sign in sign up
<<
Home , Domain (biology), Taxon, Tree of life (biology)

CorrectionKey=A DO NOT EDIT--Changes mustbemadethrough “File info” Unit 502 CHAPTER Big relationships. and genetic characteristics, whichreveal theirevolutionary ONL 17.4 17.2 17.3 Online Bi Online ■■ ■■ ■■ ■■ ■■ ■■ 17.1 17 Bioinformatics Constructing aPhylogenetic Defining Modeling DNAHybridization QuickLab Creating aDichotomous Key for LimpetShells

I 6: I N

dea

Classification andDiversity E

d m Labs tr D E Classification Based on The Linnaean Sy Classification volutionary Rel

ata omains andKingdoms Construct aCl olecular Clocks a ns can beclassified based onphysical The Tree ofLife o A l f o or nalysis gy mi

adogram n g da HMDScience.com t stem of ationships a 7A, 8A, 8B 7A, 7F 2G 3F, 8A, 8B, 8C ■■ ■■ ■■ Evolutionary Rela Open Classific Open Video Lab 7A, 8B I I nquiry LabClassification Based on nquiry LabTheLinnaean System of ation

Dichotomous K tionships eys

(t) ©Frans Lanting/Minden Pictures DO NOT EDIT--Changes must be made through “File info” CorrectionKey=A

Q How would you classify this ? Pangolins, native to Africa and Asia, are not closely related to any other living mammals. Their backs and tails are covered with large scales similar in arrange- ment to bone plates. Pangolins do not have teeth. Instead, they have an similar to a bird’s gizzard. Due to these unique traits, pangolins are classified into their own group within Mammalia.

R e a d i N G T o o lb o x This reading tool can help you learn the material in the following pages.

USING LANGUAGE Your Turn Mnemonics Mnemonic devices are tools that help you Create mnemonic devices that could help you remember remember lists or parts in their proper . Use the first all of the parts of the following groups of items. letter of every word that you want to remember as the 1. the names of all of your teachers first letter of a new word in a memorable sentence. You 2. the 12 months of the year may be more likely to remember the sentence if the sentence is funny.

Chapter 17: The Tree of 503 DO NOT EDIT--Changes must be made through “File info” CorrectionKey=B

17.1 The Linnaean System of Classification

7A, 8A, 8B Key Concept Organisms can be classified based on physical similarities. VOCABULARY Main Ideas Linnaeus developed the scientific naming system still used today. Linnaeus’s classification system has seven levels. binomial The Linnaean classification system has limitations.

Connect to Your World 7A analyze and evaluate how evidence of common ancestry The pangolin shown on the previous page may not look like any other that among groups is provided by the you are familiar with. However, scientists classify pangolins as mammals—the same fossil record, , and homologies, including anatomical, group of that includes dogs, cats, mice, and humans. All female mammals molecular, and developmental; have the ability to produce milk. Unlike pangolins, most mammals have hair. Scientists 8A define taxonomy and recognize the importance of a standardized use key characteristics such as these to classify all living things. taxonomic system to the scientific community; 8B categorize organisms using a hierarchical classification system based on similarities and differences shared among groups

MAIN IDEA 8A, 8B Linnaeus developed the scientific naming system still used today.

READING TOOLBox Before Swedish botanist Carolus Linnaeus introduced his scientific naming system, naturalists named newly discovered organisms however they wanted. Taking notes In fact, they often named organisms after themselves. Because they had no Use a main idea web to take notes about the Linnaean agreed-upon way to name living things, it was difficult for naturalists to talk system of classification. about their findings with one another. This all changed in the 1750s, when Linnaeus devised a system that standardized the way organisms are classified taxonomy and named. Linnaeus’s naming system Taxonomy Taxonomy is the science of naming and classifying organisms. Taxonomy gives scientists a standard way to refer to species and organize the diversity of living things. classifies organisms based on their physical and structural similarities. Organisms are placed into different levels in a hierarchy—a multilevel scale in which each level is “nested” in the next-higher level. In other words, each level is included in a larger, more general level, READING TOOLBox which in turn is included in an even larger, more general level. VOCABULARY A group of organisms in a classification system is called a taxon (plural, Taxonomy comes from the taxa). The basic taxon in the Linnaean system is the species. In this system, Greek taxis, which means species are most commonly defined as a group of organisms that can breed “arrangement,” and nomie, which means “method.” and produce offspring that can reproduce. Linnaeus’s system gives each species a scientific name. With few changes, this method of naming is still used today.

504 Unit 6: Classification and Diversity DO NOT EDIT--Changes must be made through “File info” CorrectionKey=B

Scientific Names Binomial nomenclature (by-noh-mee-uhl NOH-muhn-klay-chuhr) is a system that gives each species a two-part scientific name using Latin roots. The first part of the name is the genus. VISUAL VOCAB A genus (plural, genera) includes one or more physically similar species that are Binomial nomenclature is a standard naming system that gives thought to be closely related. For exam- each species a two-part name using ple, the genus Quercus includes more Latin roots. than 500 species of oak . Genus two name naming system names are always capitalized. They are written in italics or underlined. bi nomial nomen clature

The second part of the name is the (1) Genus (2) species species descriptor. It can refer to a trait of the species, the scientist who first described it, or its native location. Like the genus, the species descriptor is written in italics or underlined. However, it is always lowercase. The species descriptor is never written alone because, as figure 1.1 shows, the same word may be used in different genera. Quercus alba is the scientific name for white oak trees (alba means “white”), but alba is the scientific name FIGURE 1.1 The white oak for barn . (Quercus alba) and the barn (Tyto alba) belong to different You may wonder why use scientific names. It may seem easier to genera. The parts of their scien- use terms such as white oak instead of remembering two-part Latin names, as tific names signifying species are seen in FIGURE 1.2. However, scientific names are helpful in many ways. First, both alba, meaning “white.” genera such as Quercus contain hundreds of species. Many of these species have similar common names. Scientific names allow scientists to talk about particular species without confusion. Also, remember that biology is studied all over the world. One species may have several different common names, even within a single country. Armadillidium vulgare is the scientific name for pill bugs. However, this species is also called roly-poly, sow bug, and potato bug. Scientific names allow scientists around the world to communicate clearly about living things. Contrast Describe the difference between a genus and a species.

figure 1.2 scientific and common names Scientific Name Common names Genus species Roly-poly, pill bug, sow bug, potato bug Armadillidium vulgare

