DOCSLIB.ORG

54 Ii. /10 Iii

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
54 Ii. /10 Iii Write your Course ID# in the NAME: For GradeScope, please write your FIRST and box below. LAST name in CAPITAL letters WITHIN the box: EXAM IV I. _________________/54 April 14, 2021 Biochemistry II II. _________________/10 BI/CH 422/622 III. _________________/10 IV. _________________/26 TOTAL _________________/100 I. MULTIPLE CHOICE. (54 points; 2 points each) Choose the BEST answer to the question by WRITING the appropriate letter in the BOX to the left of each question. 1. The use of Schiff-base formation is part of the enzyme mechanism for all of the following enzymes, except ___. A. acetoacetate decarboxylase B. transaldolase C. transketolase D. aldolase E. aspartate transaminase 2. Which of the following statements about gluconeogenesis is true? A. Gluconeogenesis uses the same glycolytic enzymes except for two in the beginning which are used to circumvent the exergonic pyruvate kinase reaction, and to synthesize PEP. Fru 1,6P B. Regulation of gluconeogenesis uses the allosteric effector, 2, whereas glycolysis is regulated by the effector, Fru 2,6P2. C. Pyruvate carboxylase fixes CO2 in much the same way as rubisco. D. Since both glycolysis and gluconeogenesis involve enzymes only in the cytosol, they must be coordinately regulated. E. The exergonic nature of the fructose bisphosphatase step is sufficient to drive the whole gluconeogenesis pathway. 3. Which of these chloroplast enzymes is not regulated by light through the use of thioredoxin? A. rubisco B. fructose-1,6-bisphosphatase C. ribulose-5-phosphate kinase D. glyceraldehyde-phosphate dehydrogenase E. sedoheptulose-1,7-bisphosphatase 4. Absorption of a photon in the chloroplast of a photosynthetic organism is not associated with which one of the following? A. release of most of the energy as fluorescence B. antenna molecules C. exciton transfer D. eventual transfer of energy to a photochemical reaction center E. transfer of energy from a chlorophyll molecule in a light-harvesting complex to another chlorophyll or to a phycoerythrobilin molecule Page 2 5. Which of the following statements about the pentose-phosphate pathway is true? A. The pentose-phosphate pathway has two main roles, to make reduced NADH and ribose 5-phosphate for nucleotide biosynthesis. B. After the oxidative phase of the pentose-phosphate pathway, the ribulose 5-phosphate is isomerized to ribose 5-phosphate using an enediol mechanism much like the glycolytic enzyme phosphoglucoisomerase that converts glucose 6-phosphate to fructose 6-phosphate. C. Ribose 5-phosphate is either recycled into glucose 6-phosphate or used to synthesize phosphoribosyl pyrophosphate (PRPP) using UTP. D. The pentose-phosphate pathway enzyme transaldolase transfers a 2- carbon moiety from a ketose to an aldose. E. The reducing capacity generated by the pentose-phosphate pathway is essential for regulation of the light-independent reactions in the Calvin cycle. 6. An enzyme used in both glycolysis and gluconeogenesis is: A. hexokinase. B. glucose-6-phosphatase. C. 3-phosphoglycerate kinase. D. phosphofructokinase-1. E. pyruvate kinase. 7. The sequence of events in the response of hepatocytes to elevated epinephrine is: 1. phosphorylated phosphorylase-a rapidly degrades glycogen 2. adenylate cyclase is activated 3. epinephrine binds to its receptor on the cell surface 4. PKA phosphorylates phosphorylase kinase 5. cAMP-dependent protein kinase (PKA) is activated A. 2, 4, 1, 3, 5 B. 3, 2, 4, 5, 1 C. 3, 2, 5, 4, 1 D. 3, 5, 4, 2, 1 E. 5, 2, 3, 1, 4 8. The glycogen-branching enzyme catalyzes: A. glycogen degradation in tree branches. B. formation of (a1Æ6) linkages during glycogen synthesis. C. formation of (a1Æ4) linkages in glycogen. D. removal of unneeded glucose residues at the ends of branches. E. the synthesis of the initial 6 glucose residues of glycogen 9. Which of these compounds is not directly involved in the Calvin cycle? A. sedoheptulose-7-phosphate B. glyceraldehyde-3-phosphate C. erythrose-4-phosphate D. mannose-6-phosphate E. ribulose-5-phosphate Page 3 10. Glucagon (in liver) and epinephrine (in muscle): A. activate glycogen phosphorylase and inactivate glycogen synthase. B. inhibit glycogen synthesis and activate glycogenolysis. C. act by raising the concentration of cyclic AMP (cAMP). D. act through a protein kinase E. all of the above. 