DOCSLIB.ORG

Adenylate Kinase Intron 5: a New Nuclear Locus for Avian Systematics

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Adenylate Kinase Intron 5: a New Nuclear Locus for Avian Systematics 248 ShortCommunications [Auk, Vol. 118 WAGNER,R. H. 1992.Confidence of paternity and pa- WETTON, J. H., R. E. CARTER, D. T. PARKIN, AND D. rental effort in Razorbills. Auk 109:556-562. WALTERS.1987. Demographicstudy of a wild WESTNEAT,D. E 1990.Genetic parentage in the In- HouseSparrow population by DNA fingerprint- digo Bunting: A study using DNA fingerprint- ing. Nature 327:147-149. ing. BehavioralEcology and Sociobiology 27:67- WITTENBERGER,J. L., AND R. L. TILSON.1980. The 76. evolution of monogamy:Hypotheses and evi- WESTNEAT,D. F., AND P. W. SHERMAN.1997. Density dence.Annual Reviewsof Ecologyand System- atics 11:197-232. and extrapairfertilizations in birds: A compar- ative analysis.Behavioral Ecology and Sociobi- Received21 October1999, accepted12 September2000. ology 41:205-215. Associate Editor: F. Sheldon The Auk 118(1):248-255, 2001 Adenylate Kinase Intron 5: A New Nuclear Locusfor Avian Systematics LEO H. SHAPIRO• AND JOHN P. DUMBACHER MolecularGenetics Lab, National Zoological Park, 3001 ConnecticutAvenue NW, Washington,D.C. 20008, USA The explosionof use of the polymerasechain re- than nuclearprotein coding regions, they can nev- action (PCR) and direct DNA sequencingin recent erthelessevolve significantly more slowly than pro- yearshas provideda wealth of new data for avian tein codingmtDNA, and might thereforebe espe- systematists.Nearly all thesesequence data, how- ciallyhelpful in resolvingnodes at depthsfor which ever, have comefrom mitochondrialgenes, which the signal from mtDNA is diminished due to are inheritedas a singleunit, typicallyexhibit strict- saturation. ly matrilinealinheritance, and have other unusual Despitetheir potentialutility, nuclear genes have properties(Avise 1991). Although mitochondrial so far been little used in sequence-basedavian sys- DNA (mtDNA) has well-establishedadvantages for tematics.This is in large part becauseof a lack of ap- phylogeneticinference (Moore 1995), avian molecu- propriatePCR primers that workwell acrossa broad lar systematistsare eager to identify nuclear genes spectrumof aviangroups and that amplifysequenc- that could provide independentphylogenetic esti- es evolvingat rates suitablefor addressinga range mates(e.g. Prychitko and Moore 1997, Omland 1999). of phylogeneticquestions. In the courseof a phylo- Most nuclearloci exploredto date are slowly evolv- geneticinvestigation of the pitohuis(J. Dumbacher ing proteincoding genes and havebeen useful pri- unpubl.data), we exploredthe usefulnessof a nu- marilyfor resolvingdeep relationships (e.g. relation- cleargene not previouslyemployed for phylogenetic shipsamong taxa with divergencetimes more than analysis.In thisnote, we reportprimers we havede- 50 Ma ago; Graybeal 1994, but see Lovette and Ber- signedto amplify this new nuclearmarker, intron 5 mingham2000). It would clearlybe helpful to have of the nucleargene cytosolic adenylate kinase (AK1), at our disposalnuclear DNA sequencesthat exhibit and we documentboth the potentialphylogenetic a fasterrate of evolution,making them phylogenet- utility of this intron and the very broad taxonomic icallyuseful at intermediateand shallowtaxonomic utility of theseprimers. levels(e.g. Palumbi 1996, Prychitko and Moore 1997). Methods.