bioRxiv preprint doi: https://doi.org/10.1101/440677; this version posted March 7, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
1
2 A simple microbiome in the European common cuttlefish, Sepia officinalis
3
4 Holly L. Lutza,b,c,†,*, S. Tabita Ramírez-Pueblad,†, Lisa Abbod, Amber Durandd, Cathleen
5 Schlundtd, Neil Gottela,b, Alexandra K. Sjaardae, Roger T. Hanlond, Jack A. Gilberta,b,c , Jessica
6 L. Mark Welchd,*
7
8 aDepartment of Pediatrics, University of California San Diego, La Jolla, California, USA.
9 bScripps Institution for Oceanography, UCSD, La Jolla, California, USA
10 cIntegrative Research Center, Field Museum of Natural History, Chicago, Illinois, USA
11 dMarine Biological Laboratory, Woods Hole, MA 02543
12 eBiological Sciences Division, University of Chicago, Chicago, IL 60637
13
14
15
16 † co-first authors, contributed equally to this work
17 *to whom correspondence should be addressed. Email address: [email protected] or
19
20
21
22 ABSTRACT
23
1 bioRxiv preprint doi: https://doi.org/10.1101/440677; this version posted March 7, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
24 The European common cuttlefish, Sepia officinalis, is used extensively in biological and
25 biomedical research yet its microbiome remains poorly characterized. We analyzed the
26 microbiota of the digestive tract, gills, and skin in mariculture-raised S. officinalis using a
27 combination of 16S rRNA amplicon sequencing, qPCR and fluorescence spectral
28 imaging. Sequencing revealed a highly simplified microbiota consisting largely of two
29 single bacterial amplicon sequence variants (ASVs) of Vibrionaceae and Piscirickettsiaceae. The
30 esophagus was dominated by a single ASV of the genus Vibrio. Imaging revealed bacteria in the
31 family Vibrionaceae distributed in a discrete layer that lines the esophagus. This Vibrio was also
32 the primary ASV found in the microbiota of the stomach, cecum, and intestine, but occurred at
33 lower abundance as determined by qPCR and was found only scattered in the lumen rather than
34 in a discrete layer via imaging analysis. Treatment of animals with the commonly-used antibiotic
35 enrofloxacin led to a nearly 80% reduction of the dominant Vibrio ASV in the esophagus but did
36 not significantly alter the relative abundance of bacteria overall between treated versus control
37 animals. Data from the gills was dominated by a single ASV in the family Piscirickettsiaceae,
38 which imaging visualized as small clusters of cells. We conclude that bacteria belonging to the
39 Gammaproteobacteria are the major symbionts of the cuttlefish Sepia officinalis cultured from
40 eggs in captivity, and that the esophagus and gills are major colonization sites.
41
42
43 IMPORTANCE
44
45 Microbes can play critical roles in the physiology of their animal hosts, as evidenced in
46 cephalopods by the role of Vibrio (Aliivibrio) fischeri in the light organ of the bobtail squid and
2 bioRxiv preprint doi: https://doi.org/10.1101/440677; this version posted March 7, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
47 the role of Alpha- and Gammaproteobacteria in the reproductive system and egg defense in a
48 variety of cephalopods. We sampled the cuttlefish microbiome throughout the digestive tract,
49 gills, and skin and found dense colonization of an unexpected site, the esophagus, by a microbe
50 of the genus Vibrio, as well as colonization of gills by Piscirickettsiaceae. This finding expands
51 the range of organisms and body sites known to be associated with Vibrio and is of potential
52 significance for understanding host-symbiont associations as well as for understanding and
53 maintaining the health of cephalopods in mariculture.
54
55 KEYWORDS:
56 microbiome, fluorescence in situ hybridization, Cephalopoda, Vibrionaceae, Piscirickettsiaceae,
57 enrofloxacin
58
59 1. INTRODUCTION
60
61 Symbiotic associations between invertebrates and bacteria are common. Among cephalopods, the
62 most intensely studied association is the colonization of the light organ of the bobtail squid
63 Euprymna scolopes by the bioluminescent bacterium Vibrio (Aliivibrio) fischeri in a highly
64 specific symbiosis (1). A more diverse but still characteristic set of bacteria colonize the
65 accessory nidamental gland from which they are secreted into the egg jelly coat and likely
66 protect the eggs from fungal and bacterial attack (2). The accessory nidamental gland and egg
67 cases of the squid Doryteuthis (Loligo) pealeii and the Chilean octopus (Octopus mimus) have
68 also been reported to contain Alphaproteobacteria and Gammaproteobacteria (3, 4). These
69 associations indicate that bacteria can play a key role in the physiology of cephalopods.
3 bioRxiv preprint doi: https://doi.org/10.1101/440677; this version posted March 7, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
70 Sepia officinalis, the European common cuttlefish (hereafter cuttlefish), is used
71 extensively in biological and biomedical research (5-7) and is a model organism for the study of
72 rapid adaptive camouflage (8-11). Cuttlefish are also widely represented among zoos and
73 aquaria, and play an important role in educating the public about cephalopod biology and life
74 history (12). Little is known about the association of bacterial symbionts with cuttlefish, and
75 whether such associations may play a role in the health or behavior of these animals.
76 Understanding the importance, or lack thereof, of the cuttlefish microbiome will not only shed
77 light on the basic biology of this model organism but will also have important implications for
78 future husbandry practices and research design.
79 Using a combination of 16S rRNA amplicon sequencing, fluorescence in situ
80 hybridization (FISH), and quantitative PCR (qPCR), we characterized the gastrointestinal tract
81 (GI), gill, skin, and fecal microbiota of the common cuttlefish in wild-bred, captive-raised
82 animals (5) housed at the Marine Biological Laboratory (Woods Hole, MA). We observed a
83 highly simplified microbiome dominated by Vibrionaceae in the gastrointestinal tract and
84 Piscirickettsiaceae in the gills. We treated a subset of cuttlefish with antibiotic enrofloxacin,
85 commonly used among aquaria veterinarians, and found both ASVs to remain dominant in
86 esophagus and gill microbiota, suggesting they are resilient to this antibiotic. The simplicity of
87 this system makes it a promising model for further exploration of the factors driving host-
88 symbiont associations in marine invertebrates.
89
90 2. RESULTS
91
92 2. 1 Two taxa dominate the S. officinalis microbiome.
4 bioRxiv preprint doi: https://doi.org/10.1101/440677; this version posted March 7, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
93
94 We sampled 27 healthy adult cuttlefish (Sepia officinalis) from the mariculture laboratory
95 at Marine Biological Laboratory (Woods Hole, MA). The study comprised two time periods. The
96 first (20-21 June 2017) was a pilot survey in which three individuals were sampled. The second
97 (25 September -10 October 2017) was an experiment involving 24 individuals, of which 16 were
98 exposed to repeated doses of the antibiotic enrofloxacin and 8 individuals served as untreated
99 controls. 16S rRNA amplicon sequencing of the GI tract, gills, and skin of all 27 animals
100 revealed a highly simplified microbiota dominated by bacterial amplicon sequence variants
101 (ASVs) in the Vibrionaceae and Piscirickettsiaceae families, regardless of treatment with
102 enrofloxacin.
