248 ShortCommunications [Auk, Vol. 118 WAGNER,R. H. 1992.Confidence of paternity and pa- WETTON, J. H., R. E. CARTER, D. T. PARKIN, AND D. rental effort in Razorbills. Auk 109:556-562. WALTERS.1987. Demographicstudy of a wild WESTNEAT,D. E 1990.Genetic parentage in the In- HouseSparrow population by DNA fingerprint- digo Bunting: A study using DNA fingerprint- ing. Nature 327:147-149. ing. BehavioralEcology and Sociobiology 27:67- WITTENBERGER,J. L., AND R. L. TILSON.1980. The 76. evolution of monogamy:Hypotheses and evi- WESTNEAT,D. F., AND P. W. SHERMAN.1997. Density dence.Annual Reviewsof Ecologyand System- atics 11:197-232. and extrapairfertilizations in birds: A compar- ative analysis.Behavioral Ecology and Sociobi- Received21 October1999, accepted12 September2000. ology 41:205-215. Associate Editor: F. Sheldon The Auk 118(1):248-255, 2001 Adenylate Kinase Intron 5: A New Nuclear Locusfor Avian Systematics LEO H. SHAPIRO• AND JOHN P. DUMBACHER MolecularGenetics Lab, National Zoological Park, 3001 ConnecticutAvenue NW, Washington,D.C. 20008, USA The explosionof use of the polymerasechain re- than nuclearprotein coding regions, they can nev- action (PCR) and direct DNA sequencingin recent erthelessevolve significantly more slowly than pro- yearshas provideda wealth of new data for avian tein codingmtDNA, and might thereforebe espe- systematists.Nearly all thesesequence data, how- ciallyhelpful in resolvingnodes at depthsfor which ever, have comefrom mitochondrialgenes, which the signal from mtDNA is diminished due to are inheritedas a singleunit, typicallyexhibit strict- saturation. ly matrilinealinheritance, and have other unusual Despitetheir potentialutility, nuclear genes have properties(Avise 1991). Although mitochondrial so far been little used in sequence-basedavian sys- DNA (mtDNA) has well-establishedadvantages for tematics.This is in large part becauseof a lack of ap- phylogeneticinference (Moore 1995), avian molecu- propriatePCR primers that workwell acrossa broad lar systematistsare eager to identify nuclear genes spectrumof aviangroups and that amplifysequenc- that could provide independentphylogenetic esti- es evolvingat rates suitablefor addressinga range mates(e.g. Prychitko and Moore 1997, Omland 1999). of phylogeneticquestions. In the courseof a phylo- Most nuclearloci exploredto date are slowly evolv- geneticinvestigation of the pitohuis(J. Dumbacher ing proteincoding genes and havebeen useful pri- unpubl.data), we exploredthe usefulnessof a nu- marilyfor resolvingdeep relationships (e.g. relation- cleargene not previouslyemployed for phylogenetic shipsamong taxa with divergencetimes more than analysis.In thisnote, we reportprimers we havede- 50 Ma ago; Graybeal 1994, but see Lovette and Ber- signedto amplify this new nuclearmarker, intron 5 mingham2000). It would clearlybe helpful to have of the nucleargene cytosolic adenylate kinase (AK1), at our disposalnuclear DNA sequencesthat exhibit and we documentboth the potentialphylogenetic a fasterrate of evolution,making them phylogenet- utility of this intron and the very broad taxonomic icallyuseful at intermediateand shallowtaxonomic utility of theseprimers. levels(e.g. Palumbi 1996, Prychitko and Moore 1997). Methods.--PCRprimers located in the conserved Nuclearintrons, for example,which have recently re- exon regionsflanking AK1 intron 5 (in exon5 and ceived attentionfor their potential utility in popu- exon 6) were designedby comparingcomplete AK1 lation-level studies (e.g. Friesen et al. 1997, Hesle- DNA sequencespublished for Gallus(Suminami et wood et al. 1998), may also be very useful for al. 1988) and humans (Matsuura et al. 1989), as well inferringphylogenetic relationships among species. asamino acid sequences for severalother taxa. Prim- Althoughthese introns typically evolve more quickly er sequencesand positionsare givenin Table1. The other known membersof the well-studiedAK gene • PresentAddress: Division of InsectBiology, ESPM, family differ in sequenceso substantiallyfrom AK1, 201 Wellman Hall, 3112, University of California, includingthe regionsof primer annealing,that we Berkeley,CA 94720-3112,USA. E-mail: lshapiro@ are confidentthe primersreported here will amplify nature.berkeley.edu only AK1 (barringa recentgene duplication within January2001] ShortCommunications 249 TABLE1. Primersfor amplifying AK1 intron 5 from birds. AK5a* and AK5b+ are locatedin exon5 and the remainingthree primersare locatedin exon6. "Nucleotideposition" refers to the positionof the primer in the publishedGallus AK1 sequence(Suminami et al. 1988).Primers AK5a •, AK6d-, and AK6e- were notused to collectany of the datareported in thispaper, but preliminarystudies suggest that these primers work well in at least some taxa, so we have included them