REPRODUCTIONRESEARCH

SMAD7 antagonizes key TGFb superfamily signaling in mouse granulosa cells in vitro

Yang Gao, Haixia Wen, Chao Wang and Qinglei Li Department of Veterinary Integrative Biosciences, College of Veterinary Medicine and Biomedical Sciences, Texas A&M University, College Station, Texas 77843, USA Correspondence should be addressed to Q Li; Email: [email protected]

Abstract

Transforming growth factor b (TGFb) superfamily signaling is essential for female reproduction. Dysregulation of the TGFb signaling pathway can cause reproductive diseases. SMA and MAD (mothers against decapentaplegic) (SMAD) proteins are downstream signaling transducers of the TGFb superfamily. SMAD7 is an inhibitory SMAD that regulates TGFb signaling in vitro. However, the function of SMAD7 in the ovary remains poorly defined. To determine the signaling preference and potential role of SMAD7 in the ovary, we herein examined the expression, regulation, and function of SMAD7 in mouse granulosa cells. We showed that SMAD7 was expressed in granulosa cells and subject to regulation by intraovarian growth factors from the TGFb superfamily. TGFB1 (TGFb1), bone morphogenetic protein 4, and oocyte-derived growth differentiation factor 9 (GDF9) were capable of inducing Smad7 expression, suggesting a modulatory role of SMAD7 in a negative feedback loop. Using a small interfering RNA approach, we further demonstrated that SMAD7 was a negative regulator of TGFB1. Moreover, we revealed a link between SMAD7 and GDF9-mediated oocyte paracrine signaling, an essential component of oocyte–granulosa cell communication and folliculogenesis. Collectively, our results suggest that SMAD7 may function during follicular development via preferentially antagonizing and/or fine-tuning essential TGFb superfamily signaling, which is involved in the regulation of oocyte–somatic cell interaction and granulosa cell function. Reproduction (2013) 146 1–11

Introduction and are classified into receptor-regulated SMADs (SMAD1,2,3,5,and8),thecommonSMAD The transforming growth factor b (TGFb) superfamily, (SMAD4), and inhibitory SMADs (SMAD6 and SMAD7). one of the largest and most important growth factor Expression of SMADs in the ovary has been families in mammals, is implicated in the regulation of a documented. In rats, SMAD2 and SMAD3 are strongly wide spectrum of reproductive events (Dong et al. 1996, localized to the granulosa cells of preantral and small Hayashi et al. 1999, Galloway et al. 2000, Juengel & antral follicles. However, expression of SMAD2 and McNatty 2005, Diaz et al. 2007, Dragovic et al. 2007, SMAD3 is low in large antral follicles (Xu et al. 2002). Lee et al. 2007, Li et al. 2008b, Gong & McGee 2009). Phospho-SMAD2 (pSMAD2) is present in mouse granu- Accumulating evidence suggests that TGFb signaling losa cells of small and medium preantral follicles. is indispensable for female reproduction (Chang et al. Expression of pSMAD2, pSMAD3, and pSMAD1/5/8 is 2002, Edson et al. 2009). Disruption of TGFb signaling more uniform or stronger in the cumulus cells than in the results in reproductive disorders and cancer develop- mural granulosa cells (Tian et al. 2010), which suggests ment (Matzuk et al. 1992, Li et al. 2007, Pangas et al. the involvement of oocyte paracrine factors in the 2008, Middlebrook et al. 2009). regulation of SMADs. A recent study showed that To initiate signal transduction and elicit cellular SMAD6 is mainly localized to the oocyte, while responses, TGFb ligands bind to their type 2 and type 1 SMAD7 is expressed in oocytes and granulosa cells receptors and activate intracellular SMA and MAD from preantral and antral follicles (Quezada et al. 2012). (mothers against decapentaplegic) SMAD proteins. In addition, a number of SMADs, including SMAD4, are Activation of SMAD2/3 or SMAD1/5/8 is generally expressed in the oocyte (Xu et al. 2002, Pangas et al. associated with the respective TGFb/activin signaling 2006, Tian et al. 2010, Quezada et al. 2012). The and bone morphogenetic protein (BMP) signaling aforementioned studies point to a likely role of SMADs in (Chang et al. 2002). SMAD proteins are intracellular folliculogenesis and/or oocyte development. However, components of the TGFb signaling pathway. In mamma- the specific functions of these SMADs in the ovary lian species, eight SMAD proteins have been identified remained elusive until cell-specific knockout mice for

q 2013 Society for Reproduction and Fertility DOI: 10.1530/REP-13-0093 ISSN 1470–1626 (paper) 1741–7899 (online) Online version via www.reproduction-online.org Downloaded from Bioscientifica.com at 09/30/2021 02:55:34AM via free access 2 Y Gao and others

SMADs were generated. Conditional ablation of Smad1 Materials and methods and Smad5 in ovarian granulosa cells leads to the Animals development of metastatic granulosa cell tumors, which resemble human juvenile granulosa cell tumors (Pangas The experimental procedures were approved by the et al. 2008, Middlebrook et al. 2009). Thus, SMAD1 and Institutional Animal Care and Use Committee (IACUC) SMAD5 act as tumor suppressors in the ovary. Mechan- at Texas A&M University (protocol number 2011-0007). istically, tumor development is at least partially associ- Mice were maintained on C57BL/6/129S6/SvEv genetic ated with the upregulation of platelet-derived growth background and were allowed to feed and drink ad factor alpha (PDGFA), which is controlled by SMAD1/5 libitum. All necessary procedures were taken to and the trans-acting transcription factor 1 (SP1) minimize the discomfort, distress, and pain to the mice. (Tripurani et al. 2012). In contrast to SMAD1 and SMAD5, conditional deletion of Smad2 and Smad3 in Gonadotropin treatment granulosa cells causes fertility disorders including reduced ovulation and cumulus cell expansion. These Mice (21 day) received injections of 5 IU PMSG for 48 h defects are partially caused by the disruption of oocyte (nZ4) or both PMSG (48 h) and hCG (5 IU) (48 h; nZ3). paracrine signaling that is mediated by growth differen- Ovaries from age-matched untreated mice (nZ4 for tiation factor 9 (GDF9) and its target genes associated each group) were used as controls. Collection of ovaries with cumulus expansion (Li et al. 2008b). SMAD3 was was performed under a stereomicroscope. The ovaries reported to be required for normal follicle growth and were used for immunohistochemical and RNA analyses ovarian cell differentiation and response to FSH when a as detailed below. different targeting construct was utilized (Tomic et al. 2002, Gong & McGee 2009). Interestingly, disruption of Granulosa cell isolation and culture the signaling of the common SMAD, SMAD4, in ovarian granulosa cells results in subfertility and premature Primary mouse granulosa cell culture was described luteinization of granulosa cells, which is accompanied previously (Pangas et al. 2007, Li et al. 2009, 2011). by defects in cumulus cell expansion and ovulation Briefly, granulosa cells were collected in collection (Pangas et al. 2006). However, oocyte-specific knockout medium (DMEM containing 0.1% BSA (Sigma), 100 U/ of Smad4 only causes a slight reduction in litter size, ml penicillin–streptomycin, and 10 mM HEPES) by challenging a major role for TGFb signaling in female puncturing large antral follicles using 26 gauge needles germ cells (Li et al. 2012). under a stereomicroscope. The cell suspension was filtered Despite the well-characterized functions of receptor- through a 40 mm nylon cell strainer (BD) to remove oocytes regulated SMADs and the common SMAD in the ovary, and debris. The cell pellet was then washed, resuspended, the role of inhibitory SMADs in female reproduction and cultured for the following experiments: i) recombinant remains poorly defined. It has been suggested that protein treatment: granulosa cells were treated with SMAD6 preferentially inhibits BMP signaling (Hata control buffer, BMP4 (50 ng/ml; R&D), TGFB1 (10 ng/ml; et al. 1998, Ishisaki et al. 1999), whereas SMAD7 is R&D, Minneapolis, MN, USA), and GDF9 (50 ng/ml) to capable of targeting TGFb or both TGFb and BMP examine Smad7 regulation and target gene induction. The pathways (Nakao et al. 1997, Souchelnytskyi et al. 1998, production and purification of recombinant GDF9 were Ishisaki et al. 1999). The functions of inhibitory SMADs carried out as described previously (Li et al. 2009, 2011). are being revealed by knockout mouse models. The For TGFB1 treatment, granulosa cells were cultured Smad6 mutant mice showed partial lethality due to overnight and then serum-starved for 24 h before addition cardiovascular abnormalities (Galvin et al. 2000). In of recombinant TGFB1. The serum starvation procedure contrast, Smad7 knockout mice demonstrated variable was included to eliminate the potential basal activity of phenotypes ranging from defective B cell response to TGFb in the serum. ii) Small-molecule inhibitor assay: renal fibrosis (Li et al. 2006, Chung et al. 2009, Chen granulosa cells were pre-treated for 1 h with ALK2/3/6 et al. 2011), impaired cardiac functions (Chen et al. inhibitor dorsomorphin (4 mM; Sigma) or ALK4/5/7 2009), growth retardation, and a reduction in viability inhibitor SB-505124 (1 mM; Sigma). The cells were then (Tojo et al. 2012). incubated with recombinant BMP4 or GDF9 and collected As an initial effort to probe the reproductive function after 5 h. Selection of the doses of the growth factors and of SMAD7, we examined the expression and regulation incubation time was based on our pilot dose–response and of SMAD7 by intraovarian growth factors. Furthermore, time-course experiments and/or the published literature we explored the role of SMAD7 in regulating TGFb (Matsubara et al. 2000, Dahlqvist et al. 2003, Li et al. superfamily signaling in ovarian granulosa cells using a 2008b, 2009). Total RNA was isolated and quantitative small interfering RNA (siRNA) approach. These studies PCR was performed to analyze Smad7 mRNA expression. identify SMAD7 as a negative regulator of key TGFb iii) siRNA knockdown experiments, described below. All superfamily signaling in mouse granulosa cells. culture experiments were repeated at least three times.

