produced in the body are the result of the affinity maturation process, however low affinity antibodies are also generated both naturally and in response to antigen.246 These antibodies are produced by MZ and B-1 B cells, tend to be less diverse than

39 those produced by their Fo cell counterparts, and typically recognize carbohydrate- or glycolipid-containing T-cell independent (TI) antigens associated with bacterial membranes, such as LPS. There is also evidence that to some extent, MZ and B-1B cells are selected based on positive interaction with self-antigen.247,248 MZ B cells reside in the marginal sinus region of the spleen, are very long lived (>1 year), and possess low-affinity/high-avidity

BCRs.249 Activation of these cells occurs independently of T cells and leads to their proliferation and development into plasmablasts. Immediate and “innate” responses from MZ and B1 B cells provide a first line of defence that limits pathogen spread and provides the necessary time for more specific “adaptive” Fo B cell responses to develop.

B-1 B cells account for approximately 5% of the total B cell pool and typically reside in the peritoneal and pleural cavities.250 They differ from “conventional” B-2 B cells (Fo and MZ) in their development and activation and produce low-affinity IgM antibodies that can be detected in individuals independent of infection or immunization. Although these cells were originally defined by their CD11b+CD5+IgMhiIgDlo phenotype, the discovery of CD5- counterparts led to the further classification of B-1a (CD11b+CD5+IgMhiIgDlo) and B-1b

(CD11b+CD5-IgMhiIgDlo) subsets.251 The main functional difference between these two subsets is that B-1a B cells spontaneously produce antibody and are important in the early stages of a response, while B-1b B cells are induced to secrete antibody and are more prevalent in the later stages of pathogen clearance.252,253 There has been much debate as to the origin of B-1 B cells and two leading hypotheses currently exist. One model suggests that both B-1 and B-2 B cells are generated in a similar fashion in the BM, but environmental signals and thresholds of antigen receptor binding in the periphery bias B-1 versus B-2 fate.254

This hypothesis is supported by the observation that stimulation of B-2 B cells with certain antigens leads to the expression of CD5 and ability to respond to phorbol esters,

40 characteristically B-1 B cell responses.255 The alternate model to B-1 B cell origin is one of early lineage commitment and proposes that B-1 B cell specification occurs early in the developmental process and is mainly a function of fetal development.256 This model is supported by the fact that when irradiated or immunodeficient adult mice were reconstituted with cells from fetal tissues predominantly B-1 B cell development was observed; when reconstitution was performed using adult BM, B-2 B cells were the prominent cell population observed.257 The identification of a novel B cell progenitor with a

CD45-/lo/CD19+ phenotype that is restricted to the B-1 B cell fate has provided further support for the lineage model.258

The restricted Ab specificity of B-1 B cells could be, in large part, a consequence of cell development within the fetal environment. Since TdT is not expressed during fetal development, B cells generated during this time display decreased diversity in the CDR3 region.259 Additionally, Ig recombination in the absence of TdT results in joining of specific V,

D and J gene segments that contain complimentary ends.260 Both of these mechanisms result in a restricted receptor repertoire that is more representative of germline sequences and leads to the possibility of evolutionary conserving sequences that possess specific antigen binding domains targeted against common pathogen epitopes. It is tempting to speculate that the production of B-1 B cells during fetal development would provide a pool of natural neutralizing antibody that is capable of providing a quick response to common bacterial infections prior to the development of the adaptive immune system. In line with this, forced expression of TdT during fetal life can prevent the generation of B cells possessing anti- phosphorylcholine specificity, which is important for protection against streptococcus pneumoniae infection.261

The generation of B-1a, B-1b, MZ and Fo B cells is dependent on BCR signal strength as well as on the environmental context in which signals are received. One model suggests that strong BCR signals during fetal development direct cells toward the B-1a B cell fate, intermediate signals lead to B-1b or MZ B cells, and weak BCR interactions result in receptor editing or death.251 By contrast, during adult development, strong BCR signals elicit cell death or receptor editing, while intermediate signals lead to MZ and B-1b B cell fate, and weak signals generate Fo (B-2) B cells. Additional factors have also been shown to be important for mature B cell survival, including those mediated by the tumour necrosis family

(TNF) member BAFF. BAFF-/- mice lack most mature B cells and BAFF-R signaling has been shown to be necessary for cell survival by increasing the expression of anti-apoptotic factors

Bcl-2 and Bcl-xL, while also inactivating pro-apoptotic factors, such as FoxO proteins.262

Therefore, BCR signaling in conjunction with other environmental factors regulate the maturation and survival of peripheral B lymphocytes.

1.20 Thesis Outline

During development, B cells exhibit complex gene networks that are regulated by intricate signaling pathways influenced by surface receptors and intrinsic TFs. Decisions regarding cell survival, proliferation and differentiation are both instructive and stochastic in nature.

Selection of cells occurs at developmental checkpoints and ensures the generation of functional mature B cells, which display remarkable receptor diversity and very little self- reactivity. This thesis will focus on the molecular mechanisms that regulate the survival, proliferation, differentiation and selection of B cells as they develop from committed B cell progenitors to mature Ig secreting B cells.

In vitro B cell cultures have played a significant role in the study of B cell development, however, their utility in developmental and biochemical studies has been limited by the challenges associated with obtaining and maintaining adequate cell numbers of pure and/or rare populations. Although B cell lines allow for the circumvention of some of these issues, they have traditionally been generated via viral infection or genetic transformation and thus are less representative of in vivo cells. In chapter 3, I will describe the generation and characterization of stromal-free IL-7-dependent cell lines isolated directly from BM. IL-7- dependent cell lines can be established from wild type and mutant mice and do not require stromal cell support for their generation or maintenance. In addition, cell clones survive repeated freeze/thaw cycles and in the presence of IL-7 can be kept in culture indefinitely.

Phenotypically, these lines resemble pro-B/pre-B cells and exhibit IL-7R and pre-BCR signaling profiles that mimic ex vivo B cells. Cell lines described in chapter 3, as well as lines generated from additional knockout mice, were utilized in subsequent chapters and have been invaluable in examining the signaling pathways that regulate B cell development.

During B lymphopoiesis, IL-7 induces survival, proliferation and differentiation signals that are important during the pro-B to pre-B cell transition. Previous work, carried out by our lab and others, has demonstrated the critical requirement for regulating IL-7R signaling throughout B cell development, specifically at the pro-B to pre-B cell transition. In chapter 4,

I will describe a novel mechanism of IL-7R regulation in progenitor B cells that utilizes both receptor feedback and the integration of signals from other cytokine pathways. I show that murine small pre-B cells no longer proliferate or survive in response to IL-7, yet maintain receptor surface expression. Loss of proliferative responsiveness to IL-7 is mediated by

SOCS-1, the expression of which is regulated during B lymphopoiesis, with the highest levels observed in small pre-B cells. SOCS-1 inhibits IL-7 responses in pre-B cell lines and ex vivo B

43 lineage cells. SOCS-1 expression, and thus responsiveness to IL-7, can be regulated by IL-7 itself as well as IFN-γ and IL-21, while CXCL12 and Gfi1b enhance the proliferative responsiveness of B cell lines. I demonstrate that these molecules act together to form a

SOCS mediated “rheostat” that controls the level of IL-7R signaling in developing murine B lineage cells.

After maturing to the small pre-B cell stage of development, B cells no longer respond to IL-

7 and require contact with stromal cells to develop to the mitogenic responsive stage. The requirement for stromal cells in mediating this maturation can be bypassed if B cell progenitors are grown with LPS in conditions that promote cell-cell contact.89 Surface components of the pre-BCR are important in regulating this development, as the addition of anti-µ fab inhibits maturation.90 Heparan sulfate has been identified as a putative pre-BCR ligand and the exogenous addition of heparan sulfate, as well as heparin, enhanced the development of B cell progenitors to the IgM secreting stage.194,263 In chapter 5, I will describe what affect these molecules have on the development of B cells in cultures containing IL-7, as well the role that CD19 plays in regulating development during the pro-B to immature B cell transition. I demonstrate that pre-treatment of cells with heparin, heparan sulfate or CD19 amplifies the signaling potential of anti-µ, however, CD19 expression is not required for heparin or heparan sulfate to mediate their physiological effects. CD19 expression was necessary for signaling downstream of the pre-BCR, and in its absence, impairment exists in the development of B cells progenitors to the immature B cell stage in IL-7, as well as in the subsequent LPS-mediated maturation of B cells to the IgM secreting stage. Together, heparin, heparan sulfate and CD19 work to modulate the signaling capacity of the pre-BCR and in doing so regulate the efficiency in which B cell development proceeds.

Chapter 2

2 Materials and Methods2

2 Sections of this chapter appear in J Immunol Methods. 2007 Aug 31;325(1-2):9-19. Corfe SA, Gray A, Paige CJ; J Immunol. 2008 Mar 1;180(5):2839-47 Milne CD, Corfe SA, Paige CJ; J Immunol. 2011 Oct 1;187(7):3499- 510. Corfe SA, Rottapel R, Paige CJ.

2.1 Mice

C57Bl/6 mice were obtained from The Jackson Laboratory (Bar Harbor, ME) at 4-8 weeks of age. µMT mice were obtained through Dr. L. Shultz (The Jackson Laboratory, Bar Harbor,

ME). CD45 exon 6-/- mice were generated previously and have been backcrossed to the

C57Bl/6 background.222 CD19-Cre mice were obtained through Dr. T. Mak (Ontario Cancer

Institute, Toronto, ON). Insertion of Cre into the CD19 locus results in the disruption of the coding sequence of the CD19 gene and homozygous mice are CD19 deficient.264 All mice were bred and maintained at the Ontario Cancer Institute animal facility (Toronto, ON) and were used between 6 and 12 weeks of age. All animal procedures conformed to institutional animal protocol guidelines.

2.2 Isolation of B cells

B cell progenitors were isolated from BM of 6-12-week-old mice for all experiments. Single cell BM suspensions were prepared by crushing and gently grinding leg bones using a mortar and pestle and then flushing with PBS/FCS (PBS supplemented with 3% heat inactivated (HI) fetal calf serum (FCS)), or MACS buffer (PBS-Ca2+,-Mg2+, 1 mM EDTA, 0.25% BSA).

2.3 Magnetic Activated Cell Sorting (MACS)

BM cells were selected for expression of either B220 or CD19 by MACS (Miltenyi, Auburn,

CA). B220+ cells were isolated from BM directly using an anti-B220 bead-coupled antibody

(clone RA3-6B2, Miltenyi) at 5 µL/107 cells in 500 µL of MACS buffer. For CD19 selection, a two-step process was used. First, anti-CD19 antibody (supernatant from clone ID3) was incubated with BM cells for 20 minutes on ice at a dilution of 1/500 in 10 mL of MACS buffer. Cells were then washed twice in MACS buffer, resuspended in 500 µL of MACS buffer and incubated with a goat anti-rat bead-coupled antibody (Miltenyi) at 5 µL/107 cells.

Cells were positively selected in a VarioMACS magnet with an LS adaptor. Cells were washed three times with MACS buffer and eluted with 10 mL of OptiMEM supplemented with 10% non-heat inactivated (NHI) FCS. Typically, 10-20×106 B220+ or CD19+ cells were recovered from BM (two femurs, two tibias). Isolation by MACS resulted in >95% purity as assessed by flow cytometry.

2.4 Fluorescence Activated Cell Sorting (FACS)

Red blood cells were removed from BM cell suspensions by re-suspending centrifuged cells in 1 mL ACK solution (0.155 M ammonium chloride, 0.1 mM disodium EDTA, 0.01 M potassium bicarbonate, pH 7.3) and incubating for 3 minutes on ice. Incubation was followed by the addition of 9 mL PBS/FCS and centrifugation. Cells were re-suspended in 100 µL of

PBS/FCS, stained with appropriate antibodies and sorted using either MoFlo (Cytomation,

Inc) or Aria (BD Biosciences) cell sorters. An example sorting strategy and post sort purities are displayed in Figure 2.1.

Figure 2.1 Sorting Strategy and Post Sort Purities for B Cell Subsets

BM was isolated and treated with ACK prior to staining for CD19, CD2, IgM, and IgD. Samples were gated on CD19+ live cells and then sorted for CD2-IgM-, CD2+IgM-, or CD2+IgM+IgD- B cell subsets. Sort parameters (A) and post sort purities (B) are displayed.

2.5 Cell Culturing With IL-7

Primary B cell cultures were initiated from FACS or MACS selected BM by seeding cells in

24 well plates at a density of 5×104 cells/mL in 2 mL of OptiMEM (+10% NHI FCS, 50 µM β-

mercaptoethanol (β−ME), 2.4 g/L NaHCO3, and 100 µg/mL penicillin-streptomycin or kanamycin). Supernatant from the J558 cell line, which had been previously stably transfected with the IL-7 gene, was used as a source of IL-7 (supplied by Dr. Ana Cumano, Institute

Pasteur, Paris). The concentration of IL-7 used in culture was 5 ng/mL unless otherwise

stated. Cells were cultured in a humidified atmosphere at 37°C and 5% CO2. An aliquot of cells was removed and cultured in fresh media supplemented with IL-7 every 4-5 days or when cell densities reached 5×105 cells/mL. Cell lines were cultured under similar conditions except that 5% HI FCS was used instead of 10% NHI FCS. The B62.1 cell line is a stromal- independent IL-7-dependent cell line that was generated by the cloning of B220+ selected BM cells that had been cultured in IL-7 for approximately one month. The B62.1 IND line is a selected variant of the B62.1 parent cell line and was created by culturing B62.1 cells in gradually reduced concentrations of IL-7. During this process the majority of cells died, however, surviving cells were expanded and subsequently cloned to yield a novel cell line that no longer required IL-7 for growth and survival, but was still responsive to IL-7.

2.6 LPS Cultures

Sorted or MACS selected primary B cells were expanded in IL-7 for 4 days and then tested for mitogen responsiveness by culturing with LPS (Sigma, Oakville, ON). Cells were cultured in 96 well round bottom well plates (Costar/Fisher, Nepean, ON) at a concentration of 200-

4000 cells/well in 200 µL OptiMEM supplemented with 15 µg/mL LPS. In certain experiments, heparin (Sigma, Oakville, ON), heparan sulfate (Sigma, Oakville, ON),

49 heparitinase (Seikagaku/Associates of Cape Cod, East Flamouth, MA), or anti-CD19 (BD-

Pharmingen, Mississauga, ON) were added at indicated concentrations. Heparitinase was added every 24 hours for the duration of culture, which was sufficient to reduce the epitope detected by the 10E4 antibody.263 Cells were cultured in a humidified atmosphere at 37°C

and 5% CO2 for 7 days.

2.7 Generation of IL-7-Dependent Cell Lines

Cultures were established by seeding 1×104 B220+ or CD19+ BM cells in 4 24-well plates containing 1 mL of OptiMEM (10% NHI FCS) supplemented with IL-7. All wells were treated as individual lines with no cross contamination of media, tips, or reagents. On day 4 of culture, 1 mL of fresh IL-7-supplemented media was added to each well. Cells were fed with

IL-7 every 4-5 days. On day 8, 1 mL of media was carefully removed from the top of each well without disrupting the cells on the bottom and 1 mL of fresh media was added. On day

12, wells were mixed and half of the contents were removed and either discarded or plated in a new 24-well plate (Figure 2.2).

On approximately day 21, a large portion (~80%) of the cells began to die. Surviving cells continued to grow and when they reached a density of approximately 5×105 cells/mL and appeared healthy, half of the contents of each well (1 mL) was passed to a fresh 6-well plate.

2 mL of IL-7-supplemented media was added to the new 6-well plate and 1 mL of IL-7- supplemented media was added to the remaining 1 mL left in the 24-well plate. It was important to maintain the original well, as sometimes cells failed to grow when passed into the larger 6-well plate. Cells were fed with IL-7 every 4-5 days and when they appeared healthy and reached a density of 5×105 cells/mL the entire well was passed into a small flask containing 3 mL of fresh IL-7-supplemented media. When the cells in the small flask reached

50 a density of approximately 5×105 cells/mL, they were analyzed for surface phenotype and frozen. Freezing was carried out by centrifuging the cells, re-suspending in 1 mL of media supplemented with IL-7, and then adding 500 µL of this cell suspension to 500 µL of freeze media (80% FCS, 20% DMSO). Samples were mixed by inverting, placed on dry ice and, once frozen, stored at –80oC.

Figure 2.2 Schematic For the Generation of IL-7-Dependent Cell Lines

2.8 Cloning of Cell Lines

Frozen cells were thawed in 10 mL of media, centrifuged, and then re-suspended in 1 mL of media supplemented with IL-7 in a 24-well plate. Cultures were expanded to the small flask stage as described above, and upon reaching a density of approximately 5×105 cells/mL, were harvested, counted, and plated as limiting dilutions of 100, 50, 25, and 12.5 cells/well in 100

µL of IL-7-supplemented media. Each cell concentration was repeated in 24 wells of a 96-well plate. After 4 days, plates were scored visually for colony growth, with wells containing clusters of at least 50 live cells scored as positive. Wells were assumed to be clonal if, at any given cell concentration, 37% of the wells were negative according to Poisson distribution.

These clones were then expanded to the large flask stage, analyzed for surface phenotype, and frozen at –80oC.

2.9 Immunofluorescence Staining and Flow Cytometry

Cells were analyzed for surface and intracellular markers using flow cytometry. Cells were washed in FACS buffer (PBS, 3% FCS) and then resuspended in a 96-well round bottom assay plate or polyethylene FACS tubes. For surface phenotyping, cells were labeled for 15 minutes on ice in a total volume of 100 µL. The following antibodies were used for staining: anti-B220

(RA3-6B2), anti-CD19 (MB19-1), anti-CD117 (ACK2), anti-CD43 (S7, BD-Pharmingen), anti-

CD2 (RM2-7, BD-Pharmingen), anti-CD22 (2D6), anti-CD25 (7D4, BD-Pharmingen), anti-

BP.1 (6C3), anti-CD24 (M1/69, BD-Pharmingen), goat anti-mouse IgM (Southern Biotech), anti-µ (33.60, Lab Made), anti-IgD (11-26c), anti-IL-21Rα (ebio4A9), anti-IL-7Rα (A7R34), anti-IL-7Rγc (4G3, BD-Pharmingen). anti-Ig-κ (187.1, Lab Made), and anti-λ5 (FS1, Lab Made).

All antibodies were purchased from eBioscience unless otherwise stated. For biotin- conjugated antibodies, cells were washed twice after primary staining and then incubated

52 with a streptavidin-conjugated PerCP antibody (BD-Pharmingen) for 15 minutes on ice.

Samples were washed twice in FACS buffer before being analyzed. For determination of cytoplasmic expression of µHC, cells were fixed 1:2 in 2% paraformaldehyde for 15 minutes at room temperature. After washing once in FACS buffer and once in PBS alone, cells were permeabilized using a 1:2 dilution of PBS (+0.4% Tween-20) for 15 minutes at room temperature. Cells were then labeled with anti-µ (33.60) and incubated for 20 minutes on ice, after which they were washed twice with FACS buffer (+0.2% Tween-20). FACS analysis was performed using a FACSCalibur flow cytometer (BD Biosciences). Acquisition and analysis software used was either FloJo (Version 7.2) or CellQuest (Version 3.3).

2.10 Cell Stimulation and Western Analysis

Prior to stimulation, cells were washed three times in OptiMEM (+0.5% FCS) to remove IL-7 and then starved for 1.5–2 hr in a 37°C humidified incubator at 1×107 cells/mL (cultured cells) or 5×106 cells/mL (primary cells). Cells were stimulated by the addition of 15 µg/mL

F(ab′)2 goat anti-mouse µHC (Jackson Immunoreseach Laboratories, Jackson, ME), 25 ng/mL murine IL-7, or both, for indicated time periods. Cells were lysed in 200 µL of lysis buffer

(1% NP40, 150 mM NaCl, 20 mM Tris-HCl (pH 7.4), 1 mM EDTA, 10 mM sodium fluoride, 1 mM sodium orthovanadate, 5 mM sodium pyrophosphate, 1 mM PMSF, and 5 µg/mL aprotinin and leupeptin) on ice for 1 hour. The detergent-insoluble fraction was removed by centrifugation of the samples at 12000 rpm for 10 minutes. Protein samples were mixed with

4× NuPAGE sample buffer (Invitrogen, Burlington, ON) and 0.7 M β−ME, resolved on a 4-

12% gradient NuPAGE gel, and transferred to a PVDF membrane in transfer buffer (20 mM

Tris, 150 mM glycine, 20% methanol). Membranes were blocked in TBST (TBS + 3% Tween) with 5% milk for 2 hours. Membranes were then washed three times in TBST and probed for

53 phosphorylated Erk1/2 (pErk), pSTAT5 or pJAK1 according to the manufacturer's instructions (New England BioLabs, Ipswich, MA). Membranes were washed three times in

TBST and subsequently probed with goat anti-rabbit IgG-HRP (Santa Cruz Biotech, Santa

Cruz, CA) for 1 hour. After washing three times in TBST, membranes were developed using an enhanced chemiluminescence detection kit (Amersham Biosciences, Pittsburgh, PA). For loading controls, membranes were stripped using the Re-Blot Plus recycling kit (Chemicon

International, Temecula, CA) according to the manufacturer’s instructions. Blots were then washed in TBST, blocked in milk, and reprobed for total-Erk1/2 (New England BioLabs,

Ipswich, MA) or β-actin (Santa Cruz Biotech, Santa Cruz, CA).

2.11 IL-7-Responsiveness (Limiting Dilution Assay)

To determine the frequency of IL-7-responding cells, sorted or selected primary B cells or

IL-7-dependent B cell lines were harvested, counted, and re-plated as limiting dilutions of

200, 100, 50, and 25, or 5, 2.5, 1.25, 0.625, and 0.313 cells/well in IL-7-supplemented media in 96-well plates. Each cell concentration was repeated in 24 wells. After 4 days, plates were scored visually for colony growth, with wells containing clusters of at least 50 live cells scored as positive. The frequency of IL-7-responsive cells was determined according to

Poisson distribution.

2.12 Enzyme Labeled Immunosorbent Assay (ELISA)

96-well ELISA plates (EIA/RIA, Costar/Fisher, Nepean, ON) were coated with goat anti- mouse IgM (Jackson Immunoreseach Laboratories, Jackson, ME) at a concentration of 5

µg/mL in coating buffer (0.05 M Tris HCL pH 9.8, 0.15 M NaCl) overnight at 4oC. Plates were washed eight times using distilled water, patted dry and blocked with PBS/FCS for 1 hour at room temperature. Plates were washed twice with distilled water prior to the

54 addition of sample. Supernatants from LPS cultures were added at 0, 10x and 100x serial dilutions in PBS/FCS and incubated for 1 hour at room temperature. A standard curve used to determine sample concentration was created using 2-fold serial dilutions of purified IgM ranging from 500 to 3.9 ng/mL. Plates were washed eight times with distilled water and incubated with peroxidase conjugated goat anti-mouse IgM at a concentration of 1:2000 in

PBS/FCS for 1 hour at room temperature. Plates were washed eight times with distilled water and incubated with 50 µL of developing substrate (0.5 mg/mL 2,2,3- ethylbenzthiazoline-6-sulfonic acid (ABTS), 0.05 M phosphate citrate buffer, and 0.03% sodium perborate (Sigma, Oakville, ON)) for 30 minutes to 3 hours. Absorbance was read at

405/630 nm with an OptiMax microplate reader (Molecular Devices, Sunnyvale, CA).

Concentrations were calculated using the SoftMax Pro software. Values falling within the linear range of the standard curve were imported into Graph Pad Prism (Version 4.2) and analyzed.

2.13 3H-Thymidine Incorporation Assay

Cell proliferation was measured by incorporation of 3H-thymidine (Perken Elmer, Wellesley,

MA). Sorted or MACS selected primary cells or various IL-7-dependent cell lines were plated in triplicate at 1000-5000 cells/well in OptiMEM media (+5-10% FCS) in 96-well flat bottom plates (Costar/Fisher, Nepean, ON) with varying concentrations of IL-7. Cells were cultured at 37oC and 5% CO2 for 3-4 days. On the final day of culture 0.5 µCi of 3H-thymidine was added to each well and plates were incubated for another six hours. Cells were then lysed and harvested onto microplate filters and allowed to dry for approximately 1 hour. 25 µL of scintillation fluid was added to each well and plates were read in a scintillation counter

(Topcount Systems, Canberra Packard, Meridien, CT). Antibodies and stimulants were added on day 0 of culture at indicated concentrations.

2.14 RT-PCR and Real-Time PCR

Total RNA was extracted from sorted or MACS selected primary cells as well IL-7-expanded

B cells and B cell lines using Trizol reagent (Invitrogen, Burlington, ON) as per the manufacturer’s instructions. Alternatively, in some cases cells were lysed into RTL buffer

(Qiagen, Toronto, ON) and then passed through a Qiashredder column. RNA was isolated using the RNeasy mini kit (Qiagen, Toronto, ON) according to the manufacturer’s instructions. 5 µg of RNA was reverse transcribed into cDNA using Superscipt II (Invitrogen,

Burlington, ON) as per the manufacturer’s instructions. After reverse transcription socs-1, socs-3, ifn-γ, gfi-1b and β-actin were amplified by RT-PCR. PCR reactions were set up using 1

µL of cDNA and run for 22-35 cycles. PCR products were separated by electrophoresis on a

1.5% agarose/TAE gel and visualized by ethidium bromide staining. For real-time quantitative

PCR, total RNA was extracted as described for RT-PCR. After reverse transcription, socs-1, socs-3 and gfi-1b were amplified by real-time PCR according to the manufacturer’s instructions (Applied Biosystems, Carlsbad, CA). β-actin was used for sample normalization.

Gene primers are displayed in Table 2.1.

Primer Name Sequence (5’ – 3’)

socs-1 RT For GCAGCTCGAAGAGGCAGTCGAA

socs-1 RT Rev GCTCCCACTCTGATTACCGGCG

socs-3 RT For GCCATGCAATTACC-TGGAAC

socs-3 RT Rev CAAAGTCTGAGTTGAACTGG

ifn-γ RT For ATCCTTTGGACCCTCTGACTT

ifn-γ RT Rev TAATCTGGCTCTGCAGGATTT

gfi-1b RT For CGCGGATCCATGCCACGGTCCTTTCTA

gfi-1b RT Rev AGGTGTGTTTCTTCATGTCC

β-actin RT For TCCCTGGAGAAGAGCTACGA

β-actin RT Rev ATCTGCTGGAAGGTGGACAG

socs-1 Real-time For GCAGCTCGAAGAGGCAGTCGAA

socs-1 Real-time Rev GCTCCCACTCTGATTACCGGCG

socs-3 Real-time For TGAGCGTCAAGACCCAGTCG

socs-3 Real-time Rev CACAGTCGAAGCGGGGAACT

gfi-1b Real-time For CCTGTGATGTCTGTGGCAAAACC

gfi-1b Real-time Rev AGGGTGGATGAACGCTTGAAGG

β-actin Real-time For GCCAACCGTGAAAAGATGACCCAG

β-actin Real-time Rev ACGACCAGAGGCATACAGGGACAG

Table 2.1 Primer Sequences

2.15 Viral Infections

Generation of plasmids and GP+E packaging cell lines expressing MIEV retroviral constructs

(GFP, SOCS-1, SOCS-1 SH2 and SOCS-1 ΔCT) were obtained from Dr. Robert Rottapel

(Ontario Cancer Institute, Toronto, ON) and have been previously described.265,266 MigR1 retroviral constructs (GFP and Gfi-1b) were obtained from Dr. Barbara Kee (Department of

Pathology, University of Chicago, Chicago, IL) and have been previously described.267 For infection of B cells, GP+E cells expressing retroviral constructs were irradiated with 2000 rads prior to plating at 4×105 cells/well in a 6-well plate and culturing overnight. The following day an equivalent number of target cells (MACS selected BM or IL-7-dependent cell lines) were added to GP+E cultures in a total volume of 5 mL. Cells were cultured in

OptiMEM (+10% FCS) supplemented with IL-7 and 1:4000 polybrene (8 mg/mL stock). An aliquot of cells was taken on subsequent days and checked for infectivity by analyzing for GFP expression. Positive cells were enriched based on GFP expression and checked for purity prior to being put back in culture.

Chapter 3

3 Generation and Characterization of Stromal Cell-

Independent IL-7-Dependent B Cell Lines3

3 Sections of this chapter appear in J Immunol Methods. 2007 Aug 31;325(1-2):9-19. Corfe SA, Gray A, Paige CJ.

3.1 Introduction

The in vitro culturing of B cells can be used to study B lymphopoiesis and the signal transduction pathways that regulate development. In vitro cultures have traditionally used stromal cells as support for progenitor B cells, however, it has been shown that addition of

IL-7 and other cytokines makes the requirement for stromal cells unnecessary.87,89 By facilitating the analysis and characterization of wild type, as well as knockout and transgenic mice, in vitro cultures have provided important information regarding the ways in which specific molecules and signaling pathways affect B cell development. However, B cell subsets often exist in limited numbers and can be hard to grow in culture, which made the biochemical study of distinct and homogeneous populations difficult prior to the advent of B cell lines.

B cell lines have been created by exposing cells to radiation, chemical mutagens, viruses and gene transfections. Infection with the Abelson murine leukemia virus (AB-MuLV) induces cytokine-independent pre-B cell malignant transformation via expression of the v-Abl protein and results in the constitutive activation of several signaling pathways, including the

JAK/STAT pathway.268,269 Abelson lines have been useful for studying certain aspects of B cell development, however, these manipulated lines have been less informative when studying activation of physiological signaling pathways. Lines generated in a manner that preserves a more natural state of signaling pathways are of greater use for this purpose, since they are a better representation of in vivo cells.

Previous reports have described the creation and characterization of IL-7-dependent B cell lines. However, in many of these cases, B cell cultures required the use of stroma for support and often only resulted in the fortuitous generation of one or a few lines.26,270-276 In

60 contrast, our lab has generated numerous pro-B and pre-B cell lines in the absence of stromal cells for the purpose of studying B cell development.90,127,162,226,263,277 Grown indefinitely in the presence of IL-7, our lines are easily manipulated, infected and stimulated.

IL-7-dependent B cell lines have been crucial in studies that have furthered the understanding of signals downstream of B cell receptors and have shed light on how signaling pathways intersect and regulate B cell development.

While our lab has previously generated and utilized IL-7-dependent B cell lines, a thorough analysis and description of the lines has not been carried out. In this chapter, I describe in detail the generation, surface characterization and signaling capacity of stromal-free IL-7- dependent B cell lines. Cell lines were created by the selection of B220+ or CD19+ BM cells, which were subsequently cultured in IL-7 for several weeks. Cultures were cloned to give individual cell lines that exhibited a wide variety of phenotypes that resembled B cells at the pro-B and pre-B cell stage of development. Finally, the ability of cell lines to signal through the pre-BCR and IL-7R was tested and compared to that of ex vivo B cells.

3.2 Results

3.2.1 Frequency of Generation of IL-7-Dependent B Cell Cultures

BM from wild type or mutant mice was selected for CD19+ or B220+ progenitors and plated at 1×104 cells/mL in 24-well plates. Cells were maintained and expanded to 6-well plates and finally transferred to small flasks before being analyzed and frozen prior to cloning. It should be noted that over the course of long-term culturing a small proportion of wells became contaminated and had to be sterilized and discarded to avoid further contamination of the plate. The frequency with which wells reached the freezing stage is displayed in Table 3.1.