--PCRprimers located in the conserved Nuclearintrons, for example,which have recently re- exon regionsflanking AK1 intron 5 (in exon5 and ceived attentionfor their potential utility in popu- exon 6) were designedby comparingcomplete AK1 lation-level studies (e.g. Friesen et al. 1997, Hesle- DNA sequencespublished for Gallus(Suminami et wood et al. 1998), may also be very useful for al. 1988) and humans (Matsuura et al. 1989), as well inferringphylogenetic relationships among species. asamino acid sequences for severalother taxa. Prim- Althoughthese introns typically evolve more quickly er sequencesand positionsare givenin Table1. The other known membersof the well-studiedAK gene • PresentAddress: Division of InsectBiology, ESPM, family differ in sequenceso substantiallyfrom AK1, 201 Wellman Hall, 3112, University of California, includingthe regionsof primer annealing,that we Berkeley,CA 94720-3112,USA. E-mail: lshapiro@ are confidentthe primersreported here will amplify nature.berkeley.edu only AK1 (barringa recentgene duplication within January2001] ShortCommunications 249 TABLE1. Primersfor amplifying AK1 intron 5 from birds. AK5a* and AK5b+ are locatedin exon5 and the remainingthree primersare locatedin exon6. "Nucleotideposition" refers to the positionof the primer in the publishedGallus AK1 sequence(Suminami et al. 1988).Primers AK5a •, AK6d-, and AK6e- were notused to collectany of the datareported in thispaper, but preliminarystudies suggest that these primers work well in at least some taxa, so we have included them here. Primer name Primer sequence(5' to 3') Nucleotide position AK5a* ATGCTGCGGGACGCCATGTTGG 4769to 4790 AK5b • ATTGACGGCTACCCTCGCGAGGTG 4820to 4843 AK6c CACCCGCCCGCTGGTCTCTCC 5454to 5474 AK6d- GTTCGGTAGCCTTGTAGTACGTCTCC 5507to 5532 AK6e- CCTTGTAGAAGGCGATGACGGGTTC 5529 to 5553 lineages).To investigatethe taxonomicbreadth for min)-72øC (5 min). Our PCR reaction mix contained which thoseprimers are useful,we usedthe primer magnesium chloride (1.5 mM), primers (0.4 p•M pair AK5b+ and AK6c- to amplify and sequenceap- each), dNTPs (0.2 mM each) and 1 U Perkin Elmer proximately 500 to 650 base pairs (bp) of AK1 from AmpliTaq Gold DNA polymerase(for a 25 p•Lreac- representativesof 10 avian familiesin 7 orders.This tion) with the suppliedbuffer. PCR productswere amplification product includes intron 5 (ranging in cleanedusing QIAGEN QIAquick PCR Purification lengthfrom about350 to 500 bp amongthe taxawe Kits and cyclesequenced in bothdirections using an sampled)and 99 bp of flanking exon (27 bp at the 5' ABI PRISM cycle sequencingkit. Sequencedprod- end and 72 bp at the 3' end, excludingprimers). ucts were cleaned using Princeton Separations DNA was extractedusing standardphenol-chlo- CentriSep columns and run out on an ABI 373 au- roform extractions (Hillis et al. 1996) or using QIA- tomated sequencer. GEN DNeasy TissueKits. DNA amplificationof AK1 For purposesof comparison,we amplifiedboth intron 5 was carried out in an MJ ResearchPTC-200 AK1 intron 5 (using AK5b+ and AK6c-, as well as thermalcycler using the followingprogram: 94øC (10 several additional primers designed specificallyto min)--35 cyclesof 92øC (45 s), ramp of 1.5øC/s to pachycephalids)and the well-studiedmitochondrial 54øC,54øC (1 rain), ramp of 1.5øC/s to 72øC,72øC (1 genecytochrome-b from 17 individualsrepresenting TABLE2. The 7 avian ordersand 10 familiesfrom which we haveamplified and sequencedAK1 intron 5 from one or more speciesto demonstratetaxonomic breadth of primers.Orders and familiesfollow Gill (1995);scientific and English species names follow the 7th editionof the Checklistof North AmericanBirds (AOU 1998)for speciesoccurring in North or Middle America,and Monroe and Sibley (1993) for all others. The 12 speciesused for the phylogeneticcomponent of this studyare indicatedby asterisks. Order Family Species(partial list) Sphenisciformes Spheniscidae GalapagosPenguin (Spheniscusmendiculus) Ciconiiformes Threskiornithidae Glossy Ibis (Plegadisfalcinellus) Falconiformes Accipitridae Rough-leggedHawk (Buteolagopus) Falconidae Aplomado Falcon(Falco femoralis) Gruiformes Rallidae White-wingedCoot (Fulicaleucoptera) CommonMoorhen (Gallinula chloropus) Virginia Rail (Railuslimicola) Buff-spottedFlufftail (Sarothrura elegans) Psittaciformes Psittacidae Grey Parrot (Psittacuserithacus) Caprimulgiformes Aegothelidae FelineOwlet-nightjar (Aegotheles insignis) Passeriformes