Reproduction (2013) 146 1–11 www.reproduction-online.org

Downloaded from Bioscientifica.com at 09/30/2021 02:55:34AM via free access Role of SMAD7 in ovarian granulosa cells 3

RNA isolation and RT Table 1 Primers for SYBR green-based real-time PCR. Total RNA was extracted from the ovaries using RNA Name Sequence (50–30) Reference isolation reagent (TRI reagent; Sigma) or from mouse Smad7 Forward: GGGCTTTCAGATTCCCAACTT NA granulosa cells using an RNeasy Micro Kit (Qiagen) Reverse: CACGCGAGTCTTCTCCTCC according to the manufacturer’s instructions (Li et al. Tgfbi Forward: CGCCAAGTCACCCTACCAG PrimerBank Reverse: TGCACAGCACATACATTGGGG ID158508598c1 2009). RNA concentration was measured using a Ptgs2 Forward: TGAGCAACTATTCCAAACCAGC PrimerBank NanoDrop Spectrophotometer ND 1000 (NanoDrop Reverse: GCACGTAGTCTTCGATCACTATC ID31981525a1 Technologies, Wilmington, DE, USA). DNase I (Invi- Ptx3 Forward: CCTGCGATCCTGCTTTGTG PrimerBank Reverse: GGTGGGATGAAGTCCATTGTC ID31982085a1 trogen) treatment was performed when using TRI Id1 Forward: ACGACATGAACGGCTGCTAC Birkenkamp et al. reagent-derived RNA. On-column DNase (Qiagen) Reverse: CAGGATCTCCACCTTGCTCAC (2007) digestion was included during RNA isolation when Id2 Forward: ATGAAAGCCTTCAGTCCGGTG PrimerBank using the RNeasy Micro Kit. For RT, 1 mg or 200 ng of the Reverse: AGCAGACTCATCGGGTCGT ID6754276a1 Id3 Forward: CTGCTACGAGGCGGTGTG RTPrimerDB respective ovary and granulosa cell total RNA, random Reverse: CACCTGGCTAAGCTGAGTGC ID3261 hexamers/oligo dT primers (Invitrogen), and superscript Gapdh Forward: CAATGTGTCCGTCGTGGATCT Li et al. (2011) III (Invitrogen) reverse transcriptase were used. As Reverse: GCCTGCTTCACCACCTTCTT negative controls, reactions where superscript III was substituted with water were included to monitor graded alcohol. To expose the antigen, antigen retrieval potential genomic DNA contamination. was carried out by boiling the sections in 10 mM citrate buffer (pH 6.0) for 20 min. The slides were treated with Conventional PCR and quantitative real-time PCR 0.3% (v/v) hydrogen peroxide to eliminate endogenous peroxidase activity. The sections were then blocked Smad7 was amplified from ovary cDNA by conventional with 3% goat serum for 30 min and incubated with RT-PCR using Jumpstart Taq polymerase (Sigma) and rabbit anti-SMAD7 antibody (Imgenex; 1:300) (Reynolds gene-specific primers (forward: AAAGTGTTCCCTGG- et al.2008)at48C overnight. After primary antibody TTTCTCCAT CAAGGC; reverse: CTACCGGCTGTTGAA- incubation, the sections were washed and sequentially GATGACCTCCAGCCAGCAC) (Kitamura et al.2000). The incubated with biotinylated anti-rabbit IgG (1 h) and following PCR program was used: 95 8C for 2 min, ABC reagent (1 h; Vector Labs) at room temperature. 40 cycles of 95 8C for 30 s, 65 8C for 30 s, and 72 8Cfor Subsequently, the immunoreactive signals were 1 min and an extra extension of 10 min at 72 8C. The developed using a DAB substrate kit (Vector Labs), resultant PCR product (w207 bp) was separated and and sections were counterstained with hematoxylin and visualized on 1% agarose gel (Sigma) containing ethidium mounted with Permount (Fisher, Fair Lawn, NJ, USA). bromide. The image of the gel was acquired under u.v. light and then reversed for presentation. Quantitative real-time PCR (qPCR) was carried out as Small interfering RNA described previously with slight modifications (Li et al. Freshly prepared mouse granulosa cells were seeded 2011). Briefly, qPCR assays were conducted in a 384-well onto 24-well plates (w1!105 cells/well) in growth plate (Bio-Rad) using a CFX384 Real-time PCR Detection medium containing 5% fetal bovine serum (PAA System (Bio-Rad) with a program consisting of 95 8Cfor Laboratories, Dartmouth, MA, USA) and insulin–trans- 10 min and 40 cycles of 95 8C for 15 s and 60 8C for 1 min. ferrin–selenite (Sigma). The cells were cultured overnight Gene expression analyses were performed in duplicate before siRNA/vehicle transfection. Gapdh siRNA using SYBR Green PCR master mix (Applied Biosystems) (Ambion, Carlsbad, CA, USA) was included as a positive and gene-specific primers (Table 1) or Taqman gene control whereas an siRNA that has no significant expression assays (Tnfaip6, Mm00493736_m1; Inhbb, sequence similarity to the mouse gene was used as a Mm01286587_m1; and Gapdh, 4352339E) and Taqman negative control (Ambion). A substantial knockdown of Universal PCR Master Mix (Applied Biosystems). Gapdh Smad7 was achieved using X-tremeGENE siRNA was used as an internal control (Li et al.2008b, 2009) and Transfection Reagent (Roche) and Smad7 silencer fold changes were calculated using the DDCT method siRNA (73 nM; Ambion) in our granulosa cell culture (Livak & Schmittgen 2001). system. Transfection of siRNA was conducted according to the manufacture’s protocol. After 48 h of transfection, granulosa cells were treated with BMP4 (50 ng/ml), Immunohistochemistry TGFB1 (10 ng/ml), and GDF9 (50 ng/ml). For TGFB1 Immunohistochemistry was performed using an ABC kit treatment, granulosa cells were serum-starved for 24 h (Vector Labs, Burlingame, CA, USA) as described before adding TGFB1. After 5 h treatment, the cells were elsewhere (Li et al. 2011). In brief, sections (5 mm) collected in RNA lysis tissue buffer, RNA was isolated were prepared from paraffin-embedded tissue blocks using a Qiagen RNeasy Micro Kit, and gene expression and then deparaffinized in xylene and rehydrated in was analyzed by qPCR. www.reproduction-online.org Reproduction (2013) 146 1–11

Downloaded from Bioscientifica.com at 09/30/2021 02:55:34AM via free access 4 Y Gao and others