103 In particular, results showed a consistent and highly simplified microbiota in the
104 esophagus (Figure 1; Table 1). A single ASV in the genus Vibrio (referred to as ASV1 in
105 subsequent figures and tables) made up the majority of the 16S rRNA sequence data from the
106 esophagus of the three pilot investigation individuals (mean 92% ± 10%) and of 24 individuals
107 sampled four months later (control group mean 100% ± 1%; treatment group mean 94% ± 10%).
108 Thus, this ASV represents a dominant constituent of the esophagus microbiota stably over two
109 time periods in the study and after exposure to antibiotic treatment with enrofloxacin. Another
110 ASV of the related genus Photobacterium (Vibrionaceae) (referred to as ASV2 in Table 1) was
111 present in the esophagus community in the pilot investigation animals (mean 7% ± 10%).
112 Combined, the two Vibrionaceae ASVs (ASV1 and ASV2) in the three pilot animals constituted
113 >99% of the esophagus community.
114 The major Vibrio ASV1 was also a major constituent of downstream sites in the GI tract,
115 although present at lower abundance measured both as relative abundance in 16S sequencing
5 bioRxiv preprint doi: https://doi.org/10.1101/440677; this version posted March 7, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
116 data and by quantitative PCR (qPCR) (Figure 1; Table 1). qPCR revealed a high abundance of
117 Vibrio cell copies in the esophagus (average 520.4 ± 410 copies/ng of total DNA including host
118 DNA) relative to more distal portions of the GI tract that included stomach, cecum, and intestine
119 (combined average 25.6 ± 77.8 copies/ng) (p < 0.005, χ2 = 16.5, df =3 Kruskal-Wallis) (Fig. 1B).
120 Comparison of qPCR measures of ASVs in the genus Vibrio between the esophagus of treatment
121 and control animals revealed a striking and significant decrease of nearly 80% in the quantity (p
122 < 0.02, df = 10.8, Welch two sample t-test). We did not observe a significant difference in Vibrio
123 ASV1 quantity between other organs of the digestive tract with antibiotic treatment (Fig. 1B).
124 Relative abundance of Vibrio ASV1 in the esophagus and stomach also did not differ
125 significantly between antibiotic and control groups (Welch two sample t-test, p > 0.10), but did
126 differ significantly among the cecum (Welch two sample t-test, p = 0.00235) and intestine
127 (Welch two sample t-test, p = 1.99e-05) of treatment versus control groups. Analysis of GI tracts
128 (esophagus, stomach, cecum, and intestine samples combined) between treated versus control
129 animals from the second period of study revealed significant differences in weighted UniFrac β-
130 diversity between the two groups (PERMANOVA Pr(>F) = 0.006, F = 5.63, df = 1), despite the
131 Vibrio ASV1 remaining dominant in most organs. These differences in measured relative
132 abundance and β-diversity may result from stochastic variation in low-abundance sequences, as
133 the non-Vibrio portion of the 16S rRNA sequence data from the GI tract consisted of an
134 assortment of taxa that varied between individuals or between the two time points of the study
135 and thus suggested transient organisms rather than stable microbial colonization.
136 Samples from gills were dominated by a single highly abundant ASV in the family
137 Piscirickettsiaceae (referred to as ASV3 in subsequent figures and tables), which made up an
138 average relative abundance of 96.9% ± 2.5% in the gills. In samples from other body sites this
6 bioRxiv preprint doi: https://doi.org/10.1101/440677; this version posted March 7, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
139 ASV3 was detected only sporadically and at low relative abundance (mean 0.2%, range 0 to
140 5.8%) (Fig. 1A). An additional Vibrio ASV, ASV4, was a major constituent of the microbiota of
141 the shrimp used as food for the cuttlefish and was also detectable in some samples from stomach,
142 cecum, and intestine (Figure 1A). Skin samples did not exhibit much similarity to GI tract or
143 gills with respect to microbiome composition, with most common ASVs found in other
144 anatomical sites comprising < 20% (mean 17.2% ± 2.9% ) relative abundance of the
145 microbiome (Table S1).
146 In addition to surveying internal organs, we collected fecal samples from the 24 animals
147 from the second time period of our study. These samples were collected daily for each
148 individual throughout the course of the antibiotic treatment experiment (see methods).
149 Comparison of weighted UniFrac dissimilarity of fecal samples from experimental animals
150 revealed significant differences in beta-diversity between cuttlefish fecal samples, seawater, and
151 shrimp (PERMANOVA Pr(>F) = 0.001, F = 5.26, df = 2) upon which the animals were fed.
152 These results, paired with the differences we observed in compositional relative abundance
153 between organs, seawater, and shrimp provide additional support for our finding that bacterial
154 communities associated with cuttlefish differ from those found in their seawater environment and
155 food source (Fig. 2).
156
157
158 2.2 Imaging shows spatial structure of the microbiota in cuttlefish esophagus and scattered
159 distribution elsewhere in the gastrointestinal tract.
160
7 bioRxiv preprint doi: https://doi.org/10.1101/440677; this version posted March 7, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
161 Fluorescence in situ hybridization (FISH) revealed a striking organization of bacteria
162 distributed in a layer lining the interior of the convoluted esophagus of cuttlefish (Fig. 3A-C).
163 Hybridization with the near-universal Eub338 probe showed bacteria in high density in a layer
164 ~20-40 μm thick at the border between host tissue and lumen. Staining with fluorophore-
165 conjugated wheat germ agglutinin revealed a mucus layer that covered the epithelium and
166 generally enclosed the bacteria (Fig. 3). To verify the identity of these bacteria we employed a
167 nested probe set including Eub338 as well as probes for Alphaproteobacteria,
168 Gammaproteobacteria, and probes we designed specifically for Vibrionaceae (Vib1749 and
169 Vib2300, Table 2). Bacterial cells imaged in the esophagus showed signal from all probes
170 expected to hybridize with Vibrionaceae, suggesting that the bacteria observed in this organ are a
171 near-monoculture of this taxon (Fig. 4B-E). A probe targeted to Alphaproteobacteria was
172 included in the FISH as a negative control and, as expected, did not hybridize with the cells (Fig.
173 4F). As an additional control to detect non-specific binding of probes, we performed an
174 independent FISH with a set of probes labeled with the same fluorophores as the experimental
175 probe set but conjugated to oligonucleotides not expected to hybridize with the cuttlefish
176 microbiota (Table 2). No signal from this non-target probe set was detected (Fig. 4G-H)
177 supporting the interpretation that the signal observed in the esophagus results from a specific
178 interaction of the Vibrionaceae-targeted oligonucleotides with the visualized bacteria.