Pachycephalidae Little Shrike-thrush(Colluricincla megarhyncha)* GoldenWhistler (Pachycephalapectoralis)* RegentWhistler (Pachycephalaschlegelii)* Sclater'sWhistler (Pachycephalasoror)* Hooded Pitohui (Pitohuidichrous)* VariablePitohui (Pitohuikirhocephalus)* Mottled Whistler (Rhagologusleucostigma)* Paradisaeidae Magnificent Bird-of Paradise(Cicinnurus magnificus)* Greater Melampitta (Melampittagigantea)* Raggiana Bird-of-Paradise(Paradisaea raggiana)* Emberizidae Bronzed Cowbird (Molothrusaeneus)* Brown-headedCowbird (Molothrusater)* 250 ShortCommunications [Auk, Vol. 118 0.25- 35- ß T. 30- * TV 0.2- • 25- 0.15- ::3 ß ß 0.1- ioNß o o oo oL.. 15- 0.05- 10- o .1 0.15 0 0.;35 0' I 0.03 0.0• O. 0.•2 0.15 AK 1 intron5 (HKY distance) AK1 intron5 uncorrectedp-distance FIc. 1. Cytochrome-bpairwise distancesversus AK1 intron 5 pairwise distances.Note saturationof Fzc. 2. Transitions (T,) and transversions(Tv) ver- cytochrome-brelative to AK1. HKY-correcteddis- sus uncorrected pairwise p-distances (T• + Tv, tances(Hasegawa et al. 1985) were calculatedusing scaled)for AK1 intron 5. AK1 showsno indicationof PAUP* 4.0b4a (Swofford 1999). saturationeven at rather deep divergences.Substi- tutions were tallied and distancescalculated using PAUP* 4.0b4a (Swofford 1999). 7 speciesof Pachycephalidae,3 speciesof Paradi- saeidae,and (as an outgroup) 2 speciesof Emberi- zidae (Table2). For the analysespresented here we centlydiverged taxa, AK1 intron 5 exhibitsa substi- used, wherever possible,420-440 bp each of both tution rate severaltimes slowerthan cytochrome-b, AK1 intron5 and cytochrome-b,but a few sequences but this differenceis effectivelyreduced for deeper are shorterthan this.Sequences were easilyaligned divergencesas cytochrome-bsaturates relative to by eye (Appendix1). We calculatedgenetic distances AK1 (Fig 1). This saturationindicates the potential and generated maximum-parsimony trees using for
Load more

Recommended publications
  • Management and Breeding of Birds of Paradise (Family Paradisaeidae) at the Al Wabra Wildlife Preservation
    Management and breeding of Birds of Paradise (family Paradisaeidae) at the Al Wabra Wildlife Preservation. By Richard Switzer Bird Curator, Al Wabra Wildlife Preservation. Presentation for Aviary Congress Singapore, November 2008 Introduction to Birds of Paradise in the Wild Taxonomy The family Paradisaeidae is in the order Passeriformes. In the past decade since the publication of Frith and Beehler (1998), the taxonomy of the family Paradisaeidae has been re-evaluated considerably. Frith and Beehler (1998) listed 42 species in 17 genera. However, the monotypic genus Macgregoria (MacGregor’s Bird of Paradise) has been re-classified in the family Meliphagidae (Honeyeaters). Similarly, 3 species in 2 genera (Cnemophilus and Loboparadisea) – formerly described as the “Wide-gaped Birds of Paradise” – have been re-classified as members of the family Melanocharitidae (Berrypeckers and Longbills) (Cracraft and Feinstein 2000). Additionally the two genera of Sicklebills (Epimachus and Drepanornis) are now considered to be combined as the one genus Epimachus. These changes reduce the total number of genera in the family Paradisaeidae to 13. However, despite the elimination of the 4 species mentioned above, 3 species have been newly described – Berlepsch's Parotia (P. berlepschi), Eastern or Helen’s Parotia (P. helenae) and the Eastern or Growling Riflebird (P. intercedens). The Berlepsch’s Parotia was once considered to be a subspecies of the Carola's Parotia. It was previously known only from four female specimens, discovered in 1985. It was rediscovered during a Conservation International expedition in 2005 and was photographed for the first time. The Eastern Parotia, also known as Helena's Parotia, is sometimes considered to be a subspecies of Lawes's Parotia, but differs in the male’s frontal crest and the female's dorsal plumage colours.
