Establishing CRISPR/Cas9-Mediated Functional Knock-Outs of Genes

Establishing CRISPR/Cas9-mediated functional knock-outs of genes TRNP1 and TMEM14B via microhomology-mediated end-joining DNA-repair in human induced pluripotent stem cells

Master’s Thesis Submitted to the Institute of Molecular Biology University of Innsbruck in fulfillment of the requirements for the conferral of the degree of Master of Science (MSc)

Author: Björn Felder, BSc

Supervisor: Univ.-Prof. Frank Edenhofer, PhD Institute of Molecular Biology Department of Genomics, Stem Cell Biology and Regenerative Medicine LEOPOLD FRANZENS UNIVERSITÄT INNSBRUCK, AUSTRIA

Co-Supervisor: Assoc.-Prof. Anna Falk, PhD Department of Neuroscience KAROLINSKA INSTITUTET STOCKHOLM, SWEDEN

Innsbruck, October 2019

Contents

Summary ...... v 1. Introduction ...... 1 1.1. Genome engineering and the use of programmable nucleases ...... 1 1.2. The CRISPR/Cas9 system ...... 2 1.3. Microhomology-mediated end-joining (MMEJ) DNA-repair ...... 9 1.4. Induced pluripotent stem cells ...... 14 1.5. Aims of the Thesis ...... 16 2. Materials and Methods ...... 17 2.1. Materials ...... 17 2.2. Methods ...... 22 2.2.1. Molecular cloning and plasmid preparation ...... 22 2.2.2. gRNA and microhomologous sequences ...... 22 2.2.3. Primer design ...... 23 2.2.4. In vivo assembly and polymerase chain reaction for cloning ...... 24 2.2.5. Restriction cloning and annealing of oligos ...... 25 2.2.6. Purification of PCR and restriction enzyme digest reactions ...... 26 2.2.7. Ligation ...... 27 2.2.8. Agarose gel electrophoresis ...... 27 2.2.9. Transformation of competent cells ...... 28 2.2.10. Bacterial culture and plasmid preparation ...... 29 2.2.11. Analysis of PCR-generated genomic and vector DNA ...... 30 2.2.11.1. Isolation of genomic DNA ...... 30 2.2.11.2. Sequencing of vector products and PCR amplificates ...... 30 2.2.12. Cell culture of human NHDF iPS cells ...... 31 2.2.13. Cell imaging and fluorescence microscopy ...... 32 2.2.14. Generation and isolation of functional knock-out iPS cell lines ...... 32 2.2.15. Genotyping and screening for potential off-target cleavage ...... 32 2.3. Lists of oligonucleotides and primers ...... 34 2.4. List of plasmids ...... 40 3. Results ...... 41 3.1. Definition of gRNA target sites and microhomology sequences ...... 41 3.1.1. In silico design of TRNP1 functional knock-out approach ...... 41 3.1.2. In silico design of TMEM14B functional knock-out approach ...... 42 3.2. Cloning modifications of pCRIS-PITCh expression vector system ...... 44 3.3. Addition of empty gRNA cassette to px458-Cas9 expression vector ...... 45

iii

3.4. Introduction of gene specific gRNA sequences into px458_+PITCh gRNA vectors ...... 48 3.5. Placement of transgenic expression construct under control of human EF1a promoter ...... 50 3.6. Exchange of fluorescent reporter coding sequences, site-directed mutagenesis and poly-adenylation signal incorporation ...... 54 3.7. Introduction of gene specific microhomologous sequences into repair template vector ...... 59 3.8. Cell maintenance of TRNP1 knock-out NHDF iPS cells and fluorescence imaging ...... 64 3.9. Establishing monoclonal cell lines from single-cell sorted TRNP1-KO iPS cells . 67 3.10. PCR screen and genotyping of monoclonal TRNP1 functional knock-out iPS cell lines ...... 68 3.11. Genomic off-target PCR screening and sequence analysis of TRNP1 target locus ...... 74 4. Discussion ...... 76 4.1. To PITCh, or not to PITCh - the power lies in your hand ...... 76 4.2. A convenient but effective screening method is key to the reliability of CRIS- PITCh experiments and gene manipulation ...... 77 4.3. Physical prerequisites meet physiological limitations during CRISPR gene editing - a stem cell’s point of view ...... 78 5. Outlook ...... 81 6. List of Figures ...... 83 7. List of Tables ...... 85 8. References ...... 86 9. Supplementary figures and tables ...... 95 List of abbreviations ...... 115

Summary CRISPR/Cas9 genome editing is at the forefront of becoming a vital tool for the study of genes and their functions in live organisms and cells. One particularly promising method for the application of genome editing is to precisely integrate foreign DNA into target chromosomes, referred to as the PITCh knock-in system. The underlying mechanism within this gene manipulation method relies on an alternative DNA-repair pathway active in most dividing cells: microhomology-mediated end-joining (MMEJ) of broken DNA. This pathway has been harnessed to site-specifically knock-in foreign genes into the genome of host cells and animals with considerable precision and efficiency.

During the course of this Master’s thesis, a functional knock-out approach using MMEJ- repair and the PITCh setup, to abolish the functions of human genes TRNP1 and TMEM14B in human induced pluripotent stem (iPS) cells, was pursued. These two genes are thought to play a major role during the development of the human cerebral neocortex, as they act and function specifically in basal radial glia (bRG) and intermediate progenitors (IPs) that reside in the outer subventricular zone (OSVZ) of the cortex. Their roles in genetic regulation and their effects in vivo have been modeled by overexpression and transcriptional repression studies (knock-down) in mouse brains. The factors’ roles in controlling the proliferation of progenitor cells in the OSZV as key regulators of cortex expansion and folding during development have been elucidated. However, a knock-out of these genes in the genome of human cells has thus far not been demonstrated. Therefore, this Thesis had the aim to perform such gene knock-outs in human iPS cell-derived cell models of the central nervous system. The materials and published guidelines of PITCh knock-in were adopted and modified for the purpose of achieving functional knock-outs of the genes through MMEJ integration of reporter genes at the coding gene loci. In silico design and molecular cloning of CRISPR donor constructs, including guide RNAs for precise locus targeting were the major tasks. Generated plasmids were introduced into iPS cells by nuclear transfection followed by clonal selection through means of flow cytometry. Monoclonal isolation of transformants was performed by single-cell fluorescence-assisted cell sorting (FACS) to generate at least four putative knock-out cell lines. Thorough molecular characterization efforts included target DNA sequencing and potential off-target analysis using polymerase chain reaction (PCR), yet no confirmed knock-out from analyzed samples was achieved. Such CRISPR/Cas9-edited iPS cell lines would provide the means for directed differentiation into neural cell culture systems, such as organoids, permitting an enhanced platform for modeling the roles of neural stem cells during early cortical developmental processes in vitro, e.g. by fluorescence imaging, qPCR and single-cell RNA-Seq.

Personal Contribution

The work presented here was accomplished by the author, except for the generation and establishment of iPS cell lines. NHDF iPS clone No. 101 cell line was generated and provided by Sandra Rizzi, PhD. Experimental design of CRISPR/Cas9 strategy and the choice of gRNAs, including microhomologies, was done by Sandra Rizzi. Cell culture works and nucleofections, including fluorescence-assisted cell-sorting, were done by Anita Erharter, MSc, and Marta Suarez Cubero, MSc. Protein expression and isolation of cloning enzymes, as well as preparation of chemically competent cells was done with help by Sonja Töchterle, MSc, Dominik Regele, MSc, and Andrea Walcher, MSc, (Dept. of Molecular Genetics and Developmental Biology, Institute of Molecular Biology, University of Innsbruck).

1. Introduction

1.1. Genome engineering and the use of programmable nucleases

A cornerstone of modern research in the field of molecular biosciences is the generation of genetically engineered organisms and cells. The applications of genome modification methods are diverse and can be used for altering genomes by highly specific insertion, deletion or replacement of DNA (Guha et al. 2017). Targeted gene editing approaches have been possible throughout the past decades. However, the low rates of successful experiments, defined by precise alteration events in the genome, have limited the availability of genetically altered organims models for research. The resulting difficulty in finding desired products in face of the common random integration of foreign DNA into the genome displayed a major problem (Lin et al. 1985).

While being dependent on spontaneous mutations caused by chemical treatment and radiation to study genetic factors in the 1940s, the later development of new methods made it possible to use transposable elements carrying foreign sequences to insert DNA into genomes of organisms (Auerbach et al. 1947). The exploitation of homologous recombination, naturally occurring in cells, was later harnessed to indroduce corrected genes into mammalian genome loci carrying disease-related mutations, albeit at extremely low frequencies (Thomas, K., R. et al. 1986). By looking into the cellular responses to double-strand breaks (DSB) in the genome, researchers found that intentionally introduced DNA breaks, such as the ones during meiotic crossing over and gene conversion, and their underlying repair pathways can be exploited to produce genetically manipulated organisms. At the basis of this are the development of reagents and biomolecules that can cause precise DSBs in chromosomal DNA, both generating local mutations from non-homologous end-joining (NHEJ) DNA-repair and providing the possibility for genome editing using homologous recombination (HR) (Carroll 2014). The first target-specific DNA nucleases to be used, called zinc fingers nucleases (ZFNs), specifically recognize genomic sequences and cut DNA via the type-IIS FokI restriction endonuclease (Li et al. 1992). ZFNs are composed of modular DNA-binding derivatives of transcription factors (TFs), detecting triplets of DNA bases. They are fused to a catalytic nuclease domain of the FokI restriction enzyme. The latter is functional as a dimer, therefore two of the ZFNs are required to cooperate to target and cleave a single genomic site. The requirement for correct DNA cleavage are the funger units’ specificity towards the target DNA strand. Appropriate DNA- binding is defined by a Cys2His2-motif interface, which features four amino acid residues coordinating a zinc atom and provides adequate contact between finger residues and DNA triplets (Kim et al. 1996; Carroll 2011). By laborious recombinant protein design, multiple alternative sequence recognition TF-like domains can be combined in the synthetic ZFN

1 protein to target virtually any sequence of the genome, on average at sites every ~ 500 bp (Gaj et al. 2013).

An enhancement of this system was provided by the discovery of genes of plant-pathogenic bacteria, encoding proteins known as transcription activator-like effectors (TALEs). Such genes promote and induce infection once incorporated into host cells. TALE proteins possess modules of tandem repeats, whose singlular residues vary in concert with the specific target DNA sequences at the contact sites. TALE modules are tightly apposed to each other while bound to DNA. Within the central TAL targeting domains of the naturally occurring TALE repeats are two repeat-like modules (repeat-variable di-residues) which make contact with a single nucleotide within the target DNA sequence (Moscou and Bogdanove 2009). The unravelling of TALE recognition properties made it possible to engineer a system similar to ZFNs, by fusing the catalytically active domain of the FokI endonuclease with the TALE module framework, generally referred to as transcription activator-like effector nucleases (TALENs). However, the nuclease domain still relies on the dimerization with second FokI-domain, requiring a dual-component system for double- stranded cleavage of DNA (Joung and Sander 2013). This technology is considered higher in efficiency compared to ZFNs since it is not confined by pairing of triplets of DNA sequences corresponding to zinc fingers, allowing for only limited potential targetable sites in the genome. One drawback is the laborious cloning of repetitive TALE sequences (Gaj et al. 2013).

Despite the effectiveness of the aforementioned methods, they have been overshadowed by the discovery of the bacterial CRISPR/Cas9, which rapidly emerged as the most common and easy-to-use system among molecular life scientists. This Master’s thesis deals with the use of CRISPR/Cas9 for genome editing in particular, therefore this system is described in more detail in the following paragraph.

1.2. The CRISPR/Cas9 system

The clustered regulatory interspaced short palindromic repeats (CRISPR) were discovered by researchers browsing the genomes of many bacteria and archaea almost 30 years ago. Although only in recent years, their underlying biological functions have been understood. CRISPR loci and CRISPR-associated (cas) genes emerged as part of a natural bacterial defense system against bacteriophage infection and plasmid transfer (Mojica and Rodriguez-Valera 2016). The CRISPR loci are composed of arrays of repetitive palindromic repeats, interspersed with foreign DNA sequences originating from invasive pathogens and therefore constitute a form of adaptive immunological memory of past invaders. In general,

2 the system interferes with and cleaves pathogenic DNA or RNA using Cas endonucleases and associated proteins which are guided to invasive nucleic acids via RNA molecules (Charpentier and Doudna 2013). While being exposed to invasive pathogenic DNA from phages or plasmids, short fragments of the viral genome are cleaved by Cas proteins and integrated as novel protospacers into the CRISPR repeat-spacer array of the host genome. This feature provides a genetic footprint allowing the bacterium to memorize viral infections and thereby adaptively resist future infections by the same pathogen (Garneau et al. 2010). The array system with its pathogen-derived protospacers is transcribed and enzymatically processed. Precursor-CRISPR transcripts undergo endonucleolytic cleavage across spacer-repeat units, yielding short, single-stranded CRISPR RNAs (crRNAs) of 20 to 23 nt complementary to the foreign DNA. Within the 5’-end of the crRNAs, a segment of the complementary sequence is referred to as the protospacer. The 3’-end is composed of a part of the repetitive sequence, mediating contact with Cas proteins. Annealing of spacer sequence with a foreign DNA target directs the Cas endonucleases to interrogate and cleave invading material (Bolotin et al. 2005; Brouns et al. 2008). A necessity for appropriate cleavage and degradation of foreign DNA is the existence of a 3 nt protospacer adjacent motif (PAM) sequence, whose identity and location are canonical for many CRISRP/Cas system (Figure 1) (Gasiunas et al. 2012). One unifying feature of different CRISPR systems is the necessity of Cas proteins to form crRNA-effector complexes in order to site- specifically target DNA. However, the three major classes of CRISPR/Cas systems encompass considerable functional and structural diversity and have therefore been subdivided into several types according to classification of CRISPR-cas loci. In type I and III CRISPR/Cas systems, expression and maturation of targeting machinery, as well as DNA interference is executed and controlled by a multisubunit CRISPR-associated protein complex, a Cas3 helicase component and/or other Csm-/Cmr-complexes. Notably, in type II, V and VI systems, which are most-well described in Streptococcus pyogenes, these functions are controlled by a single large Cas9 or Cpf1-related endonuclease (Makarova et al. 2015).

The type II CRISPR/Cas9-system has been in research focus due to a set of distinct features. It employs a single Cas9 DNA endonuclease from Streptococcus pyogenes (often referred to as SpyCas9) to recognize dsDNA. The Cas9 apoenzyme shows two distinct lobes, one being an alpha-helical recognition (REC) lobe and the other being the nuclease (NUC) lobe, containing the HNH-like and the RuvC-like domains. A C-terminal domain (CTD) within the NUC lobe mediates contact with the PAM sequences, although remains structurally disordered while Cas9 remains in an inactive state. These lobes are linked with two segments, comprising an arginine-rich helical bridge sequence and a largely disordered link. The REC lobe is defined by the structurally distinct alpha-helical domains Hel-I, Hel-II

3 and Hel-III, which are unique to this CRISPR system (Figure 2A and B). The ~ 160 kDa Cas9 protein is capable of hydrolytic cleave of target DNA 3 bp upstream of a PAM sequence, leaving blunt-ended, double-strand DNA breaks. Cas9 is equally important in the process of crRNA maturation and protospacer acquisition after the first contact with infectious DNA (Jinek et al. 2012; Jiang and Doudna 2017).

Figure 1: Type II CRISPR/Cas9 as a DNA interference system providing adaptive immunity in bacteria for defense against viral infection (Jiang and Doudna 2017).

A typical CRISPR/Cas type II system, encoded in the CRISPR/Cas locus, is comprised of a CRISPR array of repeats (blue diamonds, R) interspaced with fragments of foreign DNA spacers (light and dark green, orange, red). The locus is transcribed, providing transcripts for a tracrRNA scaffold sequence (light orange) and the cas operon which includes Cas9 endonculease (yellow) and CRISPR associated proteins (grey). crRNA maturation is mediated by specific cleavage events (arrowheads) and followed by tracrRNA annealing. Maturated single guide RNAs directs Cas9 endonuclease specifically to viral DNA upon re-infection of the memorized invader.

The association of matured crRNAs with an additional, non-coding RNA termed trans-activating crRNA (tracrRNA), which hybridizes with the crRNA at repeat sequences, forms a unique, dual guide RNA hybrid structure, generally referred to as single guide RNA (sgRNA). Complementary hydrogen bonding of the crRNA repeat portion with an adjacent tracrRNA anti-repeat part and additional 3 complementary loop-forming sequences (stem- loops one to three, SL1-3) towards the 5’-end of the sgRNA cause a sophisticated scaffold structure (Figure 2D). The main contact points between Cas9 and the sgRNA are provided by the repeat-anti-repeat structure and the SL1-2, which link it to the Cas9 nuclease domains (Jiang et al. 2016). After Cas9 protein translation, the apoenzyme is bonded with a single processed crRNA:tracrRNA hybrid to form a ribonucleoprotein complex (RNP). It is then recruited towards the DNA containing the ~ 20 bp target sequence. The PAM sequence, characterized by a conserved 5’-NGG-3’ motif for the type II Cas9-system, gets nestled in a positively charged groove in between the REC and NUC folds. It is directly interrogated by hydrogen bond readout of guanine dinucleotides in the major groove by dual arginine residues situated within a β-hairpin of the CTD. Notably, the first nucleotide of the motif remains base-paired with its complementary band upon coupling (Rohs et al. 2010). If a potential target with proper PAM pairing is found, Cas9 initiates the PAM duplex unwinding and samples for target sequences by flipping and rotation of unwound target nucleotides toward the guide sequence. Complete annealing of this strand to the protospacer allows the target sequence to reach the hydrolytic centers of the NUC lobe (Jinek et al. 2014). In the catalytically active protein, DNA cleavage is mediated by two nuclease domains within the NUC-lobe: the HNH-like endonuclease domain nicking the target DNA strand complementary to the crRNA protospacer and the split RuvC-like endonuclease domain which snips the opposite, non-target strand.

Structural insights into the molecular folds of inactive-state, unspecific DNA-associated Cas9 folding in comparison with the guide-linked, active Cas9 revealed two conserved RNase-type catalytic mechanisms causing DSB. A metal ion-dependent cleavage is achieved through coordination of two Mn+ ions via conserved histidines in the HNH domain (Jinek et al. 2014) and a two metal ion-dependent hydrolysis of phosphodiester backbones is driven via Mg2+ ions coordinating aspartate residues in the RuvC domain (Yang 2008).

Figure 2: Overview of Cas9 endonuclease protein structure and functional domains in inactive and active, guide RNA-bound forms (Jiang and Doudna 2017).

(A) Schematic overview of full-length Streptococcus pyogenes SpyCas9, composed of disjoined RuvC nuclease domains (blue), an arginine-rich helical bond (pink), helical domains I-III (grey), HNH nuclease domain (green) flanked by two linker regions L-I and L-II (yellow) and a C-terminal domain (violet). (Legend continued on next page)

The mechanism of target strand recognition is thought to begin with DNA unwinding to form a RNA-DNA hybrid. In particular, an R-loop formation occurs (a three-stranded nucleic acid structure), in which the guide segment of the crRNA invades the dsDNA helix, forming the helical hybrid structure with the target strand, while the opposing non-target strand is displaced. This non-target ssDNA strand runs parallel to the hybrid RNA-DNA heteroduplex and is accommodated into a side cavity within the NUC lobe. Together, these interactions direct the non-target strand into the RuvC domain active domain, resulting in conformational positioning of the scissile phosphate in the HNH domain to the target DNA strand (Jiang et al. 2016). Site-directed mutagenesis in this domain abrogates the Cas9 enzyme’s cleavage capacity, converting Cas9 into either a nickase, only producing single-strand breaks (SSB), while both site’s catalytic activity can be abolished to obtain a “dead” Cas9 (dCas9), permitting RNA-guided DNA binding exclusively (Jinek et al. 2012).

The premises for the underlying molecular arrangements are a) the association of Cas9 with crRNA:tracrRNA hybrids, b) complementary binding of sgRNA protospacer sequence with the DNA target and c) the bonding of the Cas9 CTD with the PAM sequence upstream of the target DNA strand. The CRISPR/Cas9 effector complex is assembled to form an active DNA interrogation machinery, wherein the most drastic conformational changes within Cas9 are observed at the REC lobe’s Hel-III domain. Upon sgRNA binding, the latter moves significantly towards the HNH domain (Figure 2C). Biochemical studies showed that the SL1-Cas9 bond is indispensable for proper Cas9-sgRNA complex formation, whereas stem loops and linkers in the sgRNA are stabilizing and ameliorating features towards Cas9 nuclease. Likewise, the ~ 10 nt sequence 3’ to the protospacer portion of the sgRNA, referred to as the seed sequence, was deemed critical for complex pairing and high targeting efficiency (Wiedenheft et al. 2011).

The CRISPR/Cas9-system has recently been reworked as a simplified platform using a synthetic sgRNA mimicking the default tracrRNA-crRNA structure (Ran et al. 2013). It has been used to facilitate precise genome engineering in eukaryotic cells, providing ease of customization of guides, diverse cleavage patterns (nicks and DSBs) and high editing efficiency.

Legend continued: (B) Ribbon representation (left) and surface view (right) show the crystal structure of Apo-SpyCas9 from PDB 4CMP at 2.62 Å resolution. (C) Ribbon structure (left) and surface view (right) of SpyCas9 PBD 4ZT0 at 2.9 Å resolution with sgRNA (orange) bound in groove between recognition (REC) and nuclease (NUC) lobes. Domains are colored according to above representation. (D) Schematic representation showing sgRNA duplexes (left) and ribbon representation with sigma-A weighted composite-annealed omit 2Fobs–Fcalc electron density map overlay (right); SL1-3 = Stem-loops 1-3.

The experimental design is mainly limited to the availability and on-target specificity of gRNA sequences and the presence of a PAM sequence. In the human genome, CRISPR- capable target sites can be found on average every 8-12 bp (Hsu et al. 2013), rendering this system capable of high-precision targeted genome engineering (Figure 3).

Figure 3: Overview of the CRISPR/Cas9 system for gene editing and possibilities of gene manipulation through various DNA-repair mechanisms (modified from Ran et al. 2013).

Cas9 and customized, synthetic guide RNA (gRNA) expression provide the means of site-specific DNA cleavage. Harnessing endogenous micro- or non-homologous end-joining DNA-repair, or homologous DNA recombination pathways, enables targeted genome engineering. In typical end- joining DNA-repair, sites of cleavage are re-connected through direct end-ligation or via microhomologies (flat red bars, lower left panel) in a deleterious manner, causing indel mutations. High precision homology-directed repair requires a template DNA, either from the sister chromatid or from exogenous sources (light blue) with larger flanking homologous ends to reconstitute the compromised DNA site.

CRISPR/Cas9 experiments usually request the user to start by browsing genomic databases to find suitable CRISPR target sites. Depending on the type of experiment and on genetic and physical prerequisites, guide libraries and sgRNA design software can be used to aid experimental setup and improve the overall effectiveness of CRISPR tools. Since a number of recombinant Cas9 or Cas-related proteins exist, the spacer properties and PAM sequences may vary. A guide sequence’s specificity is further confirmed by the basic local alignment search tool (BLASTN) for matches within the respective genomes. Additionally, there are tools that may aid with the identification of suitable loci and off-targets based on sequence similarity, e.g. CCTop (Cui et al. 2018; Graham and Root 2015).

Following guide design and plasmid cloning, the strategy of delivery of CRISPR components into cells or organisms is of key importance. Respective components are typically encoded on episomal vectors containing coding sequence(s) for guides and Cas- proteins. In general, the components can be delivered by the following three methods: a) plasmid-based CRISPR/Cas9, i.e. introduction of all vector DNA-encoded constructs for in vivo expression; b) in vitro transcribed Cas9-mRNA and sgRNA introduction for directed in vivo translation; c) in vitro, pre-assembled recombinant Cas9/sgRNA ribonucleoprotein complex introduction into cells. The delivery of these components is commonly done by heat-shock, electroporation and uptake via gold nanoparticles or cationic lipids in prokaryotic and eukaryotic cells, respectively. Other methods involve microinjection into cells and approaches using parvo-/retroviral infection (Andeno-associated virus, Lentivirus) are also common (Lino et al. 2018).

1.3. Microhomology-mediated end-joining (MMEJ) DNA-repair

Organisms are constantly exposed to intrinsic and environmental insults. They experience damages to DNA and chromosomes that, if not repaired, lead to mutations and gross chromosomal instabilities. Arguably the most harmful effects are inflicted by breaks of both DNA strands in the double helix, potentially leading to mutagenesis in coding and regulatory sequences or chromosomal rearrangement, which are the most common underlying causes for a host of genetic diseases and cancer (Bohgaki et al. 2010). Specialized sensory mechanisms and repair machineries have evolved to counteract double-strand breaks and to preserve genetic material and genomic integrity. DNA-repair processes are differentially employed throughout the cell cycle. Two major forms of repair exist: classical non- homologous end-joining (C-NHEJ) and homology-directed repair (HDR), each diverse in mechanistic principles and genetic dependencies (Sancar et al. 2004). HDR is considered an error-free, high-fidelity mechanism capable of seamless repair through template acquisition of the intact homologous sister chromatid or an available template donor. This 9 mechanism is active only in the G2 and S phases of the cell cycle and is mechanistically dependent on the product of the RAD51 gene. It initiates repair at the site of DSB using a 5’-3’ exonucleolytic DNA end resection, thereby producing a long 3’ single stranded DNA tail. The latter invades and binds the homologous repair donor sequence, priming repair by DNA synthesis (Symington and Gautier 2011). An alternative to the HDR pathway is classical NHEJ DNA-repair and involves the direct ligation of endonucleolytically processed DNA ends. In general, NHEJ is most active in G1 phase, but has been demonstrated to play a role throughout the entire cell cycle (Zhang et al. 2009). Studies on the biochemical repair of DSBs in mammalian cell systems propose a kinetic model in which simple, heterochromatic and complex DNA breaks are reconditioned in the G1 and early S phase of the cell cycle (Taleei and Nikjoo 2013). Much of the understanding about biochemical mechanism of MMEJ originates from genetic analysis using cell models and in vitro experiments. While it was initially characterized to function when dominant NHEJ was compromised, it has been known to operate even in the context of intact HDR and NHEJ machinery (McVey and Lee 2008). Ku70/Ku80-dependent heterodimer association at juxtaposing DNA ends is a common necessity for the recruitment of a number of NHEJ factors. These include DNA-dependent protein kinase subunits (DNA-PKcs), X-ray repair cross complementing 4 (XRCC4) among others (Lieber 2008). Prior to junction site repair, the DNA ends may not be compatible for end-ligation so that end-processing through e.g. fill-in synthesis, blocking end-removal, trimming and/or polynucleotide-dephosphorylations may occur. Ultimately, the processed DNA ends are re-joined by DNA ligase 4 (LIG4), rendering this pathway prone for errors, associated with small alterations at junction sites (Heyer 2015). Early studies on classical NHEJ-deficient cells also identified alternative NHEJ (A-NHEJ) mechanisms, of which microhomology-mediated end-joining DNA-repair was observed to play an important role for the resolution of DSBs. Although still debated whether MMEJ displays a DNA-repair pathway separate to C-NHEJ, or not, both are characterized by overlapping mechanistic features (McVey and Lee 2008). Transformation studies in Saccharomyces cerevisiae revealed that linearized plasmids would integrate into the genome causing sustained deletions with the appearance of 5-15 bp microhomologies (MHs) at the junctions. This was also observed in Ku70/Ku80-deficient mutants, suggesting that MMEJ is a separate pathway (Boulton and Jackson 1996). Later, evidence of MMEJ engagement in mammalians emerged from studies of chromosomal translocations. It was observed that recombination-activating gene (RAG)-induced breaks in the genomes of mice lacking C-NHEJ factors were rejoined with extensive MH occurrences at cleavage sites (Robert et al. 2009). Whether or not MMEJ plays a major role under settings of high levels of HDR and NHEJ activity is still unknown. Notably, the genetic prerequisites for MMEJ and frequencies of MH-associated repair display differences across species and hold

10 discrepancies when comparing the outcome of studies using NHEJ-component deficient mutants (Sfeir and Symington 2015). The principle of MMEJ DNA-repair (outlined in Figure 4) is defined by end-resection of opposing strands, flanking microhomology annealing, fill-in synthesis and DNA end-ligation (Sallmyr and Tomkinson 2018).

Figure 4: Overview of microhomology-mediated end-joining (MMEJ) as an alternative non- homologous end-joining DNA-repair pathway (A-NHEJ) active in dividing cells (modified from McVey and Lee 2008; Sallmyr and Tomkinson 2018).