here. Primer name Primer sequence(5' to 3') Nucleotide position AK5a* ATGCTGCGGGACGCCATGTTGG 4769to 4790 AK5b • ATTGACGGCTACCCTCGCGAGGTG 4820to 4843 AK6c CACCCGCCCGCTGGTCTCTCC 5454to 5474 AK6d- GTTCGGTAGCCTTGTAGTACGTCTCC 5507to 5532 AK6e- CCTTGTAGAAGGCGATGACGGGTTC 5529 to 5553 lineages).To investigatethe taxonomicbreadth for min)-72øC (5 min). Our PCR reaction mix contained which thoseprimers are useful,we usedthe primer magnesium chloride (1.5 mM), primers (0.4 p•M pair AK5b+ and AK6c- to amplify and sequenceap- each), dNTPs (0.2 mM each) and 1 U Perkin Elmer proximately 500 to 650 base pairs (bp) of AK1 from AmpliTaq Gold DNA polymerase(for a 25 p•Lreac- representativesof 10 avian familiesin 7 orders.This tion) with the suppliedbuffer. PCR productswere amplification product includes intron 5 (ranging in cleanedusing QIAGEN QIAquick PCR Purification lengthfrom about350 to 500 bp amongthe taxawe Kits and cyclesequenced in bothdirections using an sampled)and 99 bp of flanking exon (27 bp at the 5' ABI PRISM cycle sequencingkit. Sequencedprod- end and 72 bp at the 3' end, excludingprimers). ucts were cleaned using Princeton Separations DNA was extractedusing standardphenol-chlo- CentriSep columns and run out on an ABI 373 au- roform extractions (Hillis et al. 1996) or using QIA- tomated sequencer. GEN DNeasy TissueKits. DNA amplificationof AK1 For purposesof comparison,we amplifiedboth intron 5 was carried out in an MJ ResearchPTC-200 AK1 intron 5 (using AK5b+ and AK6c-, as well as thermalcycler using the followingprogram: 94øC (10 several additional primers designed specificallyto min)--35 cyclesof 92øC (45 s), ramp of 1.5øC/s to pachycephalids)and the well-studiedmitochondrial 54øC,54øC (1 rain), ramp of 1.5øC/s to 72øC,72øC (1 genecytochrome-b from 17 individualsrepresenting TABLE2. The 7 avian ordersand 10 familiesfrom which we haveamplified and sequencedAK1 intron 5 from one or more speciesto demonstratetaxonomic breadth of primers.Orders and familiesfollow Gill (1995);scientific and English species names follow the 7th editionof the Checklistof North AmericanBirds (AOU 1998)for speciesoccurring in North or Middle America,and Monroe and Sibley (1993) for all others. The 12 speciesused for the phylogeneticcomponent of this studyare indicatedby asterisks. Order Family Species(partial list) Sphenisciformes Spheniscidae GalapagosPenguin (Spheniscusmendiculus) Ciconiiformes Threskiornithidae Glossy Ibis (Plegadisfalcinellus) Falconiformes Accipitridae Rough-leggedHawk (Buteolagopus) Falconidae Aplomado Falcon(Falco femoralis) Gruiformes Rallidae White-wingedCoot (Fulicaleucoptera) CommonMoorhen (Gallinula chloropus) Virginia Rail (Railuslimicola) Buff-spottedFlufftail (Sarothrura elegans) Psittaciformes Psittacidae Grey Parrot (Psittacuserithacus) Caprimulgiformes Aegothelidae FelineOwlet-nightjar (Aegotheles insignis) Passeriformes Pachycephalidae Little Shrike-thrush(Colluricincla megarhyncha)* GoldenWhistler (Pachycephalapectoralis)* RegentWhistler (Pachycephalaschlegelii)* Sclater'sWhistler (Pachycephalasoror)* Hooded Pitohui (Pitohuidichrous)* VariablePitohui (Pitohuikirhocephalus)* Mottled Whistler (Rhagologusleucostigma)* Paradisaeidae Magnificent Bird-of Paradise(Cicinnurus magnificus)* Greater Melampitta (Melampittagigantea)* Raggiana Bird-of-Paradise(Paradisaea raggiana)* Emberizidae Bronzed Cowbird (Molothrusaeneus)* Brown-headedCowbird (Molothrusater)* 250 ShortCommunications [Auk, Vol. 118 0.25- 35- ß T. 30- * TV 0.2- • 25- 0.15- ::3 ß ß 0.1- ioNß o o oo oL.. 15- 0.05- 10- o .1 0.15 0 0.;35 0' I 0.03 0.0• O. 0.•2 0.15 AK 1 intron5 (HKY distance) AK1 intron5 uncorrectedp-distance FIc. 1. Cytochrome-bpairwise distancesversus AK1 intron 5 pairwise distances.Note saturationof Fzc. 2. Transitions (T,) and transversions(Tv) ver- cytochrome-brelative to AK1. HKY-correcteddis- sus uncorrected pairwise p-distances (T• + Tv, tances(Hasegawa et al. 1985) were calculatedusing scaled)for AK1 intron 5. AK1 showsno indicationof PAUP* 4.0b4a (Swofford 1999). saturationeven at rather deep divergences.Substi- tutions were tallied and distancescalculated using PAUP* 4.0b4a (Swofford 1999). 7 speciesof Pachycephalidae,3 speciesof Paradi- saeidae,and (as an outgroup) 2 speciesof Emberi- zidae (Table2). For the analysespresented here we centlydiverged taxa, AK1 intron 5 exhibitsa substi- used, wherever possible,420-440 bp each of both tution rate severaltimes slowerthan cytochrome-b, AK1 intron5 and cytochrome-b,but a few sequences but this differenceis effectivelyreduced for deeper are shorterthan this.Sequences were easilyaligned divergencesas cytochrome-bsaturates relative to by eye (Appendix1). We calculatedgenetic distances AK1 (Fig 1). This saturationindicates the potential and generated maximum-parsimony trees using for