11.Glycogenin: A. is the gene that encodes glycogen synthase. B. contains a Tyr on which new glycogen chains are initiated. C. is the enzyme responsible for forming branches in glycogen. D. regulates the synthesis of glycogen. E. catalyzes the conversion of starch into glycogen. 12. In Gluconeogenesis, which compound is not considered a precursor for making glucose via gluconeogenesis in humans? A. acetyl‑CoA B. pyruvate C. glycerol D. succinyl‑CoA E. lactate 13. A person who cannot synthesize liver fructose-1,6-bisphosphatase would probably experience: A. failure to synthesize fats when the diet contained excess carbohydrate. B. inability to metabolize fructose. C. inability to convert fructose-1,6-bisphosphate into triose phosphates. D. inability to resynthesize glucose from lactate produced during exercise. E. none of the above. 14. The known mechanisms of activation of rubisco, or of other enzymes of the Calvin cycle, during illumination include all of these except : A. carbamylation of a Lys residue by CO2. B. relief of the inhibition by the "nocturnal inhibitor," 2- carboxyarabinitol-1-phosphate. C. light-driven entry of Mg2+ into the stroma. D. phosphorylation by cAMP-dependent protein kinase. E. reduction of a disulfide bridge by thioredoxin. 15. The compound that condenses with CO2 in the first reaction of carbon dioxide fixation is: A. ribose-1,5-bisphosphate. B. ribulose-1,5-bisphosphate. C. ribulose-5-phosphate. D. 3-phosphoglycerate. E. rubisco. 16. In the light-independent ("dark") reactions of photosynthesis, the biosynthesis of 1 mole of hexose from 6 moles of carbon dioxide requires: A. 18 moles of NADPH and 18 moles of ATP. B. 18 moles of NADPH and 12 moles of ATP. C. 12 moles of NADPH and 18 moles of ATP. D. 12 moles of NADPH and 12 moles of ATP. E. no NADPH and 12 moles of ATP. Page 4 17. The Cori cycle is: A. the interconversion between glycogen and glucose-l-phosphate. B. the synthesis of alanine from pyruvate in skeletal muscle and the synthesis of pyruvate from alanine in liver. C. the synthesis of urea in liver and degradation of urea to carbon dioxide and ammonia by bacteria in the gut. D. the production of lactate from glucose in peripheral tissues with the resynthesis of glucose from lactate in liver. E. none of the above. 18. Which of the following statements about the light reactions in photosynthetic plants is false ? A. There are two distinct photosystems, linked together by an electron transfer chain. B. A membrane-bound ATPase couples ATP synthesis to electron transfer. C. The ultimate source of electrons for the process is H2O. D. The ultimate electron acceptor is O2. E. No CO2 is fixed during the light reactions. 19. The fixation of CO2 into organic compounds (triose phosphates) in green plants: A. takes place in the cytosol. B. results in the production of ATP. C. involves condensation of the two-carbon compound acetate with CO2 to form 3-phosphoglycerate. D. requires NADPH. E. takes place at equal rates in light and darkness. 20. Which of the following is true of glycogen synthase? A. It catalyzes addition of glucose residues to the nonreducing end of a glycogen chain through (a1Æ4) bonds. B. The conversion of an active to an inactive form of the enzyme is controlled by the concentration of cAMP. C. Activation of the enzyme involves a phosphorylation. D. The enzyme has measurable activity only in liver. 