Journal of Materials Chemistry B
View Article Online PAPER View Journal
rGO quantum dots/ZnO hybrid nanofibers fabricated using electrospun polymer templates Cite this: DOI: 10.1039/c4tb02134g and applications in drug screening involving an intracellular H2O2 sensor†
Chi Yang,*a Ling-wei Hu,b Hong-Yan Zhu,a Yong Ling,a Jin-Hua Taoa and Chun-Xiang Xu*c
Throughout the years, reported intracellular H2O2 sensors just focused on unrelated measurements of 2+ intracellular H2O2 generated from the stimulus of Cd , ascorbic acid (AA) etc., leading to difficulty in data interpretation. Here, a novel reduced graphene oxide quantum dots (rGO QDs)/ZnO hybrid
nanofibers-based electrochemical biosensor for the detection of intracellular H2O2 released from cancer and normal cells under the stimuli of the corresponding anticancer drugs permits a quantitative study of the interaction between the target drug compound and the cancer cell, which is suitable for candidate drug screening. Nylon 6/6 nanofibers are used as robust templates for the facile fabrication of novel rGO QDs/ZnO hybrid nanofibers via electrospinning followed by a step hydrothermal growth method. The
as-made sensor was applied to determine H2O2 released from a prostate cancer cell (PC-3) versus a noncancerous cell (BPH-1) under the stimuli of the corresponding anticancer drugs (apigenin, antisense
CK2a etc.). The amount of H2O2 released from the PC-3 cancer cell is about (320 12) amol per cell Received 26th December 2014 and about (210 6) amol per cell for the BPH-1 noncancerous cell under the stimuli of specific therapy Accepted 3rd February 2015 drug antisense CK2a. These results demonstrate that the rGO QDs/ZnO hybrid nanofibers-based DOI: 10.1039/c4tb02134g electrochemical biosensor can efficiently detect the distinct amounts of H2O2 released from cancer and www.rsc.org/MaterialsB noncancer cells.
Introduction catalytic performance. For instance, the hybridization of phos- photungstic acid (PWA) and ZnO NFs through electrospinning technology leads to excellent electrocatalytic activity toward the Published on 03 February 2015. Downloaded by The University of Melbourne Libraries 06/03/2015 12:04:46. Recently, ZnO nano bers (ZnO NFs) have attracted extensive 5 interests in different research elds because of their excellent oxidation of dopamine at a low potential. And some metal or properties, repeatable and controllable fabrication processes.1 metal oxide particles can either decorate the surface of the ZnO Most notably, ZnO nanobers-based sensors possess high NFs or be encapsulated within the interior of the ZnO NFs to 6,7 sensitivities, low limits of detection, fast electron transfer enhance catalytical activity. Besides these attractive features, kinetics, and they have been widely used for the detection of hybridizing graphene sheets with ZnO NFs to yield a large molecules, such as glucose, CO, ethanol, etc.2–4 The analytical number of friction sites onto the ZnO surfaces is proven to be an performances of these sensors depend on the electrochemical efficient method to regulate the structural and electronic activity and biocompatibility of ZnO NFs, which are strongly properties of the ZnO NFs. In principle, the zero dimensional affected by their surface hybrid components. Several strategies, nanomaterials of graphene oxide quantum dots (rGO QDs) with including electrospinning technology, the hydrothermal route, more superior performance should be more favorable for and the spray pyrolysis method of hybridization, have been sensing. Considering these interesting properties, we employ developed for fabricating the hybrid ZnO NFs to impart desir- polymer nanobers as templates to fabricate novel hybrid able properties, such as enhanced sensing capabilities and nanobers of rGO QDs/ZnO via an electrospinning technique and a hydrothermal process by one step and investigate the sensing performance of the resulted sample towards hydrogen aDepartment of Pharmacy, Nantong University, Nantong 226001, China. E-mail: [email protected]; Tel: +86-513-85051728 peroxide (H2O2). 8 bShangqiu Medical College, Shangqiu 476100, Henan, China As is distributed in most of the mammalian cells, H2O2 cState Key Laboratory of Bioelectronics, Southeast University, Nanjing 210096, China. participates in the signal transduction processes in a concen- E-mail: [email protected]; Tel: +86-25-83790755 tration dependent manner.9 At low concentrations, it serves as a † Electronic supplementary information (ESI) available. See DOI: second messenger in cellular signal transduction and plays an 10.1039/c4tb02134g
This journal is © The Royal Society of Chemistry 2015 J. Mater. Chem. B View Article Online Journal of Materials Chemistry B Paper
important role in protecting the living body.10–12 Whereas at a cancer cells as compared to the normal ones. Therefore, high concentration, it can damage major cellular constituents comparing to the tedium of animal models of drug screening, and harm living organisms, causing a number of pathological this work has demonstrated a simple and effective sensing 13–16 events ranging from aging, neurodegeneration, to cancer. platform for detection of dynamic release of H2O2 from cells, Therefore, the quantitative determination of intracellular H2O2 which has potential utility to drug screen. is of great value in elaborating its regulation of signal trans- duction pathways and searching for new therapeutic strategies Results and discussion for cancer and other diseases. Recently, enzyme-based electro- chemical biosensors for the quantitative detection of intracel- Electrospinning is a simple and convenient method for fabri- lular H2O2 