Dandelion, Irish daisy, ’s tooth Taraxacum officinale

House sparrow, English sparrow Passer domesticus

Mountain lion, cougar, puma Puma concolor

Red maple, scarlet maple, swamp maple Acer rubrum (tr) ©LarryVision/Robert Harding Michael/Nature Picture Library; (br) ©Digital

Chapter 17: The 505 DO NOT EDIT--Changes must be made through “File info” CorrectionKey=B

MAIN IDEA 8B Linnaeus’s classification system has seven levels. CONNECT TO The Linnaean system of classification has seven levels, or taxa. From the most Domains general to the most specific, these levels are , (the term The tree of life has been updated division is often used instead of phylum for and fungi), class, order, since Linnaeus’s time. Scientists , genus, and species. Each level in Linnaeus’s system is nested, or in- now classify organisms into an cluded, in the level above it. A kingdom contains one or more phyla, a phylum even broader category, called the , above the kingdom level. contains one or more classes, and so forth. The classification of the gray wolf, You will learn more about domains Canis lupus, is shown in Figure 1.3. Moving down, the levels represent taxa that and kingdoms in 4. become more and more specific, until you reach the species level at the bottom.

FIGURE 1.3 The Linnaean Classification System Linnaean taxonomy classifies living things into a hierarchy of groups called taxa. The classification of the gray wolf is illustrated here.

KINGDOM: Animalia

PHYLUM: Chordata

CLASS: Mammalia

ORDER: Carnivora

FAMILY:

GENUS: Canis

SPECIES: Canis lupus

Analyze Based on the taxonomy shown here, are bats or cats more closely related to gray wolves? 8B

506 Unit 6: Classification and Diversity CorrectionKey=B DO NOT EDIT--Changes mustbemadethrough “File info”

©Sohns, Juergen and Christine/Animals Animals - Earth Scenes limitations. system classification Linnaean The has based on relatedness? relatedness? on based I sys Apply nfer 17.1 2. 3. 1. Re

related to raccoon the than to giant the panda. raccoons. Furthermore, red the panda, shown in panda is more closely related to members of family bear the than it is to Linnaean system. of have similarities, these they Because same placedinthe family been inthe are more likely than physical similarities due to be to acommon ancestor. research to help living classify similarities two things. species Genetic between account for similarities that evolved way. this today, So scientists genetic use similar traits through convergent . Linnaeus’s system not does always a result of closerelation Unrelated species. between can species evolve larities alone. Remember that physical similaritiesare two species between not study organisms at molecular level. the Linnaeus created his classification system before allowed technology us to order, class, phylum, and kingdom as wolves, dogs, and coyotes. family as wolves, dogs, and coyotes. Therefore, foxes belong also to same the genus,not but belong do belong they to Canis the to Canidae—thesame belongalso to same the family, order, class, phylum, and kingdom. Foxes do Linnaean the systemBecause is anested hierarchy, wolves, n dogs, and coyotes lupis Canis Mammalia, order and Carnivora, species the family Canidae, genus Canis, mo MA

tem must they have in common? have common? they in must tem

general to most specific. system ofclassification, from most Name each Linnae What are some limitations ofthe What is v

For e The top level represents of inkingdom all species the Animalia.As you ve down, levels the show examples of from species phylum Chordata, class

W IN iewin I oti f two species belong to the same order, what other levels in the Linnaean Linnaean levelsthe in order, other what same to the belong species f two hy is the red name panda common hy the is

ID ce thatce gray wolves are same inthe genus, Canis, an classification system? xample, giant the panda and raccoon the have similar ears and snouts. F E binomial nomenclature? A ormative Assessment . Each level. Each is included of inall more the general levels above it. g

taxon intheLinnaean

H M owe a 7A in ver, molecular biologists have found that giant the I 7A de as 8B 8B mis H 5. 4. C is sy

r

simil scientific community? t Recognize andstate?city Compare leading in terms of classification i axonomic system to important the t stem on focuses physical simi- i cal ar to anaddress that includes F igure 1.4,

th

How isascientific name Why isastandardized in as dogs and coyotes. k is more closely in g 8A GO ONLINE than to giant pandas. closely related to raccoons (Ailurus ful FIGURE 6. Hi and theirphyla. complet Refer to C

CO story ists? findings withother natural - system helphimshare his tion system. How didthis using theLinnaeanclassifica organisms, which heclassified collected of thousands During hisvoy lass CO NNE HMDScience.com Self-check Online 1.4 NNE Chapter 17: TheTree of Life e listofthekingdoms ifi A

CT TO gens) ismore ppendix

This red panda CT TO o cat f S 8A i ages, Darwin c o ien A n for a c e -

507 DO NOT EDIT--Changes must be made through “File info” CorrectionKey=A G Online!

Sort ItOut

Web BIOLOGY Using a Key to Classify Classify a Cucumber Build a Cladogram Find Use a dichotomous key to Learn about the evolutionary history out how crocodiles are classify animals based on of an animal that looks like a water related to birds by building their descriptions. balloon, and discover how it fits into a cladogram. the tree of life. ©Photoshot Holdings Ltd/Alamy

508 Unit 6: Classification and Diversity DO NOT EDIT--Changes must be made through “File info” CorrectionKey=A

Fitting

Biology IDEO V CLIP BIOLOGY BIOZINE Find out Pandemics—Is the Next Taxonomy and how scientists use One on the Way? Classification Learn about rates to measure evolution- the career of a taxonomist. Catch the latest headlines about the ary time. diversity of life, including stories about contagious diseases that can jump between species. ©Ali Imam/Reuters/Corbis

online biology 509 HMDScience.com CorrectionKey=A DO NOT EDIT--Changes mustbemadethrough “File info” Unit 510 figure 2.1 figure character derived cladogram phylogeny VOCABULARY (Gl shared amonggroups based onsimilarities anddifferences hierarchical classification system 8B categorize organisms usinga molecular, anddevelopmental and homologies, includinganatomical, fossil record, biogeography, and among groups isprovided by the how evidence ofcommon ancestry novemcinctus). nine-banded armadillo (Dasypus armadillo species,includingthe ancestor to about 20modern 10,000 years ago. Itisthecommon small car andlived more than illustrated here, was thesizeofa yptotherium arizonae),