179 In other parts of the digestive tract we observed a sparser distribution of bacteria without
180 obvious spatial organization. Bacteria in the intestine were present not in a layer but scattered
181 throughout the lumen and mixed with the luminal contents (Fig. 5). Similarly, in the cecum, we
182 observed bacteria in low abundance in the lumen (Fig. 6). FISH was also applied to the stomach,
8 bioRxiv preprint doi: https://doi.org/10.1101/440677; this version posted March 7, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
183 posterior salivary gland (poison gland) and duct of the salivary gland, but no bacteria were
184 detected (not shown).
185 Fluorescence in situ hybridization to cross-sections of the gills revealed clusters of
186 bacteria at or near the surface of the tissue (Fig. 7). These bacteria hybridized with the Eub338
187 near-universal probe and a probe for Gammaproteobacteria (Fig. 7B, C, Table 2) but not
188 Alphaproteobacteria (not shown), consistent with the identification of the clusters of gill bacteria
189 as members of the gammaproteobacterial family Piscirickettsiaceae.
190
191 3. DISCUSSION
192
193 We sampled the cuttlefish microbiome of the digestive tract, gills, and skin and found
194 dense colonization of an unexpected site, the esophagus, by a bacterium of the genus Vibrio.
195 Both imaging and 16S rRNA gene sequencing showed a near-monoculture of Vibrionaceae in
196 the esophagus, with imaging showing dense colonization of the interior lining of the esophagus
197 with a single morphotype that hybridized to probes targeting Vibrionaceae. In the remainder of
198 the GI tract, both imaging and 16S rRNA sequencing indicated a less consistent microbiota.
199 Sequencing also showed lower relative abundance of the dominant Vibrio ASV, and qPCR
200 confirmed a significantly lower total abundance of Vibrio cell copies in the distal GI tract.
201 Imaging revealed sparse and sporadic colonization in the intestine and cecum, with scattered
202 cells in the lumen and no clear colonization of the epithelium. In light of these results, we
203 conclude that the GI tract of laboratory cultured Sepia officinalis has a highly simplified
204 microbiome dominated by the genus Vibrio.
9 bioRxiv preprint doi: https://doi.org/10.1101/440677; this version posted March 7, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
205 Diverse associations with Vibrio and the Vibrionaceae are known from cephalopods.
206 Among the most extensively investigated is the mutualistic association of the bioluminescent
207 Vibrio (Aliivibrio) fischeri with the light organ of the bobtail squid Euprymna scolopes (1, 13).
208 Other well-known symbioses include the colonization of the cephalopod accessory nidamental
209 gland with Alpha- and Gammaproteobacteria, which enables the host to secrete a layer of
210 bacteria into the protective coating of the egg capsule (3, 14-18). Thus, colonization by
211 Gammaproteobacteria and specifically by Vibrionaceae is common in cephalopods, yet
212 colonization of the GI tract, and particularly the esophagus, was unexpected.
213 Bacteria from genus Vibrio and the related Vibrionaceae genus Photobacterium are
214 frequent colonizers of the GI tracts of marine fishes (19, 20) and are prominent in the
215 gastrointestinal microbiota of Octopus vulgaris paralarvae (21). Vibrionaceae have been reported
216 to produce chitinases, proteases, amylase, and lipase (20), suggesting the possibility that
217 colonization of the digestive tract by the Vibrionaceae serves to aid in host digestion (20). If the
218 Vibrio and Photobacterium ASVs serve this function, their localization in high density in the
219 esophagus, near the beginning of the digestive tract, may serve to seed the distal gut;
220 colonization of the lining of the esophagus may provide a reservoir that permits the microbes to
221 avoid washout from the gut by continually re-populating the lumen of downstream gut chambers.
222 An alternative explanation is that the colonization of the esophagus, and the rest of the
223 gut, is pathogenic or opportunistic. Various Vibrio species are known pathogens of cephalopods,
224 causing skin lesions and sometimes mortality in squids and octopuses (22-24). The genus Vibrio
225 includes representative species that are pathogenic to corals (V. coralliilyticus), fish (V.
226 salmonicida), diverse marine organisms (V. harveyi) and humans (V. alginolyticus, V. cholerae,
227 V. parahaemolyticus, and V. vulnificus) (25, 26). Likewise, the genus Photobacterium contains
10 bioRxiv preprint doi: https://doi.org/10.1101/440677; this version posted March 7, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
228 pathogenic as well as commensal representatives (27). A previous study of the microbiota of
229 Octopus vulgaris paralarvae found that recently hatched paralarvae had a high-diversity
230 microbiome that changed, in captivity, to a lower-diversity microbiome with abundant
231 Vibrionaceae (21). Whether the Vibrionaceae are an integral part of cuttlefish physiology in
232 nature or whether they represent opportunistic colonists of these laboratory-reared organisms is a
233 question for future research.
234 Our sequence data from gills were dominated by a single ASV classified as
235 Piscirickettsiaceae that was in low abundance at other body sites. The Piscirickettsiaceae are a
236 family within the Gammaproteobacteria (28) that includes the salmon pathogen P. salmonis.
237 Rickettsia-like organisms have been described from the gills of clams and oysters (29, 30) as
238 well as associated with the copepod Calanus finmarchicus (31). In recent years
239 Piscirickettsiaceae have been identified in high-throughput sequencing datasets from seawater
240 and sediment as a taxon that may be involved in biodegradation of oil and other compounds (32-
241 38). Whether taxa in this family colonize the gills of cuttlefish and other organisms as symbionts
242 or as opportunistic pathogens is a subject for future investigation.
243 Studies of wild S. officinalis microbiota will be informative for understanding natural
244 host-symbiont associations under natural conditions, as compared to the mariculture-reared
245 animals in the present study. S. officinalis in the eastern Atlantic and Mediterranean are known to
246 prey on small mysids (crustaceans) in their first few weeks post-hatching; then as juveniles and
247 adults they prey mainly on marine fishes and crabs. The sparseness and simplicity of the gut
248 microbiota observed in our study may have been in part a result of the monodiet of grass shrimp
249 (Palaemonetes) we employed. It remains to be seen whether differences in diet and natural
11 bioRxiv preprint doi: https://doi.org/10.1101/440677; this version posted March 7, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
250 variation in environmental conditions influence the association of microbial symbionts with S.
251 officinalis in the wild.
252 Because cuttlefish behavior is well-studied and there exist standardized methods for
253 documenting multiple behaviors (8), we hypothesized that these animals may provide a unique
254 opportunity to study microbes and the gut-brain axis – the effect of gut microbiota on behavior
255 (39) – in an invertebrate system. Therefore, in parallel with our study of the microbiome of
256 various organ systems, we conducted extensive preliminary experiments to study the effect of
257 antibiotic treatment on the behavior of S. officinalis. These results were largely negative, perhaps
258 due to the highly simplified microbiota we observed and its resilience to the antibiotic employed.