have received considerable attention due to their cating 1D nanomaterials, especially for nanobers, which is great advantages which include high sensitivity and selectivity, easy in geometric control, diverse in composition, and has a low rapid response, easy miniaturization and good quantitative cost.27 The terminal diameter of the whipping jet is therefore 17–20 ability. The main shortcoming is that enzymes would not controlled by the ow rate, the electric current, and the surface maintain their activity under the detection conditions because tension of the complex uid. Recently, Sigmund et al.28 gave the of their intrinsic nature. Whereas, those which were capable of relations between the nanober diameter and the process-gov- measuring H2O2 with extremely high stability used nano- erning variables as below: materials including precious metal nanoparticles,21,22 carbon 2 23,24 25,26 I pEKd c nanomaterials, and metal compound nanostructures, 3pg ¼ 2pd3 2ln pffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffi 3 (1) Q d3 I pEKd2 which would solve the problems of the low long-term opera- 2 tional stability. However, so far the reported intracellular H2O2 where 3 is the dielectric permittivity of air, g as the surface sensors just focused on the unrelated measurements of the tension, Q as liquid jet ow rate, I as the total current directed 2+ intracellular H2O2 generated from the stimulus of Cd , ascor- toward the lower electrode, K as the electric conductivity, c as a bic acid (AA) etc. which were added in the detection system by constant and d as the jet diameter. Based on the above theory, researchers, leading to difficulty in data interpretation. Thus, it the terminal jet radius d can be adjusted by the corresponding is necessary and reasonable to explore a quantitative detection parameters. In addition, the aligned bers could be controlled of the intracellular H2O2 released from cancer and normal cells by the applied electrical eld during the electrospinning under the straightforward stimuli of the corresponding anti- process.29 cancer drugs permitting a quantitative study of the interaction By comprehensively considering the parameters mentioned between the target drug compound and the cancer cell, which before, we xed the nylon 6/6 concentration at 20 wt% and the may be suitable for candidate drug screening. applied voltage at 15 kV accordingly (other data not shown in Herein, the novel hybrid nanobers of rGO QDs/ZnO with the paper). Fig. 1a reveals the SEM images of electrospun nylon random or quasi-aligned bres were prepared using polymer 6/6 nanobers with average diameters of 168 nm. The electro- nanobers as templates via an electrospinning technique and a spun nanobers have uniform diameters, smooth surfaces, and hydrothermal process by one step. The experimental procedure are randomly oriented on the indium tin oxide (ITO) glass is shown in Scheme 1. The obtained hybrid nanobers exhibit slides. The density of the nanober networks can be controlled high electrocatalytic activity towards H2O2 and achieve highly Published on 03 February 2015. Downloaded by The University of Melbourne Libraries 06/03/2015 12:04:46. sensitive detection of H2O2 at the nanomolar level, which are ascribed to their large surface area as well as their synergistic effect. Moreover, the as-made sensor can also be used to
monitor intracellular H2O2 by quantitative electrochemical measurements. By studying the effects of the stimulator loading
(anticancer drug), distinct H2O2 generation is site-detected in
Fig. 1 (a) SEM micrographs of as-spun Nylon 6/6 fibers (left, nonaligned; right, quasi-aligned); (b) the rGO QDs/ZnO hybrid NFs Scheme 1 (a) Illustration of the synthetic route of rGO QDs/ZnO (insert with the high magnification); (c) tilted view image of a broken hybrid nanofibers and (b) fabrication of the cell-based intracellular part of a Nylon 6/6 fiber coated with rGO QDs/ZnO hybrid composite
H2O2 sensors. overlayer; (d) high resolution of rGO QDs/ZnO hybrid NFs.
J. Mater. Chem. B This journal is © The Royal Society of Chemistry 2015 View Article Online Paper Journal of Materials Chemistry B
by varying the electrospinning duration. In order to align the bers in parallel to each other along some axis, two stripes of aluminum wires were placed along opposite edges of the substrate and connected to the ground terminal of the power supply that applied the electrical eld between the jet and the substrate during the electrospinning process. This imposed a directional distribution of the electrical eld ux lines between the jet and the aluminum wires, as depicted in Fig. 1a, facili- tating alignment of segments of the bers across the aluminum Fig. 2 (a) XRD patterns of rGO QDs/ZnO hybrid NFs; (b) Raman wires.30 The difference between the nonaligned and quasi- spectra of rGO QDs/ZnO hybrid NFs. aligned nylon 6/6 bers is clearly observed in the scanning electron microscopy (SEM) micrographs in Fig. 1a (le and right simultaneously, indicating that the rGO QDs/ZnO hybrid NFs graphs, respectively). have been successfully synthesized from GO QDs and zinc Following the electrospinning process, nylon 6/6 nanobers acetate dihydrate powder. The existence of the rGO QDs on the were coated with ZnO nanoparticles as seeds (Fig. S1†) by a dip- ZnO nanostructure is conrmed by the exhibition of a broad coating technique.22 Subsequently, the nylon 6/6 nanobers intense G(002) diffraction peak at 2q ¼ 26.1 . The XRD analysis covered with ZnO seeds were immersed into a aqueous solution further showed that the main diffraction peaks of the rGO QDs/ of an equimolar mixture of zinc acetate dihydrate (Zn(CH - 3 ZnO