(Betaglycan) in Mouse Ovary and Testis During Gonadogenesis

Growth Factors, October 2007; 25(5): 334–345

Differential expression of TGFBR3 (betaglycan) in mouse ovary and testis during gonadogenesis

MAI A. SARRAJ1,†, HUI KHENG CHUA1,‡, ALEXANDRA UMBERS1,{,KATEL. LOVELAND2,3,§, JOCK K. FINDLAY1,k, & KAYE L. STENVERS1

1Prince Henry’s Institute of Medical Research, P.O. Box 5152, Clayton, Vic. 3168, Australia, 2Monash Institute of Medical Research, Monash University, 27-31 Wright Street, Clayton, Vic. 3168, Australia, and 3The ARC Centre of Excellence in Biotechnology and Development, Melbourne, Vic., Australia

(Received 8 October 2007; revised 13 November 2007; accepted 27 November 2007)

Abstract TGFBR3 is an accessory receptor that binds to and modulates the activities of both transforming growth factor-beta (TGFb) and inhibin, two members of the TGFb superfamily of growth factors that regulate many aspects of reproductive biology. Tgfbr3 is known to be expressed in adult testis and ovary, but little is known about this receptor during gonadogenesis. Herein, we describe Tgfbr3 expression in the male and female fetal and neonatal murine gonad. Real-time PCR analysis revealed that Tgfbr3 mRNA was expressed at higher levels in the developing testis compared to ovary. TGFBR3 was expressed within the fetal testis interstitium, predominantly by Leydig cells, but expression shifted inside the seminiferous cords at birth. In contrast, TGFBR3 was detected in both the somatic and germ cell lineages in the fetal and neonatal ovary. This differential expression pattern suggests divergent roles for this TGFBR3 in developing testis and ovary.

Keywords: Betaglycan, TGFb type III receptor, inhibin, Leydig cell, gonadogenesis For personal use only.

Introduction testis under the control of the Y-chromosome Sry gene (Brennan et al. 2002). The seminiferous cords arise Male and female gonad differentiation in the mouse involves the coordinated behaviors of multiple cell when pre-Sertoli cells, the key support cells for the types over the fetal and neonatal developmental germ cells, migrate into the gonad from the coelomic periods. Beginning at 10.5 days post-coitum (dpc), epithelium and aggregate around the germ cells (Karl the genital ridge is colonized by primordial germ cells and Capel 1998). Peritubular cells migrate from the (PGCs). Proliferation of PGCs and somatic cells in adjacent mesonephros and cooperate with the Sertoli Growth Factors Downloaded from informahealthcare.com by University of Auckland on 10/26/14 the genital ridge gives rise to the bipotential gonad, cells to establish a basement membrane (Skinner et al. which ﬁrst becomes discernible from the underlying 1985; Nishino et al. 2001). This basement membrane mesonephros around 11.5 dpc. The testis and ovary delineates the cords, composed of Sertoli, peritubular become morphologically distinct between 12.0 and and germ cells, from the interstitium, which contains 12.5 dpc, when male-speciﬁc structures, the semi- stromal and fetal Leydig cells. During fetal develop- niferous cords and coelomic vessel, emerge within the ment, the testis grows rapidly due to the proliferation

Correspondence: K. L. Stenvers, Prince Henrys’ Institute of Medical Research, P.O. Box 5152, Clayton, Vic. 3168, Australia. Tel: 61 3 9594 4372. Fax: 61 3 9594 6125. E-mail: [email protected] †Tel: 61 3 9594 4372. Fax: 61 3 9594 6125. E-mail: [email protected] ‡Tel: 61 3 9594 4372. Fax: 61 3 9594 6125. E-mail: [email protected] {Tel: 61 3 9594 4372. Fax: 61 3 9594 6125. E-mail: [email protected] §Tel: 61 3 9594 7418. Fax: 61 3 9594 7111. E-mail: [email protected] kTel: 61 3 9594 4372. Fax: 61 3 9594 6125. E-mail: jock.ﬁ[email protected]

ISSN 0897-7194 print/ISSN 1029-2292 online q 2007 Informa UK Ltd. DOI: 10.1080/08977190701833619 Gonadal expression of TGFBR3 335

of the somatic cell populations. In contrast, the germ of germ and somatic cells of both ovary (Chuva de cells (also termed gonocytes) begin to undergo mitotic Sousa Lopes et al. 2005; Mendez et al. 2006) and arrest around 13.5 dpc and do not resume their testis (Meehan et al. 2000; Konrad et al. 2006) during proliferation until after birth, when they migrate to the development. The TGFbs also regulate the migration cord basement membrane and begin differentiating. and differentiation of multiple cell types in fetal testis Precise regulation of these morphological and cellular culture, which suggests that these factors may events during testis development is required for the influence the development of fetal testis morphology proper formation of the adult testis. In particular, the (Skinner and Moses 1989; Cupp et al. 1999; Konrad establishment of the populations of both the gonocytes et al. 2000). Specific roles for these growth factors in and their essential supporting cells, the Sertoli cells, gonadogenesis in vivo have not been reported but are during fetal and neonatal development determines suggested by the reproductive phenotypes reported for adult male reproductive function (for review, see Tgfb1, Tgfb2, Smad3, activin type II receptor (Acvr2), Loveland and Robertson 2005). inhibin-a (inha), and Inhbb null mice (Matzuk et al. Similarly, adult female reproductive capacity is 1992; Sanford et al. 1997; Tomic et al. 2004; Ma et al. thought to be determined during ovarian development 2005; Ingman et al. 2006; Yao et al. 2006; Ingman and when the populations of germ cells (or oogonia) and Robertson 2007) and for mice harboring a conditional key somatic cells (granulosa and theca cells) are ovary-specific knockout of Smad4 (Pangas et al. established. Between 10.5 and 13.5 dpc, both oogonia 2006). and ovarian somatic cells undergo proliferation. In addition to the signalling receptors, binding Around 13.5 dpc, the oogonia begin meiosis and proteins which modulate TGFb superfamily function differentiate into oocytes (Bullejos and Koopman are also present on many cell types. Of these, the 2004). The fetal oocytes associate with each other and TGFb type III receptor (TGFBR3), also known as with pre-granulosa cells, forming loosely-structured betaglycan, is the most abundant on many cell types ovigerous cords (Odor and Blandau 1969). The (Segarini et al. 1989). TGFBR3 is a membrane- clusters of oocytes are interconnected by intercellular bound proteoglycan which can bind TGFbs and cytoplasmic bridges and are considered “germ cell inhibins with high affinity and act as a non-signalling cysts”. During the early neonatal period, the germ cell accessory receptor for these growth factors cysts break down into primordial follicles, as the pre- (Lopez-Casillas et al. 1993; Lewis et al. 2000; Wiater granulosa cells grow between the oocytes and separate and Vale 2003). The presence of TGFBR3 on the cell them into discrete follicular units (Pepling and surface increases the binding of the TGFbs to their Spradling 2001). This process of neo-folliculogenesis type II receptors, an effect that is most pronounced for