    [Show full text]
  • West Papua – Birds-Of-Paradise and Endemics of the Arfaks and Waigeo
    INDONESIA: WEST PAPUA – BIRDS-OF-PARADISE AND ENDEMICS OF THE ARFAKS AND WAIGEO 03 – 14 AUGUST 2022 03 – 14 AUGUST 2023 Wilson’s Bird-of-paradise is often considered one of the best-looking birds in the world! www.birdingecotours.com [email protected] 2 | ITINERARY Indonesia: West Papua – Arfak and Waigeo New Guinea is a geographic rather than political term that refers to the main island in the region. The western half of the island of New Guinea comprises the Indonesian provinces of West Papua (Papua Barat) and Papua, collectively once called West Irian or Irian Jaya; the eastern half of the main island of New Guinea comprises the country of Papua New Guinea. We will be based in West Papua for this exhilarating, small-group birding adventure. Aside from the large landmass of New Guinea, the New Guinea region includes numerous small islands (some part of Indonesia and others part of Papua New Guinea), and we will visit one of these areas: Waigeo, part of the Raja Ampat Archipelago in West Papua (also known as the Northwestern Islands). Approximately 680 bird species have been recorded from West Papua, from slightly more than 700 for the whole New Guinea region. Some 550 species are considered breeding residents, with 279 New Guinea endemics (found in Indonesia and/or Papua New Guinea) and at least an additional 42 endemics found only in West Papua. There are also over 115 Palearctic and Australian migrant species and a range of seabirds which spend some of their time in West Papua. This tour will begin in the town of Manokwari, situated on the north-eastern tip of West Papua's Bird's Head (or Vogelkop) Peninsula where we could get our tour started with the gorgeous Lesser Bird-of-paradise, this area is usually great for Blyth’s Hornbill and numerous fruit doves.
    [Show full text]
  • Papua New Guinea Ii
    The Greater Bird-of-paradise display we witnessed at the km 17 lek in Kiunga was truly unforgettable. PAPUA NEW GUINEA II 12– 28 August / 1 September 2016 LEADER: DANI LOPEZ VELASCO Our second tour to Papua New Guinea – including New Britain - in 2016 was a great success and delivered an unprecedented number of high quality birds. A total of 21 species of Birds-of-paradise (BoPs), - undoubtedly one of the most extraordinary, and “out of this world” bird families in the world, were recorded, perhaps most memorable being a superb male Blue BoP, scoped at close range near Kumul for as long as we wished and showing one of the most vivid blue colours in the animal world. Just as impressive though were spectacular performances by displaying Raggiana and Greater BoPs in excellent light, with up to 8 males lekking at a time, a stunning male King BoP and two displaying males Twelve-wired BoPs at the Elevala River, a cracking adult male Magnificent BoP in the scope for hours at Tabubil, several amazing King-of-Saxony BoPs, waving their incredible head plumes like some strange insect antennae in the mossy forest of Tari Valley, great sightings of both Princess Stephanie´s and Ribbon-tailed Astrapias with their ridiculously long tail feathers, superb scope studies of Black and Brown Sicklebills uttering their machine-gun like calls, and so on. While Birds-of-paradise are certainly the signature family in PNG, there is of course 1 BirdQuest Tour Report: Papua New Guinea II www.birdquest-tours.com plenty more besides, for example we recorded a grand total of 33 species of pigeons and doves, -they reach their greatest diversity here in New Guinea, as do kingfishers-, including nine Fruit Doves, a rare New Guinea Bronzewing feeding on the road, and, during the extension, both Black Imperial Pigeon and Pied Cuckoo-Dove.
