The Genetic Architecture of Spawning Date and the Associations Among Life History Traits and Growth in Rainbow Trout (Oncorhynchus Mykiss)

The Genetic Architecture of Spawning Date and the Associations Among Life History Traits and Growth in Rainbow Trout (Oncorhynchus mykiss)

Melissa S. Allen

A Thesis presented to The University of Guelph

In partial fulfilment of requirements For the degree of Doctor of Philosophy In Integrative Biology

Guelph, Ontario, Canada

THE GENETIC ARCHITECTURE OF SPAWNING DATE AND THE ASSOCIATIONS AMONG LIFE HISTORY TRAITS AND GROWTH IN RAINBOW TROUT (ONCORHYNCHUS MYKISS)

Melissa Allen Advisors: University of Guelph, 2015 Professor R. G. Danzmann Professor M. M. Ferguson

I investigated the genetic architecture of spawning date through quantitative trait locus

(QTL) and candidate gene analyses and correlations among life history traits in a commercial hatchery strain of rainbow trout that has been under strong selection for spawning date. I first tested whether differentiation at the population level was occurring between early and late spawning broodstock at genetic loci throughout the rainbow trout genome. I detected significant genetic heterogeneity at microsatellite loci between females with early and late spawning dates within a season and this genetic differentiation was pronounced enough to assign females to the correct spawning group with an average accuracy of 76%. Many loci exhibiting significant differences in allele frequencies co-localize to genomic regions containing QTL for spawning date and other life history traits and potential candidate genes related to circadian rhythms and the brain-pituitary-gonadal axis (BPG axis). I next tested for associations among life history and growth traits by examining whether selection for spawning date based on the genetic markers associated with this trait results in differential growth, embryonic developmental rate and age of maturation. Families produced through selection of genetic markers associated with late spawning had significantly faster developmental rates and increased precocious male maturation.

Co-localization of the two QTL detected for developmental rate to the same markers known to be associated with spawning date in this strain suggests that some of the co-variation between spawning date and developmental rate has a genetic basis. Furthermore, faster developmental rate conferred a growth advantage up to 13 months post fertilization within families and body size was a significant predictor of the propensity to mature early both within and across families.

Finally, I tested whether variation in 9 candidate genes belonging to the clock gene system and

BPG axis is associated with variation in spawning date. I detected 255 SNPs and 45 INDEL’s within the coding and non-coding regions of candidate genes. SNPs from three genes belonging to the clock gene system (bmal, clock1b, dec2) showed nominally significant associations with spawning date, providing further evidence that circadian genes play an important role in the circannual rhythms of salmonids. ACKNOWLEDGEMENTS

First and foremost, I would like to thank my advisors Dr. Roy Danzmann and Dr. Moira

Ferguson for their support and encouragement during the course of my PhD. Their guidance has been invaluable during this process and I am truly fortunate to have had this opportunity. I would also like to thank my committee members Dr. Glen Van Der Kraak and Dr. Lewis Lukens for their guidance, suggestions and constructive criticism over the years.

My lab members in Guelph have made this a more enriching experience, so a thank you to Xia Yue, Anne Easton, Marcia Chaisson, Andrea Kockmarek, Eva Kuttner, and Joe Norman for their advice and support. Moreover, your friendship has meant a great deal to me. More thanks to Aaron Goldt, Riley Magee, Colin and Cameron Richardson.

A special thanks to my family for their unwavering support throughout my life. Words cannot express how grateful I am to my parents Sharon and Doug Allen, for all of the sacrifices they have made on my behalf. I would not be where I am today without their continual guidance and encouragement to strive towards my goals. Last, but definitely not least, I would like to thank my husband, Leonard, for always being there for me for better and for worse. His faith in me has been a driving force in my life and I will be forever grateful for his patience and support.

TABLE OF CONTENTS

Acknowledgements ……………………………………………………………………………... iv

List of Tables ...…………………………………………………………………………………. vi

List of Figures …………………………………………………………………………………. viii

Chapter I: General Introduction ……………………………………………………………….. 1

Chapter II: Molecular markers for variation in spawning date in a hatchery population of rainbow trout (Oncorhynchus mykiss) …………………………………………………………. 12 Introduction …………………………………………………………………………………….. 13 Material and Methods ..………………………………………………………………………… 16 Results ………………………………………………………………………………………….. 20 Discussion ……………………………………………………………………………………… 23

Chapter III: Marker assisted selection for spawning date and co-variation among economically important fitness traits in a commercial strain of rainbow trout (Oncorhynchus mykiss) ……... 38 Introduction .……………………………………………………………………………………. 39 Material and Methods ………………………………………………………………………….. 43 Results ………………………………………………………………………………………….. 48 Discussion ……………………………………………………………………………………… 51

Chapter IV: Candidate gene sequencing reveals variants in circadian clock genes associated with spawning date in rainbow trout (Oncorhynchus mykiss) …………………………………. 76 Introduction……………………………………………………………………………………...77 Material and Methods……………………………………………………………………………80 Results ………………………………………………………………………………………….. 83 Discussion ……………………………………………………………………………………… 87

Chapter V: Conclusions and Future Directions …………………………………………….. 111

Appendices …………………………………………………………………………………… 114 Appendix A: Additional Files for Chapter II …………………………………………………. 114 Appendix B: Additional Files for Chapter IV ………………………………………………… 120

List of Tables

Table 2.1 Sixty three marker loci distributed among all 29 linkage groups used for genotype analysis of females in the LYNDON broodstock of rainbow trout. References are given for the 15 linkage groups known to contain spawning date QTL………………………………………34

Table 2.2 The linkage group and associated microsatellite markers displaying significant differences in allelic distributions between early and late spawning groups of female rainbow trout. Markers are grouped according to the significance thresholds of p< 0.001, 0.01 and p< 0.05 following sequential Bonferroni testing (Rice 1989). For each marker, the alleles whose frequency differed significantly between early and late spawning groups are given in the last column. The BELS ranking for each marker is also provided, where l indicates the marker with the highest discriminatory power……………………………………………………………….35

Table 3.1 Microsatellite markers used in the selection index to choose male rainbow trout with genotypes associated with earlier and later spawning dates. The alleles showing significant differences in frequencies between early spawning females (mid-August to mid-October) and late spawning females (mid-November to early January) are given for each locus, along with their direction of effect (negative indicates an allele associated with early spawning, positive indicates an allele associated with late spawning)………………………………………………63

Table 3.2 Mean hatching time (± standard error) of progeny from four sets of maternal half-sib families (1 female crossed to multiple males). The vector score and corresponding predicted spawning date genotype of each male parent is given. Significant differences in mean hatching time (hours since the first embryo hatched) within maternal half-sib families are denoted by lower case letters, where shared letters indicate no significant difference in mean time to hatch (p< 0.01). Significant differences in mean hatching time between maternal half-sib groupings are denoted by upper case letters, where shared letters indicate no significant difference in mean time to hatch (p< 0.01)………………………………………………………………………….64

Table 3.3 Mean length (± standard error) at the onset of exogenous feeding (males and females combined) in the progeny of a female mated to four male rainbow trout with either an early spawning vector score (E) or late spawning vector score (L) . The mean body weights (BW) (grams) at 13 and 20 months of age (from fertilization) by sex from the early, middle and late hatching groups for the four maternal half-sib families are also given. Significant differences in trait values (p< 0.05) between hatching groups are denoted by lower case letters, where shared letters indicate no significant difference. Significant differences in trait values (p< 0.05) between half-sib families are denoted by upper case letters, where shared letters indicate no significant difference………………………………………………………………………………………..65

Table 3.4 The mean condition factor, K, (± standard error) at 13 and 20 months of age (from fertilization) by sex from the early, middle and late hatching groups for the progeny of a female mated to four male rainbow trout with either an early spawning vector score (E) or late spawning vector score (L). Significant differences in trait values (p< 0.05) between hatching groups are denoted by lower case letters, where shared letters indicate no significant difference. Significant

vi differences in trait values (p< 0.05) between half-sib families are denoted by upper case letters, where shared letters indicate no significant difference…………………………………………67

Table 3.5 The number and percentage of mature and immature males at two years of age in each of four families of rainbow trout. Families differed significantly in the rates of precocious maturation (p < 0.001). Families sired by males with early spawning alleles had significantly lower rates of precocious maturation compared to families sired by males with late spawning alleles (p < 0.001)……………………………………………………………………………….69

Table 3.6 The number of mature and immature males from each hatching group at two years of age for four families of rainbow trout. No significant association between maturation status and hatching group was detected within or across families combined……………………………...70

Table 3.7 Locations of QTL for embryonic developmental rate from a full sib analysis in rainbow trout. Significant QTL on RT-8 were associated with the female parent, while significant QTL on RT-23 were associated with the male parent………………………………71

Table 4.1 Primer sequences, annealing temperature (TA), and fragment size for candidate gene primers. The linkage groups (LG) where the fragments may localize in rainbow trout are shown (UN = unknown). The source or accession number for the derivation of each of the primers for every gene is given in the last column…………………………………………………………100

Table 4.2 Variants found to be suggestively or significantly associated with spawning time are shown. The gene, variant type, specific mutation, information on location and frequency of mutation in early and late spawning females is given. The chi-square, unadjusted and Benjamini–Hochberg false discovery rate corrected p-values are given where an * denotes significance at p< 0.05 and ᶧ denotes suggestive significance at p< 0.10. Base pair locations of mutations are relative to the reference sequence (Supplementary file 4.1)……………………101

Table 4.3 Haplotypes occurring in 5% or more of the population for the genes dec2, bmal, clock1b and g0s2. The frequency of each haplotype in the population, Chi-square value and permutation derived p-values are given where * denotes a significant association with spawning date at p< 0.05 and ᶧ denotes suggestive significance at p< 0.10. The base pairs of each haplotype are show with deletions or insertions represented with a D or I, respectively. Haplotype alleles for each gene are in chronological order following the haplotype blocks defined in Figure 2…………………………………………………………………………….103

vii

List of Figures

Figure 2.1 The number of ovulating female rainbow trout sampled from LYNDON strain on specific dates in the 2008/2009 spawning season (dates are not regularly spaced). The three groups designated early, middle and late spawners are shown. The October 24th and November 12th samples were omitted entirely from the genetic analysis as well as a subset of individuals from other sampling dates (21 from Oct. 28th, 46 from Nov. 4th, 53 from Nov. 11th, 77 from Nov 19th and 24 from Nov 26th)………………………………………………………………………36

Figure 2.2 Allele frequency distributions across spawning groups (E, early; M, middle; L, late) for the 15 marker loci showing significant allelic heterogeneity at the p < 0.001 level. Change in allele frequency throughout the spawning season is shown for each allele as a proportion of the total………………………………………………………………………………………………37

Figure 3.1 Index scores for 63 broodstock males based on their genotypes for 15 markers associated with female spawning date in the Lyndon strain. Negative scores indicate a genotype with a large cumulative number of alleles associated with an early spawning phenotype. Positive scores indicate a genotype with a large cumulative number of alleles associated with a late spawning phenotype. Males selected for crosses are indicated and families are labeled based on male ID number………………………………………………………………………………….72

Figure 3.2 Cumulative percent of hatched rainbow trout embryos produced from males with early (light grey) and late spawning dates (dark grey) for (A) half-sib families M-29, M-30, M- 52 and M-54. (B) half-sib families M-59 and M-57. (C) half-sib families M-16 and M-32. (D) half-sib families M-42 and M-33. Time 0 corresponds to the time when the first embryo hatched…………………………………………………………………………………………..73

Figure 3.3 Body weight at (A) 13 months and (B) 20 months of age for male rainbow trout that matured precociously and males that did not mature within each family. Error bars represent ± 1 standard error. * denotes a significant difference. (p< 0.001) between immature and mature fish within a family…………………………………………………………………………………..74

Figure 3.4 Condition factor at 13 months and 20 months of age for male rainbow trout that matured precociously and males that did not mature. Error bars represent ± 1 standard error. * denotes a significant difference. (p< 0.001) in K between immature and mature fish across families for each sampling date…………………………………………………………………75

Figure 4.1 Circadian rhythms are maintained through an autoregulatory feedback loop composed of both positive and negative elements. CLOCK and BMAL proteins (positive components of the feedback loop) form a heterodimer the binds to the E-box motifs of the per and cry genes to initiate their transcription. PER and CRY proteins (negative components of the feedback loop) form a heterodimer of their own which inhibits the activity of CLOCK/BMAL. The dec genes (negative components of the feedback loop) are positively regulated by CLOCK/BMAL, however DEC proteins compete for E-box binding sites and prevent activation of per by CLOCK/BMAL. The circadian pathway is responsible for the downstream regulation of daily

viii expression profiles of many genes involved in a wide range of biological functions. The G0S2 gene displays circadian regulation and is involved in the cell cycle and metabolism…………104

Figure 4.2 Neuroendocrine regulators of the brain-pituitary-gonadal axis. Gonadotropin releasing hormone (GnRH) is a key molecule responsible for the initiation of maturation and ovulation through it stimulating the release of gonadotropins such as luteinizing hormone (LH) and follicle-stimulating hormone (FSH). LH and FSH stimulate the production of sex steroids in the gonad essential for reproduction. Kisspeptin (KISS) is one of the molecules responsible for stimulation of GnRH release as it binds to kiss receptors (KISSr) on GnRH neurons. The gene Embryonic Ectoderm Development (Eed) has been implicated in the control of Kisspeptin release as it is part of a protein complex that allows it to bind to the promoter of KISS and prevent its trancription…………………………………………………………………………105

Figure 4.3 The locations of variants (SNPs and Indels) detected within the 10 candidate genes. The relative locations of introns, exons and UTR’s are shown, variants are indicated with a vertical black line. Variants associated with spawning date with nominally significant or suggestive p-values are denoted with an * or ᶧ, respectively. Drawings are to scale…………..107

Figure 4.4 A plot showing linkage disequilibrium between all SNPs within (A) g0s2 (B) bmal (C) dec2 and (E) clock1b. D' was used as the measure of linkage disequilibrium, where D'=1 represents complete disequilibrium. Boxes show in red in the plot represent strong evidence LD between two markers where D'=1 and the LOD score is greater than 2. The blue boxes indicate D'=1 with an LOD < 2 while white boxes indicate D'<1 with an LOD < 2…………………..110

CHAPTER I General Introduction

The timing of life history events is crucial to the survival and success of all organisms.

Relationships between the age and size at maturity and the timing of reproduction and

development all contribute to reproductive success and variations in these strategies often reflect

adaptation to local and historical conditions. Salmonid fishes display some of the most

remarkable and diverse life history strategies of any vertebrate (Hutchings and Jones 1998;

Keely et al. 2007). In Atlantic salmon (Salmo salar), age and size at maturation can vary several

orders of magnitude (Hutchings and Jones 1998; Sloat et al. 2014) and in Atlantic salmon and

the Pacific salmons (Oncorhynchus spp.) timing and duration of spawning within a season can

vary dramatically (Heggberget 1988; Groot and Margolis 1991; Purdom 1993; Webb and Mclay

1996; Lisi et al. 2013).

Different life histories adapted for specific environments within and between salmonid

species have direct consequences on fitness. For example, spawning time coupled with

developmental rate determines the emergence time of fish and is locally adapted to balance the

trade-offs between predation pressure, food availability and physical conditions to ensure

optimal offspring survival (Webb and Mclay 1996; Einum and Fleming 2000; Crozier et al.

2008; Gharrett et al. 2013). Spawning time has been found to be under strong genetic control in

salmonids (Siitonen and Gall 1989; Quinn et al. 2000) and heritabilities for this trait are high

(Siitonen and Gall 1989; Su et al. 1997; Neira et al. 2006). This makes the salmonids well suited

for the study of the genetic control of reproductive timing. Knowledge of the genetic basis of

spawning date and how variation in this trait may indirectly influence other traits would provide

a means to better understand how selection pressure shapes the variable life histories of

1 salmonids and how commercial stocks may respond to artificial selection for spawning date. In my thesis I investigate the genetic architecture of spawning date and correlations among life history traits including developmental rate, precocious maturation and growth in the salmonid rainbow trout (Oncorhynchus mykiss).

Rainbow trout are an important species for both recreational and aquaculture purposes and in 2013, global aquaculture production of rainbow trout exceeded 814,000 tons (FAO 2015).

Rainbow trout are also one of the most extensively studied fish species and are used as the model organism for cool and cold water aquaculture research (Thorgaard et al. 2002; Salem et al 2015).

As a result, there is a wealth of information available on their physiology, ecology, behavior and genetics. The evolutionary adaptations that have made salmonids such a successful group can prove to be a challenge to the cultivation of these species. The co-ordinated spawning over a short period of time that is representative of all salmonids, results in the seasonal availability of juveniles. These restricted spawning times can have major impacts on the efficiency, productivity and profitability of aquaculture operations, making the development of broodstock that spawn at different times throughout the year necessary to support year-round production

(Siitonen and Gall 1989; Su et al. 1997; Quinton et al. 2004; Araneda et al. 2012).

In the late 1800’s propagation of rainbow trout was established to supply commercial farms leading to the creation of a strain composed of a mixture of resident and steelhead

O.mykiss from the McCloud river of Northern California. For the most part all commercial rainbow trout stocks in use around the world today predominately originate from this single domesticated strain of spring-spawning rainbow trout (Scott and Sumpter 1986; Gall and

Crandell 1992; Behnke 2002; Gross 2007). Intense selection over the past 50 to 100 years has resulted in the shift of spawning date in some cultivated strains from spring-spawning to fall-

2 spawning. This type of selection presumably would cause divergence of genetic loci involved in the timing of reproduction. This provides the opportunity to examine genetic differentiation at the population level and identify potential regions of the rainbow trout genome that contribute to variation in spawning date. This information could then be integrated into breeding programs through marker assisted selection (MAS) to expand the breeding season more accurately and efficiently than artificial selection alone.

In my first study (Chapter II) I examine a fall-spawning, commercial population of rainbow trout that has been under strong selection for spawning date for several generations. I exploit the heterogeneity caused by this intensive selection to identify genetic markers associated with spawning date for potential future use in a MAS breeding program. In addition to identifying several new regions of the genome associated with reproductive timing, this work provides further evidence that genetic loci influencing spawning date detected in previous studies may be conserved across multiple populations of rainbow trout. My findings reinforce the idea that this trait is polygenic in nature, controlled by many loci of small to large effect. Together my results provide the basis for the the integration of genetic and molecular knowledge into breeding programs.

Genetic correlation is a principle factor in the evolution of quantitative traits and is a fundamental component in life history theory (Roff 1996; Blows and Hoffmann 2005). Life history traits are more often negatively correlated than morphological or behavioural traits (Roff

1996) and are referred to as life history trade-offs. Trade-offs can arise through genetic correlations (caused by pleiotropy or linkage disequilibrium) or by environmental factors or a combination of the two. In the case of negative trait correlations, phenotypic change in one trait may be constrained by another (Zera and Harshmann 2001). There are also many instances of

3 positive correlations between life history traits, for example, in daphnids, growth is positively correlated with reproduction (Olijnyk and Nelson 2013) and in aphids developmental rate is correlated with larger body size, higher fecundity and larger offspring size (Vorburger 2005).

Knowledge of the correlated responses of traits is vital not only to understanding how natural selection affects the evolution of life history traits but also how artificial selection may influence the life history characteristics of a population. Selection acting directly on a trait may indirectly cause changes in a correlated trait (Lande and Arnold 1983) and can be either detrimental or beneficial to genetic improvement programs (Bourdon 2000). In fishes, one of the most studied examples of the effects of artificial selection on trait correlations is that of the relationship between growth and age at maturation (Taranger et al. 2010). Negative correlations between these two traits have been observed in salmonids (Crandell and Gall 1993; Gjerde et al.

1994; Quinton et al. 2002) and other economically important fish species (Godø and Haug, 1999;

Longalong et al. 1999).

Due to genetic correlations, selection of fish carrying alleles associated with disparate spawning phenotypes may have the potential to alter the life history characteristics

(developmental rates, growth and age at maturation) of a population. However, no studies have investigated the effect artificial selection for spawning date may have on other life history traits in salmonid or other fish species. Knowledge of correlated trait responses is essential in breeding programs to avoid unintentional and unfavourable responses in a secondary trait as an indirect consequence of selection on the target trait. The identification of genetic markers for spawning date in my first study (Chapter II) provided the opportunity to explore the effects a marker assisted selection program for spawning date may have on the expression of other life history traits in subsequent generations. In my second study (Chapter III), the genetic and

4 phenotypic relationships between developmental rate, growth and precocious maturation are examined in families created by selection of sires carrying genetic markers that are associated with spawning phenotype (Chapter II). My findings reveal that selection of sires carrying late spawning alleles produce progeny with faster developmental rates in some, but not all maternal backgrounds and that the incidence of precocious male maturation was also significantly greater in these families. While growth showed no correlation with spawning date or developmental rate, I detected a strong correlation between body weight and incidence of early maturation.

Finally, I found evidence that pleiotropy may be responsible for the observed phenotypic co- variations between developmental rate and spawning date, as the two QTL for developmetal rate

I detected occurred at the same loci showing the strongest association with spawning date in

Chapter II.

Understanding of the physiological pathways responsible for a complex trait and the genes involved in maintaining those pathways is the ultimate goal in the study of complex quantitative traits. Research over the past several decades has resulted in an understanding of how reproductive events are controlled by the brain-pituitary-gonadal (BPG) axis primarily through gonadotropin-releasing hormone (GnRH) and gonadotropin systems (Gore 2002;

Hofmann 2006). However, the mechanisms responsible for mediating the transduction of environmental cues and triggering the initiation of the BPG axis remain unclear in mammals, and almost completely unknown in fishes (Hofmann 2006; Filby et al. 2008; Martinez-Chavez et al.

2008; Migaud et al. 2010).

In order to establish the synchronization and co-ordination of reproductive processes, a reliable environmental signal is required to entrain endogenous circannual rhythms, or biological clocks. It is well established that in the case of temperate teleost fishes photoperiod is the

5 primary factor that entrains circadian and circannual rhythms (Bromage et al. 2001). Knowledge of the internal pathways or photoneuroendocrine systems (PNES) that utilize photoperiodic information to mediate and maintain circadian rhythms is improving for the more studied vertebrate groups such as mammals and birds. There is evidence to suggest that these pathways may be conserved across all vertebrates (Martinez-Chavez et al. 2008; Migaud et al. 2010). In mammals, Clock-gene systems and the more recently identified kisspeptins, are key factors that have been found to play a role in the activation and maintenance of the BPG axis as potential regulators of GnRH pulsing capable of mediating environmental signals. Studies suggest that these systems also appear to be involved in the regulation of the teleost BPG axis (Leder et al.

2006; O’Malley et al. 2007; Migaud et al. 2010; Tena-Sempere et al. 2012; Gopurappilly et al.

2013; Mechaly et al. 2013). The core clock genes as well as kisppeptins and their associated receptors represent promising candidate genes in the study of reproductive timing in fishes. In my third study (Chapter IV), I sequenced several circadian and neuroendocrine candidate genes in both early and late spawning female rainbow trout and identify genetic variants within coding and non-coding regions of those genes. The association of variants with spawning date in key clock genes (bmal, clock1a, clock1b, dec1 and dec2) or clock-controlled genes (g0s2) as well as genes involved in the kisspeptin system (kiss2, kiss1r and eed) are investigated. My findings reveal that variants detected in the clock genes bmal, dec2 and clock1b all show significant associations with spawning date, indicating that clock genes may play a central role in the circannual reproduction of salmonids fishes.

The work in this thesis contributes to our understanding of the genetic architecture of spawning date. This was accomplished through identifying the key regions of the rainbow trout genome that potentially contain genes influencing this trait and demonstrating a link between

6 clock genes and reproductive timing in a salmonid fish. This thesis also uncovers complex relationships between the timing of life history events such as development, maturation and reproduction. This work could have important implications for the cultivation and natural evolution of this species and future studies should continue to endeavour to elucidate the gene pathways underlying reproductive timing and examine the genetic basis of co-variation among life history traits.

REFERENCES Araneda C, Díaz NF, Gomez G, López ME, Iturra P. (2012). Comparative mapping reveals quantitative trait loci that affect spawning time in coho salmon (Oncorhynchus kisutch). Genet Mol Biol 35:515-521 Behnke RJ (2002) Trout and Salmon of North America. The Free Press, 1230 Avenue of the Americas, New York, NY. pp79 Blows MW, Hoffmann AA (2005) A reassessment of genetic limits to evolutionary change. Ecology 86:1371-1384 Bourdon, R. M. 2000. Understanding Animal Breeding, 2nd Edition. Prentice Hall, Upper Saddle River, NJ, USA. 538pp Bromage NR, Porter MJR, Randall, CF (2001) The environmental regulation of maturation in farmed finfish with special reference to the role of photoperiod and melatonin. Aquaculture 197:63–98 Crandell PA, Gall GAE (1993) The genetics of body weight and its effect on early maturity based on individually tagged rainbow trout (Oncorhynchus mykiss). Aquaculture 117:77-93 Crozier LG, Hendry AP, Lawson PW, Quinn TP, Mantua NJ, Battin J, Shaw RG, Huey, R. B (2008) Potential responses to climate change in organisms with complex life histories: evolution and plasticity in Pacific salmon. Evol Appl 1:252-270 Einum S, Fleming IA (2000) Selection against late emergence and small offspring in Atlantic salmon (Salmo salar). Evolution 54:628-639

FAO Fishery Statistics (2015) http://www.fao.org/fishery/culturedspecies/Oncorhynchus_mykiss/en Filby AL, Van Aerle R, Duitman J, Tyler CR (2008) The kisspeptin/gonadotropin releasing hormone pathway and molecular signaling of puberty in fish. Biol Reprod 78:278–289 Gall GAE, Crandell PA, (1992) The rainbow trout. Aquaculture 100:1–10

Gharrett AJ, Joyce J, Smoker WW (2013) Fine‐scale temporal adaptation within a salmonid population: mechanism and consequences. Mol Ecol 22:4457-4469 Gjerde B, Simianer H, Refstie T (1994) Estimates of genetic and phenotypic parameters for body weight, growth rate and sexual maturity in Atlantic salmon. Livest Prod Sci 38:133-143 Godø OR, Haug T (1999) Growth Rate and Sexual Maturity in Cod (Gadus morhua) and Atlantic Halibut (Hippoglossus hippoglossus). J Northw Atl Fish Sci 25:115–123 Gopurappilly R, Ogawa S, Parhar IS (2013) Functional significance of GnRH and kisspeptin, and their cognate receptors in teleost reproduction. Front Endocrin 4:24 Gore AC (2002) GnRH: The master molecule of reproduction. Kluwer Academic Publishers, Dordrecht, The Netherlands.