For personal use only. occurs extensively in the neonatal period in rodents, TGFb2, which binds poorly to the TGFb type II establishing a pool of healthy primordial follicles, receptor in the absence of TGFBR3 (Lopez-Casillas which will serve as the main follicular reserve et al. 1993). TGFBR3 also signiﬁcantly increases the throughout life (Bristol-Gould et al. 2006; Kerr et al. function of inhibin as an antagonist of activin and the 2006). BMPs (Lewis et al. 2000; Wiater and Vale 2003). The Speciﬁc growth factors have been implicated in the role of TGFBR3 as a TGFb and inhibin co-receptor regulation of morphological events within the devel- appears essential in certain organs during embryonic oping testis and ovary. The transforming growth development, as Tgfbr3 null mice generally die during factor-beta (TGFb) superfamily is a multifunctional late gestation of heart and liver defects (Stenvers et al. group of growth factors which includes the TGFbs, 2003). In the adult, Tgfbr3 is widely expressed in many

Growth Factors Downloaded from informahealthcare.com by University of Auckland on 10/26/14 activins, inhibins, growth and differentiation factors organs, including the pituitary (MacConell et al. and bone morphogenetic proteins (BMPs). Several 2002; Chapman and Woodruff 2003), ovary (Lewis members of this superfamily participate in the et al. 2000; Drummond et al. 2002; MacConell et al. autocrine and paracrine regulation of many cellular 2002; Chapman and Woodruff 2003; Liu et al. 2003), events underlying gonad development and function, and testis (Lewis et al. 2000). These data suggest that including cellular proliferation, differentiation, TGFBR3 modulates the extragonadal and intragona- adhesion, migration and extracellular matrix pro- dal actions of its ligands in the adult reproductive duction. The diverse activities of TGFb superfamily system, a conclusion which is supported by a recent members are mediated by pairs of serine/threonine report linking mutations in the human Tgfbr3 gene to kinase receptors which form heteromeric complexes in premature ovarian failure (Dixit et al. 2006). In which the type II receptor is necessary for binding addition, the few Tgfbr3 null male and female mice ligand and the type I receptor is necessary for signal which survive to sexual maturity exhibited poor transduction. Signal transduction is mediated by the fertility (Stenvers et al. 2003), suggesting that intracellular family of molecules, the Mothers against TGFBR3 is essential to reproductive processes in decapentaplegic-homologs (SMADs) (for review, see both sexes. However, these studies examined the Shi and Massague 2003). The TGFbs (TGFb1–3), effects of germline mutations in the Tgfbr3 gene on activins and inhibins, affect the proliferation and death adult reproductive capacity. Therefore, it is currently 336 M. A. Sarraj et al.

unclear in which organ and at which stage of mix (Scoresby, Victoria, Australia). PCR was per- development that Tgfbr3 is essential for normal formed using the Applied Biosystems ABI 7900 HT reproductive function. To gain a better understanding Fast real-time machine. Cycling conditions comprised of this receptor in reproductive biology, we character- of a 10 min initial denaturation step at 958C, then 40 ized the expression patterns of the Tgfbr3 gene in cycles of denaturing (958C for 15 s), annealing (558C murine ovary and testis at different stages of fetal and for 30 s) and elongation (728C for 30 s). The Tgfbr3 postnatal development. Although limited studies have primers used for RT-PCR were Tgfbr3 forward been conducted previously in developing rat (50-CCTCCTCCACAGATTTTCCA-30)andTgfbr3 (Le Magueresse-Battistoni et al. 1995; Drummond reverse (50- CCCAGATCAAGCCTTCTGAG -30). et al. 2002) and human gonad (Anderson et al. 2002), The primers amplified a fragment spanning an this is the first study to examine the mRNA and intron-exon junction of the mouse Tgfbr3 gene protein expression patterns of this receptor through- (AF039601), ensuring that the amplified products out gonadal development in the mouse, from 12.0 dpc were not genomic in origin. 18S primers until 15 days post partum (dpp). (NR_003278.1) 18S forward (50- GTAACCCGTT- GAACCCCATT-30) and 18S reverse (50- CCATCC- AATCGGTAGTAGCG -30) were taken from Schmitt- Materials and methods gen and Zakrajsek (2000). The PCR products were Tissue collection and processing verified by cloning and sequencing. Three different sets of cDNA pools were used to perform replicates Mouse embryos from timed matings of CD1 or each comprising of seven to ten pairs of gonads from C57/B6 X sv129 female mice were obtained from each sex. PCR reactions were performed in triplicate pregnant dams between 12.0 and 16.5 dpc in half-day with negative controls, where water was used in place of increments, with noon on the day of vaginal plugging the reverse-transcribed template, included for each designated as 0.5 dpc. To validate the TGFBR3 primer pair to exclude PCR amplification of contami- antibody, wildtype (WT) and knockout littermates nating DNA. Tgfbr3 mRNA levels were normalized to were obtained from a Tgfbr3 null mouse colony and that of 18S as previously described in detail (Sarraj et al. genotyped as previously described (Stenvers et al. 2007). Analysis was performed using the DDCT 2003). Embryos were sexed by morphology and PCR method, and statistical analysis was performed using (McClive and Sinclair 2001). Neonatal and prepu- one way Analysis of variance (ANOVA). bertal mice at 0 (day of birth), 2, 4, 5, 8, 10, 12 and 15 dpp were examined. In addition, the 30 dpp ovary was Immunofluorescence

For personal use only. used as a positive control. For RT-PCR, gonads were dissected away from mesonephroi and frozen at Embryonic gonad tissues (12.0–14.5 dpc) were fixed 2808C until RNA was extracted. For histology, in 4% paraformaldehyde at 48C for 10 min, incubated urogenital systems were isolated from the embryos in 20% sucrose overnight at 48C, and embedded in an and neonates and were fixed in 4% paraformaldehyde, OCT-sucrose medium for frozen sectioning (8 mm). as detailed below. All animal handling and exper- For fetal ages over 14.5 dpc and postnatal ages, 4% imental procedures were approved by the Monash paraformaldehyde-fixed, paraffin-embedded tissues Medical Centre Animal Ethics Committee. were used, and an antigen retrieval step was added, utilizing a commercially available antigen-unmasking reagent according to the manufacturer’s instructions Real-time polymerase chain reaction (PCR) analysis