The depicted pathway and described factors include those identified in mammalian cell studies. For orthologues and factors in the yeast MMEJ DNA-repair pathway, refer to the literature. Abbreviations and color code: microhomology (MH, yellow), poly-ADP ribose polymerase 1 (PARP1, light grey), Mre11-Rad50-Nbs1 (MRN, light green), CtIP (orange), BLM RecQ like helicase/exonuclease 1 (BLM/EXO1, blue), Xeroderma pigmentosum/excision repair cross-complementing 1 (XPF/ERCC1, medium grey), DNA-ligase 3/1 (LIG3/1, dark grey), DNA polymerase theta (Polθ, red), X-ray repair cross complementing 4 (CRCC1, dark green).

Operationally, end resection to expose the complementary MHs is hypothesized to occur in a similar fashion as in HDR. In mammalians, the MRN complex (Mre11-Rad50-Nbs1) associates with the endonuclease CtIP at DNA break lesions, introducing nicks followed by 3’-5’ exonucleolytic degradation of flanking strands caused by BLM/EXO1 nuclease. Covalent adducts (hairpin-capped ends or proteins) at the MHs are also removed by CtIP, enabling the homologous annealing of short MHs (Langerak et al. 2011). The stability of hybridized intermediates are likely dictated by size and GC-content of MHs. A role of poly- ADP-ribose polymerase PARP1 for facilitation and priming of the repair has also been implicated (Mateos-Gomez et al. 2015). The sizes of individual MHs, as well as their corresponding repair efficiencies have been reported to vary significantly. However, sequences of ≤20 nt to as few as 1 nt in length seem to be generally accepted as MHs (Decottignies 2007; Wang and Xu 2017). The low-fidelity DNA polymerase θ (encoded by POLQ) is implicated in MMEJ to detect free 3’-hydroxyl termini and is capable of extending partial or even mismatched ssDNA through its C-terminal polymerase domain (Arana et al. 2008). Additionally, structural analysis showed that Polθ harnesses intrinsic SF2-like helicase activity, although its function is currently poorly understood and is mainly thought to stabilize and drive synapsis of DNA-ends (Kent et al. 2015). Furthermore, the fill-in synthesis process is likely to be tainted with junctional diversity, as it is possible that a number of nucleotides can be added de novo resulting from non-templated extension of 3’-termini (Seol et al. 2018). Heterologous flaps occur 3’ of the annealing MHs and have to to be removed prior to polymerase extension. These non-homologous tails are cleaved by the XPF/ERCC1 nuclease complex and novel DNA-ends are stabilized by XRCC1, which is hypothesized to support the DNA-ligation redundantly catalyzed by LIG3/LIG1 (Liang et al. 2008). Although DSB DNA-repair pathways prevent catastrophic outcomes and provide cells with the means to rapidly prevent chromosomal instability, the genetic consequence is that MMEJ plays a major role in DSB response and mutagenesis. DSB sites have often been reported to contain short, partially templated or non-templated insertions. Error-prone repair synthesis of Polθ is likely to be accounted for that consequence (van Schendel et al. 2016).

Recently, the properties of MMEJ DNA-repair have been harnessed for targeted gene editing in cells and embryos. The system relies on microhomologies of ~ 20 bp to specifically introduce transgenic reporter sequences in-frame with endogenous protein coding sequences. The exogenous integration of donor DNA into silk worms, frogs and human cells was demonstrated at a facet of high efficiency and minimal unspecific off-target cleavage (Sakuma et al. 2016). The system is referred to as the CRIS-PITCh system (Nakade et al. 2014). It employs a singular expression vector containing cDNA encoding Cas9, synthetic, gene-specific gRNAs and a so-called generic PITCh gRNA (Figure 5A).

Figure 5: Mechanistic principle of the precise integration into target chromosome (PITCh) system, employed by Sakuma et al., for targeted gene knock-in using microhomology-mediated end-joining DNA-repair.

(A) Plasmids encoding Cas9 and gRNA/PITCh gRNA system are co-transfected into cells or injected into early morula embryos along with a repair donor vector, encoding reporter genes. (B) The customized system simultaneously employs a guide RNA for specific genomic site cleavage (blue) and a PITCh gRNA (red) for excision of the repair template from the donor construct via Cas9 (red marks). (C) MMEJ response during G2/S-phases promotes incorporation of the reporter gene via adjacent MHs (blue dotted lines), permitting the generation of knock-in animals and cells.

The vector is co-transfected into cells or injected into fertilized eggs along with a pCRIS- PITCh donor vector containing a coding sequence for a fluorescent reporter which is flanked on both sides with generic sequences recognized by PITCh gRNAs. Cas9 then cleaves the repair template sequence from the donor vector. It may be introduced into the junction site

13 upon Cas9 cleavage with considerable precision via MMEJ DNA-repair. Sakuma and peers demonstrated a C-terminal fusion of nucleolar fibrillarin with enhanced green fluorescent protein (EGFP), shown in Figure 5B and C. In combination with customized donor repair templates for homology-directed repair of chromosomal DSBs, the use of ZFNs, TALENs or CRISPR/Cas9 provide the means for versatile genetic experiments such as site-directed mutagenesis, gene repair or transgenesis. The advantages of the CRIS-PITCh system and related HDR-based technologies lie at hand: efficient genomic knock-ins can be achieved by simple exchange of guide sequences of an all-in-one expression vector; donor templates and microhomolgies are chosen according to experimental needs while the necessary efforts for preparation of components is minimal. Remarkably, the system allows for generation of transgenic embryos within 1 week or cells within 3-6 weeks from experimental planning to final genotype confirmation. The PITCh system has one particular benefit with regards to material preparation: in contrast to HDR-mediated gene knock-ins, in which the inclusion of up-to multi-kb homology arms flanking the repair donor construct is necessary, MHs can easily be indroduced by few cloning steps.

1.4. Induced pluripotent stem cells

A fundamental notion of stem cells is that they have the potency to divide and differentiate into many different types of cells while also being capable of self-renewal. While it is possible that the mother cell maintains potency and tissue resident stem cell populations, daughter cells may undergo differentiaion (Chagastelles and Nardi 2011). In mammals, the fertilized egg until the 4 to 8 cell-stage is defined totipotent, meaning it can build the entire embryonic lineages, forming the body and germ cells, as well as the extraembryonic tissues placenta, amnion and yolk (Stephenson et al. 2012). Embryonic stem (ES) cells, which are found shortly after the 8-cell stage in the inner cell mass of the developing blastocyst, covered by an outer trophectodermal layer of cells (the later fetal portion of the placenta), are considered pluripotent (Johnson et al. 1981). They are capable of producing all the cells of the embryo. Importantly, the inner cell mass can be isolated and cultured ex vivo, where one may derive cells of pluripotential capacities, enabling differentiation into any cell type of the body (Martin 1981). At the onset of embryonic development, germ layer formation and expansion of differentiated cells is driven by a defined population of pluripotent stem cells. They typically function to generate a multitude of cell types restricted to the specificity of the tissues in which they reside (Eckfeldt et al. 2005). Multipotent stem cells are the key drivers of organogenesis during embryonic development and play critical roles in tissue regeneration in the adult body (Bindu and Srilatha 2011). Stem cells may divide symmetrically, producing daughter cells with the same fate during mitosis: either two

14 differentiated cells, resulting in the expansion of tissue and the reduction of stem cell population, or two self-renewing stem cells, increasing the resident stem cell pool respectively. Alternatively, niche-residing stem cells can also undergo asymmetric mitoses, leading to the commitment to differentiation in one daughter cell, while the other maintains potency and self-renewal (Knoblich 2008). Pluripotency promoting mechanisms have long been the focus of extensive research. The main regulatory transcription factors OCT4, SOX2 and NANOG have been deemed key regulators to maintain the uncommitted self- renewing state of stem cells and functional pluripotency (Niwa 2001; Shi and Jin 2010). Despite efforts to derive and stably expand human embryonic stem cells in vitro, their use for basic research and potential clinical implications have been restricted due to ethical concerns. To overcome these constraints, stem cells of great potency were generated from somatic cells by transfer of nuclear contents into oocytes or fusion of differentiated cells with embryonic stem cells. First reports came from Gurdon in 1962. It was shown that the transfer of embryonic and somatic cell nuclei could be transplanted into enucleated eggs that yielded sexually reproducing Xenopus laevis adults. In 2006, Takahashi and Yamanaka were able to specifically reprogram fully differentiated somatic cells of the mouse into a pluripotential-like state through transduction with four transcriptional factors Oct3/4, Sox2, Klf4 and c-Myc (OSKM). This has become known as the reprogramming of cells into induced pluripotent stem (iPS) cells. A year later, human iPS cells were established from human foreskin fibroblasts (Takahashi et al. 2007). Such reprogrammed iPS cells were equally able to differentiate into cells of all three germ layers and were capable of termatoma formation upon introduction into immunodeficient mice. iPS cell technologies have further developed to enable rapid production of different lineage- specific progenitor cells or entire tissues from iPS cells. Furthermore, the formation of embryoid bodies (EBs), representing three-dimensional aggregates of cells possessing the primitive ability of germ layer formation, resembling in vivo gastrulation have been demonstrated (Rungarunlert et al. 2009). iPS cells are focus of extensive research for the directed differentiation into organ- or tissue specific cells in vitro (Zhang and Jiang 2015; Li et al. 2014) and in the reprogramming of patient-derived somatic cells, opening promising ways in regenerative biology and disease modeling (Rawat and Singh 2017). The development of CRISPR/Cas as the state-of-the-art approach for gene manipulation and its use in iPS cells and iPS cell-derived models is reported in the literature at ever increasing rates. Great focus is put into the investigation of causative mutations and the underlying genetic background in inherited diseases (reviewed in Ben Jehuda et al. 2018). For instance, knock-out of single genes in human iPS cells through NHEJ to generate disease models, e.g. for rare dominant dystrophic epidermolysis bullosa (Webber et al. 2016). Knock-out-through NHEJ has been used in iPS cells to restore normal gene function,

15 e.g. for a model of fragile X syndrome (Park et al. 2015). HDR-repair after CRISPR/Cas9 DSBs was reported in studies on amyotrophic lateral sclerosis (ALS) using patient-specific iPS cells to generate corresponding isogenic controls (Wang et al. 2017). Besides common approaches, CRISPR and the piggyBac transposon have been combined to correct the compromised human hemoglobin beta gene, causing β-thalassemia, in iPS cell-derived hematopoietic stem and progenitor cells (Xie et al. 2014). CRISPR interference (CRISPRi), a method to repress gene function, has been used to study the cardiac disorder long QT syndrome, allowing for precise electrophysiological experimentation following interference of a gene coding for a voltage-gated channel in patient-derived, mutated iPS cells (Limpitikul et al. 2017). In addition to biomedical research purposes and iPS cell models to study diseases, CRISPR itself has been engaged in cellular reprogramming of human skin fibroblasts into iPS cells. CRISPR gene activation (CRSIPRa) and its high multiplexing capability have been used to target endogenous OCT4, SOX2, KLF4, MYC and LIN28A promoters, thereby improving the basal reprogramming efficiency by orders of magnitudes (Weltner et al. 2018). A host of experiments are being made possible through CRISPR/Cas editing in iPS cells, however, the refinement of these technologies permits researchers to functionally assess the stampede of empirical data generated by genome-wide association studies. Genome editing in these cells can be used to engineer variant alleles observed or identified in such studies and therefore eases the association of phenotypic settings with specific genetic conditions. This way, the effects of non-coding mutations, mutations in promoters or enhancer polymorphisms on relevant tissue-specific cellular behaviors are studied (Hockemeyer and Jaenisch 2016).

1.5. Aims of the Thesis

The primary aim of this Master’s thesis was to explore the strategy of genome editing in human induced pluripotent stem cells via CRISPR/Cas9 system employing the DNA-repair mechanism pathway of microhomology-mediated end-joining (Sakuma et al. 2016). The method has been used to procure the efficient generation of transgenic knock-in cell lines and animals using little cloning efforts. However, thus far, CRIPSR/Cas9 gene knock-out experiments based on MMEJ DNA-repair in iPS cells for the purpose of generation of iPS cell-derived neural stem cell models, have not been published.

In our laboratory, this protocol was adapted for use in human iPS cells to study the genetic functions of candidate genes involved in human cerebral neocortex development. In particular, CRISPR/Cas9 and MMEJ have been used to generate gene knock-outs of human genes TRNP1 and TMEM14B. The underlying strategy was to perform PITCh knock-ins primarily at exonic loci to abolish the genes’ functions. To this end, in silico design 16 of plasmid tools for a) expression of Cas9 endonuclease with appropriate guides and b) different donor repair-templates for knock-in are necessary. Molecular cloning of CRISPR constructs and plasmid preparation therefore constitute the main focus of this work.

The delivery of these components into human iPS cells is performed and refined using nucleofection protocols to permit effective plasmid uptake under minimal loss of cell viability. Upon that, one major task is be to isolate and identify putative monoclonal cell lines via flow cytometric applications enabling single-cell clonal expansion of targeted cells. The verification for successful gene targeting at the desired gene loci is of main importance. It is also needed to determine if off-target cleavage events have occurred due to unspecific Cas9 activity within isolated iPS cell lines. Therefore extraction of genomic DNA, locus- specific sequencing and/or heteroduplex analysis is required. Ultimately, the objective is to obtain viable monoclonal TRNP1 and TMEM14B knock-out iPS cell lines which retain their proliferative and pluripotential capacity for further experimental use.

2. Materials and Methods

2.1. Materials

Table 1: Cell lines

iPS cell line Properties Reference NHDF iPS Cl. 101 Sendai virus-mediated overexpression Rizzi, S., of non-integrative Yamanaka factors in (unpublished) normal human dermal fibroblasts (NHDF) (ATCC®)

Commercially available cell Supplier Cat. No. lines Mouse (ICR) inactivated Gibco™, Thermo Fisher Scientific Inc. A24903 embryonic fibroblasts 2M feeder cells

Table 2: Cell culture materials and reagents

Basic culture media Supplier Cat. No. DMEM, high glucose, pyruvate Gibco™, Thermo Fisher Scientific Inc. 2062233 DMEM/F-12, no glutamine Gibco™, Thermo Fisher Scientific Inc. 21331046 StemMACSTM iPS-Brew XF, MACS Miltenyi Biotec 130-104-368 human

Dissociation enzymes Supplier Cat. No. StemPro AccutaseTM cell Gibco™, Thermo Fisher Scientific Inc. A1110501 dissociation reagent Trypsin-EDTA 0.05 %, phenol-red Sigma-Aldrich ® T3924

Cell culture reagents Supplier Cat. No. 2-Mercaptoethanol (2-ME) Gibco™, Thermo Fisher Scientific Inc. 21985023 DMSO CryoMACS ® MACS Miltenyi Biotec 170-076-303 Dulbecco’s phosphate buffered Sigma-Aldrich ® D8537 saline Fetal bovine serum, qualified, Gibco™, Thermo Fisher Scientific Inc. 10270106 Brazil Gelatin from porcine skin Sigma-Aldrich ® G1890 KnockOutTM Serum replacement Gibco™, Thermo Fisher Scientific Inc. 10828010 L-Glutamine (200 mM) Invitrogen, Thermo Fisher Scientific Inc. 25030081 MatrigelTM Basement membrane Corning 354277 matrix, hESC-qualified NEAA Non-Essential Amino Acids Gibco™, Thermo Fisher Scientific Inc. 11140035 (100X) Penicillin-Streptomycin (10,000 Gibco™, Thermo Fisher Scientific Inc. 15140122 U/mL) StemMACSTM Y27632 Rho- MACS Miltenyi Biotec 130-104-169 associated kinase inhibitor

Cell culture dishes and hardware Supplier Cat. No. CELLSTAR ® Cell culture 48-well plate Greiner BIO-ONE 677102 CELLSTAR ® Cell culture 6-well plate Greiner BIO-ONE 657160 CELLSTAR ® Cell culture 96-well plate Greiner BIO-ONE 650101 CELLSTAR ® Cell culture dish 3.5 cm Greiner BIO-ONE 627160 Eppendorf® PCR Tubes 0.2 mL, PCR Eppendorf® 0030124359 clean, 8-tube strips Eppendorf® Safe-Lock microtubes, PCR Sigma-Aldrich Z606316 clean 1.5 mL NuncR ® CryoTubes ® Sigma-Aldrich V7509 PETRI-DISH, PS, 94/16 mm with vents Greiner BIO-ONE 633102

Table 3: Chemicals and reagents

Chemicals and reagents Supplier Cat. No. 10X BamHI-Lsp1109I Buffer Thermo Scientific™ Inc. B57 10X Buffer G Thermo Scientific™ Inc. BG5 10X Buffer Tango Thermo Scientific™ Inc. BY5 10X PBS, pH 7.4 Gibco™, Thermo Fisher Scientific Inc. 700110044 10X T4 DNA Ligase buffer Thermo Scientific™ Inc. B69 2-Propanol CARL ROTH ® T902.1 5X Phusion GC Buffer Thermo Scientific™ Inc. F519L 6X DNA Gel loading dye Thermo Scientific™ Inc. R0611 Acetic acid ethyl ester CARL ROTH ® 7338.1 Agar powder, for microbiology Sigma-Aldrich ® 05040 Ampicillin sodium salt BioChemica PanReac AppliChem ITW Reagents A0839 ATP solution (100 mM) Thermo Scientific™ Inc. R0441 Betaine hydrochloride Sigma-Aldrich ® B3501-100G D-Glucose PanReac AppliChem ITW Reagents A3730, 1000 Dimethyl sulphoxide (DMSO) CARL ROTH ® 4720.1 dNTP set 100 mM solutions Thermo Scientific™ Inc. R0181 Endotoxin binding reagent Thermo Scientific™ Inc. R1601 Ethanol, 96 % Sigma-Aldrich ® 1009832500 Ethidium bromide CARL ROTH ® 2218.3 Ethylenediamine tetraacetic acid CARL ROTH ® CN06.2 (EDTA) GeneRuler 1 kb Plus DNA ladder Thermo Scientific™ Inc. SM1331 GeneRuler 100 bp DNA ladder Thermo Scientific™ Inc. SM0241 Glacial acetic acid Sigma-Aldrich ® 537020 Glycerol anhydrous BioChemica PanReac AppliChem ITW Reagents A1123, 1000 18

Hydrochloric acid (36.5-38.0%) Sigma-Aldrich ® H1758 Invitrogen™ UltraPure™ agarose Thermo Scientific™ Inc. 16500-100 KCl PanReac AppliChem ITW Reagents A2939, 1000 KH2PO4 CARL ROTH ® 3904.1 MgCl2 * 6 H2O CARL ROTH ® 2189.1 MgSO4 * H2O CARL ROTH ® Na2HPO4 * 2 H2O PanReac AppliChem ITW Reagents A2942, 1000 NaCl PanReac AppliChem ITW Reagents A2942, 1000 Phenol/Chloroform/Isoamylalcohol CARL ROTH ® A156.2 Polyethylene glycol 8000 (PEG 8000) Promega V3011 Sodium acetate CARL ROTH ® 6773.2 Sodium dodecyl sulphate (SDS) CARL ROTH ® 4360.2 Sodium hydroxide, pellets Sigma-Aldrich ® 221465 Spectinomycin dihydrochloride PanReac AppliChem ITW Reagents A3834 5-hydrate BioChemica TRIS PUFFERAN® CARL ROTH ® 5429.3 Tris-Hydrochloride, Molecular biology Promega H512a grade Tryptone PanReac AppliChem ITW Reagents A1551, 1000 Yeast extract PanReac AppliChem ITW Reagents A1552, 1000

Table 4: Bacterial cell lines for molecular cloning

Bacterial cell lines Supplier Reference TOP10, chemically competent Homemade (origin. Invitrogen) 200236* XL1 Blue, chemically competent Homemade (origin. Agilent/Stratagene) 5429.3* *For genotypes, see: https://international.neb.com/tools-and-resources/selection-charts/competent-cell- product-comparison (accessed: 2019/06/24)

Table 5: Recombinant enzymes for cloning and assembly

Enzymes Supplier Cat. No. 2x PCR TaqNova-RED PCR Master Blirt RP85T mix BamHI (10 U/µL) Thermo Scientific™ Inc. ER0051 BpiI (BbsI) (10 U/µL) Thermo Scientific™ Inc. ER1011 DpnI (10 U/µL) Thermo Scientific™ Inc. ER1701 FastAP thermosensitive alkaline Thermo Scientific™ Inc. EF0651 phosphatase (1 U/µL) Pfu-Sso7d (Phusion) polymerase Homemade Wang et al. 2004 Proteinase K from Tritirachium album Sigma-Aldrich ® P6556 RNAse I (10 U/µL) Thermo Scientific™ Inc. EN0601 T4 DNA Ligase (5 U/µL) Thermo Scientific™ Inc. EL0014 T4 Polynucleotide kinase (10 U/µL) Thermo Scientific™ Inc. EK0031 Taq-Sso7d (S-Taq) polymerase Homemade Wang et al. 2004 XbaI (10 U/µL) Thermo Scientific™ Inc. ER0682

Table 6: Isolation and purification kits

DNA purification kits Supplier Cat. No. GeneJET Gel extraction kit Thermo Scientific™ Inc. K0692 GeneJET PCR purification kit Thermo Scientific™ Inc. K0702 GeneJET Plasmid Midiprep kit Thermo Scientific™ Inc. K0481 GeneJET Plasmid Miniprep kit Thermo Scientific™ Inc. K0503 Mix2Seq overnight Eurofins Genomics Germany GmbH n. a.

Table 7: Laboratory equipment

Machines and laboratory equipment Supplier Cat. No. Arktik™ Thermal cycler Thermo Scientific™ Inc. TCA0002PROM BD FACSMelody™ cell sorter BD Biosciences n. a. Biotech E-BOX VX2 gel documentation Peqlab Biotech n. a. system Eppendorf® ThermoMixer® F1.5 Eppendorf® 5384000012 Fisherbrand™ accuSpin™ Micro 17R Thermo Scientific™ Inc. 13-100-676 Gel electrophoresis chamber 200 mL PEQLAB Life Science n. a. Gel electrophoresis chamber 50 mL PEQLAB Life Science n. a. Heraeus™ Multifuge™ X1 centrifuge Thermo Scientific™ Inc. 75004250 CO2 incubator HERAcell ® 150 Thermo Scientific™ Inc. 50116047 KS-15 CONTROL Shaker (37 °C) EB® GmbH 444-9212 Herasafe™ KS (NSF) Thermo Scientific™ Inc. 51022485 Leica DMi8 microscope Leica Microsystems GmbH n.a. Leica inverted microscope DM IL LED Leica Microsystems GmbH n.a. MilliPore water purification system n.a. n.a. Nanodrop™ 2000 Spectrophotometer Thermo Scientific™ Inc. ND-2000 Thermal cycler, Doppio, with 2×48-well VWR® 732-2552 universal blocks TX-400 4 x 400mL swinging bucket rotor Thermo Scientific™ Inc. 75003181

Table 8: Media compositions and cell culture reagents recipes

MEF medium Final concentration DMEM, L-glutamine 45 mL FCS 5 mL 10 % (v/v) NEAA 500 µL 1 % (v/v) 2-Mercaptoethanol 100 µL 100 µM

Phosphate-buffered saline (PBS), 10X stock Final concentration NaCl 80 g 1.37 M KCl 2 g 27 mM Na2HPO4 * 2 H2O 14.4 g 100 mM KH2PO4 2.4 g 18 mM dH2O add to 1 L 1 L (pH 7.4)

Table 9: Compositions for bacterial culture media, buffers and cloning reagents

Lysogeny broth (LB) medium Final concentration Tryptone 10 g 1 % Yeast extract 5 g 0.5 % NaCl 5 g 90 mM

Reagents dissolved in 900 mL of dH2O, pH-adjusted to 7.0 with 5 M NaOH, filled up to final 1 L volume and autoclaved. LB medium was supplemented with antibiotic solutions as described below if necessary. The solution is stored at 4 °C.

Super optimal broth with catabolite repression (SOC) medium Final concentration Tryptone 10 g 1 % Yeast extract 5 g 0.5 % 5 M NaCl 2 mL 10 mM 1 M KCl 2.5 mL 2 1 M MgCl2 10 mL 10 mM 1 M MgSO4 10 mL 10 mM

Reagents dissolved in 900 mL of dH2O, pH-adjusted to 7.0 with 5 M NaOH, filled up to final 1 L volume and autoclaved. After that, 9.9 mL of SOB medium can be supplemented with 100 µL sterile 2 M Glucose solution to obtain SOC medium with 20 mM Glucose concentration. The solution is stored at 4 °C.

50X TAE (Tris acetate/EDTA) electrophoresis buffer 50X Final concentration TRIS PUFFERAN® 242.2 g 2 M 40 mM EDTA 18.61 g 50 mM 1 mM Glacial acetic acid 57.1 mL 1 M 20 mM ddH2O to 1 L

Tris base and EDTA were dissolved in ~ 700 mL ddH2O, acetic acid added and volume adjusted to 1 L. The 50X stock is diluted in dH2O for 1X electrophoresis buffer, providing a pH of ~ 8.6.

2X Annealing buffer Final concentration 1 M Tris-HCl pH 7.5 2 mL 20 mM 500 mM NaCl 2 mL 10 mM 10 mM EDTA 2 mL 2 mM ddH2O 4 mL to 10 mL

Reagents were mixed and sterile-filtered by passing the solution through a 0.25 µm filter.

Lysis buffer (stored at room temperature) Final concentration 1 M Tris-HCl pH 8.5 5 mL 100 mM 10 % SDS in ddH2O 0.5 mL 10 mM 10 mM EDTA 2.5 mL 2 mM 500 mM NaCl 2 mL 200 mM Proteinase K 25 µL 10 µg/mL ddH2O 40 mL to 50 mL

Reagents were mixed and sterile-filtered passing the solution through a 0.25 µm filter, stored at room temperature. Proteinase K solution was thawed and added before use. For production of LB agar plates, LB medium stock reagents were supplemented with 1.5 % agar (i.e. 15 g/L) before autoclaving. The stock solution can be stored at 4 °C until use. To produce agar plates, the stock solution is heated in a microwave oven to solubilize the medium and cooled down to 50 °C. Antibiotics stocks were prepared in ddH2O, sterile- filtered and stored at -20 °C. They were thawed and added to the medium shortly before

21 casting gels. The work was carried out beside a Bunsen burner flame. Plates were stored at 4 °C for a maximum of 1 month.

Table 10: Antibiotic concentrations used for bacterial work

Antibiotic compound Stock (1000X) Final concentration Ampicillin in ddH2O 100 mg/mL 100 µg/mL Spectinomycin in ddH2O 50 mg/mL 50 µg/mL

2.2. Methods

2.2.1. Molecular cloning and plasmid preparation

Sequence manipulation for in silico generation and modification of vector construct data was done with the SnapGene ® Viewer 3.2.1 (https://www.snapgene.com/snapgene- viewer/)1. Vector data, including data for the default CRISPR design were used and adapted from published protocols (Ran et al. 2013; Sakuma et al. 2016).

2.2.2. gRNA and microhomologous sequences

CHOPCHOP v3 web tool (https://chopchop.cbu.uib.no/)2 was used for selection of suitable genomic target sites for CRISPR genome editing. Target gene RefSeq accessions in the Homo sapiens (hg38/GRCh38) genome are outlined in Table 11. These were entered into the CHOPCHOP web tool using the default CRISPR/Cas9 preset for knock-out. The specificity was set to include all sites within exons and UTRs, providing a PAM sequence of the type 5’-NGG-3’ with a target sequence length of 20 nucleotides. The method for determining off-targets in the genome was set to a maximum of 3 mismatches within the protospacer sequence (Hsu et al. 2013).

Table 11: Target gene reference sequence accession data obtained from NCBI GenBank

NCBI reference sequence Gene Definition accession (RefSeq) Homo sapiens TMF1 regulated nuclear TRNP1 NM_001013642 protein 1 (TRNP1), mRNA Homo sapiens transmembrane protein 14B TMEM14B NM_001127711 (TMEM14B), transcript variant 2, mRNA

CRISPR/Cas9-sgRNA sequences, hereinafter referred to as gRNA sequences, were chosen considering genomic positions and efficiency scores, calculated from parameters including GC-content, self-complementarity and the number of target sequence mismatches (for detailed illustrations, refer to the supplementary figures 26

1,2 Accessed 2019-06-30

22 to 29, respectively). The default efficiency score calculation in CHOPCHOP is based on gRNA ranking according to the likelihood that a particular gRNA facilitates DSB (efficiency) and the likelihood that a gRNA binds off-target sites (specificity) (Labun et al. 2019). It represents a value normalized to a 0-1 interval. Combining computational methods, the web tool can score any gRNA using position-specific scoring matrices or vector machines which consider position and sequence of the gRNA, including the positions downstream of the PAM and upstream of the binding site (Xu et al. 2015). For in vitro cloning and incorporation of gRNA coding sequences, complementary 27-mer single-stranded oligos (ssODNs) containing Bbsi/BpiI-compatible overhangs at the 5’-ends were synthesized as custom 5’-phosphoprylated (-PHO) sequences at Eurofins Genomics GmbH (Ebersberg, Germany). Gene specific microhomologies, mediating precise integration of donor DNA templates into cleaved genomic target sites via complementary annealing, were defined as the sequences 22 nt up- and downstream of the cleavage sites, i.e. 3 bp upstream (5’) of the first PAM base pair.

