DOCSLIB.ORG

Coleoptera: Scarabaeidae)

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text

Load more

© Entomologica Fennica. 7 September 2018 A quick PCR-based method for identification of Melolontha melolontha and Melolontha hippocastani (Coleoptera: Scarabaeidae) Anna Tereba & Marzena Niemczyk Tereba, A. & Niemczyk, M. 2018: A quick PCR-based method for identification of Melolontha melolontha and Melolontha hippocastani (Coleoptera: Scarabae- idae). Entomol. Fennica 29: 141145. The common cockchafer (Melolontha melolontha) and the forest cockchafer (Melolontha hippocastani) are among the most destructive insect pests in many European countries. Larvae feed on the roots of numerous plant species, thus in- flicting severe damage and heavy economic losses. The two species are often dis- cussed together because they are difficult to distinguish during the larval stage. However, they differ slightly in ecology and development. The aim of this study was to develop a quick PCR-RFLP (polymerase chain reaction-restriction frag- ment length polymorphism) method for easily identifying the two Melolontha species through tissue samples or larvae, when reliable morphological identifica- tion is lacking. The strength of the method was tested on 43 M. melolontha and 37 M. hippocastani individuals. We demonstrate that the technique is rapid and in- expensive, with strong implications for the effective management of these insect pests. A. Tereba, Department of Forest Ecology, Forest Research Institute, 3 Braci Lenej Street, PL 05090 Sêkocin Stary, Poland; E-mail: [email protected] M. Niemczyk, Department of Silviculture and Forest Tree Genetics, Forest Re- search Institute, 3 Braci Lenej Street, PL 05090 Sêkocin Stary, Poland Received 2 October 2017, accepted 20 November 2017 1. Introduction stages like eggs (Freitas et al. 2014), larvae, or pupae (Chow et al. 2006). Two suchpest species Unique morphological features are often suffi- are the cockchafers Melolontha melolontha Lin- cient for species identification, but occasionally, naeus and M. hippocastani Fabricius (Scarabae- these may be too few in number. Such is often the idae, Melolonthinae) in Europe. case for cryptic species, e.g. bats of Myotis spp. The range of both the common cockchafer (M. mystacinus (Kuhl),M.brandtii(Eversmann), (M. melolontha) and the forest cockchafer (M. M. alcathoe von Helversen & Heller) (Boston et hippocastani) covers most of Europe, excluding al. 2011), neotropical black flies (Hernández- the southernmost and northernmost territories Triana 2015), and Schindleria fishes (Kon et al. (Sierpiñski 1975). Melolontha spp. have a 3- to 5- 2007). Species identification is essential to most year life cycle; in central Europe, the life cycle is biological researchand requires a distinct ap - typically 4 years (vestka 2006, Sierpiñska proachfrom theidentification of developmental 2008). Adults feed on the leaves of broadleaf 142 Tereba & Niemczyk ENTOMOL. FENNICA Vol. 29 Table 1. Sex, locations in two outbreak areas in Poland and date of collection for samples of two Melolontha spe- cies. Samples Species Sex Forest district Sub-district Sampling date 114 M. melolontha Female Smardzewice Twarda 1316 May 2015 1520 M. melolontha Male Smardzewice Twarda 1316 May 2015 2138 M. hippocastani Female Smardzewice Twarda 1316 May 2015 3940 M. hippocastani Male Smardzewice Twarda 1316 May 2015 4157 M. hippocastani Male Ostrowiec w. Ba³tów 1316 May 2015 5875 M. melolontha Male Ostrowiec w. Ba³tów 1316 May 2015 7680 M. melolontha Female Ostrowiec w. Ba³tów 1316 May 2015 trees, causing losses in agriculture, horticulture (Kessler 2004). Therefore, improved identifica- and forestry. However, cockchafer larvae (grubs) tion of these two Melolontha species is poten- are more dangerous to biological-based produc- tially the first step in developing new, specific tion systems. In their first developmental stage BCA that targets the appropriate pest while also (L ), grubs feed on and damage herbaceous plant accounting for unique soil requirements in a 1 roots in the upper soil layer. Two- (L ) and three- given region. Furthermore, distinguishing be- 2 year-old (L ) grubs feed on tree and shrub roots tween the two insects is necessary for understand- 3 even more voraciously, making reforestation and ing their respective population structures, knowl- afforestation difficult or impossible to imple- edge that is critical to both ecological studies and ment. Recent mass outbreaks have established to plant-protection efforts in forestry and agricul- cockchafers to be the most harmful root-feeding ture (e.g. decisions regarding population control). pests in forestry, affecting nurseries, young plan- Advancements in molecular techniques mean tations, and tree stands (Delb & Mattes 2001, that DNA sequences can be used to provide addi- Keller & Zimmermann 2005, vestka 