Growth Factors Downloaded from informahealthcare.com by University of Auckland on 10/26/14 (DAKO). Experiments were performed on at least Total RNA was extracted from isolated gonads three mice of each sex and age. For immunofluores- dissected free from the mesonephroi of fetal and cence, frozen sections were air dried at room neonatal mice using the RNeasy kit (Qiagen, temperature briefly then treated with 1% Triton-X Australia), as recommended by the manufacturer’s in phosphate buffered saline (PBS) for 10 min at room protocol. Contaminating DNA was removed from temperature and rinsed with PBS. Sections were the RNA preparations using the DNA-freee kit blocked with 5% donkey serum in PBS, and incubated (Ambion, TX, USA). RNA was quantified using overnight at 48C with antibodies against TGFBR3 the ND-1000 Nanodrop spectrophotometer raised in goat (R&D Systems Cat# AF-242-PB; 1:50 (NanoDrop technologies Inc., Wilmington, DE, dilution). Sections were then washed with PBS then USA). Complementary DNA was synthesized using incubated with a donkey anti-goat Alexa Fluor 488- Superscripte III Reverse Transcriptase (Life Tech- conjugated secondary antibody for detection (Mol- nologies, Grand Island, NY) using random hexamer ecular Probes; donkey anti-goat; 1:200). Cell nuclei and oligo d(T)20 primers, as previously described were visualized with either 40,6-diamidino-2phenyli- (Sarraj et al. 2005). dole-dihydrochloride (DAPI; Roche) or TO-PRO PCR samples were prepared to a final volume of (Invitrogen). Slides were mounted in Fluorosave 10 ml using the Applied Biosystems ABI SYBR Mounting Medium (Calbiochem). Images were Gonadal expression of TGFBR3 337

captured on an Olympus FV300/IX81 confocal or BX60 upright fluorescent microscope. The TGFBR3 antibody was validated by performing assays in parallel on WT and knockout littermates from the Tgfbr3 gene knockout mouse line. Additional negative controls included incubating WT sections with the primary or secondary antibody alone or with goat IgG. Assessments of the relative levels of immunostaining were made on sections processed within the same assay and imaged under the same conditions. For co- localization experiments with TGFBR3 antibody, an antibody raised in rabbit against CYP11A1/P450-Side chain cleavage (Scc) enzyme (Chemicon Cat# AB1294) was used at a dilution of 1:400. Mouse MVH Homologue (MVH) antibody (Abcam Figure 1. Tgfbr3 mRNA in the fetal and neonatal mouse gonad. Cat#ab13840) was raised in rabbit and used at a Quantitative real-time PCR analysis demonstrates the relative levels dilution of 1:1000. CYP11A1/P45-Scc and MVH of Tgfbr3 mRNA in male (black bars) and female gonads (white signals were detected using a donkey anti rabbit Cy3 bars) during development. The Y-axis represents the expression of secondary antibody (Chemicon cat#AP182C, 1:200). Tgfbr3 mRNA relative to 18S RNA levels, with values normalized to All antibodies were diluted in 1% bovine serum the corrected level in 12.5 dpc testis. The graph is representative of replicates obtained using three separate pools of gonads for each age albumin in PBS prior to use. and sex. Data are shown as the mean ^ SEM. Means marked by (a) are not significantly different from each other; means marked by (b) are significantly different from means marked by (a) and (c) at p , 0.05. Results Tgfbr3 mRNA and protein expression during testis several fetal and neonatal ages. Data from these morphogenesis analyses are summarized in Table I. To assess antibody During fetal development, similar levels of Tgfbr3 specificity, WT and Tgfbr3 null fetal gonad sections expression were measured in gonads of both sexes were processed in parallel, and this analysis revealed between 12.5 and 14.5 dpc. Expression significantly no TGFBR3 immunostaining in the null gonad increased in the testis during late gestation and at (Figure 2). In addition, in each assay, adjacent For personal use only. birth, with the newborn testis exhibiting a 3-fold sections were processed with primary or secondary increase over the levels observed in 12.5 dpc testes antibodies alone (data not shown) or with goat IgG as (Figure 1). Tgfbr3 expression in the ovary differed an isotype control (Figures 3F and 5F) in order to from the testis in that levels did not significantly determine the specific signal over background. In the change between 12.5 and 16.5 dpc. The level of fetal testis from 12.5 to 16.5 dpc, TGFBR3 expression in ovary was also significantly less than that immunostaining was predominantly localized to cells in testis at 16.5 dpc and 0 dpp (Figure 1). However, in the coelomic epithelium and coelomic vessel like the newborn testis, the newborn ovary also (Figure 2A) and within the testicular interstitium exhibited a significant increase in Tgfbr3 mRNA on the (Figures 2A and 3A–E). Between 13.5 and 16.5 dpc, day of birth compared to fetal ages (Figure 1). peritubular cells around the cords also showed Growth Factors Downloaded from informahealthcare.com by University of Auckland on 10/26/14 To determine the cellular localization of TGFBR3 TGFBR3 immunostaining (Figures 2A and 3B– protein in developing gonads, immunofluorescent C,E). Cells within the seminiferous cords of the fetal histochemistry was performed on gonad sections from testis generally showed no immunostaining between

Table I. Summary of TGFBR3 expression in developing gonad.

Testis 12.5 dpc 13.5 dpc 14.5 dpc 16.5 dpc 0 dpp 5 dpp 15 dpp

Leydig cells þ þþþ þþþ þþþ þþþ þþþ þþþ Peritubular cells þ þþþþþþþþþ Germ cells – – – – þþ þþ þþ Sertoli cells – – – – þþþ þþþ þ Ovary 12.5 dpc 13.5 dpc 14.5 dpc 16.5 dpc 0 dpp 5 dpp 15 dpp Somatic cells þþ þþ þþ þþ NA NA NA Oogonia/oocyte þ þþ þþ þþ þþþ þþþ þþþ Granulosa cells NA NA NA NA – þþþ Thecal cells NA NA NA NA NA – –

þ¼low; þþ ¼ moderate; þþþ ¼ high expression; – ¼ not detected; NA ¼ not applicable. 338 M. A. Sarraj et al.

12.5 and 16.5 dpc (Figure 3A–E). At birth, the TGFBR3 expression pattern changed as TGFBR3 immunostaining became readily detectable within the seminiferous cords (Figure 3G–H). In the cords, TGFBR3 appeared to be localized to the Sertoli cell cytoplasm and to some of the gonocytes, spermatogonia, and spermatocytes from birth through 15 dpp (Figure 3G–L). By 15 dpp (Figure 3J–L), Figure 2. Validation of the TGFBR3 antibody. Standard TGFBR3 expression within the Sertoli cells appeared fluorescencemicroscopyshowsthepresenceofTGFBR3 reduced compared to neonatal levels. A subset of cells immunostaining (green fluorescence) in WT testis but not in the within the testicular interstitium expressed TGFBR3 Tgfbr3 null (KO) testis. DAPI (blue fluorescence) was used to throughout all postnatal ages examined, including counterstain the cell nuclei. Dotted lines indicate the boundaries of seminiferous cords; open arrowheads, the coelomic blood vessel; large cells with the morphology of adult Leydig cells closed arrowheads, the coelomic epithelium; In, interstitium. Scale (Figure 3K). bar ¼ 50 mm and pertains to both images. To determine which cell lineages express TGFBR3 in the fetal testis, testis sections were processed in For personal use only. Growth Factors Downloaded from informahealthcare.com by University of Auckland on 10/26/14

Figure 3. Immunolocalization of TGFBR3 in the developing mouse testis. A–L: Single confocal testis sections show TGFBR3 immunostaining (green ﬂuorescence) in fetal (A–E) and postnatal testis (G–L). Testis tissue incubated with goat IgG as an isotype negative control is shown in (F). TO-PRO (red ﬂuorescence) was used to counterstain the cell nuclei. Dotted lines indicate the boundaries of seminiferous cords; In, interstitium; open arrowheads, peritubular cells; arrows, Leydig cells; asterisk, Sertoli cell cytoplasm; white arrowheads indicate gonocytes in G–H, spermatogonia in I, L; Sp, spermatocytes. All scale bars ¼ 50 mm except in H and L, where the scale bars ¼ 25 mm. Gonadal expression of TGFBR3 339 For personal use only.