2.2.3. Primer design

Primers for PCR cloning and colonyPCR were designed to have a length of 16 to 25 nt and to possess a melting temperature (Tm) in the range of 57 °C to 60 °C. Primers for multi- fragment assembly were built to have >15 bp of complementary homologous regions adjacent to a template binding region with a Tm of 60 °C. In combination with opposing primers, these were permitted to have ΔTm > 5 °C due to substantial differences in their respective lengths. If applicable, primer sequences were BLASTed against the human genome and/or vector sequences. Furthermore, the designed primers were validated for mispriming, hairpin formation and 3’ self-complementarity using a web tool named Oligo Calc (http://biotools.nubic.northwestern.edu/OligoCalc.html)3.

Lyophilized primers were dissolved in ddH2O volumes according to provided synthesis reports to a concentration of 100 pmol/µL (≙ 100 µM) unless otherwise indicated. Working aliquots were diluted to 10 µM concentration and stored at -20 °C. Lyophilized oligos for gRNA constructions were reconstituted in 10X higher molar concentration as stocks (final 1 M) and diluted in 2X Annealing buffer for cloning applications. Working primer stocks designated for IVA cloning were specifically diluted to 2 µM concentration (see below).

3 Accessed 2019-06-30 23

2.2.4. In vivo assembly and polymerase chain reaction for cloning

Within in vivo assembly (IVA) cloning procedures, polymerase chain reactions (PCR) were set up with minor deviations from the published guidelines, according to Table 12 (García- Nafría et al. 2016). Following this protocol, it is possible to combine all necessary reaction components and multiple templates in a single-tube reaction for seamless assembly of plasmid constructs. To this end, the corresponding primer pairs termed “A” and “B” in Table 12, with designations marking specificity towards the templates “A” or “B”, respectively. However, for some applications, the existence of sequence similarities or duplicates in both templates forced the setup of separate reactions and a later reconstitution of PCR products in downstream procedures. In such cases, reactions containing one template with appropriate forward and reverse primers were each prepared. The PCR program and number of cycles were adapted from the aforementioned protocol with optimizations mainly made for annealing temperature and extension times (Table 13). From this reaction, 10 µL were mixed with 1.6 µL of 6X DNA Gel Loading Dye and analysed in agarose gel electrophoresis for validation of proper band amplification(s). Remaining samples were then mixed with 5 U of DpnI enzyme, spun down and incubated at 37 °C for 15 minutes to selectively digest methylated template DNA and the mixture was then used directly for transformation.

Table 12: Reaction setup of Phusion-based PCR for in vivo assembly (IVA)

Component Amount (1X) Final concentration ddH2O var. to 25 µL 5X Phusion GC Buffer 5 µL 1X (providing 1.5 mM MgCl2) 10 mM dNTPs 0.5 µL 200 µM each 2 µM Primer Fwd. A 1 µL 0.1 µM 2 µM Primer Rev. A 1 µL 0.1 µM (2 µM Primer Fwd. B) (1 µL) 0.1 µM (2 µM Primer Rev. B) (1 µL) 0.1 µM DMSO 0.75 µL 3 % 5 M Betaine 5 µL 1 M Template A 1 µL 2 ng (Template B) (1 µL) (2 ng) Phusion 0.5 µL ~ 0.02 U/µL

Table 13: Cycler program for in vivo assembly PCR

Step Temperature Time Cycles Init. Denaturation 95 °C 2 min Denaturation 95 °C 20 sec. Annealing Gradient 55 °C - 65 °C 30 sec. 18x Extension 72 °C 4 min Final extension 72 °C 5 min Store 4 °C ∞

Typical PCR reactions for fragment amplification and colonyPCR were set up according to Table 14 and 15, working on ice. Polymerase and template(s) were added last. The program is outlined in Table 16. In the case of colonyPCR, individual bacterial colony forming units (cfus) were picked with sterile 20 µL pipette tips, briefly dunked in the PCR reaction mixture and then placed into 0.2 mL PCR-tube strips pre-filled with LB medium. After 5 minutes, tips were re-attached to multi-channel pipet and solution was gently suspended. Tubes lids were closed and samples were incubated at 37 °C as pre-cultures until positive cfus had been identified and if necessary stored at 4 °C for a maximum of 24 h.

Table 14: Reaction setup of Phusion-based PCR and/or colonyPCR

Component Amount (1X) Final concentration ddH2O var. to 20 µL 5X Phusion GC Buffer 4 µL 1X (providing 1.5 mM MgCl2) 10 mM dNTPs 0.4 µL 200 µM each 10 µM Primer Fwd. 1 µL 0.5 µM 10 µM Primer Rev. 1 µL 0.5 µM DMSO 0.6 µL 3 % Template 1 µL ~ 10-50 ng Phusion 0.5 µL ~ 0.02 U/µL

Table 15: Reaction setup of Taq-based PCR

Component Amount (1X) Final concentration ddH2O 6.4 µL to 20 µL 1X (providing 0.02 U/µL enzyme 2x PCR TaqNova-RED PCR 10 µL activity, 0.8 mM dNTPs and Master Mix 2 mM MgCl2) 10 µM Primer Fwd. 1 µL 0.5 µM 10 µM Primer Rev. 1 µL 0.5 µM DMSO 0.6 µL 3 % Template 1 µL ~ 10-50 ng

Table 16: Cycler program of typical PCR for cloning and screening

Step Temperature Time Cycles Init. Denaturation 95 °C 3 min Denaturation 95 °C 20 sec. Annealing 55 °C 20 sec. 35x Extension 72 °C 20 min Final extension 72 °C 4 min Store 4 °C ∞

2.2.5. Restriction cloning and annealing of oligos

Restriction enzyme digest reactions were set up according to the manufacturer’s manuals with the use of appropriate enzyme buffers (see Table 17). Components were mixed on ice, adding DNA to the reaction last. Mixtures were suspended by gently pipetting up- and down a few times, briefly spun down and incubated in a water bath at 37 °C for a minimum of 2 h.

If cleavage of larger amounts of DNA for copy-paste cloning was required, samples were incubated at 4 °C overnight.

Table 17: Reaction setup for restriction digestions

Component Amount (1X) Final concentration ddH2O var. to 20 µL 10X reaction buffer 2 µL 1X Template 1 µL up to 1.5 µg Enzyme 0.5 µL 5 U

Upon termination of the reaction, either through addition of 6X DNA Gel Loading Dye or by heat-inactivation at 65 °C, digestion products were isolated through gel electrophoresis or purification by DNA precipitation described below.

For annealing of complementary oligos without 5’-PHO modification, a 5’-end phosphorylation was conducted using T4 Polynucleotide kinase prior to ligation. To achieve so, the annealing reaction was performed with oligos reconstituted in 10X T4 DNA Ligase

Buffer (final 40 mM Tris-HCl, 10 mM MgCl2, 10 mM DTT, 0.5 mM ATP) supplemented with 100 mM ATP solution to a final concentration of 2 mM. Reagents were mixed with 1 U of T4 Polynucleotide kinase in PCR tubes, mixture was spun down briefly and incubated in a cycler with the following program: 1) 37 °C for 5 minutes, 2) 95 °C for 5 min, 3) cool down from 95 °C to 25 °C over 30 min. Alternatively, a beaker was filled with boiling water, tubes were placed inside and let to cool down to room temperature. For annealing of complementary oligos with 5’-PHO modifications, 2X Annealing buffer was used (Table 9) under the same condition, without addition of ATP or enzyme as outlined in Table 18. Exact yield and/or purity of obtained double-stranded oligonucleotides (dsODNs) were not further measured. Annealed products were used immediately in subsequent reactions.

Table 18: Reaction setup for annealing of oligos

Component Amount Final ddH2O 31 µL to 80 µL 10X T4 DNA Ligase Buffer 8 µL 1X 100 mM ATP 1 µL 2 mM Oligo A 20 µL theoretical yield ≤ 21.64 µg dsONT at given Oligo B 20 µL volume

Component Amount Final 2X Annealing buffer 40 µL 1X Oligo A 20 µL theoretical yield ≤ 48.07 µg (TRNP1) and Oligo B 20 µL ≤ 48.02 µg (TMEM14B) dsONT at given volume

2.2.6. Purification of PCR and restriction enzyme digest reactions

For sensitive applications, such as multi-fragment assembly and ligation, PCR fragments or annealed oligos were purified to remove high-molar excess primers and/or buffer 26 components. For this, GeneJET PCR Purification Kit (Thermo Scientific™ Inc.) was used according to the standard protocol. Alternatively, purification using Polyethylene glycol 8000 (PEG 8000) was performed for precipitation of DNA and enhancement of ligation reactions according to the following protocol:

0.25X volume of 50 % PEG 8000 in ddH2O supplemented with 50 mM MgCl2 was added to nucleic acid samples and mixed by carefully pipetting up- and down, then incubated at 37 °C for 15 minutes. Samples were centrifuged at room temperature at 19,000 × g for < 15 minutes. Supernatants were taken off using a pipette. 500 µL of 70 % ethanol was carefully pipetted to the wall of the tube to wash DNA pellets. Samples were immediately centrifuged at 19,000 × g for 5 minutes. Supernatant was removed by decanting and residue ethanol was taken off through aspiration with a small pipette tip. Tubes were placed with open lids onto a 37 °C heating plate to dry the DNA pellet. Samples were resuspended in up to 50 µL of ddH2O.

2.2.7. Ligation

Reactions were mixed according to the scheme outlined in Table 19. Tubes were placed on ice, adding DNA products and enzyme last and gently mixed by flicking the tubes. Samples were spun down briefly and incubated at room temperature for 10 minutes, followed by heat inactivation at 70 °C for 5 minutes. Reactions were directly used for transformation. Alternatively, reactions were stored at 4 °C until use. If DNA concentrations are known, the formula provided below can be used to calculate the amounts needed for an approximate 3:1 molar ratio of insert over vector.

퐴푚표푢푛푡 푏푎푐푘푏표푛푒 푑푠퐷푁퐴 (푛푔) × 푆푖푧푒 푖푛푠푒푟푡 (푘푏) × 3 = 퐴푚표푢푛푡 푑푠퐷푁퐴 푖푛푠푒푟푡 (푛푔) 푆푖푧푒 푏푎푐푘푏표푛푒 (푘푏)

Table 19: Blunt-end and sticky-end (cohesive) ligation reaction

Component Amount (1X) (final) ddH2O var. to 20 µL T4 DNA Ligase Buffer (10X) 2 µL 1X Linearized vector DNA var. 100 ng Insert var. 3:1 molar ratio over vector T4 DNA Ligase (5 U/µL) 0.2 µL 1 U

2.2.8. Agarose gel electrophoresis

Electrophoresis buffer (1X) was used for the production of agarose gels in the range from 0.2-2 % (w/v). For this, appropriate amounts of Invitrogen™ UltraPure™ agarose (e.g. 0.5 g agarose for a 1 % gel in 50 mL) were dissolved in 1X TAE buffer through heating in a microwave oven. The gel was cooled to 50-60 °C before adding approximately 0.2-0.5 µg/mL of Ethidium bromide (EtBr) from stock and pouring the solution into a gel tray 27

(50 mL, 100 mL or 200 mL gel volumes, respectively). Gels were let to solidify and then placed into 1X TAE buffer-filled gel chambers. PCR reactions or nucleic acid samples were directly mixed with 1/6th volume of 6X DNA Gel Loading Dye and loaded into the wells with appropriate DNA markers (Table 3). Agarose gels were documented under 280 nm UV light in a Biotech E-BOX VX2 gel documentation system (Peqlab Biotech). Gel bands were excised under minimal UV light radiation exposure by quickly cutting marks into the gel around band areas. Bands were then excised off UV light to minimize DNA damage, transferred to a tube and subjected to isolation using the GeneJET Gel Extraction Kit (Thermo Scientific™ Inc.) according to the supplier’s manual. The solubilized gel was re- loaded onto the column after the first centrifugation round to increase DNA yields. Before the elution centrifugation step, a volume of 50 µL ddH2O was added onto the column (instead of 1X TE buffer) and incubated for 2 minutes at room temperature. Note that for most convenient overview of gel electrophoreses results, only portions of the entire documented gel are shown in the results section instead of complete gel images. Lanes containing representative DNA band patterns are shown for most experimental steps, whereas complete gel images for colonyPCR and IVA-PCR are shown (as indicated) for a general overview. Refer to the electronic supplementary data provided with this Thesis to access raw images. Files are sorted and named according to the type and number of figure.

2.2.9. Transformation of competent cells

50 µL of chemically competent XL1 Blue or TOP10 Escherichia coli bacteria (homemade, cell-counts not determined), stored at -80 °C, were thawed on ice for 10 minutes, mixed with PCR products, ligation reactions or plasmids in amounts according to Table 20, briefly flicked and incubated on ice for 5 minutes. Standard heat-shock was performed to transform cells by incubation for 45 sec. in a 42 °C water bath, followed by an incubation on ice for 5 minutes. After that, 100 µL room temperature SOC outgrowth medium without antibiotics was slowly added to bacterial suspensions and samples were incubated on a shaker (250 rpm) at 37 °C for at least 45 minutes.

Suspensions were then dispensed onto LB agar plates containing appropriate antibiotics and gently streaked across plate surfaces using a Drigalski spatula, working alongside a Bunsen burner flame. Plates were incubated at 37 °C with lids facing the bottom.

Table 20: Sample volumes and amounts used for transformation of chemically competent cells for different cloning scenarios

Type of sample Amount used Circular plasmid 1-10 ng in up to 2 µL Ligation reaction 10 µL Multi fragment assembly 2 µL for each fragment Site-directed mutagenesis 6 µL

2.2.10. Bacterial culture and plasmid preparation

Colony forming units (cfus) positively identified under selective conditions were manually picked using sterile pipette tips. Pre-cultures from colonyPCR setups were directly transferred to culture media. For Mini-preps, 15 mL Falcon tubes filled with 3 mL pre- warmed LB medium containing selective antibiotics were used. For Midi-preps, a 100 mL Erlenmeyer flask with 50 mL medium was used. The inoculation was carried out beside a Bunsen burner flame. Bacterial cultures were placed on a shaker and incubated at 37 °C overnight.

Before plasmid extraction, 500 µL of bacterial suspensions were taken and mixed with

500 µL of 50 % Glycerol solution in ddH2O for long-term backup storage at -80 °C. Bacteria were transferred to Falcon tubes and harvested through centrifugation at 4 °C at 5,000 × g for 10 minutes. The supernatant was discarded and pelleted cells were subjected to SDS/alkaline lysis, followed by affinity column purification using the GeneJET Plasmid Midi/Miniprep Kit (Thermo Scientific™ Inc.).

Bacterial overnight cultures were harvested through transfer to 50 mL Falcon tubes and centrifugation at 5,000 × g for 10 minutes at 4 °C using a TX-400 4 x 400mL swinging bucket rotor (75003181, Thermo Scientific™). Pellets were resuspended in 2 mL resuspension buffer (50 mM Tris-HCl, 10 mM EDTA pH 8.0, supplemented with 100 µg/mL RNase A). Cells were lysed by addition of 2 mL lysis solution (200 mM NaOH, 1 % SDS) and 4-6x inversion of the mixture, incubated for 3 minutes. 2 mL of neutralization solution (3M Potassium acetate, pH 5.5) was added and the mixture was inverted 4-6x. 500 µL of endotoxin binding reagent was added and incubated for 5 minutes. For precipitation of debris and proteins, 3 mL of 96 % ethanol was added, briefly inverted and samples were centrifuged at 5,000 × g for ~ 40 minutes at room temperature. The plasmid DNA-containing supernatant was taken off and further purified from proteins and chromosomal DNA through precipitation by adding 3 mL 96 % ethanol. Mixtures were loaded onto purification columns, washed once with 4 mL wash-solution I (containing 25 % 2-propanol) and twice with 4 mL of wash-solution II (containing 70 % ethanol). The columns were then dry-centrifuged for 5 minutes. For plasmid elution, up to 350 µL ddH2O were added directly onto the columns, incubated for 5 minutes at room temperature and centrifuged at 2,000 × g for 5 minutes. Sample yields and qualities were determined through photometric measurement of absorbance at 260 nm and 280 nm using a NanoDrop™ 2000 Spectrophotometer (Thermo Scientific™ Inc.). Working aliquots were diluted to respective concentration needs (Table 14 and 15) and stored at -20 °C. Midi-prep stocks were stored at -80 °C. If necessary, bacterial glycerol-stocks were re-cultured in a shaking suspension by gently scraping off some viscous cell material from the surface of the frozen stock without thawing the vial, 29 using a sterile plastic pipette tip which was then dipped into a 3 mL Falcon tube pre-filled with LB medium without antibiotics. After incubation in the shaker at 37 °C for a minimum of 45 minutes, the complete volume was transferred to a Midi-culture in a 50 mL Erlenmeyer flask containing LB medium supplemented with antibiotics for incubation overnight.

2.2.11. Analysis of PCR-generated genomic and vector DNA

2.2.11.1. Isolation of genomic DNA

Cells were either lifted enzymatically from culture dishes or lysed in the wells directly. In either case, cells were washed once by removing media and suspension in 1X PBS. Up to 1 mL of Lysis buffer containing Proteinase K (250 µg/mL) was added to the cells or cell pellets and incubated overnight at 55 °C. On the next day, lysates were transferred to a 1.5 mL reaction tube and mixed with 1:1 volume of phenol:chloroform:isoamylalcohol (25:24:1, v/v) saturated with 10 mM Tris pH 8.0 and 1 mM EDTA by gently inverting tubes 4-6 times. Samples were then centrifuged at 16,000 × g for 10 minutes at room temperature. The upper aqueous phase was carefully taken off, either by spooling DNA onto a flame- sterilized Pasteur pipette or using a sterile 1000 µL plastic pipette (front portion of tip was cut off to facilitate transfer) and fetched into a new tube. 0.11X volume of 3 M sodium acetate was added and the resulting mixture was overlaid with 0.8X volumes of 96 % ethanol, gently mixed by inversion and incubated at -20 °C for a minimum of 1 h to precipitate DNA. This was followed by centrifugation at 4 °C at 16,000 × g for 20 minutes. The supernatant was removed and pellet was washed by slowly adding 1 mL of 70 % ethanol to the wall of the tube. Samples were centrifuged at 16,000 × g for 10 minutes at 4 °C, supernatant was discarded and pellets were left to air-dry on a 50 °C heating block.

DNA was dissolved in up to 100 µL of ddH2O for at least 1 h, occasionally flicking the tubes to enforce solubilization. High molecular weight genomic DNA was diluted in appropriate amounts of ddH2O for measurement of purity and for use in downstream applications.

2.2.11.2. Sequencing of vector products and PCR amplificates

DNA sequencing was done by submitting samples to Eurofins Genomics Germany GmbH (Ebersberg, Germany) using the Mix2Seq overnight kit. Barcoded tubes were filled with a minimum of 50 ng of vector DNA or a minimum of 100 ng of purified PCR products. 2 µl of

10 µM sequencing primer was added and the volume was adjusted with ddH2O to a minimum of 17 µl total. Trace files of sequence chromatogram data were aligned to respective template sequences using SnapGene® Viewer 3.2.1 and/or BLASTed against the human genome. Each submission is linked to a barcode of the sample tube and corresponding trace files downloaded from Eurofins are coded for each read, provided as an accession starting with “EF”, followed by eight digits in the results on upper left side of

30 respective chromatograms, e.g. EF01234567. Raw files are accessible and labeled accordingly in electronic supplementary provided with this Thesis.

2.2.12. Cell culture of human NHDF iPS cells

Normal human dermal fibroblast (NHDF)-derived iPS cells vials (clone No. 101, provided by Sandra Rizzi) were partially thawed from liquid nitrogen storage in a water bath at 37 °C, transferred to 15 mL room temperature DMEM and centrifuged at ~ 270 × g at 4 °C for 3 minutes using a TX-400 4 x 400mL swinging bucket rotor. Supernatant was removed using a sterile Pasteur pipette and pellet was resuspended in StemMACSTM iPS-Brew XF (MACS Miltenyi Biotec) under addition of 10 µM Rho-associated kinase Inhibitor Y-27632 (MACS Miltenyi Biotec) to increase cell survival. Suspension was seeded onto appropriate dishes that had been coated with MatrigelTM Basement Membrane Matrix, hESC-Qualified (Corning) in DMEM/F12 for 24 h at 4 °C. Cells were incubated in a humidified atmosphere enriched with 5 % CO2 (v/v) at 37 °C, with media changes undertaken every 24 h. When a confluence of approximately 70-90 % had been reached (typically after one to three days), cells were harvested for passaging and split in a ratio of 1:3 - 1:6. For this, medium was aspirated and StemPro AccutaseTM Cell Dissociation Reagent (Gibco™, Thermo Fisher Scientific Inc.) was added to cover the well (~ 500 µL). After incubation at 37 °C for approximately 3-5 minutes, cells were checked for detachment from well surfaces under the microscope and reaction was stopped by addition of 1:1 volume of cold DMEM. Cells were transferred to a 15 mL tube filled with DMEM for centrifugation. Pellet was resuspended in pre-warmed iPS Brew medium with 10 µM Y-27632. If needed, cells were counted using a Neubauer chamber. For cryopreservation of cells, 1X volume of cell suspension was transferred into a cryogenic vial with 1X volume of 2X freezing medium (FM) containing DMSO CryoMACS ® (MACS Miltenyi Biotec) and KnockOutTM Serum Replacement (Gibco™, Thermo Fisher Scientific Inc.) and placed into a freezing box at -80 °C. Prior to seedings of FACS-isolated NHDF iPS cells, Gelatine-coated dishes were prepared (0.1 % gelatine in PBS, stored at 4 °C) in advance. 1 mL mouse (ICR) inactivated embryonic fibroblasts 2M feeder cell vials (Gibco™, Thermo Fisher Scientific Inc., Lot. 20010706) were thawed according to the manufacturer’s protocol and suspended in 20 mL MEF medium (≥2 × 10^6 viable cells/mL). The suspension was transferred to a sterile cell culture reservoir. PBS was removed from dishes and MEF 2M cell suspension was dispensed onto flat-bottom 96-well plates, providing a density of ~ 10,000 cells per well in 100 µL. Culture vessels were moved in several quick back-and-forth and side-to-side motions to disperse cells across the surface of the dish. Cells were inspected under the microscope and incubated in a humidified atmosphere of 5 % CO2 (v/v) at 37 °C. Media changes were done every 24 h.

2.2.13. Cell imaging and fluorescence microscopy

On a daily basis, iPS cells were imaged and viability, growth and morphology were documented using a DM IL LED inverted microscope (Leica Microsystems GmbH). If applicable, each well was imaged using 10x and 20x objectives. To reduce hands-on time and cell stress during imaging, only representative areas of wells and/or abnormalities were captured. Fluorescence imaging was carried out using a DMi8 microscope (Leica Microsystems GmbH). Culture plates were sealed using parafilm strips to reduce contamination risk. The duration of imaging was kept to a maximum of 10 minutes to prevent cellular stress. If applicable, tile scans were captured to obtain stitched-together montages of individual well areas. Images were further processed using the LAS X Life science microscope software, FIJI/ImageJ application and Adobe Photoshop CC. Raw imaging files are provided with this Thesis if applicable (personal communication: Anita Erharter).

2.2.14. Generation and isolation of functional knock-out iPS cell lines

Human knock-out iPS cell lines were generated through nucleofection of CRISPR/Cas9 plasmids. This was carried out by Anita Erharter, using the Amaxa™ Nucleofector™ II system (Lonza) according to the manufacturer’s guidelines and previously optimized protocols (unpublished). Upon CRISPR/Cas9-mediated genome editing, cells were monitored for expression of fluorescence markers (EGFP) that would be indicative of proper CRISPR plasmid uptake. Cells with sustained reporter gene expression throughout cell expansion were deemed putative clones/colonies which had undergone genomic integration of donor repair-template fragments. Cultures were enriched for EGFP+ iPS cells via fluorescence-assisted cell-sorting (FACS) using a BD FACSMelody™ cell sorter (BD Biosciences). Having obtained bulk-sorted cultures, these were further subjected to single- cell isolation using either FACS or classical dilution assays to generate monoclonal iPS cell lines. The above mentioned steps, as well as propagation of iPS cell cultures were carried out by Anita Erharter, and Marta Suarez Cubero, MSc.

2.2.15. Genotyping and screening for potential off-target cleavage

Target loci sequences, as predicted by CCTop CRISPR/Cas9 target online predictor (https://crispr.cos.uni-heidelberg.de/)4 were BLASTed against the human genome using the UCSC-genome browser BLAT tool (https://genome.ucsc.edu/cgi-bin/hgBlat)5. Target sequences could then be entered into the NCBI primer design program (http://www.ncbi.nlm.nih.gov/tools/primer-blast/)6 to generate appropriate primer pairs for gDNA amplification and/or sequencing. They were designed centering the surrounding regions at a distance between 150-300 bp to give PCR products at around 300-600 bp

4,5,6 Accessed 2019-06-30 5 6 32 length, which has proven to be suitable for the intended sequencing applications.PCR screening at the TRNP1 target locus was performed to permit sequence analysis of correct insertion of the reporter genes. Typically, this reaction was complemented by running one additional PCR reaction using alternative primer combinations. This step employed one forward primer binding within the reporter gene sequence (EGFP) and the other reverse primer binding in the genomic locus, yielding differential band lengths to distinguish monoallelic (heterozygous) or biallelic (homozygous) transgene integration. The occurrence and chance of off-target cleavage during CRISPR experiments is a common limitation. Therefore the highest scoring genomic off-target sites determined by the CRISPR/Cas9 target prediction tool CCTOP (https://crispr.cos.uni-heidelberg.de/index.html)7 were focused on. Primers as depicted in Table 24 were designed to amplify fragments of these loci using PCR. Gel bands were excised, purified and used in T7 Endonuclease (T7E1) “surveyor” analysis or directly submitted for sequencing using primers (designated with accession “seq” in Table 24).