2006, tional diagnostic characters for species identifica- Malinowski 2007, Giannoulis et al. 2011, Wa- tion, beyond morphological features. In 2004, the genhoff et al. 2014, Niemczyk 2015, Sukovata et Consortium for the Barcode of Life (CBOL) was al. 2015, Niemczyk et al. 2017). formed as an international initiative to develop Melolontha melolontha and M. hippocastani DNA barcoding as a global standard for identify- can only be clearly distinguished during the adult ing biological species. The CBOL database stage. The former is larger, with a long and slen- (http://www.barcodeoflife.org/content/about/bar- der pygidium, whereas the latter is smaller, with a coding-landscape) identifies different barcode se- short and knob-shaped pygidium. In contrast, ac- quences depending on the taxonomic group. For curate identification of these two species based example, the cytochrome c oxidase subunit I gene only on morphological differences is extremely is a standard for animals, the internal transcribed difficult during larval stages (lasting 34 years). spacer region is that for fungi, whereas the rbcL As a result, M. melolontha and M. hippocastani and matK genes are for plants. are usually discussed together (Sukovata et al. The aim of this study was to design a method 2015). Nonetheless, the two species show slight for a quick and unequivocal identification of M. differences in developmental pace, habitat, and melolontha and M. hippocastani using simple timing of the swarming period (Szujecki 1995). polymorphisms in the cytochrome c oxidase sub- Some life-span, survival and weight differences unit I (COI) molecular marker. also exist between the two insects when they are feeding on the same tree species (Woreta et al. 2016). Suchdifferences, however,are difficult to 2. Materials and methods apply in pest-control situations, where the goal is rapid identification. Furthermore, larval origin is Samples (Table 1) were collected from two of the as influential as the virulence of biological con- most serious outbreak areas in Poland near trol agents (BCAs) in determining BCA efficacy Tomaszów Mazowiecki (51°2827.97N, 20°01 ENTOMOL. FENNICA Vol. 29 PCR-based species identification 143 Fig. 1. Species-specific digestion of the cytochrome c oxidase subunit I (COI) fragment for Melolontha melo- lontha and M. hippocastani with SacI enzyme. For samples, see Table 1. “M” indicates size standards and “K” indicates the negative control for the PCR reaction. 39.66E) and Ostrowiec wiêtokrzyski (50°56 GGGAAATTAGTGATCCGATAGA). Primers 00N, 21°2400E). Adult insects were obtained were designed in Primer3 ver. 4.0.0 (Koressaar & from forested land (Smardzewice and Ostrowiec Remm 2007, Untergasser et al. 2012), based on wiêtokrzyski Forest Districts). The species and Melolontha spp. COI sequences available in sex of adults were identified morphologically GenBank. Reaction volumes were 50 µL, includ- witha previously establishedkey (Sierpiñski ing 1535 ng of DNA, 1 µL per primer (10 µM 1975). concentration), 25 µL of REDTaq ReadyMix Genomic DNA was isolated from the leg (ready-to-use mixture of Taq DNA polymerase, muscle of 80 Melolontha specimens (43 M. 99% pure deoxynucleotides, reaction buffer; melolontha and 37 M. hippocastani), using a Sigma-Aldrich, Germany), and 20 µL of PCR NucleoSpin® Tissue Kit (Macherey-Nagel) in ac- water. The thermocycling profile was as follows: cordance withthemanufacturer protocol. A sin - 95 °C for 3 min, followed by 34 cycles at 94 °C gle polymerase chain reaction (PCR)-restriction for 30 s, 55 °C for 30 s, 72 °C for 1 min and a final fragment lengthpolymorphism(RFLP) assay extension at 72 °C for 3 min. PCR products were was used for species identification. digested withSacI restriction enzyme (Thermo We PCR-amplified fragments of the COI Fisher Scientific) for 1 h at 37 °C and were inacti- marker withtwo primers (MelCOIF, AAGG - vated at 65 °C for 20 min. Reactions were then AAACATTTGGCACTTT and MelCOIR, performed in a total volume of 29 µL, consisting 144 Tereba & Niemczyk ENTOMOL. FENNICA Vol. 29 of 16 µL PCR water, 10 µL PCR product, 2 µL of gy alone. In the case of M. melolontha and M. 10× buffer SacI, and 2 µL SacI restriction en- hippocastani, the morphologically similar grubs zyme. After digestion, the products were visual- develop for approximately 34 years before they ised under a UV lamp on 1.5% agarose gels, become morphologically distinct adults, so that a treated withNancy-520 (Sigma-Aldrich,Ger - reliable and rapid species identification method many), and identified via band patterns. would be useful in pest control efforts. Moreover, DNA polymorphisms can be used to identify other marginal species of Melolontha, once such 3. Results analyses are optimised to be more robust and more molecular barcodes
Recommended publications
  • Reduction of Population Numbers of Melolontha Spp