21. Transketolase requires the coenzyme: A. pyridoxal phosphate. B. thiamine pyrophosphate. C. cobalamin (vitamin B12). D. tetrahydrofolic acid. 22. Glucokinase, an isozyme of hexokinase, is _____________ A. more active when blood glucose concentrations are high. B. has a lower Km value for glucose than the other hexokinase isozymes. C. is found in muscle and is important for partitioning glucose between glycolysis and gluconeogenesis. D. is inhibited by glucose 6‑phosphate. E. is sequestered in the mitochondria and released when Fru 1-P binds to the complex, allowing its migration to the cytosol. Page 5 23. Photosynthetic phosphorylation and oxidative phosphorylation appear to be generally similar processes, both consisting of ATP synthesis coupled to the transfer of electrons along an electron-carrier chain. Which of the following is not true of both processes? A. Both make use of oxygen as a terminal electron acceptor. B. Both contain cytochromes and flavins in their electron carrier chains. C. Both processes are associated with membranous elements of the cell. D. Each represents the major route of ATP synthesis in those cells in which it is found. E. Both contain a membrane complex with a "Q-cycle" that helps create the proton-motive force. 24. The process of photophosphorylation in chloroplasts use all of the following reactions except _______. A. a membrane-bound complex containing cytochromes f and b6 and binding sites for plastoquinone and plastocyanin, which leads to establishment of a proton gradient. B. multiple light-absorbing molecules in the appropriate distances for efficient energy transfer C. a photosystem that creates reduced ferrodoxin with a reduction potential sufficient for subsequent reduction of NADPH or plastiquinone. D. a photosystem that uses H2O2 as a source of electrons. E. a photosystem with a special pair of chlorophyll molecules that don't perform energy transfer, but perform electron transfer. 25. André Jagendorf showed _______. A. that the pH gradient across the mitochondrial membrane is sufficient to drive ATP synthase. B. that the pH gradient across the plasma membrane is sufficient to drive ATP synthase. C. that the pH gradient across the lysosomal membrane is sufficient to drive ATP synthase.
Load more

Recommended publications
  • • Glycolysis • Gluconeogenesis • Glycogen Synthesis
    Carbohydrate Metabolism! Wichit Suthammarak – Department of Biochemistry, Faculty of Medicine Siriraj Hospital – Aug 1st and 4th, 2014! • Glycolysis • Gluconeogenesis • Glycogen synthesis • Glycogenolysis • Pentose phosphate pathway • Metabolism of other hexoses Carbohydrate Digestion! Digestive enzymes! Polysaccharides/complex carbohydrates Salivary glands Amylase Pancreas Oligosaccharides/dextrins Dextrinase Membrane-bound Microvilli Brush border Maltose Sucrose Lactose Maltase Sucrase Lactase ‘Disaccharidase’ 2 glucose 1 glucose 1 glucose 1 fructose 1 galactose Lactose Intolerance! Cause & Pathophysiology! Normal lactose digestion Lactose intolerance Lactose Lactose Lactose Glucose Small Intestine Lactase lactase X Galactose Bacteria 1 glucose Large Fermentation 1 galactose Intestine gases, organic acid, Normal stools osmotically Lactase deficiency! active molecules • Primary lactase deficiency: อาการ! genetic defect, การสราง lactase ลด ลงเมออายมากขน, พบมากทสด! ปวดทอง, ถายเหลว, คลนไสอาเจยนภาย • Secondary lactase deficiency: หลงจากรบประทานอาหารทม lactose acquired/transient เชน small bowel เปนปรมาณมาก เชนนม! injury, gastroenteritis, inflammatory bowel disease! Absorption of Hexoses! Site: duodenum! Intestinal lumen Enterocytes Membrane Transporter! Blood SGLT1: sodium-glucose transporter Na+" Na+" •! Presents at the apical membrane ! of enterocytes! SGLT1 Glucose" Glucose" •! Co-transports Na+ and glucose/! Galactose" Galactose" galactose! GLUT2 Fructose" Fructose" GLUT5 GLUT5 •! Transports fructose from the ! intestinal lumen into enterocytes!