composite were similar to that of pure ZnO and corre- COO) $2H O, 0.025 M), hexamethylene tetramine (C H N , 2 2 6 12 4 sponded to wurtzite-structured ZnO (JPCDS 36-1451), which 0.025 M) and graphene oxide quantum dots (GO QDs, 1mg indicated that the presence of graphene did not result in the mL 1, an optimum amount of content,31 see Fig. S2†). The development of new crystal orientations or changes in prefer- hydrothermal process was conducted at 90 C for 6 h. Aer this ential orientations of ZnO. No typical diffraction peaks of reaction, rGO QDs/ZnO hybrid nanostructures were grown carbon species were observed, which was attributed to the low successfully on the electrospun nylon 6/6 nanobers that amount of graphene in the composite.34 penetrate the ber network and cover the entire length of the The major Raman features as seen from the Raman spectra nanobers (Fig. 1b). On the basis of previous work by others,32 a of these rGO QDs/ZnO hybrid NFs in Fig. 2b are the D band at possible mechanism for the formation of rGO QDs/hybrid NFs around 1345 cm 1 as a breathing mode of k-point phonons of may contain the following process. Firstly, due to the electro- A1g symmetry, which is assigned to the local defects and static attraction, the GO QDs were adsorbed on the surface of 2+ disorder, especially at the edges of graphene, and the G band at ZnO seeds. Meanwhile, a part of Zn ions were adsorbed on the 1 2+ around 1591 cm , which is usually assigned to the E2g phonon surface of GO to form coagulation. Then, the Zn ions were 2 35,36 of C sp atoms. However, the intensity ratio of the D and G converted rst to Zn(OH) 2 and then to ZnO (eqn (2) and (3)). 4 bands (I /I ) of the hybrids was much higher than that of oxide During the process, the GO QDs were also reduced to rGO QDs. D G graphene (see Fig. S2b†), attributed to interactions between the 37 Zn2+ + 4OH / Zn(OH) 2 (2) ZnO nanostructure and the reduced oxide graphene. The 4 1 38 hybrid bers also show the 2E2(M) mode of ZnO at 326 cm . 2 Published on 03 February 2015. Downloaded by The University of Melbourne Libraries 06/03/2015 12:04:46. Zn(OH)4 / ZnO + H2O + 2OH (3) Moreover, in agreement with the earlier literature the Raman spectrum of rGO QDs shows two new bands, 2D band at 2762 The diameter of the rGO QDs/ZnO hybrid NFs is about 800 cm 1 and the D + G band at 2933 cm 1, showing the graphiti- nm (Fig. 1b), much larger than the diameter of nylon 6/6 zation of the carbon framework.39,40 nanobers (168 nm) due to the attachment of rGO QDs/ZnO We evaluated the electrocatalytic activity of the rGO QDs/ZnO hybrid nanostructures. From the high-magnication image hybrid NFs (in our experiments, we select the nonaligned bers) (Fig. 1b, inserted), it can be seen that the nylon 6/6 nano bers modied ITO electrode toward reduction of H2O2 in 0.1 M PBS
were capped with brush-like nanostructures uniformly. To our (pH ¼ 7.2) with the protection of N2. Fig. 3 shows the cyclic surprise, SEM images showed that the nylon 6/6 bers template voltammetric (CV) responses of the (a) rGO QDs/ZnO hybrid was not scratched off and removed during the proposed NFs/ITO, (b) ITO, (c) ZnO NFs/ITO, and (d) rGO QDs/ITO elec- hydrothermal process (Fig. 1c). Lattice images obtained at even trodes in the absence (black line) and presence of 0.2 mM (red higher magni cations displayed lattice fringes that can be line) H2O2 in the N2-saturated 0.1 M PBS solution (pH 7.2). In identi ed with crystallographic planes of the ZnO and rGO QDs the absence of H2O2, no reduction peaks were observed at (b) structure.33 For instance, lattice fringes having interplanar bare ITO, (c) ZnO NFs/ITO, and (d) the rGO QDs/ITO electrode. spacings of 0.246 nm and 0.26 nm, corresponding to rGO Similarly, in the presence of H2O2, there is no obvious reduction QD (100) planes and ZnO (002), respectively, are highlighted in peaks generated on (b) bare ITO and (c) ZnO NFs/ITO elec- Fig. 1d. The high-resolution TEM (HRTEM) image also suggests trodes, except only a weak reduction peak of H2O2 at 0.28 V that rGO QDs did not enwrap ZnO nanobers completely. was observed on the (d) rGO QDs/ITO electrode. In contrast, (a) The X-ray diffraction (XRD) pattern obtained from electro- rGO QDs/ZnO hybrid NFs/ITO displayed a pair of small oxida- spun rGO QDs/ZnO hybrid NFs is presented in Fig. 2a. Bragg tive and reductive peaks in the potential range of 0.6–0.3 V in
peaks corresponding to ZnO and rGO QDs are observed the absence of H2O2 and a remarkable reduction peak in the
This journal is © The Royal Society of Chemistry 2015 J. Mater. Chem. B View Article Online Journal of Materials Chemistry B Paper
Fig. 3 Voltammetric responses of the rGO QDs/ZnO hybrid NFs/ITO
(a), ITO (b), ZnO NFs/ITO (c), and rGO QDs/ITO electrodes (d) in N2- saturated PBS (0.1 M, pH 7.2) with (red curve) and without (black curve) Fig. 4 (a) Chronoamperograms obtained at the rGO QDs/ZnO hybrid 1 NFs/ITO in the (a) absence and presence of (b) 5, (c) 70, (d) 120, (e) 250, 0.2 mMH2O2. Scan rate was 100 mV s . and (f) 350 nM of H2O2, first and second potential steps were 0.6 and 1/2 0.3 V vs. SCE, respectively. Left: dependence of IC/IL on t derived presence of H O from 0.6 to 0.3 V. These results suggest that from the data of chronoamperogams of (a) and (f) in the main panel. (b) 2 2 Amperometric i–t response at rGO QDs/ZnO hybrid NFs upon the rGO QDs/ZnO hybrid NFs electrode possesses efficient successive additions of 1–22 mMH2O2 into continuously stirred N2 electrocatalytic activity toward the reduction of H2O2, which saturated 0.1 M PBS (pH 7.2). Applied potential: 0.4 V. The inset vs. provides an approach for detecting H2O2 at the low reduction (below) is the plot of response current [H2O2]. (c) The typical potential. Chronoamperometry could be used for the evaluation selectivity profile of the present biosensor obtained at different applied versus of the catalytic rate constant (index of electrocatalytic activity) potentials: 0.3, 0.35, 0.4 V SCE (derived from the data of Fig. S3).† (d) ROS selectivity obtained at 0.4 V versus SCE. with the help of the following equation:41 I expð lÞ C ¼ 0:5 p0:5 0:5 þ l erf l 0:5 (4) think that ZnO may be a candidate for electrochemical reduc- IL l tion of H2O2 and inferred the following reaction: where IC and IL are the currents in the presence and absence of 2 H2O2, respectively, l ¼ KcatCt is the argument of the error Oi /Oi +H2O2 / O2(g) + H2O+e /2e (6)