    Reduction of Population Numbers of Melolontha Spp

    Folia Forestalia Polonica, Series A – Forestry, 2016, Vol. 58 (2), 87–95 REVIEW ARTICLE DOI: 10.1515/ffp-2016-0010 Reduction of population numbers of Melolontha spp. adults – a review of methods Danuta Woreta Forest Research Institute, Department of Forest Protection, Sękocin Stary, Braci Leśnej 3, 05-090 Raszyn, Poland, phone: 48 22 7150551, fax: 22 7150557, e-mail: [email protected] ABSTRACT The article provides information about control of Melolontha spp. adults, the methods used in the past, chemical pest control as well as treatments applied today. In old times, cockchafer populations were reduced mechanically, by manual collection during the swarming period or by covering soil surfaces to prevent egg lying by females. Chemical pest control methods were introduced in the fifties of the 1900s, and in subsequent 50 years, they were improved to be less and less environmentally threatening. In many countries, including Poland, there have recently been intro- duced progressive restrictions on the use of insecticides in forestry. Banning chemical treatments against cockchaf- ers resulted in going back to traditional methods and seeking alternate solutions, e.g. biological control agents. In the 1990s, polyethylene nets were used to prevent egg laying in the soil by cockchafer females. At the same time, there was tested possible usefulness of a botanical insecticide derived from neem (Azadirachta indica) to combat cock- chafer adults. The net, which needs to be spread flat on the ground, can be effective in orchards, however, in forested areas, the success of this method was limited due to the specific structure of forest land.
  • Potential of Five Non-Spore-Forming Bacteria, Originated from The