7 Accessed 2019-06-30 33

2.3. Lists of oligonucleotides and primers

Table 21: List of oligonucleotides for dsDNA annealing

MW GC content Tm Length 5' No. Oligo name Sequence (5'-3') [g/mol] [%] [°C] [mer] Mod. 439 T2A_BamHI new_01 18664 56 > 75 CGATCGAGGGCAGAGGAAGTCTGCTAACATGCGGTGACGTCGAGGAGAATCCTGGACCTA 60 - 440 T2A_BamHI new_02 18290 56 > 75 GATCTAGGTCCAGGATTCTCCTCGACGTCACCGCATGTTAGCAGACTTCCTCTGCCCTCG 60 - O11_TRNP1_gRNA KO olig O11 8335 66 72,6 [PHO]CACCTCACGGGTCGCGCCTCAAGAAGG 27 PHO 1 O12_TRNP1_gRNA KO olig O12 8325 59 69,5 [PHO]AAACCCTTCTTGAGGCGCGACCCGTGA 27 PHO 2 O13_TMEM14B_gRNA KO O13 8318 74 > 75 [PHO]CACCCGCTCCGTAGTGGACTCCGCGGG 27 PHO olig1 O14_TMEM14B_gRNA KO O14 8344 66 72,6 [PHO]AAACCCCGCGGAGTCCACTACGGAGCG 27 PHO olig2

Table 22: List of primers used for IVA cloning

No. Oligo name MW GC content Tm Sequence (5'-3') Length [g/mol] [%] [°C] [mer] 431 29backbEGFPexchmCherryF 6017 68 63,1 GGAAGCGGAGAGGGCAGAG 19 w 432 29backbEGFPexchmCherryR 7649 56 66,3 GGATCTAGGTCCAGGATTCTCCTCG 25 v 433 20fragExchmCherryFw 9586 61 73,5 CCTGGACCTAGATCCATGGTGAGCAAGGGCG 31 434 20fragExchmCherryRv 11718 66 > 75 GCCCTCTCCGCTTCCCTTGTACAGCTCGTCCATGCCGCC 39 435 29EGFP Y66Hmut Fwd 10998 63 > 75 GTGACCACCCTGACCCATGGCGTGCAGTGCTTCAGC 36 436 29EGFP Y66Hmut Rev 5950 68 63,1 GGTCAGGGTGGTCACGAGG 19 437 29EGFP Y145Fmut Fwd 13204 41 71,3 AAGCTGGAGTACAACTTTAACAGCCACAACGTCTATATCATGG 43

438 29EGFP Y145Fmut Rev 6364 57 61,8 GTTGTACTCCAGCTTGTGCCC 21 011 32backb EF1a trans_Fw 5983 63 61 ATGGTGAGCAAGGGCGAGG 19 012 32backb EF1a trans_Rv 4979 81 62 GATCCGGGGGGTGGCC 16

013 16fragm EF1a trans_Fw 8778 82 > 75 GCCACCCCCCGGATCGGCTCCGGTGCCCG 29 014 16fragm EF1a trans_Rv 13760 44 73,1 GCCCTTGCTCACCATTCACGACACCTGAAATGGAAGAAAAAAACT 45 015 32bckb mCh-EBFP transf_Fw 6017 68 63,1 GGAAGCGGAGAGGGCAGAG 19 016 32bckb mCh-EBFP transf_Rv 9234 36 62,7 TCACGACACCTGAAATGGAAGAAAAAAACT 30 017 30frag mCh-EBFP transf_Fw 10330 54 72 TTTCAGGTGTCGTGAATGGTGAGCAAGGGCGAG 33 018 30frag mCh-EBFP transf_Rv 8074 62 71 GCCCTCTCCGCTTCCCTTGTACAGCTC 27 045 36 TRNP1 KO 5'MH Fw 23967 69 > 75 CCGCGTTACATAGCATCGTACGCGTACGTGTTTGGGCGGCTCACGGGTCGCGCCTCCCGGATCCGGCTCCGGTGC 78 CCG 046 36 TRNP1 KO 5'MH Rv 9246 46 66,8 TGCTATGTAACGCGGAACTCCATATATGGG 30 047 36 TRNP1 KO 3'MH Rv 16961 74 > 75 CGCGTACGTGTTTGGCGGCCGCGGCGCGGGCCCTTCTTCAGGCACCGGGCTTGCG 55 048 36 TRNP1 KO 3'MH Fw 9513 48 68,2 CAAACACGTACGCGTACGATGCTCTAGAATG 31

049 36 colPCR 5'MH Fw 4600 66 53,3 TTTGGGCGGCTCACG 15 050 32 5'MH seq1 Rv 4811 62 54,3 TCCAACCCGAAGCTCG 16 053 053-32 backb exch Fw 8319 44 63,4 CCAAGGTGAAGAACTGAAGTCCAAACA 27 054 054-32 backb exch Rv 6333 57 61,8 CTTGTACAGCTCGTCCATGCC 21 055 055-003 SV40 exch Fw 14860 35 70,3 GACGAGCTGTACAAGTAGTTGTTTATTGCAGCTTATAATGGTTACAAA 48 056 056-003 SV40 exch Rv 16323 37 72,5 AGTTCTTCACCTTGGTAAGATACATTGATGAGTTTGGACAAACCACAACTAGA 53 069 069-40 TMEM14B KO 5'MH 23996 64 > 75 CCGCGTTACATAGCATCGTACGCGTACGTGTTTGGGCTTGCGCTCCGTAGTGGACTCCGGATCCGGCTCCGGTGCC 78 Fw CG 070 070-40 TMEM14B KO 3'MH 18259 55 > 75 CGCGTACGTGTTTGGACCGACCTGCCGAAGGCCCGCGTAAGATACATTGATGAGTTTGG 59 Rv 075 075-40 TRNP1 KO 3'MH Rv 18273 59 > 75 CGCGTACGTGTTTGGCGGCCGCGGCGCGGGCCCTTCTTAAGATACATTGATGAGTTTGG 59

Table 23: List of primers used for colonyPCR screening during vector assembly

No. Oligo name MW GC content Tm Sequence (5'-3') Length [g/mol] [%] [°C] [mer] 019 29 colPCR seq1 Fw 6281 65 63,5 GGATCCGAGGGCAGAGGAAG 20 020 29 colPCR seq2 Fw 6158 60 61,4 GCTAACATGCGGTGACGTCG 20

021 29 colPCR seq1 Rv 5276 70 60 TCACGAGGGTGGGCCAG 17 023 30 colPCR seq1 Rv 5322 64 57,6 GTAGTCGGGGATGTCGG 17 024 32 colPCR seq1 Fw 5163 76 62,4 GATCCGGCTCCGGTGCC 17

025 32 colPCR seq1 Rv 6646 54 62,1 AGCTGGCCTAACTTCAGTCTCC 22 041 24 colPCR seq1 Fw 6175 50 57,3 AGACAAATGGCTCTAGAGGC 20 042A 24 colPCR seq1 Rv 6142 55 59,4 GTAACGGGTACCTCTAGAGC 20 042B TRNP1 gRNA colPCR Fw 4891 62 54,3 GTCGCGCCTCAAGAAG 16 049 36 colPCR 5'MH Fw 4600 66 53,3 TTTGGGCGGCTCACG 15 051 36 colPCR 3'MH Rv 4496 73 56 CGCGGGCCCTTCTTC 15 057 057-40 colPCR Rv 6730 45 58,4 GGACAAACCACAACTAGAATGC 22 068 068- 5162 64 57,6 CTCCGTAGTGGACTCCG 17 46TMEM14BgRNAcolPCFw 071 071-47 colPCR 5'MH Fw 4864 62 54,3 CTTGCGCTCCGTAGTG 16 072 072-47 colPCR 3'MH Rv 5177 58 55,2 TGTTTGGACCGACCTGC 17

076 076-43 colPCR 3'MH Rv 6093 55 59,4 GCGGGCCCTTCTTAAGATAC 20

Table 24: List of primers used for vector DNA sequencing

No. Oligo name MW GC content Tm [°C] Sequence (5'-3') Length [g/mol] [%] [mer] 022 PuroR Seq2 Rv 5107 70 60 GCTGCCCAGACCCTTGC 17

026 29 seq1 4667 66 53,3 GGATAAGGCGCAGCG 15 027 29 seq2 5192 52 52,8 ACGGATGGCCTTTTTGC 17 028 29 seq3 5540 55 56 GAGCTTCATGCACAGTGG 18 029 29 seq4 5411 55 56 GAGCGCACCATCTTCTTC 18

030 29 seq5 5149 64 57,6 CCGAGTACAAGCCCACG 17 031 29 seq6 4793 62 54,3 TCGGCTTCACCGTCAC 16 032 29 seq7 6789 40 56,5 CGCGAATTAATTCTGTGGAATG 22 033 29 seq8 4587 66 53,3 AGCGAGAGCCTGACC 15 034 29 seq9 4922 62 54,3 GAGCTTGCAGGATCGC 16 035 29 seq10 5436 61 58,2 CCGTCGACCTCTAGCTAG 18 036 29 seq11 5266 58 55,2 GTAAGTTGGCCGCAGTG 17 037 29 seq12 6452 47 57,9 CAGGGTTATTGTCTCATGAGC 21

038 32 EF1a seq1 5611 55 56 AGCTTCGGGTTGGAAGTG 18 039 32 EF1a seq2 6020 60 61,4 CCGTCGCTTCATGTGACTCC 20 040 33 mCherry seq1 5420 55 56 TCCCCGACTACTTGAAGC 18 043 35 TRNP1 gRNA seq1 5206 52 52,8 GAAAAACGCCAGCAACG 17 044 35 TRNP1 gRNA seq2 6059 50 57,3 CTCTAGAGCCATTTGTCTGC 20 050 32 5'MH seq1 Rv 4811 62 54,3 TCCAACCCGAAGCTCG 16 052 32 3'MH seq2 Rv 6678 40 56,5 CATTCCACAGAATTAATTCGCG 22 073 073-47 5'MH seq3 Rv 4587 66 53,3 CGGAGCCAGTACACG 15 074 074-47 3'MH seq4 Rv 5300 64 57,6 GACAGTGGGAGTGGCAC 17 077 077-43 3'MH seq 1 Rv 5862 52 56,7 CATGGACGAGCTGTACAAG 19

Table 25: List of primers used for genomic DNA amplification and sequencing

No. Oligo name MW [g/mol] GC content [%] Tm [°C] Sequence (5'-3') Length [mer] 078 078-TRNP1-KO OnTseq1 6543 66 65,7 CTGGTGTCGGAGCTGGAGAGC 21 Fw 079 079-TRNP1-KO OnTseq2 6094 65 63,5 GCACCTCGGCGAAGCTTGTC 20 Rv 080 080-TRNP1-KO OnTseq3 9013 50 68,1 CTACTGCACTTATATACGGTTCTCCCCCAC 30 Rv 081 081-TRNP1-KO OnTseq4 9909 40 65,6 ATGGACGAGCTGTACAAGTAGTTGTTTATTGC 32 Fw 082 082-TRNP1-KO OnTseq5 6625 61 63,7 GAATGGTGAGCAAGGGCGAGG 21 Fw 083 083-RUFY1-OffTseq1 6238 60 61,4 GCATGGAGGTGGGTTACAGC 20

084 084-RUFY1-OffTseq2 6127 60 61,4 AAGGCCTGCCTACCAAGGTG 20 085 085-ARAFP2-OffTseq1 6560 57 61,8 GGGAGTAAGGTCAGGCTCAAG 21 086 086-ARAFP2-OffTseq2 6630 50 60,3 TCTTCATCCCTGGACCTCAGAA 22 087 087-ARAFP3-OffTseq1 6404 57 61,8 GTGGGCTGTGACTCTTCATCC 21 088 088-ARAFP3-OffTseq2 6464 52 59,8 TAAGGTCAGGCTCAAGACAGC 21 089 089-AMPD3-OffTseq1 6013 55 59,4 CCTGATTCGGAAACCCCTTC 20 090 090-AMPD3-OffTseq2 6393 52 59,8 ATAAGGACAGACATCCCAGCC 21

091 091-ALG10-OffTseq1 5783 63 61 CAAGCCTGCACCTCAGAGG 19 092 092-ALG10-OffTseq2 6342 57 61,8 AAGGTCTTCAGGCCTCCATCC 21 093 093-ANKRD40-OffTseq1 4883 75 59,4 CTCCCGGCCATGGGGA 16 094 094-ANKRD40-OffTseq2 6368 47 57,9 AGTTACATAAACAGCCAGCCC 21 095 095-OPA3-OffTseq1 6164 55 59,4 GGGTAACCCAGGGGTCTTTT 20 096 096-OPA3-OffTseq2 6484 57 61,8 CTTTCTCCTGGGAAGTGGGTG 21 097 097-CDC7-OffTseq1 6100 60 61,4 GCTGGGCCCTTAGCCTTATG 20 098 098-CDC7-OffTseq2 6084 55 59,4 AGTACGACTTCTGTGGCTCC 20 099 099-MGAT4B-OffTseq1 5559 66 60,5 AAGGGAGTCCCAGGACCG 18 100 100-MGAT4B-OffTseq2 6115 55 59,4 CCACTTGTTTGCTGCTGGAG 20

101 101-SSBP2-OffTseq1 6078 60 61,4 GCTCAGCTCCTCACTGGAGA 20 102 102-SSBP2-OffTseq2 5535 72 62,8 CACCCCAGGGAGTAGGGC 18 103 103-EPHB6-OffTseq1 5942 55 59,4 ATTACATCGACCCCTCCACC 20 104 104-EPHB6-OffTseq2 6415 52 59,8 CTTCTCCAAAAGAGCCTGGGA 21 105 105-ELFN1-OffTseq1 6182 55 59,4 TAAAATGCCATCCGTGGGGG 20 106 106-ELFN1-OffTseq2 5098 70 60 GTGCCTCCCAGCCCTTG 17 107 107-STARD3NL-OffTseq1 6784 54 62,1 GTGGAGCTCCTCAGACTAGAGA 22 108 108-STARD3NL-OffTseq2 5789 57 58,8 TCTGGCCAAGACTGTCAGC 19 109 109-ZBTB43-OffTseq1 6798 40 56,5 TATGCCAAGGTTTCAAGAAGGT 22 110 110-ZBTB43-OffTseq2 4794 75 59,4 GTGCCTTCAGCCCCCG 16 111 111-DPF2-OffTseq1 5116 70 60 CGAGACTCACCGTCCCG 17

112 112-DPF2-OffTseq2 6366 52 59,8 CTGGATCCGCTCCTCGATAAA 21 113 113-UNC45A-OffTseq1 6173 55 59,4 GTTGCCAGGGATTCTAGCGA 20 114 114-UNC45A-OffTseq2 6222 55 59,4 TCTGTGTGGGAACAGAAGCG 20 115 115-RP11-419C5.3- 6433 52 59,8 AGAGGACAGCTCTACACCAGA 21 OffTseq1 116 116-RP11-419C5.3- 6004 55 59,4 GCTCATTAGCTGCCCTACCT 20 OffTseq2 117 117-RP11-296I10.5- 6409 57 61,8 CAGAGAGGACAGCTCTACACC 21 OfTseq1 118 118-RP11-296I10.5- 6044 55 59,4 ATTAGCTGCCCTACCTGTGC 20 OfTseq2

119 119-RP11-252A24.8- 6075 55 59,4 GGCCGACCTGTTTCATTCTG 20 OfTseq1 120 120-RP11-252A24.8- 6229 60 61,4 GTGCTCAGTAGGGGTCTGGA 20 OfTseq2 121 121-CTD-3137H5.5- 5887 57 58,8 AGGGACGCAACTCAATGGG 19 OffTseq1 122 122-CTD-3137H5.5- 6173 55 59,4 TGGTACCAGGTTGAGCTGAC 20 OffTseq2 123 123-CENPVP3-OffTseq1 5501 66 60,5 CCCCGGTGTGATGCACGA 18 124 124-CENPVP3-OffTseq2 6575 52 59,8 CAAGAGGTGGCTGGGAAAGTT 21 125 125-TMEM14B-KO 5998 60 61,4 GCTCACCTCTCTCCAAGGAC 20 OnTseq1 Fw 126 126-TMEM14B-KO 6111 55 59,4 GACGGCCGTGAAACTCCTAA 20 OnTseq2 Rv 129 129-EGFP seq4 Fwd 7966 46 63,2 ACAAGCTGGAGTACAACTACAACAGC 26

130 130 TRNP1 seq3 Fw 5427 61 58,2 CAGCTGCACCGCGTTTTC 18 131 131 TRNP1 seq4 Rv 6133 55 59,4 TGGCAGCTTTACTAGGGACC 20 2734 2734 gfp forward 6089 55 59,4 ACGACGGCAACTACAAGACC 20

2.4. List of plasmids

Table 26: List of available template plasmids used for generation of CRIS-PITCh and donor vector constructs

See supplementary figures for vector maps. Note that the finalized constructs and variants generated from the templates below are outlined in Table 30. Each plasmid is further available as electronic sequence file as Genbank- (.gb) and Snapgene-file (.dna), provided with this Thesis. Plasmid files also contain feature accessions (colour coded) and entire repository of primers used (if applicable).

Application/Donor elements amplified for vector Fluorescent reporter No. Repository name Length assembly cDNA 003 pMax-turboGFP 4,712 bp Test-nucleofections/SV40 p(A) fragment turboGFP Backbone for Cas9-EGFP + PITCh gRNA + gene specific 006 px458 (pSpCas9(BB)-2A-GFP) 9,289 bp EGFP gRNA expression system 016 #016 NaSa_p19_mutTurboRFP-2A-eGFP 11,062 bp Human elongation factor (EF) 1a fragment EGFP mCherry 018 pX330A-FBL/PITCh 8,951 bp U6-PITCh gRNA scaffold cassette - 019 pCRIS-PITChv2-FBL 6,033 bp Backbone for CRIS-PITCh donor construction EGFP 020 pSicoR-EF1a-mCherry-PuroR 8,141 bp mCherry cDNA fragment mCherry

3. Results

3.1. Definition of gRNA target sites and microhomology sequences

3.1.1. In silico design of TRNP1 functional knock-out approach

For a functional knock-out of the TRNP1 gene, protein coding exon 1, located on chromosome 1, was chosen as the target site for double-strand cleavage. A gRNA target locus within the 3’ portion of exon 1 was predicted to be suitable by the CHOPCHOP v3 tool, based on respective rankings of putative sequences according to their targeting efficiency. The gRNA sequence chosen was 5’-TCACGGGTCGCGCCTCAAGAAGG-3’, which ranked No. 9 in all predictions with an efficiency score of 49.64 % (Figure 6, Supplementary Figure 26 and 27).

Figure 6: Definition of gRNA sequence and CRISPR target site within TRNP1 locus and principle of microhomology-mediated integration of donor template

(A) Schematic view of TRNP1 protein coding exon 1 (thick black bar) and exon 2, consisting of untranslated sequence (thin black bars). gRNA target site (blue) and protospacer adjacent motif (PAM, red) are not drawn to scale. Sequence view depicts the PAM sequence (red) 3 nt downstream of the Cas9 cleavage site (scissor mark). The adjacent 22 nt up- and downstream of this site represent the MHs (blue bars). (B) Donor sequence integration via defined 22 bp MHs flanking reporter gene (green).

Since the only exon containing translated sequence is targeted, the resulting TRNP1 functional knock-out transcript is expected to be functionally compromised, leading to a hypomorphic/truncated variant interrupted by a transgenic sequence. The location of the cleavage site, 3 bp upstream of the 5’ nucleotide of the PAM sequence, permitted the definition of microhomologous sequences for use in pCRIS-PITChv2 donor vector derivatives. For the approach described herein, 22 bp sequences up- and downstream of cleavage sites were set as 5’ MH (5’-GCGGCTCACGGGTCGCGCCTC-3’) and 3’ MH (5’-AAGAAGGGCCCGCGCCGCGGC-3’).

The above mentioned gRNA sequence, however, yielded potential off-target sites due to sequence similarity to other genomic loci. Seven genomic off-targets were identified by CCTop, of which a total of five were protein coding regions, providing a CRISPRater efficiency score of 0.65 (Supplementary Figure 27). Table 27 lists all putative targets ranked according to the number of mismatches between the gRNA and genomic sequences. All off-target sequences had a total of four mismatches in common. Of these, the gene encoding Adenosine monophosphate deaminase 3 (AMPD3) was the only one that could be linked to a specific cellular function based on database entries from ENSEMBL and UniProt, whereas functions of ARAF pseudogenes 2 and 3 (ARAFP2 and ARAFP3) and Ankyrin repeat domain-containing protein 40 (ANKRD40) were not featured or specified in the databases (Ensembl or UniProt) in a particular way with regards to genetic function.

Table 27: Specificity of TRNP1 gRNA target site on chromosome 1:26994278-26994300 and off- target predictions

E = exonic; (-) = intergenic; I = intronic; MM = mismatches, shown bold; nucleotides in [parenthesis] depict the seeder region of the hybrid gRNA sequence

Genome coordinates MM Target sequence (5’-3’) Type Gene Gene ID

chr1:26994278-26994300 0 TCACGGGT[CGCGCCTCAAGA] E TRNP1 ENSG00000253368

chr12:34016442-34016464 4 TCTCAGGT[AGGGCCTCAAGA] - ALG10 ENSG00000139133

chr11:10501569-10501591 4 CCACGGGC[TGCTCCTCAAGA] E AMPD3 ENSG00000133805

chr19:45554090-45554112 4 TGAGGGGC[CGCGCCCCAAGA] I OPA3 ENSG00000125741

chr7:63343183-63343205 4 GCAAGGGT[CGCTCCCCAAGA] E ARAFP3 ENSG00000227298

chr7:63404906-63404928 4 GCAAGGGT[CGCTCCCCAAGA] E ARAFP2 ENSG00000224368

chr5:179586647-179586669 4 TCAGGGCT[GGCGCCTCAGGA] I RUFY1 ENSG00000176783

chr17:50707870-50707892 4 TCCCGGGC[CGCGCCTCCCGA] E ANKRD40 ENSG00000154945

3.1.2. In silico design of TMEM14B functional knock-out approach

As for the functional knock-out of TMEM14B gene, the choice of suitable gRNAs was limited by the presence of transmembrane protein coding genes which are existent in many conserved and distantly related forms across the human genome. Among the structurally conserved TMEM family of proteins, a highly similar coding sequence can be observed throughout the genome (Babcock and Li 2013). As a result, the chance of binding of the designated TMEM14B gRNA within other TMEM-like loci was particularly high. In addition to that, multiple primary transcripts of the gene are known as a result of differential splicing 42

(Supplementary Figure 27 and 28). Therefore, a gRNA target sequence in the 5’ untranslated region (UTR) of the first exon was deemed most reliable of the given choices, as it is represented in all of the gene’s known transcript variants. The gRNA sequence 5’-CGCTCCGTAGTGGACTCCGCGGG-3’ ranked No. 1 with an efficiency value of 51.64 according to CHOPCHOP v3 prediction. This would then lead to a functional knock- out by presumptively disturbing proper processing of the transcript and, as a consequence, prohibit expression of the transmembrane protein (Figure 7).

Figure 7: Definition of gRNA sequence and CRISPR target site within TMEM14B locus and principle of microhomology-mediated integration of donor template

(A) Schematic view of TMEM14B exon 1, 5’ untranslated region (thin black bars) and protein coding exons 2 to 5 (thick black bars). gRNA target site (blue) and protospacer adjacent motif (PAM, red) are not drawn to scale. Sequence view depicts the PAM sequence (red) 3 nt downstream of the Cas9 cleavage site (scissor mark). The adjacent 22 nt up- and downstream of this site represent the MHs (blue bars). (B) Donor sequence integration via defined 22 bp MHs flanking reporter gene (green).

In addition to that, due to how the vector transgenes were composed, a pre-mature termination of translation would occur if a transgene in conjunction with a viral poly- adenylation signal were to be inserted. Sequences flanking the genomic cleavage site were subsequently defined as 5’MH (5’-CTTGCGCTCCGTAGTGGACTC-3’) and 3’MH (5’-CGCGGGCCTTCGGCAGGTCGG-5’). As speculated above, due to sequence

43 similarities between members of the TMEM family of genes, a higher number of off-target sites was predicted for the TMEM14B gRNA, as outlined in Table 28. Consequently, the risk of unwanted genomic perturbations was higher using this particular gRNA sequence. CCTop returned a CRISPRater score of 0.65, which is considered a mediocre efficiency and somewhat contradicts the high efficiency score from CHOPCHOP results (Supplementary Figure 28 and 29). All off-targets are characterized by a minimum of 4 mismatches within the recognition sequence. Exonic targets involve genes which are described and featured in databases, encoding metabolic enzymes (MGAT4B and CENPVL3) as well as postsynaptic proteins (ELFN1) and cholesterol binding proteins (STARD3NL). Other putative off-targets were considered less susceptible to cause gross functional disruptions due to their intergenic locations (Table 28).

Table 28: Specificity of TMEM14B gRNA on chromosome 6:10747849-10747871 and off-target predictions

E = exonic; (-) = intergenic; I = intronic; MM = mismatches, shown bold; nucleotides in [parenthesis] depict the seeder region of the hybrid gRNA sequence

Genome coordinates MM Target sequence (5’-3’) Type Gene Gene ID TMEM14

chr6:10747849-10747871 0 CGCTCCGT[AGTGGACTCCGC] E ENSG00000137210 B

chr11:65334355-65334377 4 AGCCCCGC[AGTGCACTCCGC] I DPF2 ENSG00000133884

chr5:179806256-179806278 4 TGCTCCGG[ACCGGACTCCGC] E MGAT4B ENSG00000161013

chr15:90945225-90945247 4 TGCTCCAA[AGTGGCCTCCGC] I UNC45A ENSG00000140553

chr7:142868396-142868418 4 GGCTCCCT[TGTGGCCTCCGC] I EPHB6 ENSG00000106123

chr1:91500779-91500801 4 CGCCCAGT[AGCGGAATCCGC] - CDC7 ENSG00000097046

chr5:81751567-81751589 4 GGCTCTGT[CGTGGACTCGGC] I SSBP2 ENSG00000145687

chrX:51618593-51618615 4 AGCTCCTT[AGGGGACTCGGC] E CENPV3 ENSG00000224109 RP11-

chr16:69972418-69972440 4 GGCTCAGG[AGTGGACTCCCC] - ENSG00000277003 419C5.3 RP11-25

chr16:74400186-74400208 4 GGCTCAGG[AGTGGACTCCCC] - ENSG00000276822 2A24.8 RP11-

chr16:70195312-70195334 4 GGCTCAGG[AGTGGACTCCCC] - ENSG00000261145 296I10.5

chr9:126804866-126804888 4 CGCTCCAG[AGTGTACTGCGC] - ZBTB43 ENSG00000169155

chr7:1747620-1747642 4 CCCTCTGC[AGTGGACTCCGG] E ELFN1 ENSG00000225968 CTD-313

chr19:18448594-18448616 4 CGCCACGC[AGTGGACTCCGT] E ENSG00000279262 7H5.5 STARD3

chr7:38215884-38215906 4 CGCCCCCT[AGTGGACTCAGG] E ENSG00000010270 NL

3.2. Cloning modifications of pCRIS-PITCh expression vector system

While the mechanistic principles of different CRISPR/Cas9 strategies for gene knock-in are similar, the way of the CRIS-PITCh system is unique in that it requires relatively little cloning efforts in practical use. The incorporation of necessary guide sequences for Cas9 and microhomologies in the repair template are, in fact, a matter of a few days of wet chemistry work. This way, the preparation of a simplified vector system provides the user with the means for a more streamlined CRISPR experiment by way of comparison. However, in their original publication, Sakuma et al. employ the use of recombination enzymes and

44 commercially available kits (such as Golden gate assembly and In-Fusion reactions) to build ready-to use plasmids. Instead, during the course of this Thesis, the recombinatorial capacities of different competent bacterial strains were harnessed to assemble plasmid fragments and backbones in vivo, as described in the methods part. Based on the original Sakuma et al. vectors, a catalog of pCRIS-PITCh vector variants were generated. In general, these were functionalized through alterations made to the composition of transgenic cassettes, including the addition of cleavable sequences, promoters, terminators and markers, described in the following paragraphs. In the long term, the vector builds described below would be suitable for various gene targeting applications, including dedicated gene knock-ins for protein labeling (note that each vector is provided with a repository number for internal use, e.g. #001). Within this Thesis, the main focus was put onto forging pCRIS-PITCh vectors for functional knock-outs of TRNP1 and TMEM14B, although the basic variants could, in principle, be used for either genomic target.

3.3. Addition of empty gRNA cassette to px458-Cas9 expression vector

For the intended use of CRISPR components, the plasmids were needed to fulfill the following requirements: a) encoding a fluorescently labelled, Cas9 endonuclease, functionalized for activity in eukaryotic cells, b) a target gene-specific (GS) gRNA controlled by a separate promoter and c) a single and commonly usable PITCh gRNA; all of which located on the same vector. To this end, the existing #006 px458 (pSpCas9(BB)-2A-EGFP plasmid was modified through integration of an expression cassette for a PITCh gRNA, regulated by a human RNA polymerase III promoter U6 (Figure 8). Such a construct is found on the cognate #018 pX330A-FBL-PITCh plasmid and was excised by digestion with XbaI restriction enzyme (Supplementary Figure 2 and 4). The resulting fragment with a length of 422 bp was inserted into the XbaI-linearized #018 plasmid of 9,289 bp, where it integrated directly adjacent to the empty gRNA scaffold site (Figure 9A). Re-digestion with XbaI yielded a 422 bp band, confirming the integration at the site (Figure 9C).

From the transformed XL1 Blue bacteria, colonyPCR using primer pair 041 and 042 to amplify the region at the junction sites yielded a 471 bp band, based on which the plasmids were prepared. The gel electrophoresis outcome is shown in Figure 9B, in which 22 cfus were picked and putatively specific bands appeared for 10 cfus. The bacterial colony from lane No. 8 was propagated and a plasmid Midi-prep was performed. Sequencing results confirmed the integration in both forward and reverse direction (Figure 9D) and demonstrated the existence of two independent gRNA scaffold sites, each under the control of distinct U6 promoter sequences (not shown).