    [Show full text]
  • Cori Cycle Activity in Man
    Cori cycle activity in man Christine Waterhouse, Julian Keilson J Clin Invest. 1969;48(12):2359-2366. https://doi.org/10.1172/JCI106202. Research Article 12 subjects have been studied after an overnight fast with trace amounts of pyruvate-3-14C and glucose-6-14C. Blood disappearance curves and incorporation of the pyruvate-3-14C label into blood glucose have been determined. By the use of transfer functions which allow processes with many different chemical steps to be examined as a unit, we have determined the per cent of pyruvate and presumably lactate which is regenerated into glucose. 8 of the 12 subjects showed that 7-23 mg/kg per hr are recycled, while 4 subjects fell well outside this range. Correlation of increased activity was not good with any demonstrated metabolic abnormality (diabetes or obesity), and it is suggested from clinical observation of the subjects that anxiety may play a role. Find the latest version: https://jci.me/106202/pdf Cori Cycle Activity in Man CHRISTIE WATERHOUSE and JULLAN KEISON From the Department of Medicine, University of Rochester School of Medicine and Dentistry and the Department of Statistics, University of Rochester College of Arts and Sciences, Rochester, New York 14620 ABSTRACT 12 subjects have been studied after an glucose derived from lactate and pyruvate. The analysis overnight fast with trace amounts of pyruvate-3-'4C and itself also views glucose as distributed in a homogeneous glucose-6-'4C. Blood disappearance curves and incorpora- pool within the body, thus neglecting the early portion tion of the pyruvate-3-14C label into blood glucose have of the glucose 'C disappearance curve.
    [Show full text]
  • Table S1. List of Oligonucleotide Primers Used
    Table S1. List of oligonucleotide primers used. Cla4 LF-5' GTAGGATCCGCTCTGTCAAGCCTCCGACC M629Arev CCTCCCTCCATGTACTCcgcGATGACCCAgAGCTCGTTG M629Afwd CAACGAGCTcTGGGTCATCgcgGAGTACATGGAGGGAGG LF-3' GTAGGCCATCTAGGCCGCAATCTCGTCAAGTAAAGTCG RF-5' GTAGGCCTGAGTGGCCCGAGATTGCAACGTGTAACC RF-3' GTAGGATCCCGTACGCTGCGATCGCTTGC Ukc1 LF-5' GCAATATTATGTCTACTTTGAGCG M398Arev CCGCCGGGCAAgAAtTCcgcGAGAAGGTACAGATACGc M398Afwd gCGTATCTGTACCTTCTCgcgGAaTTcTTGCCCGGCGG LF-3' GAGGCCATCTAGGCCATTTACGATGGCAGACAAAGG RF-5' GTGGCCTGAGTGGCCATTGGTTTGGGCGAATGGC RF-3' GCAATATTCGTACGTCAACAGCGCG Nrc2 LF-5' GCAATATTTCGAAAAGGGTCGTTCC M454Grev GCCACCCATGCAGTAcTCgccGCAGAGGTAGAGGTAATC M454Gfwd GATTACCTCTACCTCTGCggcGAgTACTGCATGGGTGGC LF-3' GAGGCCATCTAGGCCGACGAGTGAAGCTTTCGAGCG RF-5' GAGGCCTGAGTGGCCTAAGCATCTTGGCTTCTGC RF-3' GCAATATTCGGTCAACGCTTTTCAGATACC Ipl1 LF-5' GTCAATATTCTACTTTGTGAAGACGCTGC M629Arev GCTCCCCACGACCAGCgAATTCGATagcGAGGAAGACTCGGCCCTCATC M629Afwd GATGAGGGCCGAGTCTTCCTCgctATCGAATTcGCTGGTCGTGGGGAGC LF-3' TGAGGCCATCTAGGCCGGTGCCTTAGATTCCGTATAGC RF-5' CATGGCCTGAGTGGCCGATTCTTCTTCTGTCATCGAC RF-3' GACAATATTGCTGACCTTGTCTACTTGG Ire1 LF-5' GCAATATTAAAGCACAACTCAACGC D1014Arev CCGTAGCCAAGCACCTCGgCCGAtATcGTGAGCGAAG D1014Afwd CTTCGCTCACgATaTCGGcCGAGGTGCTTGGCTACGG LF-3' GAGGCCATCTAGGCCAACTGGGCAAAGGAGATGGA RF-5' GAGGCCTGAGTGGCCGTGCGCCTGTGTATCTCTTTG RF-3' GCAATATTGGCCATCTGAGGGCTGAC Kin28 LF-5' GACAATATTCATCTTTCACCCTTCCAAAG L94Arev TGATGAGTGCTTCTAGATTGGTGTCggcGAAcTCgAGCACCAGGTTG L94Afwd CAACCTGGTGCTcGAgTTCgccGACACCAATCTAGAAGCACTCATCA LF-3' TGAGGCCATCTAGGCCCACAGAGATCCGCTTTAATGC RF-5' CATGGCCTGAGTGGCCAGGGCTAGTACGACCTCG
    [Show full text]
  • Yeast As a Tool to Understand the Significance of Human Disease
    G C A T T A C G G C A T genes Review Yeast as a Tool to Understand the Significance of Human Disease-Associated Gene Variants Tiziana Cervelli and Alvaro Galli * Yeast Genetics and Genomics Group, Laboratory of Functional Genetics and Genomics, Institute of Clinical Physiology CNR, Via Moruzzi 1, 56125 Pisa, Italy; [email protected] * Correspondence: [email protected] Abstract: At present, the great challenge in human genetics is to provide significance to the growing amount of human disease-associated gene variants identified by next generation DNA sequencing technologies. Increasing evidences suggest that model organisms are of pivotal importance to addressing this issue. Due to its genetic tractability, the yeast Saccharomyces cerevisiae represents a valuable model organism for understanding human genetic variability. In the present review, we show how S. cerevisiae has been used to