    Potential of Five Non-Spore-Forming Bacteria, Originated from The

    Ertürk and Yaman Egyptian Journal of Biological Pest Control (2019) 29:59 Egyptian Journal of https://doi.org/10.1186/s41938-019-0160-6 Biological Pest Control RESEARCH Open Access Potential of five non-spore-forming bacteria, originated from the European cockchafer, Melolontha melolontha (Linnaeus, 1758) (Coleoptera: Scarabaeidae), on three economic insect pests Ömer Ertürk1* and Mustafa Yaman2 Abstract Five non-spore-forming bacteria were isolated from the European cockchafer, Melolontha melolontha (Linnaeus, 1758) (Coleoptera: Scarabaeidae). Their potential was tested against the three economic insect pests, the great spruce bark beetle, Dendroctonus micans Kugelann (Coleoptera: Curculionidae); the pine processionary, Thaumetopoea pityocampa (Lepidoptera: Thaumetopoeidae); and the gypsy moth, Lymantria dispar (Linn.) (Lepidoptera: Erebidae), to find an effective biological control agent. All isolated bacteria were cultured and identified using VITEK bacterial identification systems and 16S rRNA gene sequence analysis. ThebacteriawereidentifiedasEnterobacter cloacae complex (isolate 1M), Serratia marcescens (isolate 3M), Pseudomonas aeruginosa (isolate 4M), Kocuria kristinae (isolate 5M), and Serratia liquefaciens (isolate 8M). Laboratory experiments, carried out to evaluate the virulence of these isolates, showed that all isolated bacteria had a pathogenic effect on the tested pests. E. cloacae had 35, 56.7, and 84%; S. marcescens 50, 60.9, and 47.8%; P. aeruginosa 55, 69.6, and 48%; K. kristinae 40, 43.5, and 16%; and S. liquefaciens 45, 65.2, and 36% mortality rates on the larvae of D. micans, T. pityocampa,andL. dispar, respectively. The isolated bacteria can be considered in integrated pest control programs. Keywords: Melolontha melolontha, Dendroctonus micans, Thaumetopoea pityocampa, Lymantria dispar,Non- spore-forming bacteria, Virulence Background include searching for entomopathogenic bacteria and de- New pest management strategies tend to minimize the termining their potentials (Egami et al.
  • Morphology, Taxonomy, and Biology of Larval Scarabaeoidea

    Morphology, Taxonomy, and Biology of Larval Scarabaeoidea

    Digitized by the Internet Archive in 2011 with funding from University of Illinois Urbana-Champaign http://www.archive.org/details/morphologytaxono12haye ' / ILLINOIS BIOLOGICAL MONOGRAPHS Volume XII PUBLISHED BY THE UNIVERSITY OF ILLINOIS *, URBANA, ILLINOIS I EDITORIAL COMMITTEE John Theodore Buchholz Fred Wilbur Tanner Charles Zeleny, Chairman S70.S~ XLL '• / IL cop TABLE OF CONTENTS Nos. Pages 1. Morphological Studies of the Genus Cercospora. By Wilhelm Gerhard Solheim 1 2. Morphology, Taxonomy, and Biology of Larval Scarabaeoidea. By William Patrick Hayes 85 3. Sawflies of the Sub-family Dolerinae of America North of Mexico. By Herbert H. Ross 205 4. A Study of Fresh-water Plankton Communities. By Samuel Eddy 321 LIBRARY OF THE UNIVERSITY OF ILLINOIS ILLINOIS BIOLOGICAL MONOGRAPHS Vol. XII April, 1929 No. 2 Editorial Committee Stephen Alfred Forbes Fred Wilbur Tanner Henry Baldwin Ward Published by the University of Illinois under the auspices of the graduate school Distributed June 18. 1930 MORPHOLOGY, TAXONOMY, AND BIOLOGY OF LARVAL SCARABAEOIDEA WITH FIFTEEN PLATES BY WILLIAM PATRICK HAYES Associate Professor of Entomology in the University of Illinois Contribution No. 137 from the Entomological Laboratories of the University of Illinois . T U .V- TABLE OF CONTENTS 7 Introduction Q Economic importance Historical review 11 Taxonomic literature 12 Biological and ecological literature Materials and methods 1%i Acknowledgments Morphology ]* 1 ' The head and its appendages Antennae. 18 Clypeus and labrum ™ 22 EpipharynxEpipharyru Mandibles. Maxillae 37 Hypopharynx <w Labium 40 Thorax and abdomen 40 Segmentation « 41 Setation Radula 41 42 Legs £ Spiracles 43 Anal orifice 44 Organs of stridulation 47 Postembryonic development and biology of the Scarabaeidae Eggs f*' Oviposition preferences 48 Description and length of egg stage 48 Egg burster and hatching Larval development Molting 50 Postembryonic changes ^4 54 Food habits 58 Relative abundance.
  • ANIMALS As DEFENDANTS - RATIONALE