Statistical analyses (50 ng/ml), a thecal cell-secreted protein, increased Smad7 transcript levels more than fivefold in granulosa One-way ANOVA was performed to determine the cells compared with vehicle-treated controls (Fig. 2B). difference among groups. When a significant difference Incubation of mouse granulosa cells with 50 ng/ml of was detected by ANOVA, the difference between means GDF9, an oocyte-derived factor, resulted in significantly was further assessed by a post hoc Tukey’s HSD test. higher Smad7 mRNA levels than controls (Fig. 2C). To Comparison of means between two groups was made by gain further mechanistic understanding of Smad7 t-test. Data are shown as meanGS.E.M. Statistical induction by the aforementioned TGFb family ligands, significance was defined at P!0.05. we performed small-molecule inhibitor assays. The small-molecule compound 2-(5-benzo[1,3]dioxol-5-yl- Results 2-tert-butyl-3H-imidazol-4-yl)-6-methylpyridine hydro- chloride (SB-505124) selectively inhibits activin-like SMAD7 is expressed in mouse granulosa cells kinase (ALK)4, ALK5, and ALK7 activity and blocks the As a first step to define the potential ovarian function activation of SMAD2/3 (DaCosta Byfield et al. 2004). of SMAD7, we examined the expression of SMAD7 in Dorsomorphin is a selective inhibitor of BMP type I mouse granulosa cells. RT-PCR analysis revealed that receptors ALK2, ALK3, and ALK6 and suppresses mouse granulosa cells expressed Smad7 transcripts BMP-induced SMAD1/5/8 phosphorylation (Yu et al. (Fig. 1A). In agreement with the RT-PCR result 2008). Using these small-molecule inhibitors, we demon- (Fig. 1A), SMAD7 was detected in primary, secondary, strated that SB505124 (1 mM) suppressed GDF9-induced and antral follicles by immunohistochemistry (Fig. 1B). Smad7 expression (Fig. 2D). Similarly, dorsomorphin Furthermore, ovarian Smad7 mRNA abundance was (4 mM) significantly reduced BMP4-promoted Smad7 reduced after 48 h of pregnant mare’s serum gonado- transcript expression (Fig. 2E). tropin (PMSG) injection and 48 h of PMSG plus 48 h of human chorionic gonadotropin (hCG) injection compared with age-matched non-treated controls Knockdown of Smad7 did not affect BMP4-induced (Fig. 1F). Immunoreactive SMAD7 staining remained inhibitor of DNA binding (Id) gene and inhibin beta-B (Inhbb) expression detectable in granulosa cells after gonadotropin injec- tion compared with those in the follicles (Fig. 1D and E). TGFB1 significantly increased pentraxin 3 (Ptx3), prostaglandin-endoperoxide synthase 2 (Ptgs2), and tumor necrosis factor alpha-induced protein 6 (Tnfaip6) b TGF superfamily ligands induce Smad7 in mouse mRNA transcript expression in mouse granulosa cells granulosa cells (Fig. 3A). Upregulation of Id1, Id2,andId3 mRNA by Real-time PCR demonstrated that TGFB1 (TGFb1) BMP4 in mouse granulosa cells was demonstrated (10 ng/ml) induced Smad7 mRNA expression in mouse (Fig. 3B). Moreover, Ptx3 (Li et al. 2011), Tnfaip6,and granulosa cells within 5 h after treatment (Fig. 2A). BMP4 Ptgs2 were upregulated by purified GDF9 recombinant

A RT-PCR BC

GC GC RT Neg GC Smad7

Hprt

Smad7 1.5 DE FCTRL Treatment

CL GC 1 CL * * GC GC 0.5 Fold change

0 PMSG PMSG+hCG

Figure 1 Expression and localization of SMAD7 in mouse ovary. (A) Smad7 mRNA was expressed in mouse granulosa cells. RT Neg, no reverse transcriptase. (B, C, D, and E) Immunostaining of SMAD7 using ovaries from untreated immature mice (B) and PMSG (48 h)ChCG (48 h)-treated mice (D) and controls (E). Negative control without primary antibody is depicted in (C). Note that omission of the primary antibody abolished the SMAD7 signals. GC, granulosa cell; CL, corpus luteum. Arrows indicate follicles. Scale barZ50 mm (B and C) and 100 mm (D and E). (F) Gonadotropin administration reduced Smad7 mRNA levels in the ovary. Total RNA was isolated from ovaries of age-matched untreated controls (CTRL; nZ4/group), PMSG (48 h)-treated (nZ4), and PMSG (48 h)/hCG (48 h)-treated mice (nZ3). Gene expression was analyzed by qPCR using the DDCT method. Smad7 mRNA levels in the treatment group were expressed as fold change of the corresponding age-matched controls. Gapdh was used as an internal control. Data represent meansGS.E.M.*P!0.05 vs the corresponding CTRL.

Reproduction (2013) 146 1–11 www.reproduction-online.org

Downloaded from Bioscientifica.com at 09/30/2021 02:55:34AM via free access Role of SMAD7 in ovarian granulosa cells 5

ABCcells was demonstrated using Smad7 siRNA (Fig. 4B; 1.6 7 2 P!0.05). To determine the inhibitory effects of SMAD7 ) * * 6 on BMP4, TGFB1, and GDF9 signaling, we incubated 1.6 * 1.2 5 granulosa cells that had been treated with vehicle Smad7 4 1.4 (control) or Smad7 siRNA in the presence or absence 0.8 3 0.8 of different ligands. Interestingly, we found that knock- down of Smad7 in granulosa cells had no significant 0.4 2 0.4 1 effect on BMP4-induced mRNA expression of Id1, Id2, Fold change ( 0 0 0 and Id3 (Fig. 4C, D, and E) as well as inhibin beta-B (Inhbb; Fig. 4F). CTRL CTRL CTRL GDF9 BMP4 TGFB1 Role of SMAD7 in TGFb signaling in mouse D * E * granulosa cells 2 5

) In contrast to the effect of Smad7 knockdown on BMP4 1.5 4 signaling, we found that stimulation of Smad7 siRNA-treated granulosa cells with TGFB1 enhanced Smad7 3 1.0 TGFB1-induced gene expression (Fig. 5). Figure 5A 2 and B depicts the experimental protocol utilized and the validation of Smad7 knockdown respectively. 0.5 1 As expected, granulosa cells treated with TGFB1 and Fold change ( negative siRNA showed increased Ptx3, Ptgs2,and 1 0 Tnfaip6 mRNA levels (Fig. 5C, D, and E). Interestingly, µ µ SB (1 M) ––+DM (4 M) ––+ a further increase in Ptx3, Ptgs2,andTnfaip6 transcript Vehicle +–– Vehicle +–– levels was found in TGFB1-treated granulosa cells that GDF9 –++ BMP4 –++ were incubated with Smad7 siRNA (P!0.05; Fig. 5C, D, Figure 2 Induction of Smad7 mRNA by TGFb family proteins in mouse and E). However, a similar effect of Smad7 siRNA on granulosa cells. (A, B, and C) Induction of Smad7 mRNA in mouse TGFB1-induced Serpine1/plasminogen activator granulosa cells by TGFB1 (A), BMP4 (B), and GDF9 (C). Mouse inhibitor-1 (PAI1) was not detected (data not shown). granulosa cells were freshly isolated and treated with vehicle (CTRL), TGFB1 (10 ng/ml), BMP4 (50 ng/ml), and GDF9 (50 ng/ml). For TGFB1 treatment, granulosa cells were cultured overnight and serum-starved SMAD7 negatively influences GDF9-mediated for 24 h before ligand addition. (D and E) Effect of small-molecule oocyte paracrine signaling inhibitors for TGFb/BMP type 1 receptors on GDF9 and BMP4-induced Smad7 mRNA expression. Note that the ALK4/5/7 inhibitor SB505124 To test the hypothesis that SMAD7 antagonizes GDF9 (SB; 1 mM) significantly reduced GDF9 (50 ng/ml)-induced Smad7 signaling in mouse granulosa cells, we performed siRNA expression (D). Similarly, the ALK2/3/6 inhibitor dorsomorphin assays using mouse primary granulosa cell culture (DM; 4 mM) mitigated BMP4 (50 ng/ml)-promoted expression of Smad7 (Fig. 5A). As anticipated, Ptx3 was induced by GDF9 in transcripts (E). Granulosa cells were harvested after 5 h of treatment and processed for qPCR analysis using the DDCT method. Gapdh was used the presence of negative siRNA (Fig. 5G). We demon- as an internal control. Data represent meansGS.E.M. of three to five strated that knockdown of Smad7 (Fig. 5F) caused a independent culture experiments. *P!0.05. significant increase in GDF9-induced Ptx3 mRNA expression compared with controls (P!0.05; Fig. 5G). A similar effect of Smad7 knockdown on GDF9-induced proteins in our culture system (Fig. 3C). Among the Ptgs2 (Fig. 5H) and Tnfaip6 (Fig. 5I) expression was also aforementioned genes, Ptx3, Ptgs2,andTnfaip6 are found. A role of SMAD7 in modulating growth factor critical regulators of cumulus cell expansion (Pangas & signaling in granulosa cells is proposed in Fig. 6. Matzuk 2005, Li et al. 2008b, 2011). Id genes are known to be downstream targets of BMPs and they are well characterized (Korchynskyi & ten Dijke 2002). Thus, the above genes were selected for the following siRNA- Discussion based assays. TGFb ligands signal through type 2 and type 1 receptors To define the role of SMAD7 in the regulation of TGFb and downstream SMAD proteins, which regulate superfamily signaling in mouse granulosa cells, we gene transcription in concert with co-activators and transfected the cells with Smad7 siRNA to knock-down co-repressors (Massague 2000). TGFb signaling is Smad7 and examined the effect on TGFb family ligand- regulated at multiple levels including ligand traps induced gene expression. Figure 4A depicts the primary (e.g. Chordin and Noggin), inhibitory SMADs (i.e. granulosa cell culture assay utilized in this study. SMAD6 and SMAD7), and interactive pathways such A substantial reduction of Smad7 in mouse granulosa as the MAP kinase (MAPK) pathway (Massague 2000, www.reproduction-online.org Reproduction (2013) 146 1–11