49% of wells seeded with wild type BM selected for CD19+ cells survived to the cloning

61 stage. An identical result was observed for cells from CD45-/- mice, and thus it can be concluded that CD45 deficiency did not alter the efficiency with which IL-7-dependent long- term cultures could be generated.

Comparison of the selection method used to isolate BM cells revealed a notable increase in the percentage of B220+ selected cells surviving to the cloning stage (67% B220+ vs. 49%

CD19+). This difference might signify an improved rate of survival of cells selected by this marker, or might simply reflect an inherent discrepancy between the B220+ and CD19+ selected BM populations. However, this disparity was not due to more IL-7-responsive cells in the B220+ population. In fact, the CD19+ fraction had a slightly higher frequency of IL-7- responsive cells (CD19 – 1:95 ± 9 vs. B220 – 1:124 ± 11). A dramatic decrease was observed when the frequency of long-term cultures established from B220+ BM from µMT mice was compared to that from wild type mice (35% µMT vs. 67% WT). This result is intriguing, given that B220+ selected BM from µMT mice had a much higher frequency of IL-7-responsive cells

(µMT – 1:50 ± 13 vs. B220 – 1:124 ± 11). These observations highlight that differences in starting populations can influence the ability to generate long-term IL-7-dependent B cell cultures.

# of % of Mouse Selection Mouse Positive Positive Genotype Method Replicate Wells Wells WT CD19 A 43 50% B 41 53% C 37 45% Total 121 49%

CD45-/- CD19 A 56 60% B 45 49% C 28 37% Total 129 49%

WT B220 A 59 70% B 59 68% C 49 63% Total 167 67%

µMT B220 A 25 30% B 31 35% C 32 41% Total 88 35%

Table 3.1 Number and Frequency of Wells Resulting in Positive Cultures

BM from wild type (WT) or mutant mice was selected for CD19+ or B220+ progenitors and plated in 24-well plates. Cells were maintained and expanded in IL-7 until they reached a stage at which they could be analyzed and frozen. The number and frequency of wells reaching this stage is displayed for each mouse, as well as the total numbers and average frequencies. Contaminated wells were not counted or used in the determination of frequency analysis. Three replicate mice were used for each condition.

3.2.2 IL-7-Dependent B Cell Culture Phenotypes Prior to Freezing

The phenotype of cells reaching the cloning stage was analyzed by flow cytometry (Table

3.2). Phenotypic results varied slightly between replicate mice but the same trends were observed. Cultures were established from CD19+ or B220+ BM cells, however, some cultures lost surface expression of these markers. Notably, 7% of cultures from cells derived from CD19+ progenitors were CD19-, while 14% of cultures derived from B220+ progenitors were B220-. The overall expression of CD19 and B220 was quite similar between the genotypes and selection methods, except for the cultures generated from CD45-/- mice, which were all B220-, as expected. It should be noted that while CD43 expression decreases in intensity during B cell differentiation in vivo, this marker remains expressed on cells in vitro and is positive on virtually all of my B cell long-term cultures.16 Other markers of differentiation such as CD2, CD22, and CD25, which are normally up-regulated at the pre-B stage of development, also showed varied expression levels, with approximately two-thirds of the cultures staining positive. However, expression of CD2, CD22, and CD25 on µMT cells, albeit at slightly reduced percentages compared to wild type cultures, demonstrates that expression of these markers is not directly regulated by the pre-BCR. While the majority of cultures were surface µ-, I observed a definite and reproducible number of cells expressing µ on the surface. The cell cultures were κ- and λ5+, presumably reflective of pre-

BCR expression on these cells.

Mouse Stain % of Marker Expression

(Selection) B220 CD19 c-Kit CD43 CD2 CD22 CD25 BP.1 HSA sµ κ λ5 cµ

WT - 16% 7% 99% 1% 22% 37% 5% 49% 1% 98% 100% 3% 36% (CD19) +/- 16% 3% 0% 0% 1% 2% 0% 13% 7% 0% 0% 0% 3% + 34% 88% 1% 32% 75% 60% 58% 23% 9% 2% 0% 55% 47% ++ 26% 1% 0% 66% 2% 0% 35% 15% 36% 0% 0% 40% 12% +++ 8% 0% 0% 1% 0% 0% 2% 0% 47% 0% 0% 2% 1%

CD45-/- - 100% 3% 100% 1% 25% 36% 10% 41% 1% 97% 100% 4% 49% (CD19) +/- 0% 5% 0% 0% 1% 2% 0% 5% 3% 1% 0% 0% 5% + 0% 92% 0% 53% 71% 62% 52% 35% 5% 2% 0% 61% 43% ++ 0% 0% 0% 46% 3% 0% 35% 19% 51% 0% 0% 32% 3% +++ 0% 0% 0% 0% 0% 0% 3% 0% 40% 0% 0% 3% 0%

WT - 14% 8% 100% 0% 23% 29% 8% 50% 0% 98% 100% 3% 45% (B220) +/- 11% 2% 0% 0% 1% 1% 0% 10% 4% 1% 0% 0% 2% + 19% 90% 0% 46% 74% 70% 66% 28% 12% 2% 0% 66% 42% ++ 49% 0% 0% 53% 1% 0% 24% 11% 51% 0% 0% 31% 10% +++ 7% 0% 0% 1% 0% 0% 1% 1% 33% 0% 0% 0% 1%

µMT - 27% 20% 100% 0% 32% 48% 0% 31% 0% 100% 100% 0% 38% (B220) +/- 20% 5% 0% 0% 0% 0% 0% 15% 7% 0% 0% 0% 0% + 18% 75% 0% 15% 64% 52% 42% 38% 0% 0% 0% 59% 56% ++ 33% 0% 0% 85% 5% 0% 55% 17% 6% 0% 0% 41% 7% +++ 1% 0% 0% 0% 0% 0% 3% 0% 88% 0% 0% 0% 0%

Table 3.2 Phenotype of IL-7-Dependent B Cell Cultures After Long-Term Culturing

Cells from positive wells were expanded in IL-7 and analyzed prior to freezing. Cells were analyzed for twelve surface markers and one cytoplasmic marker (cµ). Expression was determined to be negative (-) [FLI <101], low (+) [FLI 101-102], medium (++) [FLI 102-103], high (+++) [FL1 >103], or contain both positive and negative populations (+/-). Percentages displayed reflect the number of cultures with the representative expression for each marker. (FLI – Fluorochrome Intensity)

3.2.3 Duplicate Plate Results

Plated BM cells displayed significant proliferation during the first two weeks of culture, and thus in order to avoid death due to overgrowth, cultures were split on day 12. To better understand how cells established long-term cultures, excess cells from one 24-well plate (for each mouse) were split into a new plate. Duplicate wells were maintained as separate cultures and were carried through to the cloning stage. The frequency with which cultures were generated from the replicate plate was compared to the original plate. It was observed that, in terms of generating a long-term culture or not, duplicate wells for all four groups had identical outcomes in a high percentage of cases (B220 – 79%, µMT – 83%, CD19 – 69%,

CD45 – 82%) (Table 3.3). The expected probability of having a similar outcome in both plates was calculated, assuming that they were independent events, by using the frequencies of establishing a long-term culture in the original and replicate plates (Table 3.3). Statistical comparison of expected to observed values showed that the original and replicate plates were not independent (p-value of <0.002 for WT (CD19) and <0.001 for all others). These results suggest that by day 12 a population of cells already exist in culture that possess the ability to grow for extended periods of time and generate B cell lines.

B220 µMT CD19 CD45 Total Positive in original well and positive in duplicate well 31 13 20 23 87

Negative in original well and negative in duplicate well 10 31 22 22 85

Positive in original well and negative in duplicate well 5 6 13 5 29

Negative in original well and positive in duplicate well 6 3 6 5 20 52 53 61 55 221 Percentage of duplicate wells with the same outcome 79% 83% 69% 82% 78% Expected frequency 57% 57% 50% 50%

Table 3.3 Comparison of Duplicate Plates

On day 12, a duplicate plate was established from one 24-well plate for each mouse. Original and replicate wells were maintained as individual cultures and carried through to the freezing stage. Duplicate wells were then compared to determine if a similar outcome was observed. A positive outcome refers to a well that contained a culture that survived to the freezing stage, and a negative outcome as a culture that died.

3.2.4 Phenotype Comparison Before and After Cloning

A random selection of frozen cultures for of all genotypes and selection methods were thawed and cloned to create cell lines. In all cases, thawed cells survived and could be expanded to a stage at which they were clonable. Cloning was accomplished by limiting dilution, with 4 positive wells expanded and an individual clone chosen as a representative for that line. The surface phenotype of each line was assessed by flow analysis and compared to the surface phenotype of the culture from which each line was derived. The majority of cloned lines exhibited some change in surface marker expression, with most lines having 1-3 changes over the 12 markers analyzed (Figure 3.1). Therefore, while cultures were phenotypically quite homogenous prior to cloning, surface profiles of cloned lines differed slightly. The distribution of specific marker changes is fairly broad, however, certain markers showed a higher tendency to change after cloning (B220-16%, CD22-15%, λ5-15%, cµ-15%), while others exhibited a very low rate of change (c-Kit-2%, CD43-0%, κ-1%).

3.2.5 Clonal Responsiveness of IL-7-Dependent B Cell Lines

The frequency of IL-7-responding cells was assessed in a variety of lines to determine the proportion of cells that maintained the cultures. Established pre-BCR-, pre-BCR+ and BCR+

IL-7-dependent B cell lines were plated at various cell concentrations and the frequency of responding cells was determined. By counting the number of positive wells on day 4, it is possible to calculate the frequency of IL-7-responding cells for each line (Figure 3.2). IL-7 frequency for the pre-BCR- cell line was 1:1.3, while the frequencies for the pre-BCR+ and

BCR+ cell lines were 1:1.6 and 1:2.4 respectively. These results show that while a majority of the cells are IL-7-responsive and maintain the culture, not all cells retain this ability. IL-7-non- responsive cells will either die in culture or need to adapt in some manner to survive without IL-7.

Figure 3.1 Analysis of Surface Marker Changes in IL-7-Dependent B Cell Lines

Frozen cultures were thawed and cloned to generate cell lines. After cloning, lines were re- analyzed for surface marker expression and compared to parental cultures. (A) The percentage of cell lines displaying phenotypic changes is displayed (n=53). (B) Detailed changes of surface marker expression observed between cloned B cell lines and parental cultures (n=115).

Figure 3.2 Frequency of IL-7-Responding Cells in IL-7-Dependent B Cell Lines

Pre-BCR-, pre-BCR+ and BCR+ cell lines were grown to a density of approximately 5×105 cells/mL and then harvested, counted, and re-plated at limiting dilutions in IL-7-supplemented media. After 4 days, wells were scored visually for colony growth using the criteria that wells containing clusters of at least 50 live cells were scored as positive. IL-7 frequency was determined by plotting the percent of unresponsive wells versus the number of cells plated per well and finding the intersect point at which 37% of the wells were unresponsive, according to Poisson distribution.

3.2.6 Pre-BCR and IL-7R Signaling in IL-7-Dependent B Cell Lines

IL-7R and pre-BCR signaling pathways were examined in cloned IL-7-dependent B cell lines and compared to B220+ BM expanded in IL-7 for 10 days. Cell lines and ex vivo B cells had minimal pSTAT5 and pJAK1 activation after starvation, but rapidly phosphorylated these molecules to similar intensities after stimulation with IL-7 (Figure 3.3A). The signaling capacity of pre-BCR+ and pre-BCR- cell lines was also compared (Figure 3.3B). Pre-BCR+ and pre-BCR- cells were able to phosphorylate Erk, STAT5 and JAK1 after IL-7 stimulation, while only pre-BCR+ cells were able to phosphorylate Erk after stimulation with anti-µ. Pre-BCR- cells also lacked the increased levels of Erk phosphorylation observed after concurrent stimulation with IL-7 and anti-µ in pre-BCR+ cells (Figure 3.3B).

Figure 3.3 IL-7R and Pre-BCR Signaling in B Cell Lines and Ex Vivo B cells

Representative IL-7-dependent B cell lines, or ex vivo B cells expanded in IL-7 for 10 days were stimulated with either (A) IL-7, or (B) IL-7, anti-µ or both for 10 minutes. Cells were then lysed and subjected to Western blot analysis with the indicated phospho-specific antibodies. Membranes were stripped and reprobed with a total-Erk antibody to control for equal loading.

3.3 Discussion

In this chapter, I have described the generation and characterization of stromal-free IL-7- dependent B cell lines from murine BM. Cultures were maintained over a period of several weeks, after which time they were cloned, analyzed and frozen. I have demonstrated that it is possible to generate B cell lines from wild type BM selected for either B220+ or CD19+ cells, as well as from BM from CD45-/- and µMT mice. In theory, IL-7-dependent B cell lines can be created from any mouse that has IL-7-responsive B cell progenitors. The frequency with which lines were generated differed depending on the genotype of the mouse and the selection method used. Such differences were observed when B cell progenitors were isolated using CD19 expression versus B220. Traditionally, B220 selection has been used to isolate B cells from BM because it is expressed prior to CD19, allowing for a greater recovery of developing B cells, as well as cells that have not yet fully committed to the B lineage. However, in cases where B220 selection is not an option (i.e. CD45-/- mice), CD19 expression can be used as a selection marker. While B220 is not solely limited to B cells isolated from the BM, addition of exogenous IL-7 to in vitro cultures results in the generation of exclusively CD19+ B lineage cells within a few days.

In addition to the selection method used, defects in molecules that affect important signaling pathways in developing B cells, such as the IL-7R and pre-BCR pathways, also altered the ability to generate B cell lines. B220+ B cells selected from µMT BM had a much higher frequency of IL-7-responding cells compared to wild type cells, however, their ability to generate B cell lines was greatly diminished. This result suggests that in wild type mice there may be a population of cells present in the BM that establish or have a greater ability to

73 establish long-term cultures, and that this population is diminished, either absolutely or proportionally in µMT BM cultures.

Previous studies carried out in our lab have demonstrated that CD45-/- mice accumulate pro-

B cells in the BM. Cultures initiated with CD45-/- cells displayed abnormal in vitro differentiation, with B lineage populations exhibiting prolonged survival in the presence of high concentrations of IL-7.226 Interestingly, CD45 deficiency did not change the frequency with which B cell lines were generated, however, a decrease in the percentage of lines expressing cytoplasmic µ was observed (46% - CD45-/- versus 60% - WT). This result suggests that the number of cells with long-term culture capability is not affected by CD45 expression, but that defects in CD45 may alter the phenotype of the long-term cultured B cell lines. By determining the frequency of lines generated from mutant mice, it is possible to acquire new insights into the ways in which deleted or over-expressed molecules alter in vivo population dynamics and signaling responses in developing B cells. Once established, cell lines displayed a broad range of surface phenotypes that resembled the pro-B and pre-B cell stages of development and reflected the genetic make-up of the cell. This ability to generate lines with unique profiles from wild type and mutant mice allows for the systematic investigation of specific molecules, their interactions with other molecules, and their contribution to B cell development.

In the process of establishing B cell lines I observed that by day 21, large-scale cell death

(~80%) occurred in every culture. Cells that survived were able to grow and eventually took over the culture. This massive death and re-population occurred in every well, however, not every well gave rise to a long-term culture. At varying time points between day 25 and 50, certain wells suffered 100% cell death. In a few cases, this death happened within 2 days,

74 however, in the majority of cases, death occurred gradually and was preceded by a decrease or loss of cell proliferation. For the surviving wells, investigation into the cells that established the lines was of interest. Cells were not transfected, infected or otherwise modified, and thus the exact identity or variability of the mechanism(s) that govern their potential for long-term growth remains unknown. However, analysis of the duplicate plate results provide some insight into whether cell lines were generated from a long-term grower present early in the culture, or by some other event occurring at a later stage. I observed a similar outcome for both the original and replicate wells in a majority of cases. Replicate wells were set up early in the culturing process and showed high correlation, which suggests that the ability to generate a cell line is largely a characteristic of a population of cells present early in culture. This is supported by the fact that even though duplicate plates were set up prior to the massive death and re-population of the cultures, events that should select against well-well relationship, a significant link between them still existed.

By thawing, expanding, cloning, and re-analyzing a proportion of the frozen long-term cultures, it was possible to test the ability of cultures to survive the thawing process as well as compare the phenotype of the newly-cloned cell lines with that of their parental cultures.

All thawed cultures survived and were clonable, and the resulting cell lines displayed good viability and growth in the presence of IL-7. Cell line phenotypes generally reflected that of the parental cultures, however, some phenotypic changes were observed. Differences in surface marker expression can be attributed either to under-represented clonal variants or to a shift in cell surface marker expression as the cell culture expanded. In all likelihood both mechanisms contribute to phenotypic changes. These changes suggest that cell lines are dynamic in nature and reinforce the fact that even clonally-selected cells retain the ability to alter surface marker expression.

The analysis of signal transduction pathways in B cell populations from wild type and mutant mice has often been limited by challenges in obtaining homogeneous populations and adequate numbers of cells. IL-7-dependent B cell lines reflect stages of B cell development that have traditionally been difficult to study and provide unlimited cells for biochemical experiments. These lines allow for extensive biochemical studies involving stimulation, immunoprecipitation, and co-immunoprecipitation at the increased confidence levels afforded by appropriately controlled experiments. Unlike many other pro-B/pre-B cell lines described in the literature, the cell lines described here have not been modified and thus provide a more accurate representation of in vivo cells with which to investigate signaling pathways.

Cell line stimulation with IL-7 resulted in activation of the JAK/STAT pathway, which is essential for cell survival and proliferation. Anti-µ stimulation of the pre-BCR initiated activation of downstream targets (pErk) and also synergized with signals from the IL-7R pathway, converging at Erk phosphorylation. In wild type and mutant mice, biochemical studies have been especially useful for understanding how a specific molecule fits into the normal signaling cascade. The ability to generate unlimited numbers of lines from mice with defects or deletions in various signaling molecules allows for the systematic and comprehensive investigation into the importance of these molecules. While IL-7-dependent cell lines do not eliminate the need for ex vivo cultures, they do diminish the need for sacrificing mice, as well as the tedious selection, expansion and sorting of BM that is normally associated with the investigation of signal transduction pathways. These lines provide a new set of crucial tools with which to carry out experiments that will improve the understanding of the roles that specific molecules play during B cell development.

Chapter 4

4 Modulation of IL-7 Thresholds by SOCS Proteins in

Developing B Lineage Cells4

4 Sections of this chapter appear in J Immunol. 2011 Oct 1;187(7):3499-510. Corfe SA, Rottapel R, Paige CJ.

4.1 Introduction

IL-7 is an essential cytokine during murine B cell development and is produced by cells in the

BM, spleen, thymus and FL.91 Mice with targeted deletions of IL-7 or the IL-7R display a severe block at the early pro-B cell stage of development.93,94 Regulation of IL-7R expression and signaling is critical throughout B lymphopoiesis and a number of recent studies have demonstrated the importance of controlling IL-7R signaling prior to commitment to the B lineage.31,143,278 During the pro-B to pre-B cell stage of development, a balance between signals mediated by the IL-7R and the pre-BCR occurs, in which signaling through the IL-7R maintains cells in a proliferative state and reduces the efficiency of LC recombination, while signaling through the pre-BCR initially enhances cell proliferation and then subsequently brings cells out of cycle and promotes LC rearrangement.58,116,121,216 As with the majority of interleukins, the downstream effects of IL-7R activation depend on the signaling context in responsive cells. In this chapter, I demonstrate that the SOCS family of proteins control the contextual signaling for IL-7 in developing B cells.

SOCS proteins bind directly to JAK and STAT proteins as well as cytokine receptor chains and prevent their interaction as well as target them for proteasomal degradation.279 In many cases, SOCS protein expression is induced by the same receptor pathway that they inhibit, providing a negative feedback loop that regulates signaling to limit receptor activation. SOCS-

1 and SOCS-3 family members are closely related in structure and have similar but nonredundant functions in a variety of immune cells.105 Mice deficient for SOCS-1 die within three weeks of birth due to monocytic infiltration of multiple organs and fatty liver degeneration, while SOCS-3 deficiency results in embryonic lethality due to placental defects.280,281 SOCS-1-/- mice have greatly reduced peripheral B cell numbers, which is

78 attributed to increased apoptosis of pre-B cells unable to initiate negative feedback mechanisms that normally limit IFN-γ signaling. IFN-γ inhibits the response of pre-B cells to

IL-7, resulting in reduced proliferation and ultimately cell death.282-285 Confirmation that IFN-γ signaling is related to the B cell defect in SOCS-1-/- mice was shown in SOCS-1-/-/IFN-γ-/- double knockout mice as well as in SOCS-1-/- mice injected with IFN-γ blocking antibodies.286,287 In both of these cases peripheral B cells were recovered to almost normal levels.

It has been established that a B cell’s response to IL-7 is modified by both the amount of IL-7 present and by the activation of other signaling pathways. For example, our lab has previously shown that large pre-B cells proliferate in low (picogram) concentrations of IL-7 only in the presence of signals downstream of the pre-BCR.127 Pro-B cells, which lack the pre-BCR, and thus the signals mediated by this receptor, proliferate only in response to higher (nanogram) concentrations of IL-7. As B cells mature from the pro-B to pre-B cell stage of development they reach a point at which they stop proliferating in response to IL-

7.162 Loss of responsiveness to IL-7 is associated with a number of key differentiation events, however, the molecular mechanisms leading to non-responsiveness remain unknown. I have thus examined this stage of differentiation using both primary B lineage cells and IL-7- dependent and IL-7-independent progenitor B cell lines. From my studies it can be concluded that the response to IL-7 is largely controlled by SOCS-1, whose expression can be influenced by a number of cytokines including IL-7 itself, IL-21 and IFN-γ. I propose a model in which regulated levels of SOCS-1 act as a “rheostat” to control the ability of developing B lineage cells to respond to IL-7.

4.2 Results

4.2.1 As B Lineage Cells Mature to the CD2+ Stage They Fail to Signal or Respond to IL-7

Due to the important role that IL-7 plays during B lymphopoiesis I tested various B cell

+ subsets for their ability to signal and respond to IL-7. B220 BM (BMB220+) cells were enriched for pro-B/large pre-B (CD2-IgM-), small pre-B (CD2+IgM-) and immature (CD2+IgM+) B cell populations and plated at varying cell densities with IL-7. The use of CD2 and IgM to differentiate between B cell populations has been described previously and was utilized because we have observed that CD43 expression is not lost on small pre-B and immature B cells cultured in vitro, making the use of the traditional Hardy fractions not applicable.162

Cultures were visually inspected on day 4 and it was determined that the frequency of IL-7- responsive cells in the CD2-IgM- population was 1:15 ± 4, while the CD2+IgM- and CD2+IgM+ subsets failed to yield any live cell clusters (>1:1000). Even though CD2+IgM- and CD2+IgM+ cells are unable to respond to IL-7 and die in culture, it is still possible to experimentally investigate these populations because they reproducibly arise in cultures containing CD2-IgM- cells.162 Flow analysis of B cell fractions from freshly isolated BM or day 4 IL-7-expanded

- - BMB220+ cells revealed that expression of the IL-7Rα chain is highest on CD2 IgM cells and is decreased but still positive on CD2+IgM- and CD2+IgM+ cells (Figure 4.1A). The level of expression of the IL-7Rγc chain is approximately equal between the CD2-IgM- and CD2+IgM- populations, while higher expression is present on CD2+IgM+ cells. CD2+IgM+ cells isolated and analyzed directly from BM also include mature and recirculating IgD+ B cells. Therefore, I compared IL-7Rα and IL-7Rγc chain expression on CD2+IgM+IgD- and CD2+IgM+IgD+ populations from D0 BM. CD2+IgM+IgD- immature B cells expressed higher levels of the IL-

7Rα chain and lower levels of the IL-7Rγc chain compared to more mature CD2+IgM+IgD+ cells (Figure 4.1A).

- - Freshly isolated BM or BMB220+ cells grown in IL-7 for 4 days were fractionated into CD2 IgM

CD2+IgM- and CD2+IgM+IgD- populations and stimulated with IL-7 for 15 minutes. The 15 minute time point was used based on previous studies that showed this to be an optimal time to observe JAK and STAT activation after IL-7 stimulation.127 In both freshly isolated BM and IL-7-expanded B cells, the CD2-IgM- population displayed phosphorylation of STAT5 and

JAK1 after stimulation with IL-7, while little to no activation was observed in the CD2+IgM- or the CD2+IgM+IgD- populations (Figure 4.1B). These observations demonstrate that as B lineage cells mature to the CD2+ small pre-B cell stage of development they lose the ability to signal or respond to IL-7, but retain IL-7R surface expression.

Figure 4.1 IL-7R Surface Expression and Downstream Signaling in B Lineage Cells

B lineage cells isolated from BM were used directly or selected for B220+ cells and cultured for 4 days in IL-7-supplemented media. (A) Cells were stained and gated on CD19+ live cells prior to gating into CD2-IgM-, CD2+IgM-, and CD2+IgM+ or IgM+IgD- cell populations and analyzed for surface expression of the IL-7Rα or IL-7Rγc chains. (B) Cells were stained and enriched for CD19+CD2-IgM-, CD19+CD2+IgM- and CD19+CD2+IgM+IgD- cell populations prior to stimulation with IL-7 for 15 minutes. Stimulated cells were lysed and analyzed by Western blot analysis for phosphorylation of STAT5 and JAK1, as well as β-actin. All data presented are representative of at least two independent experiments.

4.2.2 Enforced Expression of SOCS-1 in B Cell Lines Inhibits IL-7R Signaling and IL-7-Induced Proliferation

The role of SOCS proteins were examined in my system as they have been previously shown to prevent cytokine signaling in immune cells through the inhibition of JAK and STAT activation.105,288 Experiments were initiated utilizing the stromal-independent IL-7-dependent

B lineage cell line B62.1, which was established by cloning BMB220+ cells that had been grown in the presence of IL-7.289 B62.1 cells express µ on the cell surface in conjunction with SLC proteins or κ LC proteins, have a pre-B/Immature B cell phenotype, and have not been experimentally transformed, making this line a good model for investigating signaling pathways representative of cells at the pre-B cell transitional stage of development. B62.1 cells were infected with expression constructs containing either GFP alone, or GFP and

SOCS-1 separated by an internal ribosome entry site (IRES).

Post infection, it was observed visually that B62.1 cells expressing GFP and SOCS-1 died when cultured with IL-7, while B62.1 cells expressing GFP alone did not. This observation suggested that SOCS-1 inhibited signals necessary for the survival of B62.1 cells. To determine if inhibited signals were downstream of the IL-7R, I utilized the B62.1 independent

(B62.1 IND) cell line. B62.1 IND is a variant of the B62.1 cell line that was created by growing B62.1 cells in gradually reduced concentrations of IL-7 until cells were no longer dependent on IL-7 for growth or survival yet remained responsive to IL-7. Infection of B62.1

IND cells was carried out utilizing a SOCS-1 over-expression construct or SOCS-1 over- expression mutants that lacked either a functional SH2 domain (SOCS-1 SH2) or the c- terminal SOCS box domain (SOCS-1 ΔCT).266

B62.1 IND control cells expressing GFP alone proliferated to a similar extent as uninfected cells when exposed to IL-7, while cells expressing SOCS-1 completely lost the ability to

83 proliferate in response to IL-7 (Figure 4.2A). SOCS-1 expression did not alter IL-7- independent cell proliferation or result in cell death, as SOCS-1 expressing B62.1 IND cells displayed baseline (no IL-7) levels of 3H-thymidine incorporation at all concentrations of IL-7.

Cells expressing the SOCS-1 ΔCT construct also lost the ability to proliferate in response to

IL-7 across most of the titrated range of IL-7, while cells infected with the SOCS-1 SH2 construct did not show this proliferative defect.

Expression of SOCS-1 in B62.1 IND cells prevented the phosphorylation of JAK1 and STAT5 after IL-7 stimulation as well as downstream Erk phosphorylation (Figure 4.2B). Inhibition was also observed in SOCS-1 ΔCT expressing cells but not in cells expressing the SOCS-1

SH2 mutant. Flow analysis of surface expression of the IL-7Rα and γc chains confirmed that

SOCS-1 expression did not down-regulate the IL-7R (Figure 4.2C). Lack of proliferation and

JAK/STAT phosphorylation in response to IL-7 shows that enforced expression of SOCS-1 in

B cell lines inhibits IL-7R signaling, mimicking events observed in CD2+ small pre-B cells.

Enforced gene expression experiments can lead to unnatural expression levels that result in observations that may not be physiological. To account for this, I used RT-PCR to examine the levels of socs-1 mRNA in B62.1 IND GFP control cells and compared the results to those observed in B62.1 IND cells with enforced expression of socs-1, as well as to those observed in B62.1 IND GFP cells stimulated with IL-7, IFN-γ or IL-21. Band density analysis revealed that B62.1 IND cells with enforced expression of socs-1 did express elevated levels of socs-1 mRNA compared to B62.1 IND GFP cells (Figure 4.2D). However, socs-1 levels were similar to those observed in B62.1 IND GFP cells stimulated with IFN-γ, suggesting that socs-1 expression was within a range found in induced cells.

Figure 4.2 Proliferation and Downstream Signaling in Response to IL-7 in B Cell Lines Expressing Natural or Mutated SOCS-1

B62.1 IND cells were retrovirally infected with expression vectors producing GFP and/or normal or mutated forms of SOCS-1. (A) Infected cells were plated in media with varying concentrations of IL-7 and cultured for 3 days prior to the addition of 3H-thymidine for 6 hours and subsequent measurement of 3H-thymidine uptake. Data are presented as the mean of triplicate wells; error bars represent SD. (B) SOCS-1 infected and control cells were starved for 1 hour prior to stimulation with IL-7, anti-µ or both for 15 minutes. Stimulated cells were lysed and analyzed by Western blot analysis for phosphorylated STAT5 (pSTAT5), pJAK1 and pErk, as well as total Erk. (C) Surface expression of the IL-7Rα and IL-7Rγc chains were analyzed on B62.1 IND GFP cells and B62.1 IND SOCS-1 cells. (D) B62.1 IND GFP and B62.1 IND SOCS-1 cells were starved for 1 hour prior to stimulation with either nothing, IL-7 (25 ng/mL), IFN-γ (2 ng/mL) or IL-21 (30 ng/mL) for 90 minutes. RNA was extracted from stimulated cells and samples were analyzed for socs-1 and β-actin expression by RT-PCR. Displayed arbitrary units (A.U.) were calculated by measuring the band intensity for socs-1 and normalizing to β-actin. All data presented are representative of at least two independent experiments.

4.2.3 Expression of Socs-1 and Socs-3 in Developing B Lineage Cells

I next examined the expression of socs-1 and socs-3 in ex vivo BM B lineage cells. RT-PCR analysis revealed that mRNA transcripts for socs-1 and socs-3 are expressed in whole BM as well as in CD19+ B cells (Figure 4.3A). Using c-Kit as an additional maturation marker, developing B cell populations can be further separated into four distinct fractions: CD19+c-

Kit+CD2-IgM- early pro-B cells, CD19+c-Kit-CD2-IgM- late pro-B/large pre-B cells, CD19+c-

Kit-CD2+IgM- small pre-B cells and CD19+c-Kit-CD2+IgM+ immature B cells. By real-time

PCR, I observed that socs-1 mRNA expression was similar in the CD19+c-Kit+CD2-IgM- and

CD19+c-Kit-CD2-IgM- populations but was greatly increased (~12 fold) in the CD19+c-Kit-

CD2+IgM- population and slightly increased (~3 fold) in the CD19+c-Kit-CD2+IgM+ population

(Figure 4.3B). Socs-3 expression remained unchanged in all B cell populations. These results demonstrate that expression of socs-1, but not socs-3, is regulated as B lineage cells mature, and the highest levels are observed in small pre-B cells.