Figure 4. Co-localization of TGFBR3 with germ and somatic cell markers in testis. Double labelling immunofluorescence was conducted on testis tissues to demonstrate TGFBR3 (green fluorescence) co-localization with the germ cell marker MVH (red fluorescence in B–C, E–F, K–L) or the Leydig cell marker CYP11A1/P450-Scc (red fluorescence in H–I). The merged signals (yellow in C, F, I and L) are superimposed on a lightfield image of the section to show tissue structure. Dotted lines indicate the boundaries of seminiferous cords; In, interstitium; open arrowheads, somatic cells; asterisk, Sertoli cell cytoplasm. Scale bar ¼ 50 mm and pertains to all images.

Growth Factors Downloaded from informahealthcare.com by University of Auckland on 10/26/14 double labelling immunofluorescence assays using the enzyme which catalyzes the conversion of antibodies against TGFBR3 in conjunction with cell- cholesterol to pregnenolone in mitochondria of type specific markers. This analysis revealed that in the steroidogenic cells. In contrast to the fetal expression fetal testis, TGFBR3 immunostaining did not co- pattern, on the day of birth, TGFBR3 expression was localize the germ cell marker, MVH (Figure 4A–F). detected in the Sertoli cell cytoplasm and within some At 12.0 dpc, as the germ cells are first forming of the MVH-positive gonocytes (Figure 4J–L), and this aggregates, TGFBR3 expression was localised to pattern of expression in both the somatic and germ cell somatic cells in close association with MVH-positive lineages continued until 15 dpp (Figure 3I–L). germ cells (Figure 4A–C). Once the germ cells were enclosed inside the seminiferous cords (which can be Tgfbr3 mRNA and protein expression during ovary seen as early as 12.5 dpc, see, e.g. Figure 3A) morphogenesis TGFBR3 immunostaining was detected nearly exclu- sively within peritubular cells and interstitial cells, From 12.5 to 16.5 dpc, TGFBR3 immunostaining with no TGFBR3 localizing to MVH-positive cells was present within ovarian somatic cells and in large (Figure 4D–F). The interstitial cells staining positive cells with the rounded morphology of oogonia TGFBR3 also stained positive for the Leydig (Figure 5). Most of the immunostained oogonia cell marker, CYP11A1/P450-Scc (Figure 4G–I), were scattered throughout the ovary, but occasionally 340 M. A. Sarraj et al.

Figure 5. Immunolocalization of TGFBR3 in the developing mouse ovary. Single confocal sections demonstrate TGFBR3 immunostaining (green ﬂuorescence) in mouse ovary at selected fetal (A–C) and postnatal (D–I) ages between 12.5 dpc and 30 dpp. Ovary tissue incubated with goat IgG as an isotype negative control is shown in (F). TO-PRO (red ﬂuorescence) was used to counterstain cell nuclei. Arrows in A–C indicate oogonia and oocytes; in D, germ cell cysts; and in E–F, forming primordial follicles. Asterisks in G indicate cuboidal granulosa cells and in H–I, granulosa cells of growing follicles. In, interstitium; Oo, oocytes; Th, theca. All scale bars ¼ 50 mm. For personal use only.

several positive-staining oogonia were located close ovary (Figure 6A–L). At all fetal ages, only a together in clusters (Figure 5A–C). In contrast, subpopulation of oogonia and oocytes expressed between the day of birth and 5 dpp, when germ cell TGFBR3 (Figure 6A–I), although at 13.5–14.5 dpc cysts break down into primordial follicles in the (Figure 6A–F) more oogonia and oocytes exhibited mouse, virtually all of the oocytes expressed TGFBR3 staining for TGFBR3 and MVH than at either 12.5 (Figure 5D–E). Of the somatic cell lineages, the dpc (data not shown) or 16.5 dpc (Figure 6G–I). squamous granulosa cells of the neonatal primordial Virtually all oocytes from the day of birth (Figure 6J– follicles did not express TGFBR3 (Figure 5E). L) onwards (data not shown) exhibited TGFBR3 and

Growth Factors Downloaded from informahealthcare.com by University of Auckland on 10/26/14 However, differentiating granulosa cells in growing MVH co-localization. follicles expressed TGFBR3 (Figure 5G–I). TGFBR3 immunostaining was observed within Discussion granulosa cells as soon as they began to adopt the cuboidal shape that marked the transition of the The current study demonstrates that Tgfbr3 is primordial follicles into primary follicles and the onset differentially expressed in the male and female gonads of follicular growth (Figure 5G). Throughout the during murine development. Tgfbr3 transcript and neonatal and pre-pubertal periods, oocytes and protein levels increased with age in the male gonad granulosa cells of primary, secondary and preantral while levels in the fetal ovary were relatively steady follicles expressed TGFBR3, but little expression until the day of birth, when Tgfbr3 expression was localized to thecal cells during the developmental signiﬁcantly increased in both sexes. Tgfbr3 was window examined (Figure 5H–I). Isolated cells within expressed in different cell lineages in male and female the ovarian interstitium showed moderate to low fetal gonad, suggesting that TGFBR3 has gender- TGFBR3 expression at all postnatal ages examined speciﬁc roles during gonadal development. TGFBR3 (Figure 5D–I). MVH and TGFBR3 co-immunos- has been demonstrated to be an accessory receptor for taining was used to verify that cells of germ cell lineage both TGFb and inhibin, increasing the binding of expressed TGFBR3 in the fetal and neonatal mouse these ligands to TGFb and activin/BMP type II Gonadal expression of TGFBR3 341 For personal use only.

Figure 6. Co-localization of TGFBR3 with a germ cell marker in ovary. Single confocal sections demonstrate TGFBR3 immunostaining (green fluorescence) in fetal (A–I) and neonatal (J–L) mouse ovary. Double labelling immunofluorescence was conducted with the germ cell marker MVH (red fluorescence) to demonstrate TGFBR3 co-localization (yellow fluorescence in C, F, I and L). Arrows indicate oogonia and oocytes which immunostain for both TGFBR3 and MVH. Asterisks, somatic cells. Scale bar ¼ 50 mm and pertains to all images.