Downloaded from Bioscientifica.com at 09/30/2021 02:55:34AM via free access 6 Y Gao and others

A 16 Attisano & Wrana 2002, Derynck & Zhang 2003, Yan * et al. 2009, Yan & Chen 2011). Researchers, including 14 CTRL TGFB1 the authors, have recently identified key roles of 12 receptor-regulated SMADs and the common SMAD in ovarian function and female fertility using knockout and 10 conditional knockout approaches (Tomic et al. 2002, 8 2004, Pangas et al. 2006, 2008, Li et al. 2008b, Gong & McGee 2009). However, the role of inhibitory SMADs

Fold change 6 remains a missing piece of the puzzle in this field. * Therefore, the current study was aimed at delineating the 4 * function of SMAD7 in the context of TGFb signaling in 2 the ovary. We provide compelling evidence that SMAD7 b 0 acts as a negative regulator of key TGF superfamily Ptx3 Ptgs2 Tnfaip6 ligand signaling in mouse granulosa cells. Importantly, our results reveal a link between SMAD7 and GDF9 signaling, which is an essential element for oocyte– B 16 granulosa cell communication and folliculogenesis * CTRL (Dong et al. 1996). 8 BMP4 SMAD7 is an inhibitory SMAD that antagonizes TGFb and BMP signaling in vitro (Nakao et al. 1997, Yanagisawa et al. 2001). SMAD7 is functionally distinct 6 from SMAD6 (Yan et al. 2009, Yan & Chen 2011). We demonstrated the expression of SMAD7 in mouse * 4 granulosa cells, which confirmed findings by Quezada et al. (2012). As gonadotropins are key regulatory signals * 2 for follicular development, we examined the effect of exogenous gonadotropin administration on Smad7 gene expression. We showed that Smad7 mRNA was down- 0 regulated in the ovary by gonadotropin administration. Id1 Id2 Id3 It is plausible that the reduced Smad7 expression by gonadotropin exposure could potentially facilitate C 200 * follicular development and/or luteal formation. CTRL However, regulation of Smad7 by FSH was not observed GDF9 in mouse granulosa cells cultured in vitro (Quezada et al. 150 2012). Thus, the physiological significance of this finding remains to be identified. SMAD7 is induced by TGFb signaling in several 100 cell types (Nakao et al. 1997, Afrakhte et al. 1998, Stopa et al. 2000). As the ovary is a rich source of a variety of TGFb ligands that are produced from distinct cellular 50 compartments and are essential regulators of ovarian function, we sought to determine whether Smad7 is induced by these growth factors in ovarian granulosa * * cells. Smad7 is known to be induced by TGFb ligands 0 Ptx3 Ptgs2 Tnfaip6 (Afrakhte et al. 1998), and we were able to confirm that Smad7 is a target of TGFB1 in mouse granulosa cells Figure 3 Target genes of TGFB1, BMP4, and GDF9 in mouse granulosa cells. (A) TGFB1 induced Ptx3, Ptgs2, and Tnfaip6 expression in mouse (Quezada et al. 2012). We also showed that Smad7 was granulosa cells. (B) BMP4 increased the expression of mRNAs for Id1, induced by BMP4 in mouse granulosa cells. Moreover, Id2, and Id3 in granulosa cells. (C) Induction of Ptx3, Ptgs2, and Tnfaip6 Smad7 mRNA levels were rapidly increased by GDF9, expression by GDF9 in mouse granulosa cells. Mouse granulosa cells which is an oocyte-secreted TGFb family protein and a were freshly isolated and treated with vehicle (CTRL), TGFB1 key regulator of granulosa cell function (Dong et al. (10 ng/ml), BMP4 (50 ng/ml), or GDF9 (50 ng/ml). For TGFB1 1996, Yan et al. 2001, Otsuka et al. 2011). These data treatment, granulosa cells were cultured overnight and serum-starved suggest that SMAD7 may modulate GDF9-mediated for 24 h before ligand addition. Cells were harvested after 5 h of treatment and processed for RNA isolation and qPCR analysis using the oocyte paracrine signaling essential for coordinating the DDCT method. Gapdh was used as an internal control. Data represent cross talk between ovarian somatic cells and germ cells. meansGS.E.M. of three to five independent culture experiments. It has been shown that the ALK4/5/7 inhibitor SB431542 *P!0.05 vs CTRL. attenuates TGFB1-induced Smad7 mRNA expression in

Reproduction (2013) 146 1–11 www.reproduction-online.org

Downloaded from Bioscientifica.com at 09/30/2021 02:55:34AM via free access Role of SMAD7 in ovarian granulosa cells 7

A Primary GC siRNA Ligand RNA isolation collection transfection stimulation qPCR BMP4 Overnight 48 h 5 h

B Smad7CD Id1 Id2 1.2 12 6 10 5

0.8 8 4 6 3

0.4 4 2 Fold change * 2 1

0 0 0 Neg siRNA +– +–– + +–– + Smad7 siRNA –+ – + –+ – + –+ BMP4 –– –+–+ –+–+ Figure 4 Knockdown of Smad7 did not affect BMP4-promoted Id gene and Inhbb expression in granulosa cells. (A) Schematic representation of experi- mental procedure utilized to determine the effect of E 12 Id3F 2.5 Inhbb Smad7 siRNA knockdown on BMP4-induced gene 10 2 expression in granulosa cells. (B) Smad7 siRNA dramatically reduced expression of Smad7 in granulosa 8 1.5 cells after 48 h of transfection. (C, D, E, and F) Effect of Smad7 siRNA on BMP4-induced target gene expression 6 1 in mouse granulosa cells. Note that knockdown of 4 Smad7 in granulosa cells did not significantly alter Fold change 0.5 BMP4-induced expression of Id1, Id2, Id3,andInhbb 2 compared with BMP4-treated negative siRNA controls. 0 0 Granulosa cells were harvested after 5 h of BMP4 stimulation and processed for RNA isolation and qPCR Neg siRNA +–– + +–– + analysis using the DDCTmethod.Gapdh was used as an Smad7 siRNA – + –+ – + –+ internal control. Data represent meansGS.E.M.ofthree BMP4 –+–+ –+–+ independent culture experiments. *P!0.05. mouse granulosa cells (Quezada et al. 2012). We further SMAD7 may not act as a direct antagonist for BMP4 demonstrated that TGFb and BMP type 1 receptors were signaling in mouse granulosa cells. However, the role of involved in the induction of Smad7 by GDF9 and BMP4 SMAD6 in regulating BMP4 signaling in mouse granu- respectively. In contrast to the aforementioned findings, losa cells remains to be elucidated. In contrast to the Smad6 mRNA was not affected by GDF9 treatment (data findings from the BMP4 studies, we found that TGFB1- not shown), suggesting a distinct role of the two induced expression of the Ptx3, Ptgs2,andTnfaip6 genes inhibitory SMADs in GDF9-mediated signaling. As was potentiated in Smad7 siRNA-treated granulosa cells, further support, Smad6 is induced by BMP15 but not which implies an inhibitory role of SMAD7 in TGFb TGFB1 in granulosa cells (Li et al. 2009, Quezada et al. signaling in mouse granulosa cells. Based on the fact that 2012). Collectively, these results suggest that SMAD7 SMAD7 forms a complex with activated type 1 receptors may act as a negative regulator of TGFb superfamily to inhibit receptor-regulated SMAD (R-SMAD) phos- signaling in mouse granulosa cells. Thus, the preference phorylation (Hayashi et al. 1997, Nakao et al. 1997, of SMAD7 in antagonizing TGFb superfamily signaling Mochizuki et al. 2004), it is plausible that reduction of was further exploited in this study. SMAD7 may enhance TGFb type 1 receptor-SMAD2/3 Although major functions of the BMP and TGFb signaling activity in granulosa cells. Intriguingly, a signaling pathways in mouse granulosa cells have been similar effect of Smad7 knockdown on TGFB1-induced identified (Li et al. 2008b, Pangas et al. 2008), the role of Serpine1/PAI1, a known TGFb target gene, was not SMAD7 in each signaling cascade remains elusive. Id detected. However, a p38 inhibitor significantly reduced genes are direct targets of BMPs (Hollnagel et al. 1999, TGFB1-induced PAI1 expression (Y Gao and Q Li 2012, Korchynskyi & ten Dijke 2002). Although BMP4 potently unpublished observations), suggesting that the p38 induced Smad7 expression, we did not find a significant MAPK pathway is involved in TGFB1-induced PAI1 effect of Smad7 knockdown on BMP4-stimulated Id gene expression in mouse granulosa cells. Involvement of p38 expression in the current study, which suggests that MAPK in TGFb-induced PAI1 expression has been www.reproduction-online.org Reproduction (2013) 146 1–11