4.2.4 IL-7 Induces Socs-1 and Socs-3 Expression in B Cell Lines

B62.1 IND cells were stimulated with IL-7 to determine if IL-7R signaling regulated the expression of socs-1 and socs-3 in B cells. Socs-1 mRNA levels were approximately 6 fold higher in IL-7-stimulated cells than in unstimulated cells, while socs-3 mRNA levels were increased approximately 3 fold (Figure 4.3C). Induction of socs-1 and socs-3 was concentration dependent, as reducing the amount of IL-7 used to stimulate cells resulted in a stepwise reduction in socs-1 and socs-3 expression (Figure 4.3D).

Figure 4.3 Endogenous or Induced Expression of Socs-1 / Socs-3 in B Lineage Cells and B Cell Lines

(A) RNA was extracted from whole BM or CD19+ MACS selected BM cells and analyzed for the expression of socs-1, socs-3 and β-actin. (B) B220+ B lineage cells isolated from BM were cultured for 4 days in IL-7-supplemented media. Cells were stained and gated on CD19+ live cells and then enriched for c-Kit+CD2-IgM-, c-Kit-CD2-IgM-, c-Kit-CD2+IgM- and c-Kit- CD2+IgM+ cell populations prior to extraction of mRNA for analysis of socs-1 and socs-3 expression by real-time PCR. Displayed values were normalized to β-actin and are shown as fold change compared to the c-Kit+CD2-IgM- population. Figure shows fold change for normalized values from three independent experiments. (C & D) B62.1 IND cells were starved for 1 hour prior to stimulation with either (C) IL-7 (25 ng) or (D) varying concentrations of IL-7 for 90 minutes. RNA was extracted from stimulated cells and analyzed for socs-1 and socs-3 mRNA expression by real-time PCR. Displayed values were normalized to β-actin and are shown as fold change compared to (C) unstimulated cells or (D) cells stimulated with IL-7 (25 ng/mL). All data presented are representative of at least two independent experiments.

4.2.5 In Vitro Maturation of Primary B Lineage Cells Expressing SOCS-1

Knowing that SOCS-1 can inhibit IL-7-induced proliferation and signaling in pre-B cell lines, I

questioned what effect it would have on the maturation of B lineage cells in vitro. BMB220+ cells co-cultured for 2 days with GP+E virus producing cells were enriched for CD19+c-Kit+CD2-

IgM- cells that did or did not express GFP and were placed back in culture with IL-7. 4 days later, GFP+ and GFP- cells from control cultures looked virtually identical based on surface phenotyping for c-Kit/CD2 and CD2/IgM (Figure 4.4). GFP- cells were used as internal controls, since they represented the same sorted and cultured population only without GFP or SOCS-1 expression. GFP+ cells from cultures of cells expressing SOCS-1 showed a sharp reduction in the percentage of cells in the c-Kit+CD2- and c-Kit-CD2- populations, with a corresponding increase in the percentage of cells in the c-Kit-CD2+ and CD2+IgM+ populations. The absolute number of cells in SOCS-1 GFP+ versus SOCS-1 GFP- cultures was reduced approximately 10 fold, while c-Kit+CD2-, c-Kit-CD2- and CD2+IgM- populations were reduced by approximately 85, 20, and 10 fold respectively. On the other hand, CD2+IgM+ cells were reduced by less than 1.5 fold (Table 4.I). This alteration in B cell development shows that expression of SOCS-1 in ex vivo B lineage cells greatly reduces the proliferation and/or survival of IL-7-responsive pro-B/large pre-B cells (CD2-IgM-), as well as the survival, proliferation, or replenishment of newly formed small pre-B cells (CD2+IgM-), yet does not greatly prevent the further development of cells into immature B cells (CD2+IgM+).

Figure 4.4 In Vitro Maturation of B Lineage Cells Expressing SOCS-1 B220+ B lineage cells isolated from BM were co-cultured with GP+E cells expressing GFP, or GFP and SOCS-1 for 2 days in IL-7-supplemented media. Cells were then enriched for either GFP-CD19+c-Kit+CD2-IgM- or GFP+CD19+c-Kit+CD2-IgM- populations and cultured for an additional 3 days in IL-7-supplemented media. On day 5, cells were analyzed for in vitro maturation by the surface expression of c-Kit, CD2 and IgM. Population percentages are displayed within the FACS plots and are representative of two independent experiments.

Control Cell # cKit+CD2- cKit-CD2- cKit-CD2+ CD2-IgM- CD2+IgM- CD2+IgM+

GFP –ve 3.02 x 106 7.53 x 105 1.46 x 106 7.99 x 105 2.24 x 106 6.73 x 105 1.12 x 105

GFP +ve 2.53 x 106 5.49 x 105 1.23 x 106 7.44 x 105 1.79 x 106 6.02 x 105 1.36 x 105

Ratio 0.84 0.73 0.84 0.93 0.80 0.90 1.21

SOCS-1 Cell # cKit+CD2- cKit-CD2- cKit-CD2+ CD2-IgM- CD2+IgM- CD2+IgM+

GFP –ve 2.89 x 106 3.63 x 105 1.27 x 106 1.25 x 106 1.65 x 106 1.09 x 106 1.43 x 105

GFP +ve 2.67 x 105 4.40 x 103 6.79 x 104 1.93 x 105 6.76 x 104 9.62 x 104 9.66 x 104

Ratio 0.09 0.01 0.05 0.15 0.04 0.09 0.68

Table 4.1 Cell Numbers for the In Vitro Maturation of Infected B Cells

4.2.6 IFN-γ is Expressed in BM Cells and Inhibits IL-7-Induced Proliferation in B Cell Lines

It has been reported that pre-B cells are sensitive to IFN-γ, however, the mechanism of inhibition and cause of pre-B cell death have not been fully elucidated. I thus wanted to determine if IFN-γ was playing an active role during B cell development in my system and if that role was mediated by SOCS activation. RT-PCR analysis of MACS selected BM revealed that ifn-γ transcripts can be detected in whole BM as well as in B220+ cells, but not in CD19+

B cells (Figure 4.5A). Treatment of B62.1 IND cells with IFN-γ alone had little affect on cell

proliferation (Figure 4.5B). At low (picogram) concentrations of IL-7 (IL-7Lo), the addition of

IFN-γ resulted in the ablation of IL-7-induced proliferation, reducing proliferation levels to that of cells grown in the absence of IL-7 (no IL-7), while the use of higher (nanogram)

concentrations of IL-7 (IL-7Hi) led to a further reduction in cell proliferation (Figure 4.5B).

Visual inspection of the cultures prior to incubation with 3H-thymidine led to the observation

that no live cells could be detected in wells containing IFN-γ and IL-7Hi. When using either constant high or low concentrations of IL-7, increasing the amount of IFN-γ led to decreased proliferation of B62.1 IND cells, however, the degree of IFN-γ induced inhibition observed

for cells grown with IL-7Hi exceeded that for cells cultured with IL-7Lo (Figure 4.5C). In fact, cells grown in IL-7Lo continued to proliferate above baseline levels (no IL-7) at all

concentrations of IFN-γ tested, while cells grown in IL-7Hi dropped below baseline (no IL-7) proliferative levels. Therefore, the inhibitory effect that IFN-γ has on B cell proliferation is dependent on the presence of IL-7 and is amplified by increasing the concentration of IL-7.

Figure 4.5 Proliferative Response and Induced Expression of Socs-1 and Socs-3 in B Cell Lines After Treatment with IL-7 and/or IFN-γ

(A) RNA was extracted from whole BM, B220+, or CD19+ MACS selected BM cells and analyzed for the expression of ifn-γ and β-actin by RT-PCR. (B & C) B62.1 IND cells were plated in media with either (B) varying concentrations of IL-7 with or without IFN-γ (2 ng/mL), or (C) varying concentrations of IFN-γ with either high (1.25 ng/mL) or low (0.0125 ng/mL) concentrations of IL-7. Cells were cultured for 3 days prior to the addition of 3H- thymidine for 6 hours and subsequent measurement of 3H-thymidine uptake. Data are presented as the mean of triplicate wells; error bars represent SD. (D & E) B62.1 IND cells were starved for 1 hour prior to stimulation with either (D) IL-7 (25 ng/mL) or varying concentrations of IFN-γ, or (E) IL-7 (25 ng/mL), IFN-γ (2 ng/mL), or both for 90 minutes. RNA was extracted from stimulated cells and analyzed for socs-1 and socs-3 expression by real-time PCR. Displayed values were normalized to β-actin and are shown as fold change compared to (D) IL-7 stimulated cells, or (E) unstimulated cells. All data presented are representative of at least two independent experiments.

4.2.7 IFN-γ and IL-7 Induce Socs-1 and Socs-3 in B Cell Lines

B62.1 IND cells were treated with IL-7 and/or IFN-γ to determine if socs-1 or socs-3 expression was induced. Treatment of B62.1 IND cells with IFN-γ for 90 minutes led to increased socs-1 (~7 fold) and socs-3 (~3 fold) expression compared to IL-7 alone (Figure

4.5D). This induction was concentration dependent, as reducing the amount of IFN-γ used resulted in lower levels of socs-1 induction. Stimulation of B62.1 IND cells with both IFN-γ and IL-7 for 90 minutes lead to a minor increase in socs-3 (~5 fold) and a dramatic increase

(~40 fold) in the expression of socs-1 mRNA (Figure 4.5E). The increase in socs-1 was greater than observed for either IL-7 or IFN-γ alone and demonstrates that IL-7 and IFN-γ can co- operate to increase the expression of socs-1.

4.2.8 In vitro Maturation of Primary B Lineage Cells Treated with IFN-γ

Having observed that IFN-γ and IL-7 can work together to induce socs-1 expression and inhibit the proliferation and/or survival of B cell lines, I questioned what effect IFN-γ would

have on the maturation of ex vivo B lineage cells. BMB220+ cells cultured for 4 days in the

presence of IL-7 and IFN-γLo were reduced in cell number compared to cells grown in IL-7 alone, but showed little difference in the distribution of B cell populations (Figure 4.6 and

Table 4.2). Alternatively, cells cultured in IL-7 and IFN-γHi were greatly reduced in absolute cell number and displayed a decrease in the percentage of CD2-IgM- cells, with a relative increase in CD2+IgM- and CD2+IgM+ cells. The observed shift in development toward more

+ mature CD2 cells suggests that the cells most affected in cultures containing IL-7 and IFN-γHi are the CD2-IgM- (pro-B/large pre-B) IL-7-responsive proliferating cells.

Figure 4.6 In Vitro Maturation of B Lineage Cells Treated with IFN-γ

B220+ B lineage cells isolated from BM were cultured for 3 days in IL-7 (5 ng/mL), IL-7 and low IFN-γ (0.01 ng/mL), or IL-7 and high IFN-γ (1 ng/mL). On day 4, cells were analyzed for in vitro maturation by the surface expression of B220, CD2 and IgM. Population percentages are displayed within the FACS plots and are representative of two independent experiments.

Population

Condition Cell # CD2-IgM- CD2+IgM- CD2+IgM+

IL-7 1.70 x 106 7.82 x 105 6.12 x 105 3.06 x 105

5 5 5 5 IL-7 + IFNγLo 6.70 x 10 3.15 x 10 2.01 x 10 1.47 x 10

5 4 5 4 IL-7 + IFNγHi 2.50 x 10 4.75 x 10 1.13 x 10 8.75 x 10

Table 4.2 Absolute Cell Numbers for the In Vitro Maturation of IFN-γ Treated B Lineage Cells

4.2.9 IL-21 Inhibits IL-7-Induced Proliferation and Induces Socs-1 Expression in B Cell Lines at High Concentrations of IL-7

IL-21 is a known regulator of peripheral B cell maturation and our lab has shown that it is expressed by CD4+ T cells in the BM and that B cell progenitors respond to IL-21.290 B62.1

IND cells express the IL-21Rα and IL-21Rγc chains on their surface and expression of the IL-

21R was not changed upon culturing cells with IL-7 (Figure 4.7A). B62.1 IND cells displayed

little to no growth inhibition when treated with IL-21 alone or IL-21 in the presence of IL-7Lo

(Figure 4.7B). Treatment of B62.1 IND cells with IL-21 and IL-7Hi resulted in a significant reduction in proliferation. Titration of IL-21 in the presence of IL-7Hi resulted in a dose dependent inhibition of IL-7-induced proliferation, while cells cultured in IL-7Lo were not inhibited at any concentration of IL-21 (Figure 4.7C). These results suggest that a threshold of IL-7 signaling must be reached before IL-21 has an inhibitory effect on IL-7-induced proliferation.

Treatment of B62.1 IND cells with IL-21 for 90 minutes did not lead to a significant change in socs-1 or socs-3 mRNA expression (Figure 4.7D). As observed previously, IL-7 stimulation resulted in an approximate 6-fold increase in socs-1 expression. Addition of both IL-7 and IL-

21 resulted in an approximate 9 fold increase in socs-1 mRNA, greater than observed with either condition alone, while the levels of socs-3 did not change. Thus, while IL-21 does not appear to alter socs-1 expression on its own, it can work together with IL-7 to induce socs-1.

Figure 4.7 Proliferative Responses and Induced Expression of Socs-1 and Socs-1 in B Cell Lines After Treatment with IL-7 and/or IL-21

(A) B62.1 IND cells were cultured with or without IL-7 for 4 days and then stained for the surface expression of the IL-21Rα and IL-21Rγc chains. (B & C) B62.1 IND cells were plated in media with either (B) varying concentrations of IL-7 with or without IL-21 (30 ng/mL), or (C) varying concentrations of IL-21 and IL-7. Cells were cultured for 3 days prior to the addition of 3H-thymidine for 6 hours and subsequent measurement of 3H-thymidine uptake. Data are presented as the mean of triplicate wells; error bars represent SD. (D) B62.1 IND cells were starved for 1 hour prior to stimulation with IL-7 (25 ng/mL), IL-21 (30 ng/mL) or both for 90 minutes. RNA was extracted from stimulated cells and samples were analyzed for socs-1 and socs-3 expression by real-time PCR. Displayed values were normalized to β- actin and are shown as fold change compared to unstimulated cells. All data presented are representative of at least two independent experiments.

4.2.10 Effects of CXCL12 and Anti-µ on B Cell Proliferation and SOCS Expression

In the previous sections I describe that small pre-B cells are unresponsive to IL-7 and display a dramatic increase in the expression of socs-1. Two important receptors up-regulated during this time in development are the pre-BCR and CXCR4. Signals emanating from the pre-BCR are important in providing survival, proliferation and differentiation cues, while also allowing for the proliferation of large pre-B cells in low concentrations of IL-7.127,183 CXCR4 up- regulation is important in B cell trafficking and directs cells to migrate toward CXCL12 producing stromal cells and away from IL-7 producing cells.65 Due to the important role that these molecules play during the pre-B cell stage of development, I questioned whether or not either regulated the expression of SOCS proteins or altered the IL-7 proliferative response in B cells.

The B cell line B62.1 IND expresses both the pre-BCR and CXCR4 and was tested for its

ability to respond to these factors. Addition of anti-µ F(ab’)2 to cell culture did not alter cell proliferation in the absence of IL-7, nor did it enhance or inhibit cell proliferation at any concentration of IL-7 (Figure 4.8A). This result is in line with previous studies carried out by our lab that demonstrated that pre-BCR cross-linking does not alter the proliferation of pre-

BCR+ cells.127 Addition of CXCL12 to B62.1 IND cell line cultures resulted in an increase in proliferation at all concentrations of IL-7 tested (Figure 4.8A). Increase proliferation in the absence of IL-7 was also observed, suggesting that the ability of CXCL12 to induce proliferation was independent of IL-7.

B62.1 IND cells were stimulated with IL-7, anti-µ, or CXCL12 for 90 minutes and assessed for their expression of socs-1 and socs-3 mRNA by RT-PCR. Stimulation with IL-7 resulted in

97 an increase in the expression of socs-1 and socs-3 compared to unstimulated cells, while treatment with anti-µ or CXCL12 showed no such increase (Figure 4.8B). The intensity of the PCR bands was quantified and showed that socs-1 and socs-3 expression was approximately three times higher after stimulation with IL-7, while expression was approximately equal or slightly decreased after stimulation with anti-µ or CXCL12 (Figure

4.8C). Therefore, anti-µ does not induce SOCS expression or enhance the proliferation of

B62.1 IND cells, while CXCL12 increases the proliferation of B62.1 IND cells independently of IL-7 without altering SOCS expression.

Figure 4.8 Proliferative Responses and Induced Expression of Socs-1 and Socs-3 in B Cell Lines After Treatment with Anti-µ or CXCL12

(A) B62.1 IND cells were plated in media with varying concentrations of IL-7 and anti-µ (10 µg/mL) or CXCL12 (100 ng/mL). Cells were cultured for 3 days prior to the addition of 3H- thymidine for 6 hours and subsequent measurement of 3H-thymidine uptake. Data are presented as the mean of triplicate wells; error bars represent SD. (B) B62.1 IND cells were starved for 1 hour prior to stimulation with IL-7 (25 ng/mL), anti-µ (10 µg/mL), or CXCL12 (10 ng/mL) for 90 minutes. RNA was extracted from stimulated cells and samples were analyzed for socs-1, socs-3 and β-actin expression by RT-PCR. (C) Socs-1 and socs-3 band intensities were measured and normalized to β-actin. Displayed values are shown as fold change compared to unstimulated cells. All data presented are representative of at least two independent experiments.

4.2.11 Expression and Function of Gfi-1b in Developing B Lineage Cells and B Cell Lines

In addition to examining cytokines and chemokines that regulate IL-7R signaling, I also investigated transcriptional factors that might be exerting control over IL-7-induced proliferation in developing B cells. Gfi-1b is a zinc-finger transcriptional repressor that has a variety of targets including SOCS proteins.291 Gfi-1b mRNA expression was highest in the

CD19+c-Kit+CD2-IgM- population and decreased as cells matured toward becoming CD19+c-

Kit-CD2+IgM+ cells (Figure 4.9A). B62.1 IND cells were infected with a gfi-1b expression vector and the level of expression of gfi-1b in BM, B62.1 IND GFP cells, and B62.1 Gfi-1b

IND cells was compared by RT-PCR. B62.1 IND cells expressed a higher level of gfi-1b than observed in BM, while B62.1 IND Gfi-1b cells expressed an even greater level (Figure 4.9B).

The proliferation of Gfi-1b expressing cells was equal to that of uninfected cells in the absence of IL-7, however, enhanced proliferation was observed in response to IL-7 (Figure

4.9C). These results demonstrate that Gfi-1b expression is regulated during B cell development and that Gfi-1b over-expression can amplify IL-7 proliferative signals in B62.1

IND cells.

I next questioned the mechanism by which Gfi-1b was leading to the enhanced proliferation of B62.1 IND cells in response to IL-7. B62.1 IND and B62.1 IND Gfi-1b cells were stimulated with IL-7 and assessed for their activation of socs-1 and socs-3. B62.1 IND cells stimulated with IL-7 resulted in an up-regulation of both socs-1 and socs-3 (Figure 4.9D).

B62.1 IND Gfi-1b cells also displayed an increase in socs-1 and socs-3 expression after stimulation with IL-7, however, the level of enhancement was decreased for both. The basal level of socs-1 and socs-3 expression observed in B62.1 IND Gfi-1b over-expressing cells was

100 also reduced compared to wild type controls, suggesting that Gfi-1b expression may reduce the expression of SOCS proteins in B cells. To determine if decreased SOCS expression resulted in enhanced IL-7R signaling I stimulated cells with IL-7 and measured the activation of downstream targets. B62.1 IND cells stimulated with IL-7 displayed increased phosphorylation of pSTAT5, pJAK1 and pErk (Figure 4.9E). B62.1 IND Gfi-1b over- expressing cells also phosphorylated STAT5, JAK1 and Erk, and in each case the activation was slightly elevated compared to B62.1 IND controls. These observations suggest that Gfi-

1b may function to enhance IL-7-induced proliferation by reducing SOCS expression and allowing for stronger IL-7R signaling.

101

102

Figure 4.9 Endogenous or Enforced Expression of Gfi-1b in B Lineage Cells and B Cell Lines

(A) B220+ B lineage cells isolated from BM were cultured for 4 days in IL-7-supplemented media. Cells were stained and gated on CD19+ live cells and then enriched for c-Kit+CD2- IgM-, c-Kit-CD2-IgM-, c-Kit-CD2+IgM- and c-Kit-CD2+IgM+ cell populations prior to extraction of mRNA and analyzed for gfi-1b expression by real-time PCR. Displayed values were normalized to β-actin and are shown as fold change compared to the c-Kit+CD2-IgM- population. Figure shows fold change for normalized values from three independent experiments. (B - E) B62.1 IND cells were retrovirally infected with expression vectors producing SOCS-1 or Gfi-1b. (B) RNA was extracted from whole BM, B62.1 IND cells, and B62.1 IND Gfi-1b cells, and analyzed for gfi-1b and β-actin expression by RT-PCR. Displayed arbitrary units (A.U.) were calculated by measuring the band intensity for gfi-1b and normalizing to β-actin. (C) B62.1 IND GFP, B62.1 IND Gfi-1b, or B62.1 IND SOCS-1 infected cells were plated in media with varying concentrations of IL-7 and cultured for 3 days prior to the addition of 3H-thymidine for 6 hours and subsequent measurement of 3H-thymidine uptake. Data are presented as the mean of triplicate wells; error bars represent SD. (D) B62.1 IND and B62.1 IND Gfi-1b cells were starved for 1 hour prior to stimulation with IL-7 (25 ng/mL) for 90 minutes. RNA was extracted from stimulated cells and samples were analyzed for socs-1 and socs-3 expression by real-time PCR. Displayed values were normalized to β-actin and are shown as fold change compared to B62.1 IND unstimulated cells. (E) B62.1 IND and B62.1 IND Gfi-1b infected cells were starved for 1 hour prior to stimulation with IL-7 (25 ng/mL) for 15 minutes. Stimulated cells were lysed and analyzed by western blot analysis for pSTAT5, pJAK1 and pErk, as well as Gfi-1b and total Erk. Displayed arbitrary units (A.U.) were calculated by measuring the band intensity for indicated bands and normalizing to total Erk.

103

4.3 Discussion

Signaling through the IL-7R is of critical importance during the pro-B to pre-B cell transition.

In this chapter, I show that abrogation of IL-7R signaling in B lineage cells is not due to the disappearance of the IL-7R, but rather is mediated downstream by the modulation of SOCS-

1, which in turn controls the levels of JAK/STAT phosphorylation. The highest level of socs-1 expression was observed in the c-Kit-CD2+IgM- small pre-B population, coinciding with the stage of development at which cells no longer respond to IL-7. I further show that socs-1 expression can be regulated by a number of factors including IL-7 itself, IL-21, and IFN-γ.

CXCL12 enhanced the proliferative response the B62.1 IND B cell line independent of IL-7, while Gfi-1b enhanced the proliferation in response to IL-7, likely by regulating socs-1 expression and IL-7R signaling. I propose that the dynamic regulation of SOCS-1 expression acts as a “rheostat” to control IL-7R signaling in progenitor B cells.

I show that as B cells mature to the small pre-B cell stage of development they no longer respond to IL-7. Expression of the IL-7Rα chain varied between B cells subsets, but is positive on all B cell populations tested, with notable high levels persisting on IL-7-non- responsive CD2+IgM- small pre-B cells. CD2+IgM+ immature B cells expressed the lowest level of IL-7Rα chain and highest level of the IL-7Rγc chain. The increased surface expression of the γc chain observed on CD2+IgM+ cells is likely due to its pairing with one of the other cytokine receptors that utilize the γc chain. The IL-21R is a likely candidate, as our lab has recently published that the IL-21R is expressed at elevated levels on CD2+IgM+ cells.290

The intensity of expression of the IL-7Rα chain also differed slightly between fresh and cultured cells, with freshly isolated CD2-IgM- and CD2+IgM- populations expressing slightly higher levels of the IL-7Rα chain, and slightly lower levels of the IL-7Rγc chain, than observed

104 for cultured cells. IL-7R expression was also more uniform and homogeneous on cultured populations compared to freshly isolated cells, highlighting the more heterogeneous nature of freshly isolated populations. It can be concluded that while receptor expression is not identical between freshly isolated and cultured cells, the same pattern is observed and lack of signaling or proliferation in response to IL-7 was not due to absence of receptor expression.

B cells cultured with IL-7 reach an upper proliferative “limit”, at which point increasing the concentration of IL-7 no longer led to more proliferation. This finding suggested that a mechanism exists that limits IL-7 signaling, allowing for a certain level of response to IL-7 but nothing further. My finding that socs-1 and socs-3 were induced in B62.1 IND cells after IL-7 stimulation provides a potential mechanism by which IL-7R signaling could regulate its own signal transduction pathway. Using both primary B lineage cell cultures and established B cell progenitor cell lines, I show that SOCS expression in B cells regulates IL-7R signaling, thus limiting or completely inhibiting responses to IL-7. It is the SH2 domain of SOCS-1 that mediates the majority of the inhibitory action by binding to JAK/STAT proteins and preventing their phosphorylation. Proteasomal degradation of JAK/STAT proteins, or other signaling molecules, by the c-terminal SOCS box was not a major component of SOCS-1 mediated inhibition of IL-7 signaling in my system. Elevated expression of SOCS-1 in primary

B lineage cells, either enforced or induced by IFN-γ, inhibited the expansion of IL-7- responsive CD2- pro-B/large pre-B cells, while more mature CD2+ small pre-B and IgM+ immature B populations were relatively unaffected. Reductions in the cell number observed in the CD2+ populations was likely due to fewer CD2- input cells feeding the mature compartments. These observations support my model, in which elevation of SOCS expression beyond a certain threshold results in inhibition of IL-7-induced proliferation, even though IL-7 is present and the IL-7R is expressed.

105

Various factors may be part of this dynamic signaling network designed to regulate SOCS expression. My studies with IL-7 and IFN-γ highlight a case in which two separate signaling pathways worked together to modulate socs-1 expression and ultimately responsiveness to

IL-7. On its own, IFN-γ treatment did not alter cell proliferation. However, depending on the concentration of IL-7 used, IFN-γ treated cells either displayed proliferation levels equal to that observed for cells grown without IL-7, or exhibited further reductions in proliferation and ultimately cell death when cultured with high concentrations of IL-7. IL-7 and IFN-γ acted independently and together to induce socs-1 expression and the balance of signals from these cytokines can regulate the SOCS “rheostat”. Induction of socs-1 by IFN-γ stimulation alone may be sufficient to inhibit IL-7-induced proliferation or it may be that the combined effects of IFN-γ and IL-7 are required to surpass the threshold necessary to cause this effect.

However, I do not believe that the reduction of proliferation beyond baseline (no IL-7) levels, or the cell death observed with high concentrations of IL-7, was due solely to SOCS inhibition of JAK/STAT activation downstream of the IL-7R, because I have shown that B62.1

IND cells can survive and proliferate independent of IL-7. Therefore, while IL-7-induced proliferation was inhibited in the presence of IFN-γ, other IL-7R signals may still persist and work together with IFN-γ signals to cause a further reduction in cell proliferation and ultimately cell death.

My studies with IL-21 demonstrate another example of how independent signaling pathways can work together to alter SOCS expression and regulate responsiveness to IL-7. Similar to what I found for IFN-γ, the concentration of IL-7 is critically important in yielding different results with the same concentration of a secondary factor. In this case, only at high concentrations of IL-7 did IL-21 affect cell proliferation. This was also true for the induction

106 of socs-1, as IL-21 stimulation alone induced little to no expression of socs-1, while the combination of IL-7 and IL-21 led to levels of socs-1 greater than either alone.

Development from the pro-B to pre-B cell stage of development is characterized by the surface expression and signaling of the pre-BCR. Signals emanating from the pre-BCR are critical for providing survival, proliferation and differentiation signals to pre-B cells. Pre-BCR signals have also been found to be important in abrogating cell proliferation and inducing LC rearrangement.58,116,121,216 It has been shown that signals downstream of the pre-BCR and IL-

7R converge, amplifying the activation of Erk and allowing for the proliferation of pre-B cells in low concentrations of IL-7.127 Stimulation of cells with anti-µ did not enhance the proliferation of B62.1 IND cells, suggesting that pre-BCR cross-linking does not further enhance the proliferative capacity of the pre-BCR+ cells in my system. Stimulation of B62.1

IND cells with anti-µ did not affect the expression of socs-1 and socs-3, suggesting that pre-

BCR activation is not a direct regulator of SOCS proteins in these cells.

The expression of CXCR4 is up-regulated in pre-B cells and is important in trafficking cells away from IL-7 niches and toward CXCL12 producing stromal cells.65 Stimulation with

CXCL12 has been shown to induce SOCS expression in developing and mature lymphocytes.292,293 Stimulation with CXCL12 did not result in increased socs-1 or socs-3 expression in B62.1 IND cells and rather than inhibiting proliferation, it enhanced it. The increase in proliferation resulting from CXCL12 stimulation was not dependent on IL-7, as increased proliferation was observed without IL-7, and thus utilized an alternative pathway.

Using IL-7, IFN-γ and IL-21, I have demonstrated that it is possible to dampen as well as shut off signals emanating from the IL-7R, while with Gfi-1b I show that it is also possible to enhance responses to IL-7. Gfi-1b expression did not alter normal cell proliferation, but did

107 enhance proliferative responses to IL-7. In this case, the previously observed upper proliferative limit was surpassed, highlighting the fact that a B cell’s response to IL-7 is normally controlled and kept in check. Thus, when negative regulation is removed, cells are released from this inhibition and exhibit enhanced proliferation. Preliminary results also showed that B62.1 IND Gfi-1b cells displayed reduced basal levels of socs-1 and socs-3 expression as well as reduced elevation of these factors after stimulation with IL-7. The role of Gfi-1b in regulating SOCS expression has been described for other cell types and my results suggest that Gfi-1b may be able to inhibit SOCS expression in developing B cells as well. A physiological outcome of reduced SOCS expression is enhanced IL-7R signaling and

B62.1 IND Gfi-1b over-expressing cells displayed enhanced JAK, STAT and Erk phosphorylation, which likely leads to elevated proliferation in response to IL-7.

In this chapter, I demonstrate that regulation of signaling molecules downstream of the IL-7R occurs in developing B lineage cells and is critical during B lymphopoiesis. Previous work published by our lab has shown that pro-B cells mature into pre-B cells at equal frequencies regardless of whether IL-7 is present in culture.162 I now propose that during development, pro-B cells encounter IL-7 and receive both positive and negative signals that induce proliferation and survival, while also activating SOCS proteins, ensuring that excessive signaling does not occur. As cells reach the large pre-B cell stage they remain responsive to

IL-7 and also receive signals from the pre-BCR that allow for proliferation in low concentrations of IL-7. As cells mature further to the small pre-B cell stage of development,

SOCS levels are elevated past a threshold required to fully inhibit IL-7R signals.