    ANIMALS As DEFENDANTS - RATIONALE

    ANIMALS as DEFENDANTS - RATIONALE 0. ANIMALS as DEFENDANTS - RATIONALE - Story Preface 1. PEOPLE and ANIMALS in MEDIEVAL EUROPE 2. ANIMALS as DEFENDANTS - PIGS 3. ANIMALS as DEFENDANTS - RATS 4. ANIMALS as DEFENDANTS - RATIONALE This image depicts the frontispiece of The Criminal Prosecution and Capital Punishment of Animals, by E. P. (Edward Payson) Evans (1831-1917), published in London, during 1906, by W. Heinemann. In this work, Evans details the trials of numerous animal defendants througouth the centuries. Click on the image for a better view. At first glance, it seems that stories about these trials - in which animals were charged as defendants - are just folk tales. It is impossible to fathom how a prosecutor could prove "criminal intent" on the part of an animal defendant. How would a non-thinking being suddenly become a thinker, capable of forming criminal intent? On the other hand, a respected French jurist and criminal lawyer - who was called-upon to represent such "clients" - wrote about these types of cases in 1531. Bartholomew Chassenee discussed the type of legal analysis which applied during the centuries when the practice was used. How did the analysis typically work? If an animal killed someone, for example, people thought that Satan was acting through the animal. Why else would it destroy human life? Sometimes the guilty animals were even excommunicated by the Catholic Church. In addition to pigs and rats, other Medieval-era animals (and insects) charged with crimes included: Horse Flies, in 1121, at Mainz (formerly called Mayence) Cockchafers ("May Bugs" with white grubs), in 1320, at Avignon Locust (seized from a massive swarm, tried and executed), in 1866, at Pozega (in Slavonia) E.
  • Redheaded Pasture Cockchafer Adoryphorus Couloni

    Redheaded Pasture Cockchafer Adoryphorus Couloni

    Redheaded pasture cockchafer Adoryphorus couloni Description The adult stage is a stout, shiny black beetle about 15 mm long (Fig. 47). The ovoid eggs are 2–3 mm in length and pearly–white in colour. The grubs are soft–bodied and white with three pairs of yellowish legs, a hard, reddish brown head capsule and the posterior quarter of the body is a little swollen (Fig. 48). The head capsule appears rough or matte in contrast to the shiny Fig. 47 Adult beetle of redheaded pasture capsule of blackheaded pasture cockchafer. The body cockchafer wall is transparent. The white colouration of the grub derives from fatty tissue under the skin and the greyish appearance of the rear end results from soil in the gut. The posterior end of the grub is more opaque than in blackheaded pasture cockchafer (Fig. 44). When at rest the body is curved in the shape of a letter C. Grubs are sometimes called ‘curl grubs’ or ‘white grubs’. Newly hatched grubs are only 5 mm long but when mature, are robust and up to 30 mm in length. The grubs are less active when exposed than are blackheaded pasture cockchafer grubs, which retreat rapidly if placed on a spade. The pupa, about 15 mm long, is soft–bodied and pale yellow–brown in colour. Distribution Fig. 48 Grub of redheaded pasture cockchafer This pest is a native species. Before 1987 the redheaded pasture cockchafer occurred on King Island, but not Flinders Island, and across northern Tasmania as far south as Woodbury in the central Midlands.
  • A Monographic Revision of the Genus Platycoelia Dejean (Coleoptera: Scarabaeidae: Rutelinae: Anoplognathini) Andrew B

    A Monographic Revision of the Genus Platycoelia Dejean (Coleoptera: Scarabaeidae: Rutelinae: Anoplognathini) Andrew B