Downloaded from Bioscientifica.com at 09/30/2021 02:55:34AM via free access 8 Y Gao and others

A Primary GC siRNA Ligand RNA isolation collection transfection Serum srarvation stimulation qPCR TGFB1 Overnight 5 h GDF9 Overnight 48 h 5 h

BCSmad7 Ptx3 DE Ptgs2 Tnfaip6 * 1.2 40 8 * 14 * 1 12 30 6 0.8 10 8 Figure 5 SMAD7 antagonizes TGFB1 and 0.6 20 4 6 GDF9signalinginmouse granulosa cells. (A)Schematic 0.4 * representation of experimental procedure utilized to Fold change 10 2 4 0.2 2 determine the effect of Smad7 siRNA knockdown on TGFB1andGDF9-inducedgeneexpressioningranu- 0 000 Neg siRNA +– +–+– +–+– +–+– losacells.(B,C,D,andE)EffectofSmad7 siRNA Smad7 siRNA –+ –+–+ –+–+ –+–+ knockdown (B) on TGFB1-induced expression of Ptx3 TGFB1 –– ––++ ––++ ––++ (C), Ptgs2 (D), and Tnfaip6 (E) in mouse granulosa cells. FG H I (F,G, H, and I) Effect of Smad7 siRNA knockdown (F) on * * GDF9-inducedexpressionofPtx3 (G), Ptgs2 (H), and 1.2 14 2.5 * 5 Tnfaip6 (I) in mouse granulosa cells. Note that knock- 12 1 2.0 4 down of Smad7 in granulosa cells resulted in a 10 0.8 significant increase in TGFB1 and GDF9-induced Ptx3 8 1.5 3 0.6 (C and G), Ptgs2 (D and H), and Tnfaip6 (E and I) mRNA * 6 1.0 2 expression compared with the respective ligand-treated 0.4

Fold change 4 negative siRNA controls. Granulosa cells were har- 0.5 1 0.2 2 vested after 5 h of stimulation and processed for RNA 0 000 isolation and qPCR analysis using the DDCT method. Neg siRNA +– +–+– +–+– +–+– Gapdh was used as an internal control. Data represent Smad7 siRNA –+ –+–+ –+–+ –+–+ meansGS.E.M.ofthreeindependentculture GDF9 –– ––++ ––++ ––++ experiments. *P!0.05.

observed in other cell types (Liao et al. 2001, Vayalil BMP4 TGFB1/GDF9 et al. 2007). Collectively, these results suggest a possible role for SMAD7 in controlling TGFb type 1 receptor- SMAD2/3 signaling activity in mouse granulosa cells. ALK2/3/6 ALK4/5/7 Of particular interest is the finding that GDF9 signaling is modulated by SMAD7 in granulosa cells, SMAD7 because oocyte-derived TGFb superfamily ligands (e.g. BMP15 and GDF9) are pivotal mediators of oocyte paracrine signaling essential for folliculogenesis and oocyte developmental competence (Hussein et al. 2006, SMAD7 Li et al. 2008a, Yeo et al. 2008). Within a follicle, bidirectional intercellular communications between the ? oocyte and companion somatic cells are established via gap junctions and paracrine signaling and are indis- Ptx3, Ptgs2, Id genes pensable to normal ovarian function (Eppig et al. 1997, Tnfaip6 Eppig 2001, Gilchrist et al. 2008, Li et al. 2008a). GDF9 and BMP15 are oocyte paracrine factors whose functions Granulosa cell in follicular development have been well elaborated (Dong et al. 1996, Vitt et al. 2000, Otsuka et al. 2001, Figure 6 Hypothetical model depicting the role of SMAD7 in ovarian granulosa cells. In mouse granulosa cells, TGFb family ligands such as Yan et al. 2001, Otsuka & Shimasaki 2002, Shimasaki TGFB1, BMP4, and GDF9 are key regulators of granulosa cell function et al. 2004, McNatty et al. 2005, Gilchrist et al. 2006, and follicular development. BMP4 and TGFB1/GDF9 signal through Yoshino et al. 2006, Sugiura et al. 2007, Edwards et al. ALK2/3/6 and ALK4/5/7 to regulate granulosa cell gene expression and 2008, Su et al. 2008). GDF9 is expressed in oocytes in cellular responses/functions. Our data suggest that SMAD7, an mice and humans (McGrath et al. 1995, Aaltonen et al. inhibitory SMAD, may preferentially inhibit TGFB1/GDF9-induced cumulus expansion-related transcripts in mouse granulosa cells. 1999) and plays a key role in normal follicular SMAD7 induced by TGFB1/GDF9 probably acts as a negative feedback development (Elvin et al. 1999, Orisaka et al. 2006). to limit TGFB1/GDF9 signaling, although its direct role in mediating Interestingly, our data indicated that knockdown of gene expression and cellular functions remains to be elucidated.

Reproduction (2013) 146 1–11 www.reproduction-online.org

Downloaded from Bioscientifica.com at 09/30/2021 02:55:34AM via free access Role of SMAD7 in ovarian granulosa cells 9