Groot C, Margolis L, eds. (1991). Pacific salmon life histories. University of British Columbia Press, Vancouver, BC Gross R, Lulla P, Paaver T (2007) Genetic variability and differentiation of rainbow trout (Oncorhynchus mykiss) strains in northern and Eastern Europe. Aquaculture 272:139–146 Heggberget TG (1988) Timing of spawning in Norwegian Atlantic salmon (Salmo salar). Can J Fish Aquat Sci 45:845-849 Hofmann HA (2006) Gonadotropin-releasing hormone signaling in behavioral plasticity. Curr Opin Neurobiol 16:343–350 Hutchings JA, Jones MEB (1998) Life history variation and growth rate thresholds for maturity in Atlantic salmon, Salmo salar. Can J Fish Aquat Sci 55:22–47 Keeley ER, Parkinson EA, Taylor EB (2007) The origins of ecotypic variation of rainbow trout: a test of environmental vs. genetically based differences in morphology. J Evolution Biol 20:725-736 Lande A, Arnold SJ (1983) The measurement of selection on correlated characters. Evolution 17:1210–1226 Leder EH, Danzmann RG, Ferguson MM (2006) The candidate gene, Clock, localizes to a strong spawning time quantitative trait locus region in rainbow trout. J Hered 97:74-80 Lisi PJ, Schindler DE, Bentley KT, Pess GR (2013) Association between geomorphic attributes of watersheds, water temperature, and salmon spawn timing in Alaskan streams. Geomorphology 185:78-86 Longalong FM, Eknath AE, Bentsen HB (1999) Response to bi-directional selection for frequency of early maturing females in Nile tilapia (Oreochromis niloticus). Aquaculture 178: 13–25 Martinez-Chavez CC, Minghetti M, Migaud H (2008) GPR54 and rGnRH I gene expression during the onset of puberty in Nile tilapia. Gen Comp Endocrinol 156:224-233 Mechaly AS, Vinas J, Piferrer F (2013) The kisspeptin system genes in teleost fish, their structure and regulation, with particular attention to the situation in Pleuronectiformes. Gen Comp Endocrinol 188:258–268 Migaud H, Davie A, Taylor JF (2010) Current knowledge on the photoneuroendocrine regulation of reproduction in temperate fish species. J Fish Biol 76:27-68 Neira R, Diaz NF, Gall GAE, Gallardo JA, Lhorente JP, Alert A (2006) Genetic improvement in coho salmon (Oncorhynchus kisutch). II: Selection response for early spawning date. Aquaculture 257:1-8 Olijnyk AM, Nelson WA (2013) Positive phenotypic correlations among life-history traits remain in the absence of differential resource ingestion. Funct Ecol 27:165–172

O’Malley KG, Camara MD, Banks MA (2007) Candidate loci reveal genetic differentiation between temporally divergent migratory runs of Chinook salmon (Oncorhynchus tshawytscha). Mol Ecol 16:4930-4941 Purdom CE (1993) Genetics and Fish Breeding. Chapman & Hall, New York. 277 pp Quinn TP, Unwin MJ, Kinnison MT (2000) Evolution of temporal isolation in the wild: Genetic divergence in timing of migration and breeding by introduced Chinook salmon populations. Evolution 54:1372-1385 Quinton CD, Moghadasi SM, McKay LR, McMillan I (2002) 7th World Congress on Genetics Applied to Livestock Production, August 19-23, 2002, Montpellier, France Quinton CD, McKay LR, McMillan I (2004) Strain and maturation effects on female spawning time in diallel crosses of three strains of rainbow trout (Oncorhynchus mykiss). Aquaculture 234:99-110 Roff DA (1996) The Evolution of Genetic Correlations: An Analysis of Patterns. Evolution 50:1392-1403 Salem M, Paneru B, Al-Tobasei R, Abdouni F, Thorgaard GH, Rexroad CE, Yao J (2015) Transcriptome Assembly, Gene Annotation and Tissue Gene Expression Atlas of the Rainbow Trout. PLoS ONE 10:e0121778 Scott AP, Sumpter JP (1986) A Comparison of the Female Reproductive Cycles of Autumn- Spawning and Winter-Spawning Strains of Rain Trout (Salmo gairdneri Richardson). Gen Comp Endocrinol 52:79-85 Siitonen L, Gall GAE (1989) Response to selection for early spawn date in Rainbow Trout, Salmo gairdneri. Aquaculture 78:153-161 Sloat MR, Fraser DJ, Dunham JB, Falke JA, Jordan CE, McMillan JR, Ohms HA (2014) Ecological and evolutionary patterns of freshwater maturation in Pacific and Atlantic salmonines. Rev Fish Biol Fisher 24:689-707 Su GS, Liljedahl LE, Gall GAE (1997) Genetic and environmental variation of female reproductive traits in rainbow trout (Oncorhynchus mykiss). Aquaculture 154:115-124 Taranger, G. L., Carrillo, M., Schulz, R. W., Fontaine, P., Zanuy, S., Felip, A., Weltzien, F., Dufour S, Karlsen O, Norberg B, Andersson E, Hansen T (2010) Control of puberty in farmed fish. Gen Comp Endocrinol 165:483-515 Tena-Sempere M, Felip A, Gómez A, Zanuy S, Carrillo M (2012) Comparative insights of the kisspeptin/kisspeptin receptor system: lessons from non-mammalian vertebrates. Gen Comp Endocrinol 175:234–243 Thorgaard GH, Bailey GS, Williams D, Buhler DR, Kaattari SL, Ristow SS, Hansen JD, Winton JR, Bartholomew JL, Nagler JJ, Walsh PJ, Vijayan MM, Devlin RH, Hardy RW, Overturf KE, Young WP, Robison BD, Rexroad C, Palti Y (2002) Status and opportunities for genomics research with rainbow trout. Comp Biochem Phys B 133:609-646

Vorburger C (2005) Positive Genetic Correlations among Major Life-History Traits Related to Ecological Success in the Aphid Myzus persicae. Evolution 59:1006-1015 Webb JH, McLay HA (1996) Variation in the time of spawning of Atlantic salmon (Salmo salar) and its relationship to temperature in the Aberdeenshire Dee, Scotland. Can J Fish Aquat Sci 53:2739-2744 Zera AJ, Harshmann LG (2001) The physiology of life history tradeoffs in animals. Annu Rev Ecol Syst 32:95–126

CHAPTER II Molecular markers for variation in spawning date in a hatchery population of rainbow trout (Oncorhynchus mykiss)

ABSTRACT: We examined the distribution of alleles at 63 microsatellite loci distributed across

29 linkage groups in broodstock females from a commercial population of rainbow trout

spawning on different dates throughout the season (August to January). A total of 368 females;

184 and 117 females from each of the tail-ends of the spawning distribution and a sub-sample of

67 females spawning in the middle, were used to detect marker-trait associations. Twenty-one

loci in a subset of genomic regions (RT-5, 7, 8, 10, 12, 14, 15, 22, 23, 24, 25, 29, 30 and 31)

were significantly associated with variation in spawning date. Many of these markers localize to

regions with known spawning date quantitative trait loci (QTL) based on previous studies. An

individual assignment analysis was used to test how well the molecular data could be used to

assign individuals to their correct spawning group and markers were given a ranking reflecting

their contribution to the accuracy of assignment. The top 15 ranked markers were successful at

assigning the majority of females to the correct spawning group based on genotype with an

average accuracy of 76%. The most likely genes that could contribute to these differences in

spawning date are discussed. Together, these data indicate that the loci could be incorporated

into a selection index with phenotype data to increase the accuracy of selection for spawning

date.

Published in: Marine Biotechnology, 2014 16(3): 289-98

INTRODUCTION

The precise synchronization and co-ordination of reproductive cycles typically observed

in salmonid fishes such as rainbow trout (Oncorhynchus mykiss) poses a challenge to the culture

of these species (Bromage et al. 1992). Spawning date within the season dictates the timing of

emergence and first feeding, entry into the juvenile stage and production systems and ultimately,

the eventual harvest date (Siitonen and Gall 1989; Neira et al. 2006). Given the narrow spawning

window of female rainbow trout, seed stock is often unavailable on a year round basis, causing

production to be limited to certain times of the year. It is therefore not unexpected that a primary

goal of commercial hatcheries is to expand the egg producing season of their genetic stock. The

control of spawning date in salmonids has been achieved artificially using photoperiod

manipulation or hormone treatments (Bromage et al. 1993; Zohar and Mylonas 2001). However,

these methods may be costly and impractical due lack of infrastructure, especially for outdoor

facilities, and do not provide a permanent change to spawning date.

Spawning date in salmonids is a complex life history trait that is quantitative in nature.

Like most quantitative traits, spawning date is controlled by many loci (quantitative trait loci or

QTL), with a few loci contributing major effects and many loci with small effects (Mackay

2001). To date, the genetic map available for rainbow trout is one of the highest density maps of

any cultured finfish species (Guyomard et al. 2006, 2012; Rexroad et al. 2008; Palti et al. 2012)

and the construction of these maps has made it possible to locate QTL for spawning date

(Sakamoto et al. 1999; O’Malley et al. 2003; Leder et al. 2006). These studies have uncovered

spawning date QTL with major genome-wide effects on linkage groups RT-8, 18 and RT-20 as

well as significant chromosome-wide QTL effects on 7 additional linkage groups (Danzmann

13 unpublished update of the mapping panel used by Leder et al. 2006). The QTL region on linkage group RT-8 (i.e., Omy5) was very strong and accounted for > 50% of the variation in the trait within the experimental family tested (Leder et al. 2006).

The detection of QTL (Leder et al. 2006) as well as high heritabilities (Siitonen and Gall

1989; Su et al. 1997) and repeatability (Sakamoto et al. 1999; Quinton et al. 2004) for spawning date suggests that genetic improvement can be achieved through selection. Indeed, attempts to lengthen the spawning season through artificial selection have been successful in rainbow trout

(Siitonen and Gall 1989; Sadler et al. 1992) and coho salmon (Neira et al. 2006). Moreover, selection for spawning date in a commercial rainbow trout strain from Ontario expanded the breeding season from two weeks to eight months and was associated with heterogeneity in microsatellite allele frequencies among females that spawned in different months (Fishback et al.

2000). The allelic heterogeneity observed in the limited number of microsatellite loci analyzed presumably reflect their tight linkage to QTL regions and the underlying candidate genes responsible for variance in spawning date. The integration of such marker information into breeding programs has the potential to increase the accuracy of selection. While this type of selection, known as marker assisted selection (MAS), has been implemented in breeding programs for terrestrial livestock production (Dekkers 2004), the technique has not yet been widely applied to commercial fish farming (Yue 2013).

Additional genetic gains can also be achieved for traits that can only be measured in one sex and where molecular data is used to select candidate breeders in the sex that does not express the trait (Lande and Thompson 1989). Spawning date in rainbow trout is expressed differentially in the sexes as females produce gametes for a much shorter duration compared to males. Female rainbow trout have a relatively narrow spawning window that may only span a single week since

14 fertilization is maximized within 4 to 6 days post-ovulation (Springate et al. 1984). Furthermore, individual females have spawning times in the same relative rank orders across different years

(Sakamoto et al. 1999). Conversely, male spawning dates are not easily defined as they can produce milt over six months (Siitonen and Gall 1989). The implication of this for selective breeding programs is that phenotypic selection for this particular trait can only be applied to one sex, thus hindering genetic progress. The use of molecular data to assist the selection of males could thus be used to expand the spawning season of a strain more efficiently and accurately than phenotypic selection on females alone.

We searched for associations between spawning date of females and genotypes at 63 microsatellite markers from known locations spanning all 29 linkage groups, within the entire yearly spawning season of a commercial strain of rainbow trout under selection for spawning date. We hypothesize that selection for spawning date has created allelic heterogeneity at marker loci linked to QTL for spawning date. Therefore we predict strong marker-trait associations for markers localized close to spawning date QTL because of the underlying candidate genes within these regions. Markers identified as having allele frequencies that significantly differ between spawning groups were assessed and given a ranking based on their ability to assign females to the correct spawning group. The usefulness of the data set to be used as a tool to identify individuals with genotypes indicative of a particular spawning group was also evaluated. Our long term goal is to determine the strain-specific genetic marker information required for future application of marker assisted selection.

MATERIALS and METHODS

Source of fish and collection of spawning time data

The rainbow trout used in this study were from the LYNDON commercial hatchery strain

located at Lyndon Fish Hatcheries (New Dundee, Ontario, Canada), and were obtained from the

2008/09 spawning year. The LYNDON hatchery strain is the largest egg-producing commercial

strain in Canada and provides the majority of juveniles recruited for grow out cages in the

province of Ontario. The spawning window has typically ranged from early August to the end of

January, with peak numbers of females ovulating in November. The strain is historically

regarded as a fall/winter spawning strain with the majority of females spawning in late

September into early December. The strain (originally called Spring Valley) is believed to have

originated from a strain known as the McLaren strain in the western United States. Since fish

from this strain were introduced into Ontario in the 1950’s the strain may have had local

mixtures from some additional Ontario strains (undocumented), but has been maintained as a

separate brood line since the 1990’s. Since the early 1990’s the strain has been selected to

increase the spawning times of female broodstock (approximately six generations of selection),

with a strengthening of this selection program since 2000, when the hatchery came under new

management (C. Rieck, Hatchery Manager, pers. comm.). In the 3 years following the

2008/2009 spawning season, phenotypic selection has further increased the spawning window to

the beginning of April (early spawners), and into February (late spawners) albeit with only a few

females ovulating at these ‘tail-end’ time periods. In this time period, the incidence of double-

spawning females (i.e., ovulated twice within a yearly cycle) has also increased but their

numbers are very low.

Adult females were monitored each week and ovulated females were PIT tagged for identification and fin clipped for later DNA analysis. Our samples were obtained from females spawning over a 6 month period with the first female ovulating on August 15th 2008 and the last on February 14th 2009. In total, 28 weekly checks were performed and spawning time data and clips from adipose fins were collected from 854 females (Figure 2.1). However, 40 females did not mature and thus no spawning time data were available for these individuals. Females spawning twice within the spawning season were also excluded from the analysis. Initially 502 females were selected for analysis. However, 3-year-old females within this distribution were observed to have later spawning dates than the 4 and 5-year-old females sampled and were therefore excluded from the analysis. Delayed spawning dates in first time spawning females are not unusual and relate to the increased energy demands on these individuals to mature their eggs given their smaller body size. Three spawning groups designated early, middle and late were created by arbitrarily assigning females in the population to a specific group based on their spawning date. The early spawning group consisted of 184 females with spawning dates ranging from August 15th to October 21st and the late spawning group consisted of 117 females with spawning dates ranging from November 19th to February 14th. The middle spawning group represented the median spawning dates for the population and consisted of 472 females with spawning dates ranging from October 28th to November 11th. Because a large proportion of the population had spawning dates in late October/ early November, only 67 of these females were chosen resulting in a total of 368 fish for DNA analysis.

Marker selection

Microsatellite markers derived from rainbow trout and other closely related salmonid species were used to test for genetic differences among females spawning at different times of

17 the season. Of the 120 loci screened, we identified 63 marker loci from 29 linkage groups with high levels of allelic polymorphism that were suitable for genotype analysis of the females

(Table 2.1). All females were genotyped for the selected markers from 15 linkage groups known to contain spawning date QTL and 14 groups with no known effects to test for allelic heterogeneity across the 6 month spawning season (Table 2.1). Information on the expected regions bearing spawning time QTL was derived from the 10 linkage groups with significant effects reported in Leder et al. (2006), and additional linkage groups that showed allelic heterogeneity across spawning groups (Fishback et al. 2000) in a different strain of rainbow trout.

DNA analysis

DNA was isolated using a standard phenol chloroform extraction protocol (Taggart et al.

1992). The extracted stock DNA was used to prepare working solutions of 6ng/μl genomic DNA to be utilized in PCR reactions. PCR was used to amplify the selected markers using a 7μl reaction mixture containing forward and reverse primers, one of which was labeled with tetrachloro–6-carboxy-fluorescein (TET). The PCR temperature profile followed: one cycle of

95° C for 5 min; 4 cycles of 95° C for 1 min, 54° C for 30 s, and 72° C for 30 s; 29 cycles of 95°

C for 30 s, 54° C for 30 s, and 72° C for 30 s; one cycle of 72° C for 5 min. Genotypes at microsatellite loci were determined by electrophoresis using 6% polyacrylamide gels (for further details see Moghadam et al. 2007).

Statistical analysis

Allele counts and frequencies for all markers were determined for the population and separately for each spawning group using the program ALLELE_FREQ.exe (R. G. Danzmann).

For each marker, tests for significant differences in allele frequencies between early and late spawning groups were accomplished using exact G tests for genic differentiation in GENEPOP version 4.0.10 (Raymond and Rousset 1995). Markers that remained significant after Bonferroni correction were further analyzed by the program ALLELE_SC.exe (R. G. Danzmann) to determine which individual marker alleles differed significantly between the early or late spawning groups.

To test the degree to which the molecular data could be used to assign individuals to their correct spawning group (early or late), Chromosome Segment Sharing Coefficient (CSSC) values were calculated using the program CSSC.exe (R. G. Danzmann; programs available at: www.uoguelph.ca/~rdanzman by following the links to the software directory). This program assigns individuals to a spawning group based on the average number of shared alleles. Re- assignment estimates are made removing the test individual from the population, and re- calculating all pairwise shared CSSC, with re-assignment to the highest score cluster. To determine which markers contributed the most to the accuracy of individual assignment, backward elimination locus selection (BELS) software was used (Bromaghin 2008). This program operates on a similar basis to CSSC, using allele sharing coefficients to facilitate individual assignment. BELS evaluates the baseline data by removing one locus at a time, measuring the impact on the assignment accuracy and then reinstating the locus in the baseline data. After this is completed, BELS sequentially removes loci with the smallest impact on accuracy from the data set one at a time until only one locus remains. This provides a ranking of the loci as to how well the locus can assign an individual to the correct group based upon genotype. The analysis was performed under the performance measure “maximize mean individual assignment accuracy”, where the performance measure is the mean number of the

individuals that are correctly assigned to the correct grouping. Genotypes were constructed for

individual assignment performance measures using the simulation option with fixed number of

individuals per population, with a sample size of 200 individuals per population and 250

replications in the simulation.

To test for population structure, Hardy-Weinberg equilibrium (HWE) tests were

performed for all loci in the population using GENEPOP version 4.0.10 (Raymond and Rousset

1995). The program STRUCTURE version 2.3.4 (Pritchard et al. 2000) was used to further infer

the presence of population substructure. Genotypic data for all 63 marker loci from the 368

broodstock females was used in the admixture model with a burn-in length of 20000 followed by

20000 MCMC iterations. The number of populations assumed (K) was tested for K= 1 through 6

with 10 replications for each K value tested. The posterior probability of the data for a given K,

Pr(X | K) generated by the program for each replication was used to calculate ΔK which

facilitates estimation of the most likely K structure of the test grouping (Evanno et al. 2005).

RESULTS

Marker-trait associations

Twenty one of the 63 marker loci investigated displayed significant allelic heterogeneity

between early and late spawning females (Table 2.2). Of these, variation at 15 markers were

significantly associated with spawning date at the p< 0.001, 3 at the p< 0.01 and 3 at the p< 0.05

thresholds, spanning 14 linkage groups in total. Eight of the 14 linkage groups (RT-7, 8, 15, 22,

23, 24, 29 and 31) that demonstrated significant allelic heterogeneity have been previously

identified to have QTL or marker-trait associations for spawning date (Table 2.1). Markers from

six linkage groups (RT-5, 10, 12, 14, 25 and 30) where no previous spawning time QTL have

20 been detected, showed significant allelic differentiation between early and late spawning females.

Alleles significantly associated with either accelerated or delayed spawning date were identified for those markers showing significant heterogeneity (Table 2.2, Figure 2.2). The number of alleles for markers with significant effects ranged from 1 to 5 and averaged around 3.

In most cases the change in allele frequency between early and late spawners was clinal, where the middle spawning group had an intermediate frequency compared to fish in the early and late spawning groups. The overall frequencies of significant alleles in the population varied from being relatively rare (< 5%) to being the most common (> 50%). In some cases the change in allele frequencies between early and late spawning groups was markedly different with frequencies varying 8-fold (Figure 2.2).

Individual assignment

The BELS analysis confirmed the results from the exact G-test for genic differentiation.

Without exception, all 15 markers showing highly significant (p< 0.001) genic differentiation were ranked by BELS within the top 15 markers in their ability to assign individuals to their spawning group based on genotype (Table 2.2). The marker with the largest contribution to assignment accuracy was OMM5176 on linkage group RT-23. This marker had a relatively large number of alleles (5) that differed significantly between spawning groups. Additionally, the allele designated #4 at this locus is the most common allele present in the population and declines in frequency from 44% in early spawners to only 24% in late spawners. A similar pattern was observed for the markers from RT-12 ranked second and third by BELS (OMM3061

21 and OMM1277, respectively) where both markers had at least one allele in high frequency in the population that showed marked differences between the early and late spawning groups.

The individual assignment analysis from CSSC using genotype data for all 63 loci was successful in assigning the majority of females to their correct spawning group. Based on chromosome sharing coefficients, 74% and 76.5% of females were correctly assigned to the early and late spawning groups, respectively. Using information gained from the BELS analysis, genotype information from only the top 15 ranked markers were used to perform an additional individual assignment analysis in CSSC. The results compared favorably to the initial analysis with 79% and 73.5% of females being correctly assigned to the early and late spawning groups, respectively, demonstrating that a reduction from 63 marker loci to a selective subset of 15 markers could be used to assign individuals without any significant reduction in accuracy.

Detection of population substructure

HWE tests revealed that 18 out of 63 marker loci did not conform to Hardy-Weinberg expectations (Supplementary Table 2.1). The analysis using the program STRUCTURE indicated that substructuring could be affecting this population as the mostly likely ΔK value was

2 (Supplementary Figure 2.1). However, a robust estimate for values less than 2 cannot be obtained and the lower threshold value obtained is consistent with an interpretation of either 1 or

2 groupings within the dataset.

DISCUSSION

This study investigated the genomic regions influencing spawning time in rainbow trout

and has revealed significant allelic heterogeneity in one third of the markers investigated. This

variation was localized to 13 of the 29 linkage groups in this species and the degree of

heterogeneity detected is consistent with the hypothesis that many loci are involved in the control

of this complex life history trait and supports earlier work (Leary et al. 1989; Sakamoto et al.

1999; Fishback et al. 2000).

The large amount of genetic variation between early and late spawning phenotypes

uncovered in this study indicates that these markers would be useful in a MAS program. This is

evidenced by the fact that allelic differentiation at all 63 marker loci was great enough to allow

for the correct assignment of females to their respective spawning group with an average

accuracy of 75.25%. This compares favorably to Fishback et al. (2000), where the same CSSC

analysis assigned females from another commercial population to correct spawning groups with

an accuracy of 72.5%. The 15 markers showing the strongest allelic differentiation (P < 0.001)

between the early and late spawning groups were also ranked as the top 15 predictors of

spawning groups for the individual assignment analysis. Accuracy of assignment was

maintained and even increased slightly (i.e., 76% CSSC accuracy) when the analysis was

performed using only the top 15 ranked markers. Accurate assignment based on only a subset of

marker loci would provide a cost effective means to evaluate selection candidates as minimal

genotyping would be required. The next step is to use the markers detected in this study to

identify male selection candidates and perform crosses to evaluate the validity and potential of

this approach for use in MAS.

Many of the markers displaying significant heterogeneity between spawning groups are located in regions where spawning date QTL or marker-trait associations have been detected in previous studies (e.g., linkage groups RT-7, 8, 15, 22, 23, 24 and RT-31) (Fishback et al. 2000;

Leder et al. 2006). However, in addition to these, significant associations were detected on linkage groups not previously reported to contain spawning date QTL (i.e., RT-5, 10, 12, 14, 25 and RT-30). In contrast to this, no associations were detected on linkage groups RT-3, 11, 16,

18, 19, 21, 20 or RT-29, which were previously reported to contain spawning date QTL

(Fishback et al. 2000; Leder et al. 2006). The discrepancies between the current dataset and these previous studies may be caused by strain differences, or may due to differences in sampling between the studies. The study by Leder et al. (2006) examined variation in one backcross family only, while the study by Fishback et al. (2000) examined a limited number of markers (14 spanning 11 linkage groups).

As is the case with many association studies, marker-trait associations detected in this study do not necessarily indicate a spawning date QTL in that particular region as these associations may be the result of population stratification. Stratification can be caused by various factors such a drift due to temporal isolation or a higher level of relatedness within the groups being compared. As such, further investigation is required to confirm these associations.