108

Chapter 5

5 Heparin, Heparan Sulfate, and CD19 Regulation of

Erk Phosphorylation and B Cell Development5

5 Sections of this chapter appear in J Immunol. 2008 Mar 1;180(5):2839-47 Milne CD, Corfe SA, Paige CJ.

109

5.1 Introduction

When B cells mature to the small pre-B cell stage of development they lose responsiveness to IL-7, which is mediated in part by the expression of SOCS proteins. In culture, IL-7-non- responsive small pre-B and immature B cells quickly die unless they are transferred into conditions that promote their further maturation. Two important features of cultures that mediate development are cell contact, and stimulation with the mitogen LPS. Traditionally, co-culturing of B cells with stromal cells was utilized to promote cell survival and maturation to the LPS-responsive stage.294 Once capable of responding to LPS, stimulated cells develop further and subsequently secrete Ig. It has been shown that while stromal cells can mediate this maturation they are not absolutely essential and can be omitted if cells are grown under conditions that promote cell-cell contact, such as culturing in round bottom wells.89,90 Under these supportive conditions, homotypic interactions between B cell progenitors provide the signals necessary for maturation to proceed. Our lab has identified several surface molecules that inhibit maturation and subsequent secretion of Ig, including µ, κ, CD45, CD19, and Igβ, however, only anti-µ Fab was capable of blocking development without inhibiting Ig secretion.90 Treatment of cells with anti-µ Fab did not initiate signaling events in stimulated cells and thus it was proposed that inhibition of development was due to either the prevention of oligomeric complexes of the pre-BCR, or by blockage of the interaction of the pre-BCR with an external ligand.

Since the mechanism of action of inhibition was unclear, our lab devised a new approach to investigate cell-cell interactions, as well as possibly identify additional molecules that assist in the developmental process. In this novel system, IL-7-expanded primary B cells were cultured with various “filler” cell lines to see if they were capable of supporting the

110 maturation of B cell progenitors to the LPS-responsive stage. A variety of supportive cell lines were identified, which notably, were all of B cell origin, required cell-cell contact to mediate their effect, and were not able to produce Ig themselves.263 A number of surface molecules were uniquely expressed on these cell lines, including syndecan-4 and heparan sulfate, both of which are expressed by stromal cells and B cells in the BM.76,194,295,296

Syndecan-4 is a transmembrane proteoglycan decorated in heparan sulfate side chains, which is involved in cell-cell contact and adhesion, and regulates interactions with the extracellular matrix.297 Heparin and heparan sulfate are linear chains of repeating disaccharide subunits of uronic acid and D-glucosamine with many substitutions of N-sulfate, O-sulfate, or N-acetyl groups.298 Heparan sulfate can be cleaved from the cell surface by the enzyme heparitinase, which is produced by Flavobacterium heparinum.299,300

In culture, heparin has been shown to prevent the formation of B cells in Whitlock-Witte cultures as well as cause internalization of the pre-BCR in the pre-B cell line 70Z/3; while intraperitoneal injections of heparin into mice resulted in an increase in the number of plaque forming cells.301,302 Heparan sulfate has been identified as a putative ligand for the pre-BCR and binds to the unique tail of λ5.194 Several studies have demonstrated potential roles of the unique tail of λ5 during B lymphopoiesis and deletion or mutation resulted in impaired B cell development due to decreased proliferative expansion of µHC positive pre-B cells.196,303 Our lab has demonstrated that the addition of LPS and heparin, heparan sulfate or heparitinase, to in vitro cultures of IL-7-expanded B cells led to a dose dependent increase in the amount of

IgM secreted, further supporting a role for these molecules in regulating B cell development.263 No such increase in IgM was observed when the related extracellular matrix family member chondroitin sulfate was used, demonstrating that simply the presence of charged molecules was not sufficient to mediate this response. While heparin and heparan

111 sulfate and may act on cells directly, heparitinase may function by cleaving off heparan sulfate side chains, thus unveiling new carbohydrate epitopes and possibly increasing the amount of free active heparan sulfate in culture. Interestingly, heparitinase treatment resulted in an increase in the amount of secreted IgM even in the absence of supportive “filler” cells.263

Having identified that heparin and heparan sulfate can enhance the development of B cell progenitors and lead to an increase in the production of IgM, I decided to further investigate what effect these molecules would have on the development of various B cell subsets as well as their possible mechanism of action. Additionally, the observation that anti-CD19 could block B cell development to the Ig secreting stage was of interest because it has been reported that CD19 can function to regulate signaling thresholds downstream of the pre-

BCR and is also able to bind heparan sulfate.227,230,235,304,305 Therefore, I also investigated the possible role that CD19 plays in the development of B cell precursors and if these effects were mediated by heparan sulfate.

5.2 Results

5.2.1 The Influence of Heparin, Heparan Sulfate and Heparitinase on B Cell Development in Cultures Containing IL-7

The previous experiments carried out by our lab investigating the role of heparin and heparan sulfate in B cell development were done in the absence of IL-7.263 Since the starting populations for those experiments were IL-7-expanded B cell precursors, I investigated whether or not the in vitro development of B cells in IL-7 was altered by heparin, heparan sulfate or heparitinase treatment. These molecules may act directly on B cell surface proteins or may function to enhance IL-7 activity, as it has been reported that heparan sulfate can increase the presentation of IL-7 by acting as an accessory molecule.301,306 As described in the

112 previous chapter, primary B cell progenitors grown in culture with IL-7 mature from CD2-

IgM- pro-B/large pre-B cells to CD2+IgM- small pre-B cells and eventually become CD2+IgM+ immature B cells. Addition of heparitinase did not substantially alter population percentages or the absolute number of cells in culture (Figure 5.1). Heparin treatment resulted in a decrease in the absolute number of cells in culture, mainly due to a loss of CD2-IgM- cells.

There was also a relative increase in the percentage of CD2+IgM- cells in these cultures, increasing from 46% to 57%. Thus the overall decrease in cell number may be due to inhibition of CD2-IgM- pro-B/large pre-B cell survival or proliferation, or increased maturation of this population to the IL-7-non-responsive small pre-B cell stage. Treatment of cells with heparan sulfate did not significantly alter the proportions of B cells subsets, but did lead to a slight increase in the absolute number of cells in culture, suggesting that it may function to enhance IL-7-induced proliferation.

113

Figure 5.1 Heparin and Heparan Sulfate Influence the In Vitro Development of B Cells in Cultures Containing IL-7

IL-7-expanded BMB220+ cells were cultured in 24-well plates for 2 days in the presence of IL-7 and/or 200 µg/mL heparin, heparan sulfate, or 0.02 mU heparitinase. Cultures were harvested, counted, and analyzed by FACS for the expression of CD2 and sIgM. Results represent A) absolute cell number, or B) percentage of culture and are expressed as the mean ± SE of 3 independent experiments.

114

5.2.2 Heparin, Heparan Sulfate and Anti-CD19 Increase Signaling Via the Pre-BCR

Expression and signaling downstream of the pre-BCR is essential for cells to mature past the pre-B cell checkpoint. The fact that heparin, heparan sulfate and CD19 can alter B cell development during these stages, as well as the fact that heparan sulfate can bind CD19 and the unique tail of λ5, prompted me to investigate the biochemical responses of cells to these molecules. Experiments were initiated with the cell line B62c, a line that resembles primary B cell progenitors at the pre-B cell stage of development. B62c expresses the pre-BCR and has

been previously shown to phosphorylate Erk after stimulation with anti-µ F(ab’)2, which is important for cell survival and proliferation.127 Treatment of B62c cells with heparin, heparan sulfate or anti-CD19 alone did not alter pErk activation, however, pre-treatment with any of these factors prior to stimulation with anti-µ resulted in a greater amount of Erk being phosphorylated than observed with anti-µ alone (Figure 5.2A). This observation suggested that these factors are capable of increasing pre-BCR activity by decreasing the threshold necessary for activation, possibly by altering the cell surface signaling complex making anti-µ signaling more effective.

I next utilized cell lines representing cells at the pro-B, pre-B and immature B cell stages of development to determine if the observed effects of heparan sulfate and heparin were dependent on pre-BCR or BCR expression. The pro-B cell line R5b was generated from a

Rag2-/- mouse, and thus is unable to express the pre-BCR. The B62.1 cell line was generated from a wild type C57/Blk6 mouse and expresses both the pre-BCR and mature BCR. As expected, stimulation of the R5b line with anti-µ did not elicit any activation of pErk, and heparin or heparan sulfate treatment did not alter phospho-Erk levels in this cell line (Figure

115

5.2B). Alternatively, elevated pErk levels were observed in both B62c and B62.1 cells after pre-treatment with heparin or heparan sulfate prior to anti-µ stimulation. To confirm that these results were broadly applicable, I utilized a second set of cell lines that represent similar stages of development. Similar results were obtained using the µ23 (pre-BCR-), BII-D6

(pre-BCR+), and AI-D4 (pre-BCR+/BCR+) cell lines (Figure 5.2C).

116

Figure 5.2 Heparin, Heparan Sulfate and Anti-CD19 Increase Signaling Through the Pre-BCR

(A) B62c cells were rested in OptiMEM media +0.5% FCS in the absence of IL-7 for 1 hr at 37°C. Cells were pre-stimulated with 100 µg/mL heparin, heparan sulfate, or 5 µg/mL anti-

CD19 for 15 min prior to stimulating with goat anti-mouse µ F(ab’)2 at 25 ng/mL for 2 min. Cells were pelleted, lysed, and subjected to Western blot analysis using a phospho-specific anti-Erk antibody or total Erk antibody. (B) R5b (pre-BCR-), B62c (pre-BCR+), or B62.1 (pre- BCR+/BCR+) cell lines were treated with heparin or heparan sulfate or left untreated for 15 min prior to stimulation with goat anti-mouse µ F(ab’)2 for 2 min. Western blotting was performed as described above. Band intensities were quantified and are expressed as a ratio of pErk/Erk. (C) µ23 (pre-BCR-), BII-D6 (pre-BCR+), or AI-D4 (pre-BCR+/BCR+) cell lines were treated as described above and analyzed for pErk activation.

117

5.2.3 Heparin and Heparan Sulfate Affect Proliferation of Pre-BCR+ Cells

Erk activation is important for cells during the pro-B to pre-B cell transition, and phosphorylation of Erk downstream of the IL-7R and pre-BCR allow cells to proliferate in low concentrations of IL-7.127,131 Having demonstrated that heparin and heparan sulfate can modify the signaling thresholds for the activation of Erk downstream of the pre-BCR, I questioned whether or not these factors would alter the proliferation of various B cell lines.

Pre-BCR- cells lines, R5b and µ23, require high concentrations of IL-7 to proliferate, and this requirement is not altered by the addition of heparin or heparan sulfate (Figure 5.3A).

Alternatively, the addition of heparan sulfate to the pre-BCR+ cell lines, B62c and BII-D6, resulted in a slight increase in proliferation in response to IL-7 (Figure 5.3B). This increase was not observed when cells were treated with heparin; instead, heparin treated pre-BCR+ cells proliferated at equal rates to untreated cells at high concentrations of IL-7, but displayed a reduced proliferative capacity at low concentrations of IL-7. Treatment of the pre-BCR+/BCR+ cells lines, B62.1 and AI-D4, with heparin sulfate led to minor increases in IL-

7-induced proliferation, while treatment with heparin did not lead to decreased proliferation at low concentrations of IL-7 as was observed for pre-BCR+ cell lines (Figure 5.3C).

118

Figure 5.3 Heparin and Heparan Sulfate Influence the Proliferation of Pre- BCR+ Cells

Proliferation assays were performed using a titration of IL-7 for (A) R5b and µ23 (pre-BCR-), (B) B62c and BII-D6 (pre-BCR+), or (C) B62.1 and AI-D4 (pre-BCR+/BCR+) cells and 200 µg/mL heparin (filled circle), heparan sulfate (open circle), or IL-7 alone (filled square). Proliferation was assayed by 3H-thymidine incorporation after 4 days in culture.

119

5.2.4 CD19 Deficiency Alters the Maturation of B Cells in IL-7 But Does Not Alter the Affect of Heparin, Heparan Sulfate or Heparitinase

Having observed that pretreatment of cells with anti-CD19 led to increased Erk activation, as well as the fact that CD19 has been shown to bind heparan sulfate, I questioned whether or not the absence of CD19 would alter the affect that heparin, heparan sulfate, or heparitinase had on the in vitro development of B cells. CD19-/- B cells grown in the presence of IL-7 were able to develop from the pro-B/large pre-B cell stage to the small pre-B cell stage and eventually to the immature B cell stage; however, they do so with reduced frequency, as demonstrated by the reduced absolute number of cells recovered from IL-7 cultures initiated with CD19-/- B cells (Figure 5.4A). While the overall number of CD19-/- cells in culture was decreased under all conditions compared to CD19+/+ controls, cells treated with heparin or heparin sulfate displayed a reduction or elevation in cell number respectively, similar to results obtained with CD19+/+ cells. Interestingly, pro-B, pre-B, and immature B cell subset distribution was askew in CD19-/- cultures (Figure 5.4B). The percentage of CD2-IgM- pro-B cells was elevated under all conditions initiated with CD19-/- cells, increasing from ~20%

(CD19+/+) to ~25% (CD19-/-). This increase in percentage resulted in an approximately equal absolute number of CD2-IgM- cells developing in CD19-/- and CD19+/+ cultures. The percentage of CD2+IgM- cells in CD19-/- cultures is approximately equal to that of CD19+/+ cultures (~50%), while the percentage of CD2+IgM+ cells was reduced, decreasing from ~30%

(CD19+/+) to ~20% (CD19-/-). Thus, CD19 deficiency does not appear to affect the development of CD2-IgM- cells, but does inhibit the further development or survival of

CD2+IgM+ immature B cells.

120

Figure 5.4 CD19 Deficiency Influences the Number of CD2+ Cells Emerging in Cultures Containing IL-7, But Does Not Alter the Affect of Heparin, Heparan Sulfate or Heparitinase

+/+ -/- IL-7-expanded BMB220+ CD19 or CD19 cells were cultured in 24-well plates for 2 days in the presence of IL-7 and 200 µg/mL heparin, heparan sulfate, or 0.02 mU heparitinase. Cultures were harvested, counted, and analyzed by FACS for the expression of CD2 and sIgM. Results represent A) absolute cell number, or B) percentage of culture and are expressed as the mean ± SE of 2 independent experiments.

121

5.2.5 CD19 Deficiency Inhibits the Development of B Cells to the IgM Secreting Stage But Does Not Alter the Affect of Heparin, Heparan Sulfate or Heparitinase

While CD19 deficiency did not alter the ability of B cells to respond to heparin, heparan sulfate or heparitinase in IL-7 cultures, it remained to be shown whether or not CD19 played a role in regulating the response to these factors in LPS cultures. To test for this possibility, IL-7-expanded BM cells from CD19-/- and CD19+/+ mice were cultured with LPS and heparin, heparan sulfate or heparitinase under conditions that promoted cell-cell contact and were assessed for their ability to secrete IgM. Confirming previous experiments from our lab, the addition of heparin, heparan sulfate or heparitinase to LPS cultures resulted in increased production of IgM (Figure 5.5).263 CD19-/- cells displayed a dramatic decrease in their ability to secrete IgM, however, the addition of heparin, heparan sulfate or heparitinase still led to an increased amount of IgM being produced. Therefore, while CD19 is critical for cells to develop to the Ig secreting stage, it does not appear to regulate the ability of cells to respond to heparin, heparan sulfate or heparitinase in LPS cultures.

122

Figure 5.5 CD19-/- Cells Display a Deficiency in Maturation to the Ig Secreting Stage, But Still Respond to Heparin, Heparan Sulfate and Heparitinase

600 B220+ day 4 IL-7-expanded CD19+/+ (closed circles) or CD19-/- (open circles) BM cells were cultured in 96-well plates containing LPS and 200 µg/mL heparin, heparan sulfate, or 0.1 mU heparitinase. The emergence of LPS-responsive B cells was monitored 7 days later by ELISA measuring secreted IgM. Bar shown is the mean average from two independent experiments.

123

5.2.6 CD19 Deficient Cells Display a Reduced Capacity to Activate Erk, But Normal Ability to Induce STAT5 and JAK1

CD19 is an accessory molecule for the BCR in mature B cells, while the role it plays during B cell development has yet to be fully elucidated. I have shown that CD19 is not involved in regulating the response of B cells to heparin, heparan sulfate or heparitinase, but does play an important role in mediating the development of B cells. CD19 is a PI3K activator and thus has potential to modulate proliferative signals emanating from the IL-7R as well as the pre-

BCR. Previous studies have demonstrated that activation of Erk downstream of the pre-BCR is reduced in CD19-/- cells.230,305 I questioned whether CD19 deficiency also altered the activation of targets downstream of the IL-7R. Cell lines generated from CD19+/+ or CD19-/-

BM were stimulated with IL-7, anti-µ, or both for 15 minutes and assessed for their ability to activate JAK1, STAT5 and Erk. CD19+/+ cells displayed a strong induction of pJAK1 and pSTAT5 after stimulation with IL-7, and also induced pErk after stimulation with IL-7 or anti-

µ, while the amount of Erk activated after cells were stimulated with IL-7 and anti-µ was greater than with either alone (Figure 5.6). CD19-/- cells were able to activate pJAK1 and pSTAT5 after stimulation with IL-7, and displayed only a slight reduction in pErk expression; however, the levels of pErk were greatly reduced in cells stimulated with anti-µ and the elevated levels of pErk normally observed in cells stimulated with IL-7 and anti-µ was abolished. Therefore, CD19 does not appear to alter the activation of targets downstream of the IL-7R, but is critical in regulating the activation of pErk downstream of the pre-BCR, as well as the enhanced phosphorylation of Erk observed after stimulation with IL-7 and anti-µ.

124

Figure 5.6 CD19-/- B Cells Display Normal IL-7R Activation, But Deficient Pre-BCR Activation

CD19+/+ and CD19-/- cell lines were rested in OptiMEM media +0.5% FCS in the absence of

IL-7 for 1 hr at 37°C. Cells were stimulated with IL-7 (25 ng/mL), goat anti-mouse µ F(ab’)2 (15 ng/mL), or both for 10 min. Cells were pelleted, lysed, and subjected to Western blot analysis using a phospho-specific STAT5, JAK1 and anti-Erk antibodies or total Erk antibody.

125

5.2.7 CD19 Deficient Pre-BCR+ and BCR+ Cells Exhibit a Reduced Ability to Proliferate in Low Concentrations of IL-7

Erk activation downstream of the IL-7R and pre-BCR is important for cells to proliferate in low concentrations of IL-7, therefore, I tested various CD19-/- cell lines for their capability to proliferate in varying concentrations of IL-7. The CD19-/- cell line E1 has a pre-B cell phenotype and proliferated normally at high nanogram concentrations of IL-7, but displayed reduced proliferation in lower picogram concentrations (Figure 5.7). A similar result was observed for the CD19-/- pre-B/immature B cell line G2. Alternatively, the CD19-/- pro-B cell line F4, displayed comparable levels of proliferation to its CD19+/+ counterpart, µ23. Hence, the loss of CD19 appears to hinder the ability of pre-BCR+ cells to proliferate in low concentrations of IL-7, likely due to decreased Erk activation.

126

Figure 5.7 CD19-/- Cells Display a Reduced Capacity to Proliferate in Low Concentrations of IL-7

Proliferation assays were performed using a titration of IL-7 for (A) B62c and CD19-/- E1 (pre-BCR+), (B) B62.1 and CD19-/- G2 (pre-BCR+/BCR+), or (C) µ23 and CD19-/- F4 (pre- BCR-) cells. Proliferation was assayed by 3H-thymidine incorporation after 4 days in culture.

127

5.3 Discussion

The maturation of B cells from the pro-B to immature B cell stage of development is dependent on their interaction with stromal cells in the BM, which assist by regulating B cell migration to specific BM niches, as well as by providing external factors that modulate signaling cascades in progenitor B cells. In certain circumstances the requirement for stromal cells in mediating B cell development can be circumvented by providing exogenous growth factors or culturing cells under conditions that promote cell-cell contact. The addition of IL-7 to in vitro cultures provide survival and proliferation signals to pro-B/large pre-B cells, while cell-cell contact allows for the maturation and survival of small pre-B/immature B cells to a mitogen responsive stage, after which stimulation with LPS induces the production and secretion of IgM.

Several candidate surface molecules have been identified that mediate contact dependent B cell maturation, including the pre-BCR and CD19.90 Using a soluble pre-BCR-like reagent,

Bradl et al. identified stromal cell surface molecules that bound the pre-BCR, and potentially regulated B cell development.194 This interaction could be abolished if stromal cells were pretreated with heparin, heparitinase, or a sulfation inhibitor, suggesting that heparan sulfate may be a pre-BCR binding partner. Our lab provided further evidence that heparan sulfate regulated B cell development, by demonstrating that the addition of LPS and heparin, heparan sulfate or heparitinase to B cell cultures increased the amount of IgM produced by B cells.263

A potential role for heparan sulfate in regulating IL-7-induced proliferation of B cell precursors has been previously reported. In these model systems, heparan sulfate was shown to enhance IL-7 activity by either promoting the presentation of IL-7, or by acting as a hybrid molecule with IL-7 to stimulate pre-pro-B cells.301,306 I observed that addition of heparan

128 sulfate to IL-7 cultures did lead to an increase in the absolute number of cells recovered and also enhanced the proliferation of pre-B cell lines, however, addition of heparan sulfate to pro-B cell line cultures did not increase their proliferative response to IL-7. Therefore, at least under these conditions, heparan sulfate does not appear to potentiate the effects of IL-7 on pro-B cell proliferation and the increase in cell numbers observed in heparan sulfate treated in vitro cultures is likely due to increased proliferation of the large pre-B cell population. The increased proliferation observed for this population could be explained by the elevated levels of pErk that exist after treating cells with heparan sulfate. Notably, this increase in pErk was only observed in pre-B cell lines and required anti-µ stimulation, suggesting that it was a pre-BCR mediated response. pErk activation was also observed for pre-BCR+ cell lines treated with heparin; however, instead of leading to enhanced proliferation, heparin treatment led to a reduction in proliferation at low concentrations of

IL-7. This result supports the observation that the addition of heparin to in vitro IL-7 cultures led to a reduced absolute number of cells in culture, as well as an increase in the percentage of CD2+IgM- cells. The decreased proliferation in low concentrations of IL-7 observed for pre-BCR+ cell lines was not observed for cell lines expressing the BCR. One possible explanation for this difference comes from the observation that treatment of the pre-B cell line 70Z/3 with heparin resulted in internalization of the pre-BCR, while the BCR remained on the surface of more mature heparin treated cells.302 Therefore, cells expressing the mature BCR may not experience the loss of proliferative signals that result from heparin- induced pre-BCR internalization, allowing them to continue to proliferate in low concentrations of IL-7.

CD19 is a B cell surface membrane protein that is expressed at the early stages of B cell development and functions as a BCR co-receptor by decreasing the signaling threshold for

129

IgM activation. Signals downstream of CD19 augment signals via the pre-BCR, and anti-CD19 stimulation synergized with anti-µ to enhance tyrosine phosphorylation.230 B cells from

CD19-/- mice exhibited a competitive disadvantage in auto-reconstitution studies, reduced pre-B cell proliferation, and suboptimal Erk and Btk activation downstream of anti-µ.235 My observation that anti-CD19 treatment prior to anti-µ stimulation led to enhanced pErk supports these previous studies, which have demonstrated that CD19 can reduce the threshold for pre-BCR activation. The discovery that CD19 is able to bind to heparan sulfate provided a possibly mechanism by which CD19 could be recruited to the pre-BCR complex, acting as a bridge to help increase receptor signaling. However, the fact that I observe similar trends with the addition of heparin, heparan sulfate, and heparitinase in IL-7 and LPS cultures initiated with CD19-/- or CD19+/+ progenitors suggests that the outcomes mediated by these factors were not dependent on CD19. While not essential in this regard, CD19 expression is still important during the pro-B to immature B cell transition. I observed that CD19-/- cells display a reduced ability to survive or proliferate in IL-7 in vitro cultures. However, because equal numbers of pro-B cells were obtained in these cultures, it does not appear as though

CD19 regulates IL-7-induced proliferation of pro-B cells. This fact was further supported by the observation that signaling was shown to be normal downstream of the IL-7R in CD19-/- B cells. These results are in line with previous studies that demonstrated that the defect in

CD19-/- B cells was limited to the pre-B and immature B cell populations.235 The dramatic reduction of IgM secretion observed for CD19-/- B cells demonstrates that CD19 is essential in mediating survival and/or maturation signals for developing B cells. Reduced signaling downstream of the mature BCR could explain this phenomenon, however inefficient signaling downstream of the pre-BCR may also play a role. My observation that pErk activation is decreased after anti-µ/IL-7 stimulation in CD19-/- pre-B cells provides a possible mechanism

130 of action for CD19 in regulating earlier stages of B cell development. This biochemical defect translates into a physiological response in culture, in which CD19-/- pre-BCR+ cells display a reduced capacity to proliferate in low concentrations of IL-7. This effect could lead to two potential outcomes during B cell development; it could reduce the absolute number of pre-B cells proliferating in culture, and/or it could remove the selective advantage that pre-BCR+ cells possess in low concentrations of IL-7, leading to a decrease in the number of large pre-

B cells capable of maturing to the small pre-B cell stage.

In this chapter, I have extended previous work carried out by our lab investigating the role that heparin and heparan sulfate play in B cell development. It is becoming increasingly evident that these molecules play an important role during B lymphopoiesis. In contrast to previous studies demonstrating a link between heparan sulfate and IL-7 signaling in developing B cells, I do not observe increased proliferation in response to IL-7 in my system.

Heparan sulfate is able to enhance pre-BCR activation, which potentially leads to increased proliferation and/or maturation, while enhanced pre-BCR activation induced by heparin, may be counteracted by receptor internalization. The physiological effects mediated by heparin and heparan sulfate do not require CD19, but CD19 is still essential for normal B cell development. CD19 regulates maturation of B cells to the Ig secreting state, as well as amplifies signaling downstream of the pre-BCR, which is important for cell proliferation.

Together, heparin, heparan sulfate and CD19 function to independently modulate signals emanating from the pre-BCR signaling complex, which affects the efficiency at which B cell maturation occurs.

131

Chapter 6

6 Discussion6

6 Sections of this chapter appear in J Immunol Methods. 2007 Aug 31;325(1-2):9-19. Corfe SA, Gray A, Paige CJ; J Immunol. 2008 Mar 1;180(5):2839-47 Milne CD, Corfe SA, Paige CJ; J Immunol. 2011 Oct 1;187(7):3499- 510. Corfe SA, Rottapel R, Paige CJ; Semin Immunol. 2012 (In Press) Corfe SA, Paige CJ.

132

6.1 Introduction

B lymphopoiesis is governed by an assortment of cytokines, chemokines and surface proteins that initiate essential signaling pathways in progenitor B cells. In vivo, stromal cells provide many of these factors and the necessary niches for development to transpire. In vitro, it is possible to circumvent the need for stromal cells in mediating B cell development by adding exogenous cytokines or culturing cells in conditions that promote B cell-B cell contact. In this thesis I have focused on the stromal-free maturation of B cells from the IL-7-responsive pro-B cell stage to the mature Ig secreting stage of development and the ability of IL-7,

SOCS-1, heparan sulfate and CD19 to regulate this maturation.

6.2 Generation and Characterization of IL-7-Dependent Cell Lines

In chapter 3, I describe the generation and characterization of stromal-free IL-7-dependent B cell lines. Cell lines were generated from both wild type and mutant mice and exhibit the phenotypes of cells at the pro-B to large pre-B cell stages of development. The main feature of the lines that categorizes them to these stages of B cell development is their dependence on IL-7 for survival and proliferation signals. In the absence of exogenous IL-7, or inhibition of signals downstream of the IL-7R, cells die within a matter of days. In vivo, IL-7 is secreted by stromal cells present in the BM niches in which B cells develop. It has been previously demonstrated that B cells can develop in vitro in the absence of stromal cells if exogenous cytokines are provided.87,88 A novel feature about our cell lines is that stromal cells are not required for their generation or maintenance. By eliminating the need for stromal cell support it has been possible to streamline the process for creating B cell lines and in doing so we can generate virtually unlimited numbers of cell lines from wild type and mutant mice.

Growing cells in a stromal-free environment also allows for greater control over culture

133 conditions, namely the presence and concentration of chemokines and growth factors that cells are exposed to. IL-7 is the only exogenous cytokine used to establish and maintain our

B cell cultures. In a number of studies described in this thesis, I utilize differing growth conditions and concentrations of IL-7 as well as other cytokines and chemokines to investigate signaling thresholds that exist in developing B cells. These experiments could only be accurately performed under conditions that allow for precise control over the concentration of exogenously added factors and highlight the importance of stromal-free B cell lines.

The cell lines described in chapter 3 most closely resembled cells with an early pro-B (Fr. B) or late pro-B (Fr. C) cell phenotype. Under all conditions tested, a significant percentage of cell lines generated did not express cµ or BP.1, emulating early pro-B cells. Interestingly though, virtually no cell lines were created that expressed c-Kit, a marker typically associated with early pro-B cells. B lymphopoiesis can proceed in the absence of c-Kit, but does so with reduced efficiency.83 c-Kit+ B cells do exist and persist in in vitro cultures of BM B cells grown with IL-7, however, their frequency diminishes over time. Therefore, it may be that c-Kit expression on pro-B cells requires exogenous SCF present in culture. It would be of interest to see if the addition of SCF during the generation of IL-7-dependent cell lines enhances the frequency with which cells express c-Kit, as well as if SCF treatment would allow for the improved generation of c-Kit+ pre-pro-B cell lines (Figure 6.1). This experimentation could be taken one step further with the addition of Flt-3L and/or IL-11, factors that can synergize with IL-7 to enhance proliferation of early B cell progenitors.

The majority of cell lines generated exhibited a late pro-B cell phenotype, defined by the expression of cµ, HSA, and BP.1, but lack of surface µ. A number of sµ- pro-B cell lines also

134 expressed CD2, CD22, CD25, and/or λ5, markers normally associated with sµ+ pre-B cells.

Expression of λ5 and has been detected in the cytoplasm of pro-B cells and surface expression of λ5 can be detected on pro-B cells in conjunction with the glycoprotein BILL- cadherin.184,307 Whether λ5 exists on the surface of IL-7-dependent cell lines in this structure or in an alternative form has yet to be determined. In vivo, CD2, CD22, and CD25 expression on B cells is restricted to pre-B cells. My observation that these markers are expressed on µ- cell lines from wild type, as well as µMT mice, demonstrates that the expression of these markers is not directly regulated by the pre-BCR. This observation highlights an important fact, that while surface markers can be good tools to help disseminate distinct B cell subsets, they are not absolute and the lack of, or presence of, any individual marker does not necessary define a cell population or stage of development. This fact becomes increasingly apparent when looking at B220 and CD19 expression on IL-7- dependent B cell lines. The B lineage cells used to establish lines were selected from BM by their expression of B220 or CD19, however, over the course of generating the lines, some cells lost expression of one or both of these markers. Therefore, while typically used to classify cells to the B lineage, B220 or CD19 expression is not absolutely essential for the in vitro survival and proliferation of B cells in response to IL-7, or for the generation of IL-7- dependent B cell lines. However, both have important functions during B lymphopoiesis, which will be described elsewhere in this discussion. Having generated a panel of B cell lines with similar characteristics that either express of don’t express specific surface proteins allows for the determination of their roles in regulating signaling pathways in developing B cells.