6: 7Aanalyze andevaluate

Classification andDiversity 17.2

The glyptodon 7A, 8B Relationships Classification Based onEvolutionary Glyptodon re ancestry. Cladistics based common classification on is rather thanjustphysical similarities. scientists agree that speciesshould beclassified based onevolutionary relationships actually more closely related to rodents andprimates thanthey are to birds. Today, they have several features incommon withbirds, suchaswings. However, bats are If you’ve ever observed bats inazoo orinthenightsky, you’ve likely noticed that Your to World Connect K ey

lationships. how different groups of are species related to each other. members are related to each other. The branches of an evolutionary tree show diagrams are like family trees. The branches of afamily tree show how family phylogeny and molecular data. The evolutionary for history agroup a of is called species evolutionary relationships using from evidence the species, record, more than just physical traits. Modern classification on isidentifying based learned, process this convergent is called evolution. thatspecies are adapting to similar environmental conditions. As you have know that similar traits, such as wings the of bats and birds, evolve can also in tor, such as ancestor the shared by dogs and wolves. However, scientists now Similar traits are species between often result the of sharing acommon ances- MA M C

a o Phy To cl Molecular evidence reveals species’ relatedness. Cladistics isclassification based oncommon ancestry. IN in in n

ce ID logenies shown can be as branching tree diagrams. In away, these I assify species according species assify to how are they related, scientists must at look d pt EA ea

(fy-LAHJ-uh-nee).

s Modern classification is based on evolutionary evolutionary on based is classification Modern 7A, 8B

Armadillo

(bl) ©The Natural History Museum; (br) ©Pontier, John/Animals Animals - Earth Scenes DO NOT EDIT--Changes must be made through “File info” CorrectionKey=A

Cladistics The most common method used to make evolutionary trees is called cladis- tics. Cladistics (kluh-DIHS-tihks) is classification based on common ancestry. The goal of cladistics is to place species in the order in which they descended from a common ancestor. A cladogram is a diagram based on patterns of shared, derived traits that shows the evolutionary relationships between groups of organisms. At the root of the words cladistics and cladogram is the word . A clade is a group of species that shares a common ancestor. For example, the glyptodon in Figure 2.1 is the common ancestor of about 20 modern species of armadillos. Together, the glyptodon and all of its descendants form a clade.

Through the course of evolution, certain traits change in some species of a REA d i n G TO OLB ox clade but stay the same in other species. Therefore, each species in a clade has some traits from its ancestors that have not changed, such as the similar shells VOCABULARY of glyptodons and modern armadillos. Organisms that do not share a com- The word derived comes from the Latin de-, meaning “from,” mon trait with the rest of the group are branched off into their own clade. and rivus, meaning “stream.” The traits that can be used to figure out evolutionary relationships among Therefore, derived refers to something that has “flowed” a group of species are those that are shared by some species but are not from a source. The term present in others. These traits are called derived characters. As you will soon derived characters refers to see, cladograms are made by figuring out which derived characters are shared characters that have evolved by which species. The more closely related species are, the more derived in a species since sharing a common ancestor. characters they will share. A group of species that shares no derived charac- ters with the other groups being studied is called an outgroup.

QU i c K l a B classifying 8B Construct a Cladogram You can think of a cladogram as an evolutionary family tree in which things that are more closely related share more characteristics. As an analogy, processes that have evolved due to new technologies can be organized using cladistics. In this lab, you will fill in a cladogram for methods of transportation. PROBLEM How can methods of transportation be organized using a cladogram? label label label label label Procedure wings 1. Copy the cladogram axes on the right into your notebook. 2. Think about the characteristics of the following methods of passengers transportation: bicycle, car, motorcycle, airplane, and on foot. enclosed 3. Complete your cladogram by filling in each method of transpor- motor tation listed in step 2 on the appropriate line at the top. wheels Analyze and Conclude 1. identify What “derived characters” are used in this cladogram? 2. Analyze Which mode of transportation may be considered an “outgroup”—a group that has none of the characteristics labeled on the cladogram? 3. Connect A species that has evolved a new trait is not better than a species without that trait. Each species is just adapted to a certain way of life. When might riding a bike have an advantage over flying in an airplane?

Chapter 17: The Tree of Life 511 DO NOT EDIT--Changes must be made through “File info” CorrectionKey=A

Interpreting a Cladogram The main features of a cladogram are shown in Figure 2.2. are Biology that have four limbs—amphibians, , birds, and mammals. HMDScience.com Some tetrapods, such as snakes and marine mammals, no longer have the four GO ONLINE limbs that their known ancestors had. However, they are still members of the Build a Cladogram tetrapoda clade because they share a common ancestor. Derived characters In a cladogram, groups of species are placed in order by  the derived characters that have added up in their lineage over time. This T’ ing! order is hypothesized to be the order in which they descended from their maz A Video Inquiry common ancestor. Derived characters are shown as hash marks between the HMDScience.com branches of the cladogram. All species above a hash mark share the derived

GO ONLINE character it represents. Guitarfish Nodes Each place where a branch splits is called a node. There are five nodes on the cladogram. The first node is where the amphibian branch splits off from the rest of the cladogram. Nodes represent the most recent common ancestor shared by a clade. Therefore, the first node of the tetrapod cladogram represents a common ancestor for the whole tetrapod clade. Identifying You can identify clades by using the “snip rule.” Whenever you “snip” a branch under a node, a clade falls off. In this cladogram, if you were to “snip” below the node where and tortoises branch off, you would be left with the reptilia clade. This clade includes turtles and tortoises, lizards and snakes, crocodiles and alligators, and birds. As you can see, each clade is nested within the clade that forms just before it. There are five clades in the tetrapod cladogram. Crocodiles, alligators, and birds belong to all five clades.

1 All of the organisms in this cladogram belong to the tetrapoda clade (brown). They all share the derived character of four limbs. CONNECT TO 2 An embryo protected by a fluid-filled sac is a derived character for all Animals organisms in the amniota clade (blue). Because amphibians do not The amniotic sac is a key char- produce an amniotic sac, the amphibian branch splits off from the rest of acteristic of amniotes, animals the branches before the mark that represents this trait. that are fully adapted for life on land. The amniotic sac allows 3 Organisms in the reptilia clade (yellow) have a common ancestor that amniotes to reproduce on land; had four limbs, produced protected eggs, and had a skull with openings non-amniotes must return to the behind the eyes. The third node in the cladogram represents this com- water to reproduce. You will learn much more about amniotes mon ancestor. Because mammal skulls do not have these openings, they in the chapter A Closer Look at are not part of the reptilia clade. Amniotes. 4 Organisms in the diapsida clade (green) have openings in the side of the skull. The skulls of turtles and tortoises do not have these openings, so they are not part of the diapsida clade. 5 Lizards and snakes branch off of the cladogram next. Their skulls do not have certain openings in the jaw that are found in crocodiles, alligators, and birds. This is the derived character shared by all organisms in the archosauria clade (pink). and toothless beaks separate croco- diles and alligators from birds within the archosauria clade. Contrast What is the difference between a clade and a taxon? 8B

512 Unit 6: Classification and Diversity DO NOT EDIT--Changes must be made through “File info” CorrectionKey=A

FIGURE 2.2 Cladogram for Tetrapods

A cladogram presents hypothesized evolutionary relationships among a group of species based on common ancestry and derived characters. clade A clade is a group of organisms that share certain traits derived from a common ancestor. In this cladogram, a clade looks like the letter V, including all the branches that extend from the right end of the V. The diapsida clade includes liz- ards and snakes, crocodiles and alligators, and birds.