However, given that many of the strongest associations in this study were detected in linkage group regions that have been identified in previous studies as containing spawning date and life- history related QTL (i.e., linkage groups RT-8/24), or potentially co-localize with candidate genes that are known to have a strong influence on circadian rhythms (i.e., linkage groups RT-12 and RT-23; see Discussion below), we feel that selection on these life-history regulating genetic regions is the major causal reason for the genetic differentiation within the population that is

24 currently present. A whole genome duplication event that gave rise to the salmonid lineage has led to the observation that many life-history QTL may be functionally duplicated and conserved across homeologous linkage groups (O’Malley et al. 2003; Somorjai et al. 2003). The significant associations we detected on RT-7 & -15, and RT-8 with -24 may be the result of homeologous linkage groups containing conserved duplicated QTL for spawning date. The linkage group arms

RT-7q/15p and RT-8q/24p represent homeologous linkage group affinities in rainbow trout

(Danzmann et al. 2008). Furthermore, the observation that duplicated copies of the clock gene

(clock1a/clock1b) map to RT-8/24, and period1 (per1) maps to RT-7/15 suggests these as potential candidates contributing to these observed spawning time differences (Paibomesai et al.

2010; Leder et al. 2006). The clock gene system (clock, bmal, period, and cryptochrome) consists of interconnected positive and negative transcription/translation feedback loops and acts as an endogenous clock which maintains circadian rhythms and regulate genes responsible for a wide range of temporally expressed biological activities. The duplicated regions on RT-8/24 represented the 3rd and 4th strongest regions associated with spawning time differences in the current study. While we cannot directly ascribe the observed differences in female spawning date directly to circadian regulating genes, these genes remain some of the most likely candidates for the observed differences based upon their known functions.

We performed a comparative homology search within the medaka (Oryzias latipes) genome to ascertain candidate genes that may be driving the strong marker-trait associations observed on RT-23 and -12). Genes syntenic with the markers identified in our study and others known to be within same linkage groups (Guyomard et al. 2006; Danzmann et al. 2008; Palti et al. 2012) were used in the homology search. The region on linkage group RT-23 appears to show highest homology to medaka chromosome 17 (see Supplementary Table 2.2 for a number

25 of possible candidate genes within this block). Of note, with respect to circadian-regulating genes, is the presence of per2 gene, although this putative association is not confirmed by direct mapping in rainbow trout. OMM5176 on RT-23 was the marker ranked as most significant in predicting spawning group. A copy of the gene glutamine synthetase (gs02) (also known as glutamate-ammonia ligase (glul) maps ~5cM adjacent to OMM5176 on RT-23 (Gharbi et al.

2007; Danzmann et al. 2008), and is approximately 100Kb adjacent to the per2 gene in the medaka genome. Glutamate synthetase genes may be important regulatory genes influencing sexual maturation cycles in vertebrates. Down-regulation of gs expression is linked to increasing glutamate pools within the hypothalamic-pituitary neuronal domains at the onset of sexual maturation, with higher glutamate levels having a direct stimulatory role on increasing gonadotropin releasing hormone (gnrh) expression (Ojeda et al. 2006). gs01 and gs03 may also be candidates for the QTL detected on RT-24, and RT-8, as they appear to be paralogs that map to these homeologous linkage groups (Gharbi et al. 2007).

The genomic region showing the greatest homology to RT-12 is a portion of medaka chromosome 5 (see Supplementary Table 2.3). A number of circadian regulating genes such as timeless, and the bHLH regulatory genes dec1a and dec1b (i.e., bhlhe40 genes) are located in this block, as well as the per3 gene. Alterations in the expression levels of both bhlhe40 and timeless can alter period length of the circadian rhythm, as these genes primarily interact with the photic phase genes such as the cryptochrome (cry) and period genes. However, knowledge of their function is primarily derived from studies with Drosophila and mammals (Nakashima et al.

2008; Rossner et al. 2008; Utge et al. 2010; Engelen et al. 2013) and their functions within fishes is largely unknown, although dec1 and dec2 have also been shown to alter circadian gene cycles in zebrafish (Danio rerio) (Abe et al. 2006).

Another gene of interest that putatively maps to the region being evaluated on RT-12 is the gnrh2 gene. Gnrh regulates the release of gonadotropins from the pituitary gland, and has a particularly potent influence on regulating the release of Leutinizing Hormone (GtHII or the primary active subunit LHβ), which is the major signaling hormone in final oocyte maturation in females (Breton et al. 1998; Zohar et al. 2010). Three forms of gnrh exist in fishes, and gnrh1 is regarded as a more potent stimulator of the pituitary axis genes (Zohar et al. 2010). gnrh1 is not present in all fishes and given the similar tissue developmental origins of the gnrh1 and gnrh3 expressing genes (Zohar et al. 2010), gnrh3 may share more similarity in function compared to gnrh2. gnrh3, and more specifically gnrh3a (as the duplicate form, gnrh3b, maps to RT-6) has been mapped to RT-30 in rainbow trout (Leder et al. 2006). In this study, the marker

OmyRGT24TUF showed a significant association with spawning date, and maps in close proximity to the gnrh3a gene, meriting further investigation to confirm the possible presence of a

QTL in this region. This region of the RT-30 linkage group was also recently reported to have a significant influence on embryonic developmental rates in rainbow trout (Easton et al. 2011).

We have recently mapped two genes, cry2 gene (TC163404), and sirtuin gene sirt4

(CR376409) to the region on RT-12 (unpublished data) referred to above that may also regulate biological rhythms. With respect to cry2, homology comparisons to medaka and other fish species indicates that this gene is located on another chromosome. In medaka, cry2 maps to chromosome 6, and within a region that does not share ancestral homology to the region on chromosome 5 depicted in Supplementary Table 2.3. However, sirt4 is likely located within the region of ancestral homology indicated (Danzmann et al. 2008). sirt4 is of interest in that it is known to directly regulate expression of glutamate dehydrogenase (gdh) in mammals (Haigis et al. 2006) and thereby indirectly regulates glutamate pools within cells. If similar functions exist

27 in fishes, it could suggest a direct coupling to glutamine synthetase activity. The observation that several putative circadian regulating genes cluster in this region of RT-12 in rainbow trout warrants further study.

Conclusions

A large proportion of the rainbow trout genome has been discovered to contain QTL influencing the timing of yearly spawning in female rainbow trout. Repeat studies indicate that three of the top 4 linkage group regions associated with allelic heterogeneity in this trait are likely derived from the same ancestral teleost chromosome lineage, and two of these linkage groups are also homeologs (i.e., RT-8/24) possessing genes that also influence other life-history traits such as developmental rate (Nichols et al. 2007; Easton et al. 2011; Miller et al. 2012) and maturation timing (Haidle et al. 2008) in rainbow trout. Linkage group RT-12 and RT-23

(chromosomes Omy7 and Omy8, respectively) were also discovered to have a strong influence on female reproductive timing in this study, and comparative homology studies reveal that several circadian regulating genes co-localize with major QTL regions we describe in this study suggesting their possible contribution to the observed phenotypic effects.

Ultimately, the goal for QTL detection for economically important traits in aquaculture species is the eventual application of the data to enhance the genetic quality of the strain under study. The major regions of the genome influencing spawning time in the LYNDON strain identified in this study will provide a framework for future studies to build on. Further research should focus on fine mapping of those regions identified in this study to further refine the position of QTL with the aim of creating a panel of tightly linked markers suitable for the application of MAS. The major regions found to influence spawning date could be applied to

MAS programs in other strains provided that the allelic variants associated with accelerated or delayed spawning at these loci were identified independently for each strain. Since spawning date is also a sex-limited trait, MAS applied to males in a given population should also accelerate genetic gains.

REFERENCES

Breton B, Govoroun M, Mikolajczyk T (1998) GTH I and GTH II secretion profiles during the reproductive cycle in female rainbow trout: relationship with pituitary responsiveness to GnRHa stimulation. Gen Comp Endocr 111:38–50

Bromage N, Jones J, Randall C, Trush M, Davies B, Springate JCR, Duston J, Baker G (1992) Broodstock management, fecundity, egg quality and the timing of egg production in the rainbow trout Oncorhynchus mykiss. Aquaculture 100:141-166

Bromage N, Randall C, Davies B, Thrush M, Duston J, Carillo M, Zanuy S (1993) Photoperiodism and the Control of Reproduction and Development in Farmed Fish, in Aquaculture: Fundamental and Applied Research (eds B. Lahlou and P. Vitiello), American Geophysical Union, Washington, D. C. doi: 10.1029/CE043p0081

Bromaghin JF (2008) BELS: backward elimination locus selection for studies of mixture composition or individual assignment. Mol Ecol Resour 8:568–571

Danzmann RG, Davidson EA, Ferguson MM, Gharbi K, Koop BF, Hoyheim B, Lien S, Lubieniecki KP, Moghadam HK, Park J, Phillips RB (2008) Distribution of ancestral proto- Actinopterygian chromosome arms within the genomes of 4R-derivative salmonid fishes (Rainbow trout and Atlantic salmon). BMC Genomics 9:557

Dekkers JCM (2004) Commercial application of marker- and gene-assisted selectionin livestock: Strategies and lessons. J Anim Sci 82:313-328

Easton AA, Moghadam HK, Danzmann RG, Ferguson MM (2011) The genetic architecture of embryonic developmental rate and genetic covariation with age at maturation in rainbow trout Oncorhynchus mykiss. J Fish Biol 78:602–623

Engelen E, Janssens RC, Yagita K, Smits VAJ, van der Horst GTJ, Tamanini F (2013) Mammalian TIMELESS Is Involved in Period Determination and DNA Damage- Dependent Phase Advancing of the Circadian Clock. PLoS ONE 8:e56623

Evanno G, Regnaut S, Goudet J (2005) Detecting the number of clusters of individuals using the software structure: a simulation study. Mol Ecol 14:2611–2620

Fishback AG, Danzmann RG, Ferguson MM (2000) Microsatellite allelic heterogeneity among hatchery rainbow trout maturing in different seasons. J Fish Biol 57:1367-1380

Gharbi K, Murray BW, Moghadam HK, Ferguson MM, Wright PA, Danzmann RG (2007) Genome organization of glutamine synthetase genes in rainbow trout (Oncorhynchus mykiss). Cytogenet Genome Res 116:113–115

Guyomard R, Mauger S, Tabet-Canale K, Martineau S, Genet C, Krieg F, Quillet E (2006) A type I and type II microsatellite linkage map of rainbow trout (Oncorhynchus mykiss) with presumptive coverage of all chromosome arms. BMC Genomics 7:302

Guyomard R, Boussaha M, Krieg F, Hervet C, Quillet E (2012) A synthetic rainbow trout linkage map provides new insights into the salmonid whole genome duplication and the conservation of synteny among teleosts. BMC Genetics 13:15

Haidle L, Janssen JE, Gharbi K, Moghadam HK, Ferguson MM, Danzmann RG (2008) Determination of quantitative trait loci (QTL) for early maturation in rainbow trout (Oncorhynchus mykiss). Mar Biotechnol 10:579-592. doi: 10.1007/s10126-008-9098-5

Haigis MC, Mostoslavsky R, Haigis KM, Fahie K, Christodoulou DC, Murphy AJ, Valenzuela DM, Yancopoulos GD, Karow M, Blander G, Wolberger C, Prolla TA, Weindruch R, Alt FW, Guarente L, (2006) SIRT4 inhibits glutamate dehydrogenase and opposes the effects of calorie restriction in pancreatic ß cells. Cell 126:941–954

Lande R, Thompson R (1989) Efficiency of marker-assisted selection in the improvement of quantitative traits. Genetics 124:743-756

Leary RF, Allendorf FW, Knudsen K.L (1989) Genetic differences among rainbow trout spawned on different days within a single season. Prog Fish Cult 51:10–19

Leder EH, Danzmann RG, Ferguson MM (2006) The candidate gene, Clock, localizes to a strong spawning time quantitative trait locus region in rainbow trout. J Hered 97:74-80

Mackay TFC (2001) The genetic architecture of quantitative traits. Annu Rev Genet 35:303-339

Miller MR, Brunelli JP, Wheeler PA, Liu S, Rexroad CEIII, Palti Y, Doe CQ, Thorgaard GH (2012) A conserved haplotype controls parallel adaptation in geographically distant salmonid populations. Mol Ecol 21:237-249

Moghadam HK, Poissant J, Fotherby H, Haidle L, Ferguson MM, Danzmann RG (2007) Quantitative trait loci for body weight, condition factor and age at sexual maturation in Arctic charr (Salvelinus alpinus): comparative analysis with rainbow trout (Oncorhynchus mykiss) and Atlantic salmon (Salmo salar). Mol Genet Genomics 277:647–661

Nakashima A, Kawamoto T, Honda KK, Ueshima T, Noshiro M, Iwata T, Fujimoto K, Kubo H, Honma S, Yorioka N, Kohno N, Kato Y (2008) DEC1 modulates the circadian phase of clock gene expression. Mol Cell Biol 28:4080–4092

Neira R, Diaz NF, Gall GAE, Gallardo JA, Lhorente JP, Alert A (2006) Genetic improvement in coho salmon (Oncorhynchus kisutch). II: Selection response for early spawning date. Aquaculture 257:1-8

Nichols KM, Broman KW, Sundin K, Young JM, Wheeler PM, Thorgaard GH (2007) Quantitative trait loci x maternal cytoplasmic environment interaction for development rate in Oncorhynchus mykiss. Genetics 175:335-347

Ojeda SR, Lomniczi A, Mastronardi C, Heger S, Roth C, Parent AS, Matagne V, Mungenast AE (2006) Minireview: the neuroendocrine regulation of puberty: Is the time ripe for a systems biology approach? Endocrinology 147:1166–1174

O’Malley KG, Sakamoto T, Danzmann RG, Ferguson MM (2003) Quantitative trait loci for spawning date and body weight in rainbow trout: Testing for conserved effects across ancestrally duplicated chromosomes. J Hered 94:273-284

Paibomesai MI, Moghadam HK, Ferguson MM, Danzmann RG (2010) Clock genes and their genomic distributions in three species of salmonid fishes: Associations with genes regulating sexual maturation and cell cycling. BMC Res Notes 3:215

Palti Y, Genet C, Gao G, Hi Y, You FM, Boussaha M, Rexroad CE, Lou MC (2012) A second generation integrated map of the rainbow trout (Oncorhynchus mykiss) genome: analysis of conserved synteny with model fish genomes. Mar Biotechnol 14:343–357

Pritchard J K, Stephens M, Donnelly P (2000). Inference of population structure using multilocus genotype data. Genetics 155:945–959

Raymond M, Rousset F (1995) GENEPOP (version 1.2): population genetics software for exact tests and ecumenicism. J Hered 86:248-249

Rexroad CE, Palti Y, Gahr, SA, Vallejo RL (2008) A second generation genetic map for rainbow trout (Oncorhynchus mykiss). BMC Genetics 9:74

Rice WR (1989) Analyzing tables of statistical test. Evolution 43:223–225

Rossner MJ, Oster H, Wichert SP, Reinecke L, Wehr MC, Reinecke J, Eichele G, Taneja R, Nave KA (2008) Disturbed clockwork resetting in Sharp-1 and Sharp-2 single and double mutant mice. PLoS ONE 3:e2762

Sakamoto T, Danzmann RG, Okamoto N, Ferguson MM, Ihssen PE (1999) Linkage analysis of quantitative trait loci associated with spawning time in rainbow trout (Oncorhynchus mykiss). Aquaculture 173:33-43

Sadler SE, McLeod D, McKay LR, Moccia RD (1992) Selection for early spawning and repeatability of spawn date in rainbow trout. Aquaculture 100:103

Siitonen L, Gall GAE (1989) Response to selection for early spawn date in Rainbow Trout, Salmo gairdneri. Aquaculture 78:153-161

Somorjai IML, Danzmann RG, Ferguson MM (2003) Distribution of temperature tolerance quantitative trait loci in Arctic charr (Salvelinus alpinus) and inferred homologies in rainbow trout (Oncorhynchus mykiss). Genetics 165:1443–1456

Springate JRC, Bromage NR, Elliott JAK, Hudson DH (1984) The timing of ovulation and stripping and their effects on the rates of fertilization and survival to eyeing, hatch and swim up in the rainbow trout (Salmo qairdneri). Aquaculture 43:313-322

Su GS, Liljedahl LE, Gall GAE (1997) Genetic and environmental variation of female reproductive traits in rainbow trout (Oncorhynchus mykiss). Aquaculture 154:115-124

Taggart JB, Hynes RA, Prodöhl PA, Ferguson A (1992) A simplified protocol for routine total DNA isolation from salmonid fishes. J Fish Biol 40:963-965

Utge SJ, Soronen P, Loukola A, Kronholm E, Ollila HM, Pirkola S, Porkka-Heiskanen T, Partonen T, Paunio T (2010) Systematic analysis of circadian genes in a population-based sample reveals association of TIMELESS with depression and sleep disturbance. PLoS One 5:e9259

Yue GH (2013) Recent advances of genome mapping and marker-assisted selection in aquaculture. Fish Fisheries doi: 10.1111/faf.12020

Zohar Y, Mylonas CC (2001) Endocrine manipulations of spawning in cultured fish: from hormones to genes. Aquaculture 197:99-136

Zohar Y, Munoz-Cueto JA, Elizur A, Kah O (2010) Neuroendocrinology of reproduction in teleost fish. Gen Comp Endocr 165:438–455

Table 2.1 Sixty three marker loci distributed among all 29 linkage groups used for genotype

analysis of females in the LYNDON broodstock of rainbow trout. References are given for the

15 linkage groups known to contain spawning date QTL.

Linkage group Marker

RT-1 BX076085 RT-2 Omy1UoG, Omy1212UW, BHMS211 RT-3a, b, c BX317661, OMM1297 RT-5 CA061336 RT-6 OMM1231, OMM1082 RT-7b, c Omy7INRAb, OMM1220 RT-8 a, b, c BX299451, OmyFGT12TUFa, OMM5060, One114ADFG RT-9 OMM1161, One14ASC, OMM1001 RT-10 BX867246, Omy1002UW, Omy1120UW RT-11b, c CA347214, Ots515NWFSCb RT-12 OMM3061, OMM1277 RT-13 CR373404, OmyRGT14TUF RT-14 OMM5327, OMM1412/i RT-15a BX887563, OMM5100 RT-16a OMM1088 RT-17 BX305863 RT-18b, c CA054565 RT-19b, c One3ASC RT-20b, c OMM1332, OMM1412/ii RT-21a OMM1334, OMM5132, BX082639 RT-22 a, b, c OMM1362, OMM5287 RT-23a OMM5239, OMM5176 OmyRGT36TUFb, BHMS377b, Omy4DIAS, BX077780, Clock1b- RT-24b, c PolyQ RT-25 OMM1054, OMM1335, BHMS486 RT-26 OMM5159 RT-27 OMM1070, OMM5177, OMM3002 RT-29c CA367675, OMM1113, OmyRGT19TUF RT-30 OmyRGT24TUF, OMM1019 RT-31b, c OmyRGT1TUF, OMM1058b Markers and/or linkage groups with significant associations with spawning date detected by aFishback et al. 2000, bLeder et al. 2006 and cDanzmann unpublished update (i.e., uses

the same family as reported in Leder et al. (2006) but with additional marker coverage).

0.05 following sequential Bonferroni testing (Rice 1989). For each marker, the alleles whose frequency differed significantly between early and late spawning groups are given in the last column. The BELS ranking for each marker is also provided, where l indicates the marker with the highest discriminatory power.

Linkage BELS Alleles with significant Chromosome Marker group ranking effect p<0.001 RT-7 15 Omy7INRA 12 1, 4, 5 RT-7 15 OMM1220 9 1, 3, 7 RT-8 5 BX299451 8 1, 4, 6 RT-8 5 OMM5060 5 1, 3, 7, 8 RT-10 6 Omy1002UW 13 2, 8, 9, 10 RT-12 7 OMM1277 3 3, 7, 10 RT-12 7 OMM3061 2 3, 4, 6, 9 RT-14 19 OMM5327 7 4, 7, 8, 9 RT-15 21 BX887563 15 4, 5, 6, 8, 10 RT-23 8 OMM5176 1 3, 4, 6, 8, 11 RT-24 4 OmyRGT36TUF 14 5, 6, 8 RT-24 4 BX077780 4 2, 4, 6, 7 RT-25 29 OMM1054 6 2, 4, 6, 7, 16 RT-29 17 OmyRGT19TUF 10 4 RT-30 23 OmyRGT24TUF 11 2, 4, 6, 7 p<0.01 RT-23 8 OMM5239 25 2, 7, 8 RT-24 4 Omy4DIAS 16 1, 6, 8 RT-31 3 OmyRGT1TUF 17 2, 5 p<0.05 RT-5 22 CA061336 18 2, 4 RT-8 5 One114ADFG 28 5 RT-22 16 OMM5287 31 2, 4

12th samples were omitted entirely from the genetic analysis as well as a subset of individuals from other sampling dates (21 from Oct. 28th, 46 from Nov. 4th, 53 from Nov. 11th, 77 from Nov

19th and 24 from Nov 26th).

CHAPTER III Marker assisted selection for spawning date and co-variation among economically important fitness traits in a commercial strain of rainbow trout (Oncorhynchus mykiss)

ABSTRACT: The effects of marker assisted selection for spawning date in males on embryonic

developmental rate, growth and precocious male maturation and phenotypic and genetic

correlations among traits were investigated in a commercial strain of rainbow trout

(Oncorhynchus mykiss). Families produced by males with an allele compliment associated with

late spawning had significantly faster developmental rates and higher rates of precocious male

maturation. QTL analysis suggests that some of the co-variation between spawning date and

developmental rate has a genetic basis as two QTL for developmental rate co-localized to the

same markers known to be associated with spawning date in this strain. The lack of an

association between the allelic compliment of the sire and progeny growth suggests that selection

for early or late spawning alleles will have little effect on growth traits. A strong correlation

between body size and precocious male maturation was detected and males that matured

precociously were significantly heavier at earlier sampling periods. This indicates that selection

for greater body size will likely result in higher rates of unwanted precocious male maturation.

Within families, faster developmental rates conferred a size advantage at the onset of exogenous

feeding and at 13 months post fertilization in male progeny but not at 20 months. However, no

correlation between development rate and the propensity of early male maturation was detected.

Together, these results suggest that co-variation among economically important fitness traits may

present potential trade-offs impacting selection goals.

INTRODUCTION

Fishes display immense variability in life-history strategies within and among species

(Hutchings 2002). The evolution of life-history strategies is often constrained by correlations

among traits, which present themselves as trade-offs where optimization of one trait will come at

the expense of another (Stearns 1989). The dynamic interactions of life history and growth traits

have important implications for commercially farmed fish species, whereby phenotypic and

genetic correlations of traits can impact broodstock management when selection for one

economically important trait may influence another in an undesirable manner (Doyle 1983). In

order to balance the breeding objectives for several traits at once, interactions between traits

must be assessed in the specific species and strain.

One of the most well documented examples of correlated trait responses arises from the

negative correlations between growth and age at maturity in many cultured species (Taranger et

al. 2010). As a result of domestication, growth rates have increased, which has led to a decrease

in age at maturation. Selection for increased growth rates and decreased precocious maturation

are common breeding goals in aquaculture. Maturation is a costly physiological process that

requires an organism to accumulate adequate energy reserves and a certain size threshold must

be surpassed before maturation is initiated (Simpson 1992; Crandall and Gall 1993, Day and

Rowe 2002). High levels of precocious maturation under domestication has been problematic

in the production of many species such as European seabass (Dicentrarchus labrax) (Begtashi et

al. 2004) and Atlantic cod (Gadus morhua) (Karlsen et al. 2006; Taranger et al. 2006), and is

attributed to increased growth experienced under farming conditions. Given the strong

correlation between increased growth and early maturation, selection for faster growth will likely

lead to undesirable increases of precocious maturation in economically valuable species such as

39 cod and halibut (Hippoglossus hippoglossus) (Godø and Haug 1999), tilapia (Oreochromis niloticus) (Longalong et al. 1999) and the salmonids (Thorpe et al. 1983; Crandell and Gall

1993; Quinton et al. 2002).

One of the characteristic features of reproduction in temperate fishes is the seasonality of spawning and relatively limited period of female ovaluation (Migaud et al. 2010). This seasonality can be an obstacle in the production year-round seedstock for farmed species. Thus, the manipulation of broodstock spawning dates to direct and expand the egg producing season is of great importance in the production of many species such as cod (Norberg et al. 2004), seabass

(Carrillo et al. 1989; Mañanós et al. 1997), halibut (Holmefjord et al. 1993) and the salmonids

(Bromage et al. 1993; Gall and Neira 2004). Artificial selection for earlier spawning times has shown favourable responses in coho salmon (Oncorhynchus kisutch) (Neira et al. 2006) and rainbow trout (Oncorhynchus mykiss) (Siitonen and Gall 1989; Sadler et al. 1992). However, the possible correlated responses resulting from selection for spawning date on the timing of other economically important life history traits such as embryonic developmental rate and age at maturation as well as growth traits is not well understood.

Rainbow trout are a member of the Family Salmonidae, which all display relatively narrow ovulation windows. Spawning date in rainbow trout is expressed differentially in the sexes, with females ovulating in discrete intervals (1-2 weeks) while males may produce milt over a 6 month period. Thus, phenotypic selection for spawning date is mostly applied to females. However, selection for this trait would benefit through the use of molecular markers to select for males. Several family based quantitative trait locus (QTL) studies have revealed the major areas of the genome that influence spawning date within a season in commercial strains of

O. mykiss (Sakamoto et al. 1999; O’Malley et al. 2003; Leder et al. 2006). Recently, association

40 analysis of broodstock females of a commercial hatchery strain revealed significant allelic heterogeneity between females spawning early and late within the same season (Chapter II;

Allen et al. 2014). Detection of genetic differentiation at the population level could be exploited to select breeding candidates expressing genetic markers associated with a particular spawning time in order to increase genetic gains for this trait.

Much of the life-history and phenotypic variation in rainbow trout like most species has a genetic basis, with moderate to high heritabilities detected for growth (Gjerde and Schaeffer

1989), developmental rate (McIntyre and Blanc 1973), age at maturation (Gall et al. 1988) and spawning time (Siitonen and Gall 1989; Su et al. 1997). The co-localization of major QTL for developmental rate (Robinson et al. 2001; Sundin et al. 2005; Nichols et al. 2007; Easton et al.