    University of Nebraska - Lincoln DigitalCommons@University of Nebraska - Lincoln Bulletin of the University of Nebraska State Museum, University of Nebraska State Museum 2003 A Monographic Revision of the Genus Platycoelia Dejean (Coleoptera: Scarabaeidae: Rutelinae: Anoplognathini) Andrew B. T. Smith University of Nebraska - Lincoln, [email protected] Follow this and additional works at: http://digitalcommons.unl.edu/museumbulletin Part of the Entomology Commons, and the Other Ecology and Evolutionary Biology Commons Smith, Andrew B. T., "A Monographic Revision of the Genus Platycoelia Dejean (Coleoptera: Scarabaeidae: Rutelinae: Anoplognathini)" (2003). Bulletin of the University of Nebraska State Museum. 3. http://digitalcommons.unl.edu/museumbulletin/3 This Article is brought to you for free and open access by the Museum, University of Nebraska State at DigitalCommons@University of Nebraska - Lincoln. It has been accepted for inclusion in Bulletin of the University of Nebraska State Museum by an authorized administrator of DigitalCommons@University of Nebraska - Lincoln. A Monographic Revision of the Genus Platycoelia Dejean (Coleoptera: Scarabaeidae: Rutelinae: Anoplognathini) Andrew B. T. Smith Bulletin of the University of Nebraska State Museum Volume 15 A Monographic Revision of the Genus Platycoelia Dejean (Coleoptera: Scarabaeidae: Rutelinae: Anoplognathini) by Andrew B. T. Smith UNIVERSITY. OF, ( NEBRASKA "-" STATE MUSEUM Published by the University of Nebraska State Museum Lincoln, Nebraska 2003 Bulletin of the University of Nebraska State Museum Volume 15 Issue Date: 7 July 2003 Editor: Brett C. Ratcliffe Cover Design: Angie Fox Text design and layout: Linda J. Ratcliffe Text fonts: New Century Schoolbook and Arial Bulletins may be purchased from the Museum. Address orders to: Publications Secretary W436 Nebraska Hall University of Nebraska State Museum Lincoln, NE 68588-0514 U.S.A.
  • Phylogenetic Relationships and Distribution of the Rhizotrogini (Coleoptera, Scarabaeidae, Melolonthinae) in the West Mediterranean

    Phylogenetic Relationships and Distribution of the Rhizotrogini (Coleoptera, Scarabaeidae, Melolonthinae) in the West Mediterranean

    Graellsia, 59(2-3): 443-455 (2003) PHYLOGENETIC RELATIONSHIPS AND DISTRIBUTION OF THE RHIZOTROGINI (COLEOPTERA, SCARABAEIDAE, MELOLONTHINAE) IN THE WEST MEDITERRANEAN Mª. M. Coca-Abia* ABSTRACT In this paper, the West Mediterranean genera of Rhizotrogini are reviewed. Two kinds of character sets are discussed: those relative to the external morphology of the adult and those of the male and female genitalia. Genera Amadotrogus Reitter, 1902; Amphimallina Reitter, 1905; Amphimallon Berthold, 1827; Geotrogus Guérin-Méneville, 1842; Monotropus Erichson, 1847; Pseudoapeterogyna Escalera, 1914 and Rhizotrogus Berthold, 1827 are analysed: to demonstrate the monophyly of this group of genera; to asses the realtionships of these taxa; to test species transferred from Rhizotrogus to Geotrogus and Monotropus, and to describe external morphological and male and female genitalic cha- racters which distinguish each genus. Phylogenetic analysis leads to the conclusion that this group of genera is monophyletic. However, nothing can be said about internal relationships of the genera, which remain in a basal polytomy. Some of the species tranferred from Rhizotrogus are considered to be a new genus Firminus. The genera Amphimallina and Pseudoapterogyna are synonymized with Amphimallon and Geotrogus respectively. Key words: Taxonomy, nomenclature, review, Coleoptera, Scarabaeidae, Melolonthinae, Rhizotrogini, Amadotrogus, Amphimallon, Rhizotrogus, Geotrogus, Pseudoapterogyna, Firminus, Mediterranean basin. RESUMEN Relaciones filogenéticas y distribución de
  • Quick Guide for the Identification Of