function, Kcat is the catalytic rate constant, and t is elapsed time. In the case where l > 1.5, erf(l1/2) is almost equal to unity, the Secondly, it can be attributed to the high density of edge-plane- above equation can be reduced to: like defective sites on graphene, which might provide many active 46–49 sites for electron transfer and reduce H2O2 (eqn (7)). IC : : 0:5 : Published on 03 February 2015. Downloaded by The University of Melbourne Libraries 06/03/2015 12:04:46. 0 5 0 5 0 5 ¼ l p ¼ðKcatCtÞ p (5) IL rGO-(C–OH)n +H2O2 / O2(g) + H2O + rGO (7)
50 1/2 The structures of ZnO graphene-like made it easy for the From the slope of the plot: IC/IL versus t , as shown in formation of the rGO QDs/ZnO hybrid composite, leading to Fig. 4a, the mean value of Kcat for H2O2 oxidation was calcu- ff lated to be 2.1 107 cm3 mol 1 s 1. This value is higher than synergistic e ects of the rGO QDs and ZnO. Other plausible that obtained at the graphene/poly(3,4-ethyl- reason for the enhanced catalytic activity can be ascribed to the enedioxythiophene)/iron hexacyanoferrate electrode (4.0 106 oxygen-containing groups in ZnO nano bers providing large cm3 mol 1 s 1)42 but less than that obtained at the cubic nickel amounts of anchoring sites for the deposition of rGO QDs hexacyanoferrate/polyaniline/carbon nanotubes/platinum during the synthesis of the rGO QDs/ZnO composite and control electrode (1.29 108 cm3 mol 1 s 1).43 The results showed that the rGO QDs without aggregation. The well-dispersed rGO QDs on the surface of ZnO render more accessible surfaces of rGO the catalytic rate of H2O2 on the rGO QDs/ZnO hybrid NFs electrode is fast.44 QDs over the bulk ones for the H2O2 reduction, leading to their The high electrocatalytic activity of the rGO QDs/ZnO higher electrochemical activity. composite may arise from the following aspects. Firstly, the Fig. 4b shows the typical steady state amperometric response of the rGO QDs/ZnO hybrid NFs electrode with the successive study of the adsorption of a H2O2 molecule on the ZnO and O- vacancy defected ZnO showed that the zinc atoms of the defect addition of H2O2 into the stirred N2 saturated 0.1 M PBS at 0.4 45 V (from the CV electrocatalysis and selectivity test). Aer the are more reactive toward H2O2 reduction to H2O. During the addition of H O , this sensor could achieve the steady-state adsorption process, H2O2 was reoriented in such a way that its O 2 2 atom diffused into vacancy sites, so that O/O and O/H bonds of current within 3 s, which indicated fast response time. The corresponding calibration curve for the H O sensor is shown in the molecule were dissociated and H2O was formed. Thus, we 2 2
J. Mater. Chem. B This journal is © The Royal Society of Chemistry 2015 View Article Online Paper Journal of Materials Chemistry B
the inset of Fig. 4b. The response displays a good linear range from 1 to 22.48 mM with a correlation coefficient of 0.997 and a slope of (6.49 + 0.15) mA mM 1. Therefore, the sensitivity is calculated to be 101.46 mA mM 1 cm 2 (see inset of Fig. 4b). The detection limit is estimated to be ca. (0.025 0.001) mM (at a signal/noise of 3), which is much lower than those reported previously.22 These results indicate that the rGO QDs/ZnO hybrid NFs electrode is a good platform for the detection of H O and can be used to detect the physiological levels of H O . 2 2 2 2 Fig. 5 (a) Amperometric responses of the rGO QDs/ZnO hybrid NFs/ Therefore, the tests of reproducibility and storage stability are ITO electrode for the reduction of H2O2 released from BPH-1 cells very important. The relative standard deviation (RSD) of its without (a) and with (b) the addition of 0.2 mM TBB. (b) The time course m current response for the addition of 0.2 MH2O2 was 5.5% for 8 of H2O2 released from the BPH-1 cells induced by (a) 0.5, (b) 0.4, (c) m successive measurements, which suggested good precision (see 0.1, (d) 0.3, and (e) 0.2 M TBB. Fig. S3a†). The electrode-to-electrode reproducibility was also m ff estimated from the response to 0.2 MH2O2 at six di erent potential of 0.4 V (Fig. 5a). When 0.2 mMTBBwasintroduced electrodes. The RSD of 5.8% was obtained, indicating accept- into the solution, the current increased sharply to a peak able fabrication reproducibility (data not shown). In order to value, indicative of the release of H2O2 from the cells aer investigate the stability of the sensor, the current response to being treated with TBB. Aer a stable response is reached, m 0.2 MofH2O2 was monitored periodically. The results 1 injecting 300 U mL catalase, a selective scavenger of H2O2, demonstrated that the variation of the response current at the into the solution, the response of H2O2 at the electrode rGO QDs/ZnO hybrid NFs electrode decreased to about 95% of disappears (Fig. 5a) since the releasing H2O2 was scavenged † its initial response current on the h day (see Fig. S3b ), by catalase, demonstrating