2011), age at maturation (Haidle et al. 2008) and spawning time (Sakamoto et al. 1999;

O’Malley et al. 2003; Leder et al. 2006) to the central region of linkage group 8 (chromosome 5) in this species suggests that there may be underlying genetic causes of correlations among these traits due to pleiotropy or linkage disequilibrium.

Given the possible genetic correlations between important production traits, the effect of selection for spawning date using molecular markers on other traits should be investigated.

There is evidence that several life history traits may also be correlated at the phenotypic level in

O. mykiss. Larger body size has been shown to have an association with earlier maturation

(Crandell and Gall 1993; Quinton et al. 2002; Kause et al. 2003; Martyniuk et al. 2003) and in some cases differences in embryonic development may result in differential growth (Andersson et al. 2013) and incidence of early maturation (Allendorf et al. 1983). Furthermore, maturation and spawning date are interrelated in female rainbow trout (Gall et al. 1988) and significant correlations have been found between spawning weight and date (Su et al. 1997). There is some

41 evidence that maturation schedules are advanced in female rainbow trout derived from dams that spawn later in the season (Gall 1983). In other salmonid species, embryonic developmental rates were accelerated in progeny derived from late spawning females compared to early spawning females (Beacham and Murray 1986, 1987; Tallman 1986; Beacham 1988; Tallman and Healey

1991). While no genetic correlation between spawning date and growth was detected by

Quinton et al. (2002), faster growth in fall spawning strains compared to spring spawning strains was found in commercial populations of Ontario rainbow trout (McMillan and McKay 1992).

The first goal of this study was to investigate the effects of marker assisted selection for spawning date in males on embryonic developmental rate, growth and precocious male maturation. We used data from a previous study of microsatellite variability in females with different spawning dates within a season (Chapter II; Allen et al. 2014) to identify male selection candidates carrying alleles associated with either accelerated or delayed spawning date. Several maternal half-sib crosses were made between those males to females with spawning dates falling within the mean of the hatchery population. If there is a genetic correlation among these traits, we expected that selection for earlier or later spawning dates would lead to changes in progeny developmental rates, growth and precocious maturation. Our second goal was to determine if phenotypic correlations between developmental rate, body size and precocious maturation exist in this commercial strain. We predicted that faster developmental rates will result in a growth advantage and precocious maturation will occur more frequently in males with a larger relative body size. Our third goal was to test for genetic correlations between loci associated with spawning date and developmental rate. We therefore performed a QTL analysis for embryonic developmental rate in four maternal half-sib families. If genetic correlations exist between spawning date and developmental rate, we predict that QTL for developmental rate will co-

localize to the same markers associated with spawning date at a population level (Allen et al.

2014) and known QTL locations (Sakamoto et al. 1999; O’Malley et al. 2003; Leder et al. 2006).

MATERIAL and METHODS

Experimental families

Rainbow trout utilized in the experimental crosses were from the Lyndon commercial

hatchery strain (Lyndon Fish Hatcheries, Ontario, Canada) (see Allen et al. 2014 for details on

the history of this strain). A total of 63 broodstock males were PIT tagged and fin clipped for

DNA analysis prior to the 2010 spawning season. Candidates to be used for the crosses were

determined using a selection index based solely on genotypic data. Males were genotyped for 15

microsatellite markers previously determined to have significant associations with the spawning

date of females in this strain (Allen et al. 2014). Selection co-efficients (SC) based on genotype

data of female broodstock spawning in the 2008/2009 spawning season were determined for

alleles at the 15 marker loci using the program ALLELE_SC.exe (Table 3.1). Alleles

significantly associated (p<0.05) with accelerated or delayed spawning dates were assigned an

SC value ranging from -1 to 1, where negative and positive values indicate an allele associated

with early or late female spawning date, respectively. Allelic heterogeneity between early and

late spawning females was assessed using a heterogeneity Chi-square test. Only alleles with

significant heterogeneity were included in the vector analysis and all other allelic classes were

given a 0 value. The numerical value of the allele selection co-efficient was calculated as the

probability that the presence of that allele could assign a given individual to the correct spawning

group. For a given allele, this value is obtained by dividing the allele count present in the

spawning group that the allele is associated with, by the total allele count in the entire

population. SC values were manually designated positive or negative dependent upon whether

43 the frequency of the allele of was higher in late versus early-spawning females, respectively.

The SC values were used along with the male broodstock genotypic data to generate a vector score for each of the 63 individuals with the program ALLELE_VECTOR-SC.exe (R. G.

Danzmann). The vector score represents the cumulative value of an individual’s allelic compliment weighted by the pre-determined SC for each allele, and is given by the formula:

VS = [bi(xi) +… + bn(xn)] Where, VS= vector score

th bi = selection co-efficient of the i allele

th xi = number of copies of the i allele (= 0, 1 or 2)

The resulting vector scores fall along a continuum where individuals with relatively negative vector scores are those whose cumulative genotype is associated with early spawning dates and individuals with more positive vector scores have genotypes associated with late spawning dates. Vector scores close to 0 indicate no genotypic association with accelerated or delayed spawning time relative to the population mean. Based on the vector scores of the 63 selection candidates, males with relatively negative and males with relatively positive vector scores were selected for the experimental crosses (Figure 3.1).

Four maternal half-sib families were created by crossing 2 males with vector scores associated with early spawning date (families M-29, M-30) and 2 males with vector scores associated with late spawning date (families M-52, M-54) to a single female (F2473) with a spawning date in the middle spawning distribution. Similarly, 3 additional sets of half-sib families were created by crossing a male with a positive vector score (M57, M32, M33) and a negative vector score (M59, M16, M42) to a single female (F2466, F2468, F2469, respectively) with a spawning date in the middle spawning distribution (Figure 3.1). Gamete collection for the

44 crosses was completed in the 2010 spawning season on November 24th. Once the crosses were made, embryos were transferred from Lyndon fish hatcheries to the Alma Aquaculture Research

Station (Alma, Ontario, Canada) and reared at ground water temperature (10-11°C) and fed food rations based on tank biomass until maturity.

Developmental rate

Hatching time was used as a measure of embryonic developmental rate. After fertilization, approximately 110 embryos from each family were placed in separate sections of vertical flow-through incubator trays. Half-sib families M-29, 30, 52 and 54 were replicated four times, resulting in a total of about 450 embryos per family. Half-sib families M-59 and -57, M-

16 and -32, M-42 and 33 were replicated two times, resulting in a total of about 220 embryos per family. Hatching commenced 36 days post-fertilization on Dec 30th 2010 and was complete by

Jan 4th 2011. Upon hatching, embryos were monitored every 2-4 hours and hatched embryos were counted and moved to another incubator. The first, middle and last 33% of embryos hatched from each family were placed in separate incubator sections to create the hatching designations; early, middle and late hatching groups. Half-sib families M-59 and -57, M-16 and

-32, M-42 and -33 were culled after completion of hatching. The early, middle and late hatching groups from each of the half-sib families of female 2473 were reared in separate tanks under a natural photoperiod.

Body size

At the onset of exogenous feeding, a sub-sample of embryos from each hatching group within each family was collected and the lengths of each were determined via stereo microscope equipped with an eyepiece reticle. The embryos were preserved in 75% ethanol for later use in

45 the QTL analysis. At 1 year of age fish from all families were PIT tagged and a tissue sample was taken. Body size, as measured by weight and length were sampled at two time points when the fish were about 13 months (December 20th, 2011) and 20 months (July 30th, 2012) of age.

For each sampling date, Fulton’s condition factor (K) was calculated as [100*(BW/ FL3)], where

BW is body weight in grams and FL is fork length in centimeters (Ricker 1975). Significant differences in weight between the sexes were detected and the mean weight of females was generally lower than that of males at both sampling periods. Mean body weight at 13 months ranged from 186 to 238 grams in females compared to a range 202 to 248 grams in males. At 20 months of age, mean weight of females ranged from 813 to 946 grams compared to a range of

920 to 1081grams in males. Given that significant differences in weight between the sexes were detected for family M-30 at one year of age and for families M-52 and M-54 at 20 months of age

(p< 0.05), growth traits of males and females from each family were analyzed separately.

Maturation

Checks for early maturation started on September 11th, 2012 once the first males began showing signs of milt production. The fish were checked biweekly until November 26th, 2012 for a total period of 10 weeks. Males were considered precocious if they extruded milt after being squeezed.

Statistical analysis

Differences between families in mean hatching time, body length at the onset of exogenous feeding, body weight and condition factor at 13 and 20 months were analyzed with one-way ANOVA and Tukey’s post-hoc testing or Talhane’s post-hoc testing in cases where the homogeneity of variance assumption was violated. Chi-square contingency tests (2 maturity

46 states x 4 half-sib families, 2 maturity states x 2 sire genotypes) were used to determine if there were significant differences in rates of precocious maturation between families and between families sired by males with late or early spawning genotypes. Univariate general linear models with interaction were used to test whether developmental rate had effects on each of body length at the onset of exogenous feeding, body weight and condition factor at 13 and 20 months. In each analysis, hatching group (early, middle or late) and family were considered fixed factors as the independent variables. Chi-square contingency tests (2 maturity states x 3 hatching groups) were used to determine if fish from the early, middle and late hatching groups within families showed different frequencies of sexual maturation at about 2 years from fertilization. One-way

ANOVA followed by Tukey’s post-hoc testing or Talhane’s post-hoc testing in cases where the homogeneity of variance assumption was violated was used to test whether males that were mature or not mature at 2 years differed in weight at younger ages (13 and 20 months).

QTL analysis

Fish collected after the onset of exogenous feeding from each of the 4 maternal half-sib families M29, M30, M52 and M54 were selected for a QTL analysis of developmental rate.

Between 100 and 120 fish per family with even representation from each hatching group (early, middle and late) were included in the analysis. DNA was extracted from whole-body tissue following a standard phenol-chloroform protocol (Taggart et al. 1992). PCR was used to amplify select microsatellite markers using a 7μl reaction mixture containing forward and reverse primers, one of which was labeled with tetrachloro–6-carboxy-fluorescein (TET). The PCR temperature profile followed: one cycle of 95° C for 5 min; 4 cycles of 95° C for 1 min, 54° C for 30 s, and 72° C for 30 s; 29 cycles of 95° C for 30 s, 54° C for 30 s, and 72° C for 30 s; one cycle of 72° C for 5 min. Genotypes at microsatellite loci were determined by electrophoresis

using 6% polyacrylamide gels. Progeny were genotyped for the markers presented in Table 3.1

with the exception of loci BX299451 and BX077780 where the parents were homozyous. Given

that linkage groups RT-8, 23 and 24 are known to contain major QTL for developmental rate,

spawning date and age at maturation (Sakamoto et al. 1999; Robinson et al. 2001; Sundin et al.

2005; O’Malley et al. 2003; Leder et al. 2006; Nichols et al. 2007; Haidle et al. 2008; Easton et

al. 2011), additional markers from each of these linkage groups were genotyped

(OmyFGT12TUF and One114ADFG from RT-8, OMM5239 from RT-23 and Omy4DIAS from

RT-24). Both a single family full-sib QTL analysis and a half-sib QTL analyses were performed

in GridQTL (Seaton et al. 2006).

RESULTS

Influence of sire spawning date genotype

The relationship between spawning date genotype of the sire and developmental rate was

inconsistent (Table 3.2, Figure 3.2). Progeny sired by males with early spawning date genotypes

(i.e., negative vector scores) had significantly later mean hatching times than progeny sired by

males with late spawning genotypes (i.e., positive vector scores) in half-sib families with female

parents 2473 (families M29 and M30) and 2466 (M59) (p < 0.001). Although not significant, the

same trend was observed between the half-sib families of female 2468. The reverse relationship

was observed for the two half-sib families from female 2469, where progeny sired by the male

with an early spawning genotype (family M42) had significantly earlier hatching times than the

progeny sire by the male with a late spawning genotype (family M33) (p < 0.001).

The female parent had a significant influence on the developmental rates of her progeny

(Table 3.2). Significant differences in mean progeny hatching time (p< 0.001) were detected in all cases except between the progeny of female 2466 and female 2468.

An association between the spawning date genotype of the sire and progeny growth traits was detected at exogenous feeding but not at later sampling periods (Table 3.3). Mean length at exogenous feeding in families sired by males with late spawning genotypes (early hatching families) was greater than in families sired by males with early spawning genotypes (late hatching families). However, differences in mean weight at 13 and 20 months of age did not appear to be influenced by the spawning genotype of the sire in either male or female progeny.

At both sampling dates, the male and female progeny from families M-29 (early spawning alleles, late hatching progeny) and M-52 (late spawning alleles, early hatching progeny) did not differ significantly in body weight. Similarly, progeny condition factor (K) was also not associated with the spawning genotype of the sire (Table 3.4). Male progeny from M-52 (late spawning date alleles) had significantly higher K at 13 and 20 months compared to all other half- sib families regardless of the spawning time genotype of their male parent. Female progeny from different families did not differ significantly in K at either sampling period.

Families differed significantly in the number of male progeny that were mature at 2 years

(chi-square= 52.8, 3 df., p < 0.001) (Table 3.5). The source of the variation appears to be associated with male spawning genotype. Progeny sired by males with early spawning genotypes (M-29, -30 combined) had a significantly lower incidence of precocious maturation at

2 years of age compared those sired by males with a late spawning genotype (M-52,-54 combined) (chi-square= 45.6, 1 df, p < 0.001).

Association among developmental rate, growth and age at maturation

Significant associations were detected among developmental rate, body size and later maturation status. Developmental rate was significantly associated with the mean length of fish at the onset of exogenous feeding (Table 3.3). Fish from early and middle hatching groups were significantly longer than those in late hatching groups in both families sired by males with early spawning genotypes (p< 0.01). The same pattern was detected in male progeny at 13 months of age where early hatching males were significantly heavier than the late hatching males (p< 0.05).

No associations were detected in female progeny. Hatching groups did not differ significantly in body weight at 20 months of age in either sex.

Progeny of both sexes with early and late hatching times did not differ significantly in K at 20 months but both had significantly higher K relative to progeny that hatched in the middle of the distribution (Table 3.4). No significant differences in mean K were detected between hatching groups at 13 months of age.

The propensity of early maturation in males was not associated with developmental rate.

The number of mature and immature males was evenly distributed among the early, middle and late hatching groups both within families and across families (Table 3.6). However, males that matured early were significantly heavier at sampling dates prior to maturation than those from the same family that did not mature. Males that matured early were significantly heavier (p<

0.01) than those that did not mature in 3 out of 4 families at 13 months and all four families at 20 months (Figure 3.3). Similarly male progeny that matured had significantly higher condition factors at 13 and 20 months compared to those that did not mature (p < 0.001) (Figure 3.4).

Developmental rate QTL

Half-sib QTL analysis revealed a highly significant QTL for embryonic developmental

rate on RT-8 (Experiment-wide, p< 0.001) and a moderately significant QTL on RT-23

(chromosome-wide, p< 0.05). The position of the QTL on RT-8 fell between the markers

OMM5060 and OmyFGT12TUF while the position of the QTL on RT-23 was located closest to

the marker OMM5176. Individual full-sib analysis revealed a QTL on RT-8 with experiment

wide effects in all four families and a QTL on RT-23 with chromosome wide effects in families

M-30 and M-52 (Table 3.7).

DISCUSSION

Influence of sire spawning date genotype

Results of this study indicate that marker assisted selection for spawning date in males is

associated with variation in progeny developmental rate and propensity for precocious sexual

maturation but not juvenile body size in comparisons across families. The finding that four out

of five sires with an early spawning allelic compliment produced progeny with slower

developmental rates compared to their counterparts with late spawning allelic compliments is

consistent with previous studies. There, the developmental rates of early spawning stocks of

both pink and chum salmon (Oncorhynchus gorbuscha, Oncorhynchus keta) were delayed

compared to those with later spawning dates (Beacham and Murray 1986, 1987; Beacham 1988;

Tallman 1986). In two temporally distinct populations of chum salmon, progeny of winter stocks

require less accumulated thermal units (ATU) to reach emergence (Tallman and Healey 1991). It

was hypothesized that differential developmental rates can serve to synchronize time of embryo

51 emergence between two temporally divergent spawning groups of the same population through stabilizing selection (Tallman 1986; Tallman and Healey 1991).

The observation that the relationship between the spawning date allelic compliment of sires and progeny developmental rate was reversed in one female background suggests that variation at genes not related to spawning date may have significant effects on developmental rate. This proposal is supported by the detection of significant heritability in the narrow sense for hatching time in salmonids (McIntyre and Blanc 1973; Beacham 1988). The detection of significant additive genetic variation for development time indicates that selection has the potential modify developmental timing of salmonid populations to adapt to local environments.

Maternal effects may have also played a role in the differences in developmental rates observed within maternal half-sib families. Early development in salmonids and many species of fishes is thought to be affected to a large degree by maternal effects (Hebert et al. 1998;

Pakkasmaa and Jones 2002; Green 2008). Specifically, differing maternal cytoplasmic environment has been found to influence the expression of small-effect developmental rate QTL

(Nichols et al. 2007). Additionally, there is evidence that epistasis may affect the expression of this trait as reversals in relative hatching times have been observed when the same sires are crossed with different dams (Easton et al. 2011).

The outcome of the QTL analysis supports the hypothesis that spawning date and developmental rate co-vary in this strain and that some of the co-variation may have a genetic basis. A QTL for developmental rate with experimental wide effects in all four families was detected in the central region of RT-8 close to the marker OMM5060 which is the same marker that was incorporated into the selection index for the male parents based on its significant

52 association with spawning date in this strain (Allen et al. 2014). Evidence that genetic co- variation exists on RT-8 not only between spawning date and developmental rate, but also age at maturation, is available from numerous studies. In rainbow trout, the largest QTL for development rate (Robison et al. 2001; Sundin et al. 2005; Nichols et al. 2007; Easton et al.

2011), age of maturation (Haidle et al. 2008), and spawning time (Sakamoto et al. 1999;

O’Malley et al. 2003; Leder et al. 2006) have been localized to RT-8. A QTL for developmental rate was also detected on RT-23 with chromosome wide effects in two families in this study.

This QTL mapped to the marker OMM5176 which is the same marker loci previously found to have the strongest association with spawning date in this strain (Allen et al. 2014), providing further evidence of possible genetic co-variation between spawning date and developmental rate.

The lack of a relationship between the spawning genotype of the sire and body size of their juvenile progeny suggests that selection for early or late spawning alleles will have little effect on growth traits. Of the two families with the highest body weights at 13 and 20 months, one was sired by a male carrying early spawning date alleles and the other with late spawning date alleles. Previous studies have provided limited evidence for an association between these traits. Later spawning strains (spring spawners) of Ontario rainbow trout show slower growth rates compared to fall spawning strains (McMillan and McKay 1992) and significantly higher frequencies of mitochondrial DNA haplotype 10, which was found to be associated with significantly smaller body sizes, was detected in spring spawners (Ferguson et al. 1993;

Danzmann and Ferguson 1995). In contrast, progeny of later spawning fish showed faster growth than those of earlier spawning fish (Richardson et al. 2014) within the same strain used in the current analysis. However, the results of the previous studies may not represent true genetic correlations between spawning date and body weight because of confounding environmental

53 effects (water temperature and photoperiod) (Richardson et al. 2014) and genetic differences between strains (Danzmann and Ferguson 1995). Finally, no correlation between spawning date at 4 and 5 years and weight at 2 years was detected in a backcross of rainbow trout reared in a common environment (O’Malley et al. 2003).

The data suggest that selection for sires with late spawning date alleles could impact upon the rate of early maturation in their progeny and yield higher numbers of early maturing males at least based on the limited number of families examined here. All species of salmonids display seasonal cycles of gonadal maturation/activation terminating in a narrow spawning window.

Reproductive events, such as the initiation of maturation and spawning date within a season, in rainbow trout and other temperate teleosts are entrained by photoperiod and controlled by the brain-pituitary-gonadal axis primarily through stimulation of gonadotropin systems (Davies et al.

1999; Migaud et al. 2010). Correlation between these two traits is perhaps not surprising given the similar biological pathways involved in the initiation of both maturation and spawning date within a season. However, the two families with higher rates of precocious maturation also had significantly faster developmental rates as discussed above and were larger at the onset of exogenous feeding than their half-sibs produced by other males. Thus, it is difficult to disentangle the effects of the various traits from each other at the between family level and make a conclusive statement on the effect of MAS for spawning date allelic complement on the rate of early maturation.

Association among developmental rate, growth and age at maturation

Faster developmental rates conferred a size advantage as body length at the onset of exogenous feeding was significantly greater in early hatching fish and early hatching males had

54 significantly higher body weights at 13 months of age within families. Previous studies with salmonids have shown that small differences in the timing of developmental events can translate into large effects later in life. For example, less than a one week difference in the onset of exogenous feeding resulted increased dominant behavior and growth and in a year difference in the timing of first migration in Atlantic salmon (Salmo salar) (Metcalfe and Thorpe 1992). In pink and chum salmon, hatching date was found to have negative genetic correlations with alevin and juvenile size (Beacham 1988). In rainbow trout, a mutation in the candidate gene, phosphoglucomutase, resulted in faster development, larger body size and early sexual maturity

(Allendorf et al. 1983). However, body size differences at earlier sampling periods did not translate into higher body weights of early hatching fish at 20 months of age in males or females in this study. The lack of a relationship between hatching time and body size at 20 months could be explained by the onset of the maturation process in a large proportion of the fish, as these individuals would have begun to divert energy from somatic growth into gonad development.

The lack of an association between embryonic developmental rate and propensity for early sexual maturation within families was unexpected. Full-sibs with early hatching times did not show a greater propensity for early maturation than later hatchers. An association was only seen at the between family level where progeny from sires with late spawning date alleles, hatched earlier and showed greater levels of early maturation in males. However, as discussed previously the evaluation of trait associations across families is problematic because of the confounding effects of different traits. The association between faster developmental rates and the onset of early maturation is thought to arise from the observation that fish with faster embryonic developmental rates can have higher growth rates (Allendorf et al. 1983; Metcalfe and Thorpe 1992), and in turn larger fish tend to mature earlier (Gjerde and Gjedrem 1984;

Crandell and Gall 1993). We observed that any growth advantage of faster developing fish was only observed at the onset of exogenous feeding and in males at 13 months but not later at 20 months. This suggests that the limited effects of variation in developmental rate on the growth of older fish may explain the lack of a relationship between developmental rate and the propensity for precocious maturation within families of this strain.

The observation that males that matured precociously were larger and had higher condition factors at earlier ages suggests that large body size plays a major role for the propensity for the onset precocious maturation in this strain. This finding supports the results of an earlier study with the same strain that indicates that variation in the growth rate of juveniles opposed to variation in developmental rate per se is a better predictor of the propensity to mature early (Richardson et al. 2014). Strong correlations between body size and age at maturation have been found in other strains of rainbow trout (Gjerde and Gjedrem 1984; Crandell and Gall 1993) and numerous other aquaculture finfish species such as, tilapia (Longalong et al. 1999), Atlantic salmon (Páez et al. 2011), Arctic charr (Salvelinus alpinus)(Küttner et al. 2011), cod and halibut

(Godø and Haug 1999). While there is a well-established connection between body size and age at maturity, this relationship can be highly variable depending on the strain, and even different families within a strain (Martyniuk et al. 2003), making selection for increased growth rates while maintaining low levels of precocious maturation a possibility in some cases (Kause et al.

2003). We observed considerable variation in weights among non-precocious males with relatively small and large fish present within most families. Thus, selecting non-precocious males with the largest weights may be a way to achieve genetic gains for growth while maintaining low levels of precocious maturation.

Conclusions

The use of molecular markers to select for early spawning date in male breeding candidates of the LYNDON strain of commercial hatchery rainbow trout, produced families with significantly slower developmental rates and a decreased propensity of precocious male maturation. Given the high rates of precocious maturation in families sired by males carrying late spawning alleles, selection for early spawning date may also be an effective means of reducing precocious maturation in this strain. However, further studies to confirm that selection for early spawning date consistently produces families with reduced precocious maturation and comparable growth rates is needed. Furthermore, there is a strong correlation between body size and precocious maturation in this strain which may be problematic with regard to designing selection schemes to improve growth and reduce precocious maturation simultaneously. Given the variation in the associations among traits across family groups, additional studies are required to address these trait correlations. Knowledge of the dynamic interaction among these traits will assist in the creation of breeding programs that can integrate multiple selection goals.

References

Allendorf, F.W., Knudsen, K.L., Leary, R.F. 1983. Adaptive significance of differences in the tissue specific expression of a phosphoglucomutase gene in rainbow trout. Proc. Natl. Acad. Sci. USA. 80:1397–1400. Allen, M.S., Ferguson, M.M., Danzmann, R.G. 2014. Molecular markers for variation in spawning date in a hatchery population of rainbow trout (Oncorhynchus mykiss). Mar. Biotechnol. 16: 289-98. Andersson, M. A., Laursen, D. C., Silva, P. I. M., Höglund, E. 2013. The relationship between emergence from spawning gravel and growth in farmed rainbow trout Oncorhynchus mykiss. J. Fish Biol. 83:214–219. Beacham, T.D. 1988. A genetic analysis of early development in pink (Oncorhynchus gorbuscha) and chum salmon (Oncorhynchus keta) at three different temperatures. Genome. 30: 89-96. Beacham, T.D., Murray, C.B. 1986. Comparative developmental biology of pink salmon, Oncorhynchus gorbuscha, in southern British Columbia. J. Fish Biol. 28:233-246.

Beacham, T.D., Murray, C.B. 1987. Adaptive variation in body size, age, morphology, egg' size, and developmental biology of chum salmon (Oncorhynchus keta) in British Columbia. Can. J. Fish. Aquat. Sci. 44:244-261.