In the process of creating IL-7-dependent B cell lines it has been possible to obtain a variety of interesting lines that express phenotypes not normally observed in vivo. For example, the

135 cell line B62.1 expresses sµ, λ5, BP.1, CD2 and CD25, and is dependent on IL-7 for its growth and survival, all characteristics of large pre-B cells. However, κ is also expressed on the surface in conjunction with µ in the form of the mature BCR. Normally during B lymphopoiesis, cells express the pre-BCR, which initiates LC rearrangement, and then internalize the receptor prior to expressing the mature BCR. It has been proposed that precocious LC rearrangement can proceed in cells unable to express the pre-BCR, allowing for progression past this developmental checkpoint.182 Therefore, IL-7-dependent cells may be able to rearrange their LC genes prior to, or while expressing the pre-BCR, allowing for dual pre-BCR/BCR expression. It has been suggested that BCR expression and signaling inhibits IL-7R signaling in developing B cells.308 However, the observation that B62.1, in addition to other IL-7-dependent B cell lines, express the mature BCR demonstrates that simply expression of the BCR is not sufficient to inhibit IL-7R signaling. Whether or not pre-

BCR+/BCR+ cells actually exist in vivo has not been determined, however, these lines remain useful for investigating aspects of receptor activation and interactions between signaling pathways in developing B cells.

6.3 Establishment of IL-7-Dependent B Cell Lines

During the process of generating IL-7-dependent B cell lines, questions arose regarding the mechanism by which the lines were created. Specifically, do all cells have the potential to generate cell lines or is this a unique trait that is acquired or inherited by a select few? The systematic characterization of IL-7-dependent B cell line generation has begun to shed light on these questions. Cultures initiated with CD19+ selected cells displayed a lower percentage of wells reaching the cloning stage than wells seeded with B220+ selected BM cells from wild type mice. This discrepancy was not due to more IL-7-responsive cells, because the CD19+ selected fraction had a higher frequency of IL-7 responders. In fact,

136 having a greater number of cells capable of responding to IL-7 present initially in culture may be detrimental, as µMT cells, which had the highest frequency of IL-7-responding B cells, had the lowest percentage of cultures reach the cloning stage. B cells from µMT mice contain a mutation in the transmembrane domain of the µ protein, which prevents cells from expressing the pre-BCR on the cell surface and causes a block at the pro-B cell stage of development.179 Therefore, pre-B and immature B cells are absent in the BM of these mice and a higher percentage, as well as absolute number, of IL-7-responsive pro-B cells exist.

CD19+ selected BM also contained an increased percentage of IL-7-responsive pro-B cells compared to B220+ selected BM, because CD19 selection excluded the earlier pre-pro-B cell subset, as well as any non-B lineage B220+ cells. The fact that CD19+ B cells are capable of generating cell lines demonstrates that the ability to establish a cell line is not a feature that is restricted to earlier non-committed B cell progenitors. However, the fact that both CD19+ and µMT selected BM displayed a reduced frequency of cultures capable of reaching the cloning stage does suggest that increased numbers of IL-7-responsive cells in culture dilutes out cells that are capable of generating cell lines. One possible explanation for this observation is that there exists a finite number of cells capable of generating cell lines present initially in culture and that rapidly proliferating pro-B cells use up limited resources and/or space. In an attempt to reduce the effect that overcrowding might have on cell survival, wells were mixed and split on day 12 of culture and a selection were maintained as separate and distinct wells. The results obtained from the duplicate plates were similar to the original plates and a high percentage of wells displayed the identical outcome, in terms of being able to generate a cell line or not. This result further supports the idea that the potential of a cell to become a cell line is a characteristic that exists or arises in cells early in culture. This possibility runs counter to the expected notion that long-term growth potential

137 is something that occurs through extended culturing, after sufficient time has allowed for the accumulation of oncogenic mutation(s). Several explanations exist to describe the cases where replicate wells do not show the same outcome. In these instances, cells may acquire mutations that lead to long-term growth ability later on during culturing. It is also possible that this discrepancy is due to an unequal distribution of cells with long-term growth potential when transferring to the duplicate well, death of long-term growers during the initial culture crash, or death after being out-competed for space and/or nutrients by a stronger non-long-term clone.

6.4 In vitro Development of IL-7-Dependent B Cell Lines

Traditionally, cell lines were thought of as homogenous populations that represent a snapshot of development. However, some lines retain phenotypic plasticity, as well as the ability to continue to mature in culture. One well studied example is the 70Z/3 cell line, which exhibits a pre-B cell phenotype, but retains the potential to transition to a BCR+ immature B cell after being stimulated with LPS.309 Some IL-7-dependent cell lines also retain phenotypic plasticity as demonstrated by their ability to change their expression of various surface markers over time. Phenotypic changes were frequently observed as cells matured in culture, albeit with higher frequencies for certain markers than others. B cell maturation is characterized by the rearrangement and subsequent expression of the Ig HCs and LCs, leading to novel expression of the pre-BCR or BCR. During the process of culturing, I observed that some cells started out being cµ-, but became sµ+ and even LC+ over time, however, most of these cells died due to their inability to respond to IL-7. A proportion of these sµ+ and LC+ cells did survive though and were able to proliferate and generate long- term cell cultures and eventually cell lines.

138

Interestingly, a selection of B cell lines also retained the ability to continuously mature in culture. The IL-7-dependent B cell line B62 is a heterogeneous cell line that contains 95% cµ+sµ-κ- cells and 5% sµ+κ+ cells. When sµ-κ- cells were sorted to greater than 99.9% purity and placed back in culture, sµ+κ+ begin to arise again in a matter of days.162 This ability of an

IL-7-dependent B cell line to continue to mature in culture does not appear to be a feature unique to the B62 line. The pre-B cell line B62c, which is sµ+κ-, also contains a small population of sµ+κ+ cells and culturing B62c cells with low or no IL-7 leads to an increased percentage of κ+ cells in culture. It has yet to be determined whether or not these newly created sµ+κ+ “immature” B cells are able to survive in IL-7, however, since this population is continually being generated in culture without accumulating more than a few percent it is likely that they do not survive or proliferate in response to IL-7. This suggestion is supported by the fact that the IL-7-dependent B cell lines tested to date have an IL-7 frequency greater than 1, which means that not all cells survive and proliferate in response to IL-7.

Interestingly, the pro-B cell line displayed the highest IL-7 frequency, while the pre-B and pre-B/immature B cell lines displayed slightly lower frequencies, suggesting that pre-

BCR+/BCR+ lines may have a greater propensity to produce IL-7 non-responding cells in culture. By utilizing this model system a number of important questions could be investigated. Namely, what mechanism(s) exist to determine whether a κ- pro-B/pre-B cell continues to proliferate as such or is instructed to mature? Also, what conditions favour this developmental switch and is it possible to alter conditions to push cells toward one fate or the other? In chapter 4, I describe how SOCS proteins function to regulate signaling downstream of the IL-7R in developing B cells. If these newly generated “immature” B cells are in fact unable to respond to IL-7 it would be interesting to see if non-responsiveness is the result of elevated levels of SOCS proteins.

139

6.5 Generating Pre-BCR+ and BCR+ IL-7-Dependent B Cell Lines

Very few pre-BCR+ cells were recovered after the initial culturing period or after the establishment of B cell lines. When BM cells are grown in vitro for extended periods of time in culture with IL-7 it is the pro-B cell population that expands and eventually dominates the culture and therefore the majority of lines displayed characteristics of pro-B cells. However, pre-B cell generation is not completely exhausted in culture, as pro-B cells still have the capacity to mature and differentiate into large pre-B, small pre-B, and even immature B cells, thus allowing for the less frequent generation of lines with these phenotypes. Since the number of cell lines generated that possess a pre-B cell phenotype is low, it may be advantageous to try and increase the frequency with which they arise. It has been established that pre-B cells are able to proliferate in picogram concentrations of IL-7, while pro-B cells require nanogram concentrations.127 The culture conditions used to generate B cell lines described in chapter 3 contained nanogram concentrations of IL-7, to provide the maximal conditions for cell survival. Using lower concentrations of IL-7 upon initiating the cultures would favor the survival of pre-B cells, however, many of the surviving cells would mature to

IL-7-non-responsive small pre-B and immature B cells and die. Additionally, the pro-B cells that normally repopulate the large pre-B cell population would also be unable to survive, leaving few viable cells in culture. Therefore, I would recommend initiating cultures with high concentrations of IL-7 and then gradually decreasing the concentration of IL-7 (Figure 6.1).

This would provide the best conditions to allow for efficient cell survival during the early stages of culture while selecting for pre-BCR+ cell lines in the end.

As described previously, it is also possible to obtain IL-7-dependent B cell lines that express the mature BCR. It may be possible to increase the frequency with which these lines are generated as well. In vitro, after developing to the small pre-B and immature B cell stage of

140 development, B cells normally stop responding to IL-7 and require other signals to survive and mature. Survival signals can be provided by stromal cells or B cells themselves, if cells are grown under conditions that promote cell-cell contact. Therefore, attempting to generate B cell lines under conditions that favour the maturation of B cells in culture (i.e. round bottom wells, LPS, and/or heparan sulfate), might lead to the fortuitous generation of IL-7-dependent or even IL-7-independent B cell lines with characteristics of more mature B cells (Figure 6.1).

Alternatively, generating B cell lines from Bcl-2 transgenic mice, or transducing wild type or mutant cells with a Bcl-2 transgene, might allow for the selection of rare cell lines by allowing for the survival of cells that would otherwise die.

6.6 IL-7-Independent B Cell Lines

By gradually reducing the concentration of IL-7 in culture, it is possible to select for cells that acquire characteristics that allow for cell survival and proliferation independent of IL-7, while retaining the ability to signal and proliferate in response to IL-7. One such cell line, B23 IND, has been described and utilized previously by our lab and displayed increased basal levels of pErk, which contributed to its IL-7-independent nature.127 Other IL-7-independent cell lines, such as the B62.1 IND line utilized in chapter 4 to investigate the role of SOCS proteins in regulating IL-7 signaling thresholds, did not show this increase in basal pErk levels, and thus utilizes an alternative mechanism for survival. Independence from growth factor dependence requires the constitutive activation of proliferation and/or survival pathways, or the disruption of apoptotic pathways. Utilizing various pathway inhibitors it should be possible to determine which mechanisms are most utilized to mediate growth factor independence, as well as possibly identify mutations that ultimately might lead to lymphoproliferative diseases or cancer. It is worth noting that the only IL-7-independent B cell lines created so far have been selected from cell lines that expressed the pre-BCR and/or BCR. Therefore, at this

141 time it isn’t known if it is possible to obtain an IL-7-independent pro-B cell line in culture. If such lines could be obtained it would be interesting to determine whether or not they utilized similar or distinct mechanisms for independence as compared to their pre-

BCR+/BCR+ counterparts. Overall, investigation of the mechanisms by which established IND lines, as well as novel IND lines, bypass the necessity of IL-7 could provide interesting insights into the regulation of survival and proliferative signal pathways in developing B cells.

High IL-7 No IL-7

SCF/Flt3L/IL-11

Bone Marrow

High IL-7 Lo IL-7

Pre-Pro-B Pro-B Large Pre-B c-Kit+/Flt3+ pre-BCR- pre-BCR+ Bcl-2 Tg RBW, HS, Bcl-2 Tg

Small Pre-B Immature B Pre-B/Imm B IL-7 BCR+ pre-BCR+/BCR+ Independent 142 Figure 6.1 Generation of IL-7-Dependent and IL-7-Independent Cell Lines: Schematic outlining the potential to generate B cell lines with rare phenotypes by altering factors added or modifying cell culture conditions. 143

6.7 Regulation of IL-7R Signaling in Developing B Cells

In chapter 4, I describe how the induction of SOCS proteins downstream of the IL-7R, as well as the IFN-γR and IL-21R, function to regulate IL-7 mediated proliferation and differentiation in developing B lineage cells. Numerous studies have described deficiencies that exist during murine B lymphopoiesis due to the lack of IL-7R signaling; however, excessive IL-7R signaling can also be inhibitory. High levels of expression of the IL-7Rα chain in multipotent progenitor cells led to a reduction or block in the development of B cells prior to the expression of CD19.278,310 It has also been shown that signals emanating from the

IL-7R can decrease the efficiency of LC rearrangement in pre-B cells.58,116,121,216 Therefore, it is not simply the presence or absence of IL-7R signaling that is crucial for B cell commitment and development, but also the magnitude of signals. IL-7R signaling is regulated at the level of

IL-7R expression, IL-7 availability, and inhibition of downstream receptor targets (Figure 6.2).

6.8 Expression of the IL-7R During B Cell Development

Expression of the IL-7Rα chain is induced by PU.1 activation as well as Flt-3 signaling and is first detected on the cell surface of CLPs in the BM.26,311 High levels of IL-7R expression are maintained on B cell progenitors until the large pre-B cell stage of development.226,312-314 In chapter 4, I demonstrate that surface expression of the IL-7R persists on small pre-B

(CD2+IgM-) and immature B cells (CD2+IgM+), albeit at slightly reduced levels. Expression levels of the IL-7Rα chain differed slightly between pro-B, pre-B, and immature B cells taken directly from the BM (D0) or cultured for 4 days in IL-7 (D4). D0 populations displayed a broader peak of expression as well as a greater disparity between the three populations. The most pronounced differences in receptor expression were observed in the pro-B cell population, which displayed increased IL-7Rα chain expression on D0, and the immature B

144 cell population, which displayed decreased IL-7Rα chain expression on D0, while IL-7Rα chain expression on the pre-B population was very similar between D0 and D4. The difference in IL-7Rα expression observed on immature B cells was partially due to slightly different populations being examined on D0 and D4 cells, and gating on CD2+IgM+IgD- D0 B cells gave results that more closely resembled D4 results.

Lower expression of the IL-7Rα chain on the D4 pro-B cell population could be the result of a shift in the dominant B cell subset making up the CD2-IgM- population. When taken directly from BM, B cells characterized by CD19+CD2-IgM- staining include a mix of early pro-B, late pro-B, and large pre-B cells. Culturing cells in IL-7 for 4 days results in shift in the distribution of cells between these populations, leading to an increase in the late pro-B and large pre-B populations. Alternatively, culturing cells in vitro in IL-7 may directly alter IL-7Rα chain surface expression levels. In T cells, IL-7R signaling has been shown to decrease IL-7Rα chain expression and may have a similar effect on developing B cells.315 Cells were cultured in nanogram concentrations of IL-7, to allow for maximal cell survival and expansion, however, this concentration may not reflect concentrations present in the BM. Adjusting the concentration of IL-7 used in vitro may result in more comparable levels of IL-7R expression on cultured versus fresh cells. While decreased receptor expression may result in reduced signaling, it is unlikely to lead to complete abrogation of IL-7R signaling, as was observed in the CD2+ small pre-B cell population, and instead probably works in conjunction with internal regulators to control IL-7R activation.

IL-7R signaling also leads to receptor internalization, and while receptor is recycled it may not be re-expressed at equivalent levels after in vitro culturing.315 Surface receptors and signaling molecules in developing lymphocytes have been shown to be targeted for

145 endosomal sorting and proteasomal degradation by ubiquitin ligases, such as ITCH or SOCS proteins. The c-terminal SOCS box domain is critical in mediating these responses by forming E3 ligase complexes.316 In my system, however, SOCS mediated ubiquitination and degradation of the IL-7Rα chain does not appear to play a major role in regulating receptor expression or function. This is because B cell lines over-expressing SOCS-1 do not display reduced surface levels of the IL-7R and SOCS-1 ΔCT mutant constructs remain able to inhibit JAK and STAT activation in B cell lines.

Interestingly, while the proliferation of SOCS-1 ΔCT expressing B62.1 IND cells was inhibited over the most of the range of IL-7, cells reproducibly displayed a slight increase in proliferation at high concentrations of IL-7. It was at these concentrations that I also observed a slight reduction in the proliferation of B62.1 IND cells expressing the mutated

SOCS-1 SH2 protein. Therefore, it appears as though the SOCS box possesses some function in regulating IL-7R responses and that both SH2 and ΔCT domains may be necessary for full IL-7R inhibition, especially at high concentrations of IL-7.

6.9 Regulation of IL-7 Availability During B Cell Development

The local availability of IL-7 is important in regulating B cell development, and removal of IL-7 is the most direct manner by which IL-7R signaling can be abrogated. During lymphopoiesis B cells associate with various classes of stromal cells that secrete differing cocktails of cytokines and chemokines as well as provide the niches for B cells to develop. During lymphopoiesis, B cell subsets can be found associating with different types of stromal cells within the BM and CXCL12 and CXCR4 are important in controlling the migration of B cells toward specific cellular niches. CXCR4 expression is regulated during B cell development and small pre-B cells have been shown to be associated with CXCL12 positive stromal cells

146 in the BM65. Attraction of CXCR4Hi pre-B cells by CXCL12 stromal cells has been proposed as a mechanism by which pre-B cells can be directed to migrate away from IL-7 producing stromal cells, enhancing LC rearrangement.58 CXCL12 has also been shown to induce SOCS protein expression leading to cytokine-chemokine receptor cross-talk and regulation.292,293 In chapter 4, I demonstrate that CXCL12 did not induce SOCS expression or inhibit IL-7- induced proliferation of the B cell line B62.1 IND, but rather led to increased proliferation.

Enhanced proliferation was observed in the presence and absence of IL-7, suggesting that it was not an IL-7-mediated effect. Proliferation in response to CXCL12 has been described for pre-B cells and utilized STAT5 and Erk activation.317-319 As pre-B cells migrate away from IL-7 rich niches and abrogate IL-7R signaling they lose signals that are necessary for their survival and proliferation. Stimulation with CXCL12 may help to alleviate this stress by temporarily substituting for the lack of IL-7 signals, while also targeting cells to other BM niches. It should also be noted that receptor cross-regulation occurs in both directions, and elevated levels of

SOCS proteins induced by growth factor stimulation have been shown to inhibit aspects of

CXCR4 signaling.292,320,321 Therefore, it will be interesting to see if the elevation of SOCS proteins that occurs in developing B cells in response to IL-7, IFN-γ or any other factors, also function to regulate CXCR4 signaling and affect B cell migration or proliferation in the BM.

6.10 Regulation of IL-7R Signaling During the Pro-B to Pre-B Cell Transition

The role of IL-7R signaling during the pro-B to pre-B cell transition has been the subject of investigation by a number of labs. Recent work has shown that a primary role of IL-7R signaling during pro-B cell development is one of survival, via Mcl1, as well as suppression of premature Igκ gene rearrangement, via binding of the intronic iEκ enhancer.121 While IL-7R

147 signaling decreases the efficiency of LC rearrangement in large pre-B cells, pre-BCR activation of IRF-4 initiates LC rearrangement, which is then enhanced by attenuation of IL-

7R signaling.58 This balance between pre-BCR and IL-7R signaling was further characterized to show that signals emanating from the pre-BCR co-ordinate exit from the cell cycle as well as enhance Igκ transcription by activating E2A and inhibiting ID3, while IL-7R signaling countered this effect by increasing ccnd3 expression and preventing E2A binding of the Igκ intronic enhancer.116 It has also been demonstrated that signals downstream of the pre-BCR terminate expansion of pre-B cells by suppressing c-myc, leading to a reduction of cyclin D3 and thus limiting pre-BCR and IL-7 proliferative signals.216 Collectively these reports demonstrate that signals emanating from the IL-7R diminish but don’t prevent LC rearrangement and that IL-7R signaling needs to be regulated or attenuated for optimal LC rearrangement to proceed. They also provide evidence that signals emanating from the pre-

BCR may help reduce exposure to, or dampen aspects of IL-7R activation, but do not describe a mechanism by which abrogation of IL-7R signaling occurs.

Migration away from an IL-7 source is one way in which cells may limit their exposure to IL-

7, however, other mechanisms also exist. This fact is highlighted by the observation that both

IL-7-responsive (pro-B and large pre-B) and IL-7-non-responsive (small pre-B and immature

B) cell populations exist in B cell cultures matured in vitro under conditions in which cells are provided with excess amounts of IL-7 and are unable to migrate away from the IL-7 source.162 As the concentration of IL-7 is increased in culture B cells display enhanced proliferation, however, this increase reaches a maximum after which no further proliferation is observed. This ceiling appears not to be due to altered receptor expression or saturation, but rather to internal inhibition, because the proliferative peak can be breached if signaling regulators are mutated or absent. Over-expression or lack of expression of two such

148 regulators, Gfi-1b and CD45 respectively, resulted in increased B cell proliferative responses to IL-7. CD45 appears to directly regulate IL-7 signaling by de-phosphorylating JAK and

STAT proteins, and CD45-/- pro-B cells displayed prolonged activation of these factors.226 Gfi-

1b on the other hand appears to indirectly regulate IL-7 signaling, by repressing gene expression. In my system, I show preliminary evidence to suggest that Gfi-1b may be regulating SOCS expression in developing B cells, as B62.1 IND cells exhibited reduced basal and activated expression of SOCS-1 and SOCS-3 as well as slightly elevated activation of IL-

7R targets in response to IL-7 stimulation.

In chapter 4, I demonstrate that SOCS proteins play an important role in regulating IL-7R signaling in pro-B and pre-B cells. IL-7-induced the expression of SOCS-1 and SOCS-3 in developing B cells, and the magnitude of this induction was dependent on the concentration of IL-7. Thus, as B cells respond to IL-7 they also initiate negative feedback mechanisms that regulate the extent of IL-7R signaling, providing a balance between activation and inhibition.

In this model, low concentrations of IL-7 induce minimal SOCS induction, which is inadequate to inhibit IL-7R signaling. Increasing the concentration of IL-7 leads to an increased level of proliferative signals, as well as an increased level of SOCS expression.

However, at this point the balance is still in favour of activation over inhibition and thus increased proliferation is observed. At high concentrations of IL-7 a critical threshold of

SOCS expression is reached and the scale tips, wherein IL-7R mediated signals are dampened, resulting in a balance between activation and inhibition.

IFN-γ stimulation also led to the induction of SOCS proteins and together with IL-7 synergistically increased the expression of SOCS-1 resulting in an inhibition of IL-7-induced proliferation; a similar phenomenon was observed with IL-21 and IL-7. My model system

149 allows for the alteration of SOCS protein levels in developing B cells and demonstrates that once a threshold of SOCS expression is reached further IL-7R signaling is abrogated, even when surface receptor expression remains. Investigation into the expression levels of SOCS-

1 and SOCS-3 in developing B cell populations revealed that the small pre-B cell population, which is non-responsive to IL-7, expressed elevated levels of SOCS-1, suggesting that SOCS proteins have a novel and yet to be appreciated role during the pro-B to immature B cell transition. In my system, SOCS-1 acts not only as a negative feedback inhibitor, but also plays a key developmental role as part of a dynamic signaling network that modulates a B cell’s ability to respond to IL-7. Regulation of IL-7R signaling is ultimately important during B lymphopoiesis to limit proliferation as well as modulate B cell commitment and LC rearrangement. While, I have demonstrated that IL-7, IFN-γ and IL-21 can all alter SOCS expression and IL-7-induced proliferation, it has yet to be conclusively shown if any or all of these factors directly contribute to the elevated level of SOCS expression observed in small pre-B cells in vivo. Further studies will be necessary to determine what role these factors play in B cell maturation in vivo. What can be concluded is that a variety of known and possibly yet to be identified factors can work together to regulate a SOCS-mediated “rheostat” that controls the magnitude of response to IL-7 in developing B lineage cells.

6.11 Regulation of SOCS Protein Expression

SOCS proteins are important negative regulators of cytokine signals and are essential for the development of a variety of hematopoietic lineages.105 In B cells, a role for SOCS proteins has been described during the very early stages of B cell lymphopoiesis prior to B cell commitment.31,143 In mature T cells, IL-7R signaling has been shown to be able to both increase and decrease SOCS-1 and/or SOCS-3 expression depending on the signaling

150 context of responsive cells.322,323 Furthermore, regulation of SOCS-1 expression has been shown to be important during several stages of T cell development and activation of the pre-

TCR decreased SOCS-1 expression in developing T cells.266,324 If such a decrease existed downstream of pre-BCR signaling, then the reduction of SOCS expression might work in conjunction with enhanced Erk activation to allow for proliferation in reduced concentrations of IL-7. However, contrary to the results observed in pre-T cells, pre-BCR activation did not lead to a reduction in SOCS expression in my system. Extending these results to ex vivo B cells will be important to establish if this observation holds true for pre-B cells in vivo.

A number of transcriptional repressors have also been identified that regulate SOCS protein expression, including Miz-1, Gfi-1 and Gfi-1b. Deletion of Miz-1 resulted in a block at the pro-B cell stage of development due to elevated expression of SOCS-1 and reduced expression of Bcl-2.143 A similar block is observed during T cell development, however, a secondary block also existed at the pre-T cell stage of development.324 It will be of interest to determine if this additional block in development is also observed in pre-B cells. Gfi-1-/- mice display defects in B lymphopoiesis prior to B cell commitment, due to deregulated IL-

7Rα chain expression and elevated SOCS expression. Gfi-1 and Gfi-1b are related family members that possess a number of overlapping but non-redundant functions.325-327 Gfi-1b contains SOCS binding sites and has been shown to inhibit SOCS expression.291 During lymphocyte development Gfi-1 and Gfi-1b are highly expressed in CLPs as well as various B cell progenitors and their expression gradually decreases as B cells mature.31,327 My real-time

PCR results of developing B cell subsets demonstrate that small pre-B and immature B cells express reduced levels of Gfi-1b compared to less mature IL-7-responsive pro-B cells. I have described how IL-7 stimulation induces SOCS expression in B cells and if a threshold of

151

SOCS activation is reached then IL-7R signaling is abrogated. If Gfi-1b normally functions to inhibit SOCS expression in developing B cells in vivo, then as its expression decreases an equivalent amount of IL-7 signaling should result in a greater level of SOCS activation and enhanced IL-7R inhibition. My preliminary findings with B62.1 IND Gfi-1b over-expressing cells suggest that this may in fact be the case and provides one mechanism by which SOCS proteins may be regulated during B lymphopoiesis.

In addition to modulation of SOCS expression, phosphorylation and stability of SOCS proteins are important for their functional activity and can be regulated by Pim kinases. Pim-1 activity is induced by a variety of cytokines including IL-7 and IFN-γ, and has been shown to both positively and negatively regulate SOCS function in progenitor B cells.120,328-331 The apparently contradictory effects observed for Pim kinase function on SOCS activity may be partially explained by the multiple mechanisms SOCS proteins utilize to inhibit receptor- signaling pathways. Pim kinase phosphorylation of SOCS proteins that increases stability may potentiate activity by allowing for increased binding and direct inhibition of JAK/STAT activity; while phosphorylation that disrupts Elongin BC interaction could decrease activity by preventing the targeting of signaling proteins and receptor chains for proteasomal degradation.329,330,332,333 The fact that neither absence nor transgenic expression of Pim kinases completely abrogates IL-7R signaling in developing B cells suggests that Pim kinases function to fine tune IL-7R activation through the regulation of SOCS proteins or possibly other mechanisms, making them attractive targets to investigate in our system.334,335

152

6.12 IFN-γ Regulation of IL-7R Signaling in Developing B Cells

Signaling pathways downstream of a variety of cytokine receptors, including the IL-7R and

IFN-γR have been shown to intersect and both positively and negatively regulate B cell survival, proliferation and maturation. IFN-γ is a type II interferon, produced mainly by T and

NK cells, which possesses antiviral activity that is mediated through the regulation of cell growth, differentiation, apoptosis and antigen presentation.336 The IFN-γR is composed of two IFN-γR1 chains and two IFN-γR2 chains, which dimerize after binding to IFN-γ, leading to the transphosphorylation of constitutively associated JAK proteins and subsequent recruitment and activation of STAT1 (Figure 6.2).

Treatment of B cells with IFN-γ suppressed IL-7-mediated pre-B cell colony formation and abrogated IL-7-induced proliferation of ex vivo pre-B cells and pre-B cell lines resulting in their apoptotic death.283,284 However, IFN-γ did not exert an affect on small resting pre-B cells, nor did it lead to increased apoptosis of Eµ-Bcl-2 transgenic pre-B cells; even though IL-

7 proliferative signals were inhibited. Elevated expression of IFN-γ in vivo yielded similar results, whereby IFN-γ transgenic mice displayed significantly reduced B cell numbers in the periphery and BM, with cells arrested at the pro-B cell stage.337 Administration of exogenous

IL-7 was unable to correct this defect, suggesting that cells were unable to respond to IL-7.

Mice deficient for T cell protein tyrosine phosphatase (TC-PTP) also possessed decreased numbers of pre-B cells, which was due to increased IFN-γ production by BM stromal cells.282

TC-PTP-/- pre-B cells displayed constitutive phosphorylation of STAT1 but decreased JAK1 and STAT5 activation after IL-7 stimulation.282,338,339 Regulation of mitochondrial apoptotic factors was also important for IFN-γ-mediated apoptosis of pre-B cells, as evidenced by the fact that IL-7-dependent pre-B cells treated with IFN-γ displayed decreased Bcl-2 and Bcl-xL

153 expression as well as increased expression of the pro-apoptotic molecule Diablo.340 These findings demonstrate that IFN-γ can inhibit the proliferation and survival of B cell progenitors, but do not fully address the mechanism by which inhibition occurs.

In chapter 4, I show that treatment of the B62.1 IND line with IFN-γ alone did not lead to reduced proliferation or cell death; however, IFN-γ did inhibit IL-7-induced cell proliferation.

These results are in line with those utilizing Eµ-Bcl-2 cells and highlight the fact that IFN-γ itself does not inherently cause pro-B/large pre-B cell death. Instead, initiation of apoptosis is likely due to inhibited IL-7 survival and proliferation signals. I also demonstrate that stimulation of pre-B cells with IFN-γ led to robust expression of SOCS-1 and SOCS-3.

Previous studies have described that induction of SOCS proteins after treatment with IFN-γ inhibited STAT activation downstream of IL-4 and TNF-α stimulation.341-343 In light of these studies and my findings, I suggest a novel mechanism of action for IFN-γ induced inhibition of

IL-7R signaling in pro/large pre-B cells in which IFN-γ signaling in pre-B cells activates SOCS proteins that function, not only to limit IFN-γ signaling, but also inhibit signals mediated by the IL-7R (Figure 6.2). This mechanism would explain why TC-PTP-/- pre-B cells, which are naturally exposed to high levels of IFN-γ in vivo, are unable to activate JAK/STAT after IL-7 stimulation.

While these studies demonstrate the potential of IFN-γ to regulate B lymphopoiesis, the physiological role of IFN-γ-mediated inhibition of IL-7R signaling has yet to be elucidated.

Interestingly, infection and inflammation responses in the mouse led to preferential myelopoiesis and extramedullary B lymphopoiesis, which is mediated in part by inhibited production of CXCL12 and SCF by BM stromal cells.344 IFN-γ is a key factor produced during

154 infectious responses and its activation may regulate B cell development in these situations by inhibiting IL-7R signals. In line with this hypothesis, IL-15, a cytokine important for NK cell development under naïve and inflammatory conditions, selectively expanded Mac-1+B220+

NK cells in the BM, which were then capable of inhibiting pre-B cell proliferation and survival in an IFN-γ-dependent manner.285 This may be the same B220+ BM population that I observe producing IFN-γ transcripts and suggests that IFN-γ remains a possible in vivo mediator.

Finally, recently emigrated IgD-CD21- immature B cells in the periphery have been shown to be able to produce low levels of both IL-15 and IFN-γ.345,346 If one or both of these factors are produced by immature B cells in the BM they could potentially play a role in regulating the development of earlier precursors either directly or through the development of NK cells. IL-21 may also play a role in regulating BM B cell development during infection and/or inflammation. CD4+ T cells in the BM express IL-21, and account for approximately 3% of the naïve lymphocyte population, but significantly increase after immunization.290,347 Our lab has recently published that IL-21 promoted the differentiation of developing B cells and induced the expression of AID and Blimp-1.290 In light of these observations and my findings that IL-21 and IL-7 co-operate to inhibit IL-7-induced proliferation, it would be of interest to further characterize the regulation of the CD4+ IL-21 producing T cell population present normally in the BM, as well as how this population is altered during inflammation to better understand the role that IL-21 plays in regulating B cell development.