    Quick Guide for the Identification Of

    Quick Guide for the Identification of Maryland Scarabaeoidea Mallory Hagadorn Dr. Dana L. Price Department of Biological Sciences Salisbury University This document is a pictorial reference of Maryland Scarabaeoidea genera (and sometimes species) that was created to expedite the identification of Maryland Scarabs. Our current understanding of Maryland Scarabs comes from “An Annotated Checklist of the Scarabaeoidea (Coleoptera) of Maryland” (Staines 1984). Staines reported 266 species and subspecies using literature and review of several Maryland Museums. Dr. Price and her research students are currently conducting a bioinventory of Maryland Scarabs that will be used to create a “Taxonomic Guide to the Scarabaeoidea of Maryland”. This will include dichotomous keys to family and species based on historical reports and collections from all 23 counties in Maryland. This document should be cited as: Hagadorn, M.A. and D.L. Price. 2012. Quick Guide for the Identification of Maryland Scarabaeoidea. Salisbury University. Pp. 54. Questions regarding this document should be sent to: Dr. Dana L. Price - [email protected] **All pictures within are linked to their copyright holder. Table of Contents Families of Scarabaeoidea of Maryland……………………………………... 6 Geotrupidae……………………………………………………………………. 7 Subfamily Bolboceratinae……………………………………………… 7 Genus Bolbocerosoma………………………………………… 7 Genus Eucanthus………………………………………………. 7 Subfamily Geotrupinae………………………………………………… 8 Genus Geotrupes………………………………………………. 8 Genus Odonteus...……………………………………………… 9 Glaphyridae..............................................................................................
  • Control of Cockchafer Melolontha Spp. Grubs – a Review of Methods

    Control of Cockchafer Melolontha Spp. Grubs – a Review of Methods

    Folia Forestalia Polonica, series A, 2015, Vol. 57 (1), 33–41REV REVIEW ARTICLE DOI: 10.1515/ffp-2015-0005 Control of cockchafer Melolontha spp. grubs – a review of methods Danuta Woreta Forest Research Institute, Department of Forest Protection, Sękocin Stary, Braci Leśnej 3, 05-090 Raszyn, Poland, phone: 48 22 7150551, fax: 22 7150557, e-mail: [email protected] AbstrAct The paper presents a review of information on control measures used to prevent damages due to cockchafer Melolon- tha spp. grubs in European countries including Poland. There are described the methods used at times when mechan- ical and chemical treatments were applied as well as those under advanced research. In the past, cockchafer grubs were manually removed from plowed soils. Later on, chemical pest control commenced in plant protection practice, and a range of insecticides were either spotted directly onto plants or applied into planting rows, otherwise an entire planting area was treated. In that case, powder or granular insecticide formulations were mixed with upper soil lay- ers, but liquid insecticides were poured into the soil around seedlings. The active substance of initial plant protection products used in Poland to control cockchafer grubs was lindane (organochlorine neurotoxin), which showed pretty high efficacy. Nevertheless, organochlorine products must have been withdrawn from the market and less damaging to the environment pesticides (organophosphates and carbamates) were recommended for use in forest protection against cockchafer grubs. As a result of progressive restrictions concerning application of chemicals into forest environment, alternate solutions have been sought, e.g. biological methods of cockchafer grub control have been tested.
  • Integrating Cultural Tactics Into the Management of Bark Beetle and Reforestation Pests1

    Integrating Cultural Tactics Into the Management of Bark Beetle and Reforestation Pests1