that the addition of TBB may indicating the excellent stability of the sensor. The loss of the induce the release of H2O2 from the BPH-1 cells and cannot response current may be ascribed to the adsorption of species 51 lead to the release of other ROS or RNS. In the control on the surface of the electrode. Adsorption of the species could experiment, upon the addition of TBB in the cell-free detec- block contact of the rGO QDs/ZnO hybrid NFs electrode surface tion solution, no obvious signal was observed (Fig. S5†), with H2O2 and the electron transfer between the electrode and further suggesting that H2O2 was generated from cells by the solution, decreasing the reduction of H2O2. stimulation of TBB. A maximum current of ca. 15 nA is Meanwhile, the selectivity of the rGO QDs/ZnO hybrid NFs obtained at ca. 23 s aer injection of TBB. This current for the detection of H2O2 was also evaluated. Fig. 4c shows most corresponds to the H O amount of (10.45 0.1) nmol, which ff 2 2 commonly existing interference under di erent applied poten- was calculated based on the calibration curve depicted in the tials. At the negative potential, e.g. 0.3 V, the present H2O2 insetofFig.4b.Therefore,themeanux of H2O2 releasing biosensor was free from anodic interferences like 1 mM ascor- from the cells is evaluated to be (690 7) amol per cell. These bic acid (AA), 1 mM uric acid (UA), 1 mM dopamine (DA), and 1 results suggest that the developed biosensor could be useful m mM glucose, but 8% of cathodic response current from 4 MO2 in determination of cellular H O . The cells exposed to TBB at m 2 2 was observed relative to 2 MH2O2. On the other hand, at the
Published on 03 February 2015. Downloaded by The University of Melbourne Libraries 06/03/2015 12:04:46. concentrations ranging from 0.1 to 0.5 mM were studied more negative potential, e.g. 0.35 V, 3% of anodic current of 1 (Fig. 5b). The corresponding ux of H2O2 is shown in Fig. 6a, mM DA was obtained relative to 2 mMH2O2, indicating that the theamountofH2O2 in the BPH-1 cell is signicantly AA interferes with the response of the sensor to H2O2. Fortu- increased with the enhancement of the TBB concentration, nately, at this lower potential of 0.4 V, the oxidation of DA did and it reaches the highest value (ca. 691 8 amol per cell) at a not occur at rGO QDs/ZnO hybrid NFs. Importantly, the TBB concentration of 0.2 mM, aer that, the concentration of reduction peak currents of H2O2 had no change in the presence H O generated by the cells decreases with the enhancement 2 2 and absence of O2. Therefore, for ful lling both the selectivity of the TBB loading. This may be because an extra high and sensitivity of the present biosensor, low-potential was concentration of H2O2 induced by the high loading of TBB can selected as the working potential. In addition, the selectivity of damage the lipid membrane of the cells and even cause cell the present H2O2 over reactive oxygen species (ROS) was also death (the image of the cells on the ITO surface is depicted in examined. As demonstrated in Fig. 4d, negligible interferences 52 Scheme 1b). And this result leads to the decrease in the were observed for other typical ROS including O2c , ClO , NO, amount of released H2O2. Therefore, a concentration of 0.2 HNO. These results convincingly indicated that the present rGO mM for TBB is applied in subsequent treatment of cells. In QDs/ZnO hybrid NFs electrode showed high selectivity for addition, the amount of H2O2 generated in BPH-1 cells is also typical ROS, O2, and other biological species at the low-potential affected by the time of TBB treatment. Fig. 6b depicts the time detection. course experimental results with TBB loading at a constant The proposed sensor was applied to perform real-time concentration of 0.2 mM for TBB. The value of H2O2 in BPH-1 detection of endogenous generation of H2O2 in the BPH-1 cellsissignicantly increased aer treatment with 0.2 mM cells induced by 4,5,6,7-tetrabromobenzotriazole (TBB). TBB. The concentration of H2O2 increases with the increase of Without the stimulation of TBB, BPH-1 cells did not generate the induction time and the highest value is attained at the any measurable signal at the electrode under the applied
This journal is © The Royal Society of Chemistry 2015 J. Mater. Chem. B View Article Online Journal of Materials Chemistry B Paper
Conclusions
In summary, rGO QDs/ZnO hybrid NFs were synthesized by the combination of a simple electrospinning and thermal treat- ment processes. The rGO QDs are well dispersed on the surface of ZnO nanobers. Such rGO QDs/ZnO hybrid NFs exhibited high electroactive surface area and high electrocatalytic activity
toward the reduction of H2O2. The fabricated sensor based on rGO QDs/ZnO hybrid NFs possesses high sensitivity and selec- tivity against other ROS, oxygen, and other biological species, as well as broad linear range and low detection limit with satis- factory stability and repeatability. Accordingly, the present biosensor has been successfully applied in determination of
H2O2 released from living cells. Meanwhile, the proposed