Stromal Cell Stromal Cell NK Cell T Cell IL-7

Stromal Cell pre-BCR

CD45 CXCL12 IL-21 IFN-γ IL-7Rα γc Igα/β IFN-γR1 IL-21Rα γc CXCR4 IFN-γR2

P P P JAK2 JAK2 P P P JAK1 JAK3 JAK1 JAK3 P JAK1 JAK1 P P STAT1/3 P P STAT1 STAT1 P STAT5

SOCS P

Pim LC Rearrangement Proliferation G -1b 155

Figure 6.2 Regulation of IL-7R Signaling: Signaling cascades initiated downstream of surface receptors in developing B cells lead to proliferative and maturational events, as well as negative feedback mechanisms that limit receptor activation. Black lines denote activating actions and red lines inhibitory actions. 156

6.13 Importance of Cell-Cell Contact in Mediating B Cell Development

During lymphopoiesis, B cells are targeted to cellular niches within the BM that provide growth factors and the environmental structure that is necessary for development to proceed. Stromal cells are an integral component of this environment and produce a variety of cytokines, chemokines and growth factors that provide survival, proliferative and maturation signals to developing progenitors. Disruption of in vivo cellular niches or factors that mediate B cell homing or migration in the BM result in abnormal or inhibited development.8 In vitro, stromal cells have traditionally been utilized to provide the necessary environment and factors for culturing B cells. The requirement of stromal cells for in vitro development is not absolute though, and the addition of various cytokine cocktails can promote B cell maturation from the uncommitted progenitor stage all the way to the large pre-B cell stage.87,88 Once cells develop to the small pre-B and immature B cell stage, no combination of cytokines have been discovered that mediate their survival and development, and instead cells are typically cultured with stromal cells and additional mitogenic factors, such as LPS. Culturing pre-B/immature B cells with stromal cells is thought to provide signals necessary for survival and maturation that allow them to develop to the mitogenic responsive stage, upon which, polyclonal activation with LPS cause cells to mature into Ig secreting plasmablasts.

During the transition from the large pre-B to immature B cell stage of development, signals downstream of the pre-BCR are critical to ensure that functional rearrangement of the µHC proteins has occurred. How these signals are initiated has engendered much debate. Two basic models exist, which revolve around whether or not ligand engagement is necessary for

157 pre-BCR activation. Evidence for the ligand-independent model comes from studies in which

B cell development can proceed when extracellular components of the pre-BCR, such as

SLC or µHC constant regions, are mutated or absent.188,219,348-350 However, under these conditions, elevated expression or unnatural aggregation of mutated receptors may provide nonphysiological circumstances that allow for ligand-independent activation. Conversely, support for the ligand dependent model is based on the fact that B cell development is somewhat perturbed or completely absent in mice and humans when SLC components are deficient.196,350,351 Additionally, molecules, such as heparin sulfate and galectin-1, have been identified as putative pre-BCR ligands in mice and humans.194,195,352 BM stromal cells express both heparan sulfate and galectin-1, which suggest that pre-BCR ligand engagement may be another important role for stromal cells during B cell development. While stromal cells may provide pre-BCR developmental signals in vivo, it has been demonstrated that they are not absolutely required for the development of pre-B cells to the LPS-responsive stage in vitro.

Instead, culturing cells under conditions that promote homotypic interactions, such as culturing in round bottom wells that ensure B cell-B cell contact, provide the necessary maturation signals.89,90 The ability of B cells to differentiate in vitro in the absence of stromal cells does not necessarily oppose the ligand-independent model, but instead indicates that if a ligand is necessary it must be present on the B cells themselves, or in the media, FCS or LPS, in which cells are cultured. In fact, support for a ligand in mediating development has been reported, as addition of anti-µ fab prevents maturation, possibly by preventing pre-BCR engagement or aggregation.90

6.14 Regulation of B Cell Development by Heparan Sulfate

Our lab has recently shown that heparin, heparin sulfate or heparitinase enhance IgM secretion by B cells when added to stromal-free cultures.263 Several studies have pointed to a

158 role for heparin sulfate in mediating B cell development via its interaction with the pre-BCR.

Heparan sulfate binds to the unique tail of λ5 and treatment of stromal cells with heparin or heparitinase prevented the binding of a pre-BCR like molecule to the stroma surface.194

Further evidence supporting a role for the unique tail of λ5 in pre-BCR activation was reported when λ5 was mutated or deleted, which resulted in reduced receptor aggregation, tyrosine phosphorylation and pre-B cell proliferation.196,303 The discovery that heparan sulfate is expressed on “filler” cell lines that support the maturation of B cells to the LPS-responsive stage suggested that it may be a critical factor in mediating this transition.263 In chapter 5, I describe how heparan sulfate led to an increase in the absolute number of cells recovered from IL-7 in vitro B cell cultures, as well as increased proliferation of pre-BCR+, but not pre-

BCR- cell lines, demonstrating that heparan sulfate enhances the proliferation of developing B cells. A biochemical mechanism to explain the increased proliferation observed in pre-BCR+ cells was provided when it was shown that pre-treatment of cells with heparin or heparan sulfate resulted in increased Erk phosphorylation after anti-µ stimulation, as Erk proteins play an important role in regulating the maturation and proliferation of pre-B cells.

How heparan sulfate physiologically mediates this response has yet to be fully elucidated.

Heparan sulfates are composed of repeating disaccharide units that are acetylated as well as

N- or O-sulfated.353,354 Heparan sulfates are widely distributed on a variety of cell types and exhibit exceptional structural diversity, thus it is possible that certain structural conformers exist, which are uniquely expressed on lymphopoietic tissues and are better able to exert specific physiological effects. Heparan sulfate chains can exist freely in the environment or can be expressed on the cell surface as heparan sulfate proteoglycans (HSPG), whereby one or more chains are attached to core proteins, such as syndecans, which are anchored to the cell membrane.355 HSPGs are involved in a variety of cellular events including adhesion,

159 migration, differentiation and proliferation during hematopoiesis.296,297 Syndecan-4 is a heavily heparan sulfated molecule that is expressed on stromal cells as well as pre-B cells, is developmentally regulated during B lymphopoiesis, and is expressed on “filler” cell lines capable of supporting stromal-free B cell maturation, making it a potential source of heparan sulfate during development.295,356 Culturing of B cells with stromal cells might setup niches in which B cells are exposed to heparan sulfate chains expressed on the surface of stroma, or this interaction may simply bring B cells in close enough proximity to allow for the interaction of heparan sulfate chains on developing B cells themselves (Figure 6.3). This speculation is supported by the fact that individual heparan sulfate chains contain several regions capable of binding the unique tail of λ5 and that most HSPG core proteins can bind multiple heparan sulfate chains, providing a bridge between cells or receptors.357 One, or both roles for stromal cells may occur in vivo, however, in vitro it appears as though only the ability to bring cells within close proximity of each other is necessary, as maturation still occurs in the absence of stromal cells when cells are cultured in round bottom wells. This situation is experimentally replicated by the use of supportive “filler” cells, which mediate development solely by surface protein engagement, as the “filler” cell to B cell ratio is such that the probability of progenitor B cell-B cell contact is low (Figure 6.3). Regardless of the source, heparan sulfate appears to regulate signaling by lowering the threshold for pre-BCR activation, leading to elevated Erk activation, resulting in increased proliferation and possibly enhanced maturation. This may occur by stabilizing pre-BCR complexes, causing receptor oligomerization initiating the formation of a signaling synapse or lipid raft that exclude signaling inhibitors. It is also feasible that, in vivo, heparan sulfate may function to concentrate

IL-7 to regions in which pre-B cells are present, however in my in vitro system no affect of heparan sulfate on IL-7 potency was detected.

160

Pretreatment with heparin also led to enhanced Erk phosphorylation, however, rather than increasing proliferation, I observed decreased proliferation in low concentrations of IL-7 and fewer absolute cell numbers recovered from IL-7 in vitro B cell cultures. A partial explanation for the difference in developmental outcomes between heparin and heparan sulfate, may be due to the fact that heparin has been shown to cause internalization of the pre-BCR.302

Therefore, heparin treatment may bind the pre-BCR allowing for activation of downstream signaling pathways, only to subsequently abrogate that activation. Reduced expression of the pre-BCR would explain why pre-B cells are no longer able to proliferate at low concentrations of IL-7, when pre-BCR signaling in required. Initial activation of the pre-BCR may be sufficient to trigger cells to mature to the IL-7-non-responsive small pre-B cell stage without expanding the large pre-B cell population, which would explain the decrease in the

CD2- population as well as the increase in CD2+ population.

HSPGs expressed on the surface of stromal cells or B cells are capable of binding the pre-

BCR, likely leading to enhanced B cell proliferation and elevated Ig secretion. However, heparitinase cleavage of cell surface heparan sulfate did not diminish its effects, but rather enhanced it. This result may be due to the fact that heparitinase treatment exposed new carbohydrate epitopes that were better able to influence B cell development. Alternatively, heparitinase cleavage of heparan sulfate chains from the cell surface could result in an increase in the amount of free heparan sulfate in culture. The differences in function between surface bound and free heparan sulfate are not fully known, however free heparan sulfate may not have the same steric hindrances or constraints as surface bound heparan sulfate and thus have an improved ability to aggregate surface receptors on the same or adjacent cells

(Figure 6.3). This might explain why heparitinase treated cells displayed elevated levels of IgM secretion even in the absence of “filler” cells.263 My results demonstrate that heparin,

161 heparan sulfate and heparitinase can regulate the proliferation and/or maturation of B cells and appear to be integral components of the complex interaction between stromal cells and

B cells, or B cells and B cells that mediate the transition from the pre-B cell stage to the LPS- responsive cell stage during development.

Stromal Cell

Signal Signal

Stromal Cell Dependent

Stromal Cell Independent Signal Filler Cell Heparin, Heparan Sulfate Signal

Heparatinase

Signal Signal 162 Figure 6.3 Stromal Cell-Dependent and Independent B Cell Development: Maturation of B cells to the Ig secreting stage of development requires either contact with stromal cells or culturing of cells under conditions that promote B cell-B cell interaction. Filler cells can also promote maturation, if they express heparan sulfate on their cell surface. 163

6.15 CD19 Regulation of Heparan Sulfate Activity

CD19 is a transmembrane protein expressed exclusively on B cells from the pro-B cell stage of development, and functions as a co-receptor for the BCR and pre-BCR.358,359 Crosslinking of CD19 leads to tyrosine phosphorylation of its cytoplasmic tails leading to activation of downstream targets Btk and PI3K/Akt.230,231,360-362 Regulation of CD19 activity is important in modifying the thresholds for receptor activation in both developing and mature B lymphocytes. CD19 associates with CD21, the receptor for C3d complement, and physiologically functions to recruit CD19, leading to cross-linking with IgM.230,363,364 CD19-/- mice display a more severe phenotype than CD21-/- mice though, suggesting that CD19 might be recruited to the signaling complex by alternative co-receptors.365-368 One potential candidate was heparan sulfate, and a fusion protein comprised of the extracellular region of

CD19 has been shown to bind stromal cell expressed heparan sulfate.304 In this regard heparan sulfate may function as a bridge to help stabilize CD19-pre-BCR interactions, allowing for enhanced downstream signaling. My observation that pretreatment with anti-

CD19 resulted in an increase in Erk phosphorylation, similar to that observed with heparan sulfate after anti-µ activation, further supported this idea. However, using CD19-/- cells I was able to demonstrate that CD19 was not required to mediate the effects that heparin, heparan sulfate or heparitinase had on in vitro B cell development in IL-7, or IgM secretion in response to LPS. Therefore while CD19 may be capable of binding to heparan sulfate and elicits a similar effect on pre-BCR signaling, it appears as though distinct mechanisms of activation are utilized.

164

6.16 Regulation of B Cell Development by CD19

It was originally reported that B cell development was normal in CD19-/- mice and that only peripheral B cell development was perturbed. CD19-/- mice displayed a significant reduction in peripheral B cells and serum Ig of all isotypes as well as a decreased immune response due to reduced antigenic and mitogenic activation of splenic B cells.233,234,362,365,369 While, not originally observed, a role for CD19 during B lymphopoiesis was suggested, as CD19 transgenic mice displayed defects at the immature B cell stage of development.233 The observation that CD19 activation lead to tyrosine phosphorylation and calcium mobilization in pre-B cells as well as enhanced signaling through the anti-µ-SLC complex supported the idea that CD19 functioned prior to the immature B cell stage of development.227,230,360

Subsequent in-depth analysis of CD19-/- mice revealed a defect in B cell development at the pre-B cell stage resulting from reduced pre-BCR activation and proliferation.235 While I demonstrated that CD19-/- cells did not show a defect in their ability to respond to heparan sulfate, they did not proliferate as well as CD19+/+ cells in in vitro IL-7 cultures, with overall cell numbers being reduced by about 15%. Lack of CD19 was reported not to have an affect on IL-7-induced proliferation in B cell progenitors and my observation that JAK and STAT activation downstream of the IL-7R was normal in CD19-/- B cells confirmed this result, suggesting that the defect observed in IL-7 in vitro cultures was not in the IL-7-responsive pro-B cell population. This was further demonstrated when the absolute number of CD2- pro-B cells was shown to be approximately equal in CD19+/+ and CD19-/- cultures. While IL-7 signaling was not directly inhibited in CD19-/- cells, proliferative responses to IL-7 were still affected when the concentration of IL-7 was reduced. It is in picogram concentrations of IL-7 that IL-7R signaling alone, resulting in Erk activation, is insufficient to initiate proliferation. I show that activation of Erk downstream of the pre-BCR is deficient in CD19-/- B cells and

165 that these cells also fail to phosphorylate Erk to sufficient levels after IL-7R and anti-µ stimulation to allow for proliferation in reduced concentrations of IL-7. The reason that no reduction in the number of CD2- pro-B/large pre-B cells in IL-7 cultures is observed was likely due to the fact that cells were grown in high concentrations of IL-7, in which signaling through the IL-7R alone is sufficient to induce proliferation. The most affected population in the in vitro IL-7 cultures was the CD2+IgM+ immature B cell population, which displayed a dramatic decrease in percentage and absolute cell numbers compared to CD19+/+ cultures.

Additionally, CD19-/- B cells displayed a significant reduction in their ability to mature and become Ig secreting cells in response to LPS. This defect is likely due to a combination of impaired maturation as well as reduced responsiveness to LPS. The lack of CD19 signaling in immature B cells results in impaired tonic BCR signaling, leading to decreased survival.305,370-373

Therefore, fewer cells would survive or mature to the LPS-responsive stage. However,

CD19-/- B cells also have defective responses to LPS. LPS signals through the toll like receptor RP105, which is expressed on mature B cells.374 RP105 signaling is dependent on

CD19 and B cells exhibited reduced Lyn and Vav activation after stimulation with LPS in the absence of CD19.375 Therefore it is likely the combined effect of reduced survival and hypo- responsiveness to LPS that leads to the dramatic decrease in IgM secretion observed in

CD19-/- cultures. In demonstrating that CD19 was not the mediator of heparan sulfate function I was able to further the understanding of the role that CD19 plays during B lymphopoiesis and highlight the fact that it not only controls development at the immature B cell stage but is also an important regulator of pre-B cell function.

166

6.17 Conclusion

B lymphopoiesis is a regulated differentiation process, whereby uncommitted hematopoietic progenitors develop through intermediate precursor stages prior to becoming mature B cells. This development is controlled by a variety of cytokines, chemokines and surface proteins that initiate signaling pathways in developing B cells as well as target cells to appropriate developmental niches. In this thesis, I have examined the maturation of B cells from the IL-7-responsive pro-B cell stage to the Ig secreting stage and investigated the role that IL-7, SOCS-1, heparan sulfate and CD19 play in regulating this transition.

Murine BM B cells grown in vitro in the presence of IL-7 mature from the pre-pro-B cell stage to the immature B cell stage of development. I describe the generation and characterization of IL-7-dependent B cell lines created from BM B cell cultures. Progenitor B cell lines exhibited phenotypes that mostly resembled pro-B and large pre-B cells, were dependent on

IL-7 for their survival and proliferation, and activated signaling pathways in a manner similar to that observed for ex vivo B cells. In theory, IL-7-dependent B cell lines can be generated from any mouse that has IL-7-responsive B cell progenitors and experimental methods are presented on how to select for phenotypically rare populations. Progenitor B cell lines have been used to help understand the biochemical processes that regulate B cell development and my description for the generation of IL-7-dependent B cell lines will provide a virtually unlimited set of novel tools with which to further this pursuit.

Data presented herein also demonstrate that as B cells mature to the CD2+ small pre-B cell stage of development they no longer respond to IL-7, even though receptor expression persists. Proliferative responses, as well as signaling in response to IL-7, was shown to be inhibited by SOCS-1, a developmentally regulated factor that was most highly expressed in

167 small pre-B cells. Stimulation with IL-7 and IFN-γ induced the expression of SOCS-1 in B cell lines and the combination of these factors, as well as IL-7 and IL-21, led to levels of SOCS-1 that were greater than observed with any factor alone. Combinations of IL-7 and IFN-γ or IL-

21 inhibited IL-7-induced proliferation, while over-expression of Gfi-1b or addition of

CXCL12 led to enhanced IL-7-dependent or IL-7-independenet proliferation respectively. It has been speculated that, in vivo, regulation of IL-7R signaling in pre-B cells is controlled at the level of IL-7 availability and IL-7R expression. I provide data that demonstrates that responsiveness to IL-7 is also internally regulated by the expression of SOCS proteins, which themselves are modulated by a network of positive and negative regulators.

Small pre-B and immature B cells do not respond to IL-7 and thus must be cultured with stromal cells or under conditions that promote homotypic interactions to maintain their survival. Addition of LPS to these cultures promotes the maturation of cells to the Ig secreting stage. Cell surface interactions are important for mediating these responses and heparan sulfate has been shown to be an important player. I demonstrate that pre-treatment of pre-BCR+ cells with heparan sulfate, as well as heparin or CD19, modified the receptor signaling complex and allowed for enhanced pre-BCR activation. This led to an enhanced proliferative capacity of pre-BCR+ cells in response to heparan sulfate, which was determined to be independent of CD19. Expression of CD19 was shown to be required for B cell survival and maturation to the Ig secreting stage in response to LPS, as well as for optimal pre-BCR mediated Erk activation and proliferation in low concentrations of IL-7. Together these results have furthered the understanding of the role that heparin, heparan sulfate and

CD19 play during B cell development as well as provided a biochemical mechanism by which these factors exert their affects.

168

References

1. Conley ME, Dobbs AK, Farmer DM, et al. Primary B cell immunodeficiencies: comparisons and contrasts. Annu Rev Immunol. 2009;27:199-227

2. Rajewsky K. Clonal selection and learning in the antibody system. Nature. 1996;381(6585):751-758

3. von Boehmer H, Melchers F. Checkpoints in lymphocyte development and autoimmune disease. Nat Immunol. 2010;11(1):14-20

4. Karasuyama H, Rolink A, Melchers F. Surrogate light chain in B cell development. Adv Immunol. 1996;63:1-41

5. Allman D, Pillai S. Peripheral B cell subsets. Curr Opin Immunol. 2008;20(2):149-157

6. Gathings WE, Lawton AR, Cooper MD. Immunofluorescent studies of the development of pre-B cells, B lymphocytes and immunoglobulin isotype diversity in humans. Eur J Immunol. 1977;7(11):804-810

7. Velardi A, Cooper MD. An immunofluorescence analysis of the ontogeny of myeloid, T, and B lineage cells in mouse hemopoietic tissues. J Immunol. 1984;133(2):672-677

8. Nagasawa T. Microenvironmental niches in the bone marrow required for B-cell development. Nat Rev Immunol. 2006;6(2):107-116

9. Welner RS, Pelayo R, Kincade PW. Evolving views on the genealogy of B cells. Nat Rev Immunol. 2008;8(2):95-106

10. Miller JP, Izon D, DeMuth W, Gerstein R, Bhandoola A, Allman D. The earliest step in B lineage differentiation from common lymphoid progenitors is critically dependent upon interleukin 7. J Exp Med. 2002;196(5):705-711

11. Akashi K, Traver D, Miyamoto T, Weissman IL. A clonogenic common myeloid progenitor that gives rise to all myeloid lineages. Nature. 2000;404(6774):193-197

12. D'Amico A, Wu L. The early progenitors of mouse dendritic cells and plasmacytoid predendritic cells are within the bone marrow hemopoietic precursors expressing Flt3. J Exp Med. 2003;198(2):293-303

13. Cumano A, Paige CJ, Iscove NN, Brady G. Bipotential precursors of B cells and macrophages in murine fetal liver. Nature. 1992;356(6370):612-615

14. Lacaud G, Carlsson L, Keller G. Identification of a fetal hematopoietic precursor with B cell, T cell, and macrophage potential. Immunity. 1998;9(6):827-838

15. Montecino-Rodriguez E, Leathers H, Dorshkind K. Bipotential B-macrophage progenitors are present in adult bone marrow. Nat Immunol. 2001;2(1):83-88

169

16. Hardy RR, Carmack CE, Shinton SA, Kemp JD, Hayakawa K. Resolution and characterization of pro-B and pre-pro-B cell stages in normal mouse bone marrow. J Exp Med. 1991;173(5):1213-1225

17. Melchers F. B cell differentiation in bone marrow. Clin Immunol Immunopathol. 1995;76(3 Pt 2):S188-191

18. Wang YH, Stephan RP, Scheffold A, et al. Differential surrogate light chain expression governs B-cell differentiation. Blood. 2002;99(7):2459-2467

19. LeBien TW. Fates of human B-cell precursors. Blood. 2000;96(1):9-23

20. Allman D, Lindsley RC, DeMuth W, Rudd K, Shinton SA, Hardy RR. Resolution of three nonproliferative immature splenic B cell subsets reveals multiple selection points during peripheral B cell maturation. J Immunol. 2001;167(12):6834-6840

21. Bassing CH, Swat W, Alt FW. The mechanism and regulation of chromosomal V(D)J recombination. Cell. 2002;109 Suppl:S45-55

22. Chen J, Trounstine M, Kurahara C, et al. B cell development in mice that lack one or both immunoglobulin kappa light chain genes. EMBO J. 1993;12(3):821-830

23. Weterings E, Chen DJ. The endless tale of non-homologous end-joining. Cell Res. 2008;18(1):114-124

24. de Villartay JP. V(D)J recombination deficiencies. Adv Exp Med Biol. 2009;650:46-58

25. Mandel EM, Grosschedl R. Transcription control of early B cell differentiation. Curr Opin Immunol;22(2):161-167

26. DeKoter RP, Lee HJ, Singh H. PU.1 regulates expression of the interleukin-7 receptor in lymphoid progenitors. Immunity. 2002;16(2):297-309

27. Kamath MB, Houston IB, Janovski AJ, et al. Dose-dependent repression of T-cell and natural killer cell genes by PU.1 enforces myeloid and B-cell identity. Leukemia. 2008;22(6):1214-1225

28. DeKoter RP, Singh H. Regulation of B lymphocyte and macrophage development by graded expression of PU.1. Science. 2000;288(5470):1439-1441

29. Houston IB, Kamath MB, Schweitzer BL, Chlon TM, DeKoter RP. Reduction in PU.1 activity results in a block to B-cell development, abnormal myeloid proliferation, and neonatal lethality. Exp Hematol. 2007;35(7):1056-1068

30. Spooner CJ, Cheng JX, Pujadas E, Laslo P, Singh H. A recurrent network involving the transcription factors PU.1 and Gfi1 orchestrates innate and adaptive immune cell fates. Immunity. 2009;31(4):576-586

31. Rathinam C, Klein C. Transcriptional repressor Gfi1 integrates cytokine-receptor signals controlling B-cell differentiation. PLoS One. 2007;2(3):e306

170

32. Iwasaki H, Somoza C, Shigematsu H, et al. Distinctive and indispensable roles of PU.1 in maintenance of hematopoietic stem cells and their differentiation. Blood. 2005;106(5):1590- 1600

33. Ramirez J, Lukin K, Hagman J. From hematopoietic progenitors to B cells: mechanisms of lineage restriction and commitment. Curr Opin Immunol. 2010;22(2):177-184

34. Bain G, Engel I, Robanus Maandag EC, et al. E2A deficiency leads to abnormalities in alphabeta T-cell development and to rapid development of T-cell lymphomas. Mol Cell Biol. 1997;17(8):4782-4791

35. Lin H, Grosschedl R. Failure of B-cell differentiation in mice lacking the transcription factor EBF. Nature. 1995;376(6537):263-267

36. de Pooter RF, Kee BL. E proteins and the regulation of early lymphocyte development. Immunol Rev. 2010;238(1):93-109

37. Zhuang Y, Cheng P, Weintraub H. B-lymphocyte development is regulated by the combined dosage of three basic helix-loop-helix genes, E2A, E2-2, and HEB. Mol Cell Biol. 1996;16(6):2898-2905

38. Kee BL. E and ID proteins branch out. Nat Rev Immunol. 2009;9(3):175-184

39. Sun XH. Constitutive expression of the Id1 gene impairs mouse B cell development. Cell. 1994;79(5):893-900

40. Cochrane SW, Zhao Y, Perry SS, Urbaniak T, Sun XH. Id1 has a physiological role in regulating early B lymphopoiesis. Cell Mol Immunol. 2011;8(1):41-49

41. Zhang Z, Cotta CV, Stephan RP, deGuzman CG, Klug CA. Enforced expression of EBF in hematopoietic stem cells restricts lymphopoiesis to the B cell lineage. EMBO J. 2003;22(18):4759-4769

42. Lukin K, Fields S, Hartley J, Hagman J. Early B cell factor: Regulator of B lineage specification and commitment. Semin Immunol. 2008;20(4):221-227

43. Thal MA, Carvalho TL, He T, et al. Ebf1-mediated down-regulation of Id2 and Id3 is essential for specification of the B cell lineage. Proc Natl Acad Sci U S A. 2009;106(2):552-557

44. O'Riordan M, Grosschedl R. Coordinate regulation of B cell differentiation by the transcription factors EBF and E2A. Immunity. 1999;11(1):21-31

45. Pridans C, Holmes ML, Polli M, et al. Identification of Pax5 target genes in early B cell differentiation. J Immunol. 2008;180(3):1719-1728

46. Rolink AG, Nutt SL, Melchers F, Busslinger M. Long-term in vivo reconstitution of T- cell development by Pax5-deficient B-cell progenitors. Nature. 1999;401(6753):603-606

47. Horcher M, Souabni A, Busslinger M. Pax5/BSAP maintains the identity of B cells in late B lymphopoiesis. Immunity. 2001;14(6):779-790

171

48. Mikkola I, Heavey B, Horcher M, Busslinger M. Reversion of B cell commitment upon loss of Pax5 expression. Science. 2002;297(5578):110-113

49. Pongubala JM, Northrup DL, Lancki DW, et al. Transcription factor EBF restricts alternative lineage options and promotes B cell fate commitment independently of Pax5. Nat Immunol. 2008;9(2):203-215

50. Kirstetter P, Thomas M, Dierich A, Kastner P, Chan S. Ikaros is critical for B cell differentiation and function. Eur J Immunol. 2002;32(3):720-730

51. Sabbattini P, Lundgren M, Georgiou A, Chow C, Warnes G, Dillon N. Binding of Ikaros to the lambda5 promoter silences transcription through a mechanism that does not require heterochromatin formation. EMBO J. 2001;20(11):2812-2822

52. Ma S, Pathak S, Trinh L, Lu R. Interferon regulatory factors 4 and 8 induce the expression of Ikaros and Aiolos to down-regulate pre-B-cell receptor and promote cell-cycle withdrawal in pre-B-cell development. Blood. 2008;111(3):1396-1403

53. Thompson EC, Cobb BS, Sabbattini P, et al. Ikaros DNA-binding proteins as integral components of B cell developmental-stage-specific regulatory circuits. Immunity. 2007;26(3):335-344

54. Sun J, Matthias G, Mihatsch MJ, Georgopoulos K, Matthias P. Lack of the transcriptional coactivator OBF-1 prevents the development of systemic lupus erythematosus-like phenotypes in Aiolos mutant mice. J Immunol. 2003;170(4):1699-1706

55. Wang JH, Avitahl N, Cariappa A, et al. Aiolos regulates B cell activation and maturation to effector state. Immunity. 1998;9(4):543-553

56. Lu R. Interferon regulatory factor 4 and 8 in B-cell development. Trends Immunol. 2008;29(10):487-492

57. Lu R, Medina KL, Lancki DW, Singh H. IRF-4,8 orchestrate the pre-B-to-B transition in lymphocyte development. Genes Dev. 2003;17(14):1703-1708

58. Johnson K, Hashimshony T, Sawai CM, et al. Regulation of immunoglobulin light-chain recombination by the transcription factor IRF-4 and the attenuation of interleukin-7 signaling. Immunity. 2008;28(3):335-345

59. Sciammas R, Shaffer AL, Schatz JH, Zhao H, Staudt LM, Singh H. Graded expression of interferon regulatory factor-4 coordinates isotype switching with plasma cell differentiation. Immunity. 2006;25(2):225-236

60. Egawa T, Kawabata K, Kawamoto H, et al. The earliest stages of B cell development require a chemokine stromal cell-derived factor/pre-B cell growth-stimulating factor. Immunity. 2001;15(2):323-334

61. Bosco N, Ceredig R, Rolink A. Transient decrease in interleukin-7 availability arrests B lymphopoiesis during pregnancy. Eur J Immunol. 2008;38(2):381-390

172

62. Sudo T, Ito M, Ogawa Y, et al. Interleukin 7 production and function in stromal cell- dependent B cell development. J Exp Med. 1989;170(1):333-338

63. Tsuboi I, Morimoto K, Hirabayashi Y, et al. Senescent B lymphopoiesis is balanced in suppressive homeostasis: decrease in interleukin-7 and transforming growth factor-beta levels in stromal cells of senescence-accelerated mice. Exp Biol Med (Maywood). 2004;229(6):494-502

64. Labrie JE, 3rd, Borghesi L, Gerstein RM. Bone marrow microenvironmental changes in aged mice compromise V(D)J recombinase activity and B cell generation. Semin Immunol. 2005;17(5):347-355

65. Tokoyoda K, Egawa T, Sugiyama T, Choi BI, Nagasawa T. Cellular niches controlling B lymphocyte behavior within bone marrow during development. Immunity. 2004;20(6):707-718

66. Milne CD, Zhang Y, Paige CJ. Stromal cells attract B-cell progenitors to promote B- cell-B-cell contact and maturation. Scand J Immunol. 2005;62 Suppl 1:67-72

67. Hargreaves DC, Hyman PL, Lu TT, et al. A coordinated change in chemokine responsiveness guides plasma cell movements. J Exp Med. 2001;194(1):45-56

68. Dorshkind K. In vitro differentiation of B lymphocytes from primitive hemopoietic precursors present in long-term bone marrow cultures. J Immunol. 1986;136(2):422-429

69. Whitlock CA, Witte ON. Long-term culture of B lymphocytes and their precursors from murine bone marrow. Proc Natl Acad Sci U S A. 1982;79(11):3608-3612

70. Whitlock CA, Witte ON. Long-term culture of murine bone marrow precursors of B lymphocytes. Methods Enzymol. 1987;150:275-286

71. Borghesi LA, Smithson G, Kincade PW. Stromal cell modulation of negative regulatory signals that influence apoptosis and proliferation of B lineage lymphocytes. J Immunol. 1997;159(9):4171-4179