Smad7 in mouse granulosa cells significantly enhanced and/or fine-tuning essential TGFb superfamily signaling, GDF9-induced expression of Ptx3, which is a cumulus which is involved in the regulation of oocyte–somatic expansion-related transcript as well as a potential cell interaction and granulosa cell function. Therefore, granulosa cell marker of oocyte competence (Zhang targeting inhibitory SMAD signaling may represent a et al. 2005). In addition, induction of Tnfaip6 and Ptgs2 strategic approach to manipulate the TGFb signaling by GDF9 was potentiated in Smad7 siRNA-treated pathway in female reproduction. granulosa cells, suggesting increased GDF9 signaling activity in the absence of SMAD7. As enhanced oocyte paracrine signaling in ovarian somatic cells could Declaration of interest promote oocyte competence during in vitro maturation The authors declare that there is no conflict of interest that (IVM; Hussein et al. 2006), it is tempting to speculate could be perceived as prejudicing the impartiality of the that targeting Smad7 in a temporal and spatial manner research reported. could be potentially utilized to benefit oocyte develop- ment in assisted reproductive technology clinics. Despite the above findings, the functional requirement Funding for SMAD7 in mouse granulosa cells warrants further investigation using Smad7 mutant mouse models. This work is supported by Texas A&M College of Veterinary Currently, there are conflicting reports on the phenotype Medicine (CVM) graduate student award (to Y Gao) and Texas of Smad7 knockout mice, which is potentially due to A&M New Faculty Start-up Funds (to Q Li). incomplete SMAD7 loss-of-function in some mutant mice. Four Smad7 mutant mouse lines have been established (Li et al. 2006, Chen et al. 2009, Kleiter Acknowledgements et al. 2010, Tojo et al. 2012). Deletion of exon 1 of The authors thank Dr Gregory A Johnson for critical reading Smad7 gene (Li et al. 2006) results in a fertile phenotype. and editing of this manuscript. Another Smad7 knockout model was generated by deletion of exon 4 encoding the entire MH2 domain (Chen et al. 2009). Unlike the exon 1 knockout mice, the majority of Smad7 exon 4 knockouts died in utero References because of defective cardiovascular development (Chen Aaltonen J, Laitinen MP, Vuojolainen K, Jaatinen R, Horelli-Kuitunen N, et al. 2009). Two of the Smad7 mutant mouse lines were Seppa L, Louhio H, Tuuri T, Sjoberg J, Butzow R et al. 1999 Human growth differentiation factor 9 (GDF-9) and its novel homolog GDF-9B recently described (Kleiter et al. 2010, Tojo et al. 2012). are expressed in oocytes during early folliculogenesis. Journal of Clinical In one report, the promoter region and exon 1 of the Endocrinology and Metabolism 84 2744–2750. (doi:10.1210/jc.84.8. Smad7 gene were flanked by LoxP sites and could be 2744) Afrakhte M, Moren A, Jossan S, Itoh S, Sampath K, Westermark B, deleted upon Cre-mediated recombination. In contrast Heldin CH, Heldin NE & ten Dijke P 1998 Induction of inhibitory Smad6 to the previous reports, Smad7 homozygous mice and Smad7 mRNA by TGF-b family members. Biochemical and generated by this targeting strategy display complete Biophysical Research Communications 249 505–511. (doi:10.1006/ embryonic mortality, which suggests that deletion of the bbrc.1998.9170) Attisano L & Wrana JL 2002 Signal transduction by the TGF-b superfamily. promoter region and exon 1 of the Smad7 gene probably Science 296 1646–1647. (doi:10.1126/science.1071809) creates a null mutation (Kleiter et al. 2010). In the other Birkenkamp KU, Essafi A, van der Vos KE, da Costa M, Hui RC, Holstege F, report, disruption of both the MH2 domain and poly (A) Koenderman L, Lam EW & Coffer PJ 2007 FOXO3a induces signal sequence of Smad7 in mice causes either early differentiation of Bcr-Abl-transformed cells through transcriptional down-regulation of Id1. Journal of Biological Chemistry 282 postnatal mortality or growth retardation depending on 2211–2220. (doi:10.1074/jbc.M606669200) the genetic background of the mice (Tojo et al. 2012). Chang H, Brown CW & Matzuk MM 2002 Genetic analysis of the Despite the phenotypic variability of Smad7 mutant mammalian transforming growth factor-b superfamily. Endocrine Reviews 23 787–823. (doi:10.1210/er.2002-0003) mouse models, the overall results point to a role for Chen Q, Chen HY, Zheng DW, Kuang CZ, Fang H, Zou BY, Zhu WQ, SMAD7 in the essential processes of growth and Bu GX, Jin T, Wang ZZ et al. 2009 Smad7 is required for the development development. Results from the current study provide a and function of the heart. Journal of Biological Chemistry 284 292–300. rationale for further functional analysis, which would (doi:10.1074/jbc.M807233200) Chen HY, Huang XR, Wang WS, Li JH, Heuchel RL, Chung ACK & Lan HY allow for an unequivocal assessment of the role of 2011 The protective role of Smad7 in diabetic kidney disease: SMAD7 and its functional redundancy with SMAD6, if mechanism and therapeutic potential. Diabetes 60 590–601. (doi:10. any, in ovarian somatic cells. 2337/db10-0403) Chung ACK, Huang XR, Zhou L, Heuchel R, Lai KN & Lan HY 2009 In summary, our findings, together with a recent report Disruption of the Smad7 gene promotes renal fibrosis and inflammation that SMAD7 mediates TGFb-induced apoptosis in in unilateral ureteral obstruction (UUO) in mice. Nephrology, Dialysis, ovarian granulosa cells (Quezada et al. 2012), highlight Transplantation 24 1443–1454. (doi:10.1093/ndt/gfn699) SMAD7 as a potential regulator of ovarian function. DaCosta Byfield S, Major C, Laping NJ & Roberts AB 2004 SB-505124 is a selective inhibitor of transforming growth factor-b type I receptors ALK4, Results of this study suggest that SMAD7 may function ALK5, and ALK7. Molecular Pharmacology 65 744–752. (doi:10.1124/ during follicular development through antagonizing mol.65.3.744) www.reproduction-online.org Reproduction (2013) 146 1–11

Downloaded from Bioscientifica.com at 09/30/2021 02:55:34AM via free access 10 Y Gao and others