1 Tetrapoda clade 2 Amniota clade

3 Reptilia clade 4 Diapsida clade 5 Archosauria clade amphibians mammals turtles/tortoises lizards/snakes crocodiles/alligators birds

FEATHERS AND TOOTHLESS BEAKS

SKULL OPENINGS IN FRONT OF THE EYE AND IN THE JAW

OPENINGS IN THE SIDE OF THE SKULL

SKULL OPENINGS BEHIND THE EYES

EMBRYO PROTECTED BY Node AMNIOTIC FLUID In a cladogram, a node is the intersection of two branches. This node represents FOUR LIMBS WITH DIGITS the most recent common ancestor shared by the entire tetrapoda clade. Derived character Organisms that branch off after a hash mark share the derived character represented by the hash mark. An embryo protected by amniotic fluid is a derived character shared by all organisms in the amniota clade. Amphibians do not have this derived character.

CRITICAL Which groups of animals belong to the amniota clade? Which VIEWING belong to the archosauria clade? 8b

Chapter 17: The Tree of Life 513 DO NOT EDIT--Changes must be made through “File info” CorrectionKey=A

MAIN IDEA 7A, 8B Molecular evidence reveals species’ relatedness. You have learned how physical characteristics, such as protected eggs, can be figure 2.3 Based on structural used to build evolutionary trees. In this example, a protected egg is a derived similarities, scientists previously classified segmented worms and character shared by all species in the amniota clade. Today, new technology as sister taxa. The dis- allows biologists to compare groups of species at the molecular level. Molecu- covery of a hormone found only lar evidence, such as a certain DNA sequence, can be used as a derived charac- in roundworms and arthropods has led scientists to propose a ter if it is shared among certain groups of species. new phylogeny for these taxa. In many cases, molecular data agree with classification based on physical similarities. In other cases, this of data leads scientists to classify species BEFORE in a different way. An evolutionary tree is always a work in progress. With new evidence, trees can be changed to show how species are likely related. roundworms For example, based on physical traits, most biologists considered seg- mented worms and arthropods (, lobsters, , and their relatives) to mollusks be more closely related to each other than to any other group of species. segmented worms However, the discovery of a certain hormone has provided new information. This hormone affects molting, and it is found only in arthropods and round- arthropods worms. Biologists have now proposed a new evolutionary tree, shown in figure 2.3. In this tree, roundworms and arthropods are grouped closer to- gether. This tree is based on the idea that the hormone evolved only once, AFTER in an ancestor shared by arthropods and roundworms. flatworms Proteins and are also used to help learn about evolutionary relation- mollusks ships. In fact, DNA is considered by many scientists to have the “last word” when figuring out how related two species are to each other. After all, any segmented worms traits that can get passed on to offspring must have a genetic basis. The more roundworms similar to each other the genes of two species are, the more closely related the species are likely to be. In the next section, you will see how DNA and protein arthropods sequences can be used to measure evolutionary time itself. Analyze Why does DNA often have the “last word” when scientists are constructing evolutionary relationships? 7A

Self-check Online HMDScience.com 17.2 Formative Assessment GO ONLINE Reviewing Main Ideas Critical thinking CONNECT TO 1. What is the goal of cladistics? 3. Compare and Contrast Discuss 2. What role does molecular evidence some similarities and differences 5. Recall that a hypothesis is a play in determining how closely two between the Linnaean system of possible explanation for a set species are related to each other? classification and cladistics. 8B of observations. Why are 7A 4. Analyze Describe the relationship cladograms considered between clades and shared to be hypotheses? 2B derived characters.

514 Unit 6: Classification and Diversity D A T A ANALYSIS 515

1 0 21 15 18 10 20 an Chapter 17:Chapter of Life The Tree Differences Differences m Sequence and Structure and Sequence d u H ci A h t e c HMDScience.com m ino wi Atlas of Protein of Protein Atlas M. Dayhoff, Source: d Lampreys such as this one are jawless jawless such as this one are Lampreys sucking mouth. with a round, Am GO ONLINE charts and animated Create Smart Grapher. graphs using pare ochro m t o 2G Table 1. Table C cy OrganismChimpanzee Rhesus Number of Differences Whale Bullfrog Lamprey ormed data suggest about how related each type of animal is to humans? is to type of animal each related about how suggest ormed data edure outlined above to find percentage differences in cytochrome C between C between in cytochrome differences find percentage to outlined above edure ​

entage of the human cytochrome C protein is the same as that of whales? of whales? is the same as that C protein of the human cytochrome entage

Use the proc Use

What do the transf What Transform Data Transform What perc What

ction of the total number of amino acids that make make that number of amino acids ction of the total pply alculate 20 differences nfer C humans and the following animals: , bullfrogs, turtles, whales, rhesus monkeys, and chimpanzees. rhesus monkeys, whales, turtles, tunas, bullfrogs, animals: humans and the following A I similarity. 5 percentage difference 2 percentage Hint: 100 percent

104 total amino acids 104 total 20 4 10 Transform this number into a percentage by multiplying by 100. by multiplying by a percentage this number into Transform Next, perform the division. perform Next,  First, transform the number of amino acid differences into into differences the number of amino acid transform First, a fra (104). C protein up the cytochrome  19.23% difference 3 100 5 19.23% 0.1923 ______1. 3. 2. 45 0.1923

ractice

1. 3. 2. P

Look at the data table at the right. Notice that the cytochrome C of of C cytochrome the that Notice right. the at table data the at Look cytochrome the while humans, of that resembles closely most chimpanzees more To differences. more has fish, jawless of type a lampreys, of C be can data these are, they different how represent clearly percentage the calculate To differences. percentage into transformed follow lampreys, and humans between C cytochrome of difference procedure. this Model 104 of sequence A respiration. cellular in functions that protein a is C Cytochrome this compared have Scientists C protein. up the cytochrome makes amino acids other of in a variety in humans with the sequence of amino acids sequence humans in C cytochrome between differences acid amino of number The species. species. between relatedness determine to species has been used and in other Transforming Data usually are data Instead, alone. data publish raw rarely Researchers of observations types certain is because This way. in some analyzed in different presented are when data clearer be made can and patterns be best may or difference change show that data example, For ways. difference. as percentage represented ©Gary Meszaros/Photo Researchers, Inc. Researchers, Meszaros/Photo ©Gary