259 These results may prove helpful to the cephalopod husbandry community, as they suggest that
260 application of the commonly used antibiotic enrofloxacin is compatible with maintenance of
261 normal behavioral and microbiome characteristics of this species
262
263
264 4. MATERIALS AND METHODS
265
266 4. 1 Sampling and antibiotic treatment
267
268 Our study included 27 cuttlefish that were bred in the wild and moved to captivity prior
269 to hatching. Animals were held in water tables connected to a single open-filtration system fed
270 by filtered seawater. Animals were euthanized via immersion into a 10% dilution of ethanol in
271 seawater and were then dissected under sterile conditions within a biosafety cabinet using
272 autoclaved tools to obtain samples for microbial analyses. The gastrointestinal tract was
12 bioRxiv preprint doi: https://doi.org/10.1101/440677; this version posted March 7, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
273 dissected into four components: esophagus, stomach, cecum, and intestine. Gill tissue and skin
274 from the mantle was sampled as well (~ 0.5g per sample). All tissues were stored in separate
275 sterile cryogenic tubes and flash-frozen in liquid nitrogen.
276 Following a pilot study of three individual cuttlefish, we included 24 cuttlefish (16 test, 8
277 control) in an experiment designed to test the effect of the antibiotic treatment on the
278 composition of the cuttlefish microbiome. The experimental design consisted of administering
279 antibiotic to animals in the treatment group (n = 16) via injection into the food source (grass
280 shrimp, Palaemonetes sp.), which was then fed to the animals. Prior to feeding, shrimp were
281 injected with enrofloxacin (Baytril; 22.7 mg/mL, Bayer HealthCare LLC, Shawnee Mission,
282 KS, USA) using a 0.5 cc, U-100 insulin syringe with an attached 28 g x 1/2” needle (Covidien
283 LLC, Mansfield, MA, USA). The antibiotic dosage was 10 mg/kg rounded up to the nearest
284 hundredth mL. The antibiotic was injected into the coelomic cavity of the shrimp which were
285 then immediately fed to the cuttlefish once daily for 14 days. We maintained 8 animals as
286 controls, none of which received antibiotic treatment. Experimental animals were held in two
287 separate water tables and control animals a third, all of which were connected to the same open-
288 filtration system fed by filtered seawater. Within each water table, animals were isolated into
289 individual holding pens via plastic panels. The experimental period lasted for 14 days (1 – 15
290 Oct 2017), during which fecal samples were collected from each individual daily; fecal samples
291 were collected via pipetting free-floating material from the tank of each individual animal into a
292 sterile pipette.
293 To assess the extent to which cuttlefish microbial symbionts were shared with their
294 environment and food sources, 1L water samples were taken from each of three water tables in
295 which animals were held on the day of euthanasia and filtered using a 0.22 micron Sterivex filter
13 bioRxiv preprint doi: https://doi.org/10.1101/440677; this version posted March 7, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
296 for DNA extraction; grass shrimp used as the food source throughout the duration of the
297 experiment were collected in 1.8ml sterile cryotubes on the same day that water was sampled,
298 and were frozen at -20˚C until prepared for DNA extraction.
299
300
301 4.2 DNA extraction, sequencing, qPCR, and16S rRNA gene statistical analyses
302
303 DNA extractions were performed on cuttlefish tissue biopsies, water, and whole shrimp
304 using the MoBio PowerSoil 96 Well Soil DNA Isolation Kit (Catalog No. 12955-4, MoBio,
305 Carlsbad, CA, USA). We used the standard 515f and 806r primers (49-51) to amplify the V4
306 region of the 16S rRNA gene, using mitochondrial blockers to reduce amplification of host
307 mitochondrial DNA. Sequencing was performed using paired-end 150 base reads on an
308 Illumina HiSeq sequencing platform. Following standard demultiplexing and quality filtering
309 using the Quantitative Insights Into Microbial Ecology pipeline (QIIME2) (52) and vsearch8.1
310 (53), ASVs were identified using the Deblur method (19) and taxonomy was assigned using the
311 Greengenes Database (May 2013 release; http://greengenes.lbl.gov). Libraries containing fewer
312 than 1000 reads were removed from further analyses. All 16S rRNA sequence data and metadata
313 will be made available via the QIITA platform prior to publication. Statistical analyses and
314 figure production were produced with the aid of several R packages including vegan (40), dplyr
315 (41), ggplot2 (42) and Adobe Illustrator® CC 2019. Code for analyses and figures is available at
316 www.github.com/hollylutz/CuttlefishMP. We performed qPCR analyses targeting the genus
317 Vibrio to quantify the abundance of bacterial cells throughout the GI tract. Conditions for qPCR
318 were borrowed from Thompson et al. (43), using the primers 567F and 680R and performing two
14 bioRxiv preprint doi: https://doi.org/10.1101/440677; this version posted March 7, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
319 replicates of qPCR analysis that were combined to produce the final results reported in this
320 study.
321
322 4.3 Sample collection, fixation and sectioning for imaging
323
324 Samples from esophagus, stomach, intestine and cecum of 9 cuttlefish (1 from the pilot
325 and 8 from the second period experiment) were dissected and divided in order to include the
326 same individuals in both microscopy and sequencing analyses. Immediately after dividing,
327 samples for imaging were fixed with 2% paraformaldehyde in 10 mM Tris pH 7.5 for 12 h at 4
328 ºC, washed in PBS, dehydrated through an ethanol series from 30, 50, 70, 80 and 100%, and
329 stored at -20 ºC. Samples were dehydrated with acetone for 1 h, infiltrated with Technovit 8100
330 glycol methacrylate (EMSdiasum.com) infiltration solution 3 times 1 hour each followed by a
331 final infiltration overnight under vacuum, transferred to Technovit 8100 embedding solution and
332 solidified for 12 h at 4 ºC. Blocks were sectioned to 5 um thickness and applied to Ultrastick
333 slides (Thermo Scientific). Sections were stored at room temperature until FISH was performed.
334
335 4.4 Fluorescence in situ hybridization (FISH)
336
337 Hybridization solution [900 mM NaCl, 20 mM Tris, pH 7.5, 0.01% SDS, 20% (vol/vol)
338 formamide, each probe at a final concentration of 2 μM] was applied to sections and incubated at
339 46 ºC for 2 h in a chamber humidified with 20% (vol/vol) formamide. Slides were washed in
340 wash buffer (215 mM NaCl, 20 mM Tris, pH 7.5, 5mM EDTA) at 48 ºC for 15 min. Samples
341 were incubated with wheat germ agglutinin (20 ug ml-1) conjugated with Alexa Fluor 488 and
15 bioRxiv preprint doi: https://doi.org/10.1101/440677; this version posted March 7, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
342 DAPI (1 ug ml-1) at room temperature for 30 minutes after FISH hybridization to label mucus
343 and host nuclei, respectively. Slides were dipped in ice-cold deionized water, air dried, mounted
344 in ProLong Gold antifade reagent (Invitrogen) with a #1.5 coverslip, and cured overnight in the
345 dark at room temperature before imaging. Probes used in this study are listed in Table 2.