Dahlqvist C, Blokzijl A, Chapman G, Falk A, Dannaeus K, Ibanez CF & Ishisaki A, Yamato K, Hashimoto S, Nakao A, Tamaki K, Nonaka K, ten Lendahl U 2003 Functional notch signaling is required for BMP4- Dijke P, Sugino H & Nishihara T 1999 Differential inhibition of Smad6 induced inhibition of myogenic differentiation. Development 130 and Smad7 on bone morphogenetic protein- and activin-mediated 6089–6099. (doi:10.1242/dev.00834) growth arrest and apoptosis in B cells. Journal of Biological Chemistry Derynck R & Zhang YE 2003 Smad-dependent and Smad-independent 274 13637–13642. (doi:10.1074/jbc.274.19.13637) pathways in TGF-b family signalling. Nature 425 577–584. (doi:10.1038/ Juengel JL & McNatty KP 2005 The role of proteins of the transforming nature02006) growth factor-b superfamily in the intraovarian regulation of follicular Diaz FJ, Wigglesworth K & Eppig JJ 2007 Oocytes determine cumulus cell development. Human Reproduction Update 11 144–161. (doi:10.1093/ lineage in mouse ovarian follicles. Journal of Cell Science 120 humupd/dmh061) 1330–1340. (doi:10.1242/jcs.000968) Kitamura K, Aota S, Sakamoto R, Yoshikawa SI & Okazaki K 2000 Smad7 Dong J, Albertini DF, Nishimori K, Kumar TR, Lu N & Matzuk MM 1996 selectively interferes with different pathways of activin signaling and Growth differentiation factor-9 is required during early ovarian inhibits erythroid leukemia cell differentiation. Blood 95 3371–3379. folliculogenesis. Nature 383 531–535. (doi:10.1038/383531a0) Kleiter I, Song J, Lukas D, Hasan M, Neumann B, Croxford AL, Pedre X, Dragovic RA, Ritter LJ, Schulz SJ, Amato F, Thompson JG, Armstrong DT & Hovelmeyer N, Yogev N, Mildner A et al. 2010 Smad7 in T cells drives T Gilchrist RB 2007 Oocyte-secreted factor activation of SMAD 2/3 helper 1 responses in multiple sclerosis and experimental autoimmune signaling enables initiation of mouse cumulus cell expansion. Biology of encephalomyelitis. Brain 133 1067–1081. (doi:10.1093/brain/awq039) Reproduction 76 848–857. (doi:10.1095/biolreprod.106.057471) Korchynskyi O & ten Dijke P 2002 Identification and functional Edson MA, Nagaraja AK & Matzuk MM 2009 The mammalian ovary from characterization of distinct critically important bone morphogenetic genesis to revelation. Endocrine Reviews 30 624–712. (doi:10.1210/er. protein-specific response elements in the Id1 promoter. Journal of 2009-0012) Biological Chemistry 277 4883–4891. (doi:10.1074/jbc.M111023200) Edwards SJ, Reader KL, Lun S, Western A, Lawrence S, McNatty KP & Lee KY, Jeong JW, Wang J, Ma L, Martin JF, Tsai SY, Lydon JP & DeMayo FJ Juengel JL 2008 The cooperative effect of growth and differentiation 2007 Bmp2 is critical for the murine uterine decidual response. factor-9 and bone morphogenetic protein (BMP)-15 on granulosa cell Molecular and Cellular Biology 27 5468–5478. (doi:10.1128/MCB. function is modulated primarily through BMP receptor II. Endocrinology 00342-07) 149 1026–1030. (doi:10.1210/en.2007-1328) Li R, Rosendahl A, Brodin G, Cheng AM, Ahgren A, Sundquist C, Elvin JA, Clark AT, Wang P, Wolfman NM & Matzuk MM 1999 Paracrine Kulkarni S, Pawson T, Heldin CH & Heuchel RL 2006 Deletion of exon I actions of growth differentiation factor-9 in the mammalian ovary. of SMAD7 in mice results in altered B cell responses. Journal of Molecular Endocrinology 13 1035–1048. (doi:10.1210/me.13.6.1035) Immunology 176 6777–6784. Eppig JJ 2001 Oocyte control of ovarian follicular development and Li Q, Graff JM, O’Connor AE, Loveland KL & Matzuk MM 2007 SMAD3 function in mammals. Reproduction 122 829–838. (doi:10.1530/rep.0. regulates gonadal tumorigenesis. Molecular Endocrinology 21 1220829) 2472–2486. (doi:10.1210/me.2007-0147) Eppig JJ, Chesnel F, Hirao Y, O’Brien MJ, Pendola FL, Watanabe S & Li Q, McKenzie LJ & Matzuk MM 2008a Revisiting oocyte–somatic cell Wigglesworth K 1997 Oocyte control of granulosa cell development: interactions: in search of novel intrafollicular predictors and regulators of how and why. Human Reproduction 12 127–132. oocyte developmental competence. Molecular Human Reproduction 14 Galloway SM, McNatty KP, Cambridge LM, Laitinen MPE, Juengel JL, 673–678. (doi:10.1093/molehr/gan064) Jokiranta TS, McLaren RJ, Luiro K, Dodds KG, Montgomery GW et al. Li Q, Pangas SA, Jorgez CJ, Graff JM, Weinstein M & Matzuk MM 2008b 2000 Mutations in an oocyte-derived growth factor gene (BMP15) cause Redundant roles of SMAD2 and SMAD3 in ovarian granulosa cells in increased ovulation rate and infertility in a dosage-sensitive manner. vivo. Molecular and Cellular Biology 28 7001–7011. (doi:10.1128/MCB. Nature Genetics 25 279–283. (doi:10.1038/77033) 00732-08) Galvin KM, Donovan MJ, Lynch CA, Meyer RI, Paul RJ, Lorenz JN, Fairchild- Li Q, Rajanahally S, Edson MA & Matzuk MM 2009 Stable expression and Huntress V,Dixon KL, Dunmore JH, Gimbrone MA Jr et al. 2000 A role for characterization of N-terminal tagged recombinant human bone smad6 in development and homeostasis of the cardiovascular system. morphogenetic protein 15. Molecular Human Reproduction 15 Nature Genetics 24 171–174. (doi:10.1038/72835) Gilchrist RB, Ritter LJ, Myllymaa S, Kaivo-Oja N, Dragovic RA, Hickey TE, 779–788. (doi:10.1093/molehr/gap062) Ritvos O & Mottershead DG 2006 Molecular basis of oocyte-paracrine Li Q, Agno JE, Edson MA, Nagaraja AK, Nagashima T & Matzuk MM 2011 b signalling that promotes granulosa cell proliferation. Journal of Cell Transforming growth factor receptor type 1 is essential for female Science 119 3811–3821. (doi:10.1242/jcs.03105) reproductive tract integrity and function. PLoS Genetics 7 e1002320. Gilchrist RB, Lane M & Thompson JG 2008 Oocyte-secreted factors: (doi:10.1371/journal.pgen.1002320) regulators of cumulus cell function and oocyte quality. Human Li X, Tripurani SK, James R & Pangas SA 2012 Minimal fertility defects in Reproduction Update 14 159–177. (doi:10.1093/humupd/dmm040) mice deficient in oocyte-expressed Smad4. Biology of Reproduction 86 Gong X & McGee EA 2009 Smad3 is required for normal follicular follicle- 1–6. (doi:10.1095/biolreprod.111.094375) stimulating hormone responsiveness in the mouse. Biology of Reproduc- Liao JH, Chen JS, Chai MQ, Zhao S & Song JG 2001 The involvement of p38 tion 81 730–738. (doi:10.1095/biolreprod.108.070086) MAPK in transforming growth factor b1-induced apoptosis in murine Hata A, Lagna G, Massague J & Hemmati-Brivanlou A 1998 Smad6 inhibits hepatocytes. Cell Research 11 89–94. (doi:10.1038/sj.cr.7290072) BMP/Smad1 signaling by specifically competing with the Smad4 tumor Livak KJ & Schmittgen TD 2001 Analysis of relative gene expression data K suppressor.GenesandDevelopment12186–197.(doi:10.1101/gad.12.2.186) using real-time quantitative PCR and the 2( Delta Delta C(T)) method. Hayashi H, Abdollah S, Qiu Y, Cai J, Xu YY, Grinnell BW, Richardson MA, Methods 25 402–408. (doi:10.1006/meth.2001.1262) Topper JN, Gimbrone MA Jr, Wrana JL et al. 1997 The MAD-related Massague J 2000 How cells read TGF-b signals. Nature Reviews. Molecular protein Smad7 associates with the TGFb receptor and functions as an Cell Biology 1 169–178. (doi:10.1038/35043051) antagonist of TGFb signaling. Cell 89 1165–1173. (doi:10.1016/S0092- Matsubara H, Ikuta K, Ozaki Y, Suzuki Y, Suzuki N, Sato T & Suzumori K 8674(00)80303-7) 2000 Gonadotropins and cytokines affect luteal function through control Hayashi M, McGee EA, Min G, Klein C, Rose UM, van Duin M & Hsueh AJ of apoptosis in human luteinized granulosa cells. Journal of Clinical 1999 Recombinant growth differentiation factor-9 (GDF-9) enhances Endocrinology and Metabolism 85 1620–1626. (doi:10.1210/jc.85.4. growth and differentiation of cultured early ovarian follicles. Endo- 1620) crinology 140 1236–1244. (doi:10.1210/en.140.3.1236) Matzuk MM, Finegold MJ, Su JG, Hsueh AJ & Bradley A 1992 a-Inhibin is a Hollnagel A, Oehlmann V, Heymer J, Ruther U & Nordheim A 1999 Id tumour-suppressor gene with gonadal specificity in mice. Nature 360 genes are direct targets of bone morphogenetic protein induction in 313–319. (doi:10.1038/360313a0) embryonic stem cells. Journal of Biological Chemistry 274 McGrath SA, Esquela AF & Lee SJ 1995 Oocyte-specific expression of 19838–19845. (doi:10.1074/jbc.274.28.19838) growth/differentiation factor-9. Molecular Endocrinology 9 131–136. Hussein TS, Thompson JG & Gilchrist RB 2006 Oocyte-secreted factors (doi:10.1210/me.9.1.131) enhance oocyte developmental competence. Developmental Biology McNatty KP, Juengel JL, Reader KL, Lun S, Myllymaa S, Lawrence SB, 296 514–521. (doi:10.1016/j.ydbio.2006.06.026) Western A, Meerasahib MF, Mottershead DG, Groome NP et al. 2005

Reproduction (2013) 146 1–11 www.reproduction-online.org

Downloaded from Bioscientifica.com at 09/30/2021 02:55:34AM via free access Role of SMAD7 in ovarian granulosa cells 11