CorrectionKey=A DO NOT EDIT--Changes must be made through “File info” info” “File through be made must EDIT--Changes DO NOT DO NOT EDIT--Changes must be made through “File info” CorrectionKey=B

17.3 Molecular Clocks

7a, 7f Key Concept Molecular clocks provide clues to evolutionary history. VOCABULARY Main Ideas molecular clock Molecular clocks use to estimate evolutionary time. mitochondrial DNA Mitochondrial DNA and ribosomal RNA provide two types of molecular clocks. ribosomal RNA

Connect to Your World 7A analyze and evaluate how evidence of common ancestry Have you ever played the game “Telephone?” One person whispers a message to among groups is provided by the another person, who repeats it to yet another person, and so on. By the time it fossil record, biogeography, and homologies, including anatomical, reaches the final person, the message has changed. In a similar way, DNA changes molecular, and developmental and slightly each time it is passed from generation to generation. 7F analyze and evaluate the effects of other evolutionary mechanisms, including , flow, MAIN IDEA 7a, 7f mutation, and recombination Molecular clocks use mutations to estimate evolutionary time. In the early 1960s, biochemists Linus Pauling and Emile Zuckerkandl pro- posed a new way to measure evolutionary time. They compared the amino acid sequences of hemoglobin from a wide range of species. Their findings show that the more distantly related two species are, the more amino acid CONNECT TO differences there are in their hemoglobin. Using these data, they were able to Human Biology calculate a mutation rate for part of the hemoglobin protein. Hemoglobin is an oxygen- carrying protein that is found in the blood cells of all vertebrates, Molecular clocks are models that use mutation rates to measure evolutionary including humans. You will learn time. Recall that mutations are nucleotide substitutions in DNA, some of more about hemoglobin in the chapter Respiratory and which cause amino acid substitutions in proteins. Pauling and Zuckerkandl Circulatory Systems. found that mutations tend to add up at a constant rate for a group of related species. As shown in Figure 3.1, the rate of mutations is the “ticking” that powers a molecular clock. The more time that has passed since two species have diverged from a common ancestor, the more mutations that will have built up in each lineage, and the greater the differences between the two species at the molecular level.

Figure 3.1 Molecular Evolution Mutations add up at a fairly constant Ten million years later— Another ten million years later— rate in the DNA of species that evolved one mutation in each lineage one more mutation in each lineage from a common ancestor. G T ACG T A T T C G T A A G T A T T C

The DNA sequences from two The mutation rate of this GAACG T A T T C descendant species show muta- sequence equals one mutation tions that have accumulated (black). per ten million years. DNA sequence from a hypothetical ancestor GAACG T A T G C GAAC C T A T G C

516 Unit 6: Classification and Diversity CorrectionKey=B DO NOT EDIT--Changes mustbemadethrough “File info”

©Michael Durham/Minden Pictures two types of molecular clocks. of molecular two types Mitochondrial tha I Analyze more aminoacid differences inthebeta chainoftheirhemoglobin. Animal speciesthat evolved longer ago compared withhumanshave Figure nfer

use as amolecular clock.use are related, scientists with an amolecule choose appropriate mutation rate to others have low mutation very rates. on Depending how closely two species sequences of DNA accumulate mutations relatively quickly inalineage, while Different have molecules different mutation rates. For example, some of organisms is shown in humanbetween hemoglobin and hemoglobin the ofother types several each groupbetween of The number species. of amino acid differences ­numb organism fossil inthe record. Using dates, these that confirmed they the compared molecular their data with first appearance the of of each type 200 million years ago, two continents these when split. know that of Australia and of those South Americadiverged about mutation rate for are they molecule the studying. For example, scientists began to species diverge the when from acommon ancestor, canthe find they is known to have are separated they species the studying. If scientists know and real time. comes Often link this from timing the of ageologic event that To estimate mutation rates, scientists must molecular data between links find Molecular Linking from that species diverged earliest inevolutionary time. MA an t of birds? Mouse H Shark

A link ca A link F Bird Why is the hemoglobin of humans more different from that of sharks than than sharks of that from different more humans of hemoglobin the Why is orse IN rog i ma

3.2

er of amino acid differences increases with evolutionary the time Which two animals inthist

ID

l l E in A n also comen also from fossil evidence. Pauling and Zuckerkandl k

C AM in om g I NO A

p mol ar 7a, 7f 7a, e DN C D e d I cul D D wi ata w Figure 3.2. 79 62 35 18 16 A and r A and t iffe ar h hu able are least related to humans?

a ith Realith r nd f nd e man nc Human hemoglobin is most different e o s ssi s ibosomal R ibosomal

T l ime d Re App a cord t e a ara (m nc illions of years ago)illions e i 450 270 350 N n 70 70

Fos A pro

7a, 7f s il il vide chain ofhemoglobin. differences inthebeta Frogs andhumanshave 62 Molecular Clock GO ONLINE HMDScience.com Chapter 17: TheTree of Life Biology