    [Show full text]
  • Engelsk Register
    Danske navne på alverdens FUGLE ENGELSK REGISTER 1 Bearbejdning af paginering og sortering af registret er foretaget ved hjælp af Microsoft Excel, hvor det har været nødvendigt at indlede sidehenvisningerne med et bogstav og eventuelt 0 for siderne 1 til 99. Tallet efter bindestregen giver artens rækkefølge på siden.
    [Show full text]
  • An Initial Estimate of Avian Ark Kinds
    Answers Research Journal 6 (2013):409–466. www.answersingenesis.org/arj/v6/avian-ark-kinds.pdf An Initial Estimate of Avian Ark Kinds Jean K. Lightner, Liberty University, 1971 University Blvd, Lynchburg, Virginia, 24515. Abstract Creationists recognize that animals were created according to their kinds, but there has been no comprehensive list of what those kinds are. As part of the Answers in Genesis Ark Encounter project, research was initiated in an attempt to more clearly identify and enumerate vertebrate kinds that were SUHVHQWRQWKH$UN,QWKLVSDSHUXVLQJPHWKRGVSUHYLRXVO\GHVFULEHGSXWDWLYHELUGNLQGVDUHLGHQWLÀHG 'XHWRWKHOLPLWHGLQIRUPDWLRQDYDLODEOHDQGWKHIDFWWKDWDYLDQWD[RQRPLFFODVVLÀFDWLRQVVKLIWWKLVVKRXOG be considered only a rough estimate. Keywords: Ark, kinds, created kinds, baraminology, birds Introduction As in mammals and amphibians, the state of avian $VSDUWRIWKH$UN(QFRXQWHUSURMHFW$QVZHUVLQ WD[RQRP\LVLQÁX['HVSLWHWKHLGHDORIQHDWO\QHVWHG Genesis initiated and funded research in an attempt hierarchies in taxonomy, it seems groups of birds to more clearly identify and enumerate the vertebrate are repeatedly “changing nests.” This is partially NLQGVWKDWZHUHSUHVHQWRQWKH$UN,QDQLQLWLDOSDSHU because where an animal is placed depends on which WKH FRQFHSW RI ELEOLFDO NLQGV ZDV GLVFXVVHG DQG D characteristics one chooses to consider. While many strategy to identify them was outlined (Lightner et al. had thought that molecular data would resolve these 6RPHRIWKHNH\SRLQWVDUHQRWHGEHORZ issues, in some cases it has exacerbated them. For this There is tremendous variety seen today in animal HVWLPDWHRIWKHDYLDQ$UNNLQGVWKHWD[RQRPLFVFKHPH OLIHDVFUHDWXUHVKDYHPXOWLSOLHGDQGÀOOHGWKHHDUWK presented online by the International Ornithologists’ since the Flood (Genesis 8:17). In order to identify 8QLRQ ,28 ZDVXVHG *LOODQG'RQVNHUD which modern species are related, being descendants 2012b and 2013). This list includes information on RI D VLQJOH NLQG LQWHUVSHFLÀF K\EULG GDWD LV XWLOL]HG extant and some recently extinct species.