Figure 8: Overview of copy-paste cloning steps to generate a universal Cas9-gRNA-PITCh gRNA expression system

The resulting #024 vector (herein referred to as the px458_+PITCh gRNA expression vector), encodes the tools needed for CRISPR experiments from an all-in-one plasmid and is used for PITCh in conjunction with donor template vectors. Empty gRNA segment (yellow) and PITCh gRNA segment (blue) are each under the transcriptional control of human U6 promoters, while an engineered Cas9-EGFP (purple/green) protein is expressed from a synthetic CAG promoter. T2A (black) is a self-cleavage peptide leading to a dissociation of the fluorescent reporter from the nuclease.

A 3xFLAG epitope-tagged, nuclear localization signal-carrying engineered Cas9 nuclease, fused to enhanced green fluorescent protein (EGFP) via a self-cleavage T2A “ribosomal skip” peptide is expressed under a distinct CAG promoter. The latter is a synthetic fusion product composed of human cytomegalovirus early enhancer, chicken β-actin promoter and 5’-intron 1 portion as well as the 3’-intron 2 and 5’-exon 3 portion of the rabbit β-globulin gene. Translation of the engineered Cas9 proteins can be monitored through fluorescence microscopy. A dissociation of Cas9 from the EGFP tag is expected to occur in the cytoplasm, while Cas9 is then bonded with expressed gRNA and PITCh gRNA molecules and is finally translocated to the nucleus.

Figure 9: Generation and cloning of universal CRISPR/Cas9 vector construct used throughout the Thesis for gene-specific targeting

(A) Restriction digest of #018 fragment and #006 backbone and cloning of #024 px458_+PITCh gRNA vector. (B) ColonyPCR screen showing the entire gel electrophoresis performed for 22 picked colonies. The bands at 471 bp represent the desired insert of positively transformed bacteria; (C) Re- digest of newly generated #024 vector using XbaI (D) Sequencing data of #024 vector and chromatogram providing sequence traces in forward (upper panel) and reverse (lower panel) direction derived from sample in lane 2 from colonyPCR gel electrophoresis. Bases marked in red in the underlying sequences depict mismatches.

3.4. Introduction of gene specific gRNA sequences into px458_+PITCh gRNA vectors

After having obtained a universal vector component based on the #024 default vector layout, the gene-specific sequences for gRNAs were introduced into the empty gRNA scaffold upstream and adjacent to the PITCh gRNA scaffold (Figure 10). The first step was to linearize and excise the generic sequence within the 5’ portion of the scaffold sequence using BbsI/BpiI restriction enzyme (Figure 11A), leading to a 9,709 bp vector backbone fragment. The respective gRNA sequences (5’-TCACGGGTCGCGCCTCAAGAAGG-3’) for TRNP1 and (5’-CGCTCCGTAGTGGACTCCGCGGG-3’) for TMEM14B, carrying compatible restriction site overhangs were incorporated through annealing of synthesized oligonucleotides which were phosphorylated at the 5’-ends (Table 21). After ligation of double-stranded oligonucleotides and linear templates, positive transformants were isolated using colonyPCR primers, one directly hybridizing with the gene-specific gRNA sequence portion, while the reverse primer bound at the U6-promoter/PITCh gRNA sequence (Figure 10, Supplementary Figure 14 and 23).

Figure 10: Overview of cloning steps necessary for insertion of gene-specific gRNA sequences into the #024 px458 expression vector.

The procedure includes backbone linearization using BbsI/BpiI digestion to excise an “empty” gRNA sequence (blue, upper panel), incorporation of annealed dsDNA oligonucleotides with 5’ phosphorylated compatible overhangs (light orange), and ligation with the backbone to obtain gene-specific px458 variants (termed GS “gene specific”, for final TRNP1 and TMEM14B targeting constructs respectively).

For the resulting vector #035 px458-TRNP1 gRNA+PITCh gRNA_KO, primer pairs 042A and 042B were employed in colonyPCR and gave 637 bp amplicons for positive cfus (Figure 11B). Sequencing resulted in a 100 % read confirmation at the TRNP1-specific gRNA site in forward direction, while in reverse direction, the read had issues with partial background noise. However, when inspecting the raw chromatogram data, the presence of emission peaks for the desired nucleotides at the respective nucleotide positions were indeed confirmed (Figure 11C, orange bars).

Figure 11: Generation of #035 gRNA expressing vector for functional knock-out of TRNP1.

(A) Restriction digest linearization of default #024 px458 vector using BbsI/PbiI enzyme. Note that a positive control was omitted; (B) Representative colonyPCR screen band of 637 bp from transformed bacteria; Refer to electronic supplements to access raw imaging files. (C) Sequencing data of #035 vector gRNA expression cassette (not drawn to scale) and chromatogram providing sequence traces in forward (upper panel) and reverse (lower panel) direction, light orange bars depict gRNA sequences. Bases marked in red in the underlying sequences depict mismatches.

Likewise, the linearized vector was used for ligation with TMEM14B-specific gRNA oligos, yielding the vector #046 px458-TMEM14B gRNA+PITCh gRNA_KO. ColonyPCR was performed in the same manner as described above, using gene-specific forward primer 068 49 in combination with 042B reverse primer, resulting in a 641 bp amplicon, albeit with shifted electrophoretic mobility, apparent at ~ 700 bp (Figure 12A). Sequencing confirmed the entirety of the TMEM14B-gRNA construct in the forward read, with minor unresolved sequence portions in the reverse read due to overlapping emission peaks and background signals, seen in Figure 12B.

Figure 12: Generation of #046 gRNA expressing vector for functional knock-out of TMEM14B.

The linearized backbone band pattern is shown in Figure 11; (A) Representative colonyPCR screen band from transformed bacteria; Refer to electronic supplements to access raw imaging files. (B) Sequencing data of #046 vector gRNA expression cassette (not drawn to scale) and chromatogram providing sequence traces in forward (upper panel) and reverse (lower panel) direction. Light orange bars depict gRNA sequences. Bases marked in red in the underlying sequences depict mismatches.

3.5. Placement of transgenic expression construct under control of human EF1a promoter

Designated vector constructs carrying the donor sequences for MMEJ-directed knock-in were all based on modifications of the published and commercially available donor plasmid, herein referred to as the #019 pCRIS-PITChv2 FBL. The first vector variants were initially obtained by inclusion of different fluorescent reporter cDNAs, encoding EGFP, mCherry and EBFP genes. These variants were individually modified by placement of the reporter coding 50 sequence cassettes under the control of the human elongation factor EF1a promoter. This was done by IVA cloning, employing inverse PCR of the default vector backbone, at the sites adjacent to the 5’-MHs and Start-codons of the reporter genes (Figure 13). The EF1a core promoter fragment, comprised of the intron A upstream of the start codon of human elongation factor 1a, was cloned through PCR using vector #016 NaSa_p19_mutTurboRFP-2A-eGFP as template. It was integrated into existing #029, #030 and #031 variants (Supplementary Figure 3). The newly obtained donors #032 to #034 were named pCRIS-PITChv2-FBL-EF1a-(NNN)-T2A-PuroR, wherein “NNN” would indicate fluorescent protein flavors, respectively.

Figure 13: Overview of PCR-mediated in vivo assembly and insertion of human EF1a promoter sequence to generate pCRIS-PITChv2 donor vector derivatives further used in subsequent modification steps and/or incorporation of microhomologies (not drawn to scale).

For the generation of the vector #032 pCRIS-PITChv2-FBL-EF1a-EGFP-T2A-PuroR, all templates (#019 pCRIS-PITCh donor vector and #016 for EF1a fragment, respectively) and primers were combined in either separate IVA reactions, or in an all-in-one (AIO) cloning reaction. Across the entirety of the set up PCR conditions, defined by an annealing temperature (Ta) gradient, this yielded amplicons of 6,033 bp for the backbone and 1,209 bp band lengths for the EF1a-fragment (Figure 14A). The sample shown in lane No. 3 of the

AIO reaction, derived from a cycle program with a Ta of 63 °C, was the only reaction to give cfus containing specific plasmid products. It showed the most specific amplification with minor PCR smear. This is in contrast to the intermediate (INT) reactions for the #019 backbone and the #016 fragment, which gave specific PCR products across the entire temperature gradient, but yielded no cfus containing the right plasmid product. ColonyPCR yielded a single 1,070 bp fragment using the primer combinations 024 and 025, permitting the identification of positively transformed cfus from the AIO reaction (Figure 14B). 51

A seamless integration of the EF1a sequence upstream of the reporter sequence was confirmed by sequencing (Figure 14C, grey bar; Supplementary Figure 11).

Figure 14: Generation of #032 pCRIS-PITCh donor vector encoding a green fluorescent reporter under the control of the human EF1a promoter, fused to a puromycin resistance gene by the T2A self-cleavage sequence.

(A) IVA-PCR generated backbone and fragment bands in either an all-in-one (AIO) reaction or in separated PCR reactions, labeled as intermediate (INT). The shown reactions are run in the same cycle program, although an annealing temperature (Ta) gradient was set up in order to find best possible PCR conditions, reducing product smear and unspecific amplicons. (B) Representative colonyPCR screen band from transformed bacteria; Refer to electronic supplements to access raw imaging files. (C) Sequencing data of #032 vector (not drawn to scale) and chromatogram providing sequence traces at the 5’MH site (left panel) and at the EF1a-EGFP fusion gene (right panel), grey bar depicts EF1a sequence, green bar depicts start site of EGFP coding sequence. Bases marked in red in the underlying sequences depict mismatches or gaps.

Successfully transformed cfus, carrying the red fluorescent #033 pCRIS-PITChv2-FBL- EF1a-mCherry-T2A-PuroR donor vector, were obtained when separating the PCR reactions and recombining the obtained IVA-PCR products. No further purification of the latter was needed (Figure 15A). The same primers, 024 and 025, were used to perform colonyPCR, yielding a singular 1,070 bp band in positive clones (Figure 15B). Sequence integrity of the assembled product was confirmed by sequencing the respective integration sites (Figure 15C; Supplementary Figure 12). 52

Figure 15: Generation of #033 pCRIS-PITCh donor vector encoding a red fluorescent reporter under the control of the human EF1a promoter, fused to a puromycin resistance gene by the T2A self- cleavage sequence.

(A) Separate reactions were set up to generate the backbone (bckbne.) and EF1a fragments (frgmnt.); (B) Representative colonyPCR screen band from transformed bacteria; Refer to electronic supplements to access raw imaging files. (C) Sequencing data of #033 vector and chromatogram providing sequence traces at the 5’MH site (left panel) and at the EF1a-mCherry fusion (right panel), grey bar depicts EF1a sequence (not drawn to scale), red bar depicts start site of mCherry coding sequence. Bases marked in red in the underlying sequences depict mismatches or gaps.

The blue fluorescent #034 pCRIS-PITChv2-FBL-EF1a-EBFP-T2A-PuroR donor vector (containing a permutation of the given EGFP sequence) was assembled in the same fashion as described above. Components for IVA-PCR were separated from each other, yielding the backbone of 6,033 bp and the EF1a fragment of 1,209 bp (Figure 16A). Recombination of the two fragments led to formation of clones which were identified by colonyPCR using the primers 024 and 025, leading to the characteristic 1,070 bp amplicon (Figure 16B). Sequence integrity was confirmed in two forward-direction reads (Figure 16C, Supplementary Figure 13), showing proper integration of the EF1a promoter sequence upstream of the EBFP sequence, while simultaneously confirming the identity and existence of the Y66H and Y145F substitution mutations (each further described in Figure 20).

Figure 16: Generation of #034 pCRIS-PITCh donor vector encoding a blue fluorescent reporter fused to puromycin resistance gene by self-cleavage T2A sequence under the transcriptional control of the human EF1a promoter.

(A) Separate reactions were set up to generate the backbone (bckbne.) and EF1a fragments (frgmnt.); (B) Representative colonyPCR screen band from transformed bacteria; Refer to electronic supplements to access raw imaging files. (C) Sequencing data of #034 vector (not drawn to scale) and chromatogram providing sequence traces at the 5’MH site (left panel) and at the EF1a-EBFP fusion (right panel), grey bar depicts EF1a sequence, blue bar depicts start site of EBFP coding sequence and sequences encoding residues H66 and F145. Bases marked in red in the underlying sequences depict mismatches or gaps.

3.6. Exchange of fluorescent reporter coding sequences, site-directed mutagenesis and poly-adenylation signal incorporation

The plasmid based on the default #019 pCRIS-PITCh donor vector was modified to incorporate an additional T2A self-cleavage sequence directly upstream of the Start-codon of the fluorescent reporter coding sequence, after the last nucleotide of the 5’ MH. The construct was originally designed and intended for C-terminal labeling of proteins, however, with the novel variant, both the fluorescent protein and the puromycin resistance (PuroR) gene product would dissociate from the labeled protein upon translation. The underlying sequence, encoding T2A self-cleavage peptide, was introduced into the #019 vector by exploitation of a BamHI restriction site located between the 5’ MH and the start codon (ATG) 54 of the fluorescent reporter. A T2A-encoding, 60 bp oligonucleotide with BamHI-compatible 3’ overhangs was annealed using synthesized ssODNs and ligated into the linear donor backbone (Figure 17). The resulting donor vector #029 pCRIS-PITChv2-FBL-T2A-EGFP- T2A-PuroR served as the template for further modification steps.

Figure 17: Overview of restriction cloning and assembly of the reporter construct to generate pCRIS- PITChv2 donor vector derivatives, suitable for knock-in at a gene’s stop-codon to achieve C-terminal labeling proteins, permitting fluorescence tracing of gene expression in vivo.

The T2A self-cleavage peptide coding sequence (black) is encoded on an annealed oligomer, inserted into BamHI restriction sites of a linearized default pCRIS-PITCh donor vector (not drawn to scale). Both the fluorescent reporter and the antibiotic resistance marker are dissociated from the labeled protein upon translation.

Restriction enzyme digest of the #019 pCRIS-PITChv2-FBL vector resulted in a 6,033 bp backbone fragment which was subsequently excised, purified and 5’-end/3’-end de- phosphorylated using FastAP thermosensitive alkaline phosphatase. The annealed oligonucleotides, 439 and 440, were phosphorylated at the free 5’ hydroxyl-end of the dsODNs according to the described protocol, using T4 polynucleotide kinase. During ligation attempts, numerous apparent cfus per transformation were obtained. However, a

55 large portion of the transformants did not show signs of all the desired colonyPCR products. Only few proper clones were identified and positively sequenced during the screen, displaying the band patterns as depicted in Figure 18B. In particular, as the T2A sequence is present twice within the plasmid, three primers had to be employed to confirm the correct integration: 019 in conjunction with 021 gave a 253 bp band, while 019 in conjunction with 022 resulted in a 477 bp band. Samples originating from cfus displaying this dual-band pattern were submitted to sequencing.

Figure 18: Generation of #029 pCRIS-PITCh donor vector encoding a self-cleavable green fluorescent reporter fused to puromycin resistance gene by self-cleaving T2A sequences.

(A) Restriction digest linearization of default backbone using BamHI; (B) Representative colonyPCR screen bands from transformed bacteria; Refer to electronic supplements to access raw imaging files. (C) Sequencing data of #029 vector (not drawn to scale) and chromatogram providing a sequence trace at the 5’MH-T2A-EGFP portion (panel). Pink bar depicts T2A sequence, green bar depicts start site of EGFP coding sequence. Bases marked in red in the underlying sequences depict mismatches or gaps.

However, it took multiple attempts to obtain a high-quality readout of proper sequence insertion (Figure 18C, black bar), for reasons yet not entirely elucidated. Variants of the same donor vector include the mCherry-encoding vector #030 and the EBFP-encoding vector #031 which were equally generated after the protocol described above (Table 26, Supplementary Figure 8 to 10). A modification of the donor variants performed subsequently

56 was the removal of T2A-Puromycin-resistance gene fusion and its replacement with a Simian virus 40 (SV40) poly-adenylation signal, as terminator of the transgenic reporter construct. The 119 bp minimal termination signal fragment was derived from IVA-PCR amplification of the #003 pMax-turboGFP vector (Supplementary Figure 1) using primers 055 and 056. In parallel, linear amplifications of the #32 (EGFP), #033 (mCherry) and #034 (EBFP) vector backbones, omitting the T2A-PuroR portion from the amplicons, were performed. A representative IVA experiment, employing an AIO reaction, is shown in Figure 19A. Primers 029 in combination with 057 were used in subsequent transformant screens, yielding a ~ 540 bp colonyPCR amplicon for each respective EF1a-fluorophore- SV40 p(A)-fusion (Figure 19B).

Figure 19: Generation of #040 pCRIS-PITChv2-FBL-EF1a-EGFP-SV40 p(A) donor vector encoding a miniature gene composed of human EF1a promoter, EGFP cDNA and SV40 poly-adenylation signal as donor template.

(A) IVA-PCR generated backbone and fragment bands in an all-in-one (AIO) reaction; (B) Representative colonyPCR screen band from transformed bacteria; Refer to electronic supplements to access raw imaging files. (C) Sequencing data of #040 vector (not drawn to scale) and chromatogram providing a sequence trace at the EGFP-SV40 p(A) fusion (panel). Green bar depicts 3’-end of EGFP sequence, dark grey bar depicts SV40 p(A) signal.

The sequences and seamless integrations into the constructs at the Stop-codon of the reporter genes and upstream of the 3’-MHs were confirmed. Representative sequence reads for #040 pCRIS-PITChv2-FBL-EF1a-EGFP-SV40 p(A) are shown in Figure 19C (grey bars).

The aforementioned generation of a blue-fluorescent reporter construct within the pCRIS- PITCh donor template derivatives involved the sequential site-directed mutagenesis of residues involved in energy absorption and emission within EGFP coding sequence. In particular, substitutions causing Tyrosine 66 → Histidine and Tyrosine 145 → Phenylalanine were desired. The first modification is responsible to produce a change in fluorescence emission from 510 nm (green) to 450 nm (blue), while the latter is responsible for an increase in emission intensity and scaffolding stabilization (Girón and Salto 2011).

Figure 20: Generation of #031 pCRIS-PITCh donor vector encoding the basic reporter cassette as present in vector #029, carrying a blue fluorescent reporter. This was achieved through site-directed mutagenesis in the EGFP coding sequence.

(A) IVA-PCR generated backbone intermediates encoding Y66H and Y66H/Y145F mutations in consecutive reactions; (B) Representative colonyPCR screen bands from transformed bacteria; Refer to electronic supplements to access raw imaging files. (C) Schematic of inverse PCR using mutagenic primers and chromatograms providing sequence traces at the EBFP coding sequence (Y66H left panel and Y145F right panel, not drawn to scale).

This was achieved by inversely amplifying the #029 donor vector at the respective sites, each primer carrying the substitution mutation (TAC→CAT at Y66 within primer 435 and TAC→TTT at Y145 in primer 437, respectively). The intermediate IVA product, containing one mutation, was used as a template for the second mutation step, each yielding 6,093 bp long backbone fragments (Figure 20A). Transformant screens were performed using primers confirming the presence of the entire basis vector (e.g. 019 and 438), with representative colonyPCR bands shown in Figure 20B. Site-directed mutagenesis steps were individually confirmed for each variant of this vector, as shown in the representative sequencing data of the vector #031 pCRIS-PITChv2-FBL-EBFP-T2A-PuroR (Figure 20C).

3.7. Introduction of gene specific microhomologous sequences into repair template vector

Gene specific microhomologies were defined as the 22 bp up- and downstream of the Cas9 cleavage site. The respective sequences were incorporated into the donor construct’s flanking sites up- and downstream, positioned directly adjacent to the two PAM sites of the generic PITCh gRNA target sequences. Using overlapping primers combinations, amplification of the reporter gene and the inverse amplification of the backbone was possible. Of note, MH-sequences were each encoded within the long primers for amplification of the donor template cassettes (marked as 22 nt “NNN” within illustration seen in Figure 21). The respective MH sequences are outlined in Table 29.

Figure 21: Overview of the cloning method to incorporate gene-specific microhomologies into the pCRIS-PITChv2 donor vector variants, employing an inverse PCR approach using primer pairs containing microhomologies.

The donor reporter construct is amplified between the PITCh gRNA sites (blue) and the resulting fragment containing gene-specific MHs is assembled into the inversely PCR-amplified backbone.

Table 29: Microhomology sequences for functional knock-outs incorporated into donor vector variants and primers containing these sequences

Gene Position Microhomology sequence (5’-3’, sense strand) Primers 5’ GGCGGCTCACGGGTCGCGCCTC encoded in 045 TRNP1 3’ AGAAGGGCCCGCGCCGCGGCCG encoded in 047 5’ GCTTGCGCTCCGTAGTGGACTC encoded in 068 TMEM14B 3’ CGCGGGCCTTCGGCAGGTCGGT encoded in 070

PCR amplifications of respective donor cassettes, using primers outlined in Table 29, were performed in combination with the amplification of the backbone using IVA-PCR primer pairs 046 and 048. This resulted in proper band formations. However, reactions for the 2,110 bp long donor cassette fragments were prone to contain unspecific amplicons in the range of 4,000 to 5,000 bp, whereas the backbone was amplified in a specific manner, yielding a single band of 4,584 bp (Figure 22A). Nonetheless, the products could be used directly for bacterial transformations. ColonyPCR screens were entirely done with gene- specific primer pairs which would only bind in the respective 5’ and 3’ MH regions, giving rise to a complete donor cassette fragment of 2,050 bp (Figure 22B).

Figure 22: Generation of #043 vector for TRNP1 gene targeting and #047 vector for TMEM14B gene targeting, employing the #040 vector on the basis of a minimal fluorescent reporter gene as a repair template.

(A) IVA-PCR generated backbone and fragment bands in separate reactions for TRNP1 (left gel image) and TMEM14B (right gel image); (B) Representative colonyPCR screen bands from transformed bacteria; Refer to electronic supplements to access raw imaging files. (C) Sequencing data of #043 vector (upper panels) and #047 vector (lower panels). Chromatograms provide sequence traces of the 5’ MHs (left panels) and 3’MHs (right panels) for each gene, outlined by light orange bars respectively.

However, despite initially giving positive colonyPCR results during screening, such reactions would not lead to a desired product with high quality chromatogram sequence traces. Sample degradation during shipping of samples could not be ruled out, especially since Midi-prep yields were similar and protocols were not altered. Therefore, the procedure was repeated, although performing PEG8000 purification of PCR products, as described in methods section, in conjunction with a longer digestion period of template by the DpnI enzyme prior to transformation. This immediately yielded proper colony growth and high-quality sequence data (Figure 22C, orange bars).

Taken together, each plasmid designated for use as pCRIS-PITCh repair donor template was efficiently cloned and verified in terms of sequence integrity at the gene-specifically modified MH sites, with the exception of the vector with the number 48, pCRIS-PITCHv2- TMEM14B-EF1a-mCherry-SV40p(A) (Table 30). The latter was assembled in the same manner and yielded approximately the same bacterial transformation rates as observed with other plasmids. However, the sequence integrity of the 3’MH specifically could not be confirmed 100 %, owing to a lack of high quality sequence readout caused by severe background noise. Peculiarly, raw chromatogram data of sample reads revealed high intensity spikes for most, but not all of the respective nucleotides within that sequence position. They were overlapped by high background noise, only permitting the assumption that the chromatogram data was compromised due to process quality issues. Spectrophotometric measurements of these samples revealed acceptable quantities and quality, which were usually within the same range as observed for the majority of the other plasmids (data not shown). The remaining segments of the transgene (promoter-mCherry cDNA-terminator), including that of the 5’MH were completely resolved and confirmed. Ultimately, a catalog of CRISPR/Cas9 tools suitable for various applications of knock-ins and knock-outs were cloned. Originally, the derivatives of the px458 vector and the pCRIS- PITChv2 donor vectors were intended for use in C-terminal labeling of the human FBL gene. These have been altered to suit TRNP1 gene targeting (vectors 035 to 038, 043, 044, marked in blue in Table 30) or TMEM14B gene targeting (vectors 046 to 048, marked in red). While the remaining plasmids 029 to 034, 040 to 042 are, by default, provided with the FBL-specific MHs, they harness the capability to be used as tools for reporter gene knock- ins, permitting analysis of endogenous gene expression in a spatial-temporal manner. Moreover, the px458 vector variants 035 and 046 are, when used without delivery of a donor vector, capable of CRISPR/Cas9 gene targeting via NHEJ DNA-repair (Table 30).

Table 30: List of pCRIS-PITCh donor vector and px458 CRISPR/Cas9 expression vector constructs generated within this study

Plasmid names and corresponding repository numbers are listed as described throughout this Thesis. Light green depicts constructs which were initially designated for the FBL gene in Sakuma’s publication and modified for experimental use. Light blue depicts constructs designated for TRNP1 gene knock-out and light red depicts constructs designated for TMEM14B gene targeting. See supplementary figures for respective vector maps.

Fluorescent No. Plasmid name Length Specification of gene target and use scenario Genomic target reporter cDNA FBL specific gRNA + PITCh gRNA + FLAG-NLS-SpCas9-EGFP 024 px458_+PITCh gRNA 9,731 bp FBL C-terminus (serves as EGFP expression sort-of control); can be 029 pCRIS-PITCHv2-FBL-T2A-EGFP-T2A-PuroR 6,093 bp EGFP referenced to HEK293T 030 pCRIS-PITCHv2-FBL-T2A-mCherry-T2A-PuroR 6,084 bp C-terminal labeling of FBL under endogenous promoter mCherry (Sakuma et al. 2016) 031 pCRIS-PITCHv2-FBL-T2A-EBFP-T2A-PuroR 6,093 bp EBFP 032 pCRIS-PITCHv2-FBL-EF1a-EGFP-T2A-PuroR 7,214 bp FBL C-terminus (serves as EGFP 033 pCRIS-PITCHv2-FBL-EF1a-mCherry-T2A-PuroR 7,203 bp sort-of control); can be mCherry FBL, reporter is no functional disruptor with existing gRNA donors referenced to HEK293T 034 pCRIS-PITCHv2-FBL-EF1a-EBFP-T2A-PuroR 7,212 bp EBFP (Sakuma et al. 2016) TRNP1 specific gRNA + PITCh gRNA + FLAG-NLS-SpCas9-EGFP 035 px458-TRNP1 gRNA+PITCh gRNA_KO 9,736 bp EGFP expression TRNP1 exon 1 036 pCRIS-PITCHv2-TRNP1-EF1a-EGFP-T2A-PuroR 7,215 bp (chr1:26994278- EGFP 037 pCRIS-PITCHv2-TRNP1-EF1a-mCherry-T2A-PuroR 7,206 bp Functional KO of TRNP1; reporter is disruptor of gene function 26994300) mCherry 038 pCRIS-PITCHv2-TRNP1-EF1a-EBFP-T2A-PuroR 7,215 bp EBFP 040 pCRIS-PITCHv2-FBL-EF1a-EGFP-SV40p(A) 6,671 bp FBL C-terminus (serves as EGFP FBL, reporter is no functional disruptor in combination with existing 041 pCRIS-PITCHv2-FBL-EF1a-mCherry-SV40p(A) 7,203 bp sort-of control); can be mCherry gRNA donors; Fluorophore reports transgene insertion into genomic referenced to HEK293T 042 pCRIS-PITCHv2-FBL-EF1a-EBFP-SV40p(A) 7,212 bp site EBFP (Sakuma et al. 2016) 043 pCRIS-PITCHv2-TRNP1-EF1a-EGFP-SV40p(A) 6,674 bp TRNP1 exon 1 EGFP Functional KO of TRNP1, reporter is disruptor of gene function (chr1:26994278- 044 pCRIS-PITCHv2-TRNP1- EF1a-mCherry-SV40p(A) 6,665 bp mCherry 26994300) Gene specific gRNA + PITCh gRNA + FLAG-NLS-SpCas9-EGFP 046 px458-TMEM14B gRNA+PITCh gRNA_KO 9,736 bp TMEM14B exon 1 EGFP expression (chr6:10747849- 047 pCRIS-PITCHv2-TMEM14B-EF1a-EGFP-SV40p(A) 6,674 bp EGFP Functional KO of TMEM14B, reporter is disruptor of gene function 10747871) 048 pCRIS-PITCHv2-TMEM14B-EF1a-mCherry-SV40p(A) 6,665 bp mCherry

3.8. Cell maintenance of TRNP1 knock-out NHDF iPS cells and fluorescence imaging

NHDF iPS cells have been previously characterized in terms of pluripotency (immunocytochemistry not shown, described elsewhere by Sandra Rizzi). Upon initial seeding, cells were passaged and split in a 1:6 ratio, as described in methods, to obtain cell amounts required for nucleofection procedures. Notably, these cultures were allowed to grow until a confluency of approximately 80-90 % had been reached, since only limited amounts of starting material (cells, media) and nucleofection reagents (electroporation buffers, cuvettes) were available at the time. The NHDF iPS cells were grown on ES-Matrigel-coated 6-well dishes, initially forming small colonies. Such cells possessed laminar-like morphology with the appearance of distal processes 24 h after seeding (representative image in Figure 23A, arrowheads). Typically, some minor amounts of debris or detached cell bodies were visible throughout cell culture after the first day of seeding. Until day 2 of culture, NHDF iPS cells were dispersed across the plate surface, forming ever increasing colony area sizes with sparse cell-cell contacts, as indicated by the broader gap between cell bodies (visible as bright gaps between the cells through phase contrast microscopy). After four days of culture, the laminar/rod-like appearance had mostly changed to a more rounded morphology. In addition to the appearance of a distinct nucleolar structure (Figure 23A, arrows), the close contacts between the cells were indicative for epithelial-like growth which, by morphological terms, has been proposed typical for true iPS- type character using this very cell line in previous studies (unpublished, data not shown). Confluent wells, however, were slightly more prone to contain areas of high density cell growth, leading to noticeable cell detachment and accumulation of debris (visible as bright dots in Figure 23A, left image; note that the image was taken after a wash step in 1X PBS to remove gross portion of debris in the central area of the wells).