Growth Factors Downloaded from informahealthcare.com by University of Auckland on 10/26/14 receptors, respectively (Lopez-Casillas et al. 1993; and the in vitro actions of these growth factors in Lewis et al. 2000; Wiater and Vale 2003). During primary gonadal cultures. gonadal development, TGFBR3 is coordinately TGFBR3 is dynamically expressed during testis expressed with its ligands and their type I and II development, with predominant expression ﬁrst receptors in speciﬁc gonadal cell populations, indicat- localized to the interstitial compartment of the fetal ing that TGFBR3 may modulate both TGFb- and testis, and then shifting to the seminiferous cords at inhibin-mediated processes. However, the in vivo roles birth. The fetal testis interstitium and fetal Leydig of the TGFbs and inhibins during early gonadogenesis cells, in particular, appear to be important targets for are poorly understood. Despite the presence of the TGFbs and activins, as type I and II TGFb and reproductive phenotypes in Tgfb1 (Ingman et al. activin receptors have been detected on these cell 2006; Ingman and Robertson 2007), Tgfb2 (Sanford types in fetal rat and human testis (Olaso et al. 1998; et al. 1997), and inhibin-a knockout mice (Matzuk Anderson et al. 2002). In the current study, TGFBR3 et al. 1992), no detailed analyses of the fetal gonads in was localized to fetal Leydig cells during early testis any of these mutants have been reported. The current development, and the increase in the level of TGFBR3 results on Tgfbr3 expression are discussed below expression throughout fetal testis development was relative to the literature on the expression patterns of largely due to the increase in the number of TGFBR3- the TGFBR3 ligands and their type I and II receptors positive Leydig cells after 12.5 dpc. During fetal 342 M. A. Sarraj et al.

development, TGFBR3 may modulate both autocrine Although a direct role of TGFBR3 in testis cord and paracrine actions of its ligands on fetal Leydig formation is currently speculative, a 69-fold increase cells. All three TGFb isoforms are expressed in the in Tgfbr3 transcript levels has previously been reported developing rodent testis, by fetal Leydig, Sertoli, germ in the adult testis of a seasonal-breeding species of and peritubular cells (for review, see Olaso and Habert mouse speciﬁcally during a period of rapid morpho- 2000). Inhibin-a and bB subunits are also co- logical change (Pyter et al. 2005). expressed beginning at 14.5 dpc in fetal rat Leydig TGFBR3 expression continues in the interstitial and Sertoli cells, indicating that these cell types could compartment of the testis during the neonatal period, produce inhibin B and activin B (Majdic et al. 1997). with sustained high expression by Leydig cells. In In vitro, TGFbs, activins, and inhibins have been addition, TGFBR3 becomes highly expressed within reported to regulate Leydig cell proliferation and the seminiferous cords at birth. These ﬁndings are in steroidogenesis, with the TGFbs acting to inhibit both accordance with a previous study which detected processes in differentiated Leydig cells (Hsueh et al. transcripts encoding all three TGFb receptor subtypes 1987; Risbridger et al. 1989; Gautier et al. 1997; in 10–90 dpp rat testis by Northern blot analysis, with Olaso et al. 1999). As fetal Leydig cells are essential the highest expression detected in immature testis in for the production of androgens which drive mascu- Leydig-enriched, Sertoli, peritubular and germ cell linization of the murine fetus (O’Shaughnessy et al. fractions (Le Magueresse-Battistoni et al. 1995). The 2006), the function of TGFBR3 in fetal testis may coincident expression of all three TGFb receptor impact upon the production of these key steroidal subtypes by multiple cell types in postnatal testis hormones and their downstream effects on the male suggests that the TGFbs are important regulators of reproductive tract. postnatal testis growth and maturation. TGFBR3 may TGFBR3 may also regulate the behavior of other directly contribute to the regulation of spermatogen- fetal cell types during testis differentiation and esis, as gonocytes express TGFb type I–III receptors maturation. Notably, the expression of TGFBR3 in and the TGFbs regulate mitosis, death, and differen- the coelomic vessel and somatic cells closely associ- tiation of gonocytes in vitro. Rodent gonocytes are ated with the forming cords from 12.0 to 14.5 dpc quiescent during late gestation but re-enter the cell suggests that TGFBR3 may play a role in the cycle around 1–3 dpp. In cultures of rat testis establishment of fetal testis structure. Data from fragments, these mitotically active gonocytes undergo in vitro studies indicate that the TGFbs regulate apoptosis in response to TGFb (Olaso et al. 1998) somatic cell proliferation, death, migration, and while activin increases the number of gonocytes aggregation in fetal testis (Skinner and Moses 1989; directly after birth and inhibits gonocyte differen-

For personal use only. Gautier et al. 1997; Cupp et al. 1999; Konrad et al. tiation into spermatogonia (Meehan et al. 2000). 2000), as well as germ cell proliferation and survival Apoptosis is postulated to contribute to the morpho- (Olaso et al. 1998). Activated Smad2, a downstream genesis of the seminiferous cords by ensuring that signaling molecule of TGFb and activin, was detected germ cell numbers are appropriately balanced to the in both somatic and germ cell lineages in 12.5 dpc number of supporting Sertoli cells (for review, see mouse gonad (Chuva de Sousa Lopes et al. 2005), Itman et al. 2006). TGFBR3 may contribute to the suggesting that TGFb and/or activin act on both negative control of germ cell number and the lineages at the time of cord formation. TGFb2isof promotion of germ cell maturation as the presence particular interest in fetal testis development because of this receptor on postnatal gonocytes would be it is locally produced within rat testis Sertoli cells from anticipated to affect both TGFb- and (via inhibin)

Growth Factors Downloaded from informahealthcare.com by University of Auckland on 10/26/14 13.5 dpc onwards (Olaso and Habert 2000) and has activin-mediated processes. been found to enhance aggregation of Sertoli cells in Since Sertoli cell number directly impacts on germ co-cultures with peritubular cells (Konrad et al. cell survival and maturation, TGFBR3 may also 2000). These data suggest that TGFb2 may be a inﬂuence spermatogenesis by regulating the actions of paracrine signal in fetal testis, originating from Sertoli its ligands on Sertoli cells in postnatal testis. Type I cells and acting on TGFBR3-expressing interstitial and II receptors for TGFb and activin have been and peritubular cells, to coordinate cell–cell inter- reported on neonatal and pre-pubertal Sertoli cells in actions during testis morphogenesis. In support of this rat (Le Magueresse-Battistoni et al. 1995; Buzzard hypothesis, preliminary observations of the Tgfbr3 null et al. 2003), and the current study has shown that fetal gonads revealed that testis morphology is TGFBR3 is abundantly expressed in immature mouse disrupted between 12.5 and 13.5 dpc (M.A. Sarraj, Sertoli cells during a window of their development H.K. Chua, A. Umbers, K.L. Loveland, J.K. Findlay, from birth until 15 dpp. During this phase of and K.L. Stenvers, unpublished observations). How- development, immature Sertoli cells are rapidly ever, TGFb signalling receptors have only been proliferating. An apparent decrease in TGFBR3 detected on germ and Leydig cells in fetal testis expression in Sertoli cells at 15 dpp coincides with (Olaso et al. 1998), and the mechanism by which the the cessation of proliferation and the onset of Sertoli lack of Tgfbr3 disrupts cord formation is not yet clear. cell maturation and spermatogenesis (for review, see Gonadal expression of TGFBR3 343