72. Collins LS, Dorshkind K. A stromal cell line from myeloid long-term bone marrow cultures can support myelopoiesis and B lymphopoiesis. J Immunol. 1987;138(4):1082-1087

73. Kierney PC, Dorshkind K. B lymphocyte precursors and myeloid progenitors survive in diffusion chamber cultures but B cell differentiation requires close association with stromal cells. Blood. 1987;70(5):1418-1424

74. Namen AE, Lupton S, Hjerrild K, et al. Stimulation of B-cell progenitors by cloned murine interleukin-7. Nature. 1988;333(6173):571-573

75. Namen AE, Schmierer AE, March CJ, et al. B cell precursor growth-promoting activity. Purification and characterization of a growth factor active on lymphocyte precursors. J Exp Med. 1988;167(3):988-1002

173

76. Oritani K, Kincade PW. Identification of stromal cell products that interact with pre- B cells. J Cell Biol. 1996;134(3):771-782

77. Billips LG, Petitte D, Dorshkind K, Narayanan R, Chiu CP, Landreth KS. Differential roles of stromal cells, interleukin-7, and kit-ligand in the regulation of B lymphopoiesis. Blood. 1992;79(5):1185-1192

78. Cho SK, Webber TD, Carlyle JR, Nakano T, Lewis SM, Zuniga-Pflucker JC. Functional characterization of B lymphocytes generated in vitro from embryonic stem cells. Proc Natl Acad Sci U S A. 1999;96(17):9797-9802

79. Veiby OP, Lyman SD, Jacobsen SE. Combined signaling through interleukin-7 receptors and flt3 but not c-kit potently and selectively promotes B-cell commitment and differentiation from uncommitted murine bone marrow progenitor cells. Blood. 1996;88(4):1256-1265

80. Besmer P, Manova K, Duttlinger R, et al. The kit-ligand (steel factor) and its receptor c-kit/W: pleiotropic roles in gametogenesis and melanogenesis. Dev Suppl. 1993:125-137

81. Geissler EN, McFarland EC, Russell ES. Analysis of pleiotropism at the dominant white-spotting (W) locus of the house mouse: a description of ten new W alleles. Genetics. 1981;97(2):337-361

82. Tan JC, Nocka K, Ray P, Traktman P, Besmer P. The dominant W42 spotting phenotype results from a missense mutation in the c-kit receptor kinase. Science. 1990;247(4939):209-212

83. Waskow C, Paul S, Haller C, Gassmann M, Rodewald HR. Viable c-Kit(W/W) mutants reveal pivotal role for c-kit in the maintenance of lymphopoiesis. Immunity. 2002;17(3):277-288

84. Funk PE, Varas A, Witte PL. Activity of stem cell factor and IL-7 in combination on normal bone marrow B lineage cells. J Immunol. 1993;150(3):748-752

85. Mackarehtschian K, Hardin JD, Moore KA, Boast S, Goff SP, Lemischka IR. Targeted disruption of the flk2/flt3 gene leads to deficiencies in primitive hematopoietic progenitors. Immunity. 1995;3(1):147-161

86. Ahsberg J, Tsapogas P, Qian H, et al. Interleukin-7-induced Stat-5 acts in synergy with Flt-3 signaling to stimulate expansion of hematopoietic progenitor cells. J Biol Chem;285(47):36275-36284

87. Kee BL, Cumano A, Iscove NN, Paige CJ. Stromal cell independent growth of bipotent B cell--macrophage precursors from murine fetal liver. Int Immunol. 1994;6(3):401- 407

88. Ray RJ, Paige CJ, Furlonger C, Lyman SD, Rottapel R. Flt3 ligand supports the differentiation of early B cell progenitors in the presence of interleukin-11 and interleukin-7. Eur J Immunol. 1996;26(7):1504-1510

174

89. Ray RJ, Stoddart A, Pennycook JL, et al. Stromal cell-independent maturation of IL-7- responsive pro-B cells. J Immunol. 1998;160(12):5886-5897

90. Stoddart A, Fleming HE, Paige CJ. The role of homotypic interactions in the differentiation of B cell precursors. Eur J Immunol. 2001;31(4):1160-1172

91. Milne CD, Paige CJ. IL-7: a key regulator of B lymphopoiesis. Semin Immunol. 2006;18(1):20-30

92. Rich BE, Campos-Torres J, Tepper RI, Moreadith RW, Leder P. Cutaneous lymphoproliferation and lymphomas in interleukin 7 transgenic mice. J Exp Med. 1993;177(2):305-316

93. Peschon JJ, Morrissey PJ, Grabstein KH, et al. Early lymphocyte expansion is severely impaired in interleukin 7 receptor-deficient mice. J Exp Med. 1994;180(5):1955-1960

94. von Freeden-Jeffry U, Vieira P, Lucian LA, McNeil T, Burdach SE, Murray R. Lymphopenia in interleukin (IL)-7 gene-deleted mice identifies IL-7 as a nonredundant cytokine. J Exp Med. 1995;181(4):1519-1526

95. Vosshenrich CA, Cumano A, Muller W, Di Santo JP, Vieira P. Thymic stromal-derived lymphopoietin distinguishes fetal from adult B cell development. Nat Immunol. 2003;4(8):773- 779

96. Vosshenrich CA, Cumano A, Muller W, Di Santo JP, Vieira P. Pre-B cell receptor expression is necessary for thymic stromal lymphopoietin responsiveness in the bone marrow but not in the liver environment. Proc Natl Acad Sci U S A. 2004;101(30):11070-11075

97. Chappaz S, Flueck L, Farr AG, Rolink AG, Finke D. Increased TSLP availability restores T- and B-cell compartments in adult IL-7 deficient mice. Blood. 2007;110(12):3862- 3870

98. Jensen CT, Kharazi S, Boiers C, et al. FLT3 ligand and not TSLP is the key regulator of IL-7-independent B-1 and B-2 B lymphopoiesis. Blood. 2008;112(6):2297-2304

99. Jensen CT, Kharazi S, Boiers C, Liuba K, Jacobsen SE. TSLP-mediated fetal B lymphopoiesis? Nat Immunol. 2007;8(9):897; author reply 898

100. Puel A, Ziegler SF, Buckley RH, Leonard WJ. Defective IL7R expression in T(- )B(+)NK(+) severe combined immunodeficiency. Nat Genet. 1998;20(4):394-397

101. Parrish YK, Baez I, Milford TA, et al. IL-7 Dependence in human B lymphopoiesis increases during progression of ontogeny from cord blood to bone marrow. J Immunol. 2009;182(7):4255-4266

102. Pribyl JR, Dittel BN, LeBien TW. In vitro studies of human B lymphopoiesis. Ann N Y Acad Sci. 1995;764:9-18

175

103. Johnson SE, Shah N, Panoskaltsis-Mortari A, LeBien TW. Murine and human IL-7 activate STAT5 and induce proliferation of normal human pro-B cells. J Immunol. 2005;175(11):7325-7331

104. Giliani S, Mori L, de Saint Basile G, et al. Interleukin-7 receptor alpha (IL-7Ralpha) deficiency: cellular and molecular bases. Analysis of clinical, immunological, and molecular features in 16 novel patients. Immunol Rev. 2005;203:110-126

105. Yoshimura A, Naka T, Kubo M. SOCS proteins, cytokine signalling and immune regulation. Nat Rev Immunol. 2007;7(6):454-465

106. Jiang Q, Li WQ, Aiello FB, et al. Cell biology of IL-7, a key lymphotrophin. Cytokine Growth Factor Rev. 2005;16(4-5):513-533

107. Macchi P, Villa A, Giliani S, et al. Mutations of Jak-3 gene in patients with autosomal severe combined immune deficiency (SCID). Nature. 1995;377(6544):65-68

108. Nosaka T, van Deursen JM, Tripp RA, et al. Defective lymphoid development in mice lacking Jak3. Science. 1995;270(5237):800-802

109. Park SY, Saijo K, Takahashi T, et al. Developmental defects of lymphoid cells in Jak3 kinase-deficient mice. Immunity. 1995;3(6):771-782

110. Thomis DC, Gurniak CB, Tivol E, Sharpe AH, Berg LJ. Defects in B lymphocyte maturation and T lymphocyte activation in mice lacking Jak3. Science. 1995;270(5237):794- 797

111. Rodig SJ, Meraz MA, White JM, et al. Disruption of the Jak1 gene demonstrates obligatory and nonredundant roles of the Jaks in cytokine-induced biologic responses. Cell. 1998;93(3):373-383

112. Paukku K, Silvennoinen O. STATs as critical mediators of signal transduction and transcription: lessons learned from STAT5. Cytokine Growth Factor Rev. 2004;15(6):435-455

113. Chou WC, Levy DE, Lee CK. STAT3 positively regulates an early step in B-cell development. Blood. 2006;108(9):3005-3011

114. van der Plas DC, Smiers F, Pouwels K, Hoefsloot LH, Lowenberg B, Touw IP. Interleukin-7 signaling in human B cell precursor acute lymphoblastic leukemia cells and murine BAF3 cells involves activation of STAT1 and STAT5 mediated via the interleukin-7 receptor alpha chain. Leukemia. 1996;10(8):1317-1325

115. Heltemes-Harris LM, Willette MJ, Vang KB, Farrar MA. The role of STAT5 in the development, function, and transformation of B and T lymphocytes. Ann N Y Acad Sci;1217:18-31

116. Mandal M, Powers SE, Ochiai K, et al. Ras orchestrates exit from the cell cycle and light-chain recombination during early B cell development. Nat Immunol. 2009;10(10):1110- 1117

176

117. Cui Y, Riedlinger G, Miyoshi K, et al. Inactivation of Stat5 in mouse mammary epithelium during pregnancy reveals distinct functions in cell proliferation, survival, and differentiation. Mol Cell Biol. 2004;24(18):8037-8047

118. Hoelbl A, Kovacic B, Kerenyi MA, et al. Clarifying the role of Stat5 in lymphoid development and Abelson-induced transformation. Blood. 2006;107(12):4898-4906

119. Yao Z, Cui Y, Watford WT, et al. Stat5a/b are essential for normal lymphoid development and differentiation. Proc Natl Acad Sci U S A. 2006;103(4):1000-1005

120. Goetz CA, Harmon IR, O'Neil JJ, Burchill MA, Farrar MA. STAT5 activation underlies IL7 receptor-dependent B cell development. J Immunol. 2004;172(8):4770-4778

121. Malin S, McManus S, Cobaleda C, et al. Role of STAT5 in controlling cell survival and immunoglobulin gene recombination during pro-B cell development. Nat Immunol;11(2):171- 179

122. Isaksen DE, Baumann H, Zhou B, et al. Uncoupling of proliferation and Stat5 activation in thymic stromal lymphopoietin-mediated signal transduction. J Immunol. 2002;168(7):3288-3294

123. Seckinger P, Fougereau M. Activation of src family kinases in human pre-B cells by IL- 7. J Immunol. 1994;153(1):97-109

124. Ingley E, Klinken SP. Cross-regulation of JAK and Src kinases. Growth Factors. 2006;24(1):89-95

125. Venkitaraman AR, Cowling RJ. Interleukin-7 induces the association of phosphatidylinositol 3-kinase with the alpha chain of the interleukin-7 receptor. Eur J Immunol. 1994;24(9):2168-2174

126. Corcoran AE, Smart FM, Cowling RJ, Crompton T, Owen MJ, Venkitaraman AR. The interleukin-7 receptor alpha chain transmits distinct signals for proliferation and differentiation during B lymphopoiesis. EMBO J. 1996;15(8):1924-1932

127. Fleming HE, Paige CJ. Pre-B cell receptor signaling mediates selective response to IL-7 at the pro-B to pre-B cell transition via an ERK/MAP kinase-dependent pathway. Immunity. 2001;15(4):521-531

128. Suzuki H, Terauchi Y, Fujiwara M, et al. Xid-like immunodeficiency in mice with disruption of the p85alpha subunit of phosphoinositide 3-kinase. Science. 1999;283(5400):390- 392

129. Ramadani F, Bolland DJ, Garcon F, et al. The PI3K isoforms p110alpha and p110delta are essential for pre-B cell receptor signaling and B cell development. Sci Signal;3(134):ra60

130. Baracho GV, Miletic AV, Omori SA, Cato MH, Rickert RC. Emergence of the PI3- kinase pathway as a central modulator of normal and aberrant B cell differentiation. Curr Opin Immunol;23(2):178-183

177

131. Yasuda T, Sanjo H, Pages G, et al. Erk kinases link pre-B cell receptor signaling to transcriptional events required for early B cell expansion. Immunity. 2008;28(4):499-508

132. Trampont P, Zhang L, Ravichandran KS. ShcA mediates the dominant pathway to extracellular signal-regulated kinase activation during early thymic development. Mol Cell Biol. 2006;26(23):9035-9044

133. Zhang L, Camerini V, Bender TP, Ravichandran KS. A nonredundant role for the adapter protein Shc in thymic T cell development. Nat Immunol. 2002;3(8):749-755

134. Giles AJ, Bender TP, Ravichandran KS. The adaptor protein Shc plays a key role during early B cell development. J Immunol. 2009;183(9):5468-5476

135. Kondo M, Akashi K, Domen J, Sugamura K, Weissman IL. Bcl-2 rescues T lymphopoiesis, but not B or NK cell development, in common gamma chain-deficient mice. Immunity. 1997;7(1):155-162

136. Maraskovsky E, Peschon JJ, McKenna H, Teepe M, Strasser A. Overexpression of Bcl- 2 does not rescue impaired B lymphopoiesis in IL-7 receptor-deficient mice but can enhance survival of mature B cells. Int Immunol. 1998;10(9):1367-1375

137. Dias S, Silva H, Jr., Cumano A, Vieira P. Interleukin-7 is necessary to maintain the B cell potential in common lymphoid progenitors. J Exp Med. 2005;201(6):971-979

138. Kikuchi K, Lai AY, Hsu CL, Kondo M. IL-7 receptor signaling is necessary for stage transition in adult B cell development through up-regulation of EBF. J Exp Med. 2005;201(8):1197-1203

139. Goetz CA, Harmon IR, O'Neil JJ, Burchill MA, Johanns TM, Farrar MA. Restricted STAT5 activation dictates appropriate thymic B versus T cell lineage commitment. J Immunol. 2005;174(12):7753-7763

140. Hirokawa S, Sato H, Kato I, Kudo A. EBF-regulating Pax5 transcription is enhanced by STAT5 in the early stage of B cells. Eur J Immunol. 2003;33(7):1824-1829

141. Roessler S, Gyory I, Imhof S, et al. Distinct promoters mediate the regulation of Ebf1 gene expression by interleukin-7 and Pax5. Mol Cell Biol. 2007;27(2):579-594

142. Nutt SL, Heavey B, Rolink AG, Busslinger M. Commitment to the B-lymphoid lineage depends on the transcription factor Pax5. Nature. 1999;401(6753):556-562

143. Kosan C, Saba I, Godmann M, et al. Transcription factor miz-1 is required to regulate interleukin-7 receptor signaling at early commitment stages of B cell differentiation. Immunity;33(6):917-928

144. Lu L, Chaudhury P, Osmond DG. Regulation of cell survival during B lymphopoiesis: apoptosis and Bcl-2/Bax content of precursor B cells in bone marrow of mice with altered expression of IL-7 and recombinase-activating gene-2. J Immunol. 1999;162(4):1931-1940

178

145. Wen R, Wang D, McKay C, et al. Jak3 selectively regulates Bax and Bcl-2 expression to promote T-cell development. Mol Cell Biol. 2001;21(2):678-689

146. Opferman JT, Letai A, Beard C, Sorcinelli MD, Ong CC, Korsmeyer SJ. Development and maintenance of B and T lymphocytes requires antiapoptotic MCL-1. Nature. 2003;426(6967):671-676

147. Downward J. PI 3-kinase, Akt and cell survival. Semin Cell Dev Biol. 2004;15(2):177-182

148. Huntington ND, Labi V, Cumano A, et al. Loss of the pro-apoptotic BH3-only Bcl-2 family member Bim sustains B lymphopoiesis in the absence of IL-7. Int Immunol. 2009;21(6):715-725

149. Oliver PM, Wang M, Zhu Y, White J, Kappler J, Marrack P. Loss of Bim allows precursor B cell survival but not precursor B cell differentiation in the absence of interleukin 7. J Exp Med. 2004;200(9):1179-1187

150. Li WQ, Jiang Q, Aleem E, Kaldis P, Khaled AR, Durum SK. IL-7 promotes T cell proliferation through destabilization of p27Kip1. J Exp Med. 2006;203(3):573-582

151. Kops GJ, Medema RH, Glassford J, et al. Control of cell cycle exit and entry by protein kinase B-regulated forkhead transcription factors. Mol Cell Biol. 2002;22(7):2025-2036

152. Liang J, Zubovitz J, Petrocelli T, et al. PKB/Akt phosphorylates p27, impairs nuclear import of p27 and opposes p27-mediated G1 arrest. Nat Med. 2002;8(10):1153-1160

153. Morrow MA, Lee G, Gillis S, Yancopoulos GD, Alt FW. Interleukin-7 induces N-myc and c-myc expression in normal precursor B lymphocytes. Genes Dev. 1992;6(1):61-70

154. Seet CS, Brumbaugh RL, Kee BL. Early B cell factor promotes B lymphopoiesis with reduced interleukin 7 responsiveness in the absence of E2A. J Exp Med. 2004;199(12):1689- 1700

155. Dillon SR, Schlissel MS. Partial restoration of B cell development in Jak-3(-/-) mice achieved by co-expression of IgH and E(mu)-myc transgenes. Int Immunol. 2002;14(8):893-904

156. Habib T, Park H, Tsang M, et al. Myc stimulates B lymphocyte differentiation and amplifies calcium signaling. J Cell Biol. 2007;179(4):717-731

157. Vallespinos M, Fernandez D, Rodriguez L, et al. B Lymphocyte commitment program is driven by the proto-oncogene c-Myc. J Immunol;186(12):6726-6736

158. Grawunder U, Haasner D, Melchers F, Rolink A. Rearrangement and expression of kappa light chain genes can occur without mu heavy chain expression during differentiation of pre-B cells. Int Immunol. 1993;5(12):1609-1618

159. Kato I, Miyazaki T, Nakamura T, Kudo A. Inducible differentiation and apoptosis of the pre-B cell receptor-positive pre-B cell line. Int Immunol. 2000;12(3):325-334

179

160. Melamed D, Kench JA, Grabstein K, Rolink A, Nemazee D. A functional B cell receptor transgene allows efficient IL-7-independent maturation of B cell precursors. J Immunol. 1997;159(3):1233-1239

161. Rolink A, Grawunder U, Haasner D, Strasser A, Melchers F. Immature surface Ig+ B cells can continue to rearrange kappa and lambda L chain gene loci. J Exp Med. 1993;178(4):1263-1270

162. Milne CD, Fleming HE, Paige CJ. IL-7 does not prevent pro-B/pre-B cell maturation to the immature/sIgM(+) stage. Eur J Immunol. 2004;34(10):2647-2655

163. Bertolino E, Reddy K, Medina KL, Parganas E, Ihle J, Singh H. Regulation of interleukin 7-dependent immunoglobulin heavy-chain variable gene rearrangements by transcription factor STAT5. Nat Immunol. 2005;6(8):836-843

164. Chowdhury D, Sen R. Stepwise activation of the immunoglobulin mu heavy chain gene locus. EMBO J. 2001;20(22):6394-6403

165. Hewitt SL, Yin B, Ji Y, et al. RAG-1 and ATM coordinate monoallelic recombination and nuclear positioning of immunoglobulin loci. Nat Immunol. 2009;10(6):655-664

166. Herzog S, Hug E, Meixlsperger S, et al. SLP-65 regulates immunoglobulin light chain gene recombination through the PI(3)K-PKB-Foxo pathway. Nat Immunol. 2008;9(6):623-631

167. Hinman RM, Nichols WA, Diaz TM, Gallardo TD, Castrillon DH, Satterthwaite AB. Foxo3-/- mice demonstrate reduced numbers of pre-B and recirculating B cells but normal splenic B cell sub-population distribution. Int Immunol. 2009;21(7):831-842

168. Inlay M, Alt FW, Baltimore D, Xu Y. Essential roles of the kappa light chain intronic enhancer and 3' enhancer in kappa rearrangement and demethylation. Nat Immunol. 2002;3(5):463-468

169. Ma S, Turetsky A, Trinh L, Lu R. IFN regulatory factor 4 and 8 promote Ig light chain kappa locus activation in pre-B cell development. J Immunol. 2006;177(11):7898-7904

170. Kuo TC, Schlissel MS. Mechanisms controlling expression of the RAG locus during lymphocyte development. Curr Opin Immunol. 2009;21(2):173-178

171. Amin RH, Schlissel MS. Foxo1 directly regulates the transcription of recombination- activating genes during B cell development. Nat Immunol. 2008;9(6):613-622

172. Dengler HS, Baracho GV, Omori SA, et al. Distinct functions for the transcription factor Foxo1 at various stages of B cell differentiation. Nat Immunol. 2008;9(12):1388-1398

173. Lazorchak AS, Liu D, Facchinetti V, et al. Sin1-mTORC2 suppresses rag and il7r gene expression through Akt2 in B cells. Mol Cell;39(3):433-443

180

174. Novak R, Jacob E, Haimovich J, Avni O, Melamed D. The MAPK/ERK and PI3K pathways additively coordinate the transcription of recombination-activating genes in B lineage cells. J Immunol;185(6):3239-3247

175. Jiang H, Chang FC, Ross AE, Lee J, Nakayama K, Desiderio S. Ubiquitylation of RAG-2 by Skp2-SCF links destruction of the V(D)J recombinase to the cell cycle. Mol Cell. 2005;18(6):699-709

176. Li Z, Dordai DI, Lee J, Desiderio S. A conserved degradation signal regulates RAG-2 accumulation during cell division and links V(D)J recombination to the cell cycle. Immunity. 1996;5(6):575-589

177. Bosma GC, Custer RP, Bosma MJ. A severe combined immunodeficiency mutation in the mouse. Nature. 1983;301(5900):527-530

178. Chen J, Lansford R, Stewart V, Young F, Alt FW. RAG-2-deficient blastocyst complementation: an assay of gene function in lymphocyte development. Proc Natl Acad Sci U S A. 1993;90(10):4528-4532

179. Kitamura D, Rajewsky K. Targeted disruption of mu chain membrane exon causes loss of heavy-chain allelic exclusion. Nature. 1992;356(6365):154-156

180. Mombaerts P, Iacomini J, Johnson RS, Herrup K, Tonegawa S, Papaioannou VE. RAG- 1-deficient mice have no mature B and T lymphocytes. Cell. 1992;68(5):869-877

181. Martensson IL, Rolink A, Melchers F, Mundt C, Licence S, Shimizu T. The pre-B cell receptor and its role in proliferation and Ig heavy chain allelic exclusion. Semin Immunol. 2002;14(5):335-342

182. Karasuyama H, Rolink A, Shinkai Y, Young F, Alt FW, Melchers F. The expression of Vpre-B/lambda 5 surrogate light chain in early bone marrow precursor B cells of normal and B cell-deficient mutant mice. Cell. 1994;77(1):133-143

183. Martensson IL, Keenan RA, Licence S. The pre-B-cell receptor. Curr Opin Immunol. 2007;19(2):137-142

184. Karasuyama H, Rolink A, Melchers F. A complex of glycoproteins is associated with VpreB/lambda 5 surrogate light chain on the surface of mu heavy chain-negative early precursor B cell lines. J Exp Med. 1993;178(2):469-478

185. Ohnishi K, Melchers F, Shimizu T. Lymphocyte-expressed BILL-cadherin/cadherin-17 contributes to the development of B cells at two stages. Eur J Immunol. 2005;35(3):957-963

186. Gong S, Nussenzweig MC. Regulation of an early developmental checkpoint in the B cell pathway by Ig beta. Science. 1996;272(5260):411-414

187. Torres RM, Flaswinkel H, Reth M, Rajewsky K. Aberrant B cell development and immune response in mice with a compromised BCR complex. Science. 1996;272(5269):1804- 1808

181

188. Shaffer AL, Schlissel MS. A truncated heavy chain protein relieves the requirement for surrogate light chains in early B cell development. J Immunol. 1997;159(3):1265-1275

189. Caldwell RG, Brown RC, Longnecker R. Epstein-Barr virus LMP2A-induced B-cell survival in two unique classes of EmuLMP2A transgenic mice. J Virol. 2000;74(3):1101-1113

190. Teh YM, Neuberger MS. The immunoglobulin (Ig)alpha and Igbeta cytoplasmic domains are independently sufficient to signal B cell maturation and activation in transgenic mice. J Exp Med. 1997;185(10):1753-1758

191. Pierce SK. Lipid rafts and B-cell activation. Nat Rev Immunol. 2002;2(2):96-105

192. Guo B, Kato RM, Garcia-Lloret M, Wahl MI, Rawlings DJ. Engagement of the human pre-B cell receptor generates a lipid raft-dependent calcium signaling complex. Immunity. 2000;13(2):243-253

193. Fuentes-Panana EM, Bannish G, van der Voort D, King LB, Monroe JG. Ig alpha/Ig beta complexes generate signals for B cell development independent of selective plasma membrane compartmentalization. J Immunol. 2005;174(3):1245-1252

194. Bradl H, Wittmann J, Milius D, Vettermann C, Jack HM. Interaction of murine precursor B cell receptor with stroma cells is controlled by the unique tail of lambda 5 and stroma cell-associated heparan sulfate. J Immunol. 2003;171(5):2338-2348

195. Gauthier L, Rossi B, Roux F, Termine E, Schiff C. Galectin-1 is a stromal cell ligand of the pre-B cell receptor (BCR) implicated in synapse formation between pre-B and stromal cells and in pre-BCR triggering. Proc Natl Acad Sci U S A. 2002;99(20):13014-13019

196. Ohnishi K, Melchers F. The nonimmunoglobulin portion of lambda5 mediates cell- autonomous pre-B cell receptor signaling. Nat Immunol. 2003;4(9):849-856

197. Monroe JG. ITAM-mediated tonic signalling through pre-BCR and BCR complexes. Nat Rev Immunol. 2006;6(4):283-294

198. Gauld SB, Cambier JC. Src-family kinases in B-cell development and signaling. Oncogene. 2004;23(48):8001-8006

199. Saijo K, Schmedt C, Su IH, et al. Essential role of Src-family protein tyrosine kinases in NF-kappaB activation during B cell development. Nat Immunol. 2003;4(3):274-279

200. Rolli V, Gallwitz M, Wossning T, et al. Amplification of B cell antigen receptor signaling by a Syk/ITAM positive feedback loop. Mol Cell. 2002;10(5):1057-1069

201. Schweighoffer E, Vanes L, Mathiot A, Nakamura T, Tybulewicz VL. Unexpected requirement for ZAP-70 in pre-B cell development and allelic exclusion. Immunity. 2003;18(4):523-533

202. Ellmeier W, Jung S, Sunshine MJ, et al. Severe B cell deficiency in mice lacking the tec kinase family members Tec and Btk. J Exp Med. 2000;192(11):1611-1624

182

203. Su YW, Jumaa H. LAT links the pre-BCR to calcium signaling. Immunity. 2003;19(2):295-305

204. Wen R, Chen Y, Schuman J, et al. An important role of phospholipase Cgamma1 in pre-B-cell development and allelic exclusion. EMBO J. 2004;23(20):4007-4017

205. Gold MR, Chan VW, Turck CW, DeFranco AL. Membrane Ig cross-linking regulates phosphatidylinositol 3-kinase in B lymphocytes. J Immunol. 1992;148(7):2012-2022

206. Scharenberg AM, El-Hillal O, Fruman DA, et al. Phosphatidylinositol-3,4,5- trisphosphate (PtdIns-3,4,5-P3)/Tec kinase-dependent calcium signaling pathway: a target for SHIP-mediated inhibitory signals. EMBO J. 1998;17(7):1961-1972

207. Donahue AC, Fruman DA. PI3K signaling controls cell fate at many points in B lymphocyte development and activation. Semin Cell Dev Biol. 2004;15(2):183-197

208. Marshall AJ, Niiro H, Yun TJ, Clark EA. Regulation of B-cell activation and differentiation by the phosphatidylinositol 3-kinase and phospholipase Cgamma pathway. Immunol Rev. 2000;176:30-46

209. Kulathu Y, Hobeika E, Turchinovich G, Reth M. The kinase Syk as an adaptor controlling sustained calcium signalling and B-cell development. EMBO J. 2008;27(9):1333- 1344

210. Lu L, Osmond DG. Apoptosis and its modulation during B lymphopoiesis in mouse bone marrow. Immunol Rev. 2000;175:158-174

211. Janani R, Harris AW, Strasser A, Dhanoa S, Plyam R, Osmond DG. Effect of a bcl-2 transgene on production and localization of precursor B cells in mouse bone marrow. Exp Hematol. 1998;26(10):982-990

212. Erlandsson L, Licence S, Gaspal F, Lane P, Corcoran AE, Martensson IL. Both the pre- BCR and the IL-7Ralpha are essential for expansion at the pre-BII cell stage in vivo. Eur J Immunol. 2005;35(6):1969-1976

213. Flemming A, Brummer T, Reth M, Jumaa H. The adaptor protein SLP-65 acts as a tumor suppressor that limits pre-B cell expansion. Nat Immunol. 2003;4(1):38-43

214. Middendorp S, Dingjan GM, Hendriks RW. Impaired precursor B cell differentiation in Bruton's tyrosine kinase-deficient mice. J Immunol. 2002;168(6):2695-2703

215. van Loo PF, Dingjan GM, Maas A, Hendriks RW. Surrogate-light-chain silencing is not critical for the limitation of pre-B cell expansion but is for the termination of constitutive signaling. Immunity. 2007;27(3):468-480

216. Ma S, Pathak S, Mandal M, Trinh L, Clark MR, Lu R. Ikaros and Aiolos inhibit pre-B- cell proliferation by directly suppressing c-Myc expression. Mol Cell Biol;30(17):4149-4158

183

217. Pathak S, Ma S, Trinh L, et al. IRF4 is a suppressor of c-Myc induced B cell leukemia. PLoS One. 2011;6(7):e22628

218. Hayashi K, Yamamoto M, Nojima T, Goitsuka R, Kitamura D. Distinct signaling requirements for Dmu selection, IgH allelic exclusion, pre-B cell transition, and tumor suppression in B cell progenitors. Immunity. 2003;18(6):825-836

219. Galler GR, Mundt C, Parker M, Pelanda R, Martensson IL, Winkler TH. Surface mu heavy chain signals down-regulation of the V(D)J-recombinase machinery in the absence of surrogate light chain components. J Exp Med. 2004;199(11):1523-1532

220. Xu S, Wong SC, Lam KP. Cutting edge: B cell linker protein is dispensable for the allelic exclusion of immunoglobulin heavy chain locus but required for the persistence of CD5+ B cells. J Immunol. 2000;165(8):4153-4157

221. Saunders AE, Johnson P. Modulation of immune cell signalling by the leukocyte common tyrosine phosphatase, CD45. Cell Signal;22(3):339-348

222. Benatar T, Carsetti R, Furlonger C, Kamalia N, Mak T, Paige CJ. Immunoglobulin- mediated signal transduction in B cells from CD45-deficient mice. J Exp Med. 1996;183(1):329-334

223. Katagiri T, Ogimoto M, Hasegawa K, et al. CD45 negatively regulates lyn activity by dephosphorylating both positive and negative regulatory tyrosine residues in immature B cells. J Immunol. 1999;163(3):1321-1326