Plasmid #035 px458-TRNP1 gRNA+PITCh gRNA_KO, containing the TRNP1-gRNA sequence, was co-nucleofected along with #043 pCRIS-PITCHv2-TRNP1-EF1a-EGFP- SV40p(A) donor, conferring a site-specific integration of a EF1a-EGFP-SV40p(A) miniature transgene at the locus. As the knock-out experiments were done for the first time using the PITCh system by Anita Erharter, emphasis was put into maintaining the overall survival and pluripotential integrity of the NHDF iPS cells. To prevent dissociation-induced apoptosis (anoikis), the transfected cells were kept in culture conditions of a prolonged administration of Y-27632 Rho-associated, coiled-coil containing protein kinase (ROCK) inhibitor. Until at least three days of culture, a mayor portion of NHDF iPS cells displayed EGFP fluorescence signals during live cell imaging, indicative of an effective uptake of px458 CRISPR/Cas9 plasmids and Cas9-EGFP expression (not further quantified). Mayor portions of the cells,

64 especially in the central colony areas, had stronger Cas9-EGFP expression across the entire cell body (Figure 23B, right image).

Figure 23: Live cell imaging and fluorescence microscopy of NHDF iPS cells before and after nucleofection with #035 px458 and #043 pCRIS-PITCh donor vectors.

(A) WT NHDF iPS cells at day 1 after seeding reaching high confluence after day 4. Arrowheads indicate cell processes (left image), arrows depict visible nucleolar structure (dark dots); Scale bars = 50 µm. (B) Representative bulk population of putative TRNP1 functional knock-out cells 3 passages post-nucleofection, showing differential levels of intracellular Cas9-EGFP expression from the px458 CRISPR/Cas9 vector; Scale bars = 100 µm. (C) Live cell fluorescence imaging of a single cluster of putatively transgenic TRNP1-KO cells showing EGFP expression attributed to a site- specific integration of EF1a-EGFP-SV40p(A) sequence. Arrowheads depict alleged apoptotic events with appearance of fragmented cell foci and debris; Scale bars = 100 µm; Images in (B) and (C) by Anita Erharter.

At the onset of cell culture expansion of NHDF iPS cells treated with pCRIS-PITCh TRNP1-KO plasmids, the green fluorescence signals captured during live cell imaging were drastically reduced in terms of signal intensity and led to an apparent abundance of EGFP+ cells. A diminished Cas9-EGFP expression from the episomal vectors was expected, as over time and with increasing number of cell divisions, the plasmid amounts per cell are sequentially diluted to a point where fluorescence signals can no longer be observed. Notably, after passaging the cells three times post-nucleofection, individual clusters of EGFP+ cells started to appear in low numbers across the monitored cultures (Figure 23C). Such clusters of cells were deemed putatively positive for a stable integration of the donor transgene EF1a-EGFP-SV40p(A). After full confluence had been reached, the number of EGFP+ cells per cluster was in the range between 30 to 50 cells, albeit with a vast number of individual cells that had seemingly undergone cell death. This was accompanied by the appearance of focal accumulations of cell fragments and localized debris in the fluorescence channel (Figure 23C, arrowheads).

Next, after at least two differential expansion cultures had been generated and appropriately backed-up, a bulk enrichment for EGFP+ cells from these primary transfected cell cultures was performed (Figure 24). To this end, confluent wells of 6-well plate expansion cultures were pooled and a small portion of the sample was flow-cytometrically analyzed with help by Marta Suarez Cubero. A subpopulation of the total singlets (0.04 %) were measured with high levels of EGFP expression as opposed to 99.93 % of bulk population (EGFP-). A proportion of 0.03 % of EGFP-negative singlets (A-+) showed auto-fluorescence signals in the PE (YG) channel. Neither of the populations gated exhibited strong fluorescence signals in both channels (A++), as evident of cytometric measurement results of NHDF iPS cells (Figure 24B).

Figure 24: Fluorescence live-cell imaging of bulk-sorted NHDF iPS EGFP+ putative TRNP1 functional knock-out cells on day 3 after FACS.

(A) Fluorescence live-cell imaging of representative, bulk-sorted NHDF iPS showing strong enrichment for EGFP+ cells; Scale bars = 100 µm; Images by Anita Erharter. (B) Flow cytometric assessment of intracellular EGFP expression in nucleofected NHDF iPS cells shown in Figure 23C; Data provided by Marta Suarez Cubero.

3.9. Establishing monoclonal cell lines from single-cell sorted TRNP1-KO iPS cells

The pre-enriched EGFP+ cells mentioned above, were further subjected to single-cell isolation for monoclonal expansion cultures, done by Anita Erharter. To this end, single cells were seeded onto MEF 2A feeder layers in 96-well dishes and closely monitored for growth continuity and stable EGFP expression. After approximately two weeks of culture, individual monoclonal transgenic starter cultures could be passaged to expand cultures for decent cell amounts necessary for a) propagation and backup and b) genotyping purposes (representative images shown in Figure 25).

Figure 25: Live cell imaging of putative NHDF iPS TRNP1 KO monoclonal cells

(A) EGFP+ cluster of potentially transgenic NHDF iPS cells carrying the functional knock-out allele of TRNP1 gene (arrowheads). MEF 2A feeder cells are visible in the phase contrast and overlay image surrounding densely packed iPS cells with high levels of reporter expression; Scale bars = 100 µm. (B) Representative image of an expansion colony on ES-Matrigel-coated, feeder-free surface; Scale bars = 150 µm; Images by Anita Erharter.

3.10. PCR screen and genotyping of monoclonal TRNP1 functional knock-out iPS cell lines

Analysis of stable and specific knock-in of the reporter gene at the TRNP1 locus was a necessity to assess the precision and effectiveness of the pCRIS-PITCh system. Although the system has proven to be highly effective for gene knock-ins in HEK293T cells in previous reports by Sakuma et al., published data on the use of this system in human iPS cells, as well as on suitable screening methods was hitherto not available. To this end, genomic DNA (gDNA) samples were extracted from a number of candidate monoclonal cell lines from four available lines for genotyping, including one WT NHDF iPS sample as described in methods section. The primary genotyping screen method relied on PCR amplification of the TRNP1 exon 1 sequence (Figure 26).

Figure 26: Schematic of genotyping method and expected electrophoretic profiles following PCR and T7E1-assay for TRPN1 functional knock-out samples

(A) The WT allele of TRNP1 protein coding sequence was PCR amplified using given forward (Fwd.) and reverse (Rev.) primers. The same primers were used to identify the transgene insertion, yielding a ~ 2.5 kbp product. Identification was aided by use of an additional primer binding in the forward direction within the transgene (Fwd. TG). (B) Schematic representation of PCR screens including T7E1-assay outcomes. The samples yield differential PCR amplicon lengths (left side), dependent on the respective genotypes (WT, heterozygous KO and homozygous KO), according to the schematic represented in (A). The right side depicts the potential outcomes if off-target cleavage had occurred in case of identification of a positively knocked-out monoclone. (C) Overview of primers and their binding sites described in this Thesis (not drawn to scale). Note that the principle for screening would be similar for TMEM14B knock-out confirmation.

A primer combination, centering the site of target cleavage for a ~ 500 bp amplicon, was set up. Since the available Thermus aquaticus (Taq) and Phusion (Phu)-polymerases had previously not been used in reactions comprised of gDNA, it was deemed necessary to test both of them for the genotyping PCR screen. Notably, the higher-fidelity, self-made Phu-polymerase had proven effective and reliable for polymerization of larger DNA fragments up to ~ 9 kbp (e.g. in previous cloning of pFUW-based lentiviral, mammalian expression plasmids conducted throughout thesis, not further described). Its capability for genomic amplification of shorter fragments remained unknown. To rule out any inconsistencies of Phu-based PCRs, Taq-polymerase (2x PCR TaqNova-RED PCR master mix, Blirt) was typically used in a parallel reaction. Initially, primer combinations such as the ones described above, would either lead to a PCR amplicon for the WT alleles or, in case of successful knock-in, to at least one additional amplicon of ~ 2 kbp (heterozygous, monoallelic TRNP1+/-). If a biallelic cleavage and knock-in had occurred at the sites, a singular transgenic amplicon would be visible. For such a PCR, differential reaction cycle parameters, e.g. extension times and annealing temperatures were be needed, attributed to the transgene’s length of > 2 kbp (Figure 26B). To overcome this physical constraint, a forward primer, designed to bind in the central part within the transgene, would permit identification of the specific integration at the site if used in combination with a designated primer binding in the 5’-end of the first TRNP1 exon sequence (Figure 26A). In initial attempts to PCR-amplify the on-target TRNP1 sequence, a number of different conditions were tested under the use of one primer pair designed by measures provided by the primer BLASTN default algorithm (Table 25).

Overall, the expected and possible PCR outcomes of the gene knock-out screen are summarized in Table 31. Primers 078 and 079 were initially expected to lead to an amplification of a 387 bp fragment in case of WT control (ctrl.) samples. A 2,403 bp transgenic band would appear under homozygous knock-out conditions, or, as described above, appear in a dual band pattern if case of heterozygosity. The complementary forward primer 029 was employed for transgene amplification in conjunction with the reverse 079 primer, in anticipation of a 645 bp PCR fragment. However, despite efforts to optimize PCR reaction parameters by adjusting annealing properties (e.g. through gradient PCR) and alterations of the chemical setup (e.g. through use of optimized, high-fidelity PCR buffers, additives such as 1M Betaine, DMSO etc.), no specific PCR fragments could be generated. In particular, Taq-based PCRs showed a singular band at ~ 600 bp in the WT-reaction, but only under addition of 1M Betaine, while Phu-based PCRs, showed an equal band above ~ 600 bp. Under the condition of supplementation with 1M Betaine, the only band visible occurred at ~ 1,000 bp, albeit at lower intensity compared to the previous attempt (Figure 27A). The first monoclonal TRNP1-KO cell line to be tested was sample E6. The 70 aforementioned PCR setup was tested under the same conditions as described aboce. During the first attempts, Taq-based PCR reactions did not favor the addition of PCR supplements (not shown), in that no specific PCR bands would appear, but would rather show an amplicon of ~ 450 bp at stock reaction settings described in materials. The Phu-based PCR showed some minor unspecific products in the lower < 500 bp sizes and one prominent band at ~ 600 bp (Figure 27B, left lanes). An additional screen for transgene insertion was performed, using primers 129 and 079, which yieldied a seemingly specific band at 645 bp and a weak band at just under 500 bp. To analyse the origin and specificity of the prominent PCR amplicon, it was excised from the gel, purified and submitted to DNA sequencing (Figure 27B, right lanes, red asterisk). However, the obtained sequence information could not be matched in any particular way to the target sequence, i.e. neither to the putative TRNP1-KO allele, nor to the WT-allele (data not shown).

To rule out any principal specificity constraints of the used primers, new ones were manually designed and suitability towards the desired locus was individually assessed (i.e. BLASTed against the human genome). The design of primers 130 and 131 were the result of this consideration (Table 25). Given the previous outcomes, PCR setups were re-tested under the same principal conditions and physical parameters. Using these alternative primers, PCRs led to a locus-specific amplification of the target, yielding a 564 bp band (Figure 27C, left block). This was possible with the Taq-setup under default conditions, while no specific fragment was observed in the Phu-setup. However, the addition of 1M Betaine to the Phu-based mix, in combination with a prolonged denaturation cycle and a slightly reduced annealing time led to the same specific amplicon. Full sequence integrity of at least one of the respective products was confirmed through sequencing (data not shown). Likewise, TRNP1-KO samples from monoclonal cell lines B5, C1 and C9 available during the course of this Thesis were analysed. These were examined using the very same reactions and physical PCR parameters as deemed optimal in previous analysis. However, using the primers 130 and 131, only the sample E6 exhibited a singular WT band, while none of the reactions led to the anticipated 2,598 bp product. Of the sample E6, the WT band was excised and sequence analyzed (Figure 27C, second block from left, red asterisk). A match against the WT template was confirmed, as evident in sequencing data (Figure 28D). Noteworthy is that neither of the remaining samples exhibited the desired product using Taq-setups. An exception to that was the sample B5, which displayed dominant PCR-smear with unspecific product of unknown origin in the sub-300 bp part. This was similar to an appearance of the very same unspecific product within all of the Phu-setups, including those of the WT samples, but with the exception of sample B5. The latter contained an apparent, presumably unspecific product at ~ 800 bp (Figure 27C, third block).

In face of the presumptive susceptibility to unspecific PCR-amplification throughout the screen, the whole assay was repeated with newly prepared reagents (i.e. novel dilutions of gDNA, primers, dNTPs and buffers) to rule out any methodological biases. However, the only product that could be confirmed was a singular 564 bp band from sample C1 which was a 100 % positive match against the WT allele as determined by sequencing (Figure 27D, lower panel). A further band of this kind was derived from the C9 sample, albeit at much lower intensity. No gel isolation could be performed due to the overall low DNA recovery yields of the affinity columns in use.

In attempts to further optimize this PCR screen, another existing primer of the institute’s repository (number 2734, graciously provided by Prof. Dirk Meyer’s group) was employed (Table 25). This primer binds in the reverse direction of the EGFP sequence and exhibits similar physical properties as the intended reverse primer 131 in terms of melting temperature (57-58 °C) and GC-content (55 % each). The PCR screen was repeated in efforts to gain a singular amplicon from the transgene as described above, yielding a theoretical 927 bp band. The only sample which stood out was monoclone C9, in that electrophoresed samples led to a strong band of potentially specific origin observed at roughly the desired migration length. This was accompanied by a slight smear of unspecific origin in the range between 1 kbp to 4 kbp region. The stronger fragment was isolated and subjected to sequencing. However, it could not be mapped against the human genome or the in silico template of the TNRP1-KO allele, attributed to poor quality sequencing chromatogram traces (Figure 27E, blue asterisk).

Table 31: List of primer combinations used for genotyping purposes and expected amplicon lengths

Template Primer Fwd. Primer Rev. Amplicon length(s) WT 078 079 378 bp TRNP1-KO 078 079 2,403 bp (+ 378 bp) TRNP1-KO 129 079 645 bp WT 130 131 564 bp TRNP1-KO 130 131 2,598 bp (+ 564 bp) TRNP1-KO 129 131 861 bp TRNP1-KO 2734 131 927 bp

Figure 27: Genotyping of monoclonal TRNP1-KO iPS cell lines and gel electrophoresis screen

(A) Gel electrophoreses of wild-type (WT) sample PCRs using indicated primer combinations 079 and 079. Default and optimized refer to the respective PCR conditions, wherein gDNA samples were newly diluted and reactions were adjusted with additives. (B) 129 and 079 were used for identification of the transgene in monoclone sample E6. (C) Alternative primers 130 and 131 were used in PCR screen of samples E6, B5, C1 and C9. (D) Re-evaluation of the PCR screen with an adjusted cycle program and enhanced PCR reaction mixtures using indicated primers. Note that the screen was performed using Taq-polymerase. (E) Screen for transgene insertion using an EGFP forward primer 2734 and reverse primer 131. Blue asterisks mark lanes from which strong, putatively transgenic fragments were excised and submitted to sequencing. Red asterisks mark lanes containing sequence-confirmed WT products of TRNP1 sequence. See Table 31 for exact amplicon lengths anticipated with respective primer combinations. Lanes of representative PCRs of a gradient setup are shown. For complete gel electrophoresis data, see provided electronic raw files.

3.11. Genomic off-target PCR screening and sequence analysis of TRNP1 target locus

In terms of off-target sequence analysis for the TRNP1-KO approach, PCR amplification of the respective loci, summarized in Table 27, was performed. Since potential cleavage events in genomic off-target loci are not expected to be repaired in a MMEJ DNA-repair manner with an inclusion of the transgenic donor cassette, but rather via NHEJ DNA-repair, these PCR-generated off-target amplicons would have to be subjected to T7E1-assays. To precisely rule out any putative, positively identified TRNP1-KO samples with unwanted off- targets, only T7E1-negative samples would be then have to be submitted to sequence analysis. Such an experimental setup is overviewed in a schematic in Figure 26B. A necessity to provide required DNA fragments for putative T7E1-analysis this was the design of PCR primers, amplifying the regions around chromosomal loci listed in Table 27 and Table 28. In this study, since no positive functional TRNP1-KO has been identified, a principal validation of some, but not all of the off-target primers was performed instead. In particular, all TRNP1-KO off-targets, including RUFY1 (intronic), ARAFP2 (exonic), ARAFP3 (exonic), AMPD3 (exonic), ALG10 (intergenic), ANKRD40 (exonic) and OPA3 (intronic) sequences were tested in PCRs. In addition to that, the TMEM14B target locus itself, as well as two of its potential off-targets, CDC7 (intergenic) and STARD3NL (exonic) sequences were also included. The latter were examined, because it had proven difficult during genomic data browsing to find specific primer pairs which would not exhibit strong off-target binding due to repetitive sequences around the respective loci (Supplementary table 1). With the exception of the ANKRD40 exon locus, each of the potential off-target sequences could be PCR amplified specifically, yielding desired amplicon lengths. While the gel electrophoresis image provided in Figure 28A contained samples prepared in Taq-based PCR reactions, including the TMEM14B exon band in Figure 28C, remaining products in Figure 28CB were amplified with Phu-polymerase. The individual bands were not further analyzed by sequencing or T7E1-assays due to limited availability of reagents and to reduce the overall costs. However, WT samples of TMEM14B and TRNP1 PCR products have been purified and stored for future applications (such as hybridization template used in T7E1-analysis). Slightly blurry appearances of both marker and sample lanes in gel electrophoreses, shown in Figure 28, were observed. This is due to the fact that reactions were loaded onto larger gels of low-percentage agarose concentrations, since only limited electrophoresis hardware was available at the time of experiments. Overall, the general primer design guidelines described for off-target analysis in this type of knock-out approach proved efficient enough, permitting subsequent T7E1- assays and/or sequencing applications.

Figure 28: Additional PCR results displaying amplification of predicted genomic off-target sequences, TMEM14B target sequence and sequencing results from TRNP1-KO PCR screen.

(A) Gel electrophoresis of Taq-polymerase PCR-amplified off-target sequences (CDC7 and STARD3NL were used for the purpose of testing general PCR conditions). Note that negative control lanes were omitted. (B) Remaining off-target fragments from TRNP1-KO screen amplified by Phu-polymerase. (C) PCR fragment of the TMEM14B exonic target sequence, amplified by Taq-polymerase. (D) Sequencing results with a schematic overview of the TRNP1 site of interest (not drawn to scale). Monoclones E6 and C1 show no sign of CRISPR/Cas9-cleavage at the target site (gRNA target sequence marked in blue, red mark indicates the site of cleavage) or indel- mutations. Codes refer to provided Eurofins Genomics Mix2Seq accessions. Red marked nucleotides represent mismatches (in sample E6 due to poor chromatogram quality of emission peaks at respective nucleotide positions).

4. Discussion

4.1. To PITCh, or not to PITCh - the power lies in your hand

The CRISPR/Cas9 system for gene editing has dominated the literature in recent years, undoubtedly making it the tool of choice for major gene engineering experiments and applications in the field of biomolecular research. As more techniques and novel variations of the system emerge, it gets increasingly important to know the benefits of each system and to determine which might make for the most suitable to achieve highest possible efficiency. “PITChing” an allele according to reports from Sakuma and peers has not only proven to be robust and effective, but also brings the benefits of easily prepared and cost- effective plasmid tools to the lab bench. The experimental design in this Master’s thesis was adapted from the original Sakuma publication and was turned into a versatile platform for the general use in iPS cell-related research at the institute. While there has been, at least to date, no publicly available data on the use of the pCRIS-PITCh system in human iPS cells specifically, it was assumed that it would perform equally as effective, as shown in HEK293T cells and animals (Nakade et al. 2014; Sakuma et al. 2016). A major part of the Thesis work was dedicated to arranging and building vector tools for PITCh knock-in via MMEJ DNA-repair. Two of the generated vector components have been tested in vitro in cell culture use. Despite the efforts to identify and isolate precisely gene edited iPS cells, none of the obtained samples could be confirmed as TRNP1 functional knock-outs. On the contrary, it is equally unknown after all data gathered as to whether or not the donor transgene cassette had been incorporated at the desired location. More importantly, the origins of stable and robust expression of EGFP throughout a portion of the bulk population of cells, as well as in single-cell derived monoclones, remain unknown. These promiscuous facts lead the reader to question the overall functionality of the PITCh TRNP1-KO approach in lack of experimental proof on the level of DNA-sequence. Also, one has to consider the complete integration of the transgene at a random position in the genome, which, as a form of a miniature-gene, is theoretically functional at any given transcriptionally active position in the genome. In this study, four samples could be analyzed in the given time. It was expected that a confirmed hit would have occurred throughout the screen as more samples would be available. Nevertheless, one cannot rule out constraints caused by physical and physiological circumstances leading to a limited effectivity of the pCRIS-PITCh system in the given stem cell culture system. Such circumstances might involve the stability of exogenous plasmids while being introduced into cells or their readability by the cellular transcription machinery. Will human iPS cells respond to forced CRISPRization in a MMEJ fashion? Is MMEJ machinery even “turned on” and readily employed throughout the state of DNA-damage in face of competing NHEJ activity in these highly-artificial, reprogrammed

76 cells? To address these concerns, in theory, one may want to shed light onto and investigate on the individual prerequisites of a CRISPR experiment: the choice of gRNA setup, the type of Cas9 protein, the delivery of components into cells and the overall principle of monoclonal isolation. All mentioned factors may contribute to the success of a CRISPR/Cas9 experiment in different manners which implicates that each individual step must be tested and optimized experimentally. Ultimately, gaining evidence(s) to address these concerns, as part of a proof of principle, is highly desired. Such measures usually require a lot of material, not at least to mention immense work. However, when implying the insights gained from such comparative experiments (e.g. measurement of Cas9-mRNA and gRNA levels through RT-qPCR), one might effectively be able to tune the pCRIS-PITCh experiment specifically for use in a desired cell culture model.

4.2. A convenient but effective screening method is key to the reliability of CRIS-PITCh experiments and gene manipulation

In search of a potential hit, two indispensable requirements for a full knock-out confirmation have to be fulfilled: a monoclonal functional knock-out candidate has to a) carry the complete, biallelic transgene, thereby leading to the functional impairment of the gene and b) exhibit no off-target cleavage events or unwanted integration of foreign genes at undesired loci. For few samples, distinct PCR band profiles could be shown which would imply the incorporation of the transgene into one allele. However, due to the lack of sequencing data, the above mentioned points leading to this assumption cannot be confirmed. On one hand, it is possible that the product could indeed be present at the given genomic site, but PCR reactions did simply not prove efficient enough for specific amplificates. On the other hand, it might very well be the case that principal genotyping screen conditions and the overall setup would in fact work (as evident by specific amplification of the on-targets), however, no actual knock-in had occurred in the given material. A concern which remains is that either of these cases can truly be ruled out in lack of a possibility to achieve positive controls (e.g. by comparison with an already established and verified knock-in reporter line carrying the very same transgene). A partial confirmation of wild-type identity of one chromosome was achieved for at least two of the given samples. Further work on optimization of screening methods and handling of DNA samples is definitely needed in future experimentation. The roles of sample preparation and use of materials involved in next-generation sequencing methods are not to be undervalued (Serrao et al. 2016; Alekseyev et al. 2018)

4.3. Physical prerequisites meet physiological limitations during CRISPR gene editing - a stem cell’s point of view

CRISPR/Cas9 systems are not devoid of certain problems, such as insufficient effectiveness in some experiment models (Karagyaur et al. 2018). There are a multitude of reasons why no confirmed functional knock-out iPS cell lines could be identified. A number of explanations for that have to do with the nature of the CRISPR tools. One possibility is that the TRNP1-gRNA may not have been successful in target annealing and binding of Cas9-RNP complex, likely for chromatin accessibility reasons (Jensen et al. 2017). Employment of multiple gRNAs for that particular gene locus and systematic comparison of targeting efficiencies may aid more reliable gene targeting. The obvious limitation of this, however, would be that a greater amount of cell culture work, not to mention clonal expansion has to be undertaken, raising the overall costs immensely. A significant role of PARP1 regulation during MMEJ has been demonstrated in recent experiments designed for the correction of disease-associated microduplications in the genome of patient-derived iPS cells (Iyer et al. 2019). A principal analysis of PARP1 activity in NHDF iPS cells before and after nucleofection with CRIS-PITCh tools may help determine at what levels MMEJ DNA-repair actually occurs in human iPS cells. The upregulation of this factor or associated genes in targeted cells may lead to increased PITCh knock-in rates, although, at least for the knock-in of larger genes, there is yet no evidence available to support this hypothesis. Targeted genetic manipulations using the CRISPR/Cas9 system in pluripotent cells have been proven to be feasible in numerous studies, freely adapted from the proposition that everyone can edit anything (Patmanathan et al. 2018; Kampmann 2017; Hendriks et al. 2016). The transient delivery of CRISPR/Cas9 plasmids and FACS-based enrichment of targeted cells is reported to work with high efficiency in human and mouse neural stem cells cultures, with remarkable effectiveness regarding the biallelic knock-out of genes through HR (Toledo et al. 2015; Bressan et al. 2017). Although the consistency of biallelic alleles undergoing precise integration of donor DNA is rare, as suggested by Bressan and peers, it is reported that a great value exists in observing consistent amounts of monoallelic transformants carrying indel mutations at the site of interest. While this does not necessarily cause a complete knock-out of the gene, its practical value lies within the fact that targeting and selection in a single round are enabled and guarantee rapid isolation of hypomorphic/loss-of-function clones. Likewise, as one scales down the amounts of samples (cells and DNA), the possibility of establishing higher transformation throughput, and thus, an increase in efficiency of the whole CRISPR experiment, might open up.

It has been reported elsewhere that the use of antibiotics to select clones carrying the intended genomic alterations has proven particularly useful (Supharattanasitthi et al. 2019).

The use of a puromycin N-acetyl-transferase (PAC) resistance gene is commonly accepted (Vara et al. 1986). A stable CRISPR/Cas9-driven integration of the resistance gene into the genome in conjunction with a transgene of interest (fluorescence markers) are widely in use. Its transient expression, linked to the translation of the Cas9 protein and clonal selection based on early expression of Cas9 has proven effective for scarless gene editing in human pluripotent stem cells (Steyer et al. 2018). The general setup was designed with a focus on minimal exogenous impact on the iPS cells. To this end, the PuroR-marker was omitted from the transgene to be incorporated. With this in mind, it was hypothesized that pluripotential capacities and integrity of stem cells would not be altered dramatically or compromised artificially by ceded chemicals. Reports on the detrimental effects of aminoglycosides and common cell-culture selection antibiotics on the viability and differentiation capability of human embryonic and mesenchymal stem cells have emerged (Skubis et al. 2017; Varghese et al. 2017). Of note, the combined cytotoxic effects caused by simultaneous CRISPR/Cas9-cleavage may also contribute to this potential impact on the iPS cells. Therefore FACS selection was deemed more suitable to counterbalance these hazards during clonal isolation, as individual parameters such as flow rates, agitation and culture conditions can be adjusted to need. Nevertheless, this physical sorting method, albeit allowing for precise cytometric analysis, can be potentially harmful and produce cellular stress, such as oxidative and metabolic alterations (Llufrio et al. 2018).