    [Show full text]
  • Supplementary Information For
    Supplementary Information for Earth history and the passerine superradiation Oliveros, Carl H., Daniel J. Field, Daniel T. Ksepka, F. Keith Barker, Alexandre Aleixo, Michael J. Andersen, Per Alström, Brett W. Benz, Edward L. Braun, Michael J. Braun, Gustavo A. Bravo, Robb T. Brumfield, R. Terry Chesser, Santiago Claramunt, Joel Cracraft, Andrés M. Cuervo, Elizabeth P. Derryberry, Travis C. Glenn, Michael G. Harvey, Peter A. Hosner, Leo Joseph, Rebecca Kimball, Andrew L. Mack, Colin M. Miskelly, A. Townsend Peterson, Mark B. Robbins, Frederick H. Sheldon, Luís Fábio Silveira, Brian T. Smith, Noor D. White, Robert G. Moyle, Brant C. Faircloth Corresponding authors: Carl H. Oliveros, Email: [email protected] Brant C. Faircloth, Email: [email protected] This PDF file includes: Supplementary text Figs. S1 to S10 Table S1 to S3 References for SI reference citations Other supplementary materials for this manuscript include the following: Supplementary Files S1 to S3 1 www.pnas.org/cgi/doi/10.1073/pnas.1813206116 Supplementary Information Text Extended Materials and Methods Library preparation and sequencing. We extracted and purified DNA from fresh muscle tissue, liver tissue, or toepad clips from 113 vouchered museum specimens (Supplementary File S1) using the Qiagen DNeasy Blood and Tissue Kit following the manufacturer’s protocol. We quantified DNA extracts using a Qubit fluorometer, and we prepared aliquots of DNA extracted from muscle and liver at 10 ng/µL in 60 µL volume for shearing. We sheared each DNA sample to 400–600 bp using a Qsonica Q800R sonicator for 15–45 cycles, with each cycle running for 20 seconds on and 20 seconds off at 25% amplitude.
    [Show full text]
  • Birding Attenborough's Paradise: Papua New Guinea
    BIRDING ATTENBOROUGH’S PARADISE: PAPUA NEW GUINEA 31 AUGUST – 18 SEPTEMBER 2018 Raggiana Bird-of-paradise is one of our major targets on this trip. www.birdingecotours.com [email protected] 2 | ITINERARY Birding Attenborough’s Paradise: Papua New Guinea 2018 Papua New Guinea (PNG) is indeed a birder’s paradise. Thirty-four birds-of-paradise live on the island of New Guinea, of which thirty-one can be found in Papua New Guinea. The island of New Guinea is home to an incredible 399 endemics! Together with awe-inspiring scenery, endless rainforests, and fascinating highland societies that only made contact with the outside world in 1930, this makes Papua New Guinea a definite must-do destination for any avid birder. We start our adventure in the tropical savanna near Port Moresby. This area holds species restricted to northern Australia and PNG, such as the remarkable Papuan Frogmouth, Fawn-breasted Bowerbird, and the really rather spotty Spotted Whistling Duck. We then fly to the Mount Hagen Highlands, where we base ourselves at Kumul Lodge, the holy grail of PNG highlands birding. At Kumul's legendary feeding table Papua New Guinea spectaculars await us in the form of Ribbon-tailed Astrapia, Rufous-naped Whistler, Brehm's Tiger Parrot, Archbold's Bowerbird, Crested Satinbird, and many more. The area around Mount Hagen also holds a host of other birding gems, Brown Sicklebill, King of Saxony Bird-of-paradise, and Lesser Bird-of-paradise among them. Our next destination is the western lowlands around Kiunga, a port town on the Fly River in the Western Province of Papua New Guinea.
    [Show full text]
  • Report Summary
    REPORT SUMMARY Dripping mossy interior of lower montane forest near the top of Hides Ridge BACKGROUND AND AIMS The island of New Guinea has an exceptionally high biodiversity, and a large proportion of its fauna and flora is found nowhere else on Earth. Charismatic species such as birds-of-paradise, echidnas and tree kangaroos are widely known and often have great cultural significance for local communities in Papua New Guinea (PNG). Less well known is that the flora and smaller fauna of PNG are not only incredibly diverse but remain poorly documented, and numerous plants and animals that are new to science are being discovered every year. Studies conducted prior to Project development documented substantial biodiversity values in the Upstream Project Area of the Papua New Guinea Liquefied Natural Gas (PNG LNG) Project. These were summarised in ExxonMobil PNG Limited’s (EMPNG) Biodiversity Strategy as (i) extensive intact forest, (ii) high floristic diversity, (iii) high faunal diversity, (iv) endemic species, (v) unique assemblages of species, (vi) species of conservation concern, and (vii) biodiversity of importance to local communities for resource use and cultural and spiritual purposes. As part of its commitment to safeguarding these biodiversity values in the Upstream Project Area EMPNG’s Biodiversity Strategy outlines how biodiversity has been, and will continue to be, assessed and managed. To evaluate the success of this long-term strategy, EMPNG has developed a series of four Programmed Monitoring Activities (PMAs). These PMAs will provide data to compare against a series of Key Performance Indicators (KPIs) that align directly with the major objectives of EMPNG’s Biodiversity Strategy.