    DA United States US Department of Proceedings --z:;;-;;; Agriculture Forest Service Integrating Cultural Tactics into Northeastern Forest Experiment Station the Management of Bark Beetle General Technical Report NE-236 and Reforestation Pests Edited by: Forest Health Technology Enterprise Team J.C. Gregoire A.M. Liebhold F.M. Stephen K.R. Day S.M.Salom Vallombrosa, Italy September 1-3, 1996 Most of the papers in this publication were submitted electronically and were edited to achieve a uniform format and type face. Each contributor is responsible for the accuracy and content of his or her own paper. Statements of the contributors from outside the U.S. Department of Agriculture may not necessarily reflect the policy of the Department. Some participants did not submit papers so they have not been included. The use of trade, firm, or corporation names in this publication is for the information and convenience of the reader. Such use does not constitute an official endorsement or approval by the U.S. Department of Agriculture or the Forest Service of any product or service to the exclusion of others that may be suitable. Remarks about pesticides appear in some technical papers contained in these proceedings. Publication of these statements does not constitute endorsement or recommendation of them by the conference sponsors, nor does it imply that uses discussed have been registered. Use of most pesticides is regulated by State and Federal Law. Applicable regulations must be obtained from the appropriate regulatory agencies. CAUTION: Pesticides can be injurious to humans, domestic animals, desirable plants, and fish and other wildlife - if they are not handled and applied properly.
  • Statecraft and Insect Oeconomies in the Global French Enlightenment (1670-1815)

    Statecraft and Insect Oeconomies in the Global French Enlightenment (1670-1815)

    Statecraft and Insect Oeconomies in the Global French Enlightenment (1670-1815) Pierre-Etienne Stockland Submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the Graduate School of Arts and Sciences COLUMBIA UNIVERSITY 2018 © 2017 Etienne Stockland All rights reserved ABSTRACT Statecraft and Insect Oeconomies in the Global French Enlightenment (1670-1815) Pierre-Etienne Stockland Naturalists, state administrators and farmers in France and its colonies developed a myriad set of techniques over the course of the long eighteenth century to manage the circulation of useful and harmful insects. The development of normative protocols for classifying, depicting and observing insects provided a set of common tools and techniques for identifying and tracking useful and harmful insects across great distances. Administrative techniques for containing the movement of harmful insects such as quarantine, grain processing and fumigation developed at the intersection of science and statecraft, through the collaborative efforts of diplomats, state administrators, naturalists and chemical practitioners. The introduction of insectivorous animals into French colonies besieged by harmful insects was envisioned as strategy for restoring providential balance within environments suffering from human-induced disequilibria. Naturalists, administrators, and agricultural improvers also collaborated in projects to maximize the production of useful substances secreted by insects, namely silk, dyes and medicines. A study of
  • The Asiatic Garden Beetle, Maladera Castanea (Arrow 1913) (Coleoptera; Scarabaeidae), a White Grub Pest New to Florida

    The Asiatic Garden Beetle, Maladera Castanea (Arrow 1913) (Coleoptera; Scarabaeidae), a White Grub Pest New to Florida

    Entomology Circular Number 425 Florida Department of Agriculture and Consumer Services November 2012 Division of Plant Industry FDACS-P-01823 The Asiatic Garden Beetle, Maladera Castanea (Arrow 1913) (Coleoptera; Scarabaeidae), a White Grub Pest New to Florida Paul E. Skelley1 INTRODUCTION: The Asiatic garden beetle, Maladera castanea (Arrow), has been a pest in the northeastern United States since the 1920s. Generally not as abundant or damaging as the Japanese beetle (Popillia japonica Newman), the Asiatic garden beetle is occasionally numerous enough to cause damage to turf, gardens and field crops, as well as simply being a nuisance. The discovery of the Asiatic garden beetle in Florida was not unexpected. This is the first report of this pest beetle in the lower southeastern U.S. coastal plain. IDENTIFICATION: Asiatic garden beetles (Fig. 1a-b) can be confused with native species of scarab beetles in the genus Serica. In general, Asiatic garden beetles are recognized by their robust body, 8-9 mm in length, reddish- brown color with iridescent sheen, hidden labrum, antenna with 10 segments (not 8-9), and strongly flattened hind tibia with apical spurs separated by the tarsal articulation. If in doubt, the long male genitalia with the large movable apical hook is distinctive (Fig. 1c-d, dissection required). Identification keys including adult Asiatic garden beetle can be found in Harpootlian (2001) for South Carolina and Evans (2002) for the entire U.S. Larvae are white grubs that are distinguished from other known U.S. scarabs by their maxilla being laterally swollen and bulbous. Identification of larval Asiatic garden beetles can be made with the key of Ritcher (1966).