Following an approach suggested by Steyer and peers, one may indeed be able to overcome the stress-caused limitations of single-cell FACS to enrich Cas9 and/or reporter gene expressing cells, which can be challenging in human stem cells due to low survival rates and high risk of contamination (Yang et al. 2013). The overall isolation efficiency of cells transiently expressing Cas9 and the selection marker simultaneously could thereby be improved drastically. This would elevate the abundance of putatively gene modified cells in the bulk population, consequently aiding in clonal isolations. Moreover, observations have emerged suggesting a transient co-expression of factors reducing overall biological and exogenous stresses that cells would undergo during CRISPR/Cas9-targeting and FACS applications (Li et al. 2018). For example, this has been achieved by transient overexpression of anti-apoptotic isoform of BCL2-like “extra-large” (BCL-XL) regulator in human iPS cells, providing enhanced means of single cell cloning and survival of positive clones. Strikingly, the expression of this factor led to a ~ 100-fold increase in HDR knock-in efficiency at various loci.

While the delivery method of the CRISPR/Cas9-cargoes will often dictate the overall outcome and effectiveness of gene editing experiments (Lino et al. 2018), CRISPR components and the choice of and the functional arrangements of transgenic elements

79 themselves may have differential effects on the gene targeting efficiency. One way to elucidate the most optimal transgene constellation for use in iPS cells is to perform gene knock-ins at genomic safe harbor sites, e.g. at the adeno-associated virus site 1 (AAVS1), a naturally occurring site of integration used by the AAV virus (Papapetrou and Schambach 2016). This would be beneficial for the user in that it allows to precisely assess cell survival and targeting efficiencies with a range of given donor transgenes, while simultaneously being able to refine hands-on steps of the protocol during experimentation (single-cell FACS vs. antibiotic selection).

Figure 29: Aspired roadmap of experimental steps necessary for rapid and highly efficient CRISPR/Cas9-editing using the described methodology.

Three main stages can be distinguished: CRISPR-editing (upper panel), FACS isolation (middle panel) and genotyping of cells, combining the screening and selection for positive clones and molecular characterization of identified transformants. Time specifications are estimations.

Once a suitable setup and an optimal protocol has been determined, parameters such as gRNA alterations (lengths, positions), Cas9 variants, cell-culture supplementations etc. could be tested to ensure best possible conditions before actually targeting a specific gene of interest. Nevertheless, proper characterization of novel CRISPRized iPS cell lines remains indispensable within any experiment. Such a characterization includes, at the very least, extensive off-target analysis and the validation of pluripotency (Figure 29).

Taken together, numerous optimizations and additional measures to aid CRISPR/Cas9 efficiency and clonal isolation can be undertaken. However, the method and design of the approach described herein was intentionally set up with easy and minimal preparation requirements, little material needs and reduction of stress on cell cultures in mind (Figure 29). As the need for higher throughput screens and efficient gene manipulation approaches rise by ever increasing interest in gene function, a protocol described in this Thesis can indeed prove highly valuable over time in these studies. This is particularly true in face of the desire to study genetic functions on larger scales (Koike-Yusa et al. 2014).

5. Outlook Since iPS cells possess the ability to give rise to a multitude of cell types, including neural stem- and progenitor cells, the newly generated iPS cell lines were intended to be employed in consecutive differentiation experiments. Drastic changes in phenotypical characteristics are anticipated as potential key regulatory factors of neurodevelopmental processes would be absent. The abolishment of gene functions by targeting individual coding DNA sequences as part of functional knock-outs may have the same overall effect as deletion of the complete genomic locus. Monoallelic, PITChed NHDF iPS cells for functional knock- outs of TRNP1 and TMEM14B through transgene insertion are therefore highly desired, given the institute’s focus of research.

TRNP1 acts as a key regulator of the proliferative behavior of basal radial glia (RG). Its level of expression determines the output of neuronal cells during the development of the human cerebral neocortex. Defined expression characteristics and tight regulation of TRNP1 activity within outer RGs of the subventricular zone direct these cells to take on the identity of either self-renewing RGs and/or radially expanding and proliferative RGs. Ultimately, these cells promote neurogenesis, thereby leading to the folding of cortical tissue (Stahl et al. 2013). Genetic dysregulation or abolishment of this factor may therefore lead to a larger pool of proliferative subventricular outer RG pools, enabling subsequent cortex expansion.

The primate-specific factor TMEM14B is characteristic for outer RGs and as such represents another key determinant of progenitor cell regulation. Its genetic expression 81 marks outer radial glia and intermediate progenitor cells of the subventricular zone and impacts the proliferative behavior by regulating cell-cycle progression. This implicates a role of dynamic regulation through TMEM14B activity during early cortical neurogenesis. A crucial level of gene expression is maintained within progenitor-type outer RG and basal IPs of the subventricular zone (Liu et al. 2017). The absence of the TMEM14B factor may lead to a reduced capacity of neurogenic sub-type specification within this population of cells. Consecutively lower levels of cortical tissue formation and loss of cerebral folding and gyrification may therefore be possible. It is unknown whether or not, if any, related transmembrane proteins of this superfamily of genes act in concert with TMEM14B specifically. Likewise, it is not elucidated to date in any form if there is a combined effect or cross-regulation of the two factors in radial glia. Nonetheless, the genes are anticipated to strongly regulate downstream genetic instances which control the rate of proliferation (e.g. through G1-S transition) or impact the transcriptional landscape of basal RGs (e.g. up- or downregulation of stemness/multipotential markers, neuronal specification markers). Monoallelic functional knock-outs of the genes TRNP1 and TMEM14B in human iPS cells are expected to directly alter their ability to induce neurogenesis. Thus, the capability of NPCs to generate subtype-specific neuronal cells (e.g. CTIP2+ deep layer neurons or STAB2+ upper layer neurons) may be drastically altered. Loss-of function of TMEM14B is hypothesized to lead to an abolishment of basal progenitor proliferation and a decrease in outer RGs and IPs in iPS cell-derived 2D models of neural development in vitro. As a consequence, direct phenotypical aberrations would occur within TMEM14B-/- iPS cell- derived cerebral organoids, epitomized by a loss of neuronal subtype-specific layer structure and the appearance of a smooth cortex surface. In contrast to this, the knock-out of the human TRNP1 gene in iPS cells directed for neuronal differentiation would result in hyper-proliferation of basal RGs in vitro. Thereby, a considerable increase of neuron subtype formation would potentially be permitted. In 3D-culture applications, this would likely be expected to lead to a significant increase in the level of cortex gyrification and radial expansion of the underlying SVZ. Ultimately, the insights gained from such genome editing experiments are highly desired for the study of genetic factors in the context of transgenic and/or knock-out 3D-cultures. These allow the precise analysis of spatio-temporal patterns and aspects of cell differentiation/organization. It is aimed to establish human cerebral organoids as they permit a broad range of model experiments and permit gene analysis without the need of limited primary samples or tissues and furthermore do not entail ethical concerns.

6. List of Figures Figure 1: Type II CRISPR/Cas9 as a DNA interference system providing adaptive immunity in bacteria for defense against viral infection (Jiang and Doudna 2017)...... 4 Figure 2: Overview of Cas9 endonuclease protein structure and functional domains in inactive and active, guide RNA-bound forms (Jiang and Doudna 2017)...... 6 Figure 3: Overview of the CRISPR/Cas9 system for gene editing and possibilities of gene manipulation through various DNA-repair mechanisms (modified from Ran et al. 2013)...... 8 Figure 4: Overview of microhomology-mediated end-joining (MMEJ) as an alternative non- homologous end-joining DNA-repair pathway (A-NHEJ) active in dividing cells (modified from McVey and Lee 2008; Sallmyr and Tomkinson 2018)...... 11 Figure 5: Mechanistic principle of the precise integration into target chromosome (PITCh) system, employed by Sakuma et al., for targeted gene knock-in using microhomology-mediated end-joining DNA-repair...... 13 Figure 6: Definition of gRNA sequence and CRISPR target site within TRNP1 locus and principle of microhomology-mediated integration of donor template ...... 41 Figure 7: Definition of gRNA sequence and CRISPR target site within TMEM14B locus and principle of microhomology-mediated integration of donor template ...... 43 Figure 8: Overview of copy-paste cloning steps to generate a universal Cas9-gRNA-PITCh gRNA expression system ...... 46 Figure 9: Generation and cloning of universal CRISPR/Cas9 vector construct used throughout the Thesis for gene-specific targeting ...... 47 Figure 10: Overview of cloning steps necessary for insertion of gene-specific gRNA sequences into the #024 px458 expression vector...... 48 Figure 11: Generation of #035 gRNA expressing vector for functional knock-out of TRNP1...... 49 Figure 12: Generation of #046 gRNA expressing vector for functional knock-out of TMEM14B. ... 50 Figure 13: Overview of PCR-mediated in vivo assembly and insertion of human EF1a promoter sequence to generate pCRIS-PITChv2 donor vector derivatives further used in subsequent modification steps and/or incorporation of microhomologies (not drawn to scale)...... 51 Figure 14: Generation of #032 pCRIS-PITCh donor vector encoding a green fluorescent reporter under the control of the human EF1a promoter, fused to a puromycin resistance gene by the T2A self-cleavage sequence...... 52 Figure 15: Generation of #033 pCRIS-PITCh donor vector encoding a red fluorescent reporter under the control of the human EF1a promoter, fused to a puromycin resistance gene by the T2A self-cleavage sequence...... 53 Figure 16: Generation of #034 pCRIS-PITCh donor vector encoding a blue fluorescent reporter fused to puromycin resistance gene by self-cleavage T2A sequence under the transcriptional control of the human EF1a promoter...... 54 Figure 17: Overview of restriction cloning and assembly of the reporter construct to generate pCRIS-PITChv2 donor vector derivatives, suitable for knock-in at a gene’s stop-codon to achieve C-terminal labeling proteins, permitting fluorescence tracing of gene expression in vivo...... 55

Figure 18: Generation of #029 pCRIS-PITCh donor vector encoding a self-cleavable green fluorescent reporter fused to puromycin resistance gene by self-cleaving T2A sequences...... 56 Figure 19: Generation of #040 pCRIS-PITChv2-FBL-EF1a-EGFP-SV40 p(A) donor vector encoding a miniature gene composed of human EF1a promoter, EGFP cDNA and SV40 poly- adenylation signal as donor template...... 57 Figure 20: Generation of #031 pCRIS-PITCh donor vector encoding the basic reporter cassette as present in vector #029, carrying a blue fluorescent reporter. This was achieved through site- directed mutagenesis in the EGFP coding sequence...... 58 Figure 21: Overview of the cloning method to incorporate gene-specific microhomologies into the pCRIS-PITChv2 donor vector variants, employing an inverse PCR approach using primer pairs containing microhomologies...... 60 Figure 22: Generation of #043 vector for TRNP1 gene targeting and #047 vector for TMEM14B gene targeting, employing the #040 vector on the basis of a minimal fluorescent reporter gene as a repair template...... 61 Figure 23: Live cell imaging and fluorescence microscopy of NHDF iPS cells before and after nucleofection with #035 px458 and #043 pCRIS-PITCh donor vectors...... 65 Figure 24: Fluorescence live-cell imaging of bulk-sorted NHDF iPS EGFP+ putative TRNP1 functional knock-out cells on day 3 after FACS...... 67 Figure 25: Live cell imaging of putative NHDF iPS TRNP1 KO monoclonal cells ...... 68 Figure 26: Schematic of genotyping method and expected electrophoretic profiles following PCR and T7E1-assay for TRPN1 functional knock-out samples ...... 69 Figure 27: Genotyping of monoclonal TRNP1-KO iPS cell lines and gel electrophoresis screen .. 73 Figure 28: Additional PCR results displaying amplification of predicted genomic off-target sequences, TMEM14B target sequence and sequencing results from TRNP1-KO PCR screen. ... 75 Figure 29: Aspired roadmap of experimental steps necessary for rapid and highly efficient CRISPR/Cas9-editing using the described methodology...... 80

7. List of Tables Table 1: Cell lines ...... 17 Table 2: Cell culture materials and reagents ...... 17 Table 3: Chemicals and reagents ...... 18 Table 4: Bacterial cell lines for molecular cloning ...... 19 Table 5: Recombinant enzymes for cloning and assembly ...... 19 Table 6: Isolation and purification kits ...... 19 Table 7: Laboratory equipment ...... 20 Table 8: Media compositions and cell culture reagents recipes ...... 20 Table 9: Compositions for bacterial culture media, buffers and cloning reagents ...... 20 Table 10: Antibiotic concentrations used for bacterial work ...... 22 Table 11: Target gene reference sequence accession data obtained from NCBI GenBank ...... 22 Table 12: Reaction setup of Phusion-based PCR for in vivo assembly (IVA) ...... 24 Table 13: Cycler program for in vivo assembly PCR ...... 24 Table 14: Reaction setup of Phusion-based PCR and/or colonyPCR ...... 25 Table 15: Reaction setup of Taq-based PCR ...... 25 Table 16: Cycler program of typical PCR for cloning and screening ...... 25 Table 17: Reaction setup for restriction digestions ...... 26 Table 18: Reaction setup for annealing of oligos ...... 26 Table 19: Blunt-end and sticky-end (cohesive) ligation reaction ...... 27 Table 20: Sample volumes and amounts used for transformation of chemically competent cells for different cloning scenarios ...... 28 Table 21: List of oligonucleotides for dsDNA annealing ...... 34 Table 22: List of primers used for IVA cloning ...... 34 Table 23: List of primers used for colonyPCR screening during vector assembly ...... 35 Table 24: List of primers used for vector DNA sequencing ...... 36 Table 25: List of primers used for genomic DNA amplification and sequencing ...... 37 Table 26: List of available template plasmids used for generation of CRIS-PITCh and donor vector constructs ...... 40 Table 27: Specificity of TRNP1 gRNA target site on chromosome 1:26994278-26994300 and off- target predictions ...... 42 Table 28: Specificity of TMEM14B gRNA on chromosome 6:10747849-10747871 and off-target predictions ...... 44 Table 29: Microhomology sequences for functional knock-outs incorporated into donor vector variants and primers containing these sequences ...... 60 Table 30: List of pCRIS-PITCh donor vector and px458 CRISPR/Cas9 expression vector constructs generated within this study ...... 63 Table 31: List of primer combinations used for genotyping purposes and expected amplicon lengths ...... 72

8. References Alekseyev, Yuriy O.; Fazeli, Roghayeh; Yang, Shi; Basran, Raveen; Maher, Thomas; Miller, Nancy S.; Remick, Daniel (2018): A Next-Generation Sequencing Primer-How Does It Work and What Can It Do? In Academic pathology 5, 2374289518766521. DOI: 10.1177/2374289518766521.

Arana, Mercedes E.; Seki, Mineaki; Wood, Richard D.; Rogozin, Igor B.; Kunkel, Thomas A. (2008): Low-fidelity DNA synthesis by human DNA polymerase theta. In Nucleic acids research 36 (11), pp. 3847–3856. DOI: 10.1093/nar/gkn310.

Auerbach, C.; Robson, J. M.; Carr, J. G. (1947): The Chemical Production of Mutations. In Science (New York, N.Y.) 105 (2723), pp. 243–247. DOI: 10.1126/science.105.2723.243.

Babcock, Joseph J.; Li, Min (2013): Deorphanizing the human transmembrane genome: A landscape of uncharacterized membrane proteins. In Acta Pharmacologica Sinica 35, 11 EP -. DOI: 10.1038/aps.2013.142.

Ben Jehuda, Ronen; Shemer, Yuval; Binah, Ofer (2018): Genome Editing in Induced Pluripotent Stem Cells using CRISPR/Cas9. In Stem cell reviews and reports 14 (3), pp. 323–336. DOI: 10.1007/s12015-018-9811-3.

Bindu A, Hima; B, Srilatha (2011): Potency of Various Types of Stem Cells and their Transplantation. In J Stem Cell Res Ther 01 (03). DOI: 10.4172/2157-7633.1000115.

Bohgaki, Toshiyuki; Bohgaki, Miyuki; Hakem, Razqallah (2010): DNA double-strand break signaling and human disorders. In Genome integrity 1 (1), p. 15. DOI: 10.1186/2041-9414-1-15.

Bolotin, Alexander; Quinquis, Benoit; Sorokin, Alexei; Ehrlich, S. Dusko (2005): Clustered regularly interspaced short palindrome repeats (CRISPRs) have spacers of extrachromosomal origin. In Microbiology (Reading, England) 151 (Pt 8), pp. 2551–2561. DOI: 10.1099/mic.0.28048-0.

Boulton, S. J.; Jackson, S. P. (1996): Saccharomyces cerevisiae Ku70 potentiates illegitimate DNA double-strand break repair and serves as a barrier to error-prone DNA repair pathways. In The EMBO Journal 15 (18), pp. 5093–5103.

Bressan, Raul Bardini; Dewari, Pooran Singh; Kalantzaki, Maria; Gangoso, Ester; Matjusaitis, Mantas; Garcia-Diaz, Claudia et al. (2017): Efficient CRISPR/Cas9-assisted gene targeting enables rapid and precise genetic manipulation of mammalian neural stem cells. In Development (Cambridge, England) 144 (4), pp. 635–648. DOI: 10.1242/dev.140855.

Brouns, Stan J. J.; Jore, Matthijs M.; Lundgren, Magnus; Westra, Edze R.; Slijkhuis, Rik J. H.; Snijders, Ambrosius P. L. et al. (2008): Small CRISPR RNAs guide antiviral defense in prokaryotes. In Science (New York, N.Y.) 321 (5891), pp. 960–964. DOI: 10.1126/science.1159689.

Carroll, Dana (2011): Genome engineering with zinc-finger nucleases. In Genetics 188 (4), pp. 773–782. DOI: 10.1534/genetics.111.131433.

Carroll, Dana (2014): Genome engineering with targetable nucleases. In Annual review of biochemistry 83, pp. 409–439. DOI: 10.1146/annurev-biochem-060713-035418. 86

Chagastelles, Pedro C.; Nardi, Nance B. (2011): Biology of stem cells: an overview. In Kidney international supplements 1 (3), pp. 63–67. DOI: 10.1038/kisup.2011.15.

Charpentier, Emmanuelle; Doudna, Jennifer A. (2013): Rewriting a genome. In Nature 495, 50 EP -. DOI: 10.1038/495050a.

Cui, Yingbo; Xu, Jiaming; Cheng, Minxia; Liao, Xiangke; Peng, Shaoliang (2018): Review of CRISPR/Cas9 sgRNA Design Tools. In Interdisciplinary sciences, computational life sciences 10 (2), pp. 455–465. DOI: 10.1007/s12539-018-0298-z.

Decottignies, Anabelle (2007): Microhomology-mediated end joining in fission yeast is repressed by pku70 and relies on genes involved in homologous recombination. In Genetics 176 (3), pp. 1403–1415. DOI: 10.1534/genetics.107.071621.

Eckfeldt, Craig E.; Mendenhall, Eric M.; Verfaillie, Catherine M. (2005): The molecular repertoire of the 'almighty' stem cell. In Nature reviews. Molecular cell biology 6 (9), pp. 726–737. DOI: 10.1038/nrm1713.

Gaj, Thomas; Gersbach, Charles A.; Barbas, Carlos F. (2013): ZFN, TALEN, and CRISPR/Cas-based methods for genome engineering. In Trends in biotechnology 31 (7), pp. 397–405. DOI: 10.1016/j.tibtech.2013.04.004.

García-Nafría, Javier; Watson, Jake F.; Greger, Ingo H. (2016): IVA cloning: A single-tube universal cloning system exploiting bacterial In Vivo Assembly. In Scientific reports 6, p. 27459. DOI: 10.1038/srep27459.

Garneau, Josiane E.; Dupuis, Marie-Ève; Villion, Manuela; Romero, Dennis A.; Barrangou, Rodolphe; Boyaval, Patrick et al. (2010): The CRISPR/Cas bacterial immune system cleaves bacteriophage and plasmid DNA. In Nature 468, 67 EP -. DOI: 10.1038/nature09523.

Gasiunas, Giedrius; Barrangou, Rodolphe; Horvath, Philippe; Siksnys, Virginijus (2012): Cas9-crRNA ribonucleoprotein complex mediates specific DNA cleavage for adaptive immunity in bacteria. In Proceedings of the National Academy of Sciences of the United States of America 109 (39), E2579-86. DOI: 10.1073/pnas.1208507109.

Girón, María D.; Salto, Rafael (2011): From green to blue: site-directed mutagenesis of the green fluorescent protein to teach protein structure-function relationships. In Biochemistry and molecular biology education: a bimonthly publication of the International Union of Biochemistry and Molecular Biology 39 (4), pp. 309–315. DOI: 10.1002/bmb.20467.

Graham, Daniel B.; Root, David E. (2015): Resources for the design of CRISPR gene editing experiments. In Genome biology 16, p. 260. DOI: 10.1186/s13059-015-0823- x.

Guha, Tuhin Kumar; Wai, Alvan; Hausner, Georg (2017): Programmable Genome Editing Tools and their Regulation for Efficient Genome Engineering. In Computational and structural biotechnology journal 15, pp. 146–160. DOI: 10.1016/j.csbj.2016.12.006.

Gurdon, J. B. (1962): The developmental capacity of nuclei taken from intestinal epithelium cells of feeding tadpoles. In Journal of embryology and experimental morphology 10, pp. 622–640. 87

Hendriks, William T.; Warren, Curtis R.; Cowan, Chad A. (2016): Genome Editing in Human Pluripotent Stem Cells: Approaches, Pitfalls, and Solutions. In Cell stem cell 18 (1), pp. 53–65. DOI: 10.1016/j.stem.2015.12.002.

Heyer, Wolf-Dietrich (2015): Regulation of recombination and genomic maintenance. In Cold Spring Harbor perspectives in biology 7 (8), a016501. DOI: 10.1101/cshperspect.a016501.

Hockemeyer, Dirk; Jaenisch, Rudolf (2016): Induced Pluripotent Stem Cells Meet Genome Editing. In Cell stem cell 18 (5), pp. 573–586. DOI: 10.1016/j.stem.2016.04.013.

Hsu, Patrick D.; Scott, David A.; Weinstein, Joshua A.; Ran, F. Ann; Konermann, Silvana; Agarwala, Vineeta et al. (2013): DNA targeting specificity of RNA-guided Cas9 nucleases. In Nature biotechnology 31 (9), pp. 827–832. DOI: 10.1038/nbt.2647.

Iyer, Sukanya; Suresh, Sneha; Guo, Dongsheng; Daman, Katelyn; Chen, Jennifer C. J.; Liu, Pengpeng et al. (2019): Precise therapeutic gene correction by a simple nuclease-induced double-stranded break. In Nature 568 (7753), pp. 561–565. DOI: 10.1038/s41586-019-1076-8.

Jensen, Kristopher Torp; Fløe, Lasse; Petersen, Trine Skov; Huang, Jinrong; Xu, Fengping; Bolund, Lars et al. (2017): Chromatin accessibility and guide sequence secondary structure affect CRISPR-Cas9 gene editing efficiency. In FEBS letters 591 (13), pp. 1892–1901. DOI: 10.1002/1873-3468.12707.

Jiang, Fuguo; Doudna, Jennifer A. (2017): CRISPR-Cas9 Structures and Mechanisms. In Annual review of biophysics 46, pp. 505–529. DOI: 10.1146/annurev- biophys-062215-010822.

Jiang, Fuguo; Taylor, David W.; Chen, Janice S.; Kornfeld, Jack E.; Zhou, Kaihong; Thompson, Aubri J. et al. (2016): Structures of a CRISPR-Cas9 R-loop complex primed for DNA cleavage. In Science (New York, N.Y.) 351 (6275), pp. 867–871. DOI: 10.1126/science.aad8282.

Jinek, Martin; Chylinski, Krzysztof; Fonfara, Ines; Hauer, Michael; Doudna, Jennifer A.; Charpentier, Emmanuelle (2012): A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. In Science (New York, N.Y.) 337 (6096), pp. 816–821. DOI: 10.1126/science.1225829.

Jinek, Martin; Jiang, Fuguo; Taylor, David W.; Sternberg, Samuel H.; Kaya, Emine; Ma, Enbo et al. (2014): Structures of Cas9 endonucleases reveal RNA-mediated conformational activation. In Science (New York, N.Y.) 343 (6176), p. 1247997. DOI: 10.1126/science.1247997.

Johnson, M. H.; Pratt, H. P. M.; Handyside, A. H. (1981): The Generation and Recognition of Positional Information in the Preimplantation Mouse Embryo. In Stanley R. Glasser, David W. Bullock (Eds.): Cellular and Molecular Aspects of Implantation, vol. 17. N. Boston: Springer US, pp. 55–74.

Joung, J. Keith; Sander, Jeffry D. (2013): TALENs: a widely applicable technology for targeted genome editing. In Nature reviews. Molecular cell biology 14 (1), pp. 49–55. DOI: 10.1038/nrm3486.

Kampmann, Martin (2017): A CRISPR Approach to Neurodegenerative Diseases. In Trends in molecular medicine 23 (6), pp. 483–485. DOI: 10.1016/j.molmed.2017.04.003.

Karagyaur, M. N.; Rubtsov, Y. P.; Vasiliev, P. A.; Tkachuk, V. A. (2018): Practical Recommendations for Improving Efficiency and Accuracy of the CRISPR/Cas9 Genome Editing System. In Biochemistry. Biokhimiia 83 (6), pp. 629–642. DOI: 10.1134/S0006297918060020.

Kent, Tatiana; Chandramouly, Gurushankar; McDevitt, Shane Michael; Ozdemir, Ahmet Y.; Pomerantz, Richard T. (2015): Mechanism of microhomology-mediated end- joining promoted by human DNA polymerase θ. In Nature structural & molecular biology 22 (3), pp. 230–237. DOI: 10.1038/nsmb.2961.

Kim, Y. G.; Cha, J.; Chandrasegaran, S. (1996): Hybrid restriction enzymes: zinc finger fusions to Fok I cleavage domain. In Proceedings of the National Academy of Sciences of the United States of America 93 (3), pp. 1156–1160. DOI: 10.1073/pnas.93.3.1156.

Knoblich, Juergen A. (2008): Mechanisms of asymmetric stem cell division. In Cell 132 (4), pp. 583–597. DOI: 10.1016/j.cell.2008.02.007.

Koike-Yusa, Hiroko; Li, Yilong; Tan, E-Pien; Velasco-Herrera, Martin Del Castillo; Yusa, Kosuke (2014): Genome-wide recessive genetic screening in mammalian cells with a lentiviral CRISPR-guide RNA library. In Nature biotechnology 32 (3), pp. 267–273. DOI: 10.1038/nbt.2800.

Labun, Kornel; Montague, Tessa G.; Krause, Maximilian; Torres Cleuren, Yamila N.; Tjeldnes, Håkon; Valen, Eivind (2019): CHOPCHOP v3: expanding the CRISPR web toolbox beyond genome editing. In Nucleic acids research. DOI: 10.1093/nar/gkz365.

Langerak, Petra; Mejia-Ramirez, Eva; Limbo, Oliver; Russell, Paul (2011): Release of Ku and MRN from DNA ends by Mre11 nuclease activity and Ctp1 is required for homologous recombination repair of double-strand breaks. In PLoS genetics 7 (9), e1002271. DOI: 10.1371/journal.pgen.1002271.

Li, L.; Wu, L. P.; Chandrasegaran, S. (1992): Functional domains in Fok I restriction endonuclease. In Proceedings of the National Academy of Sciences of the United States of America 89 (10), pp. 4275–4279. DOI: 10.1073/pnas.89.10.4275.

Li, Xiao-Lan; Li, Guo-Hua; Fu, Juan; Fu, Ya-Wen; Zhang, Lu; Chen, Wanqiu et al. (2018): Highly efficient genome editing via CRISPR-Cas9 in human pluripotent stem cells is achieved by transient BCL-XL overexpression. In Nucleic acids research 46 (19), pp. 10195–10215. DOI: 10.1093/nar/gky804.

Li, Yan; Xu, Chunhui; Ma, Teng (2014): In vitro organogenesis from pluripotent stem cells. In Organogenesis 10 (2), pp. 159–163. DOI: 10.4161/org.28918.

Liang, Li; Deng, Li; Nguyen, Son C.; Zhao, Xin; Maulion, Christopher D.; Shao, Changshun; Tischfield, Jay A. (2008): Human DNA ligases I and III, but not ligase IV, are required for microhomology-mediated end joining of DNA double-strand breaks. In Nucleic acids research 36 (10), pp. 3297–3310. DOI: 10.1093/nar/gkn184.

Lieber, Michael R. (2008): The mechanism of human nonhomologous DNA end joining. In The Journal of biological chemistry 283 (1), pp. 1–5. DOI: 10.1074/jbc.R700039200.

Limpitikul, Worawan B.; Dick, Ivy E.; Tester, David J.; Boczek, Nicole J.; Limphong, Pattraranee; Yang, Wanjun et al. (2017): A Precision Medicine Approach to the Rescue of Function on Malignant Calmodulinopathic Long-QT Syndrome. In Circulation research 120 (1), pp. 39–48. DOI: 10.1161/CIRCRESAHA.116.309283.