    [Show full text]
  • Breeding System Evolution Influenced the Geographic
    ORIGINAL ARTICLE doi:10.1111/evo.12695 Breeding system evolution influenced the geographic expansion and diversification of the core Corvoidea (Aves: Passeriformes) Petter Z. Marki,1,2,3,∗ Pierre-Henri Fabre,1,4 Knud A. Jønsson,1,5,6 Carsten Rahbek,1,5 Jon Fjeldsa,˚ 1 and Jonathan D. Kennedy1,∗ 1Center for Macroecology, Evolution and Climate, Natural History Museum of Denmark, University of Copenhagen, Universitetsparken 15, DK-2100 Copenhagen, Denmark 2Department of Environmental and Health Studies, Telemark University College, Hallvard Eikas Plass, N-3800 Bø, Norway 3E-mail: [email protected] 4Department of Organismic and Evolutionary Biology, Harvard University, Cambridge, Massachusetts 02138 5Department of Life Sciences, Imperial College London, Silwood Park Campus, Ascot, West Berkshire, SL5 7PY, United Kingdom 6Department of Life Sciences, Natural History Museum, Cromwell Road, London SW7 5BD, United Kingdom Received July 9, 2014 Accepted May 20, 2015 Birds vary greatly in their life-history strategies, including their breeding systems, which range from brood parasitism to a system with multiple nonbreeding helpers at the nest. By far the most common arrangement, however, is where both parents participate in raising the young. The traits associated with parental care have been suggested to affect dispersal propensity and lineage diversification, but to date tests of this potential relationship at broad temporal and spatial scales have been limited. Here, using data from a globally distributed group of corvoid birds in concordance with state-dependent speciation and extinction models, we suggest that pair breeding is associated with elevated speciation rates. Estimates of transition between breeding systems imply that cooperative lineages frequently evolve biparental care, whereas pair breeders rarely become cooperative.
    [Show full text]
  • The Systematic Affinity of the Enigmatic Lamprolia Victoriae (Aves
    Molecular Phylogenetics and Evolution 48 (2008) 1218–1222 Contents lists available at ScienceDirect Molecular Phylogenetics and Evolution journal homepage: www.elsevier.com/locate/ympev Short Communication The systematic affinity of the enigmatic Lamprolia victoriae (Aves: Passeriformes)—An example of avian dispersal between New Guinea and Fiji over Miocene intermittent land bridges? Martin Irestedt a,*, Jérôme Fuchs b,c, Knud A. Jønsson d, Jan I. Ohlson e, Eric Pasquet f,g, Per G.P. Ericson e a Molecular Systematics Laboratory, Swedish Museum of Natural History, P.O. Box 50007, SE-104 05 Stockholm, Sweden b University of Cape Town, Department of Zoology, Percy Fitzpatrick Institute of African Ornithology-DST-NRF Centre of Excellence, PD Hahn: 4.04, Rondebosch 7701, Cape Town, South Africa c Museum of Vertebrate Zoology and Department of Integrative Biology, 3101 Valley Life Science Building, University of California, Berkeley, CA 94720-3160, USA d Zoological Museum, University of Copenhagen, Universitetsparken 15, DK-2100 Copenhagen, Denmark e Department of Vertebrate Zoology, Swedish Museum of Natural History, P.O. Box 50007, SE-104 05 Stockholm, Sweden f UMR5202 ‘‘Origine, Structure et Evolution de la Biodiversité”, Département Systématique et Evolution, Muséum National d’Histoire Naturelle, 55 Rue Buffon, 75005 Paris, France g Service Commun de Systématique Moléculaire, IFR CNRS 101, Muséum National d’Histoire Naturelle, 43, rue Cuvier, 75005 Paris, France 1. Introduction In recent publications (e.g. Coates et al., 2006), Lamprolia is Lamprolia victoriae (silktail) is a distinctive bird endemic to placed among the monarch-flycatchers (Monarchidae). However, the Fiji Islands, where two well-marked subspecies inhabit hu- there is no morphological synapomorphy that unambiguously mid forest undergrowth and subcanopy on the islands of Taveuni groups Lamprolia with the monarchs, and several other passerine (L.