517 DO NOT EDIT--Changes must be made through “File info” CorrectionKey=B

Mitochondrial DNA Figure 3.3 inheritance of Mitochondrial DNA Mitochondrial DNA (mtDNA) is DNA found grandparents only in mitochondria, the energy factories of mitochondrial cells. The mutation rate of mtDNA is about ten DNA times faster than that of nuclear DNA, which nuclear DNA makes mtDNA a good molecular clock for closely related species. Furthermore, as shown parents Mitochondrial DNA is in figure 3.3, mtDNA is always inherited from passed down only from the mother of each gen- the mother because the mitochondria in a eration, so it is not sub- sperm are lost after fertilization. This type ject to recombination. of inheritance is different from that of nuclear child DNA, which is a combination of DNA from Nuclear DNA is inherited from both both parents. Scientists use the fact that parents, making it more difficult to mtDNA is passed down unshuffled to trace trace back through generations. mutations back through many generations in a single species. In fact, mutations in mtDNA have been used to study the migration routes of humans over the past 200,000 years. Ribosomal RNA READING TOOLBox Ribosomes, the that manufacture proteins in cells, contain ribosomal RNA (rRNA). Ribosomal RNA is useful for studying distantly VOCABULARY related species, such as species that are in different kingdoms or phyla. In this context, the word When studying the relationships among species over longer time scales, it is conservative means “resistant to change.” Because ribosomes best to use a molecule that has a lower mutation rate. Ribosomal RNA has play such a crucial role in cell conservative regions that accumulate mutations at a low rate relative to most function, even small changes DNA. Over long periods of geologic time, mutations that do build up in the can be very disruptive and damaging to the cell. Therefore, rRNA of different lineages are relatively clear and can be compared. American most mutations in rRNA do not microbiologist first used rRNA to establish that diverged accumulate within the . from the common ancestor they share with almost 4 billion years ago. As you will learn in the next section, these findings supported a restructuring of the tree of life at its highest level. Summarize Why is rRNA useful for studying more distantly related species? 7a

Self-check Online HMDScience.com 17.3 Formative Assessment GO ONLINE Reviewing Main Ideas Critical thinking CONNECT TO 1. How are molecular clocks used to 3. Explain How do rates of mutation measure evolutionary time? 7a “power” molecular clocks? 7f 5. The theory of endosymbio- 2. What are the benefits of 4. Apply What molecular clock might sis explains how eukaryotic mitochondrial DNA and be useful to examine the evolution- cells may have evolved from ribosomal RNA as molecular ary relationship between several prokaryotic cells. According clocks? 7a phyla in the kingdom Plantae? Explain to this theory, explain why your answer. 7f mitochondria have their own DNA, separate from nuclear DNA. 7G

518 Unit 6: Classification and Diversity DO NOT EDIT--Changes must be made through “File info” CorrectionKey=A

17.4 Domains and Kingdoms

3F, 8A, 8B, 8C Key Concept the current tree of life has three domains. Main Ideas VOCABULARY Classification is always a work in progress. Bacteria The three domains in the tree of life are Bacteria, Archaea, and Eukarya. Archaea Eukarya Connect to Your World Have you ever swum in a pond? Every drop of pond water is teeming with single- 3F research and describe celled organisms. At one time, scientists classified these organisms as either plants or the and con- tributions of scientists; 8A define animals. However, classification schemes change. Single-celled such as taxonomy and recognize the importance of a standardized these pond dwellers now have a kingdom of their own. taxonomic system to the scientific community; 8B categorize organisms using a hierarchical classification system based on similarities and MAIN IDEA 3F, 8A, 8B differences shared among groups; 8C compare characteristics of Classification is always a work in progress. taxonomic groups, including archaea, bacteria, , fungi, plants, and animals The tree of life is a model that shows the most current understanding of how living things are related. Some new discoveries confirm parts of the tree that were once based on similarities in form alone. But as figure 4.1 shows, new findings can also lead scientists to change how they classify certain organisms. • The two-kingdom system was accepted by biologists until 1866, when German proposed moving all single-celled organ- CONNECT TO isms to the kingdom Protista. Fungi • In 1938, American biologist Herbert Copeland argued that the Fungi are heterotrophs that feed deserved their own kingdom, called . Prokaryotes are single-celled by absorbing dead organic mate- organisms that do not have membrane-bound nuclei or organelles. rials from the environment. This • In 1959, American ecologist Robert Whittaker proposed that because of is one characteristic that distin- guishes fungi from plants, which how they feed, fungi should be placed into their own kingdom apart from are autotrophs, or organisms that plants. The kingdom Fungi includes molds and mushrooms. make their own food. You will • In 1977, rRNA research by Carl Woese revealed two genetically different learn more about fungi in the chapter Protists and Fungi. groups of prokaryotes. His findings led scientists to split the kingdom Monera into two kingdoms, called Bacteria and Archaea.

Figure 4.1 History of the kingdom system 1753 Two kingdoms 1866 Three kingdoms 1938 Four kingdoms 1959 Five kingdoms 1977 Six kingdoms

Plantae Plantae Plantae Plantae Plantae Animalia Animalia Animalia Animalia Animalia Protista Protista Protista Protista

Monera Monera Archaea Fungi Fungi Bacteria

Chapter 17: The Tree of Life 519 DO NOT EDIT--Changes must be made through “File info” CorrectionKey=A

Woese’s discovery did more than split the kingdom Monera. The two groups of prokaryotes that he studied have very different cell wall chemistry. In terms of genes, these two groups are more different from each other than animals are from plants, fungi, and protists. Based on these differences, Woese proposed that all life be divided into three domains. These domains are above the kingdom level. Analyze Why did Woese propose classifying bacteria and archaea into separate domains, rather than just separate kingdoms? 8B

MAIN IDEA 8B, 8C The three domains in the tree of life are Bacteria, Archaea, and Eukarya. Most biologists now accept Woese’s domain system. This system more clearly shows the great diversity of prokaryotes in the tree of life by dividing them into two domains. These domains are called Bacteria and Archaea. All eukary- otes are placed into a third domain, called Eukarya.

R E AD i n g TOO LB ox Bacteria The domain Bacteria includes single-celled prokaryotes in the kingdom TAKING NOTES Bacteria. The domain Bacteria is one of the largest groups of organisms on Use a three-column chart to take notes about the three Earth. In fact, there are more bacteria in your mouth than there are people domains and six kingdoms in the that have ever lived! Bacteria can be classified by many traits, such as their modern classification of life. shape, their need for oxygen, and whether they cause disease.