study variants of genes involved in different diseases and in different pathways, highlighting the versatility of this model organism. Keywords: yeast; Saccharomyces cerevisiae; functional assays; Mendelian disease; cancer; human gene variants 1. Introduction The advent of next generation DNA sequences technologies allows us to identify Citation: Cervelli, T.; Galli, A. Yeast individual genetic variants, and this revolutionized the strategy for discovering the cause as a Tool to Understand the of several genetic and multifactorial diseases. The association between genetic variants Significance of Human and disease risk can potentially overturn our understanding of common disease. The Disease-Associated Gene Variants. discovery of pathways and processes that are causally involved in a disease, so far not Genes 2021, 12, 1303. https:// linked, may open the way towards the development of targeted therapies and prevention doi.org/10.3390/genes12091303 strategies.
    [Show full text]
  • Structures, Functions, and Mechanisms of Filament Forming Enzymes: a Renaissance of Enzyme Filamentation
    Structures, Functions, and Mechanisms of Filament Forming Enzymes: A Renaissance of Enzyme Filamentation A Review By Chad K. Park & Nancy C. Horton Department of Molecular and Cellular Biology University of Arizona Tucson, AZ 85721 N. C. Horton ([email protected], ORCID: 0000-0003-2710-8284) C. K. Park ([email protected], ORCID: 0000-0003-1089-9091) Keywords: Enzyme, Regulation, DNA binding, Nuclease, Run-On Oligomerization, self-association 1 Abstract Filament formation by non-cytoskeletal enzymes has been known for decades, yet only relatively recently has its wide-spread role in enzyme regulation and biology come to be appreciated. This comprehensive review summarizes what is known for each enzyme confirmed to form filamentous structures in vitro, and for the many that are known only to form large self-assemblies within cells. For some enzymes, studies describing both the in vitro filamentous structures and cellular self-assembly formation are also known and described. Special attention is paid to the detailed structures of each type of enzyme filament, as well as the roles the structures play in enzyme regulation and in biology. Where it is known or hypothesized, the advantages conferred by enzyme filamentation are reviewed. Finally, the similarities, differences, and comparison to the SgrAI system are also highlighted. 2 Contents INTRODUCTION…………………………………………………………..4 STRUCTURALLY CHARACTERIZED ENZYME FILAMENTS…….5 Acetyl CoA Carboxylase (ACC)……………………………………………………………………5 Phosphofructokinase (PFK)……………………………………………………………………….6
    [Show full text]
  • Glycolysis and Gluconeogenesis
    CC7_Unit 2.3 Glycolysis and Gluconeogenesis Glucose occupies a central position in the metabolism of plants, animals and many microorganisms. In animals, glucose has four major fates as shown in figure 1. The organisms that do not have access to glucose from other sources must make it. Plants make glucose by photosynthesis. Non-photosynthetic cells make glucose from 3 and 4 carbon precursors by the process of gluconeogenesis. Glycolysis is the process of enzymatic break down of one molecule of glucose (6 carbon) into two pyruvate molecules (3 carbon) with the concomitant net production of two molecules of ATP. The complete glycolytic pathway was elucidated by 1940, largely through the pioneering cotributions of Gustav Embden, Otto Meyerhof, Carl Neuberg, Jcob Parnad, Otto Wrburg, Gerty Cori and Carl Cori. Glycolysis is also known as Embden-Meyerhof pathway. • Glycolysis is an almost universal central pathway of glucose catabolism. • Glycolysis is anaerobic process. During glycolysis some of the free energy is released and conserved in the form of ATP and NADH. • Anaerobic microorganisms are entirely dependent on glycolysis. • In most of the organisms, the pyruvate formed by glycolysis is further metabolised via one of the three catabolic routes. 1) Under aerobic conditions, glucose is oxidized all the way to C02 and H2O. 2) Under anaerobic conditions, the pyruvic acid can be fermented to lactic acid or to 3) ethanol plus CO2 as shown in figure 2. • Glycolytic breakdown of glucose is the sole source of metabolic energy in some mammalian tissues and cells (RBCs, Brain, Renal medulla and Sperm cell). Glycolysis occurs in TEN steps.