346
347 4.5 Image acquisition and linear unmixing
348
349 Spectral images were acquired using a Carl Zeiss LSM 780 confocal microscope with a
350 Plan-Apochromat 40X, 1.4 N.A. objective. Images were captured using simultaneous excitation
351 with 405, 488, 561, and 633 nm laser lines. Linear unmixing was performed using the Zeiss ZEN
352 Black software (Carl Zeiss) using reference spectra acquired from cultured cells hybridized with
353 Eub338 probe labeled with the appropriate fluorophore and imaged as above. Unmixed images
354 were assembled and false-colored using FIJI software (Schindelin et al., 2012).
355
356 4.6 Data availability
357 All 16S rRNA sequences and sample metadata will be made available via the QIITA platform
358 prior to publication.
359
360 FIGURE LEGENDS
361
362 Figure 1. A single Vibrio taxon dominates the esophagus, and a single Piscirickettsiaceae
363 taxon dominates the gills of the European common cuttlefish in captivity. (A) Relative
364 abundance of top bacterial taxa found among cuttlefish organs. Shrimp for feeding and seawater
16 bioRxiv preprint doi: https://doi.org/10.1101/440677; this version posted March 7, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
365 from holding tanks are also shown. ASVs are labeled according to the finest level of taxonomic
366 resolution provided by the Greengenes database; bacteria not included in the top 8 taxa are
367 pooled as “other”. Bars correspond to individual 16S rRNA sequence libraries from the pilot
368 investigation animals (labeled “A”), experimental animals in the control category (labeled “B”),
369 and experimental animals in the antibiotic treatment category (labeled “C”); only libraries with
370 >1000 read depth are shown. (B) Quantity of Vibrio cells per nanogram of DNA measured using
371 Vibrio-specific primers (567F and 680R (43)). Asterisk indicates significant difference between
372 organs (p < 0.05, Welch two sample t-test). (C) Anatomical depiction of the gastrointestinal tract
373 of S. officinalis, illustration modified from Plate XI of Tompsett (44).
374
375 Figure 2. Principal Coordinates Analysis (PCoA) of weighted UniFrac β-diveristy
376 comparing shrimp, tank water, and (A) fecal samples of treatment cuttlefish and (B) fecal
377 samples of control cuttlefish. Fecal samples from control animals (B) show a more tightly
378 clustered pattern than do fecal samples from animals treated with enrofloxacin (A).
379
380 Figure 3. Spatial organization of bacteria in the esophagus of the European common
381 cuttlefish, S. officinalis. The image shown is a cross-section of esophagus that was embedded in
382 methacrylate, sectioned, and subjected to fluorescence in situ hybridization (FISH). (A) Bacteria
383 (magenta) lining the interior of the esophagus in association with the mucus layer (wheat germ
384 agglutinin staining, green). (B) and (C) are enlarged images of the regions marked with
385 arrowheads in (A) where bacteria extend past the edge of the mucus layer. Blue: Host nuclei.
386 Scale bar =100 m (A); 20 m (B) and (C).
387
17 bioRxiv preprint doi: https://doi.org/10.1101/440677; this version posted March 7, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
388 Figure 4. Fluorescence in situ hybridization identifies bacteria in the esophagus of S.
389 officinalis as Vibrionaceae. A methacrylate-embedded section was hybridized with a nested
390 probe set containing probes for most bacteria, Gammaproteobacteria, Alphaproteobacteria, and
391 Vibrionaceae. (A) near-universal probe showing a similar bacterial distribution as in Figure 3.
392 (B, C, D) Enlarged images of the region marked by the dashed square in (A) showing
393 hybridization with near-universal, Vibrionaceae, and Gammaproteobacteria probes, respectively.
394 (E) Merged image of B, C, and D showing an exact match of the signal from those three probes.
395 (F) Alphaproteobacteria probe showing no hybridization. (G) An independent hybridization with
396 the non-target probe set as a control; no signal is observed. (H) enlarged image of the dashed
397 square in (G). Scale bar=20 m (A, G); 5 m (B-F, H).
398
399 Figure 5. Fluorescence in situ hybridization in intestine of S. officinalis. A methacrylate-
400 embedded section was hybridized with the near-universal probe and stained with fluorophore-
401 labeled wheat germ agglutinin to visualize mucus. (A) Bacteria (magenta) are sparsely
402 distributed through the lumen. (B) Enlarged image of the dashed square in (A). (C) An
403 independent FISH control with a non-target probe (Hhaem1007); no signal was detected. Scale
404 bar= 20 m (A, C); 5 m (B).
405
406 Figure 6. Fluorescence in situ hybridization in cecum of S. officinalis. (A) Bacteria are
407 observed in low abundance in the lumen of cecum. (B) Enlarged image of dashed square in (A).
408 Scale bar=20 m (A); 5 m (B).
409
18 bioRxiv preprint doi: https://doi.org/10.1101/440677; this version posted March 7, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
410 Figure 7. Fluorescence in situ hybridization in gills of S. officinalis. Bacteria are observed in
411 small clusters at or near the surface of the gill. (A) Overview image. (B, C): enlarged images of
412 the dashed square in (A) showing hybridization with near-universal and Gammaproteobacteria
413 probes, respectively. (D) Merged image of (B) and (C) showing colocalization of the signal from
414 those two probes. Scale bar=20 m (A); 5 m (B-D).
415
416
417 ACKNOWLEDGEMENTS
418 We thank Alan Kuzirian, Louie Kerr, Wyatt Arnold, Madeline Kim, Elle Hill, Tyler He, Tifani
419 Anton, and Eric Edsinger. HLL was supported by NSF 1611948. TR and JMW were supported
420 by NSF 1650141. RTH thanks the Sholley Foundation for partial support. Amber Durand was
421 supported by the Woods Hole Partnership Education Program. The funders had no role in study
422 design, data collection and interpretation, or the decision to submit the work for publication.
423
424
425
426
427
428 REFERENCES
429
430 1. McFall-Ngai M. 2014. Divining the essence of symbiosis: insights from the squid-vibrio 431 model. PLoS Biol 12:e1001783. 432 2. Kerwin AH, Nyholm SV. 2017. Symbiotic bacteria associated with a bobtail squid 433 reproductive system are detectable in the environment, and stable in the host and 434 developing eggs. Environ Microbiol 19:1463-1475.