Fig. 6 (a) Dependence of the amount of H2O2 generated in BPH-1 sensor was evaluated for H2O2 released from prostate cancer cells on the concentration of TBB at a fixed treatment time of 60 min, cells and noncancerous cells under the stimuli of the corre- fi m and (b) on the treatment time at a xed TBB concentration of 0.2 M. sponding anticancer drugs and the results demonstrated that (c) Comparison of intracellular H2O2 production in prostatic cancer and nontumorigenic cells in response to therapy drug. the sensor could be applied in drug screening. In this way, the proposed device is a promising tool for further drug studies dealing with living cells. time of 60 min. Aerwards the concentration decreases gradually and reaches a relatively stable value (ca. 518 10 amol per cell) at 5 h. These results demonstrate that low Experimental section concentration of H2O2 in living cells can indeed be success- fully detected by the developed electrode, which represents a Indium tin oxide (ITO)-coated glass plates with a square resis- new biosensing platform for a reliable collection of kinetic tance of 10 U cm 2 were purchased from Nanbo Display
information of cellular H2O2 release and could be potentially Technology Co. Ltd. (Shenzhen, China). 4,5,6,7-Tetra- useful for oxidative stress biosensors in the study of down- bromobenzotriazole (TBB) and uric acid (UA) were purchased stream biological effects of various stimuli in physiology and from Alfa Aesar. Apigenin, dopamine (DA) and catalase were pathology. obtained from Sigma-Aldrich. Ascorbic acid (AA, $99.0%), 30% As we know, relatively speci c chemical drug apigenin and hydrogen peroxide (H2O2) and glucose were obtained from TBB, much more specic biological agent, CK2a (casein kinase Aladdin Chemistry Co. Ltd. catalase (E.C. 1.11.1.6, from bovine 2a) are the anticancer drugs for therapy against prostate cancer. liver, lyophilized powder, 2000–5000 U mg 1, Sigma). PC-3 was Here, we selected apigenin, TBB, and antisense CK2a as the maintained in RPMI 1640 (Sigma-Aldrich) supplemented with 1 stimuli and three kinds of cells (Prostatic cancer PC-3 cells, 7% fetal bovine serum (FBS) and 2 mmol L L-glutamine and nontumorigenic prostate BPH-1 cells, and noncancerous cell grown in standard T-75 asks. Chinese hamster ovary (CHO) Published on 03 February 2015. Downloaded by The University of Melbourne Libraries 06/03/2015 12:04:46. line Chinese hamster ovary (CHO)) as model cells. The devel- cell line was purchased from Sigma-Aldrich and maintained in
oped electrode can be also used for measuring the ux of H2O2 Ham's F12 supplemented with 2 mM glutamine and 10% FBS. releasing from the cells induced by a variety of stimuli such as BPH-1 cell line (benign prostate epithelial cells, Shanghai Gene apigenin, TBB, and antisense CK2a, which were reported to Core Bio. Technologies Co., Ltd) was maintained in Dulbecco's 1 induce the generation of H2O2 in cells. The amount of H2O2 Modied Eagle's Medium (DME H-21 4.5 g L glucose) sup- generated in the cells and the ux of H2O2 from the cells are plemented with 10% FBS. The sequence for the antisense CK2a signicantly dependent on the stimuli. PC-3 cells, BPH-1 cells, oligonucleotide employed in the experiments was 50- and CHO cells were equally responsive to treatment with api- CCTGCTTGGCACGGGTCCCGA CAT-30, which was obtained
genin or TBB as indicated by the intracellular H2O2 production. from Shanghai Gene Core Bio. Technologies Co., Ltd. All the However, treatment of these cells with antisense CK2a oligo- reagents were of analytical grade and used as received. All the nucleotide showed a distinctly differential response in cancer aqueous solutions were prepared with Milli-Q water (18.2 MU 1 versus noncancer cells, such that although the H2O2 production cm ). Except the interference test of O2 (under O2 saturated was comparable in cancer (PC-3) and noncancer (BPH-1 and solution), all the experiments were deaerated with high purity
CHO) cells in response to apigenin or TBB it was minimal in nitrogen before experiments. Solutions of H2O2 were freshly noncancer cells treated with antisense CK2a oligonucleotide diluted from the 30% solution, and their concentrations were a (Fig. 6c). This could be ascribed to the antisense CK2 oligo- determined using a standard KMnO4 solution. All electro- nucleotide being more effective in down-regulation of CK2a and chemical experiments were carried out at room temperature. 53–55 c results in induction of intracellular H2O2. These results In the selectivity test, superoxide anion (O2 ) was derived a m demonstrated that the antisense CK2 is more speci cto from dissolved KO2 (10 M) in the DMSO solution. Hypochlorite prostate cancer, which is in agreement with the reported anion (ClO ) was provided by NaClO (10 mM).48 Nitric oxide (NO) results.56 and nitroxyl (HNO) were derived from the solution of S-nitroso-
J. Mater. Chem. B This journal is © The Royal Society of Chemistry 2015 View Article Online Paper Journal of Materials Chemistry B
N-acetyl-DL-penicillamine (10 mM) and Angeli's salt (10 mM), supplemented with 10% FBS and incubated at 37 Cina 57,58 – respectively. humidi ed incubator (5% CO2 95% air). At the logarithmic 1 Commercial nylon 6/6 (Mw 262.35 g mol , Sigma Aldrich) growth phase, the cells were then washed three times with PBS was used as the polymer in the present study. Formic acid and (0.1 M, pH 7.2) and the cell number was estimated (1.5 104 acetic acid were used as-received. 20-wt% nylon 6/6 was dis- cell per mL), and 80 mL PBS (0.1 M, pH 7.2) was added for the solved in 4 : 1 formic acid/acetic acid solvents. This solution electrochemical experiments. Before measurements, the buffer was stirred for 3 h at room temperature and loaded into a 10 mL was deoxygenated by gently shaking the cells under a humidi- plastic syringe tted with metallic needles of 0.5 mm of inner ed nitrogen stream. Aer a steady state background was diameter. Then the syringes were xed horizontally on the attained, 20 mL TBB (0.2 mM) was injected into buffer and syringe pump (model SP 101IZ, WPI). The solution was response current corresponding to the electrocatalytic reduc-