    [Show full text]
  • The Microbiota-Produced N-Formyl Peptide Fmlf Promotes Obesity-Induced Glucose
    Page 1 of 230 Diabetes Title: The microbiota-produced N-formyl peptide fMLF promotes obesity-induced glucose intolerance Joshua Wollam1, Matthew Riopel1, Yong-Jiang Xu1,2, Andrew M. F. Johnson1, Jachelle M. Ofrecio1, Wei Ying1, Dalila El Ouarrat1, Luisa S. Chan3, Andrew W. Han3, Nadir A. Mahmood3, Caitlin N. Ryan3, Yun Sok Lee1, Jeramie D. Watrous1,2, Mahendra D. Chordia4, Dongfeng Pan4, Mohit Jain1,2, Jerrold M. Olefsky1 * Affiliations: 1 Division of Endocrinology & Metabolism, Department of Medicine, University of California, San Diego, La Jolla, California, USA. 2 Department of Pharmacology, University of California, San Diego, La Jolla, California, USA. 3 Second Genome, Inc., South San Francisco, California, USA. 4 Department of Radiology and Medical Imaging, University of Virginia, Charlottesville, VA, USA. * Correspondence to: 858-534-2230, [email protected] Word Count: 4749 Figures: 6 Supplemental Figures: 11 Supplemental Tables: 5 1 Diabetes Publish Ahead of Print, published online April 22, 2019 Diabetes Page 2 of 230 ABSTRACT The composition of the gastrointestinal (GI) microbiota and associated metabolites changes dramatically with diet and the development of obesity. Although many correlations have been described, specific mechanistic links between these changes and glucose homeostasis remain to be defined. Here we show that blood and intestinal levels of the microbiota-produced N-formyl peptide, formyl-methionyl-leucyl-phenylalanine (fMLF), are elevated in high fat diet (HFD)- induced obese mice. Genetic or pharmacological inhibition of the N-formyl peptide receptor Fpr1 leads to increased insulin levels and improved glucose tolerance, dependent upon glucagon- like peptide-1 (GLP-1). Obese Fpr1-knockout (Fpr1-KO) mice also display an altered microbiome, exemplifying the dynamic relationship between host metabolism and microbiota.
    [Show full text]
  • 8. 2020-New METABOLISM in CANCER CELLS-Students
    METABOLIC ALTERATIONS IN CANCER CELLS METABOLIC CHARACTERISTICS OF CANCER CELLS Increased GLYCOLYTIC ACTIVITY (Warburg Effect) Increased production of LACTATE Loss of PASTEUR’S EFFECT (Oxygen inhibition of glycolysis) INCREASED CONSUMPTION Cox4- of GLUTAMINE 2 INCREASED PROTEIN SYNTHESIS DECREASED PROTEOLYSIS DECREASED SYNTHESIS OF FATTY ACIDS (increased lipolysis from host adipose tissue) ENERGETIC METABOLISM IN TUMOURS • WARBURG EFFECT • In the 1920s, Otto Warburg observed that tumor cells consume a large amount of glucose, much • more than normal cells, and convert most of it to lactic acid. This phenomenon, now known as the • ‘Warburg effect,’ is the foundation of one of the earliest general concepts of cancer: that a • fundamental disturbance of cellular metabolic activity is at the root of tumor formation and growth. Biography Otto Heinrich Warburg: • Born-October 8, 1883 in Germany • Died-August 1, 1970 in Berlin, Germany • Son of physicist Emil Warburg • Otto was a German physiologist and medical doctor. • He won a Nobel prize in Physiology and Medicine for his Warburg effect in 1931. • He was one of the twentieth century's leading biochemist One of his Lectures… • "Cancer, above all other diseases, has countless secondary causes. But, even for cancer, there is only one prime cause. Summarized in a few words, the prime cause of cancer is the replacement of the respiration of oxygen in normal body cells by a fermentation of sugar… " -- Dr. Otto H. Warburg in Lecture The Warburg hypothesis The prime cause of cancer is the replacement of the respiration of oxygen…by a fermentation of sugar…” Injury of respiration Aerobic glycolysis De-differentiation Normal cell Phase I Phase II Phase III Cancer cell The Warburg Effect • Pyruvate is an end-product of glycolysis, and is oxidized within the mitochondria.