Begtashi, I., Rodrıguez, L., Moles, G., Zanuy, S., Carrillo, M. 2004. Long-term exposure to continuous light inhibits precocity in juvenile male European sea bass (Dicentrarchus labrax). I. Morphological aspects. Aquaculture. 241:539–559.

Bromage, N., Randall, C., Duston, J., Thrush, M., Jones, J. 1993. Environmental control of reproduction in salmonids, in: J. Muir, R. Roberts (Eds.), Recent Advances in Aquaculture, vol. IVBlackwell Science, Oxford, pp. 55–66. Carrillo, M., Bromage, N.R., Zanuy, S., Prat, E and Serrano, R. 1989. The effects of modifications of photoperiod on spawning time, ovarian development and egg quality in the sea bass (Dicentrarchus labrax L.). Aquaculture. 8:351-65. Crandell, P.A. & Gall, G.A.E. 1993. The genetics of body weight and its effect on early maturity based on individually tagged rainbow trout (Oncorhynchus mykiss). Aquaculture. 117:77-93. Danzmann, R.G, Ferguson, M.M. 1995. Heterogeneity in the body size of Ontario cultured rainbow trout with different mitochondrial DNA haplotypes. Aquaculture. 137:231-244. Davies, B., Bromage, N., Swanson, P. 1999. The Brain–Pituitary–Gonadal Axis of Female Rainbow Trout Oncorhynchus mykiss: Effects of Photoperiod Manipulation. Gen. Comp. Endocrinol. 115:155–166. Day, T. & Rowe, L. 2002 Developmental thresholds and the evolution of reaction norms for age and size at life-history transitions. American Naturalist. 159:338–350.

Doyle, R.W. 1983. An approach to the quantitative analysis of domestication selection in aquaculture. Aquaculture. 33:167-185. Easton, A.A., Moghadam, H.K., Danzmann, R.G., Ferguson, M.M. 2011. The genetic architecture of embryonic developmental rate and genetic covariation with age at maturation in rainbow trout Oncorhynchus mykiss. J. Fish. Biol. 78:602-23. Ferguson, M.M., Danzmann, R.G., Arndt, S.K.A. 1993. Mitochondrial-DNA and allozyme variation in Ontario cultured rainbow trout spawning in different seasons. Aquaculture. 117:237– 259. Gall, G.A.E. 1983. Things are not always what they seem to be, pp. 44-51. In R.N. Iwamoto and S. Sower [ed.] Salmonid reproduction. University of Washinton, Seattle, WA. Gall, G.A.E., Baltodano J., Huang N. 1988. Heritability of age at spawning for rainbow trout. Aquaculture. 68: 93-102. Gall, G.A. & Neira, R. 2004. Genetic analysis of female reproduction traits of farmed coho salmon (Oncorhyncus kisutch). Aquaculture. 234:143-154. Gjerde, B. and Gjedrem, T. 1984. Estimates of phenotypic and genetic parameters for carcass traits in Atlantic salmon and rainbow trout. Aquaculture. 36:97-110. Gjerde, B. & Schaeffer, L.R. 1989. Body Traits in Rainbow Trout II. Estimates of heritabilities and of phenotypic and genetic correlations. Aquaculture. 80:25-44. Godø, O.R., Haug, T. 1999. Growth rate and sexual maturity in cod (Gadus morhua) and Atlantic halibut (Hippoglossus hippoglossus). J. Northw. Atl. Fish. Sci. 25:115–123. Green, B.S. 2008. Maternal effects in fish populations. Adv. Mar. Biol. 54:1–105. Haidle, L., Janssen, J.E., Gharbi, K., Moghadam, H.K., Ferguson, M.M., Danzmann, R.G. 2008. Determination of quantitative trait loci (QTL) for early maturation in rainbow trout (Oncorhynchus mykiss). J. Mar. Biotechnol. 10:579-592.

Hebert, K.P., Goddard, P.L., Smoker, W.W., Gharrett, A.J. 1998. Quantitative genetic variation and genotype by environment interaction of embryo development rate in pink salmon (Oncorhynchus gorbuscha). Can. J. Fish. Aquat. Sci. 55:2048–2057.

Holmefjord, I., Gulbrandsen, J., Lein, I., Reftsie, T., Lèger, P., Harboe, T., Huse, I., Sorgeloos, P., Bolla, S., Reitan, K.I., Vadstein, O., Øie, G., Danielsberg, A. 1993. An intensive approach to Atlantic halibut fry production. J. World Aquacult. Soc. 24:275–284.

Hutchings, J.A. 2002. Life Histories of Fish. In: Handbook of Fish Biology and Fisheries: Volume 1, Fish Biology (eds. PJB Hart & JD Reynolds), pp 149-174. Blackwell Publishing, Oxford.

Karlsen, Ø., Norberg, B., Kjesbu, O.S., Taranger, G.L. 2006. Effects of photoperiod and exercise on growth, liver size, and age at puberty in farmed Atlantic cod (Gadus morhua L.). J. Mar. Sci. 63:355-364.

Kause, A., Ritola, O., Paananen, T., Mantysaari, E., Eskelinen, U. 2003. Selection against early maturity in large rainbow trout Oncorhynchus mykiss: the quantitative genetics of sexual dimorphism and genotype-by-environment interactions. Aquaculture. 228:53–68.

Küttner, E., Moghadam, H.K., Skulason, S., Danzmann, R.G., Ferguson, M.M. 2011. Genetic architecture of body weight, condition factor and age of sexual maturation in Icelandic Arctic charr (Salvelinus alpinus). Mol. Genet. Genomics. 286:67–79.

Leder, E.H., Danzmann, R.G., Ferguson, M.M. 2006. The candidate gene, Clock, localizes to a strong spawning time quantitative trait locus region in rainbow trout. J. Hered. 97:74-80.

Longalong, F.M., Eknath, A.E., Bentsen, H.B. 1999. Response to bi-directional selection for frequency of early maturing females in Nile tilapia (Oreochromis niloticus). Aquaculture. 178:13–25.

Mañanós, E.L., Zanuy, S., Carrillo, M. 1997. Photoperiodic manipulations of the reproductive cycle of sea bass (Dicentrarchus labrax) and their effects on gonadal development, and plasma 17ß-estradiol and vitellogenin levels. Fish Physiol. Biochem. 16:211-222.

Martyniuk, C.J., Perry, G.M.L., Moghadam, H.K., Ferguson, M.M., Danzmann, R.G. 2003. The genetic architecture of correlations among growth-related traits and male age at maturation in rainbow trout (Oncorhynchus mykiss). J. Fish Biol. 63:746–764.

McIntyre, J.D. & Blanc, J.M. 1973. A genetic analysis of hatching time in steelhead trout (Salmo gairdneri). J. Fish. Res. Bd. Can. 30:137–139.

McMillan, I. & McKay, L.R. 1992. A comparison of four strains of spring spawning rainbow trout. Bull. Aquacult. Assoc. Can. 92–93, 37–39.

Metcalfe, N.B. & Thorpe, J.E. 1992. Early predictors of life-history events: the link between first feeding date, dominance and seaward migration in Atlantic salmon, Salmo salar L. J. Fish Biol. 41:93–99.

Migaud, H., Davie, A., Taylor, J.F. 2010. Current knowledge on the photoneuroendocrine regulation of reproduction in temperate fish species. J. Fish Biol. 76:27-68.

Neira, R., Diaz, N.F., Gall, G.A.E., Gallardo, J.A., Lhorente, J.P., Alert, A. 2006. Genetic improvement in coho salmon (Oncorhynchus kisutch). II: Selection response for early spawning date. Aquaculture. 257:1-8.

Nichols, K.M., Boman, K.W., Sundin, K., Young, J.M., Wheeler, P.A., Thorgaard, G.H. 2007. Quantitative trait loci X maternal cytoplasmic environment interaction for development rate in Oncorhynchus mykiss. Genetics. 175:335-347.

Norberg, B., Brown, C.L., Halldorsson, O., Stensland, K., Björnsson, B.T. 2004. Photoperiod regulates the timing of sexual maturation, spawning, sex steroid and thyroid hormone profiles in the Atlantic cod (Gadus morhua). Aquaculture. 229:451–467.

O’Malley, K.G., Sakamoto, T., Danzmann, R.G., Ferguson, M.M. 2003. Quantitative trait loci for spawning date and body weight in rainbow trout: Testing for conserved effects across ancestrally duplicated chromosomes. J. Hered. 94:273-284.

Páez, D.J. , Bernatchez, L., Dodson, J.J. 2011. Alternative life histories in the Atlantic salmon: genetic covariances within the sneaker sexual tactic in males. Proc. R. Soc. B. 278:2150–2158.

Pakkasmaa, S. & Jones, M. 2002. Individual‐level analysis of early life history traits in hatchery‐ reared lake trout. J. Fish Biol. 60:218-225.

Quinton, C.D., Moghadasi, S.M., McKay, L.R., McMillan, I. 2002. 7th World Congress on Genetics Applied to Livestock Production, August 19-23, 2002, Montpellier, France Richardson, C.J., Bernier, N.J., Danzmann, R.G., Ferguson, M.M. 2014. Phenotypic and QTL allelic associations among embryonic developmental rate, body size, and precocious maturation in male rainbow trout. Mar. Genomics. http://dx.doi.org/10.1016/j.margen.2014.06.009 Ricker, W.E. 1975. Computation and interpretation of biological statistics of fish populations. B. Fish. Res. Board Can. 191:1-382. Robison, B.D., Wheeler, P.A., Sundin, K., Sikka, P., Thorgaard, G.H. 2001. Composite interval mapping reveals a major locus influencing embryonic development rate in rainbow trout (Oncorhynchus mykiss). J. Hered. 92:16–22. Sakamoto, T., Danzmann, R.G., Okamoto, N., Ferguson, M.M., Ihssen, P.E. 1999. Linkage analysis of quantitative trait loci associated with spawning time in rainbow trout (Oncorhynchus mykiss). Aquaculture. 173:33-43. Sadler, S.E., McLeod, D., Mckay, L.R., Moccia, R.D. 1992. Selection for early spawning and repeatability of spawn date in rainbow trout. Aquaculture. 100:103. Seaton, G., Hernandez, J., Grunchec, J.A., White, I., Allen, J., De Koning, D.J., Wei, W., Berry, D., Haley, C., Knott, S. 2006. GridQTL: A Grid Portal for QTL Mapping of Compute Intensive Datasets. Proceedings of the 8th World Congress on Genetics Applied to Livestock Production, August 13-18, 2006. Belo Horizonte, Brazil.

Siitonen, L. & Gall, G.A.E. 1989. Response to selection for early spawn date in rainbow trout S. gairdneri. Aquaculture. 78:153–161. Simpson, A.L. 1992. Differences in body size and lipid reserves between maturing and nonmaturing Atlantic salmon parr, Salmo salar L. Can. J. Zool. 70:1737–1742.

Stearns, S.C. 1989. Trade-offs in life-history evolution. Funct. Ecol. 3:259-268. Su, G.S., Liljedahl, L.E., Gall, G.A.E. 1997. Genetic and environmental variation of female reproductive traits in rainbow trout (Oncorhynchus mykiss). Aquaculture. 154:115-124. Sundin, K., Brown, K., Drew, R.E., Nichols, K., Wheeler, P.E., Thorgaard, G.H. 2005. Genetic analysis of a development rate QTL in backcrosses of clonal rainbow trout, Oncorhynchus mykiss. Aquaculture. 247:75-83. Taggart, J.B., Hynes, R.A., Prodöhl, P.A., Ferguson, A. 1992. A simplified protocol for routine total DNA isolation from salmonid fishes. J. Fish Biol. 40:963-965. Tallman, R.F. 1986. Genetic differentiation among seasonally distinct spawning populations of chum salmon, Oncorhynchus keta. Aquaculture. 57:211–217.

Tallman, W.F. & Healey, M.C. 1991. Phenotypic differentiation in seasonal ecotypes of chum salmon, Oncorhynchus keta. Can. J. Fish. Aquat. Sci. 48:661-671.

Taranger, G.L., Aardal, L., Hansen, T., Kjesbu, O.S. 2006. Continuous light delays sexual maturation and increases growth of Atlantic cod (Gadus morhua) in sea cages. ICES J. Mar. Sci. 63:365-375. Taranger, G.L., Carrillo, M., Schulz, R.W., Fontaine, P., Zanuy, S., Felip, A., Weltzien, F., Dufour S., Karlsen O., Norberg B., Andersson E., Hansen, T. 2010. Control of puberty in farmed fish. Gen. Comp. Endocrinol. 165:483-515. Thorpe, J.E., Morgan, R.I.G., Talbot, C. Miles, M.S. 1983. Inheritance of developmental rates in Atlantic salmon, Salmo salar. Aquaculture. 33:119-128.

Alleles with significant Linkage group Chromosome Marker effect and corresponding direction of effect

Omy7INRA 1(+), 4(-), 5(-) RT-7 15 OMM1220 1(-), 3(-), 7(+) BX299451 1(+), 4(-), 6(+) RT-8 5 OMM5060 1(-), 3(+), 7(-), 8(+) RT-10 6 Omy1002UW 2(+), 8(+), 9(-), 10(-) OMM1277 3(-), 7(+), 10(-) RT-12 7 OMM3061 3(+), 4(-), 6(+), 9(-) RT-14 19 OMM5327 4(-), 7(-), 8(+), 9(-) RT-15 21 BX887563 4(+), 5(+), 6(+), 8(-), 10(-) RT-23 8 OMM5176 3(+), 4(-), 6(+), 8(+), 11(+) OmyRGT36TUF 5(+), 6(+), 8(-) RT-24 4 BX077780 2(+), 4(-), 6(+), 7(+) RT-25 29 OMM1054 2(-), 4(-), 6(+), 7(-), 16(+) RT-29 17 OmyRGT19TUF 4(+) RT-30 23 OmyRGT24TUF 2(+), 4(-), 6(+), 7(-)

(p< 0.01). Significant differences in mean hatching time between maternal half-sib groupings are denoted by upper case letters, where shared letters indicate no significant difference in mean time to hatch (p< 0.01).

Spawning Mean progeny Female Vector Mean Family date N hatching time (across parent score hatching time genotype families)

2473 M-29 Early -2.054 70.28 ± 1.19 a 473 M-30 Early -4.519 70.56 ± 1.27 a 439 59.02 ± 0.67B M-52 Late 4.405 48.73 ± 1.28 b 468 M-54 Late 3.191 46.81 ± 1.17 b 457 2466 M-59 Early -4.622 90.57 ± 1.44 a 201 82.13 ± 1.13 A M-57 Late 0.829 74.76 ± 1.53 b 230 2468 M-16 Early -2.423 80.46 ± 1.28 a 223 79.61 ± 1.09 A M-32 Late 1.04 78.66 ± 1.79 a 201 2469 M-42 Early -2.719 43.23 ± 1.68 a 245 50.61 ± 1.17C M-33 Late 2.358 58.22 ± 1.43 b 238

(grams) at 13 and 20 months of age (from fertilization) by sex from the early, middle and late hatching groups for the four maternal half-sib families are also given. Significant differences in trait values (p< 0.05) between hatching groups are denoted by lower case letters, where shared letters indicate no significant difference. Significant differences in trait values (p< 0.05) between half-sib families are denoted by upper case letters, where shared letters indicate no significant difference.

Family Early Middle Late Total N

Length at the onset of exogenous feeding

M-29(E) 24.35 ± 0.12 24.12 ± 0.15 23.33 ± 0.14 23.87 ± 0.09 A, B 121 M-30(E) 23.85 ± 0.14 23.76 ± 0.15 23.05 ± 0.19 23.63 ± 0.10 A 100 M-52(L) 24.27 ± 0.10 24.08 ± 0.17 23.94 ± 0.13 24.10 ± 0.08 B, C 118 M-54(L) 24.48 ± 0.08 24.17 ± 0.12 23.84 ± 0.17 24.20 ± 0.07 C 116

Combined 24.24 ± 0.06 a 24.04 ± 0.07 a 23.57 ± 0.08 b 455

Weight at 13 months Males M-29(E) 262.08 ± 17.85 247.25 ± 10.56 232.21 ± 21.94 248.18 ± 9.28 A 45 M-30(E) 233.63 ± 17.37 207.15 ± 11.72 206.66 ± 9.35 214.63 ± 7.37 B, C 45 M-52(L) 246.48 ± 14.81 227.84 ± 14.10 214.69 ± 12.10 230.63 ± 8.08 A, B 66 M-54(L) 204.11 ± 10.02 212.41 ± 11.96 195.02 ± 10.83 202.87 ± 6.25 C 70 a a,b b Combined 233.22 ± 7.51 224.34 ± 6.38 208.88 ± 6.51 226 Females M-29(E) 236.18 ± 9.69 249.66 ± 12.18 230.68 ± 12.51 238.53 ± 7.55A 67 M-30(E) 181.73 ± 10.84 177.20 ± 10.22 211.01 ± 14.19 186.15 ± 6.17 B 65 M-52(L) 221.98 ± 13.27 203.50 ± 10.41 220.35 ± 10.84 214.11 ± 5.64 C 66 M-54(L) 191.73 ± 11.07 208.34 ± 11.58 225.06 ± 11.87 207.59 ± 6.85 B, C 64 a a a Combined 208.69 ± 5.94 206.39 ± 6.23 222.31 ± 5.65 262

Weight at 20 months Males M-29(E) 999.20 ± 77.73 949.14 ± 60.12 927.80 ± 80.06 957.59 ± 40.12 A, B 34 M-30(E) 1011.33 ± 46.92 860.57 ± 48.36 902.67 ± 41.88 920.10 ± 27.48 B 41 M-52(L) 1107.48 ± 66.53 1092.89 ± 74.00 1032.94 ± 58.40 1081.10 ± 38.5 A 58 M-54(L) 850.37 ± 41.59 967.57 ± 57.78 966.00 ± 41.78 921.86 ± 26.97 B 57 Combined 989.76 ± 32.33 a 975.90 ± 32.80 a 962.92 ± 26.56 a 190 Females M-29(E) 961.68 ± 35.85 949.88 ± 46.01 918.94 ± 48.01 946.73 ± 30.1 A 62 M-30(E) 825.40 ± 42.42 792.78 ± 39.55 901.33 ± 54.76 813.70 ± 25.53 B 55 M-52(L) 897.10 ± 50.70 869.68 ± 37.94 928.47 ± 41.40 896.68 ± 24.08 A, B 60 M-54(L) 757.64 ± 40.44 826.63 ± 43.52 900.00 ± 50.70 817.71 ± 21.83 B 55 Combined 865.02 ± 23.16 a 855.12 ± 21.39 a 914.66 ± 21.25 a 232

Family Early hatchers Middle hatchers Late hatchers N

Mean K at 13 Months Males

M-29(E) 1.38 ± 0.03 1.34 ± 0.02 1.38 ± 0.03 1.37 ± 0.02 A 45 M-30(E) 1.41 ± 0.06 1.32 ± 0.02 1.36 ± 0.03 1.36 ± 0.02 A 45 M-52(L) 1.47 ± 0.02 1.42 ± 0.02 1.40 ± 0.04 1.43 ± 0.02B 66 M-54(L) 1.35 ± 0.02 1.34 ± 0.02 1.33 ± 0.02 1.34 ± 0.01 A 70

a a a Combined 1.40 ± 0.02 1.36 ± 0.01 1.36 ±0.01 226 Females M-29(E) 1.20 ± 0.07 1.00 ± 0.00 1.17 ± 0.09 1.13 ± 0.04 A 67 M-30(E) 1.00 ± 0.00 1.04 ± 0.04 1.07 ± 0.07 1.03 ± 0.02 A 65 M-52(L) 1.25 ± 0.11 1.08 ± 0.05 1.08 ± 0.06 1.12 ± 0.04 A 66 M-54(L) 1.04 ± 0.04 1.10 ± 0.07 1.10 ± 0.07 1.08 ± 0.03 A 64 Combined 1.12a ± 0.03 1.05a ± 0.02 1.11a ± 0.04 262

Mean K at 20 Months Males M-29(E) 1.30 ± 0.15 1.14 ± 0.10 1.40 ± 0.16 1.26 ± 0.08 A 34 M-30(E) 1.33 ± 0.14 1.07 ± 0.07 1.47 ± 0.13 1.29 ± 0.07 A 41 M-52(L) 1.74 ± 0.09 1.61 ± 0.12 1.88 ± 0.08 1.74 ± 0.06B 58 M-54(L) 1.50 ± 0.11 1.21 ±0.11 1.57 ± 0.11 1.46 ± 0.07 A 57

Combined 1.52a ± 0.06 1.28b ± 0.06 1.60a ± 0.06 190

Females M-29(E) 1.71 ± 0.09 1.41 ± 0.12 1.41 ± 0.12 1.55 ± 0.06 A 62 M-30(E) 1.60 ± 0.11 1.13 ± 0.07 1.83 ± 0.11 1.45 ± 0.07 A 55 M-52(L) 1.76 ± 0.11 1.44 ± 0.10 1.81 ±0.11 1.65 ± 0.07 A 60 M-54(L) 1.59 ± 0.11 1.26 ± 0.10 1.57 ± 0.14 1.47 ± 0.07 A 55 Combined 1.67a ± 0.05 1.31 b ± 0.05 1.66 a ± 0.06 232

Spawning Family No. immature No. mature % mature genotype

M-29 Early 20 6 30 M-30 Early 27 10 37 Total 47 16 M-52 Late 8 43 81 M-54 Late 14 39 64 Total 22 81

Immature Mature chi- Family Early Middle Late Early Middle Late df. p-value square M-29 7 5 8 2 2 2 2 0.176 0.916 M-30 7 10 10 4 2 4 2 1.16 0.561 M-52 4 1 3 16 15 12 2 1.57 0.456 M-54 8 1 5 12 11 16 2 3.99 0.136 Combined 26 17 26 34 30 34 2 0.715 0.699

Family Linkage Group p-value Marker M-29 RT-8 < 0.001** OMM5060, OmyFGT12TUF M-30 RT-8 < 0.001** OMM5060, OmyFGT12TUF RT-23 < 0.05* OMM5176 M-52 RT-8 < 0.001** OMM5060, OmyFGT12TUF RT-23 < 0.05* OMM5176 M-54 RT-8 < 0.001** OMM5060, OmyFGT12TUF ** experiment-wide QTL (p<0.001) *chromosome-wide QTL (p<0.05)

4.5 M-52

3.5 M-54

M-33 2.5

1.5 M-32 M-57 0.5

-0.5

Vector score -1.5

-2.5 M-29 M-16 M-42 -3.5

-4.5 M-30 M-59 -5.5

100 100

90 (A) 90 (B) 80 80 70 70 60 60 50 50 M-29 40 40 % Hatched 30 M-30 30 20 M-52 20 M-59

10 M-54 10 M-57 0 0 0 0 21 29 51 56 72 21 29 51 56 72 46.5 76.5 91.5 96.5 46.5 76.5 91.5 96.5 Time (hrs) 106.5 Time (hrs) 106.5

100 100

90 (C) 90 (D) 80 80 70 70 60 60 (B) 50 50 40 40

% Hatched 30 30 20 M-16 20 M-42

10 M-32 10 M-33 0 0 0 8 0 30 35 51 21 29 51 56 72 25.5 55.5 70.5 75.5 85.5 46.5 76.5 91.5 96.5 106.5 Time (hrs) Time (hrs)

Figure 3.2 Cumulative percent of hatched rainbow trout embryos produced from males with early (light grey) and late spawning dates (dark grey) for (A) half-sib families M-29, M-30, M-

52 and M-54. (B) half-sib families M-59 and M-57. (C) half-sib families M-16 and M-32. (D) half-sib families M-42 and M-33. Time 0 corresponds to the time when the first embryo hatched.

(A) (B)

Figure 3.4 Condition factor at 13 months and 20 months of age for male rainbow trout that matured precociously and males that did not mature. Error bars represent ± 1 standard error.

* denotes a significant difference. (p< 0.001) in K between immature and mature fish across families for each sampling date.

CHAPTER IV Candidate gene sequencing reveals variants in circadian clock genes associated with spawning date in rainbow trout (Oncorhynchus mykiss)

ABSTRACT: I searched for mutations in 9 candidate genes suspected to play a role in circadian

rhythms and the initiation of ovulation in rainbow trout. Primers were designed from EST

sequences of Salmonidae species and long range PCR was used to amplify the complete or near

complete genomic sequences of genes associated with circadian (clock1a, bmal, g0s2, dec1 and

dec2) and neuroendocrine (gnrh3b, kiss2, kiss1r, eed) pathways. Sequences for each candidate

gene were obtained for 24 female rainbow trout with spawning (ovulation) dates at both ends of

the spawning distribution at a commercial hatchery. A total of 300 variants (255 SNPs and 45

indels) were identified in both the coding and non-coding regions of the candidate genes. Allelic

association tests revealed that SNPs occurring in genes belonging to the clock gene system

(clock1b, bmal, and dec2) showed nominally significant associations with spawning date. A

variant detected in the dec2 gene, which is involved in circadian rhythm regulation is through its

suppression of CLOCK/BMAL-induced gene expression, displayed the strongest association

with spawning date of any variant analyzed in this study. Additionally, two haplotypes from

both dec2 and bmal showed significant associations with spawning phenotype. These results

provide further evidence that circadian rhythm genes may play an important role in regulating

the timing of circannual events such as spawning in salmonids.