    [Show full text]
  • Earth History and the Passerine Superradiation
    Earth history and the passerine superradiation Carl H. Oliverosa,1, Daniel J. Fieldb,c, Daniel T. Ksepkad, F. Keith Barkere,f, Alexandre Aleixog, Michael J. Andersenh,i, Per Alströmj,k,l, Brett W. Benzm,n,o, Edward L. Braunp, Michael J. Braunq,r, Gustavo A. Bravos,t,u, Robb T. Brumfielda,v, R. Terry Chesserw, Santiago Claramuntx,y, Joel Cracraftm, Andrés M. Cuervoz, Elizabeth P. Derryberryaa, Travis C. Glennbb, Michael G. Harveyaa, Peter A. Hosnerq,cc, Leo Josephdd, Rebecca T. Kimballp, Andrew L. Mackee, Colin M. Miskellyff, A. Townsend Petersongg, Mark B. Robbinsgg, Frederick H. Sheldona,v, Luís Fábio Silveirau, Brian Tilston Smithm, Noor D. Whiteq,r, Robert G. Moylegg, and Brant C. Fairclotha,v,1 aDepartment of Biological Sciences, Louisiana State University, Baton Rouge, LA 70803; bDepartment of Biology & Biochemistry, Milner Centre for Evolution, University of Bath, Claverton Down, Bath BA2 7AY, United Kingdom; cDepartment of Earth Sciences, University of Cambridge, Cambridge CB2 3EQ, United Kingdom; dBruce Museum, Greenwich, CT 06830; eDepartment of Ecology, Evolution and Behavior, University of Minnesota, Saint Paul, MN 55108; fBell Museum of Natural History, University of Minnesota, Saint Paul, MN 55108; gDepartment of Zoology, Museu Paraense Emílio Goeldi, São Braz, 66040170 Belém, PA, Brazil; hDepartment of Biology, University of New Mexico, Albuquerque, NM 87131; iMuseum of Southwestern Biology, University of New Mexico, Albuquerque, NM 87131; jDepartment of Ecology and Genetics, Animal Ecology, Evolutionary Biology Centre,
    [Show full text]
  • Melampitta Gigantea: Possible Relation Between Feather Structure
    SHORT COMMUNICATIONS Condor 85:X9-91 G The Cooper Om~ihological Society 1983 tails are fresh. The bill is black, the iris dark brown, the legs black and stout. It has not been previously noticed that the rachis (but MELAMPITTA GIGANTEA: not the barbs)is stiffenedin both the remigesand rectrices POSSIBLE RELATION BETWEEN of the Greater Melampitta. In addition, comparisonof the FEATHER STRUCTURE AND specimensshows that thesefeathers are subjectto marked and asymmetricalwear. The remigesand rectricesare new UNDERGROUND ROOSTING HABITS in specimens 2 and 3, worn in specimens 4 and 5, and very worn in specimens 1 and 7. The fresh feathers are broad, and the vane is loose-textured, especially at the JARED M. DIAMOND margin. Even in fresh rectrices,the rachis projects several millimeters beyond the vane at the tip of the tail. With wear, the shafts of the rectrices become bare distally for The Greater Melampitta (Me/amp&a gigantea)is one of 10 mm or more and break at the tip. The outer vanes of the least known and apparently rarest New Guinea birds. the rectriceswear off, leaving the tighter proximal portion No field observationsat all have been reported for it. Only of the barbs and causing the rectrices to become quite six specimensare known, from four far-flung areasof New asymmetrical. The remiges wear especially on the inner Guinea, and recordsof only four of these specimenshave vanes. been published.The apparent rarenessof this speciescon- Two other peculiar featuresof the Greater Melampitta trastswith the relative abundanceof its only congener,the deserve mention. First, there is an exposed,conical, bony LesserMelampitta (M.
    [Show full text]