    [Show full text]
  • Overexpression of a Biotic Stress-Inducible Pvgstu Gene Activates Early Protective Responses in Tobacco Under Combined Heat and Drought
    International Journal of Molecular Sciences Article Overexpression of A Biotic Stress-Inducible Pvgstu Gene Activates Early Protective Responses in Tobacco under Combined Heat and Drought Evangelia Stavridou 1,2 , Georgia Voulgari 1, Michail Michailidis 3 , Stefanos Kostas 4 , Evangelia G. Chronopoulou 5, Nikolaos E. Labrou 5 , Panagiotis Madesis 2,6 and Irini Nianiou-Obeidat 1,* 1 Laboratory of Genetics and Plant Breeding, School of Agriculture, Forestry and Natural Environment, Aristotle University of Thessaloniki, P.O. Box 261, GR-54124 Thessaloniki, Greece; [email protected] (E.S.); [email protected] (G.V.) 2 Institute of Applied Biosciences, CERTH, 6th km Charilaou-Thermis Road, Thermi, P.O. Box 361, GR-57001 Thessaloniki, Greece; [email protected] 3 Laboratory of Pomology, Department of Horticulture, School of Agriculture, Aristotle University of Thessaloniki, GR-54124 Thessaloniki, Greece; [email protected] 4 Laboratory of Floriculture, School of Agriculture, Forestry and Natural Environment, Aristotle University of Thessaloniki, GR-54124 Thessaloniki, Greece; [email protected] 5 Laboratory of Enzyme Technology, Department of Biotechnology, School of Food, Biotechnology and Development, Agricultural University of Athens, 75 Iera Odos Street, 11855 Athens, Greece; [email protected] (E.G.C.); [email protected] (N.E.L.) 6 Laboratory of Molecular Biology of Plants, School of Agricultural Sciences, University of Thessaly, Citation: Stavridou, E.; Voulgari, G.; 38446 Thessaly, Greece Michailidis, M.; Kostas, S.; * Correspondence: [email protected]; Tel.: +30-2310-998-617 Chronopoulou, E.G.; Labrou, N.E.; Madesis, P.; Nianiou-Obeidat, I. Abstract: Drought and heat stresses are major factors limiting crop growth and productivity, and Overexpression of A Biotic their effect is more devastating when occurring concurrently.
    [Show full text]
  • 2 Points Chem 465 Biochemistry II Test 1 Spring 2017 Multiple Choice
    Name: 2 points Chem 465 Biochemistry II Test 1 Spring 2017 Multiple choice (4 points apiece): 1. Which of the following statements about the oxidative decarboxylation of pyruvate in aerobic conditions in animal cells is correct? A) One of the products of the reactions of the pyruvate dehydrogenase complex is a thioester of acetate. B) The methyl (-CH3) group is eliminated as CO2. C) The process occurs in the cytosolic compartment of the cell. D) The pyruvate dehydrogenase complex uses all of the following as cofactors: NAD+, lipoic acid, pyridoxal phosphate (PLP), and FAD. E) The reaction is so important to energy production that pyruvate dehydrogenase operates at full speed under all conditions. 2. In comparison with the resting state, actively contracting human muscle tissue has a: A) higher concentration of ATP. B) higher rate of lactate formation. C) lower consumption of glucose. D) lower rate of consumption of oxygen E) lower ratio of NADH to NAD+. 3.The metabolic function of the pentose phosphate pathway is: A) act as a source of ADP biosynthesis. B) generate NADPH and pentoses for the biosynthesis of fatty acids and nucleic acids. C) participate in oxidation-reduction reactions during the formation of H2O. D) provide intermediates for the citric acid cycle. E) synthesize phosphorus pentoxide. 4. Gluconeogenesis must use "bypass reactions" to circumvent three reactions in the glycolytic pathway that are highly exergonic and essentially irreversible. Reactions carried out by which three of the enzymes listed must be bypassed in the gluconeogenic pathway? 1) Hexokinase 2) Phosphoglycerate kinase 3) Phosphofructokinase-1 4) Pyruvate kinase 5) Triosephosphate isomerase A) 1, 2, 3 B) 1, 2, 4 C) 1, 4, 5 D) 1, 3, 4 E) 2, 3, 4 5.