INTRODUCTION

The seasonality of reproduction is a ubiquitous feature of temperate vertebrates from

fishes to mammals. While the environmental cues, such as photoperiod and temperature,

responsible for entrainment of reproductive events is well established, much less is known about

the molecular pathways involved. In mammals, the clock gene system plays an important role in

maintaining circadian rhythms responsible for cycles of gonadal activity (Lincoln et al. 2003;

Boden and Kennaway 2006; Sellix 2013, 2015). Clock genes influence the gonadal axis through

modulation of gonadotropin releasing hormone (GnRH) and thus secretion of gonadotropins

(Chappell et al. 2003). Expression of core clock genes (clock, cry, bmal1, per1 and per2) has

been demonstrated in the ovaries of mice (Dolatshad et al. 2010), rats (Karman and Tischkau

2006) and cows (Cushman et al. 2007; Shimizua et al. 2011). In mice, mutations of the clock

gene have been found to disrupt normal patterns of GnRH release and results in decreased

fertility and lengthened estrous cycles (Chappell et al. 2003; Miller et al. 2004). Kisspeptins

have also emerged a potential regulator of reproduction through modulation of gonadotropins

(Murphy 2005; Seminara 2005) and the interaction between kisspeptins and GnRH neurons may

be influenced by clock genes (Tonsfeldt et al. 2011; Choe et al. 2013). Furthermore, studies of

the Siberian hamster have demonstrated that Kiss gene expression is modulated by photoperiod

to drive the onset of puberty (Revel et al. 2006, 2007).

There is evidence to suggest that both the clock gene system and kisspeptins studied in

mammals may be conserved across all vertebrates and therefore play similar roles in

reproduction in teleost fishes (Cahill 2002; Elizur 2009). Expression of clock genes has been

detected in the ovaries of flatfish, Solea senegalensis (Martín-Robles et al. 2012) and reef fish,

Siganus guttatus (Fukushiro et al. 2011) and in the brain of zebrafish, Danio reiro (Whitmore et

77 al. 1998), rainbow trout, Oncorhynchus mykiss (Mazurais et al. 2000) and Atlantic salmon,

Salmo salar (Davie et al. 2009). Studies of natural populations of salmonids have shown that the clock gene bmal1 is upregulated in precocious sneaker males of S. salar (Aubin-Horth et al.

2005) and clock poly-Q variants are associated with temporally divergent migratory runs of

Chinook salmon, Oncorhynchus tshawytscha, demonstrating a link to migration and spawning time (O’Malley et al. 2007). Similarly, there is evidence that the Kiss1/GPR54 system is modulated by photoperiod and is linked to the onset of puberty in Nile tilapia,

Oreochromis niloticus (Martinez-Chavez et al. 2008) and the seasonal control of reproduction in

European seabass, Dicentrarchus labrax (Migaud et al. 2012).

Recent advances in genome sequencing technologies have provided the opportunity to investigate variants within candidate genes associated with important production traits in several species. Previous studies have found significant associations between SNPs in candidate genes and growth traits in gilthead seabream, Sparus aurata (Sanchez-Ramos et al. 2012), Arctic charr,

Salvelinus alpinus (Tao and Boulding 2003) and Asian seabass, Lates calcarifer (He et al. 2012).

Additionally, associations between candidate gene SNPs and reproductive traits were detected in

Japanese flounder, Paralichthys olivaceus (He et al. 2008a, 2008b). However, with the exception of poly-Q length variants of the Clock1b gene found to be associated with migration and spawning timing in Chinook salmon (O’Malley et al. 2007; O’Malley and Banks 2008), variants associated with reproductive timing in candidate genes belonging to the clock gene and kisspeptin systems have not been investigated in any fish species to date. Given the known roles of clock genes and kisspeptins in mammalian reproduction, investigating the associations of variants in these genes may provide insight into their roles in teleosts.

Reproductive timing is a variable life history trait in salmonids that is of great importance to both the local adaptation of natural populations to their environment and the aquaculture industry. Salmonids are temperate teleosts well known for the effects of photoperiod on the entrainment of seasonal reproduction (Bromage et al. 2001). Precise co-ordination of reproductive events can directly impact offspring fitness in the natural environment. Spawning dates of populations must be synchronized so that the emergence of alevins coincides when local food availability, environmental conditions and predation pressures are optimized (Einum and

Fleming 2000). Additionally, the control of reproductive timing is of significant importance to the aquaculture of these species as it is crucial to ensuring a steady and reliable supply of seed stock for the industry (Quinton et al. 2004). Many aquaculture operations are limited by the seasonality of salmonid reproduction as a given stock will normally produce eggs only over a 2 month period on average.

Timing of spawning and migration has a large genetic component in salmonids (Siitonen

& Gall 1989; Quinn et al. 2000; O’Malley et al. 2007). The use of genetic linkage maps has facilitated the identification of spawning date QTL in rainbow trout (Sakamoto et al. 1999;

Fishback et al. 2000; O’Malley et al. 2003; Leder et al. 2006) and coho salmon, Oncorhynchus kisutch (Araneda et al. 2012). In rainbow trout, the candidate gene clock has been found to localize to the strongest QTL for spawning date (Leder et al. 2006). However, very little is known about the genetic basis for variation in spawning date both within and between species of salmonids or even within populations of the same species. Investigation of mutations in circadian and neuroendocrine candidate genes may provide insight into the mechanisms responsible for maintaining annual reproductive cycles in fish.

I searched for mutations in 9 candidate genes (clock1a, bmal, dec1,dec2, g0s2, gnrh3b,

kiss2, kiss1r, eed) belonging to the clock gene system, kisspeptin and neuroendocrine system

suspected to play a role in circadian rhythms and the initiation of ovulation in rainbow trout

(Figure 4.1, 4.2). Female rainbow trout from a commercial hatchery with spawning dates at both

tail ends of the spawning distribution were selected for targeted gene sequencing on the MiSeq

platform. My goal was to first identify variants (InDels or SNPs) in candidate genes for

reproductive traits and secondly, to determine if identified variants were associated with a

particular spawning date phenotype. If the candidate genes investigated are involved in the

expression of spawning date phenotype I expected to find variants in these genes associated

(through either a direct causative effect or linkage disequilibrium) with either an early or late

spawning phenotype.

MATERIALS and METHODS

Animals

Samples were obtained from LYNDON Fish Hatcheries Inc., located in New Dundee,

Ontario, Canada. The LYNDON strain is historically a fall spawning strain and has been under

selection to expand the spawning season for approximately six generations (see Allen et al.

2014). Adipose fin for DNA analysis was collected from 3 year old females from the 2008/2009

spawning cohort. Females were selected from the tail ends of the spawning distribution with a

spawning date of approximately 4 months between the two groups. Females categorized as early

spawners ovulated between August 15 - 20, 2008, while late spawners produced eggs between

December 23, 2008 and January 7, 2009. Adipose fin tissue was collected from each of the 24

females for later DNA analysis.

DNA sequencing

Nine candidate genes were chosen for sequencing (Table 4.1). Primer sequences were taken from the literature (GnRH3B –von Schalburg et al. 1999; Clock1a - Paibomesai et al.

2010), designed from rainbow trout genomic scaffolds (G0S2 - Miller 2013) or available EST sequences from various salmonids including sockeye salmon, chinook salmon and Atlantic salmon as well as rainbow trout. DNA was isolated using a standard phenol chloroform extraction protocol (Taggart et al. 1992) and stock solutions were used to prepare working solutions of 15ng/μl genomic DNA. Long-range PCR was used to amplify the selected genes using a 50μl reaction mixture containing forward and reverse primers and high fidelity

Platinum® Taq. The PCR temperature profile followed: one cycle of 95° C for 2 min; 30 cycles of 95° C for 30 s, 55° C for 30 s, and 72° C for 1 min per KB; one cycle of 72° C for 10 min.

PCR products were loaded onto 1.2 to 2.5% agarose gels containing 0.5 μg/ml ethidium bromide and run at 80-100V for approximately 2-8 hours depending on size of fragment being analyzed.

Fragments were visualized using an AlphaImager™ 3400 to confirm size and presence of only a single amplification product. All PCR products were purified using Invitrogen PureLink™ quick PCR purification kits and quantified through picogreen® assays. The ABI 3730 DNA analyzer was used to sequence a portion of 2 random samples for each candidate gene to confirm that the correct fragment had been isolated. With the exception of the kiss2 gene, PCR products were pooled for each individual and libraries created with the Nextera DNA Sample Preparation

Kit (Illumina). Due to the small size of the kiss2 gene (750bp) it was not suitable to be included in the library and thus primers were designed to capture the gene in two overlapping fragments of around 400 bp. During a 2 step PCR process, the fragments were amplified using primers with adapters incorporated and then purified, and with this product a second round of PCR was

81 performed to attach the universal barcodes. Final sequencing of all individuals was carried out on an Illumina Miseq instrument.

Analysis

Quality control checks on raw sequence data were performed using FastQC (Andrews

2010). Quality filtering was then done using Trimmomatic (Bolger et al. 2014) where reads under 80bp in length and a Q score of 20 were removed. To generate longer reads to facilitate improved assembly of sequence data, the software FLASH (Magoc and Salzberg 2011) was used to merge overlapping paired end reads. De-novo assembly of reads was done in CodonCode aligner (CodonCode Corporation, www.codoncode.com). Using the reference sequence generated by CodonCode aligner, the program NextGENe (Softgenetics, State College, PA) was used to align reads from each individual and generate mutation reports for each individual.

Alignment parameters required that more than 80% of a reads length matched the reference genome and mutations were only reported if occurring at a frequency greater that 20%. BLAST searches were performed against the Berthelot et al. (2014) rainbow trout genome assembly to determine the linkage group location of the candidate genes. If a sequence was assigned to more than one location from the BLAST output, the location with the highest affinity score was assumed to be the correct location.

To determine if mutations occurred at a significantly different frequency in late versus early spawners, allelic association tests were performed in PLINK version 1.07 (Purcell et al.

2007). The nominal p-values referred to in this paper represent the uncorrected (for independent multiple testing) significance level (p<0.05 for significant, p<0.10 for suggestive) of each SNP tested. Gene-based significance refers to the significance after correction for the multiple SNPs

tested within each gene. Gene-based significance was determined for each gene using the

Benjamini-Hotchberg false discovery rate method to correct for multiple testing within each

gene. We used Haploview (Barrett et al. 2005) to examine linkage disequilibrium between SNPs

within each gene and perform haplotype association tests for genes showing significant or

suggestive nominal p-values in the single marker tests. To correct for multiple testing bias,

permutation testing was performed for haplotypes of each gene that exceeded a minimum

frequency of 5% in the overall population using 10,000 permutations per test. Determination of

exon-intron boundaries was accomplished through alignments of coding regions annotated in the

rainbow trout genome assembly (Berthelot et al. 2014) to the genomic reference sequence of

each candidate gene. The program fancyGENE v1.4 (Rambaldi and Ciccarelli 2009) was used to

produce annotated figures of each candidate gene. NCBI ORF finder was used to predict protein

sequences based on the reference sequence and variant sequences to determine if SNPs that

differed significantly between the early and late spawners were synonymous or non-synonymous

mutations.

RESULTS

Processing of sequence data

To discover gene variants, nine proposed candidate genes covering over 29,000 bp were

amplified and sequenced in 24 female rainbow trout. In total, 8.9 million reads were generated

with an average of 370,190 reads covering the candidate genes in each individual. After strict

quality control measures were applied, approximately 15% of reads were removed from the

analysis due to poor quality or if the length of the read was below 80 bp after trimming ends. In

order to generate longer reads for greater ease of assembly, paired end reads that overlapped

83 were merged, which accounted for around 31% of paired end reads. De-novo assembly of a sub- sample of reads, carried out in CodonCode aligner, was successful at generating a consensus sequence for each of the 9 candidate genes (Supplementary file 4.1). This consensus was then used as the reference sequence for alignment of reads using NextGENe software which successfully aligned 98% of reads for each of the 24 individuals. The average depth of coverage ranged from 1500x to 6000x across all genes for each individual.

Variant detection

Variants (either SNPs or Indels) occurring at a locus with a frequency of 30% or greater were detected and reported using NextGENe software. In 7 individuals the first 2000bp of the gene bmal did not have enough coverage to perform variant detection. In total, 300 variants

(255 SNPs and 45 indels) were detected within the introns and exons of candidate genes (Figure

4.3, Supplementary Table 4.1). In the genes dec1, bmal, gnrh3b, and g0s2, approximately 1 variant was detected for every 110 to 178 bp of sequence data with most variants concentrated in introns but with at least one variant in the exons. The genes clock1a, kiss1r and kiss2 appeared to be highly conserved, having very few mutations and/or mutations occurring at a low frequency in the population.

The relatively large number of variants detected is likely due to the presence of duplicate gene copies for the genes dec2, clock but primarily eed. The distribution of genotypes for the eed gene suggests that up to three duplicate copies were amplified in the samples, however, sequence divergence between the duplicated copies was not great enough to be able to assign reads to a specific copy. Variants detected in eed accounted for nearly 50% of the total 300 variants detected overall with most of these variants appearing to reflect fixed differences

84 between copies, therefore SNP data from this gene was not used in the association analysis.

Similarly, the frequency of some variants occurring in 25 or 75% of reads in the dec2 gene initially suggested that two copies of this gene were amplified and a BLAST search revealed 2 copies of this gene are present in the rainbow trout genome. However, the dec2 sequenced in this study was a 100% match to a copy on RT-27 but only an 88% match to the alternate copy.

This suggests that only a single copy was captured since if we had duplicate copies we would have expected to detect a much larger number of variants, whereas we only detected 11 variants in this gene. In addition, a significant amount of low frequency variants (10-20% of reads) detected toward the 3' end of the clock1a gene suggest that partial amplification of a duplicate at a low frequency occurred.

The partial duplicate showing significant sequence divergence from clock1a was found to be a region of clock1b that corresponds to exon 14 through exon 17 of clock1a. This encompasses a region of known divergence between the two genes which contains a polyQ tail of differing length (exon 14 of clock1a) and an adjacent intron that contains a large Tc1-like transposon found only in clock1a (Paibomesai et al. 2010). As a result, a 1.5 Kb section of clock1b was added to the reference sequence and re-alignments were successful in assigning reads to the correct copy of clock. Coverage depth for this region was significantly lower compared to all other genes and ranged from 30x to 450x.

Associations between genotypes and spawning date

Analysis of the distribution of genotypes at each locus revealed nominally significant allelic heterogeneity between early and late spawning females at 12 SNP positions, 7 of these located within the gene bmal, 4 in clock1b and one in dec2 (Table 4.2). An additional 24 SNP

85 loci within bmal, clock1b, dec2 and g0s2 produced nominal p-values with suggestive significance (p< 0.10). After corrections for multiple testing, only one SNP in the dec2 gene showed gene-based significance, however, these corrections may have been overly conservative

(discussed below). Four variants associated with spawning date within the genes bmal, clock1b, and dec2 resulted in nonsynonymous substitutions. The SNP in exon 5 of the dec2 gene had a nominally suggestive association with spawning date and as a result of this mutation, the amino acid alanine is substituted for valine at the 186th amino acid position in the protein. SNP4167 located in exon 13 of bmal had a nominally suggestive association with spawning date and resulted in an arginine to leucine substitution in amino acid 251. Additionally, 2 SNPs in exons

15 and 16 of the clock1b gene (406 and 533, respectively) with a nominally significant association with spawning date resulted in nonsynonymous substitutions of leucine to glutamine in amino acid 98 and from proline to arginine in amino acid 106. After corrections for multiple testing, only one SNP in dec2 remained significant while 7 SNPs in dec2 and 4 in clock1b displayed suggestive significance.

The corrections for multiple independent testing may have produced overly-conservative p-values since linkage disequilibrium among SNPs within the same gene would result in dependence among SNPs. This was supported by the results from Haploview which identified significant LD among SNP alleles within the genes bmal, clock1b, g0s2 and dec2 (Figure 4.4).

This strong LD is evident when examining the pattern of haplotypes for these genes within the population. For example, 5 of the 7 SNPs located within bmal which showed nominally significant associations with spawning date appeared to be in perfect disequilibrium, where the presence of one of these SNP alleles could be used to infer the presence of the other 4.

Similarly, the 4 nominally significant SNPs within the clock1b gene as well as the 7 suggestively

significant SNPs in dec2 were also in perfect disequilibrium. This observation was supported by

permutation testing which revealed 2 haplotypes of bmal and 2 of dec2 to be significantly

associated with spawning date as well as a suggestive association with one haplotype of clock1b

(Table 4.3). Thus, for the purposes of this study we considered the nominal p-values form the

single marker tests to be biologically significant.

DISCUSSION

I have identified genetic variants associated with reproductive timing in rainbow trout

through the examination of candidate genes related to endocrine and circadian pathways.

Through sequencing of 24 female rainbow trout with early and late spawning dates I identified

255 putative SNPs and 45 putative indels belonging to ten candidate genes. SNPs within three

circadian clock genes (bmal1, dec2 and clock1b) showed significant differentiation between

early and late spawning females, providing further support that circadian genes may play an

important role in influencing reproductive timing in salmonids.

The finding that many of the genes showing associations with spawning date belong to

the clock gene system is not surprising given the multitude of biological systems under circadian

control. The circadian oscillator operates as an autoregulatory feedback loop composed of both

positive and negative elements that produce a rhythm with a definable period length (Bell-

Pedersen et al. 2005). There are four main families of clock genes; clock, cry, bmal, and period.

The protein BMAL forms a heterodimer with the CLOCK protein and it is these two components

which make up the positive limb of the oscillator feedback loop, while CRY and PERIOD from a

complex involved in the negative feedback loop (Doi et al. 2006; Uchida et al. 2010). The

CLOCK/BMAL complex stimulates the transcription of many clock controlled genes (CCG’s)

87 outside of the oscillator and thus mediates the ‘output function’ of the clock that accounts for the circadian regulation of many biological processes (Uchida et al. 2010). It has been found that clock genes may affect reproductive traits through the regulation of GnRH pulsing (Chappell et al. 2003; Boden and Kennaway 2006) and the transcriptional activation of GnRHr by the

CLOCK/BMAL heterodimer (Resuehr et al. 2007). In addition to its role in seasonal reproduction, a wide array of biological activities such as metabolism, stress responses, development, cell division, hormone production and behavior are directly influenced by circadian oscillators (Dunlap 1999; Uchida et al. 2010).

I found evidence that polymorphisms within the gene bmal1 may affect the circannual timing of reproductive events in female rainbow trout. There is also evidence that the bmal sequence investigated in this study may co-localize to a QTL for spawning date detected in a previous study (Leder et al. 2006). The bmal sequence isolated here shares the greatest sequence affinity (99%) with a copy on rainbow trout linkage group 20, where the QTL for spawning date is located. Seven nominally significant and six nominally suggestive single marker loci were associated with spawning date as well as two highly significant haplotypes. Most of these mutations were synonymous with the exception of a SNP located in exon 13 which resulted in an arginine to leucine substitution in amino acid 251.

The role of bmal1 in the control of reproductive physiology of fish is not well understood, however, function of the core clock genes appears to be conserved across multiple taxa from drosophila to Homo sapiens (Dunlap 1999). Daylength dependent rythmic expression of Clock and bmal have been detected in the brains of Atlantic salmon (Davie et al. 2009) and levels of bma1l were upregulated in precociously maturing ‘sneaker’ males (Aubin-Horth et al.

2005). Through examining the effects of bmal1 null mice, previous studies have determined that

Bmal1 is required for proper reproductive function. bmal1 null mice have exhibited delayed puberty, prolonged estrous cycles, infertility or impaired fertility (Boden and Kennaway 2004;

2005; Alvarez et al. 2008; Ratajczak et al. 2009). In humans, two SNPs in bmal1 have been found to be associated with fertility and seasonal variations in energy (Kovanen et al. 2010).

A variant detected in the dec2 gene displayed the strongest association with spawning date of any variant analyzed in this study. Additionally, several variants within the dec2 gene in strong LD with each other have a nominally suggestive association with spawning date and one of these variants located in exon 5 alters the amino acid sequence, resulting in an alanine to valine substitution. dec1 and dec2 encode basic helix-loop-helix proteins that form a fifth family of clock genes which act as an additional negative feedback loop that can repress circadian rhythms through direct interaction with BMAL or by competing for E-box binding sites (Honma et al. 2002). Mutations in the dec2 gene affect sleep duration in humans and impair the ability of dec2 to repress CLOCK/BMAL transactivation in vitro (He et al. 2009; Pellegrino et al. 2014).

The function of dec genes is likely conserved in teleosts as both dec1 and dec2 have been shown to suppress CLOCK/BMAL induced gene expression in zebrafish (Abe et al. 2006). Although no studies to date have investigated the association of dec variants with reproductive traits, DEC proteins have the potential to alter rhythmic gene expression within the female reproductive cycle (Boden et al. 2013) as dec1 has been found to act as a transcriptional repressor regulated by gonadotropins (LH/FSH) in the ovaries of rats (Yamada et al. 2004). A previous investigation of this rainbow trout population found that genetic markers with the second and third strongest associations with spawning date mapped to RT-12, near the locations of dec1a and dec1b based on homologies with Medaka (Allen et al. 2014). While the role of dec genes in salmonid

89 reproduction remains unclear, the strong associations found in this study between polymorphisms in dec2 and female spawning date warrant further investigation.

I detected variants associated with spawning date in clock1b but not clock1a. The lack of variants associated with spawning date in clock1a was surprising, given that it maps to the location of the strongest QTL for spawning date (Sakamoto et al. 1999; O’Malley et al. 2003,

Leder et al. 2006), developmental rate (Robinson et al. 2001; Sundin et al. 2005; Nichols et al.

2007; Easton et al. 2011), and age at maturation (Haidle et al. 2008) in this species. Therefore, the clock1a gene appears to be highly conserved in this population of rainbow trout. This is not unique however as the highly conservative nature of this gene has been observed in Chinook salmon (O’Malley and Banks, 2008) and cyprinids (Krabbenhoft and Turner 2014). It should be noted that only exons 3 through 19 of clock1a were surveyed in this study so it is possible that mutations in upstream transcription factor binding sites may be responsible for the large QTL effects observed in previous studies.

While no variation was detected in clock1a, several polymorphisms in the paralogous duplicate clock1b showed significant associations with spawning date. There are various lines of evidence that suggest clock1b plays a role in the timing of reproductive events in salmonids.

Previous studies have localized spawning time QTL in this population (Allen et al. 2014), as well as other strains of rainbow trout (O’Malley et al 2003; Leder et al 2006), to the marker

OmyRGT36TUF, located within 5.5 cM of clock1b. Furthermore, variation in the length of the polyglutamine motif (polyQ) within exon 15 of clock1b varies in salmonid populations along a latitudinal gradient (O’Malley et al. 2008) and differs between temporally distinct spawning runs of Chinook salmon (O’Malley et al. 2007). Although I did not detect any polyQ length variation in my study, one SNP located within exon 15 at the end of the polyQ region resulted in a

90 substitution from leucine (L) to glutamine (Q). This SNP had a nominally significant association with spawning date and was found exclusively in late spawning females.

I found marginal evidence that SNPs located within the gene g0s2 and its flanking sequences were associated with spawning phenotype or possibly in LD with a nearby circadian gene that may be involved with reproductive timing. Four SNPs within the 3' and 5' UTR and the single exon of this gene and 4 SNPs within the flanking sequences showed suggestive associations with spawning date before corrections for multiple testing was applied. The g0s2 gene plays important roles in metabolism through its promotion of energy storage of lipids

(Heckmann et al. 2013) and displays circadian expression in the mouse liver (Storch et al. 2002).

Since it has been postulated that a certain threshold of lipid reserves must be reached before sexual maturation is initiated (Simpson 1992), this gene may be of significance in reproductive timing. However, no studies to date have investigated a link between reproductive timing and g0s2. It is interesting to note that in rainbow trout, g0s2 is found nearly adjacent to the gene camk1gb, separated only by 3.5Kb, and this gene coupling of g0s2 and camk1gb is conserved across several taxa of teleosts including stickleback, medaka and zebrafish. Recently camk1gb has been identified as a new component of the circadian clock system in zebrafish, providing a link between master pineal clock and downstream physiology (Tovin et al. 2012). Given the strong linkage disequilibrium across the region, this raises the possibility that associations of

SNPs in g0s2 and flanking sequences with spawning date may be the result of linkage disequilibrium with functional polymorphisms in the camk1gb gene.

I have demonstrated a possible link between three key clock genes and spawning date in a population of rainbow trout. Given the limited number of fish tested in this study, variants associated with spawning date should be validated in a larger subset of the population and across

91 multiple year classes to see if they hold true. Additionally, further studies could test these SNPs in different strains of rainbow trout and other salmonid species to determine if they would make suitable genetic markers to investigate the role of circadian genes in reproductive timing in a wide range of salmonids. Although numerous variants within clock, bmal and dec2 were associated with spawning date, linkage disequilibrium could be exploited in future studies to reduce the amount genotyping required. Strong linkage disequilibrium within these genes resulted in several of the variants significantly or suggestively associated with spawning date to be present together as a group in the same individuals. Tight linkage of SNPs would mean minimal genotyping would be required in future studies as a small number of SNPs, referred to as “tag SNPs” (Halperin et al. 2005), could be used to infer the haplotype of a large block of

SNPs. While I took measures to ensure that only a single copy of each gene was amplified and sequenced in the samples, it is possible that some identified variants represent paralogous sequence variants because of the relatively recent whole duplication event that occurred in the salmonids. Given the demonstrated effects of clock gene mutations in mammals on a wide array of physiological and behavioural traits, a logical next step would be to investigate if the variants uncovered in this study may influence other traits in salmonids such as development and maturation.