Loveland and Robertson 2005). This suggests that significantly increase the number of primordial TGFBR3 is particularly important to immature follicles generated during this period, a process linked Sertoli cell biology but not to maturing or differ- to an activin-mediated increase in germ cell and entiated Sertoli cells. This conclusion is in agreement somatic cell proliferation (Bristol-Gould et al. 2006). with studies which have failed to detect Tgfbr3 In addition, in human fetal ovaries, both the type I and expression in adult Sertoli cells (Lewis et al. 2000; II TGFb receptors, as well as all of the TGFb MacConell et al. 2002; Konrad et al. 2006). isoforms, are highly expressed in oocytes and In contrast to the developing testis, TGFBR3 was moderately expressed in supporting granulosa cells detected in both germ cell and somatic cell lineages in during the second trimester (14–24 weeks) of mouse ovary throughout fetal and neonatal develop- gestation (Schilling and Yeh 1999) when neofollicu- ment. This indicates that TGFBR3 plays different logenesis is occurring in humans (Forabosco and roles in ovary than in testis, particularly in the germ Sforza 2007). These studies suggest that the TGFbs cell lineage. Reports are conflicting as to whether may also regulate the process of follicle formation; inhibins are produced in fetal ovary (Majdic et al. TGFBR3 on oocytes may be required for TGFb or 1997; Kang et al. 2003; Weng et al. 2006). However, inhibin to optimally counterbalance the stimulatory TGFb1 and TGFb2 have been detected by immuno- effects of activin on this process. histochemistry in rat ovarian somatic cells from 14.5 After primordial follicle formation, a subset of the dpc through gestation (Levacher et al. 1996). In primordial follicles begins to grow and differentiate in addition, activated Smad2 was detected in the the human fetal (Forabosco and Sforza 2007) and 12.5 dpc murine gonad in both germ cell and somatic rodent neonatal periods (Drummond et al. 2003; Kerr cell lineages, suggesting that TGFb may act on both et al. 2006). Crosstalk between oocytes and granulosa lineages (Chuva de Sousa Lopes et al. 2005). This cells is believed to coordinate the differentiation, conclusion is supported by the expression of the type I growth, and maturation of ovarian follicles, with and II TGFb receptors and the three TGFbs in both multiple members of the TGFb superfamily taking germ and somatic cell populations in human fetal part in the regulation of these processes (for review, ovary (Schilling and Yeh 1999). A recent study see Juengel and McNatty 2005). All components of showed that TGFb1 and TGFb2 inhibit somatic cell the TGFb and activin/inhibin signalling systems are proliferation in embryonic chick ovary organ cultures expressed during the mammalian postnatal period, without affecting oogonia proliferation or death, although there are cell-, age- and species-specific although the migration of germ cells was altered differences (for review, see Drummond et al. 2003; (Mendez et al. 2006). In mice lacking the type I TGFb Juengel and McNatty 2005). In the neonatal period,

For personal use only. receptor, PGC migration was altered but not PGC granulosa cells may be the direct targets of TGFb, proliferation or death (Chuva de Sousa Lopes et al. activin and inhibin. The type I and II activin and 2005), suggesting that the TGFbs may play similar TGFb receptors have been detected on granulosa cells roles in the fetal chick and murine ovary, regulating in postnatal rodent ovary, and the TGFbs negatively somatic cell proliferation and germ cell migration. regulate proliferation and steroidogenesis in these cells The presence of TGFBR3 on both somatic and germ in vitro (Drummond et al. 2002; Juengel and McNatty cells in fetal ovary suggests TGFBR3 could serve as a 2005). TGFBR3 on both oocytes and granulosa cells TGFb accessory receptor on both oogonia and may contribute to the regulation of follicle maturation somatic cells. However, preliminary examination of during this period of development. TGFBR3 immu- the Tgfbr3 null ovary indicates no overt morphological nostaining was intense in oocytes, from the day of

Growth Factors Downloaded from informahealthcare.com by University of Auckland on 10/26/14 phenotype at 12.5–14.5 dpc, indicating that birth. TGFBR3 expression was also detected at TGFBR3 may not play an essential role in establishing moderate levels on granulosa cells throughout the ovarian structure at this time (M.A. Sarraj, H.K. postnatal period examined. Notably, TGFBR3 was Chua, A. Umbers, K.L. Loveland, J.K. Findlay, and not detected on the squamous granulosa cells of the K.L. Stenvers, unpublished observations). primordial follicles but on the cuboidal granulosa cells In the newborn mouse ovary, the level of Tgfbr3 of growth-initiated follicles from the time of their expression increased and was detected predominantly differentiation, suggesting that TGFBR3 may take in oocytes. Perinatally, the oocytes are associated in part in granulosa cell differentiation and maturation. germ cell cysts, which are in the process of breaking Of interest, Tgfbr3 mRNA expression is increased by down to form individual primordial follicles (Pepling follicle stimulating hormone in human granulosa- and Spradling 2001). This process involves the luteal cell cultures (Liu et al. 2003) and synergistically encapsulation of oocytes with somatic (pre-granulosa) by follicle stimulating hormone and estradiol in rat cells, and those oocytes that do not successfully form granulosa cell cultures (Omori et al. 2005), suggesting primordial follicles undergo apoptosis (Pepling and that TGFBR3 expression on granulosa cells is Spradling 2001). Few studies have examined the regulated by pituitary- and ovarian-derived hormones TGFb superfamily during this process of neofollicu- during folliculogenesis. However, unlike previous logenesis. However, recently, activin A was shown to studies in developing and adult rat (Lewis et al. 344 M. A. Sarraj et al.