    [Show full text]
  • Physiological and Proteomic Responses of Diploid and Tetraploid Black Locust (Robinia Pseudoacacia L.) Subjected to Salt Stress
    Int. J. Mol. Sci. 2013, 14, 20299-20325; doi:10.3390/ijms141020299 OPEN ACCESS International Journal of Molecular Sciences ISSN 1422-0067 www.mdpi.com/journal/ijms Article Physiological and Proteomic Responses of Diploid and Tetraploid Black Locust (Robinia pseudoacacia L.) Subjected to Salt Stress Zhiming Wang 1,†, Mingyue Wang 1,†, Likun Liu2 and Fanjuan Meng 1,* 1 College of Life Science, Northeast Forestry University, Harbin 150040, China; E-Mails: [email protected] (Z.W.); [email protected] (M.W.) 2 Department of Medical Biotechnology, College of Biomedical Science, Kangwon National University, Chuncheon, Gangwon-do 200-701, Korea; E-Mail: [email protected] † These authors contributed equally to this work. * Author to whom correspondence should be addressed; E-Mail: [email protected]; Tel.: +86-451-8219-2170; Fax: +86-451-8643-3905. Received: 17 June 2013; in revised form: 31 August 2013 / Accepted: 9 September 2013 / Published: 14 October 2013 Abstract: Tetraploid black locust (Robinia pseudoacacia L.) is adaptable to salt stress. Here, we compared morphological, physiological, ultrastructural, and proteomic traits of leaves in tetraploid black locust and its diploid relatives under salt stress. The results showed that diploid (2×) plants suffered from greater negative effects than those of tetraploid (4×) plants. After salt treatment, plant growth was inhibited, photosynthesis was reduced, reactive oxygen species, malondialdehyde content, and relative electrolyte leakage increased, and defense-related enzyme activities decreased in 2× compared to those in 4×. In addition, salt stress resulted in distorted chloroplasts, swollen thylakoid membranes, accumulation of plastoglobules, and increased starch grains in 2× compared to those in 4×.
    [Show full text]
  • Biological Chemistry I: Endings to Glycolysis
    Chemistry 5.07SC Biological Chemistry Fall Semester, 2013 I Lecture 15/16 Endings to Glycolysis: how to regenerate NAD+ and reversible conversion of P to alanine. I. There are three endings to glycolysis. We will look at each transformation and the energetic consequences. 1. Homolactate fermentation which occurs in muscle under anaerobic conditions. 2. Ethanol production which occurs in yeast under anaerobic conditions and is central to the beer and wine industry. 3. AcetylCoA production in aerobic metabolism and a segway into the TCA cycle. 4. We will also discuss conversion of pyruvate to alanine using Vitamin B6, pyridoxal phosphate. PLP is central to all amino acid metabolism and reversible conversion of α- ketoacids and amino acids is central to feeding intermediates into/ and removal of intermediates from the TCA cycle. 1. Lactate dehydrogenase (LDH) catalyzes the conversion of pyruvate (P) to lactate (L) using NADH as the cofactor: This ending of the glycolysis pathway is utilized when the demand for ATP is high and the O2 supply is low. Anaerobic glycolysis can continue at high rates for 1 to 3 min. Generation of ATP by this mechanism is much faster than the O/P pathway. In muscles, lactic acid is the end product produced and is transported through the blood to the liver, where it can be converted back to pyruvate and used to make glucose. Lactic acid requires a transporter in muscles and is coupled to H+ transport. Contrary to general belief, it is not lactic acid buildup that causes muscle fatigue and soreness; this phenotype occurs on too long a time scale.
    [Show full text]