References

Abe T, Ishikawa T, Masuda T, Mizusawa K, Tsukamoto T, Mitani H, Yanagisawa T, Todo T, Iigo M (2006) Molecular analysis of Dec1 and Dec2 in the peripheral circadian clock of zebrafish photosensitive cells. Biochem Biophys Res Commun 351:1072–1077 Allen MS, Ferguson MM, Danzmann RG (2014) Molecular markers for variation in spawning date in a hatchery population of rainbow trout (Oncorhynchus mykiss). Mar Biotechnol 16:289- 98 Alvarez JD, Hansen A, Ord T, Bebas P, Chappell PE, Giebultowicz JM, Williams C, Moss S, Sehgal A (2008) The circadian clock protein BMAL1 is necessary for fertility and proper testosterone production in mice. J Biol Rhythms 23:26–36 Andrews S (2010). FastQC: a quality control tool for high throughput sequence data. Available online at: http://www.bioinformatics.babraham.ac.uk/projects/fastqc Araneda C, Día, NF, Gomez G, López ME, Iturra P (2012) Comparative mapping reveals quantitative trait loci that affect spawning time in coho salmon (Oncorhynchus kisutch). Genet Mol Biol 35:515–521 Aubin-Horth N, Landry CR, Letcher BH, Hormann HA (2005) Alternative life histories shape brain gene expression profiles in males of the same population. P Roy Soc B 272:1655–1662 Barrett JC, Fry B, Maller JD, Daly MJ (2005) Haploview: analysis and visualization of LD and haplotype maps. Bioinformatics 21:263-265 Bell-Pedersen D, Cassone VM, Earnest DJ, Golden SS, Hardin PE, Thomas TL, Zoran MJ (2005) Circadian rhythms from multiple oscillators: lessons from diverse organisms. Nat Rev Genet 6:544-556 Berthelot C, Brunet F, Chalopin D, Juanchich A, Bernard M, Noel B, Bento P, Da Silva C, Labadie K, Alberti A, Aury JM, Louis A, Dehais P, Bardou P, Montfort J, Klopp C, Cabau C, Gaspin C, Thorgaard GH, Boussaha M, Quillet E, Guyomard R, Galiana D, Bobe J, Volff JN, Genet C, Wincker P, Jaillon O, Roest Crollius H, Guiguen Y (2014) The rainbow trout genome provides novel insights into evolution after whole-genome duplication in vertebrates. Nat Commun 22:3657 Boden MJ, Kennaway DJ (2004) Reproductive consequences of circadian dysfunction: fertility in the Bmal1 null mouse. Reprod Fertil Dev 16:280–280 Boden MJ, Kennaway DJ (2005) Reproduction in the arrhythmic Bmal1 knockout mouse. Reprod Fertil Dev 17:126–126

Boden MJ, Kennaway DJ (2006) Circadian rhythms and reproduction. Reproduction 132: 379- 392

Boden MJ, Varcoe TJ, Kennaway DJ (2013) Circadian regulation of reproduction: From gamete to offspring. Prog Biophys Mol Biol 113:387–397

Bolger AM, Lohse M, Usadel B (2014) Trimmomatic: A flexible trimmer for Illumina Sequence Data. Bioinformatics 170 Bromage NR, Porter MJR, Randall CF (2001) The environmental regulation of maturation in farmed finfish with special reference to the role of photoperiod and melatonin. Aquaculture 197:63–98 Cahill GM (2002) Clock mechanisms in zebrafish. Cell Tissue Res 309:27–34 Chappell PE, White RS, Mellon PL (2003) Circadian gene expression regulates pulsatle gonadotropin-releasing hormone (GnRH) secretory patterns in the hypothalamic GnRH-secreting GT1-7 cell line. J Neurosci 23:11202-11213

Choe HK, Kim HD, Park SH, Lee HW, Park JY, Seong JY, Lightman SL, Son GH, Kim K (2013) Synchronous activation of gonadotropin-releasing hormone gene transcription and secretion by pulsatile kisspeptin stimulation. PNAS 110:5677–5682

Cushman RA, Allan MF, Jones SA, Rupp GP, Echternkamp SE (2007) Localization of Period 1 mRNA in the ruminant oocyte and investigations of its role in ovarian function. Anim Reprod Sci 99:93-105

Davie A, Minghetti M, Migaud H (2009) Seasonal Variations in Clock‐Gene Expression in Atlantic Salmon (Salmo salar). Chronobiol Int 26:379-395

Doi M, Hirayam, J, Sassone-Corsi P (2006) Circadian regulator CLOCK is a histone acetyltransferase. Cell 125:497-508

Dolatshad H, Cary AJ, Davis FC (2010) Differential expression of the circadian clock in maternal and embryonic tissues of mice. PloS one 5:e9855

Dunlap JC (1999) Molecular bases for circadian clocks. Cell 96:271-290

Einum S, Fleming IA (2000) Selection against late emergence and small offspring in Atlantic salmon (Salmo salar). Evolution 54:628-639

Elizur A (2009) The KiSS1/GPR54 system in fish. Peptidesn 30:164–17

Fishback AG, Danzmann RG, Ferguson MM (2000) Microsatellite allelic heterogeneity among hatchery rainbow trout maturing in different seasons. J Fish Biol 57:1367–1380

Fukushiro M, Takeuchi T, Takeuchi Y, Hur SP, Sugama N, Takemura A, Kubo Y, Okano K, Okano T (2011) Lunar phase-dependent expression of cryptochrome and a photoperiodic mechanism for lunar phase-recognition in a reef fish, goldlined spinefoot. PloS one 6:e28643.

Halperin E, Kimmel G, Shamir R (2005) Tag SNP selection in genotype data for maximizing SNP prediction accuracy. Bioinformatics 21:195-203

He F, Wen HS, Dong SL, Shi B, Chen CF, Wang LS, Yao J, Mu XJ, Zhou YG (2008a) Identification of single nucleotide polymorphism cytochrome P450-c19a and its relation to reproductive traits in Japanese flounder (Paralichthys olivaceus). Aquaculture 279:177–181

He F, Wen HS, Dong SL, Wang LS, Chen CF, Shi B, Mu XJ, Yao J, Zhou YG (2008b) Identification of estrogen receptor [alpha] gene polymorphisms by SSCP and its effect on reproductive traits in Japanese flounder (Paralichthys olivaceus). Comp Biochem Physiol B Biochem Mol Biol 150:278–283

He XP, Xia JH, Wang CM, Pang HY, Yue GH (2012) Significant associations of polymorphisms in the prolactin gene with growth traits in Asian seabass (Lates calcarifer). Anim Genet 43:233- 236

He Y, Jones CR., Fujiki N, Xu Y, Guo B, Holder JL, Rossner MJ, Nishino S, Fu YH (2009) The transcriptional repressor DEC2 regulates sleep length in mammals. Science 325:866-870

Heckmann BL, Zhang X, Xie X, Liu J (2013) The G0/G1 Switch Gene 2 (G0S2): Regulating metabolism and beyond. Biochimica et Biophysica Acta 1831:276–281

Honma S, Kawamoto T, Takagi Y, Fujimoto K, Sato F, Noshiro M, Kato Y, Honma K (2002) Dec1 and Dec2 are regulators of the mammalian molecular clock. Nature 419:841–844

Karman BN, Tischkau SA (2006) Circadian Clock Gene Expression in the Ovary: Effects of Luteinizing Hormone. Biol Reprod 75:624-632

Kovanen L, Saarikoski ST, Aromaa A, Lonnqvist J, Partonen T (2010) ARNTL (BMAL1) and NPAS2 gene variants contribute to fertility and seasonality. PLoS One 5:e10007

Krabbenhoft TJ, Turner TF (2014) Clock gene evolution: seasonal timing, phylogenetic signal, or functional constraint? J Hered 105:407–415

Leder EH, Danzmann RG, Ferguson MM (2006) The candidate gene, Clock, localizes to a strong spawning time quantitative trait locus region in rainbow trout. J Hered 97:74–80

Lincoln GA, Andersson H, Loudon A (2003) Clock genes in calendar cells as the basis of annual timekeeping in mammals – a unifying hypothesis. J Endocrinol 179: 1–13

Magoc T, Salzberg S (2011) FLASH: Fast length adjustment of short reads to improve genome assemblies. Bioinformatics 27:2957-63

Martinez-Chavez CC, Minghetti M, Migaud H (2008) GPR54 and rGnRH I gene expression during the onset of puberty in Nile tilapia. Gen Comp Endocrin 156:224-233

Martín-Robles ÁJ, Whitmore D, Sánchez-Vázquez FJ, Pendón C, Muñoz-Cueto JA (2012) Cloning, tissue expression pattern and daily rhythms of Period1, Period2, and Clock transcripts in the flatfish Senegalese sole, Solea senegalensis. J Comp Physiol B 182:673-685

Mazurais D, Le Dréan G, Brierley I, Anglade I, Bromage N, Williams LM, Kah O (2000) Expression of clock gene in the brain of rainbow trout: comparison with the distribution of melatonin receptors. J Comp Neurol 422:612-620

Migaud H, Ismail R, Cowan M, Davie A (2012) Kisspeptin and seasonal control of reproduction in male European sea bass (Dicentrarchus labrax). Gen Comp Endocrin 179:384-399

Miller BH, Olson SL, Turek FW, Levine JE, Horton TH, Takahashi JS (2004) Circadian clock mutation disrupts estrous cyclicity and maintenance of pregnancy. Cur Biol 14:1367-1373

Miller M (2013) Rainbow trout genome assembly draft. USDA/NAGRP.

Murphy KG (2005) Kisspeptins: Regulators of metastasis and the hypothalamic-pituitary- gonadal axis. J. Neuroendocrinol 17:519–525

Nichols KM, Boman KW, Sundin K, Young JM, Wheeler PA, Thorgaard GH (2007) Quantitative Trait Loci X maternal cytoplasmic environment interaction for development rate in Oncorhynchus mykiss. Genetics 175:335-347

O'Malley KG, Sakamoto T, Danzmann RG, Ferguson MM (2003) Quantitative trait loci for spawning date and body weight in rainbow trout: testing for conserved effects across ancestrally duplicated chromosomes. J Hered 94:273–284

O'Malley KG, Camara MD, Banks MA (2007) Candidate loci reveal genetic differentiation between temporally divergent migratory runs of Chinook salmon (Oncorhynchus tshawytscha). Mol Ecol 16:4930-4941

O’Malley KG, Banks MA (2008) A latitudinal cline in the Chinook salmon (Oncorhynchus tshawytscha) Clock gene: evidence for selection on PolyQ length variants. Proc R Soc B-Biol Sci 275:2813–2821

Paibomesai MI, Moghadam HK, Ferguson MM, Danzmann RG (2010) Clock genes and their genomic distributions in three species of salmonid fishes: associations with genes regulating sexual maturation and cell cycling. BMC Res Notes 3:215

Pellegrino R, Kavakli IH, Goel N, Cardinale CJ, Dinges DF, Kuna ST, Maislin G, Van Dongen HP, Tufik S, Hogenesch J, Hakon H, Pack AI (2014) A novel BHLHE41 variant is associated with short sleep and resistance to sleep deprivation in humans. Sleep 37:1327

Purcell S, Neale B, Todd-Brown K, Thomas L, Ferreira MAR, Bender D, Maller J, Sklar P, de Bakker PIW, Daly MJ, Sham PC (2007) PLINK: a toolset for whole-genome association and population-based linkage analysis. Am J Hum Genet 81

Quinn TP, Unwin MJ, Kinnison MT (2000) Evolution of temporal isolation in the wild: genetic divergence in timing of migration and breeding by introduced chinook salmon populations. Evolution 54:1372-1385

Quinton CD, McKay LR, McMillan I (2004) Strain and maturation effects on female spawning time in diallel crosses of three strains of rainbow trout (Oncorhynchus mykiss). Aquaculture 234:99-110

Rambaldi D, Ciccarelli FD (2009) FancyGene: dynamic visualization of gene structures and protein domain architectures on genomic loci. Bioinformatics 25:2281-2

Ratajczak CK, Boehle KL, Muglia LJ (2009) Impaired steroidogenesis and implantation failure in Bmal1-/- mice. Endocrinology 150:1879–1885

Resuehr D, Wildemann U, Sikes H, Olcese J (2007) E-box regulation of gonadotropin-releasing hormone (GnRH) receptor expression in immortalized gonadotrope cells. Mol Cell Endocrinol 278:36–43

Revel FG, Saboureau M, Masson-Pévet M, Pévet P, Mikkelsen JD, Simonneaux V (2006) Kisspeptin mediates the photoperiodic control of reproduction in hamsters. Cur Biol 16:1730- 1735

Revel FG, Ansel L, Klosen P, Saboureau M, Pévet P, Mikkelsen JD, Simonneaux V (2007) Kisspeptin: a key link to seasonal breeding. Rev Endocr Metab Disord 8:57-65

Robison BD, Wheeler PA, Sundin K, Sikka P, Thorgaard GH (2001) Composite interval mapping reveals a major locus influencing embryonic development rate in rainbow trout (Oncorhynchus mykiss). J Hered 92:16–22

Sánchez-Ramos I, Cross I, Mácha J, Martínez-Rodríguez G, Krylov V, Rebordinos L (2012) Assessment of tools for marker-assisted selection in a marine commercial species: significant association between MSTN-1 gene polymorphism and growth traits. Sci World J (369802)

Sellix, MT (2013) Clocks Underneath: The Role of Peripheral Clocks in the Timing of Female Reproductive Physiology. Front Endocrinol 4:91 Sellix, MT (2015) Circadian Clock Function in the Mammalian Ovary. J Biol Rhythms 30:7–19 Seminara SB (2005) Metastin and its G protein-coupled receptor, GPR54: Critical pathway modulating GnRH secretion. Front Neuroendocrinol 26:131–138 Shimizu T, Hirai Y, Murayama C, Miyamoto A, Miyazaki H, Miyazaki K (2011) Circadian Clock genes Per2 and clock regulate steroid production, cell proliferation, and luteinizing hormone receptor transcription in ovarian granulosa cells. Biochem Biophys Res Commun 412:132-135 Siitonen L, Gall GAE (1989) Response to selection for early spawn date in rainbow trout, Salmo gairdneri. Aquaculture 78:153–161 Simpson AL (1992) Differences in body size and lipid reserves between maturing and nonmaturing Atlantic salmon parr, Salmo salar. L. Can J Zool 70:1737–1742 Storch KF, Lipan O, Leykin I, Viswanathan N, Davis FC, Wong WH, Weitz CJ (2002) Extensive and divergent circadian gene expression in liver and heart. Nature 417:78-83 Sundin K, Brown KH, Drew RE, Nichols KM, Wheeler PA, Thorgaard GH (2005) Genetic analysis of a development rate QTL in backcrosses of clonal rainbow trout, Oncorhynchus mykiss. Aquaculture 247:75-83 Taggart JB, Hynes RA, Prodöhl PA, Ferguson A (1992) A simplified protocol for routine total DNA isolation from salmonid fishes. J Fish Biol 40:963–965 Tao WJ, Boulding EG (2003) Associations between single nucleotide polymorphisms in candidate genes and growth rate in Arctic charr (Salvelinus alpinus L.). Heredity 91:60–69 Tonsfeldt KJ, Goodall CP, Latham KL, Chappell PE (2011) Oestrogen induces rhythmic expression of the Kisspeptin‐1 receptor GPR54 in hypothalamic Gonadotrophin‐Releasing Hormone‐Secreting GT1‐7 cells. J Neuroendocrinol 23:823-830 Tovin A, Alon S, Ben-Moshe Z, Mracek P, Vatine G, Foulkes NS, Jacob-Hirsch J, Rechavi G, Toyama R, Coon SL, Klein DC, Eisenberg E, Gothilf Y (2012) Systematic identification of rhythmic genes reveals camk1gb as a new element in the circadian clockwork. PLoS genetics 8:e1003116 Uchida Y, Hirayama J, Nishina H (2010) A common origin: Signaling similarities in the regulation of the circadian clock and DNA damage responses. Biol Pharm Bull 33:535-544 von Schalburg KR, Harrower WL, Sherwood NM (1999) Regulation and expression of gonadotropin-releasing hormone in salmon embryo and gonad. Mol Cell Endocrinol 157:41-54

Whitmore D, Foulkes NS, Strähle U, Sassone-Corsi P (1998) Zebrafish Clock rhythmic expression reveals independent peripheral circadian oscillators. Nat Neurosci 1:701-707 Yamada K, Kawata H, Mizutani T, Arima T, Yazawa T, Matsuura K, Shou Z, Sekiguch T, Yoshino M, Kajitani T and Miyamoto K (2004) Gene expression of basic helix-loop-helix transcription factor, SHARP-2, is regulated by gonadotropins in the rat ovary and MA-10 cells. Biol Reprod 70:76–82

Table 4.1 Primer sequences, annealing temperature (TA), and fragment size for candidate gene

primers. The linkage groups (LG) where the fragments may localize in rainbow trout are shown

(UN = unknown). The source or accession number for the derivation of each of the primers for

every gene is given in the last column.

Fragment Source of primer TA LG Gene Primer sequence size derivation

clock1a F-AATAGCTGCGCAGTCAGAGT DQ780892 55 6.5Kb 8 R1-AGTCACCAGCTTAGTCAGCAA Paibomesai et al. 2010

BMAL F-AGAAGAGGCGCAGAGACAAG DY735402 55 8Kb 20 R-TCCAATGGAGTCAGGTCCTC TC139956

GnRH3B F(A)-GAAGCTTATGCACTAAGCAGG Von Schalburg et al. 55 1.3Kb 6 R(C)-TTATTTATGGGGCATCCATTTC 1999

Kiss1r F-TTCAAGCCACCTGCATTACA 58 1Kb 23 BX078215 R-TGTTTGAACAGAAGGGGAAAG

Kiss2-Fragment 1 F-CTGCATCACTTGGATTTTGA 410bp R-TTTGCTGGTCCGAGTTAAA 56 15 AB435387 Kiss2-Fragment 2 F-GTGGTGATGAGAAGCGAGAT 420bp R-TTTCCCAAACCCAACTTACA

G0S2 F-CGGCCAAGAACCATAAAGAG 55 3.5kB 22 Miller 2013 R-GGCATGACGTGATTGTGAAC

DecO1 F-GGAGAGGATTACAAGTGCACAA TC194600 54 2.75Kb UN R-TTTCCAGGTTCATGGGAAGT CA359319

DecO2 F-TGCAACATCTTCCCAAAAGC 54 1.75Kb 27 TC208383 R-GACGCATGTGATTGAGGCTA

EED F-AACATGTCCGAGACCCCTAC TC191422 57 6.5Kb UN R-GCCAGATAGAGGCGTCGT TC189760

100

4.1).

Variant Location Intronic vs Freq. of alleles in Freq. of alleles in CHIS Nominal FDR_B Gene Mutation type (bp) Exonic early spawners late spawners Q p-value H

dec2 SNP G/T 523 Intron 2 87.5% G, 12.5% T 100% G 3.2 0.0736ᶧ 0.0828ᶧ dec2 SNP A/T 697 Intron 3 87.5% A, 12.5% T 100% A 3.2 0.0736ᶧ 0.0828ᶧ dec2 SNP A/T 698 Intron 3 50% A, 50% T 12.5% A, 87.5% T 7.86 0.005* 0.0456* dec2 SNP A/T 699 Intron 3 87.5% A, 12.5% T 100% A 3.2 0.0736ᶧ 0.0828ᶧ dec2 SNP A/T 701 Intron 3 87.5% A, 12.5% T 100% A 3.2 0.0736ᶧ 0.0828ᶧ dec2 SNP A/T 703 Intron 3 87.5% A, 12.5% T 100% A 3.2 0.0736ᶧ 0.0828ᶧ dec2 SNP A/C 1053 Intron 4 87.5% C, 12.5% A 100% C 3.2 0.0736ᶧ 0.0828ᶧ dec2 SNP T/C 1294 Exon 5 87.5% C, 12.5% T 100% C 3.2 0.0736ᶧ 0.0828ᶧ bmal SNP T/A 470 intron 5 100% A 75% A, 25% T 5.1 0.0239* 0.1818 bmal Indel Del ATT 558 intron 5 100% ATT 75% ATT 5.1 0.0239* 0.1818 bmal Indel delAA 1786 intron 7 83.3% AA 100% AA 2.93 0.0872ᶧ 0.255 bmal SNP C/T 2263 Exon 8 100% C 79.2% C, 20.8% T 5.58 0.0182* 0.1818 bmal SNP A/G 2696 Exon 9 83.3% G, 16.7% A 100% G 4.36 0.0367* 0.2108 bmal SNP T/C 3325 intron 12 87.5% C, 12.5% T 100% C 3.2 0.0736ᶧ 0.2544 bmal SNP G/T 4167 Exon 13 87.5% G, 12.5% T 100% G 3.2 0.0736ᶧ 0.2544 bmal SNP T/C 4186 Exon 13 100% C 79.2% C, 20.8% T 5.58 0.0182* 0.1818 bmal SNP G/A 4741 Exon 14 62.5% A, 37.5% G 37.5% A, 62.5%G 3 0.0833ᶧ 0.255 bmal SNP C/T 4753 Exon 14 87.5% C, 12.5% T 100% C 3.2 0.0736ᶧ 0.2544

101

bmal SNP C/G 5100 intron 15 75% G, 25% C 45.8% G, 54.16% G 4.27 0.0388* 0.2108 bmal SNP G/A 5353 intron 16 87.5% G, 12.5% A 100% A 3.2 0.0736ᶧ 0.2544 bmal SNP T/A 5866 intron 17 100% T 79.2% T, 20.8% A 5.58 0.0182* 0.1818 clock1b SNP A/T 406 Exon 15 100% T 83.3% T , 16.7% A 4.36 0.0367* 0.0918ᶧ clock1b SNP G/T 507 Intron15 100% T 83.3% T , 16.7% G 4.36 0.0367* 0.0918ᶧ clock1b SNP A/C 514 Intron15 100% A 83.3% A , 16.7% C 4.36 0.0367* 0.0918ᶧ clock1b SNP A/C 533 Exon 16 100% C 83.3% C , 16.7% A 4.36 0.0367* 0.0918ᶧ clock1b SNP C/G 692 Intron16 87.5% C, 12.5% G 100% C 3.2 0.0736ᶧ 0.1052 clock1b SNP G/A 710 Intron16 87.5% G, 12.5% A 100% G 3.2 0.0736ᶧ 0.1052 clock1b SNP C/A 1392 Intron17 87.5% C, 12.5% A 100% C 3.2 0.0736ᶧ 0.1052 g0s2 SNP G/T 2476 5' UTR 58.3% G, 41.7% T 83.3% G, 16.7% T 3.63 0.0567ᶧ 0.2999 g0s2 SNP A/G 2535 Exon 1 58.3% A, 41.7% G 83.3% A, 16.7% G 3.63 0.0567ᶧ 0.2999 g0s2 SNP A/C 2874 3' UTR 58.3% A, 41.7% C 83.3% A, 16.7% C 3.63 0.0567ᶧ 0.2999 g0s2 SNP T/C 2878 3' UTR 58.3% T, 41.7% C 83.3% T, 16.7% C 3.63 0.0567ᶧ 0.2999 g0s2 SNP G/T 4005 flanking sequnce 58.3% G, 41.7% T 83.3% G, 16.7% T 3.63 0.0567ᶧ 0.2999 g0s2 SNP A/C 4112 flanking sequnce 29.2% A, 70.8% C 54.2% A, 45.8% C 3.09 0.0789ᶧ 0.3207 g0s2 Indel delATGACGGTC 4420 flanking sequnce 58.3% ATGACGGTC 83.3% ATGACGGTC 3.63 0.0567ᶧ 0.2999 g0s2 SNP G/T 4637 flanking sequnce 58.3% G, 41.7% T 83.3% G, 16.7% T 3.63 0.0567ᶧ 0.2999

102

Haplotype alleles for each gene are in chronological order following the haplotype blocks defined in Figure 4.4.

Freq. of Gene Haplotype haplotype in CHISQ p population TGAAAAAACCT 24.20% 7.039 0.021* 32% 4.521 0.0498* dec2 TGATAAAACCT TTTTTTTACTG 6.30% 3.2 0.1409 TGATAAAAACT 26.30% 1.051 0.8387 AATACCGGAGCACTCTTCGTTTGCATGTACTCGGCCGAA 10.40% 5.581 0* DACATAGGTAGTCTCTDAGCTTACATGTACTTGGCGGTT 10.40% 2.009 0* bmal AACATAGGTAGTCTCTDAGCTTACATGTACTTGGCGGTT 6.20% 0.356 1 DACATAGDTAGTCTCTDAGCTTACATGTACTTGGCGGTT 22.90% 0.118 1 DACACCGGAGCACITATAGCTTGCATGTACTCGGCCGTA 27.10% 0.105 1 AGGCACGCTG 8.30% 4.363 0.0952ᶧ 6.20% 3.2 0.3086 clock1b TGTACGAATG TGTACCGCTG 57% 0.588 0.9072 TGTACCGCIT 22.10% 0.048 1 CTGTGTAAGTCGATGGATACACCDGTGTTCTGCDCTATTGTTTD 10.40% 2.009 0.1153 8.30% 1.091 0.3558 g0s2 CTGTACAGGTCGACTGGTCTAACDGTGTTDDTCDCCATCACGTA CTGAGCGAGTCGATGAACACAATCGTGTTCTGAGCCACCGCGCA 22.90% 1.061 0.3558 CTTTGTAAGTCGATGAACACAATCGTGTTCTGADCCDCCGCGCA 25% 0 1

103

(negative components of the feedback loop) are positively regulated by CLOCK/BMAL, however DEC proteins compete for E-box binding sites and prevent activation of per by

CLOCK/BMAL. The circadian pathway is responsible for the downstream regulation of daily expression profiles of many genes involved in a wide range of biological functions. The G0S2 gene displays circadian regulation and is involved in the cell cycle and metabolism.

104

105

* ᶧ ᶧ* ᶧ * ᶧ * * ᶧ ᶧ

ᶧ ᶧ ᶧ ᶧ ᶧ ᶧ ᶧ

106

ᶧ ᶧ* ᶧ ᶧ ᶧ ᶧ

* * ** ᶧ ᶧ ᶧ

107

(A)

108

(B)

109

(C)

(D)

Figure 4.4 A plot showing linkage disequilibrium between all SNPs within (A) g0s2 (B) bmal

(C) dec2 and (E) clock1b. D' was used as the measure of linkage disequilibrium, where D'=1 represents complete disequilibrium. Boxes show in red in the plot represent strong evidence LD between two markers where D'=1 and the LOD score is greater than 2. The blue boxes indicate

D'=1 with an LOD < 2 while white boxes indicate D'<1 with an LOD < 2

110

CHAPTER V Conclusions and Future Directions

This research contributes to our understanding of the genetic architecture of reproductive

timing in rainbow trout and co-variation among life history traits. I have identified novel regions

of the rainbow trout genome associated with spawning date and have provided the first empirical

evidence that mutations in the clock genes, bmal and dec2, may influence reproductive timing in

a teleost species. I have also demonstrated that selection for genetic markers associated with

reproductive timing may also influence the timing of other life history events such as

development and maturation. My findings not only enhance knowledge of the genetic basis of

spawning date and correlated trait responses, but have applications towards the commercial

cultivation of this species and perhaps other salmonids.