Lin, F. L.; Sperle, K.; Sternberg, N. (1985): Recombination in mouse L cells between DNA introduced into cells and homologous chromosomal sequences. In Proceedings of the National Academy of Sciences of the United States of America 82 (5), pp. 1391–1395. DOI: 10.1073/pnas.82.5.1391.

Lino, Christopher A.; Harper, Jason C.; Carney, James P.; Timlin, Jerilyn A. (2018): Delivering CRISPR: a review of the challenges and approaches. In Drug delivery 25 (1), pp. 1234–1257. DOI: 10.1080/10717544.2018.1474964.

Liu, Jing; Liu, Wensu; Yang, Lu; Wu, Qian; Zhang, Haofeng; Fang, Ai et al. (2017): The Primate-Specific Gene TMEM14B Marks Outer Radial Glia Cells and Promotes Cortical Expansion and Folding. In Cell stem cell 21 (5), 635-649.e8. DOI: 10.1016/j.stem.2017.08.013.

Llufrio, Elizabeth M.; Wang, Lingjue; Naser, Fuad J.; Patti, Gary J. (2018): Sorting cells alters their redox state and cellular metabolome. In Redox biology 16, pp. 381–387. DOI: 10.1016/j.redox.2018.03.004.

Makarova, Kira S.; Wolf, Yuri I.; Alkhnbashi, Omer S.; Costa, Fabrizio; Shah, Shiraz A.; Saunders, Sita J. et al. (2015): An updated evolutionary classification of CRISPR-Cas systems. In Nature reviews. Microbiology 13 (11), pp. 722–736. DOI: 10.1038/nrmicro3569.

Martin, G. R. (1981): Isolation of a pluripotent cell line from early mouse embryos cultured in medium conditioned by teratocarcinoma stem cells. In Proceedings of the National Academy of Sciences of the United States of America 78 (12), pp. 7634–7638. DOI: 10.1073/pnas.78.12.7634.

Mateos-Gomez, Pedro A.; Gong, Fade; Nair, Nidhi; Miller, Kyle M.; Lazzerini- Denchi, Eros; Sfeir, Agnel (2015): Mammalian polymerase θ promotes alternative NHEJ and suppresses recombination. In Nature 518 (7538), pp. 254–257. DOI: 10.1038/nature14157.

McVey, Mitch; Lee, Sang Eun (2008): MMEJ repair of double-strand breaks (director's cut): deleted sequences and alternative endings. In Trends in genetics: TIG 24 (11), pp. 529–538. DOI: 10.1016/j.tig.2008.08.007.

Mojica, Francisco J. M.; Rodriguez-Valera, Francisco (2016): The discovery of CRISPR in archaea and bacteria. In The FEBS journal 283 (17), pp. 3162–3169. DOI: 10.1111/febs.13766.

Moscou, Matthew J.; Bogdanove, Adam J. (2009): A simple cipher governs DNA recognition by TAL effectors. In Science (New York, N.Y.) 326 (5959), p. 1501. DOI: 10.1126/science.1178817.

Nakade, Shota; Tsubota, Takuya; Sakane, Yuto; Kume, Satoshi; Sakamoto, Naoaki; Obara, Masanobu et al. (2014): Microhomology-mediated end-joining-dependent integration of donor DNA in cells and animals using TALENs and CRISPR/Cas9. In Nature communications 5, p. 5560. DOI: 10.1038/ncomms6560.

Niwa, Hitoshi (2001): Molecular Mechanism to Maintain Stem Cell Renewal of ES Cells. In Cell Structure and Function 26 (3), pp. 137–148. DOI: 10.1247/csf.26.137.

Papapetrou, Eirini P.; Schambach, Axel (2016): Gene Insertion Into Genomic Safe Harbors for Human Gene Therapy. In Molecular therapy: the journal of the American Society of Gene Therapy 24 (4), pp. 678–684. DOI: 10.1038/mt.2016.38.

Park, Chul-Yong; Halevy, Tomer; Lee, Dongjin R.; Sung, Jin Jea; Lee, Jae Souk; Yanuka, Ofra et al. (2015): Reversion of FMR1 Methylation and Silencing by Editing the Triplet Repeats in Fragile X iPSC-Derived Neurons. In Cell reports 13 (2), pp. 234–241. DOI: 10.1016/j.celrep.2015.08.084.

Patmanathan, Sathya Narayanan; Gnanasegaran, Nareshwaran; Lim, Moon Nian; Husaini, Roslina; Fakiruddin, Kamal Shaik; Zakaria, Zubaidah (2018): CRISPR/Cas9 in Stem Cell Research: Current Application and Future Perspective. In Current stem cell research & therapy 13 (8), pp. 632–644. DOI: 10.2174/1574888X13666180613081443.

Ran, F. Ann; Hsu, Patrick D.; Wright, Jason; Agarwala, Vineeta; Scott, David A.; Zhang, Feng (2013): Genome engineering using the CRISPR-Cas9 system. In Nature protocols 8 (11), pp. 2281–2308. DOI: 10.1038/nprot.2013.143.

Rawat, N.; Singh, M. K. (2017): Induced pluripotent stem cell: A headway in reprogramming with promising approach in regenerative biology. In Veterinary world 10 (6), pp. 640–649. DOI: 10.14202/vetworld.2017.640-649.

Robert, Isabelle; Dantzer, Françoise; Reina-San-Martin, Bernardo (2009): Parp1 facilitates alternative NHEJ, whereas Parp2 suppresses IgH/c-myc translocations during immunoglobulin class switch recombination. In The Journal of experimental medicine 206 (5), pp. 1047–1056. DOI: 10.1084/jem.20082468.

Rohs, Remo; Jin, Xiangshu; West, Sean M.; Joshi, Rohit; Honig, Barry; Mann, Richard S. (2010): Origins of specificity in protein-DNA recognition. In Annual review of biochemistry 79, pp. 233–269. DOI: 10.1146/annurev-biochem-060408-091030.

Rungarunlert, Sasitorn; Techakumphu, Mongkol; Pirity, Melinda K.; Dinnyes, Andras (2009): Embryoid body formation from embryonic and induced pluripotent stem cells: Benefits of bioreactors. In World journal of stem cells 1 (1), pp. 11–21. DOI: 10.4252/wjsc.v1.i1.11.

Sakuma, Tetsushi; Nakade, Shota; Sakane, Yuto; Suzuki, Ken-ichi T.; Yamamoto, Takashi (2016): MMEJ-assisted gene knock-in using TALENs and CRISPR-Cas9 with the PITCh systems. In Nature protocols 11 (1), pp. 118–133. DOI: 10.1038/nprot.2015.140.

Sallmyr, Annahita; Tomkinson, Alan E. (2018): Repair of DNA double-strand breaks by mammalian alternative end-joining pathways. In The Journal of biological chemistry 293 (27), pp. 10536–10546. DOI: 10.1074/jbc.TM117.000375.

Sancar, Aziz; Lindsey-Boltz, Laura A.; Unsal-Kaçmaz, Keziban; Linn, Stuart (2004): Molecular mechanisms of mammalian DNA repair and the DNA damage 91 checkpoints. In Annual review of biochemistry 73, pp. 39–85. DOI: 10.1146/annurev.biochem.73.011303.073723.

Seol, Ja-Hwan; Shim, Eun Yong; Lee, Sang Eun (2018): Microhomology-mediated end joining: Good, bad and ugly. In Mutation research 809, pp. 81–87. DOI: 10.1016/j.mrfmmm.2017.07.002.

Serrao, Erik; Cherepanov, Peter; Engelman, Alan N. (2016): Amplification, Next- generation Sequencing, and Genomic DNA Mapping of Retroviral Integration Sites. In Journal of visualized experiments: JoVE (109). DOI: 10.3791/53840.

Sfeir, Agnel; Symington, Lorraine S. (2015): Microhomology-Mediated End Joining: A Back-up Survival Mechanism or Dedicated Pathway? In Trends in biochemical sciences 40 (11), pp. 701–714. DOI: 10.1016/j.tibs.2015.08.006.

Shi, Guilai; Jin, Ying (2010): Role of Oct4 in maintaining and regaining stem cell pluripotency. In Stem cell research & therapy 1 (5), p. 39. DOI: 10.1186/scrt39.

Skubis, Aleksanra; Gola, Joanna; Sikora, Bartosz; Hybiak, Jolanta; Paul- Samojedny, Monika; Mazurek, Urszula; Łos, Marek J. (2017): Impact of Antibiotics on the Proliferation and Differentiation of Human Adipose-Derived Mesenchymal Stem Cells. In International journal of molecular sciences 18 (12). DOI: 10.3390/ijms18122522.

Stahl, Ronny; Walcher, Tessa; Juan Romero, Camino de; Pilz, Gregor Alexander; Cappello, Silvia; Irmler, Martin et al. (2013): Trnp1 regulates expansion and folding of the mammalian cerebral cortex by control of radial glial fate. In Cell 153 (3), pp. 535–549. DOI: 10.1016/j.cell.2013.03.027.

Stephenson, Robert O.; Rossant, Janet; Tam, Patrick P. L. (2012): Intercellular interactions, position, and polarity in establishing blastocyst cell lineages and embryonic axes. In Cold Spring Harbor perspectives in biology 4 (11). DOI: 10.1101/cshperspect.a008235.

Steyer, Benjamin; Bu, Qian; Cory, Evan; Jiang, Keer; Duong, Stella; Sinha, Divya et al. (2018): Scarless Genome Editing of Human Pluripotent Stem Cells via Transient Puromycin Selection. In Stem cell reports 10 (2), pp. 642–654. DOI: 10.1016/j.stemcr.2017.12.004.

Supharattanasitthi, Wasu; Carlsson, Emil; Sharif, Umar; Paraoan, Luminita (2019): CRISPR/Cas9-mediated one step bi-allelic change of genomic DNA in iPSCs and human RPE cells in vitro with dual antibiotic selection. In Scientific reports 9 (1), p. 174. DOI: 10.1038/s41598-018-36740-2.

Symington, Lorraine S.; Gautier, Jean (2011): Double-strand break end resection and repair pathway choice. In Annual review of genetics 45, pp. 247–271. DOI: 10.1146/annurev-genet-110410-132435.

Takahashi, Kazutoshi; Tanabe, Koji; Ohnuki, Mari; Narita, Megumi; Ichisaka, Tomoko; Tomoda, Kiichiro; Yamanaka, Shinya (2007): Induction of pluripotent stem cells from adult human fibroblasts by defined factors. In Cell 131 (5), pp. 861–872. DOI: 10.1016/j.cell.2007.11.019.

Takahashi, Kazutoshi; Yamanaka, Shinya (2006): Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. In Cell 126 (4), pp. 663–676. DOI: 10.1016/j.cell.2006.07.024.

Taleei, Reza; Nikjoo, Hooshang (2013): Biochemical DSB-repair model for mammalian cells in G1 and early S phases of the cell cycle. In Mutation research 756 (1- 2), pp. 206–212. DOI: 10.1016/j.mrgentox.2013.06.004.

Thomas, K., R.; Folger, K. R.; Capecchi, M. R. (1986): High frequency targeting of genes to specific sites in the mammalian genome. In Cell 44 (3), pp. 419–428. DOI: 10.1016/0092-8674(86)90463-0.

Toledo, Chad M.; Ding, Yu; Hoellerbauer, Pia; Davis, Ryan J.; Basom, Ryan; Girard, Emily J. et al. (2015): Genome-wide CRISPR-Cas9 Screens Reveal Loss of Redundancy between PKMYT1 and WEE1 in Glioblastoma Stem-like Cells. In Cell reports 13 (11), pp. 2425–2439. DOI: 10.1016/j.celrep.2015.11.021.

van Schendel, Robin; van Heteren, Jane; Welten, Richard; Tijsterman, Marcel (2016): Genomic Scars Generated by Polymerase Theta Reveal the Versatile Mechanism of Alternative End-Joining. In PLoS Genet 12 (10), e1006368. DOI: 10.1371/journal.pgen.1006368.

Vara, J. A.; Portela, A.; Ortín, J.; Jiménez, A. (1986): Expression in mammalian cells of a gene from Streptomyces alboniger conferring puromycin resistance. In Nucleic acids research 14 (11), pp. 4617–4624. DOI: 10.1093/nar/14.11.4617.

Varghese, Divya S.; Parween, Shama; Ardah, Mustafa T.; Emerald, Bright Starling; Ansari, Suraiya A. (2017): Effects of Aminoglycoside Antibiotics on Human Embryonic Stem Cell Viability during Differentiation In Vitro. In Stem cells international 2017, p. 2451927. DOI: 10.1155/2017/2451927.

Wang, Hailong; Xu, Xingzhi (2017): Microhomology-mediated end joining: new players join the team. In Cell & bioscience 7, p. 6. DOI: 10.1186/s13578-017-0136-8.

Wang, Lixia; Yi, Fei; Fu, Lina; Yang, Jiping; Wang, Si; Wang, Zhaoxia et al. (2017): CRISPR/Cas9-mediated targeted gene correction in amyotrophic lateral sclerosis patient iPSCs. In Protein & cell 8 (5), pp. 365–378. DOI: 10.1007/s13238-017-0397-3.

Wang, Yan; Prosen, Dennis E.; Mei, Li; Sullivan, John C.; Finney, Michael; Vander Horn, Peter B. (2004): A novel strategy to engineer DNA polymerases for enhanced processivity and improved performance in vitro. In Nucleic acids research 32 (3), pp. 1197–1207. DOI: 10.1093/nar/gkh271.

Webber, Beau R.; Osborn, Mark J.; McElroy, Amber N.; Twaroski, Kirk; Lonetree, Cara-lin; DeFeo, Anthony P. et al. (2016): CRISPR/Cas9-based genetic correction for recessive dystrophic epidermolysis bullosa. In npj Regenerative Medicine 1 (1), p. 16014. DOI: 10.1038/npjregenmed.2016.14.

Weltner, Jere; Balboa, Diego; Katayama, Shintaro; Bespalov, Maxim; Krjutškov, Kaarel; Jouhilahti, Eeva-Mari et al. (2018): Human pluripotent reprogramming with CRISPR activators. In Nature communications 9 (1), p. 2643. DOI: 10.1038/s41467-018- 05067-x.

Wiedenheft, Blake; van Duijn, Esther; Bultema, Jelle B.; Bultema, Jelle; Waghmare, Sakharam P.; Waghmare, Sakharam et al. (2011): RNA-guided complex from a bacterial immune system enhances target recognition through seed sequence interactions. In Proceedings of the National Academy of Sciences of the United States of America 108 (25), pp. 10092–10097. DOI: 10.1073/pnas.1102716108.

Xie, Fei; Ye, Lin; Chang, Judy C.; Beyer, Ashley I.; Wang, Jiaming; Muench, Marcus O.; Kan, Yuet Wai (2014): Seamless gene correction of β-thalassemia mutations in patient-specific iPSCs using CRISPR/Cas9 and piggyBac. In Genome research 24 (9), pp. 1526–1533. DOI: 10.1101/gr.173427.114.

Xu, Han; Xiao, Tengfei; Chen, Chen-Hao; Li, Wei; Meyer, Clifford A.; Wu, Qiu et al. (2015): Sequence determinants of improved CRISPR sgRNA design. In Genome research 25 (8), pp. 1147–1157. DOI: 10.1101/gr.191452.115.

Yang, Luhan; Guell, Marc; Byrne, Susan; Yang, Joyce L.; Los Angeles, Alejandro de; Mali, Prashant et al. (2013): Optimization of scarless human stem cell genome editing. In Nucleic acids research 41 (19), pp. 9049–9061. DOI: 10.1093/nar/gkt555.

Yang, Wei (2008): An equivalent metal ion in one- and two-metal-ion catalysis. In Nature structural & molecular biology 15 (11), pp. 1228–1231. DOI: 10.1038/nsmb.1502.

Zhang, Donghui; Jiang, Wei (2015): From One-Cell to Tissue: Reprogramming, Cell Differentiation and Tissue Engineering. In BioScience 65 (5), pp. 468–475. DOI: 10.1093/biosci/biv016.

Zhang, Yu; Shim, Eun Yong; Davis, Melody; Lee, Sang Eun (2009): Regulation of repair choice: Cdk1 suppresses recruitment of end joining factors at DNA breaks. In DNA repair 8 (10), pp. 1235–1241. DOI: 10.1016/j.dnarep.2009.07.007.

9. Supplementary figures and tables

Supplementary Figure 1: #003 pMax-turboGFP vector map

Supplementary Figure 2: #006 px458 (pSpCas9(BB)-2A-GFP) vector map 95

Supplementary Figure 3: #016 NaSa_p19_mutTurboRFP-2A-eGFP vector map

Supplementary Figure 4: #018 pX330A-FBL/PITCh vector map 96

Supplementary Figure 5: #019 pCRIS-PITChv2-FBL vector map

Supplementary Figure 6: #020 pSicoR-EF1a-mCherry-PuroR vector map 97

Supplementary Figure 7: #024 px458_+PITCh gRNA vector map

Supplementary Figure 8: #029 pCRIS-PITCHv2-FBL-T2A-EGFP-T2A-PuroR vector map 98

Supplementary Figure 9: #030 pCRIS-PITCHv2-FBL-T2A-mCherry-T2A-PuroR vector map

Supplementary Figure 10: #031 pCRIS-PITCHv2-FBL-T2A-EBFP-T2A-PuroR vector map 99

Supplementary Figure 11: #032 pCRIS-PITCHv2-FBL-EF1a-EGFP-T2A-PuroR vector map

Supplementary Figure 12: #033 pCRIS-PITCHv2-FBL-EF1a-mCherry-T2A-PuroR vector map 100

Supplementary Figure 13: #034 pCRIS-PITCHv2-FBL-EF1a-EBFP-T2A-PuroR vector map

Supplementary Figure 14: #035 px458-TRNP1 gRNA+PITCh gRNA_KO vector map 101

Supplementary Figure 15: #036 pCRIS-PITCHv2-TRNP1-EF1a-EGFP-T2A-PuroR vector map

Supplementary Figure 16: #037 pCRIS-PITCHv2-TRNP1-EF1a-mCherry-T2A-PuroR vector map 102

Supplementary Figure 17: #038 pCRIS-PITCHv2-TRNP1-EF1a-EBFP-T2A-PuroR vector map

Supplementary Figure 18: #040 pCRIS-PITCHv2-FBL-EF1a-EGFP-SV40p(A) vector map 103

Supplementary Figure 19: #041 pCRIS-PITCHv2-FBL-EF1a-mCherry-SV40p(A) vector map

Supplementary Figure 20: #042 pCRIS-PITCHv2-FBL-EF1a-EBFP-SV40p(A) vector map 104

Supplementary Figure 21: #043 pCRIS-PITCHv2-TRNP1-EF1a-EGFP-SV40p(A) vector map

Supplementary Figure 22: #044 pCRIS-PITCHv2-TRNP1- EF1a-mCherry-SV40p(A) vector map 105

Supplementary Figure 23: #046 px458-TMEM14B gRNA+PITCh gRNA_KO vector map

Supplementary Figure 24: #047 pCRIS-PITCHv2-TMEM14B-EF1a-EGFP-SV40p(A) vector map 106

Supplementary Figure 25: #048 pCRIS-PITCHv2-TMEM14B-EF1a-mCherry-SV40p(A) vector map

107

TRNP1 gRNA design - CHOPCHOP v3 webtool screenshot:

(Continued on next page) 108

Supplementary Figure 26: CHOPCHOP gRNA browsing and comparison of predicted gRNA target sites captured by screenshot (see previous page) and respective ranking of TRNP1 gRNA sequence based on off-target frequency predictions. Note that the upper-most panel depicts an overview of the entire genomic locus, while the middle panel provides a closer view of the site of interest with gRNA binding sites (refer to the genomic scale bars). MM = Mismatch

109

Supplementary Figure 27: Screenshot of CCTop gRNA target site prediction tool, including information on TRNP1 gRNA and potential off-target locations

110

TMEM14B gRNA design - CHOPCHOP v3 webtool screenshot:

(Continued on next page) 111

Supplementary Figure 28: CHOPCHOP gRNA browsing and comparison of predicted gRNA target sites captured by screenshot (see previous page) and respective ranking of TMEM14B gRNA sequence based on off-target frequency predictions. Note that the upper-most panel depicts an overview of the entire genomic locus, while the middle panel provides a closer view of the site of interest with gRNA binding sites (refer to the genomic scale bars). MM = Mismatch

112

Supplementary Figure 29: Screenshot of CCTop gRNA target site prediction tool, including information on TMEM14B gRNA and potential off-target locations

113

Supplementary Table 1: List of primers for use in on- and off-target PCR screens for identification of functional knock-outs of TRNP1 and TMEM14B

No. Primer name Sequence (5’-3’) Target centered in genomic region Type Amplicon size(s) Experiment 078 078-TRNP1-KO OnTseq1 Fw CTGGTGTCGGAGCTGGAGAGC 378 bp (WT) and/or 079 079-TRNP1-KO OnTseq2 Rv GCACCTCGGCGAAGCTTGTC 2,403 bp (KO-allele) TRNP1 chr1:26994278-26994300 exon 130 130 TRNP1 seq3 Fw CAGCTGCACCGCGTTTTC 564 bp (WT) and/or

131 131 TRNP1 seq4 Rv TGGCAGCTTTACTAGGGACC 2,598 bp (KO-allele) TRNP1 083 083-RUFY1-OffTseq1 GCATGGAGGTGGGTTACAGC RUFY1 chr5:179586647-179586669 intronic 251 bp 084 084-RUFY1-OffTseq2 AAGGCCTGCCTACCAAGGTG

085 085-ARAFP2-OffTseq1 GGGAGTAAGGTCAGGCTCAAG knock functional ARAFP2 chr7:63404906-63404928 exon 254 bp 086 086-ARAFP2-OffTseq2 TCTTCATCCCTGGACCTCAGAA 087 087-ARAFP3-OffTseq1 GTGGGCTGTGACTCTTCATCC ARAFP3 chr7:63343183-63343205 exon 261 bp 088 088-ARAFP3-OffTseq2 TAAGGTCAGGCTCAAGACAGC 089 089-AMPD3-OffTseq1 CCTGATTCGGAAACCCCTTC AMPD3 chr11:10501569-10501591 exon 269 bp 090 090-AMPD3-OffTseq2 ATAAGGACAGACATCCCAGCC

091 091-ALG10-OffTseq1 CAAGCCTGCACCTCAGAGG - ALG10 chr12:34016442-34016464 intergenic 343 bp out 092 092-ALG10-OffTseq2 AAGGTCTTCAGGCCTCCATCC 093 093-ANKRD40-OffTseq1 CTCCCGGCCATGGGGA ANKRD40 chr17:50707870-50707892 exon 250 bp 094 094-ANKRD40-OffTseq2 AGTTACATAAACAGCCAGCCC 095 095-OPA3-OffTseq1 GGGTAACCCAGGGGTCTTTT OPA3 chr19:45554090-45554112 intronic 261 bp 096 096-OPA3-OffTseq2 CTTTCTCCTGGGAAGTGGGTG 097 097-CDC7-OffTseq1 GCTGGGCCCTTAGCCTTATG CDC7 chr1:91500779-91500801 intergenic 279 bp 098 098-CDC7-OffTseq2 AGTACGACTTCTGTGGCTCC 099 099-MGAT4B-OffTseq1 AAGGGAGTCCCAGGACCG MGAT4B chr5:179806256-179806278 exon 299 bp 100 100-MGAT4B-OffTseq2 CCACTTGTTTGCTGCTGGAG 101 101-SSBP2-OffTseq1 GCTCAGCTCCTCACTGGAGA SSBP2 chr5:81751567-81751589 intronic 250 bp 102 102-SSBP2-OffTseq2 CACCCCAGGGAGTAGGGC 103 103-EPHB6-OffTseq1 ATTACATCGACCCCTCCACC EPHB6 chr7:142868396-142868418 intronic 251 bp 104 104-EPHB6-OffTseq2 CTTCTCCAAAAGAGCCTGGGA

105 105-ELFN1-OffTseq1 TAAAATGCCATCCGTGGGGG TMEM14B ELFN1 chr7:1747620-1747642 exon 265 bp 106 106-ELFN1-OffTseq2 GTGCCTCCCAGCCCTTG 107 107-STARD3NL-OffTseq1 GTGGAGCTCCTCAGACTAGAGA STARD3NL chr7:38215884-38215906 exon 264 bp 108 108-STARD3NL-OffTseq2 TCTGGCCAAGACTGTCAGC

109 109-ZBTB43-OffTseq1 TATGCCAAGGTTTCAAGAAGGT ZBTB43 chr9:126804866-126804888 intergenic 250 bp knock functional 110 110-ZBTB43-OffTseq2 GTGCCTTCAGCCCCCG 111 111-DPF2-OffTseq1 CGAGACTCACCGTCCCG DPF2 chr11:65334355-65334377 intronic 269 bp 112 112-DPF2-OffTseq2 CTGGATCCGCTCCTCGATAAA 113 113-UNC45A-OffTseq1 GTTGCCAGGGATTCTAGCGA UNC45A chr15:90945225-90945247 intronic 259 bp 114 114-UNC45A-OffTseq2 TCTGTGTGGGAACAGAAGCG 115 115-RP11-419C5.3-OffTseq1 AGAGGACAGCTCTACACCAGA RP11-419C5.3 chr16:69972418-69972440 intergenic 251 bp

116 116-RP11-419C5.3-OffTseq2 GCTCATTAGCTGCCCTACCT out 117 117-RP11-296I10.5-OffTseq1 CAGAGAGGACAGCTCTACACC RP11-296I10.5 chr16:70195312-70195334 intergenic 250 bp 118 118-RP11-296I10.5-OffTseq2 ATTAGCTGCCCTACCTGTGC 119 119-RP11-252A24.8-OffTseq1 GGCCGACCTGTTTCATTCTG RP11-252A24.8 chr16:74400186-74400208 intergenic 262 bp 120 120-RP11-252A24.8-OffTseq2 GTGCTCAGTAGGGGTCTGGA 121 121-CTD-3137H5.5-OffTseq1 AGGGACGCAACTCAATGGG CTD-3137H5.5 chr19:18448594-18448616 exon 256 bp 122 122-CTD-3137H5.5-OffTseq2 TGGTACCAGGTTGAGCTGAC 123 123-CENPVP3-OffTseq1 CCCCGGTGTGATGCACGA CENPVP3 chrX:51618593-51618615 exon 254 bp 124 124-CENPVP3-OffTseq2 CAAGAGGTGGCTGGGAAAGTT 125 125-TMEM14B-KO OnTseq1 Fw GCTCACCTCTCTCCAAGGAC 251 bp (WT) and/or TMEM14B chr6:10747849-10747871 exon 126 126-TMEM14B-KO OnTseq2 Rv GACGGCCGTGAAACTCCTAA 2,304 bp (KO allele)

114

List of abbreviations AIO All-in-one AP Alkaline phosphatase

BLAST(N) Basic local alignment search tool (nucleotide database) bRG/oRG Basal/outer radial glia cfu Colony forming unit CRISPR/Cas9 Clustered regulatory interspaced short palindromic repeats/CRISPR-associated 9 DMEM Dulbecco’s Modified Eagle’s Medium DMSO Dimethyl sulphoxide dNTP Deoxyribonucleotide-triphosphate DSB/SSB Double-strand/single-strand break EDTA Ethylendiamine tetraacetic acid FACS Fluorescence-assisted cell-sorting FBS Fetal bovine serum GS Gene-specific HEK293T Human embryonic kidney 293 cell line (containing the SV40 T-antigen) HDR Homology-directed repair IPs Intermediate progenitors iPSCs (iPS cells) Induced pluripotent stem cells

IVA In vivo assembly KO/KI Knock-out/Knock-in LB Lysogeny broth MEF Mouse embryonic fibroblasts MMEJ Microhomology-mediated end-joining NHDF Normal human dermal (foreskin) fibroblast NHEJ Non-homologous end-joining NPCs Neural progenitor cells NSCs Neural stem cells

(O)SVZ (Outer) subventricular zone PARP1 Poly-ADP ribose polymerase 1 PBS Phosphate buffered saline PCR Polymerase chain reaction PNK Poly-nucleotide kinase (s)gRNA (Single) guide RNA (ribonucleic acid) ssODN Single-stranded oligo deoxy-oligonucleotide ss/dsDNA Single-stranded/double-stranded deoxy-ribonucleic acid

TALEN Transcription activator-like effector nuclease TMEM14B Transmembrane protein 14B TRNP1 TMF-regulated nuclear protein 1

115