19 bioRxiv preprint doi: https://doi.org/10.1101/440677; this version posted March 7, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
435 3. Barbieri E, Bruce J. Paster, Deborah Hughes, Ludek Zurek, Duane P. Moser, Andreas 436 Teske, and Mitchell L. Sogin 2001. Phylogenetic characterization of epibiotic bacteria in 437 the accessory nidamental gland and egg capsules of the squid Loligo pealei 438 (Cephalopoda: Loliginidae). Environmental Microbiology 3:151-167. 439 4. Iehata S, Valenzuela F, Riquelme C. 2016. Evaluation of relationship between Chilean 440 octopus (Octopus mimusGould, 1852) egg health condition and the egg bacterial 441 community. Aquaculture Research 47:649-659. 442 5. Panetta D, Solomon M, Buresch K, Hanlon RT. Small-scale rearing of cuttlefish (Sepia 443 officinalis) for research purposes. Marine and Freshwater Behaviour and Physiology 444 50:115-124. 445 6. Messenger JB. 2001. Cehpalopod chromatophores: neurobiology and natural history. 446 Biological Review 76:473-528. 447 7. Darmaillacq AS, Dickel L, Mather J. 2014. Cephalopod cognition. Cambridge University 448 Press, Cambridge, UK. 449 8. Hanlon RT, Messenger JB. 1988. Adaptive coloration in young cuttlefish (Sepia officinalis 450 L): the morhpology and development of body patterns and their relation to behaviour. 451 Phil Trans R Soc B 320:437-487. 452 9. Buresch KC, Ulmer KM, Akkaynak D, Allen JJ, Mäthger LM, Nakamura M, Hanlon RT. 453 2015. Cuttlefish adjust body pattern intensity with respect to substrate intensity to aid 454 camouflage, but do not camouflage in extremely low light. Journal of Experimental 455 Marine Biology and Ecology 462:121-126. 456 10. Yu C, Li Y, Zhang X, Huang X, Malyarchuk V, Wang S, Shi Y, Gao L, Su Y, Zhang Y, Xu H, 457 Hanlon RT, Huang Y, Rogers JA. 2014. Adaptive optoelectronic camouflage systems with 458 designs inspired by cephalopod skins. Proc Natl Acad Sci U S A 111:12998-13003. 459 11. Chiao CC, Chubb C, Hanlon RT. 2015. A review of visual perception mechanisms that 460 regulate rapid adaptive camouflage in cuttlefish. Journal of Comparative Physiology A: 461 Neuroethology, Sensory, Neural, and Behavioral Physiology 201:933-945. 462 12. Tonkins BM, Tyers AM, Cooke GM. 2015. Cuttlefish in captivity: An investigation into 463 housing and husbandry for improving welfare. Applied Animal Behaviour Science 464 168:77-83. 465 13. Koch EJ, Miyashiro T, McFall-Ngai MJ, Ruby EG. 2014. Features governing symbiont 466 persistence in the squid-vibrio association. Molecular Ecology 23:1624-1634. 467 14. Bloodgood RA. 1977. The squid accessory nidamental gland: ultrastructure and 468 association with bacteria. . Tissue & Cell 9:197-208. 469 15. Pichon D, Isabelle Domart-Coulon, and Renata Boucher-Rodoni 2017. Cephalopod 470 bacterial associations: characterization and isolation of the symbiotic complex in the 471 Accessory Nidamental Glands. . Boll Malacol 43:96-102. 472 16. Collins AJ, LaBarre BA, Won BS, Shah MV, Heng S, Choudhury MH, Haydar SA, Santiago 473 J, Nyholm SV. 2012. Diversity and partitioning of bacterial populations within the 474 accessory nidamental gland of the squid Euprymna scolopes. Appl Environ Microbiol 475 78:4200-4208. 476 17. Gromek SM, Andrea M. Suria, Matthew S. Fullmer, Jillian L. Garcia, Johann Peter 477 Gogarten, Spencer V. Nyholm, and Marcy J. Balunas. 2016. Leisingera sp. JC12, a
20 bioRxiv preprint doi: https://doi.org/10.1101/440677; this version posted March 7, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
478 Bacterial Isolate from Hawaiian Bobtail Squid Eggs, Produces Indigoidine and 479 Differentially Inhibits Vibrios. Frontiers in Microbiology 7:1342. 480 18. Lum-Kong A, Hastings TS. 1992. The accessory nidamental glands of Loligo forbesi 481 (Cephalopoda: Loliginidae): characterization of symbiotic bacteria and preliminary 482 experiments to investigate factors controlling sexual maturation. . J Zool, Lond 228:395- 483 403. 484 19. Tarnecki AM, Burgos FA, Ray CL, Arias CR. 2017. Fish intestinal microbiome: diversity 485 and symbiosis unravelled by metagenomics. J Appl Microbiol doi:10.1111/jam.13415. 486 20. Egerton S, Sarah Culloty, Jason Whooley, Catherine Stanton, and R. Paul Ross 2018. 487 The Gut Microbiota of marine fish. Microbiology 9:837. 488 21. Roura A, Doyle SR, Nande M, Strugnell JM. 2017. You Are What You Eat: A Genomic 489 Analysis of the Gut Microbiome of Captive and Wild Octopus vulgaris Paralarvae and 490 Their Zooplankton Prey. Front Physiol 8:362. 491 22. Hanlon RT, Forsythe JW. 1990. 1. Diseases of Mollusca: Cephalopoda. 1.1. Diseases 492 caused by microorganisms and 1.3 Structural abnormalities and neoplasia., p 23-46 and 493 203-204. In Kinne O (ed), Diseases of Marine Animals, vol III. Biologische Anstalt 494 Helgoland, Hamburg. 495 23. Forsythe JW, Hanlon RT, Lee PG. 1990. A formulary for treating cephalopod mollusc 496 diseases. San Diego: Academic Press. 497 24. Ford LA, Alexander SK, Cooper KM, Hanlon RT. 1986. Bacterial populations of normal 498 and ulcerated mantle tissue of the squid, Lolliguncula brevis. Journal of Invertebrate 499 Pathology 48:13-26. 500 25. Takemura AF, Chien DM, Polz MF. 2014. Associations and dynamics of Vibrionaceae in 501 the environment, from the genus to the population level. Front Microbiol 5:38. 502 26. Pruzzo C, Huq A, Colwell RR, Donelli G. 2005. Pathogenic Vibrio Species in the Marine 503 and Estuarine Environment, p 217-252. In Belkin S, Colwell RR (ed), Oceans and Health: 504 Pathogens in the Marine Environment doi:10.1007/0-387-23709-7_9. Springer US, 505 Boston, MA. 506 27. Labella AM, Arahal DR, Castro D, Lemos ML, Borrego JJ. 2017. Revisiting the genus 507 Photobacterium: taxonomy, ecology and pathogenesis. Int Microbiol 20:1-10. 508 28. Mauel MJ, S.J. Giovannoni, and J.L. Fryer 1999. Phylogenetic analysis of Piscirickettsia 509 salmonis by 16S, internal transcribed spacer (ITS) and 23S ribosomal DNA sequencing. . 510 Diseases of Aquatic Organisms 35:115-123. 511 29. Azevedo C, Villalba A. Extracellular Giant Rickettsiae Associated with Bacteria in the Gill 512 of Crassostrea gigas (Mollusca, Bivalvia). Journal of Invertebrate Pathology 58:75-81. 513 30. Wen C-M, Guang-Hsiung Kou, and Shiu-Nan Chen 1994. Rickettsiaceae-like 514 Microorganisms in the Gill and Digestive Gland of the Hard Clam, Meretrix lusoria 515 Röding. Journal of Invertebrate Pathology 64:138-142. 516 31. Moisander P, Andrew D. Sexton, and Meaghan C. Daley. 2014. Stable Associations 517 Masked by Temporal Variability in the Marine Copepod Microbiome. . PLoS ONE 518 10:e0138967. 519 32. Lu X, Sun S, Hollibaugh JT, Mou X. 2015. Identification of polyamine-responsive 520 bacterioplankton taxa in South Atlantic Bight. Environ Microbiol Rep 7:831-838.