continuously fed through the nozzle using a syringe pump tion of H2O2 releasing from the cells was recorded under the (model SP 101IZ, WPI) at a rate of 0.5 mL h 1. High voltage (15 physiological pH and temperature (pH 7.2 and 37 C). The
kV) was applied between the needle and the grounded collector effects of TBB concentration on the release of H2O2 from the 18 cm below it. As a result, a continuous stream was ejected cells were also evaluated. Various concentrations of TBB from the nozzle as a long ber and collected on the substrates. (ranging from 0.1 to 0.5 mM) were injected into the buffer to
ITO glass slides (1 cm 1 cm) were used as substrates in induce the generation of H2O2 in the cells, and the ux of H2O2 specimens for microstructural characterizations and used for from the cells was measured using the developed electrode. For biosensing measurements. To obtain uniaxial alignment of the control experiments, 0.2 mM TBB was added into a PBS buffer bers, two stripes of aluminum wires (diameter ¼ 0.5 mm) were without BPH-1 cells. To study the stimulus type-dependent
placed right next to the ITO edges as shown in Fig. 1b. The characteristics of H2O2 releasing from the BPH-1 cells, Anti- distribution of the electrical eld ux lines between the needle sense CK2a, and apigenin were added into the buffer, respec- and the aluminum wires led to uniaxial alignment of the elec- tively, with each concentration of 0.2 mM. The release process
trospun bers perpendicular to the wires. The electrospinning and the release ux of H2O2 were monitored by recording the processes were carried out at 25 C and 30% relative humidity in change of the reduction current of H2O2 at the electrode with an enclosed box. Aer being vacuum dried for 24 h, the bers time. Similarly, PC-3 or CHO (1.5 104 cells) were treated with were used for further analysis. Antisense CK2a, apigenin or TBB (0.2 mM) and monitored by The electrospun nanobers (collected on the ITO) were rst amperometric measurements. dip-coated with the ZnO seed solution (0.1 M, see ESI†) for 10 The morphology, uniformity and microstructure evolution of min, rinsed with ethanol, heat treated at 90 C for 1 h, and then the bers were investigated aer each processing step by using a dried in air for 24 h. rGO QDs/ZnO hybrid NFs were grown on scanning electron microscope (FE-SEM, S-7400, Hitachi, Japan). nylon 6/6 nanobers using hydrothermal treatment of as- A transmission electron microscope (TEM, JEOL JEM 2010) was prepared electrospun nylon 6/6. Prepared aqueous solutions of used for the detailed morphological investigation of the rGO
zinc acetate dihydrate (Zn(CH3COO)2$2H2O, 0.025 M) and hex- QDs/ZnO hybrid NFs. X-ray diffraction (XRD) data of rGO QDs/ ¼ – amethylene tetramine (C6H12N4, 0.025 M) were mixed and ZnO hybrid NFs were collected within the range of 2q 10 55 stirred for 0.5 h and also added reduced graphene oxide by using a Rigaku D/max-2500 diffractometer with Cu Ka radi- quantum dots (1 mg mL 1, see ESI†). The as-prepared electro- ation, operating at a voltage of 45 kV and a current of 40 mA. Published on 03 February 2015. Downloaded by The University of Melbourne Libraries 06/03/2015 12:04:46. spun mat (2 cm 2 cm) with this mixture was then taken into a Raman scattering of the hybrid nanostructures were collected Teon crucible and kept inside the autoclave. This autoclave on a Ranishaw inVia Raman microscope with an excitation laser was kept at 90 C for 5 h. The obtained mat aer cooling was of 514 nm. Additionally, all the voltammetric and amperometric washed several times with distilled water and dried in air. By a measurements were carried out with a CHI 660E (Chenhua similar procedure, the rGO QDs/ITO and ZnO NFs/ITO were also Shanghai) electrochemical analyzer. Cell apoptosis was fabricated, and their electrocatalytic characteristics were measured by acridine orange (100 mgmL 1)/ethidium bromide compared with those of the rGO QDs/ZnO hybrid NFs/ITO. (100 mgmL1) staining and examined with confocal laser The fabrication process is schematically shown in Scheme scanning uorescence microscopy (Nikon 300, USA). 1b. A piece of punched adhesive tape with a hole (diameter: 4 mm) was attached onto the ITO substrate surface, which is modied by the rGO QDs/ZnO hybrid NFs and prepared as the Author contributions working electrode. Then the H O suspension in pH 7.2 PBS 2 2 All authors have given approval to the nal version of the with the volume of 8 mL was dropped on the hole. Then a piece manuscript. of lter paper which is 6 mm long and 6 mm wide was covered on the hole. Aer that a calomel electrode (SCE) wire and a Pt wire were integrated with the ITO glass (working electrode, WE) Acknowledgements to form the electrochemical detection system. And last the three electrode detection device was integrated in a PDMS cover. This work was supported by NSFC (Grants 61404075, 81302628,
The release ux of H2O2 from cells was measured with the 81102743, 81202467, and 61475035) and (no BK20130394), a use of the rGO QDs/ZnO hybrid NFs electrode. Typically, pros- project funded by the Priority Academic Program Development tate cancer cells BPH-1 were maintained in RPMI-1640 of Jiangsu Higher Education Institutions, NSFC (Grant
This journal is © The Royal Society of Chemistry 2015 J. Mater. Chem. B View Article Online Journal of Materials Chemistry B Paper