Domain Kingdoms Characteristics Name Included Archaea Like bacteria, organisms in the domain Archaea (ahr-KEE-uh) are single-celled prokaryotes. However, the cell walls of archaea and bacteria are chemically differ- ent. Archaea, like those in figure 4.2, are known for their ability to live in extreme environments, such as deep sea vents, hot geysers, Antarctic waters, and salt lakes. All archaea are classified in the kingdom Archaea. Eukarya The domain Eukarya (yoo-kar-ee-uh) is FIGURE 4.2 This archaean made up of all organisms with eukaryotic species, Pyrococcus furiosus, can cells. Eukaryotic cells have a distinct be found in undersea hot vents and in the sand surrounding sulfurous HMDScience.com nucleus and membrane-bound organelles. volcanoes. These organisms live GO ONLINE Eukarya may be single-celled, such as most without oxygen and can grow in temperatures higher than the Using a Key to Classify protists. They can also be colonial, such as some , or multicellular, like you. The boiling point of water. (colored SEM; magnification 6500) domain Eukarya includes the kingdoms Protista, Plantae, Fungi, and Animalia. ©Eye of Science/Photo Inc. Researchers,

520 Unit 6: Classification and Diversity DO NOT EDIT--Changes must be made through “File info” CorrectionKey=A

FIGURE 4.3 tree of Life The most recent classification system divides life into three domains, which include six kingdoms. Kingdom: Domain: Bacteria Domain: Archaea Domain: Eukarya Plantae Kingdom: Kingdom: Protista Fungi Kingdom: Archaea Kingdom: Kingdom: Bacteria Animalia Web

HMDScience.com

GO ONLINE Classify a Sea Cucumber

Scientists constructed this evolutionary tree by comparing rRNA CONNECT TO sequences from species in each of the six recognized kingdoms. Kingdoms and Phyla The distances between branches are proportional to the number See Appendix A for a detailed of differences in rRNA sequences among these species. description of each kingdom and Source: C. Woese, PNAS 97:15. its phyla.

Classifying Bacteria and Archaea Some scientists think that bacteria and archaea have no true species. This is because many of these organisms transfer genes among themselves outside of typical . This sharing of genes blurs the lines between “species” as we define them in the Linnaean system. One study found that almost a quarter of the genes in the bacterium maritima are similar to archaean genes. Our understanding of how to classify prokaryotes is just beginning. Analyze Why are protists, plants, fungi, and animals classified into the same domain but into different kingdoms? 8C

Self-check Online HMDScience.com 17.4 Formative Assessment GO ONLINE Reviewing Main Ideas Critical thinking CONNECT TO 1. Why is the classification of life 3. Apply If you come across an unusual History of Life considered a work in progress? single-celled organism, what parts of 5. The Archaea lineage may 8A the cell would you study in order to include the first life on Earth, 2. What kingdoms are included in each classify it into one of the three which began under much of the three domains in the modern domains? 8B, 8C different environmental tree of life? 4. Analyze Why is it difficult, using the conditions from those traditional definition of species, to present today. What charac- classify some bacteria and archaea at teristics of archaea help to the species level? 8B, 8C support this statement? 8C

Chapter 17: The Tree of Life 521 CorrectionKey=A DO NOT EDIT--Changes mustbemadethrough “File info” Unit 522

CHAPTER about Use Main Idea Web 17.2 17.1 17 Key Con Key G N I D A E R

t 6:

phylogeny cla by by gr ary diverg to rela Modern two-part binomial tem most with syst structura based sific The based O Rela Classification Based onEvolutionary

Classification andDiversity he Linnae am rganisms

dograms. clade group which identifying

tionships. rel

em ation

Linnae

is

se

cal tionships specific c

ed

ationships S on on a

ven epts is

led species.

classification l

nomencla from

species

ummary scientific group a species shared physic chara Glyptodon

an can

nested tax a cladogram

cladogr

sy Cla an System ofClassification le

which a, a

a x o b l o o T be cteristics. s vel

stem

al main

common

or Species can physic

org distics based in

classified similarities.

hierar

ture, in name

le the anisms

be

am. derived

vels. of this idea

derived is

al

on

is group pres which clas-

chy based

are Cladogr

using

This or sy

a ancest The

web

the

common

s- node

ented named

chara character

being

gives

order on Latin to or. ams

SPECIES: Canis lupis GENUS: Canis gray wolf Common name:

evolutionary take cters in

Sy These

ac ea

roo anal

Armadillo in a method are cording

n

ch

branching notes which

th ts. are

yzed. construct

species

ev esi

shared olution-

z used they to

e

Y

dia- a ou

ed rela and B ig

r tionships. omy Summarize Concept Map

No genetic I dea

t

using es 17.4 17.3 use

chara

a kingdoms The measure DNA for time. molecular common two rat Molecular Eukarya between ­prokaryo respectiv all kingdoms. cellul domains species history. enc Domains andKingdoms Molecular Clocks

conc include

T e org cteristics,

es these ree oflife

current for species O

ar Bacteria pro They

scientific anisms ept between rganisms

names

le will Muta a includes

vide tes, ev are

ely.

vel.

these

ancest species. group

map. Pro

are clocks The

clocks can

olution

be

tree

are

based

Bac but which

in Within tions tista, important two

Archaea

Bac at

then

group the what

any can or, separ of

teria

al the of

by

the

provide Ribos

ty teria

l

Fungi, tend

rel on

at

the

Bac org re life other

be

linking pes

measur these

genetic

you s and ated ated molecul veal

differ

fundamenta

are anisms

teria

classified more because and omal has

Eukarya

to

of

Plant

know

archa

two

clues their gre

aft domains species.

ac ent

molecul molecul

three e Archa and

and

RNA differ cumulate er

ater the ar ae,

with kingdoms.

ea

time

about ev

to diver le Archa

based cel

and domains.

ea ra

vel. are olutionary than

and l

ent evolutionary

The

eukaryo te ar ar differ are

lular sc domains

ging

unicel Animali

Biologists clocks, dat

ea of tax ales.

the mitochondri

the

at a long on

differ ev kingdoms, ences to

The a on- a from

two

to physical tic The differ- tal olution lular const er

a.

used include domain

re

ences cel of that

at a

al use

ant ls— six

the

to

al

(bl) ©The Natural History Museum; (bc) ©Pontier, John/Animals Animals - Earth Scenes CorrectionKey=A DO NOT EDIT--Changes mustbemadethrough “File info”

CHAPTER 17 G N I D A E R Write

Answer: taxon taxonomy, what iseach level ofclassification called?” taxonomy, taxon, thequestioncould be“InLinnaean that uses thesecond term astheanswer. For thepair terms below. Thenwrite aquestionaboutthefirstterm Think abouttherelationship between each pairof is called ataxon.” write “InLinnaean taxonomy, each level ofclassification example, for theterms taxonomy and taxon, you could to explain clearly how theterms are connected. For For each group ofwords below, write asentence ortwo V R 17.1 vo Chapter 6. 4. 2. 5. ocabulary Connections 3. 7. 1. eviewing

molecular cl Bact how thismeaning relates to Archaea. arkhaio, whichmeans “ancient” or“primitive.” Explain The prefix ar cladogr binomial nomenclature, genus, species this meaning relates to cladogram. meaning “ Klados isGreek for “branch,” and-gram isasuffix phylogeny, cladistics

genus binomial nomenclature taxon taxonomy Y our eria, Archaea, Eukarya Review am, derived characters X O B L O O T O something writtenordrawn.” Explain how wn Questions c V ock, mitochondrial ribosomalock, RNA DNA, abu chaeo- comes from theGreek word ocabulary lary Word Word and Greek O ri g L ins 17.3 17.2 ati n

ribosomal RNA mitochondri molecular clock derived character cladogram cla phylogeny distics al DNA