21 bioRxiv preprint doi: https://doi.org/10.1101/440677; this version posted March 7, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
521 33. Wang K, Zhang D, Xiong J, Chen X, Zheng J, Hu C, Yang Y, Zhu J. 2015. Response of 522 bacterioplankton communities to cadmium exposure in coastal water microcosms with 523 high temporal variability. Appl Environ Microbiol 81:231-240. 524 34. Hamdan LJ, Salerno JL, Reed A, Joye SB, Damour M. 2018. The impact of the Deepwater 525 Horizon blowout on historic shipwreck-associated sediment microbiomes in the 526 northern Gulf of Mexico. Sci Rep 8:9057. 527 35. Kamalanathan M, Xu C, Schwehr K, Bretherton L, Beaver M, Doyle SM, Genzer J, 528 Hillhouse J, Sylvan JB, Santschi P, Quigg A. 2018. Extracellular Enzyme Activity Profile in 529 a Chemically Enhanced Water Accommodated Fraction of Surrogate Oil: Toward 530 Understanding Microbial Activities After the Deepwater Horizon Oil Spill. Front 531 Microbiol 9:798. 532 36. Lofthus S, Netzer R, Lewin AS, Heggeset TMB, Haugen T, Brakstad OG. 2018. 533 Biodegradation of n-alkanes on oil-seawater interfaces at different temperatures and 534 microbial communities associated with the degradation. Biodegradation 29:141-157. 535 37. Ribicic D, McFarlin KM, Netzer R, Brakstad OG, Winkler A, Throne-Holst M, Storseth 536 TR. 2018. Oil type and temperature dependent biodegradation dynamics - Combining 537 chemical and microbial community data through multivariate analysis. BMC Microbiol 538 18:83. 539 38. Wang B, Liu H, Tang H, Hu X. 2018. Microbial ecological associations in the surface 540 sediments of Bohai Strait. Journal of Oceanology and Limnology 36:795-804. 541 39. Carabotti M, Scirocco A, Maselli MA, Severi C. 2015. The gut-brain axis: interactions 542 between enteric microbiota, 543 central and enteric nervous systems. Annals of Gastroenterology 28:203-209. 544 40. Oksanen J., Blanchet F. G., Friendly M., Kindt R., Legendre P., McGlinn D., Minchin P. 545 R., O'Hara R. B., Simpson G. L., Solymos P., Henry M., Stevens H., Szoecs E., H. W. 546 2018. vegan: Community Ecology Package, vR package version 2.5-2. https://CRAN.R- 547 project.org/package=vegan. 548 41. Wickham H, François R, Henry L, Müller K. 2018. dplyr: A Grammar of Data 549 Manipulation, vR package version 0.7.6. https://CRAN.R-project.org/package=dplyr. 550 42. Wickham H. 2016. ggplot2: Elegant Graphics for Data Analysis. Springer-Verlag, New 551 York, NY. 552 43. Thompson J, Randa M, Marcelino L, Tomita-Mitchell A, Lim E, Polz M. 2004. Diversity 553 and dynamics of a north Atlantic coastal Vibrio community. Applied Environmental 554 Microbiology 70:4103-4110. 555 44. Tompsett DH. 1939. L. M. B. C. Memoirs on Typical British Marine Plants & Animals. The 556 University Press of Liverpool. 557 558 42. Amann RI, Ludwig, W., Schleiffer, K. 1995. Phylogenetic identification and in situ 559 detection of individual microbial cells without cultivation. Microbiological Reviews 59:143-169. 560
561 43. Neef A. 1997. Anwendung der in situ-Einzelzell- Identifizierung von Bakterien zur 562 Populations analyse in komplexen mikrobiellen BiozönosenUniversity of Munich. 563
22 bioRxiv preprint doi: https://doi.org/10.1101/440677; this version posted March 7, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
564 44. Manz W, Amann R, Ludwig W, Wagner M, Schleifer KH. 1992. Phylogenetic 565 oligodeoxynucleotide probes for the major subclasses of Proteobacteria: problems and 566 solutions. Systematic and Applied Microbiology 15:593-600. 567 568 45. Chalmers NI, Palmer RJ, Jr., Cisar JO, Kolenbrander PE. 2008. Characterization of a 569 Streptococcus sp.-Veillonella sp. community micromanipulated from dental plaque. J 570 Bacteriol 190:8145-8154. 571 572 46. Valm A. M. MW, J. L., Rieken, C. W., Hasegawa, Y., Sogin, M. L., Oldenbourg, R., 573 Dewhirst, F. E., Borisy, G. G. . 2011. Systems-level analysis of microbial community 574 organization through combinatorial labeling and spectral imaging. 575
576
577
578
23 bioRxiv preprint doi: https://doi.org/10.1101/440677; this version posted March 7, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under A aCC-BY-NC-ND 4.0 International license. Esophagus Stomach Cecum 100
75
50 % Relaive % Relaive
Abundancue 25
0 AB C AB C AB C
Intesine Skin Gills 100
75
50 % Relaive % Relaive
Abundancue 25
0 AB C AB C AB C
Shrimp Water 100 Bacterial taxon Study group
75 Vibrio sp. (ASV1) A = Preliminary study Photobacterium sp. (ASV2) B = Experiment: Control C = Experiment: Treatment 50 Vibrio spp. Vibrionaceae (non-Vibrio) % Relaive % Relaive Abundancue 25 Pisciricketsiaceae (ASV3) Flavobacteriaceaea 0 Pseudoalteromonadaceae Vibrio sp. (ASV4; in shrimp) Other bacterial taxa
B C *
C = Control Esophagus Intesine T = Anibioic treatment 1000 ASV1
sp. 500 copies/ng VIbrio
0 Stomach Cecum CTCTCTCT
Esophagus Stomach Cecum Intesine bioRxiv preprint doi: https://doi.org/10.1101/440677; this version posted March 7, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
A Control Group Fecal vs Shrimp, Water
0.3 Control 0.2 0.1 Shrimp
[10.2%] 0.0 -0.1 Water 0.0 0.25 0.50 [57.8%]
B Treatment Group Fecal vs Shrimp, Water
Treatment 0.1 Shrimp
0.0 Water [9.2%]
-0.1