2000; Drummond et al. 2002; MacConell et al. 2002) Chuva de Sousa Lopes SM, van den Driesche S, Carvalho RL, and adult human (Liu et al. 2003), very little Larsson J, Eggen B, Surani MA, Mummery CL. 2005. Altered TGFBR3 immunostaining was detected in the thecal primordial germ cell migration in the absence of transforming growth factor beta signaling via ALK5. Dev Biol 284:194–203. layer during the murine neonatal/prepubertal period. Cupp AS, Kim G, Skinner MK. 1999. Expression and action of This suggests that the role of Tgfbr3 in these species transforming growth factor beta (TGFbeta1 TGFbeta2, and differs during neonatal theca development and that, TGFbeta3) during embryonic rat testis development. Biol unlike in the rat and human, TGFBR3 is not Reprod 60:1304–1313. necessary to modulate the effects of the TGFbs and Dixit H, Rao KL, Padmalatha VV, Kanakavalli M, Deenadayal M, Gupta N, Chakrabarty BN, Singh L. 2006. Mutational analysis inhibins on thecal cell biology in neonatal/prepubertal of the betaglycan gene-coding region in susceptibility for ovarian growing follicles in mice. failure. Hum Reprod 21:2041–2046. In summary, this is the ﬁrst report to characterize Drummond AE, Le MT, Ethier JF, Dyson M, Findlay JK. 2002. Tgfbr3 mRNA and protein expression throughout Expression and localization of activin receptors, Smads, and male and female murine gonadogenesis. The current betaglycan to the postnatal rat ovary. Endocrinology 143:1423–1433. study demonstrates that Tgfbr3 mRNA and protein are Drummond AE, Dyson M, Le MT, Ethier JF, Findlay JK. 2003. differentially expressed in the male and female gonads Ovarian follicle populations of the rat express TGF-beta during murine development, suggesting multiple roles signalling pathways. Mol Cell Endocrinol 202:53–57. for this receptor in the developing gonad of both sexes. Forabosco A, Sforza C. 2007. Establishment of ovarian reserve: Notably, we observed prominent expression of Tgfbr3 A quantitative morphometric study of the developing human ovary. Fertil Steril 88:675–683. during the critical periods of development that Gautier C, Levacher C, Saez J-M, Habert R. 1997. Transforming determine the reproductive capacity of the adult growth factor b1 inhibits steroidogenesis in dispersed fetal mouse. This gives support to the notion that the testicular cells in culture. Mol Cell Endocrinol 131:21–30. reproductive defects observed in the adult Tgfbr3 null Hsueh AJ, Dahl KD, Vaughan J, Tucker E, Rivier J, Bardin CW, mice (Stenvers et al. 2003) may have their origin in the Vale W. 1987. Heterodimers and homodimers of inhibin fetal or neonatal periods of gonadogenesis. Fetal subunits have different paracrine action in the modulation of luteinizing hormone-stimulated androgen biosynthesis. Proc gonadogenesis in the Tgfbr3 null mouse line warrants Natl Acad Sci USA 84:5082–5086. further study and will be the future focus of our work. Ingman WV, Robker RL, Woittiez K, Robertson SA. 2006. Null mutation in transforming growth factor beta1 disrupts ovarian function and causes oocyte incompetence and early embryo arrest. Endocrinology 147:835–845. Acknowledgements Ingman WV, Robertson SA. 2007. Transforming growth factor- beta1 null mutation causes infertility in male mice associated This work was supported by the NHMRC of Australia with testosterone deﬁciency and sexual dysfunction. Endocrin-

For personal use only. (RegKeys 338516 and 198705 for KLS, JKF; 384108 ology 148(8):4032–4043. and 334011 for KLL) and the Australian Research Itman C, Mendis S, Barakat B, Loveland KL. 2006. All in the Council (KLL). The technical assistance of Marnie family: TGF-b family action in testis development. Reproduc- Sparrow is gratefully acknowledged. tion 132:233–246. Juengel JL, McNatty KP. 2005. The role of proteins of the transforming growth factor-beta superfamily in the intraovarian regulation of follicular development. Hum Reprod Update References 11:143–160. Kang JS, Lee CJ, Lee JM, Rha JY, Song KW, Park MH. 2003. Anderson RA, Cambray N, Hartley PS, McNeilly AS. 2002. Follicular expression of c-Kit/SCF and inhibin-alpha in mouse Expression and localization of inhibin alpha, inhibin/activin ovary during development. J Histochem Cytochem betaA and betaB and the activin type II and inhibin beta-glycan 51:1447–1458.

Growth Factors Downloaded from informahealthcare.com by University of Auckland on 10/26/14 receptors in the developing human testis. Reproduction Karl J, Capel B. 1998. Sertoli cells of the mouse testis originate from 123:779–788. the coelomic epithelium. Dev Biol 203:323–333. Brennan J, Karl J, Capel B. 2002. Divergent vascular mechanisms Kerr JB, Duckett R, Myers M, Britt KL, Mladenovska T, Findlay JK. downstream of Sry establish the arterial system in the XY gonad. 2006. Quantiﬁcation of healthy follicles in the neonatal and adult Dev Biol 244:418–428. mouse ovary: Evidence for maintenance of primordial follicle Bristol-Gould SK, Kreeger PK, Selkirk CG, Kilen SM, Cook RW, supply. Reproduction 132:95–109. Kipp JL, Shea LD, Mayo KE, Woodruff TK. 2006. Postnatal Konrad L, Albrecht M, Renneberg H, Aumuller G. 2000. regulation of germ cells by activin: The establishment of the Transforming growth factor-beta2 mediates mesenchymal- initial follicle pool. Dev Biol 298:132–148. epithelial interactions of testicular somatic cells. Endocrinology Bullejos M, Koopman P. 2004. Germ cells enter meiosis in rostro- 141:3679–3686. caudal wave during development of the mouse ovary. Mol Konrad L, Luers GH, Volck-Badouin E, Keilani MM, Laible L, Reprod Dev 68:422–428. Aumuller G, Hofmann R. 2006. Analysis of the mRNA Buzzard JJ, Farnworth PG, de Kretser DM, O’Connor AE, Wreford expression of the TGF-beta family in testicular cells and NG, Morrison JR. 2003. Proliferative phase Sertoli cells display localization of the splice variant TGF-beta2B in testis. Mol a developmentally regulated response to activin in vitro. Reprod Dev 73:1211–1220. Endocrinology 144:474–483. Le Magueresse-Battistoni B, Morera AM, Goddard I, Benahmed M. Chapman SC, Woodruff TK. 2003. Betaglycan localization in 1995. Expression of mRNAs for transforming growth factor-beta the female rat pituitary: Implications for the regulation of receptors in the rat testis. Endocrinology 136:2788–2791. follicle-stimulating hormone by inhibin. Endocrinology Levacher C, Gautier C, Saez JM, Habert R. 1996. Immunohisto- 144:5640–5649. chemical localization of transforming growth factor beta 1 and Gonadal expression of TGFBR3 345