R

16. 14. 12. 15. 10. 13. 17. 11. 8. 9. eviewing Review Games•ConceptMapSectionSelf-Checks online Go

exposed limitations inLinnaean taxonomy? isms at themolecular level. How hasthistechnology Current technol around theworld? names whenreporting theirresearch to other biologists mutations? Explain. expect thissequence to have accumulated sixmore taxonomy, from themost general to themost specific. f Why isitimportant genus dohumansbel The scientific namefor. What humansisHomosapiens evolution ofspeciesfrom different kingdoms? would provide abettermolecular clock for studyingthe than inmitochondri Mutations accumulate more slowly inribosomal RNA tions ov A particular DNAsequence accumulated three muta- species share? evidence outweigh physical similarities that the as previously Why should themolecular thought. conclude that these speciesare not asclosely related hav Two specieswithsimilar are found to of org What basicidea doescladistics use to classify groups Name thesev this change suggest aboutthenature ofclassification? kingdoms. Biologists now use sixkingdoms. What does from oneano What distinguishesthe three domainsinthetree oflife The original Linnae e key differences at themolecular level. Scientists anisms? HMDScience.com Interact 3F, 8A er 10,000years. After how muchtimewould you

17.4 M ther? en levels oforganization inLinnaean AIN

ogy allowsogy scientists to examine organ- Archa Bacteria Eukarya i an system ofclassification had two ve Review al DNA. Whichofthese moleculesal DNA.

or biologists to include scientific IDEAS ong to? 8B 7A ea 8A 8C 7F Chapter 17: The Tree of Life Chapter 17: 8B 7F 7A

523 DO NOT EDIT--Changes must be made through “File info” CorrectionKey=A

Critical Thinking 18. Apply Are species in the same family more or less Analyzing Data Transform Data closely related than species in the same class? Explain The family Ursidae contains all bear species. The data 8B your answer. below show the number of species in each of the five 19. Evaluate Scientists have used mtDNA as a molecular genera of this family. Use these data to answer the next clock to trace and early migration three questions. routes. Explain why mtDNA would be more useful in this research than rRNA. 7A, 7F genera of the family ursidae Genus Names Number of Species 20. Apply Refer to the cladogram in Figure 2.2 of Section 2. Are crocodiles and alligators more closely related to Ailuropoda 1 snakes or to birds? Explain your answer using the terms common ancestor and derived characters. 7A, 8B Helarctos 1 21. Compare and Contrast What types of evidence are Melursus 1 used for classifying organisms in the Linnaean classifica- Tremarctos 1 tion system? What types of evidence are used for classifying organisms based on evolutionary relation- Ursus 4 ships? 7A, 8C Source: University of Michigan Museum of 22. Evaluate What is the significance of grouping the six kingdoms into three domains? How does the domain 26. Analyze How many species belong to family Ursidae? model more clearly represent the diversity of prokary- otes than a system with the six kingdoms as its broadest 27. Transform Data Transform the number of species in divisions? 8B, 8C each genus to a percent of the total number of bear species in family Ursidae. Interpreting Visuals 28. Analyze What do the transformed data show that raw Use the cladogram, which classifies species A, B, C, and data do not show? D, to answer the next three questions.

A B C D Making Connections 4 29. Write a Letter Imagine that you are a modern‑day molecular biologist. Write a letter to Linnaeus explaining 3 how advances in technology have affected the way that scientists classify living organisms. Describe the parts of 2 his classification system that are still used in the same way today. Also describe the aspects of his system that 1 have changed over the years. 3f 30. Compare and Contrast The pangolin on the chapter opener shares many physical traits, such as a long snout, 23. Apply What represents the derived characters that with anteaters and . However, these traits are were used to construct this cladogram? known to have evolved separately in each of these groups of species. Write a paragraph that compares how 24. Analyze Where are the nodes in this cladogram, and Linnaeus and a modern taxonomist would likely classify what do they represent? pangolins. Include in your paragraph the kinds of addi- tional information that a modern taxonomist might look 25. Analyze How many clades are represented in this for in order to classify the pangolin. 3F, 8A cladogram?

524 Unit 6: Classification and Diversity Biology End-of-Course Exam Practice

Record your answers on a separate piece of paper. 4A, 8B MULTIPLE CHOICE 5 Mammals are multicellular organisms with about 3 billion base pairs in their genome. Yeasts are 8A single-celled organisms with about 13 million 1 Taxonomy can best be defined as a — base pairs in their genome. Both of these groups are classified as eukaryotes because they — A standardized means of referring to organisms using a two-part Latin name A have over one million base pairs B means of grouping organisms based solely B can reproduce sexually upon cell structure C utilize aerobic respiration C hierarchal grouping of organisms based upon D have a similar basic cellular structure differences among them THINK THROUGH THE QUESTION D branching classification system based on the shared characteristics of organisms Do not get confused by extra information provided in this question. Focus on the definition of eukary- otes. The number of base pairs is not ­relevant to this 2C, 8A, 8b question. 2 In the past 150 years, the classification of life has changed through the addition and restructuring of kingdoms and domains. This system is always changing because — 6B, 6E, 7f 6 A genetic research provides more accurate data B scientific theories never change ginger a t g c g c c g a t c c t t a c g t c g a a t c g g a a c C change evolutionary relationships corn acgcaccgatacttacgtcgattcgggac D humans increase the rate of orchid acgcgccgatacttacgtcgaatcgggac lily acgcgccgatacttccgtcgaatctggac 7a, 8B 3 Birds and snakes share a common ancestor from The DNA sequences above show a conserved, or over 250 million years ago, but now they show essentially unchanged, gene among four related many physical differences. These differences are plants. The highlighted parts are most directly the most directly the result of — result of — A between species A crossing over B molecular clocks ticking at different rates B C the long-term accumulation of mutations C mutation D differences in the alleles of the ancestor D meiosis

6E, 7A 4 Scientists notice very few differences in the DNA sequences of individual . This indicates that modern cheetahs likely descended from only a few individuals because — A smaller populations have less B genetically different individuals are less fit C the mutation rate depends on population size D mutations do not affect small populations

Chapter 17: The Tree of Life 525