Bone morphogenetic protein 15 and growth differentiation factor 9 Sugiura K, Su Y-Q, Diaz FJ, Pangas SA, Sharma S, Wigglesworth K, co-operate to regulate granulosa cell function. Reproduction 129 O’Brien MJ, Matzuk MM, Shimasaki S & Eppig JJ 2007 Oocyte-derived 473–480. (doi:10.1530/rep.1.0511) BMP15 and FGFs cooperate to promote glycolysis in cumulus cells. Middlebrook BS, Eldin K, Li X, Shivasankaran S & Pangas SA 2009 Smad1– Development 134 2593–2603. (doi:10.1242/dev.006882) Smad5 ovarian conditional knockout mice develop a disease profile Tian X, Halfhill AN & Diaz FJ 2010 Localization of phosphorylated SMAD similar to the juvenile form of human granulosa cell tumors. proteins in granulosa cells, oocytes and oviduct of female mice. Gene Endocrinology 150 5208–5217. (doi:10.1210/en.2009-0644) Expression Patterns 10 105–112. (doi:10.1016/j.gep.2010.02.003) Mochizuki T, Miyazaki H, Hara T, Furuya T, Imamura T, Watabe T & Tojo M, Takebe A, Takahashi S, Tanaka K, Imamura T, Miyazono K & Miyazono K 2004 Roles for the MH2 domain of Smad7 in the specific Chiba T 2012 Smad7-deficient mice show growth retardation with inhibition of transforming growth factor-b superfamily signaling. reduced viability. Journal of Biochemistry 151 621–631. (doi:10.1093/jb/ Journal of Biological Chemistry 279 31568–31574. (doi:10.1074/jbc. mvs022) M313977200) Tomic D, Brodie SG, Deng C, Hickey RJ, Babus JK, Malkas LH & Flaws JA Nakao A, Afrakhte M, Moren A, Nakayama T, Christian JL, Heuchel R, 2002 Smad3 may regulate follicular growth in the mouse ovary. Biology Itoh S, Kawabata M, Heldin NE, Heldin CH et al. 1997 Identification of of Reproduction 66 917–923. (doi:10.1095/biolreprod66.4.917) Smad7, a TGFb-inducible antagonist of TGF-b signalling. Nature 389 Tomic D, Miller KP, Kenny HA, Woodruff TK, Hoyer P & Flaws JA 2004 631–635. (doi:10.1038/39369) Ovarian follicle development requires Smad3. Molecular Endocrinology Orisaka M, Orisaka S, Jiang JY, Craig J, Wang YF, Kotsuji F & Tsang BK 2006 18 2224–2240. (doi:10.1210/me.2003-0414) Growth differentiation factor 9 is antiapoptotic during follicular Tripurani SK, Cook RW, Eldin KW & Pangas SA 2012 BMP-specific SMADs development from preantral to early antral stage. Molecular Endo- function as novel repressors of PDGFA and modulate its expression in crinology 20 2456–2468. (doi:10.1210/me.2005-0357) ovarian granulosa cells and tumors. Oncogene [in press]. (doi:10.1038/ Otsuka F & Shimasaki S 2002 A negative feedback system between oocyte onc.2012.392) bone morphogenetic protein 15 and granulosa cell kit ligand: Its role in Vayalil PK, Iles KE, Choi J, Yi AK, Postlethwait EM & Liu RM 2007 regulating granulosa cell mitosis. PNAS 99 8060–8065. (doi:10.1073/ Glutathione suppresses TGF-b-induced PAI-1 expression by inhibiting pnas.122066899) p38 and JNK MAPK and the binding of AP-1, SP-1, and Smad to the PAI-1 Otsuka F, Yamamoto S, Erickson GF & Shimasaki S 2001 Bone promoter. American Journal of Physiology. Lung Cellular and Molecular morphogenetic protein-15 inhibits follicle-stimulating hormone (FSH) Physiology 293 L1281–L1292. (doi:10.1152/ajplung.00128.2007) action by suppressing FSH receptor expression. Journal of Biological Vitt UA, Hayashi M, Klein C & Hsueh AJW 2000 Growth differentiation Chemistry 276 11387–11392. (doi:10.1074/jbc.M010043200) factor-9 stimulates proliferation but suppresses the follicle-stimulating Otsuka F, McTavish KJ & Shimasaki S 2011 Integral role of GDF-9 and BMP- hormone-induced differentiation of cultured granulosa cells from small 15 in ovarian function. Molecular Reproduction and Development 78 antral and preovulatory rat follicles. Biology of Reproduction 62 9–21. (doi:10.1002/mrd.21265) 370–377. (doi:10.1095/biolreprod62.2.370) Pangas SA & Matzuk MM 2005 The art and artifact of GDF9 activity: Xu J, Oakley J & McGee EA 2002 Stage-specific expression of Smad2 and cumulus expansion and the cumulus expansion-enabling factor. Biology Smad3 during folliculogenesis. Biology of Reproduction 66 1571–1578. of Reproduction 73 582–585. (doi:10.1095/biolreprod.105.042127) (doi:10.1095/biolreprod66.6.1571) Pangas SA, Li X, Robertson EJ & Matzuk MM 2006 Premature luteinization Yan XH & Chen YG 2011 Smad7: not only a regulator, but also a cross-talk and cumulus cell defects in ovarian-specific Smad4 knockout mice. mediator of TGF-b signalling. Biochemical Journal 434 1–10. (doi:10. Molecular Endocrinology 20 1406–1422. (doi:10.1210/me.2005-0462) 1042/BJ20101827) Pangas SA, Jorgez CJ, Tran M, Agno J, Li X, Brown CW, Kumar TR & YanC,WangP,DeMayoJ,DeMayoFJ,ElvinJA,CarinoC,PrasadSV,SkinnerSS, Matzuk MM 2007 Intraovarian activins are required for female fertility. Dunbar BS, Dube JL et al. 2001 Synergistic roles of bone morphogenetic Molecular Endocrinology 21 2458–2471. (doi:10.1210/me.2007-0146) protein 15andgrowth differentiationfactor 9 inovarianfunction. Molecular Pangas SA, Li X, Umans L, Zwijsen A, Huylebroeck D, Gutierrez C, Endocrinology 15 854–866. (doi:10.1210/me.15.6.854) Wang D, Martin JF, Jamin SP, Behringer RR et al. 2008 Conditional b deletion of Smad1 and Smad5 in somatic cells of male and female Yan X, Liu Z & Chen Y 2009 Regulation of TGF- signaling by Smad7. Acta gonads leads to metastatic tumor development in mice. Molecular and Biochimica et Biophysica Sinica 41 263–272. (doi:10.1093/abbs/ Cellular Biology 28 248–257. (doi:10.1128/MCB.01404-07) gmp018) Quezada M, Wang J, Hoang V & McGee EA 2012 Smad7 is a transforming Yanagisawa M, Nakashima K, Takeda K, Ochiai W, Takizawa T, Ueno M, growth factor-b-inducible mediator of apoptosis in granulosa cells. Takizawa M, Shibuya H & Taga T 2001 Inhibition of BMP2-induced, Fertility and Sterility 97 1452.e1456–1459.e1456. (doi:10.1016/j. TAK1 kinase-mediated neurite outgrowth by Smad6 and Smad7. Genes fertnstert.2012.03.024) to Cells 6 1091–1099. (doi:10.1046/j.1365-2443.2001.00483.x) Reynolds LE, Conti FJ, Silva R, Robinson SD, Iyer V, Rudling R, Cross B, Yeo CX, Gilchrist RB, Thompson JG & Lane M 2008 Exogenous growth Nye E, Hart IR, Dipersio CM et al. 2008 alpha3beta1 integrin-controlled differentiation factor 9 in oocyte maturation media enhances subsequent Smad7 regulates reepithelialization during wound healing in mice. embryo development and fetal viability in mice. Human Reproduction Journal of Clinical Investigation 118 965–974. (doi:10.1172/JCI33538) 23 67–73. (doi:10.1093/humrep/dem140) Shimasaki S, Moore RK, Otsuka F & Erickson GF 2004 The bone Yoshino O, McMahon HE, Sharma S & Shimasaki S 2006 A unique morphogenetic protein system in mammalian reproduction. Endocrine preovulatory expression pattern plays a key role in the physiological Reviews 25 72–101. (doi:10.1210/er.2003-0007) functions of BMP-15 in the mouse. PNAS 103 10678–10683. (doi:10. Souchelnytskyi S, Nakayama T, Nakao A, Moren A, Heldin CH, Christian JL 1073/pnas.0600507103) & ten Dijke P 1998 Physical and functional interaction of murine and Yu PB, Hong CC, Sachidanandan C, Babitt JL, Deng DY, Hoyng SA, Lin HY, Xenopus Smad7 with bone morphogenetic protein receptors and Bloch KD & Peterson RT 2008 Dorsomorphin inhibits BMP signals transforming growth factor-b receptors. Journal of Biological Chemistry required for embryogenesis and iron metabolism. Nature Chemical 273 25364–25370. (doi:10.1074/jbc.273.39.25364) Biology 4 33–41. (doi:10.1038/nchembio.2007.54) Stopa M, Anhuf D, Terstegen L, Gatsios P, Gressner AM & Dooley S 2000 Zhang X, Jafari N, Barnes RB, Confino E, Milad M & Kazer RR 2005 Studies Participation of Smad2, Smad3, and Smad4 in transforming growth factor of gene expression in human cumulus cells indicate pentraxin 3 as a b (TGF-b)-induced activation of Smad7. THE TGF-b response element of possible marker for oocyte quality. Fertility and Sterility 83 (Suppl 1) the promoter requires functional Smad binding element and E-box 1169–1179. (doi:10.1016/j.fertnstert.2004.11.030) sequences for transcriptional regulation. Journal of Biological Chemistry 275 29308–29317. (doi:10.1074/jbc.M003282200) Su YQ, Sugiura K, Wigglesworth K, O’Brien MJ, Affourtit JP, Pangas SA, Received 7 March 2013 Matzuk MM & Eppig JJ 2008 Oocyte regulation of metabolic First decision 2 April 2013 cooperativity between mouse cumulus cells and oocytes: BMP15 and GDF9 control cholesterol biosynthesis in cumulus cells. Development Revised manuscript received 21 April 2013 135 111–121. (doi:10.1242/dev.009068) Accepted 30 April 2013 www.reproduction-online.org Reproduction (2013) 146 1–11

Downloaded from Bioscientifica.com at 09/30/2021 02:55:34AM via free access