beta 2 in the fetal and neonatal rat ovary. Differentiation Pangas SA, Li X, Robertson EJ, Matzuk MM. 2006. Premature 61:45–51. luteinization and cumulus cell defects in ovarian-speciﬁc Smad4 Lewis KA, Gray PC, Blount AL, MacConell LA, Wiater E, knockout mice. Mol Endocrinol 20:1406–1422. Bilezikjian LM, Vale W. 2000. Betaglycan binds inhibin and can Pepling ME, Spradling AC. 2001. Mouse ovarian germ cell cysts mediate functional antagonism of activin signalling. Nature undergo programmed breakdown to form primordial follicles. 404:411–414. Dev Biol 234:339–351. Liu J, Kuulasmaa T, Kosma VM, Butzow R, Vanttinen T, Hyden- Pyter LM, Hotchkiss AK, Nelson RJ. 2005. Photoperiod-induced Granskog C, Voutilainen R. 2003. Expression of betaglycan, an differential expression of angiogenesis genes in testes of adult inhibin coreceptor, in normal human ovaries and ovarian sex Peromyscus leucopus. Reproduction 129(2):201–209. cord-stromal tumors and its regulation in cultured human Risbridger G, Kerr J, de Kretser D. 1989. Differential effects of the granulosa-luteal cells. J Clin Endocrinol Metab 88:5002–5008. destruction of Leydig cells by administration of ethane Lopez-Casillas F, Wrana JL, Massague J. 1993. Betaglycan presents dimethane sulphonate to postnatal rats. Biol Reprod ligand to the TGF beta signaling receptor. Cell 73:1435–1444. 40:801–809. Loveland KL, Robertson DM. 2005. The transforming growth factor-beta superfamily in Sertoli cell biology. In: Skinner MK, Sanford LP, Ormsby I, Gittenberger-de Groot AC, Sariola H, Griswold MD, editors. Sertoli cell biology. Elsevier Science. Friedman R, Boivin GP, Cardell EL, Doetschman T. 1997. p 227–247. TGFbeta2 knockout mice have multiple developmental defects Ma X, Reyna A, Mani SK, Matzuk MM, Kumar TR. 2005. that are non-overlapping with other TGFbeta knockout Impaired male sexual behavior in activin receptor type II phenotypes. Development 124:2659–2670. knockout mice. Biol Reprod 73:1182–1190. Sarraj MA, McClive PJ, Wilmore HP, Loveland KL, Sinclair AH. MacConell LA, Leal AM, Vale WW. 2002. The distribution of 2005. Novel scavenger receptor gene is differentially expressed in betaglycan protein and mRNA in rat brain, pituitary, and the embryonic and adult mouse testis. Dev Dyn gonads: Implications for a role for betaglycan in inhibin- 234:1026–1033. mediated reproductive functions. Endocrinology Sarraj MA, McClive PJ, Szczepny A, Daggag H, Loveland KL, 143:1066–1075. Sinclair AH. 2007. Expression of Wsb2 in the developing and Majdic G, McNeilly AS, Sharpe RM, Evans LR, Groome NP, adult mouse testis. Reproduction 133:753–761. Saunders PT. 1997. Testicular expression of inhibin and activin Schilling B, Yeh J. 1999. Expression of transforming growth factor subunits and follistatin in the rat and human fetus and neonate (TGF)-b1, TGF-b2, and TGF-b3 and of type I and II TGF-b and during postnatal development in the rat. Endocrinology receptors during the development of the human fetal ovary. 138:2136–2147. Fertil Steril 72(1):147–153. Matzuk MM, Finegold MJ, Su JG, Hsueh AJ, Bradley A. 1992. SegariniPR,RosenDM,SeyedinSM.1989.Bindingof Alpha-inhibin is a tumour-suppressor gene with gonadal transforming growth factor-beta to cell surface proteins varies speciﬁcity in mice. Nature 360:313–319. with cell type. Mol Endocrinol 3:261–272. McClive PJ, Sinclair AH. 2001. Rapid DNA extraction and PCR- Shi Y, Massague J. 2003. Mechanisms of TGF-beta signaling from sexing of mouse embryos. Mol Reprod Dev 60:225–226. cell membrane to the nucleus. Cell 113:685–700. Meehan T, Schlatt S, O’Bryan MK, de Kretser DM, Loveland KL. 2000. Regulation of germ cell and Sertoli cell development by Skinner MK, Tung PS, Fritz IB. 1985. Cooperativity between Sertoli cells and testicular peritubular cells in the production and

For personal use only. activin, follistatin, and FSH. Dev Biol 220:225–237. Mendez C, Alcantara L, Escalona R, Lopez-Casillas F, Pedernera E. deposition of extracellular matrix components. J Cell Biol 2006. Transforming growth factor beta inhibits proliferation of 100:1941–1941. somatic cells without inﬂuencing germ cell number in the Skinner MK, Moses HL. 1989. Transforming growth factor beta chicken embryonic ovary. Cell Tissue Res 325:143–149. geneexpressionandactionintheseminiferoustubule: Nishino K, Yamanouchi K, Naito K, Tojo H. 2001. Characteriz- Peritubular cell-Sertoli cell interactions. Mol Endocrinol ation of mesonephric cells that migrate into the XY gonad during 3:625–634. testis differentiation. Exp Cell Res 267:225–232. Schmittgen TD, Zakrajsek BA. 2000. Effect of experimental Odor DL, Blandau RJ. 1969. Ultrastructural studies on fetal and treatment on housekeeping gene expression: Validation by real- early postnatal mouse ovaries. 1. Histogenesis and organogen- time, quantitative RT-PCR. J Biochem Biophys Methods esis. Am J Anat 124:163–166. 46(1–2):69–81. Olaso R, Habert R. 2000. Genetic and cellular analysis of male germ Stenvers KL, Tursky ML, Harder KW, Kountouri N, Amatayakul- cell development. J Androl 21:497–511.

Growth Factors Downloaded from informahealthcare.com by University of Auckland on 10/26/14 Chantler S, Grail D, Small C, Weinberg RA, Sizeland AM, Olaso R, Pairault C, Boulogne B, Durand P, Habert R. 1998. Zhu HJ. 2003. Heart and liver defects and reduced transforming Transforming growth factor beta 1 and beta 2 reduce the number growth factor beta2 sensitivity in transforming growth factor of gonocytes by increasing apoptosis. Endocrinology beta type III receptor-deﬁcient embryos. Mol Cell Biol 139:733–740. 23:4371–4385. Olaso R, Pairault C, Saez JM, Habert R. 1999. Transforming Tomic D, Miller KP, Kenny HA, Woodruff TK, Hoyer P, Flaws JA. growth factor beta3 in the fetal and neonatal rat testis: 2004. Ovarian follicle development requires Smad3. Mol Immunolocalization and effect on fetal Leydig cell function. Endocrinol 18(9):2224–2240. Histochem Cell Biol 112:247–254. Omori Y, Nakamura K, Yamashita S, Matsuda H, Mizutani T, Weng Q, Wang H, M SM, Jin W, Xia G, Watanabe G, Taya K. 2006. Miyamoto K, Minegishi T. 2005. Effect of follicle-stimulating Expression of inhibin/activin subunits in the ovaries of fetal and hormone and estrogen on the expression of betaglycan neonatal mice. J Reprod Dev 52:607–616. messenger ribonucleic acid levels in cultured rat granulosa Wiater E, Vale W. 2003. Inhibin is an antagonist of bone cells. Endocrinology 146:3379–3386. morphogenetic protein signaling. J Biol Chem 278:7934–7941. O’Shaughnessy PJ, Baker PJ, Johnston H. 2006. The foetal Leydig Yao HH-C, Aardema J, Holthusen K. 2006. Sexually dimorphic cell-differentiation, function and regulation. Int J Androl regulation of inhibin beta B in establishing gonadal vasculature 29:90–95. in mice. Biol Reprod 74:978–983. 本文献由“学霸图书馆-文献云下载”收集自网络，仅供学习交流使用。

学霸图书馆（www.xuebalib.com）是一个“整合众多图书馆数据库资源，

提供一站式文献检索和下载服务”的24 小时在线不限IP 图书馆。图书馆致力于便利、促进学习与科研，提供最强文献下载服务。

图书馆导航：

图书馆首页文献云下载图书馆入口外文数据库大全疑难文献辅助工具