-0.1 0.0 0.1 0.2 [52%] bioRxiv preprint doi: https://doi.org/10.1101/440677; this version posted March 7, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Figure 3. Spatial organization of bacteria in the esophagus of S. officinalis. The image shown is a cross-section of esophagus that was embedded in methacrylate, sectioned, and subjected to fluorescence in situ hybridization. (A) Bacteria (magenta) lining the interior of the esophagus in association with the mucus layer (wheat germ agglutinin staining, green). (B) and (C) are enlarged images of the regions marked with arrowheads in (A) where bacteria extend past the edge of the mucus layer. Blue: Host nuclei. Scale bar =100 µm in (A) and 20 µm in (B) and (C). bioRxiv preprint doi: https://doi.org/10.1101/440677; this version posted March 7, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under Figure 4. Fluorescence in aCC-BY-NC-ND situ hybridization4.0 International license identifies. bacteria in the esophagus of S. officinalis as Vibrionaceae. A methacrylate-embedded section was hybridized with a nested probe set containing probes for most bacteria, Gammaproteobacteria, Alphaproteobacteria, and Vibrionaceae. (A) Near-universal probe showing a similar bacterial distribution as in figure 2. (B - D) Enlarged images of the region marked by the dashed square in (A), showing hybridization with near- universal, Vibrionaceae, and Gammaproteobacteria probes, respectively. (E) Merged image of (B, C, and D) showing an exact match of the signal from those three probes. (F) Alphaproteobacteria probe showing no hybridization. (G) An independent hybridization with the non-target probe set as a control; no signal is observed. (H) enlarged image of the region marked by the dashed square in (G). Scale bar=20 µm (A, G); 5 µm (B-F, H). bioRxiv preprint doi: https://doi.org/10.1101/440677; this version posted March 7, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
Figure 5. Fluorescence in situ hybridization in intestine of S. officinalis. A methacrylate- embedded section was hybridized with the near-universal probe and stained with fluorophore- labeled wheat germ agglutinin to visualize mucus (green). (A) Bacteria (magenta) are sparsely distributed through the lumen. (B) enlarged image of the region marked by the dashed square in (A). (C) An independent FISH control with a non-target probe (Hhaem1007); no signal was detected. Scale bar= 20 µm (A, C); 5 µm (B). bioRxiv preprint doi: https://doi.org/10.1101/440677; this version posted March 7, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Figure 6. Fluorescence in situ hybridization in cecum of S. officinalis. A methacrylate- embedded section was hybridized with the near-universal probe and stained with fluorophore- labeled wheat germ agglutinin to visualize mucus (green). (A) Bacteria are observed in low abundance in the lumen of cecum. (B) Enlarged image of region marked by the dashed square in (A). Scale bar=20 µm (A); 5 µm (B). bioRxiv preprint doi: https://doi.org/10.1101/440677; this version posted March 7, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Figure 7. Fluorescence in situ hybridization in gills of S. officinalis. A methacrylate-embedded section was hybridized with the near-universal probe and stained with fluorophore-labeled wheat germ agglutinin to visualize mucus (green). Bacteria are observed in small clusters. (A) Overview image. (B, C): enlarged images of the region marked by the dashed square in (A) showing hybridization with near-universal, and Gammaproteobacteria probes, respectively. (D) Merged image of (B), and (C) showing an exact match of the signal from those two probes. Display in (B, C, and D) was adjusted for clarity. Scale bar=20 µm (A); 5 µm (B-D). bioRxiv preprint doi: https://doi.org/10.1101/440677; this version posted March 7, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
1
Table 1. Relative abundance of three most abundant ASVs found among two sampling periods of the European common cuttlefish. Averages correspond to relative abundance of individual ASVs from each anatomical site and period. Period 1 consisted of three individuals, Period 2 consisted of eight individuals. ASV1 ASV2 ASV3 Anatomical Site Vibrionaceae, Vibrio sp. Vibrionaceae, Photobacterium sp. Piscirickettsiaceae, unknown Pilot Control Antibiotic Pilot Control Antibiotic Pilot Control Treatment
0.92 ± 1.00 ± 0.94 ± 0.07 ± Esophagus 0.10 0.01 0.10 0.10 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0
0.39 ± 0.43 ± 0.19 ± 0.25 + Stomach 0.34 0.37 0.31 0.42 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0
0.24 ± 0.44 ± 0.06 ± Cecum 0.14 0.23 0.09 0.28+0.35 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0
0.22 ± 0.57 ± 0.06 ± 0.50 ± 0.01 ± Intestine 0.42 0.16 0.06 0.57 0.01 0 ± 0 0 ± 0 0 ± 0 0 ± 0
0.01 ± 0.79 ± 0.97 ± 0.82 ± Gills 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0.01 0 ± 0 0.11 0.03 0.19
0.02 ± 0.08 ± 0.01 ± 0.03 ± 0.01 ± Skin 0.03 0.11 0.02 0.02 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0.02
2 3 4
1 bioRxiv preprint doi: https://doi.org/10.1101/440677; this version posted March 7, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
Ta le . FISH p o es used i this stud P o e Fluo opho e s Ta get o ga is Se ue e ’ – ’ Ta get positio Refe e e a e Ale a o Eu -I Most Ba te ia GCTGCCTCCCGTAGGAGT S, - A a et al. Rhoda i e Red-X Vi Te as Red-X Vi io a eae fa il AGCCACCTGGTATCTGCGACT S, - S hlu dt et al., i p ep Vi Te as Red-X Vi io a eae fa il TAACCTCACGATGTCCAACCGTG S, - S hlu dt et al., i p ep
p o e set Alf Atto o D Alphap oteo a te ia GGTAAGGTTCTGCGCGTT S, - Neef, A., E pe i e tal Ga a Atto N o C Ga ap oteo a te ia GCCTTCCCACATCGTTT S, - Ma z et al. Vei Ale a Veillo ella CCGTGGCTTTCTATTCCG S, - Chal e s et al. Po Ta Porphyro o as a d Te as Red-X GTTAAGCCTATCGCTAGC S, - Ma k Wel h et al., i p ep. Ta erella set Fus Atto Fuso a teriu GGCTTCCCCATCGGCATT S, - Val et al. No -ta get
o t ol p o e Lept Atto N Leptotri hia GCCTAGATGCCCTTTATG S, - Val et al. Hhae Rhoda i e Red-X Hae ophilus AGGCACTCCCATATCTCTACAG S, - Ma k Wel h et al., i p ep. hae olyti us No - p o e ta get