81102327) and the Open Research Fund of State Key Laboratory 28 W. Sigmund, J. Yuh, H. Park, V. Maneeratana, G. Pyrgiotakis, of Bioelectronics, Southeast University. A. Daga, J. Taylor and J. C. Nino, J. Am. Ceram. Soc., 2006, 89, 395–407. 29 S. H. Choi, G. Ankonina, D. Y. Youn, S. GeunOh, J. M. Hong, References A. Rothschild and I. D. Kim, ACS Nano, 2009, 3, 2623–2631. 30 D. Li, Y. Wang and Y. Xia, Nano Lett., 2003, 3, 1167–1171. 1 A. Staniak, B. Boratynski, A. Baranowska-Korczyc, K. Fronc, 31 K. Anand, O. Singh, M. P. Singh, J. Kaur and R. C. Singh, D. Elbaum and M. Tłaczała, J. Am. Ceram. Soc., 2014, 97, Sens. Actuators, B, 2014, 195, 409–415. 1157–1163. 32 R. S. Dey and C. A. RetnaRaj, RSC Adv., 2013, 3, 25858–25864. 2 M. Ahmad, C. f. Pan, Z. X. Luo and J. Zhu, J. Phys. Chem. C, 33 Z. Y. Yin, S. X. Wu, X. Z. Zhou, X. Huang, Q. C. Zhang, F. Boey 2010, 114, 9308–9313. and H. Zhang, Small, 2010, 6, 307–312. 3 A. Katoch, G. J. Sun, S. W. Choi, J. H. Byun and S. S. Kim, 34 D. I. Son, B. W. Kwon, H. H. Kim, D. H. B. Angadi and Sens. Actuators, B, 2013, 185, 411–416. W. K. Choi, Carbon, 2013, 59, 289–295. 4 Z. Y. Zhang, X. H. Li, C. H. Wang, L. M. Wei, Y. C. Liu and 35 Z. S. Wu, W. C. Ren, L. B. Gao, J. P. Zhao, Z. P. Chen, B. L. Liu, C. L. Shao, J. Phys. Chem. C, 2009, 113, 19397–19403. D. M. Tang, B. Yu, C. B. Jiang and H. M. Cheng, ACS Nano, 5 J. P. Wu and F. Yin, Sens. Actuators, B, 2013, 185, 651–657. 2009, 3, 411–417. 6 S. W. Choi, A. Katoch, G. J. Sun and S. S. Kim, Sens. Actuators, 36 E. H. M. Ferreira, M. V. O. Moutinho, F. Stavale, B, 2013, 181, 787–794. M. M. Lucchese, R. B. Capaz, C. A. Achete and A. Jorio, 7 C. Y. Wang, S. Y. Ma, A. M. Sun, R. Qin, F. C. Yang, X. B. Li, Phys. Rev. B: Condens. Matter Mater. Phys., 2010, 82, F. M. Li and X. H. Yang, Sens. Actuators, B, 2014, 193, 326– 125429–125437. 333. 37 D. Y. Fu, G. Y. Han, Y. Z. Chang and J. H. Dong, Mater. Chem. 8 C. Amatore, S. Arbault, M. Guille and F. Lemaitre, Chem. Rev., Phys., 2012, 132, 673–681. 2008, 108, 2585–2621. 38 D. Y. Pan, J. C. Zhang, Z. Li and M. H. Wu, Adv. Mater., 2010, 9 T. Finkel, FEBS Lett., 2000, 476,52–54. 22, 734–738. 10 S. G. Rhee, Science, 2006, 312, 1882–1883. 39 I. K. Moon, J. Lee, R. S. Ruoff and H. Lee, Nat. Commun., 11 T. Finkel, Curr. Opin. Cell Biol., 2003, 15, 247–254. 2010, 1,73–78. 12 J. R. Stone and S. Yang, Antioxid. Redox Signaling, 2006, 8, 40 H. Wang, J. T. Robinson, X. Li and H. Dai, J. Am. Chem. Soc., 243–270. 2009, 131, 9910–9911. 13 W. Droge¨ and H. M. Schipper, Aging Cell, 2007, 6, 361–370. 41 A. J. Bard and L. R. Faulkner, Electrochemical Methods, 14 S. DiMauro and E. A. Schon, Annu. Rev. Neurosci., 2008, 31, Fundamentals and Applications, John Wiley & Sons, Inc., 91–123. New York, 2001, ch. 12, p. 471. 15 T. Finkel, M. Serrano and M. A. Blasco, Nature, 2007, 448, 42 G. M. C. J. Jos´e, M. M. F. Grasyelle, G. O. Fernanda, 767–774. S. D. Flavio and C. S. L. Rita de, J. Electroanal. Chem., 2014, 16 D. J. Rossi, C. H. M. Jamieson and I. L. Weissman, Cell, 2008, 732,93–100. 132, 681–696. 43 Z. D. Wang, S. B. Sun, X. G. Hao, X. L. Ma, G. Q. Guan, 17 J. Zhou, C. A. Liao, L. M. Zhang, Q. G. Wang and Y. Tian, Z. L. Zhang and S. B. Liu, Sens. Actuators, B, 2012, 171–172, Published on 03 February 2015. Downloaded by The University of Melbourne Libraries 06/03/2015 12:04:46. Anal. Chem., 2014, 86, 4395–4401. 1073–1080. 18 S. H. Kim, B. Kim, V. K. Yadavalli and M. V. Pishko, Anal. 44 R. Ojani, J. B. Raoof and P. Salmany-Afagh, J. Electroanal. Chem., 2005, 77, 6828–6833. Chem., 2004, 571,1–8. 19 Y. P. Luo, H. Q. Liu, Q. Rui and Y. Tian, Anal. Chem., 2009, 81, 45 J. Wang, M. Xu, R. Zhao and G. A. Chen, Analyst, 2010, 135, 3035–3041. 1992–1996. 20 P. Wu, Z. W. Cai, J. Chen, H. Zhang and C. X. Cai, Biosens. 46 C. E. Banks, T. J. Davies, G. G. Wildgoose and R. G. Compton, Bioelectron., 2011, 26, 4012–4017. Chem. Commun., 2005, 7, 829–841. 21 Z. H. Wen, S. Q. Ci and J. H. Li, J. Phys. Chem. B, 2009, 113, 47 C. E. Banks, R. R. Moore, T. J. Davies and R. G. Compton, 13482–13487. Chem. Commun., 2004, 16, 1804–1805. 22 C. M. Yu, Z. K. Zhu, Q. H. Wang, W. Gu, N. Bao and H. Y. Gu, 48 C. E. Banks and R. G. Compton, Analyst, 2005, 130, 123–127. Chem. Commun., 2014, 50, 7329–7331. 49 Y. Huang and S. F. Y. Li, J. Electroanal. Chem., 2013, 690,8– 23 H. C. Chang, X. M. Wang, K. K. Shiu, Y. L. Zhu, J. L. Wang, 12. Q. W. Li, B. A. Chen and H. Jiang, Biosens. Bioelectron., 50 B. Kaewruksa and V. Ruangpornvisuti, J. Mol. Model., 2012, 2013, 41, 789–794. 18, 1447–1454. 24 F. N. Xi, D. J. Zhao, X. W. Wang and P. Chen, Electrochem. 51 C. Chen, W. Cai, M. Long, B. Zhou, Y. Wu, D. Wu and Commun., 2013, 26,81–84. Y. Feng, ACS Nano, 2010, 4, 6425–6432. 25 J. Bai and X. Jiang, Anal. Chem., 2013, 85, 8095–8101. 52 E. Orzechowska, E. Kozłowska, K. Staron´ and J. Trzcinska-´ 26 T. Y. Wang, H. C. Zhu, J. Q. Zhuo, Z. W. Zhu, Danielewicz, Oncol. Rep., 2012, 27, 281–285. P. Papakonstantinou, G. Lubarsky, J. Lin and M. X. Li, 53 J. L. Hirpara, M. V. Clement and S. Pervaiz, J. Biol. Chem., Anal. Chem., 2013, 85, 10289–10295. 2001, 276, 514. 27 Y. Dzenis, Science, 2004, 304, 1917–1919.
J. Mater. Chem. B This journal is © The Royal Society of Chemistry 2015 View Article Online Paper Journal of Materials Chemistry B
54 K. A. Ahmad, K. Iskandar, M. V. Clement, M. V. Clement and 58 S. B. Solomon, L. Bellacia, D. Sweeney, B. Piknova, S. Pervaiz, Cancer Res., 2004, 64, 7867–7878. A. Perlegas, C. C. Helms, G. A. Ferreyra, S. B. N. King, 55 T. W. Poh and S. Pervaiz, Cancer Res., 2005, 65, 6264–6274. J. H. Raat, S. J. Kern, J. Sun, L. C. McPhail, A. N. Schechter, 56 K. A. Ahmad, G. X. Wang and K. Ahmed, Mol. Cancer Res., C. Natanson, M. T. Gladwin and D. B. Kim-Shapiro, Free 2006, 4, 331–338. Radical Biol. Med., 2012, 53, 2229–2239. 57 R. J. Singh, N. Hogg, J. Joseph and B. Kalyanaraman, J. Biol. Chem., 1996, 271, 18596–18603. Published on 03 February 2015. Downloaded by The University of Melbourne Libraries 06/03/2015 12:04:46.
This journal is © The Royal Society of Chemistry 2015 J. Mater. Chem. B