224. Yanagi S, Sugawara H, Kurosaki M, Sabe H, Yamamura H, Kurosaki T. CD45 modulates phosphorylation of both autophosphorylation and negative regulatory tyrosines of Lyn in B cells. J Biol Chem. 1996;271(48):30487-30492

225. Huntington ND, Tarlinton DM. CD45: direct and indirect government of immune regulation. Immunol Lett. 2004;94(3):167-174

226. Fleming HE, Milne CD, Paige CJ. CD45-deficient mice accumulate Pro-B cells both in vivo and in vitro. J Immunol. 2004;173(4):2542-2551

227. Billips LG, Nunez CA, Bertrand FE, 3rd, et al. Immunoglobulin recombinase gene activity is modulated reciprocally by interleukin 7 and CD19 in B cell progenitors. J Exp Med. 1995;182(4):973-982

228. Buhl AM, Cambier JC. Phosphorylation of CD19 Y484 and Y515, and linked activation of phosphatidylinositol 3-kinase, are required for B cell antigen receptor-mediated activation of Bruton's tyrosine kinase. J Immunol. 1999;162(8):4438-4446

229. Fujimoto M, Poe JC, Satterthwaite AB, Wahl MI, Witte ON, Tedder TF. Complementary roles for CD19 and Bruton's tyrosine kinase in B lymphocyte signal transduction. J Immunol. 2002;168(11):5465-5476

184

230. Krop I, Shaffer AL, Fearon DT, Schlissel MS. The signaling activity of murine CD19 is regulated during cell development. J Immunol. 1996;157(1):48-56

231. Otero DC, Omori SA, Rickert RC. Cd19-dependent activation of Akt kinase in B- lymphocytes. J Biol Chem. 2001;276(2):1474-1478

232. Buhl AM, Pleiman CM, Rickert RC, Cambier JC. Qualitative regulation of B cell antigen receptor signaling by CD19: selective requirement for PI3-kinase activation, inositol- 1,4,5-trisphosphate production and Ca2+ mobilization. J Exp Med. 1997;186(11):1897-1910

233. Engel P, Zhou LJ, Ord DC, Sato S, Koller B, Tedder TF. Abnormal B lymphocyte development, activation, and differentiation in mice that lack or overexpress the CD19 signal transduction molecule. Immunity. 1995;3(1):39-50

234. Rickert RC, Rajewsky K, Roes J. Impairment of T-cell-dependent B-cell responses and B-1 cell development in CD19-deficient mice. Nature. 1995;376(6538):352-355

235. Otero DC, Rickert RC. CD19 function in early and late B cell development. II. CD19 facilitates the pro-B/pre-B transition. J Immunol. 2003;171(11):5921-5930

236. Osmond DG. Population dynamics of bone marrow B lymphocytes. Immunol Rev. 1986;93:103-124

237. Osmond DG. Proliferation kinetics and the lifespan of B cells in central and peripheral lymphoid organs. Curr Opin Immunol. 1991;3(2):179-185

238. ten Boekel E, Melchers F, Rolink AG. Precursor B cells showing H chain allelic inclusion display allelic exclusion at the level of pre-B cell receptor surface expression. Immunity. 1998;8(2):199-207

239. Alt FW, Blackwell TK, Yancopoulos GD. Development of the primary antibody repertoire. Science. 1987;238(4830):1079-1087

240. Melchers F, ten Boekel E, Seidl T, et al. Repertoire selection by pre-B-cell receptors and B-cell receptors, and genetic control of B-cell development from immature to mature B cells. Immunol Rev. 2000;175:33-46

241. Wardemann H, Yurasov S, Schaefer A, Young JW, Meffre E, Nussenzweig MC. Predominant autoantibody production by early human B cell precursors. Science. 2003;301(5638):1374-1377

242. King LB, Monroe JG. Immunobiology of the immature B cell: plasticity in the B-cell antigen receptor-induced response fine tunes negative selection. Immunol Rev. 2000;176:86- 104

243. Nemazee D. Receptor editing in lymphocyte development and central tolerance. Nat Rev Immunol. 2006;6(10):728-740

185

244. Cyster JG. B cell follicles and antigen encounters of the third kind. Nat Immunol. 2010;11(11):989-996

245. McHeyzer-Williams LJ, McHeyzer-Williams MG. Antigen-specific memory B cell development. Annu Rev Immunol. 2005;23:487-513

246. Boes M. Role of natural and immune IgM antibodies in immune responses. Mol Immunol. 2000;37(18):1141-1149

247. Hardy RR, Wei CJ, Hayakawa K. Selection during development of VH11+ B cells: a model for natural autoantibody-producing CD5+ B cells. Immunol Rev. 2004;197:60-74

248. Wen L, Brill-Dashoff J, Shinton SA, Asano M, Hardy RR, Hayakawa K. Evidence of marginal-zone B cell-positive selection in spleen. Immunity. 2005;23(3):297-308

249. Pillai S, Cariappa A, Moran ST. Marginal zone B cells. Annu Rev Immunol. 2005;23:161- 196

250. Kantor AB, Herzenberg LA. Origin of murine B cell lineages. Annu Rev Immunol. 1993;11:501-538

251. Hardy RR. B-1 B cell development. J Immunol. 2006;177(5):2749-2754

252. Alugupalli KR, Leong JM, Woodland RT, Muramatsu M, Honjo T, Gerstein RM. B1b lymphocytes confer T cell-independent long-lasting immunity. Immunity. 2004;21(3):379-390

253. Haas KM, Poe JC, Steeber DA, Tedder TF. B-1a and B-1b cells exhibit distinct developmental requirements and have unique functional roles in innate and adaptive immunity to S. pneumoniae. Immunity. 2005;23(1):7-18

254. Berland R, Wortis HH. Origins and functions of B-1 cells with notes on the role of CD5. Annu Rev Immunol. 2002;20:253-300

255. Rothstein TL, Kolber DL, Murphy TP, Cohen DP. Induction of phorbol ester responsiveness in conventional B cells after activation via surface Ig. J Immunol. 1991;147(11):3728-3735

256. Dorshkind K, Montecino-Rodriguez E. Fetal B-cell lymphopoiesis and the emergence of B-1-cell potential. Nat Rev Immunol. 2007;7(3):213-219

257. Kantor AB, Stall AM, Adams S, Herzenberg LA. Differential development of progenitor activity for three B-cell lineages. Proc Natl Acad Sci U S A. 1992;89(8):3320-3324

258. Montecino-Rodriguez E, Dorshkind K. Identification of B/macrophage progenitors in adult bone marrow. Semin Immunol. 2002;14(6):371-376

259. Li YS, Hayakawa K, Hardy RR. The regulated expression of B lineage associated genes during B cell differentiation in bone marrow and fetal liver. J Exp Med. 1993;178(3):951-960

186

260. Feeney AJ. Predominance of VH-D-JH junctions occurring at sites of short sequence homology results in limited junctional diversity in neonatal antibodies. J Immunol. 1992;149(1):222-229

261. Benedict CL, Kearney JF. Increased junctional diversity in fetal B cells results in a loss of protective anti-phosphorylcholine antibodies in adult mice. Immunity. 1999;10(5):607-617

262. Mackay F, Figgett WA, Saulep D, Lepage M, Hibbs ML. B-cell stage and context- dependent requirements for survival signals from BAFF and the B-cell receptor. Immunol Rev. 2010;237(1):205-225

263. Milne CD, Corfe SA, Paige CJ. Heparan sulfate and heparin enhance ERK phosphorylation and mediate preBCR-dependent events during B lymphopoiesis. J Immunol. 2008;180(5):2839-2847

264. Rickert RC, Roes J, Rajewsky K. B lymphocyte-specific, Cre-mediated mutagenesis in mice. Nucleic Acids Res. 1997;25(6):1317-1318

265. De Sepulveda P, Okkenhaug K, Rose JL, Hawley RG, Dubreuil P, Rottapel R. Socs1 binds to multiple signalling proteins and suppresses steel factor-dependent proliferation. EMBO J. 1999;18(4):904-915

266. Trop S, De Sepulveda P, Zuniga-Pflucker JC, Rottapel R. Overexpression of suppressor of cytokine signaling-1 impairs pre-T-cell receptor-induced proliferation but not differentiation of immature thymocytes. Blood. 2001;97(8):2269-2277

267. Xu W, Kee BL. Growth factor independent 1B (Gfi1b) is an E2A target gene that modulates Gata3 in T-cell lymphomas. Blood. 2007;109(10):4406-4414

268. Danial NN, Pernis A, Rothman PB. Jak-STAT signaling induced by the v-abl oncogene. Science. 1995;269(5232):1875-1877

269. Rosenberg N, Baltimore D, Scher CD. In vitro transformation of lymphoid cells by Abelson murine leukemia virus. Proc Natl Acad Sci U S A. 1975;72(5):1932-1936

270. Ishihara K, Medina K, Hayashi S, et al. Stromal-cell and cytokine-dependent lymphocyte clones which span the pre-B- to B-cell transition. Dev Immunol. 1991;1(3):149- 161

271. Martinez MJ, Minguet S, Gonzalo P, et al. Long-lived polyclonal B-cell lines derived from midgestation mouse embryo lymphohematopoietic progenitors reconstitute adult immunodeficient mice. Blood. 2001;98(6):1862-1871

272. Mire-Sluis AR, Healey L, Griffiths S, Hockley D, Thorpe R. Development of a continuous IL-7-dependent murine pre-B cell line PB-1 suitable for the biological characterisation and assay of human IL-7. J Immunol Methods. 2000;236(1-2):71-76

187

273. Miyamoto A, Kunisada T, Yamazaki H, et al. Establishment and characterization of pro-B cell lines from motheaten mutant mouse defective in SHP-1 protein tyrosine phosphatase. Immunol Lett. 1998;63(2):75-82

274. Park LS, Friend DJ, Schmierer AE, Dower SK, Namen AE. Murine interleukin 7 (IL-7) receptor. Characterization on an IL-7-dependent cell line. J Exp Med. 1990;171(4):1073-1089

275. Schweitzer BL, DeKoter RP. Analysis of gene expression and Ig transcription in PU.1/Spi-B-deficient progenitor B cell lines. J Immunol. 2004;172(1):144-154

276. Song H, Zhang J, Chiang YJ, Siraganian RP, Hodes RJ. Redundancy in B cell developmental pathways: c-Cbl inactivation rescues early B cell development through a B cell linker protein-independent pathway. J Immunol. 2007;178(2):926-935

277. Corfe SA, Rottapel R, Paige CJ. Modulation of IL-7 thresholds by SOCS proteins in developing B lineage cells. J Immunol; 2011;187(7):3499-3510

278. Purohit SJ, Stephan RP, Kim HG, Herrin BR, Gartland L, Klug CA. Determination of lymphoid cell fate is dependent on the expression status of the IL-7 receptor. EMBO J. 2003;22(20):5511-5521

279. Croker BA, Kiu H, Nicholson SE. SOCS regulation of the JAK/STAT signalling pathway. Semin Cell Dev Biol. 2008;19(4):414-422

280. Roberts AW, Robb L, Rakar S, et al. Placental defects and embryonic lethality in mice lacking suppressor of cytokine signaling 3. Proc Natl Acad Sci U S A. 2001;98(16):9324-9329

281. Starr R, Metcalf D, Elefanty AG, et al. Liver degeneration and lymphoid deficiencies in mice lacking suppressor of cytokine signaling-1. Proc Natl Acad Sci U S A. 1998;95(24):14395- 14399

282. Bourdeau A, Dube N, Heinonen KM, Theberge JF, Doody KM, Tremblay ML. TC- PTP-deficient bone marrow stromal cells fail to support normal B lymphopoiesis due to abnormal secretion of interferon-{gamma}. Blood. 2007;109(10):4220-4228

283. Garvy BA, Riley RL. IFN-gamma abrogates IL-7-dependent proliferation in pre-B cells, coinciding with onset of apoptosis. Immunology. 1994;81(3):381-388

284. Grawunder U, Melchers F, Rolink A. Interferon-gamma arrests proliferation and causes apoptosis in stromal cell/interleukin-7-dependent normal murine pre-B cell lines and clones in vitro, but does not induce differentiation to surface immunoglobulin-positive B cells. Eur J Immunol. 1993;23(2):544-551

285. Nakajima S, Hida S, Taki S. IL-15 inhibits pre-B cell proliferation by selectively expanding Mac-1+B220+ NK cells. Biochem Biophys Res Commun. 2008;369(4):1139-1143

286. Alexander WS, Starr R, Fenner JE, et al. SOCS1 is a critical inhibitor of interferon gamma signaling and prevents the potentially fatal neonatal actions of this cytokine. Cell. 1999;98(5):597-608

188

287. Marine JC, Topham DJ, McKay C, et al. SOCS1 deficiency causes a lymphocyte- dependent perinatal lethality. Cell. 1999;98(5):609-616

288. Rottapel R, Ilangumaran S, Neale C, et al. The tumor suppressor activity of SOCS-1. Oncogene. 2002;21(28):4351-4362

289. Corfe SA, Gray AP, Paige CJ. Generation and characterization of stromal cell independent IL-7 dependent B cell lines. J Immunol Methods. 2007;325(1-2):9-19

290. Simard N, Konforte D, Tran AH, Esufali J, Leonard WJ, Paige CJ. Analysis of the role of IL-21 in development of murine B cell progenitors in the bone marrow. J Immunol;186(9):5244-5253

291. Jegalian AG, Wu H. Regulation of Socs gene expression by the proto-oncoprotein GFI-1B: two routes for STAT5 target gene induction by erythropoietin. J Biol Chem. 2002;277(3):2345-2352

292. Garzon R, Soriano SF, Rodriguez-Frade JM, et al. CXCR4-mediated suppressor of cytokine signaling up-regulation inactivates growth hormone function. J Biol Chem. 2004;279(43):44460-44466

293. Soriano SF, Hernanz-Falcon P, Rodriguez-Frade JM, et al. Functional inactivation of CXC chemokine receptor 4-mediated responses through SOCS3 up-regulation. J Exp Med. 2002;196(3):311-321

294. Cumano A, Dorshkind K, Gillis S, Paige CJ. The influence of S17 stromal cells and interleukin 7 on B cell development. Eur J Immunol. 1990;20(10):2183-2189

295. Yamashita Y, Oritani K, Miyoshi EK, Wall R, Bernfield M, Kincade PW. Syndecan-4 is expressed by B lineage lymphocytes and can transmit a signal for formation of dendritic processes. J Immunol. 1999;162(10):5940-5948

296. Kim CW, Goldberger OA, Gallo RL, Bernfield M. Members of the syndecan family of heparan sulfate proteoglycans are expressed in distinct cell-, tissue-, and development- specific patterns. Mol Biol Cell. 1994;5(7):797-805

297. Couchman JR, Chen L, Woods A. Syndecans and cell adhesion. Int Rev Cytol. 2001;207:113-150

298. David G, Bai XM, Van der Schueren B, Cassiman JJ, Van den Berghe H. Developmental changes in heparan sulfate expression: in situ detection with mAbs. J Cell Biol. 1992;119(4):961-975

299. Hovingh P, Linker A. The enzymatic degradation of heparin and heparitin sulfate. 3. Purification of a heparitinase and a heparinase from flavobacteria. J Biol Chem. 1970;245(22):6170-6175

189

300. Silva M, Dietrich CP, Nader HB. On the structure of heparitin sulfates. Analyses of the products formed from heparitin sulfates by two heparitinases and a heparinase from Flavobacterium heparinum. Biochim Biophys Acta. 1976;437(1):129-141

301. Borghesi LA, Yamashita Y, Kincade PW. Heparan sulfate proteoglycans mediate interleukin-7-dependent B lymphopoiesis. Blood. 1999;93(1):140-148

302. Chen J, Herzenberg LA. Heparin alters the expression of different forms of immunoglobulin mu heavy chains and their associated proteins by pre-B cell lines and normal Ly-1 (CD5+) B cells. Int Immunol. 1991;3(11):1117-1127

303. Vettermann C, Herrmann K, Albert C, Roth E, Bosl MR, Jack HM. A unique role for the lambda5 nonimmunoglobulin tail in early B lymphocyte development. J Immunol. 2008;181(5):3232-3242

304. de Fougerolles AR, Batista F, Johnsson E, Fearon DT. IgM and stromal cell-associated heparan sulfate/heparin as complement-independent ligands for CD19. Eur J Immunol. 2001;31(7):2189-2199

305. Otero DC, Anzelon AN, Rickert RC. CD19 function in early and late B cell development: I. Maintenance of follicular and marginal zone B cells requires CD19-dependent survival signals. J Immunol. 2003;170(1):73-83

306. Lai L, Chen F, McKenna S, Goldschneider I. Identification of an IL-7-associated pre- pro-B cell growth-stimulating factor (PPBSF). II. PPBSF is a covalently linked heterodimer of IL-7 and a Mr 30,000 cofactor. J Immunol. 1998;160(5):2280-2286

307. Parker MJ, Licence S, Erlandsson L, et al. The pre-B-cell receptor induces silencing of VpreB and lambda5 transcription. EMBO J. 2005;24(22):3895-3905

308. Smart FM, Venkitaraman AR. Inhibition of interleukin 7 receptor signaling by antigen receptor assembly. J Exp Med. 2000;191(4):737-742

309. Paige CJ, Kincade PW, Ralph P. Murine B cell leukemia line with inducible surface immunoglobulin expression. J Immunol. 1978;121(2):641-647

310. Jiang Q, Li WQ, Aiello FB, Klarmann KD, Keller JR, Durum SK. Retroviral transduction of IL-7Ralpha into IL-7Ralpha-/- bone marrow progenitors: correction of lymphoid deficiency and induction of neutrophilia. Gene Ther. 2005;12(24):1761-1768

311. Borge OJ, Adolfsson J, Jacobsen AM. Lymphoid-restricted development from multipotent candidate murine stem cells: distinct and complimentary functions of the c-kit and flt3-ligands. Blood. 1999;94(11):3781-3790

312. Loffert D, Schaal S, Ehlich A, et al. Early B-cell development in the mouse: insights from mutations introduced by gene targeting. Immunol Rev. 1994;137:135-153

190

313. Marshall AJ, Fleming HE, Wu GE, Paige CJ. Modulation of the IL-7 dose-response threshold during pro-B cell differentiation is dependent on pre-B cell receptor expression. J Immunol. 1998;161(11):6038-6045

314. Wei C, Zeff R, Goldschneider I. Murine pro-B cells require IL-7 and its receptor complex to up-regulate IL-7R alpha, terminal deoxynucleotidyltransferase, and c mu expression. J Immunol. 2000;164(4):1961-1970

315. Henriques CM, Rino J, Nibbs RJ, Graham GJ, Barata JT. IL-7 induces rapid clathrin- mediated internalization and JAK3-dependent degradation of IL-7Ralpha in T cells. Blood. 2010;115(16):3269-3277

316. Piessevaux J, Lavens D, Peelman F, Tavernier J. The many faces of the SOCS box. Cytokine Growth Factor Rev. 2008;19(5-6):371-381

317. Acharya M, Edkins AL, Ozanne BW, Cushley W. SDF-1 and PDGF enhance alphavbeta5-mediated ERK activation and adhesion-independent growth of human pre-B cell lines. Leukemia. 2009;23(10):1807-1817

318. Ganju RK, Brubaker SA, Meyer J, et al. The alpha-chemokine, stromal cell-derived factor-1alpha, binds to the transmembrane G-protein-coupled CXCR-4 receptor and activates multiple signal transduction pathways. J Biol Chem. 1998;273(36):23169-23175

319. Mowafi F, Cagigi A, Matskova L, Bjork O, Chiodi F, Nilsson A. Chemokine CXCL12 enhances proliferation in pre-B-ALL via STAT5 activation. Pediatr Blood Cancer. 2008;50(4):812-817

320. Le Y, Zhu BM, Harley B, et al. SOCS3 protein developmentally regulates the chemokine receptor CXCR4-FAK signaling pathway during B lymphopoiesis. Immunity. 2007;27(5):811-823

321. Pello OM, Moreno-Ortiz Mdel C, Rodriguez-Frade JM, et al. SOCS up-regulation mobilizes autologous stem cells through CXCR4 blockade. Blood. 2006;108(12):3928-3937

322. Cornish AL, Chong MM, Davey GM, et al. Suppressor of cytokine signaling-1 regulates signaling in response to interleukin-2 and other gamma c-dependent cytokines in peripheral T cells. J Biol Chem. 2003;278(25):22755-22761

323. Pellegrini M, Calzascia T, Toe JG, et al. IL-7 engages multiple mechanisms to overcome chronic viral infection and limit organ pathology. Cell;144(4):601-613

324. Saba I, Kosan C, Vassen L, Klein-Hitpass L, Moroy T. Miz-1 is required to coordinate the expression of TCRbeta and p53 effector genes at the pre-TCR "beta-selection" checkpoint. J Immunol. 2011;187(6):2982-2992

325. Fiolka K, Hertzano R, Vassen L, et al. Gfi1 and Gfi1b act equivalently in haematopoiesis, but have distinct, non-overlapping functions in inner ear development. EMBO Rep. 2006;7(3):326-333

191

326. van der Meer LT, Jansen JH, van der Reijden BA. Gfi1 and Gfi1b: key regulators of hematopoiesis. Leukemia. 2010;24(11):1834-1843

327. Vassen L, Okayama T, Moroy T. Gfi1b:green fluorescent protein knock-in mice reveal a dynamic expression pattern of Gfi1b during hematopoiesis that is largely complementary to Gfi1. Blood. 2007;109(6):2356-2364

328. Chen JL, Limnander A, Rothman PB. Pim-1 and Pim-2 kinases are required for efficient pre-B-cell transformation by v-Abl oncogene. Blood. 2008;111(3):1677-1685

329. Chen XP, Losman JA, Cowan S, et al. Pim serine/threonine kinases regulate the stability of Socs-1 protein. Proc Natl Acad Sci U S A. 2002;99(4):2175-2180

330. Peltola KJ, Paukku K, Aho TL, Ruuska M, Silvennoinen O, Koskinen PJ. Pim-1 kinase inhibits STAT5-dependent transcription via its interactions with SOCS1 and SOCS3. Blood. 2004;103(10):3744-3750

331. Yip-Schneider MT, Horie M, Broxmeyer HE. Transcriptional induction of pim-1 protein kinase gene expression by interferon gamma and posttranscriptional effects on costimulation with steel factor. Blood. 1995;85(12):3494-3502

332. Haan S, Ferguson P, Sommer U, et al. Tyrosine phosphorylation disrupts elongin interaction and accelerates SOCS3 degradation. J Biol Chem. 2003;278(34):31972-31979

333. Limnander A, Danial NN, Rothman PB. v-Abl signaling disrupts SOCS-1 function in transformed pre-B cells. Mol Cell. 2004;15(3):329-341

334. Domen J, van der Lugt NM, Acton D, Laird PW, Linders K, Berns A. Pim-1 levels determine the size of early B lymphoid compartments in bone marrow. J Exp Med. 1993;178(5):1665-1673

335. Mikkers H, Nawijn M, Allen J, et al. Mice deficient for all PIM kinases display reduced body size and impaired responses to hematopoietic growth factors. Mol Cell Biol. 2004;24(13):6104-6115

336. Saha B, Jyothi Prasanna S, Chandrasekar B, Nandi D. Gene modulation and immunoregulatory roles of interferon gamma. Cytokine;50(1):1-14

337. Young HA, Klinman DM, Reynolds DA, et al. Bone marrow and thymus expression of interferon-gamma results in severe B-cell lineage reduction, T-cell lineage alterations, and hematopoietic progenitor deficiencies. Blood. 1997;89(2):583-595

338. Simoncic PD, Lee-Loy A, Barber DL, Tremblay ML, McGlade CJ. The T cell protein tyrosine phosphatase is a negative regulator of janus family kinases 1 and 3. Curr Biol. 2002;12(6):446-453

339. ten Hoeve J, de Jesus Ibarra-Sanchez M, Fu Y, et al. Identification of a nuclear Stat1 protein tyrosine phosphatase. Mol Cell Biol. 2002;22(16):5662-5668

192

340. Yoshikawa H, Nakajima Y, Tasaka K. IFN-gamma induces the apoptosis of WEHI 279 and normal pre-B cell lines by expressing direct inhibitor of apoptosis protein binding protein with low pI. J Immunol. 2001;167(5):2487-2495

341. Dickensheets HL, Venkataraman C, Schindler U, Donnelly RP. Interferons inhibit activation of STAT6 by interleukin 4 in human monocytes by inducing SOCS-1 gene expression. Proc Natl Acad Sci U S A. 1999;96(19):10800-10805

342. Sato T, Saito R, Jinushi T, et al. IFN-gamma-induced SOCS-1 regulates STAT6- dependent eotaxin production triggered by IL-4 and TNF-alpha. Biochem Biophys Res Commun. 2004;314(2):468-475

343. Venkataraman C, Leung S, Salvekar A, Mano H, Schindler U. Repression of IL-4- induced gene expression by IFN-gamma requires Stat1 activation. J Immunol. 1999;162(7):4053-4061

344. Cain D, Kondo M, Chen H, Kelsoe G. Effects of acute and chronic inflammation on B- cell development and differentiation. J Invest Dermatol. 2009;129(2):266-277

345. Flaishon L, Lantner F, Hershkoviz R, Levo Y, Shachar I. Low levels of IFN-gamma down-regulate the integrin-dependent adhesion of B cells by activating a pathway that interferes with cytoskeleton rearrangement. J Biol Chem. 2001;276(50):46701-46706

346. Hart G, Avin-Wittenberg T, Shachar I. IL-15 regulates immature B-cell homing in an Ly49D-, IL-12 , and IL-18 dependent manner. Blood. 2008;111(1):50-59

347. Price PW, Cerny J. Characterization of CD4+ T cells in mouse bone marrow. I. Increased activated/memory phenotype and altered TCR Vbeta repertoire. Eur J Immunol. 1999;29(3):1051-1056

348. Corcos D, Dunda O, Butor C, et al. Pre-B-cell development in the absence of lambda 5 in transgenic mice expressing a heavy-chain disease protein. Curr Biol. 1995;5(10):1140-1148

349. Muljo SA, Schlissel MS. The variable, C(H)1, C(H)2 and C(H)3 domains of Ig heavy chain are dispensable for pre-BCR function in transgenic mice. Int Immunol. 2002;14(6):577- 584

350. Shimizu T, Mundt C, Licence S, Melchers F, Martensson IL. VpreB1/VpreB2/lambda 5 triple-deficient mice show impaired B cell development but functional allelic exclusion of the IgH locus. J Immunol. 2002;168(12):6286-6293

351. Minegishi Y, Coustan-Smith E, Wang YH, Cooper MD, Campana D, Conley ME. Mutations in the human lambda5/14.1 gene result in B cell deficiency and agammaglobulinemia. J Exp Med. 1998;187(1):71-77

352. Bradl H, Jack HM. Surrogate light chain-mediated interaction of a soluble pre-B cell receptor with adherent cell lines. J Immunol. 2001;167(11):6403-6411

193

353. Rabenstein DL. Heparin and heparan sulfate: structure and function. Nat Prod Rep. 2002;19(3):312-331

354. Tumova S, Woods A, Couchman JR. Heparan sulfate proteoglycans on the cell surface: versatile coordinators of cellular functions. Int J Biochem Cell Biol. 2000;32(3):269-288

355. Iozzo RV. Heparan sulfate proteoglycans: intricate molecules with intriguing functions. J Clin Invest. 2001;108(2):165-167

356. Sanderson RD, Lalor P, Bernfield M. B lymphocytes express and lose syndecan at specific stages of differentiation. Cell Regul. 1989;1(1):27-35

357. Bernfield M, Gotte M, Park PW, et al. Functions of cell surface heparan sulfate proteoglycans. Annu Rev Biochem. 1999;68:729-777

358. Del Nagro CJ, Otero DC, Anzelon AN, Omori SA, Kolla RV, Rickert RC. CD19 function in central and peripheral B-cell development. Immunol Res. 2005;31(2):119-131

359. Tedder TF, Isaacs CM. Isolation of cDNAs encoding the CD19 antigen of human and mouse B lymphocytes. A new member of the immunoglobulin superfamily. J Immunol. 1989;143(2):712-717

360. Chalupny NJ, Kanner SB, Schieven GL, et al. Tyrosine phosphorylation of CD19 in pre-B and mature B cells. EMBO J. 1993;12(7):2691-2696

361. Ishiura N, Nakashima H, Watanabe R, et al. Differential phosphorylation of functional tyrosines in CD19 modulates B-lymphocyte activation. Eur J Immunol. 2010;40(4):1192-1204

362. Sato S, Steeber DA, Jansen PJ, Tedder TF. CD19 expression levels regulate B lymphocyte development: human CD19 restores normal function in mice lacking endogenous CD19. J Immunol. 1997;158(10):4662-4669

363. Dempsey PW, Allison ME, Akkaraju S, Goodnow CC, Fearon DT. C3d of complement as a molecular adjuvant: bridging innate and acquired immunity. Science. 1996;271(5247):348-350

364. Fearon DT, Carroll MC. Regulation of B lymphocyte responses to foreign and self- antigens by the CD19/CD21 complex. Annu Rev Immunol. 2000;18:393-422

365. Depoil D, Fleire S, Treanor BL, et al. CD19 is essential for B cell activation by promoting B cell receptor-antigen microcluster formation in response to membrane-bound ligand. Nat Immunol. 2008;9(1):63-72

366. Hasegawa M, Fujimoto M, Poe JC, Steeber DA, Tedder TF. CD19 can regulate B lymphocyte signal transduction independent of complement activation. J Immunol. 2001;167(6):3190-3200

194

367. Matsumoto AK, Kopicky-Burd J, Carter RH, Tuveson DA, Tedder TF, Fearon DT. Intersection of the complement and immune systems: a signal transduction complex of the B lymphocyte-containing complement receptor type 2 and CD19. J Exp Med. 1991;173(1):55-64

368. Prodeus AP, Goerg S, Shen LM, et al. A critical role for complement in maintenance of self-tolerance. Immunity. 1998;9(5):721-731

369. Aiba Y, Kameyama M, Yamazaki T, Tedder TF, Kurosaki T. Regulation of B-cell development by BCAP and CD19 through their binding to phosphoinositide 3-kinase. Blood. 2008;111(3):1497-1503

370. Diamant E, Keren Z, Melamed D. CD19 regulates positive selection and maturation in B lymphopoiesis: lack of CD19 imposes developmental arrest of immature B cells and consequential stimulation of receptor editing. Blood. 2005;105(8):3247-3254

371. Lam KP, Kuhn R, Rajewsky K. In vivo ablation of surface immunoglobulin on mature B cells by inducible gene targeting results in rapid cell death. Cell. 1997;90(6):1073-1083

372. Roberts T, Snow EC. Cutting edge: recruitment of the CD19/CD21 coreceptor to B cell antigen receptor is required for antigen-mediated expression of Bcl-2 by resting and cycling hen egg lysozyme transgenic B cells. J Immunol. 1999;162(8):4377-4380

373. Shivtiel S, Leider N, Sadeh O, Kraiem Z, Melamed D. Impaired light chain allelic exclusion and lack of positive selection in immature B cells expressing incompetent receptor deficient of CD19. J Immunol. 2002;168(11):5596-5604

374. Ogata H, Su I, Miyake K, et al. The toll-like receptor protein RP105 regulates lipopolysaccharide signaling in B cells. J Exp Med. 2000;192(1):23-29

375. Yazawa N, Fujimoto M, Sato S, et al. CD19 regulates innate immunity by the toll-like receptor RP105 signaling in B lymphocytes. Blood. 2003;102(4):1374-1380