My investigation of a rainbow trout population that has been under strong selection for

spawning date resulted in the identification of specific regions of the genome associated with

reproductive timing. This work has direct applications to the aquaculture industry as it provides

the basis for future application of marker assisted selection to achieve expansion of the spawning

season in this species. The large number of loci (21 loci on 14 different linkage groups)

significantly associated with spawning date supports the idea that expression of this life history

trait is under the control of many genetic loci. My findings reinforce previous studies detecting

major QTL in on RT-8 and RT-24 as well as providing new evidence of genetic loci possessing

very strong associations with spawning date on RT-12 and RT-23. While synteny analysis with

other teleost species pointed to genes belonging to the clock gene system as likely potential

candidate genes responsible for the detected associations, this still needs to be confirmed through

experimentation. Therefore, the next logical goal is to further refine the positions of these trait

associations and ultimately determine the causative genes responsible for variations in spawning

111 date in this population. This would require that higher density maps and genome sequence become available, which may be possible in the near future as sequencing of the rainbow trout genome is well underway.

Using the knowledge gained from my discovery of marker trait associations from Chapter

II, I was able to investigate the effects that marker assisted selection for spawning date may have on other life history traits due to possible genetic correlations. It was revealed that selection for late spawning date may have the potential to increase both developmental rates and unwanted precocious male maturation. Given the limited number of families tested, further studies should seek to confirm these relationships. It is important that the nature of these trait co-variations be established, because if confirmed, they will have important repercussions for breeding programs.

It is also possible, and likely, that the relationships between life history traits varies significantly in commercial stocks and wild populations to reflect historical selection pressures and local adaptation over time. Studies examining how co-variation among traits differ between commercial stocks and between different wild populations would serve to resolve the potential factors leading to the coupling of life history traits.

The observation that variants in several clock genes were associated with reproductive timing may indicate that this gene system plays a crucial role in the initiation of spawning in rainbow trout and other salmonids. Very few studies have investigated the role of clock genes in teleost reproduction despite the wide range of studies in mammals that have implicated clock gene mutations in various reproductive impairments. Variants in bmal, dec2 and clock1b found to be associated with spawning date could be tested across multiple year classes of this population, different strains and even different species of salmonids to see how consistent the relationships with spawning phenotype are. In addition, studies detailing the expression profiles

112 of these genes under different photoperiod regimes would help to illustrate the relative importance of the various clock genes during and leading up to spawning.

The identification of 300 putative variants across 10 different genes will be a useful resource in future studies, not only on spawning date but numerous other traits, as the candidate genes sequenced in this study have known roles in other biological pathways. For example, clock genes have been linked to regulation of metabolism, development and the onset of puberty.

Similarly, kisspeptins and their receptors have been shown to be important in embryonic development in Medaka and are thought to be critical for the onset of puberty in all vertebrates.

The involvement of g0s2 in lipid storage and metabolism and its abundant expression in metabolically active tissues such as fat and liver has implicated it as an important gene in energy metabolism in mammals. Moreover, g0s2 is thought to be a “thrifty gene” that favours energy storage to protect from times of food shortage. While very few studies have focused on the role of this gene in salmonids, g0s2 has been found to be expressed in the muscle and adipose tissue of rainbow trout. Variants in this gene would therefore be a prime candidate in the study of variations in lipid deposition in rainbow trout.

In this thesis I have explored the genetic basis of an important and complex life history trait, identifying variants within suspected candidate genes and specific regions of the rainbow trout genome associated with reproductive timing. I have also linked variation in reproductive timing to variation in developmental rate and precocious maturation, and detected strong relationships between growth and maturation. Together, these findings highlight the highly polygenic nature of this life history trait and the complex connections to pronounced variations in the timing of other life history traits that are characteristic of the diverse life history strategies of salmonids.

113

APPENDIX A – Additional Files for Chapter II

Supplementary Table 2.1 Hardy-Weinberg equilibrium (HWE) tests for all 63 loci shown with

p-values and standard error. Asterisk show which loci remain out of HWE after Bonferonni

correction.

Significance (Bonferonni Locus P-val S.E. corrected) Omy1UoG 0.0864 0.0099 Omy1212UW 0 0 * BHMS211 0.0659 0.0072 BX317661 0.0951 0.015 Omy7INRA 0.0943 0.0089 OMM1220 0.0656 0.0102 BX299451 0.3209 0.0178 OmyFGT12TUF 0 0 * OMM5060 0.031 0.0045 One114ADFG 0.1208 0.0169 OMM1161 0 0 * One14ASC 0 0 * OMM1001 0.0427 0.0041 CA347214 0.023 0.0046 Ots515NWFS 0.0007 0.0004 * OMM5327 0.8487 0.0177 OMM1332 0 0 * OMM5100 0.3315 0.0167 OMM1297 0.335 0.0146 OMM1412/i 0.0087 0.0017 OMM1412/ii 0.4127 0.0112 BX887563 0.0016 0.0013 BX305863 0.0427 0.006 One3ASC 0.3319 0.0174 OMM1362 0.2153 0.0183 OmyRGT36TU 0.1436 0.0138 BHMS377 0.1889 0.0176 Omy4DIAS 0 0 * BX077780 0 0 * CA367675 0.0382 0.0082

114

OmyRGT24TU 0 0 * OMM1019 0 0 * OmyRGT1TUF 0.0232 0.0058 OMM1058 0.2165 0.0156 BX076085 0.098 0.0153 BX867246 0.8809 0.0106 Omy1002UW 0.2516 0.0163 Omy1120UW 0.9783 0.0021 OMM1054 0.0894 0.0182 OMM1335 0.6327 0.0215 BHMS486 0.9162 0.0019 OMM5159 0.6906 0.011 OMM1231 0.0004 0.0002 * OMM1082 0.2628 0.0174 CR373404 0 0 * OMM1088 0.2067 0.0144 CA061336 0.0002 0.0002 * OMM3061 0 0 * Clock1b-Po 0 0 * OMM1277 0.0046 0.0024 OMM5176 0.073 0.0129 OMM5239 0 0 * OMM3002 0.0425 0.0053 OMM5177 0.2666 0.0117 OMM5287 0.3114 0.0135 BX082639 0.0181 0.0028 OMM1334 0.001 0.0004 OMM5132 0.2257 0.0187 CA054565 0 0 * OMM1113 0 0 * OmyRGT19TU 0.586 0.0175 OmyRGT14TU 0.0613 0.0091 Omm1070 0.0829 0.011

115

Δ 10

0 2 3 4 5 6 K

Supplementary Figure 2.2 Delta K (ΔK) plot showing the number of subpopulations (K) on the x-axis and the calculated ΔK values on the y-axis. The large spike at K=2 indicates that this is the most likely value of K.

116

Supplementary Table 2.2 Possible candidate genes for marker-trait associations on RT-23 based upon synteny

homologies with medaka chromosome 17.

Chr Start (bp) End (bp) Ensembl Gene ID Abbr. Description PAX interacting (with transcription-activation domain) protein 1 17 13348920 13369424 ENSORLG00000008032 PAXIP1 [Source:HGNC Symbol;Acc:8624] 17 14886132 14926469 ENSORLG00000009010 EPHB3 EPH receptor B3 [Source:HGNC Symbol;Acc:3394] glutamate decarboxylase 1 (brain, 67kDa) [Source:HGNC 17 15136163 15149041 ENSORLG00000009208 GAD1 Symbol;Acc:4092] 17 16176724 16177653 ENSORLG00000010096 JUN jun proto-oncogene [Source:HGNC Symbol;Acc:6204] retinol binding protein 2, cellular [Source:HGNC 17 22034797 22039220 ENSORLG00000014024 RBP2 Symbol;Acc:9920] 17 22531679 22556326 ENSORLG00000014683 EPHA4 EPH receptor A4 [Source:HGNC Symbol;Acc:3388] 17 22895782 22908411 ENSORLG00000014983 SIRT6 sirtuin 6 [Source:HGNC Symbol;Acc:14934]** calcium/calmodulin-dependent protein kinase II inhibitor 2 17 23784254 23785207 ENSORLG00000015784 CAMK2N2 [Source:HGNC Symbol;Acc:24197] 17 24082395 24095842 ENSORLG00000015932 PAX3 paired box 3 [Source:HGNC Symbol;Acc:8617] 17 24357608 24450606 ENSORLG00000015972 EPHB1 EPH receptor B1 [Source:HGNC Symbol;Acc:3392] Period homolog 2 (Drosophila) [Source:HGNC Symbol; 17 25658720 25680938 ENSORLG00000016612 PER2 Acc:8846] glutamate-ammonia ligase [Source:HGNE Symbol; 17 25782947 25785523 ENSORLG00000016687 GLUL Acc:4341]**

** = currently located on the RT-23 rainbow trout linkage map. For SIRT6, a duplicate copy has been mapped to the homeologous linkange group arm on RT-13 BOLD = circadian regulating genes

117

Supplementary Table 2.3 Possible candidate genes for marker-trait asociations on RT-12 based upon synteny homologies with medaka chromosome 5.

Chr Start (bp) End (bp) Ensembl Gene ID Abbr. Description 5 7408610 7448685 ENSORLG00000004269 PAX7 paired box 7 [Source:HGNC Symbol;Acc:8621]** peroxisome proliferator-activated receptor gamma 5 7735910 7753213 ENSORLG00000004432 PPARG [Source:HGNC Symbol;Acc:9236] MAP3K12 (2 mitogen-activated protein kinase kinase kinase 12 5 8977786 8992409 ENSORLG00000005144 of 2) [Source:HGNC Symbol;Acc:6851] 5 9030547 9037115 ENSORLG00000005195 SP1 Sp1 transcription factor [Source:HGNC Symbol;Acc:11205] 5 9068597 9071092 ENSORLG00000005215 SP7 Sp7 transcription factor [Source:HGNC Symbol;Acc:17321] Retinol dehydrogenase 5 5 11669965 11673427 ENSORLG00000006299 A5HL78_ORYLA [Source:UniProtKB/TrEMBL;Acc:A5HL78] glutamate receptor, metabotropic 4 [Source:HGNC 5 13412379 13572195 ENSORLG00000007238 GRM4 Symbol;Acc:4596] progonadoliberin-2 [Source:RefSeq 5 16160763 16161955 ENSORLG00000008485 gnrh2 peptide;Acc:NP_001098141] glutamate receptor, metabotropic 7 [Source:HGNC 5 19774877 19839780 ENSORLG00000010879 GRM7 Symbol;Acc:4599] glutamate receptor, metabotropic 7 [Source:HGNC 5 19971775 19974209 ENSORLG00000010883 GRM7 Symbol;Acc:4599] 5 23964103 23968526 ENSORLG00000011982 FBXO2 F-box protein 2 [Source:HGNC Symbol;Acc:13581] 5 24899033 24965286 ENSORLG00000012405 EPHA8 EPH receptor A8 [Source:HGNC Symbol;Acc:3391] bHLH protein DEC1a [Source:RefSeq 5 25207123 25208845 ENSORLG00000012739 Q2L4U5_ORYLA peptide;Acc:NP_001098201] 5 25556132 25566017 ENSORLG00000012909 HDAC11 histone deacetylase 11 [Source:HGNC Symbol;Acc:19086] MAPKAPK3 (1 mitogen-activated protein kinase-activated protein kinase 3 5 25961574 25982501 ENSORLG00000013296 of 2) [Source:HGNC Symbol;Acc:6888] NCOA3 (2 of nuclear receptor coactivator 3 [Source:HGNC 5 26625045 26638592 ENSORLG00000013704 2) Symbol;Acc:7670] inhibitor of DNA binding 1, dominant negative helix-loop-helix 5 26643637 26644638 ENSORLG00000013719 ID1 protein [Source:HGNC Symbol;Acc:5360]** bHLH protein DEC1b [Source:RefSeq 5 27364071 27366154 ENSORLG00000014397 Q2L4U4_ORYLA peptide;Acc:NP_001098202] 5 29000414 29050918 ENSORLG00000015849 FOXP4 forkhead box P4 [Source:HGNC Symbol;Acc:20842] 5 27714203 27717633 ENSORLG00000014972 CDK2 cyclin-dependent kinase 2 [Source:HGNC Symbol;Acc:1771]

118

timeless homolog (Drosophila) [Source:HGNC 5 27745117 27758015 ENSORLG00000015066 TIMELESS Symbol;Acc:11813] Retinoic acid receptor gamma 2 5 27978172 27991914 ENSORLG00000015382 A5JL89_ORYLA [Source:UniProtKB/TrEMBL;Acc:A5JL89] mitogen-activated protein kinase-activated protein kinase 2 5 28587107 28616471 ENSORLG00000015745 MAPKAPK2 [Source:HGNC Symbol;Acc:6887] 5 29085376 29085633 ENSORLG00000015854 MDFI MyoD family inhibitor [Source:HGNC Symbol;Acc:6967] period homolog 3 (Drosophila) [Source:HGNC 5 29288111 29298254 ENSORLG00000015952 PER3 Symbol;Acc:8847] calcium/calmodulin-dependent protein kinase I 5 29367766 29399838 ENSORLG00000016042 CAMK1 [Source:HGNC Symbol;Acc:1459] mitogen-activated protein kinase 14 [Source:HGNC 5 29806257 29815580 ENSORLG00000016122 MAPK14 Symbol;Acc:6876] 5 32260502 32349780 ENSORLG00000017097 EPHB2 EPH receptor B2 [Source:HGNC Symbol;Acc:3393]

** = currently located on the RT-12 rainbow trout linkage map. BOLD = circadian regulating genes and genes directly involved in sexual maturation induction.

119

APPENDIX B – Additional Files for Chapter IV

Supplementary File 4.1 The reference sequence for each gene is given. Untranslated regions

(UTR’s) are shown in lower-case italics, coding regions are underlined and bolded.

>Dec1 aaaaagcttgccctttcctgcgtcatttggagtagcttaaagagaatggaaATGGAAAGGATTACAAGTGCACA ACCCACCCCCAAGCACCAGCAGGCTGAGCTGCCTGACATGCAAGGGTAAGTTGCTGATGATTCTTCTTATGCCC TATGCCATGCTTGCCCTCTTTATAGTGGCATACATTCGCGTCTCCTGACATTGAGTGCGCAACCTCACCAAACC CACATCTCATTGACTGTCTTCTGTTTTTCATTAGGATGGATTTCCCTATGTATGTATACAAATCCCGTCGGGGA ATGAAACGAGGAGATGATAGCAAGGTTGGTTGATATTTTATATATTTTTTTTATAGAAACAATATTGGTGTATA TTCACTTAATTAACTGTTTGTAAATATGATTACAATAGAATAATATTATGATTATATACAATGCTATTGAAACA TTGATCTATTTAGATCAATTAGTTGGCCTGATCATTCCGATCATGTGGTGACCTATTTTCCCACATGATGTAAT CCTTGGAGTCCATGTTACTGTTCACAGTGCTGCTCGTCAAACTGCTGAGGTTGTTATTTAACCTCAGTATCACT CCTGCCTTTAGGAAACCTACAAACTGCCTCACCGACTTATCGAGAAGAAAAGGCGTGACAGGATAAACGAGTGC ATCGCTCAGTTGAAAGATTTATTGCCCGAGCACCTGAAACTTACAGTAAGTTCCTATTTATCTTGAAGTAGCAC ATTACTAAAGCGCGATCAAGTGGTTGCTTGGTGGTACTTCAGGTTAAGGTGACAGCCTGACTAACAGGTGAGAT CTGTAAAGGAATTTTAAATTAAATAATGAATGTGAATACCTAAACAAATGGCATCTTTGAGATGTTAACTAAAA TTGAACACATTTCCTCTGATTTGTATTTTTATAGATTAAAGAATGTAATATTACACATTCAAATTTTGCATTTG AGTAGATCTACTTAGTTATTGCTTTTGATTGTTGTTGAGAACGTTTGTGTGCATGTGTGTGTTAGTAATCCATA AGAGATGAGCCTGTGCTGAAAGTAGTGTGTGTTCTTCCCATAGACTCTTGGCCATCTGGAGAAGGCTGTGGTTT TGGAGCTCACACTTAAGCATGTGAAAGCTCTAACCACTCTACTGGAAAACCAGCAGCAGAAAATCCTCAGTCTG CAGAATGGCATGCAAATCGGTGAGCAAACACACACACACACACACACACACACACATACACAATAAGATGATTA TGCAGAAGCGCATACAAATCAGTGAATTTAAATATAGCTTGTGGTCTCTTGCTTTGGCTAGCTTCAATTTGGAT GCAGACCACATCCTCACTAATTTTCAAATGCAGCACAGTGCATTGCTCATCTACTGCATTATAATAACATAATA ATAGAATAAGGAACTGAGTCAGAATAACTGCTAAATTTAGTTTGGATGTGGTTGCGTAGAAGGGGATTTTATAC CCATATTAAGATATATTACTTACAAGAATCATGTAAATACGATGAAAGTAGTTTGGTAGTTTCCATAATAATGC ATTGTGGTAGATCTGTGTTTGACAGCGTTTGTGGTGTTGTCCATTCCTGCCTACAGAGCAGTCCTCTCCCAGCC AGGAGAACAGTGAGGAGATCTTCCGCTCAGGCTTCCATGTCTGTGCCAAGGAGGTGCTGCAGTACCTGGTCAAC CAGGAGGGTCACGGTGACCTTACACCCTCCCACATGGTCAACCACCTGCACAAGGTGGCCACTGAGGTCCTCCA GGGTCCTCCCTGTAGCCCCTGCAAACCCCGGTCTGAAGAGACCACCATCCACTACCAACATCATCAGGCCCACA GGGAGAAGCCTGCAGGCCAGCCCCCCAAGCCCAGTGAAGGCCATGGGAAGAACTGCGTTCCCGTCATCCAGCGG AGGTATGCCCATGCGGGCGGTGAGCAGAGCGGCAGCGATACAGACACAGACAGCGGCTACGGTGGCGAGCAGGT TGAGCATCTGGCGTCGCATGCAGGGTATTACGGCCAGGAGAGACAGCTGAAGAGGGCGCTGGGAGAAAAGAGGG CGTCATTTTGCATTAAGCAGGAAGATGAGGCGTGCCACAAACGCAGCCGGGTCGAGTCATCCGAGGACGAGTCT CTCTCAGGCGGAGAGTCATCCTCATCCTCCTCCAGCGGCCACGGCAGCTACATGAGCGCCTACTCCCCTCACCA GGCCCAACCTCATCCCCTTTGCATGCCCTTCTACCTCATCCCCCCCTCTGCCGCCGCCTATCTGCCCATGCTGG AGAAGTGCTGGTACTCAGGGGCCATGCCCATGATTTACCCTGGCCTGGGAGGCTCCGCGCAGGGCATGCCTAGT GACAGGCATGCCCCCTCTCCCTCGATCATGATGTCCCCCAGGGGGCGCTCTCCCTCTCCCCCTACCGTAGCCCA AAGCCCCATGGACTCCCCGGCCTTCCTCCAAGTGTTAAAGCAGGTACTTCCCATGAACTTTTCCAGGTTCATGG G

120

>Dec2 ttctaaagtgcagcactattcagaacactcgccgtgcaacatcttcccaaaagcttctctgcctgctggttttg gaataagacacattgtaaagacaaagaggaataccaacaagagacaagttATGGATGAAAAAATATCGCGTCTG CAGGACAGGCAATTTATGGATCATGCTGATTTCTTAGGGTAATCTAATTATTTCATTTTTAGAATGGTATGGGG CTATGCCCATGGTATGGGGCTATGCCCATTAACTATTAGATGTACACCATTTGTACGTTTAACTATGTAACTAA CCTGCCCTTTTCATTTTGTCAGGGTGGAATACTCCTCACTCTACATGTGTAAATCGAAAAGAGGGCTGAAGCGC GAAGATGGCAAGGTATGCGCGCGTTTTATCCTGTTTGTAGATCAATAAATGTCTGATAGGTAAAACGTCCTTGT AGGATGTGTCTTGACTGTGTTGTACTTGTTGTAGATTTGATCTAATGCTATCATTTGTTTCTGTGGTCGTAATC AAATGTATCTTTTCATTCCCAGGACGCGTACAAGTTACCACACCGATTGATAGAGAAGAAGAGGAGAGACAGAA TCAATGAGTGTATCGGACAGTTAAAGGATTTGTTACCCGAACATCTCAAACTGACAGTAAGCTTTTACGATTAA GAAGTGATTTGCATATGAAATGTAAAAAAAAAATATATTATTGTTTTGATGAATGATTGTTGAGTTATCTGATC TCGTGTTTTCCACTCAGACGCTCGGGCATTTGGAGAAAGCAGTTGTTCTTGAGTTAACTTTGAAGCATTTAAAC GCTTTGACTGCAGTCACTGAGCAGCAGCACCAGGAGATTCTGGCTTTTCAGAATGGTAAGTTGTTGTTGCATAA CCTCCAATGACTATTCAGTTTCATGATAGGCTAGAGTTTATGAATTCTCTATTTTGGCTTCTTTGGTTTTGGAT AGGCTATGCGTAAAAGTTATTGTAGCCATCAAATTTGATATGGTTGCATTCTCACAATTAGGTACAATTTAATT CAGTCAATGAAGTTGTCTTTTCTAACTTTTAAATGCATGTTTTCCAGGGGATCTATCGATGAAAGTGCCCATTC GCGCTGATTTGGATGCGTTCCACTCGGGGTTCCAAGCGTGTGCCAAAGAGGTCCTGCAGTACCTAAACAAGTTG GAGAACTGGAATGCATGTGAGCAGCGGTGCGCGCAACTAATCAGCCACTTGCACAAAGTCTCGGCGCAGTTTCA GCCTGGTACGCCACTGCACCATCCCCAGCTACCTGCCAGAGACGCGCTCGACCGCGATGGCCAAAAACCAGACA GCCAAGCCGGACATGACCGCGTATCAGTCATACAGAGGAGCCATGGAGAGCTTAACGAGAATGACACAGACACA GACAGTGGATATGGGGGTGAGGCGGAAAAGAATGATGGGAAGAAAGGATGTGACCGGAGCAAACTGCAGGGGCC CAAGGCAGTAAAGATAAAGCAGGAGTTCGAGGATGACCGCGCTGCCAAAAAAACAAAGATGAACTGGGCTGGAA ACTGCACGACAAGCGCAGACATGACCACCAGACCCGATCTGGTCTTTATGAATTCGTTGATGGGAATAACTGGC GTGGGACAACAGACTCCCTTTTGCATGCCCTTTTACTTCATAAATCCCTCGGCGGCAGCGTCCTACATGCCTCT ATTTGACAAAAGTAACCTAGAGAAGTTTGTGTACCCAGCTGCGGCAGCGGCCACGATCTCATCTCAGTTTCACT GGTTATACCCTAGCCTCAATCACATGCGTCGGCAGCTGCGGCCGCAACAGCCGGTGTTTTTTCCCGCATGTCGA CAGAGAA

121

>Eed GTCCGAGACCCCTACCGAAGCGGGAAAGGAGATGCCGACAAAAAAGCAGAAGCTGAGCAGTGATGAAAACAGTA ATCCCGATCTCTCTGCAGATGAGAATGTAAATTCGGTTTTGTTCTGTTTGTATCGGCGCGGACATGAAATATGG TTAGCTAGCTAAGTAGCTAATGTTAGCCTAACTTTTCATAGCTAGCAAGCTAACTAGCAAGCGACTGGTAGTTG ATTTTGGAGTTCGTGATGATAGCTGGGCCTTTCCCTTTGTTTCAACTAGGCCTAGATTTTTTATTTCTTTAGCT ATAGATACCTAGTTAACGTTAGTTGTGGTTATTTCCCTTTCAAACATTCCAGAACAGGAAATAAGAAAATTATC ATTCAACGAGCAAGGGATTCGAGGCAACACTGCAAAGGGCCTCCACCTAAAATAGCTAGCTGGCTAGTTATGCT CTCTAGGTAGTGTTAGCTATCAAGCTATGGACCCTTCTGGTATTGTCCAAGTAGATAATCATCAGCCAGTTGTC AGTTTAGTTTTTCTAGTCTATCTCAAGCCCCTCATGGTAGGCCATCCCACTTCTGACACCAGTGTAGTCGAAAA CAGGGGGTGCAGAACATCCATTGCAGGTTGCAAACGTATCAACCACAACCATCTCATGTTGCTATAATTTGTGT TTGTAGGATGATGCTGTCAGCGTTGAGAGTGGGACCAATGTGGAGCGTCCAGACACACCCACCAACACAGCCAA CGCTCCAGGCAGGAAGAGCTGGGGCAAGGGCAAGTGGAAATCAAAGAAGTGCAAATATTCCTTCAAGTGCGTCA ACAGCCTCAGGGTGAGCCCATCTTATCAATAATATTTCCAATCATTTCCAACTGCAGACATGTCACATCTTATC AATAGGCCTAATTTTGATTCCAGAAATGTCATAATCTCAACCTTGGACTTGGCATGCCTGTTATAAGTATGTGT GAACTGTGCTGTTTATATGATACTGTGTGAGTTGTAAACAGCTGAATGAAGATGTTCTAATGTTACGGGTGGGC TCTGAACCCAGGTCTCCCACAGCAGAAACCAATGTCTTGACCATTAGACCAAGAGGGAATTCCCACTTGGGCCG AGGTTAACACTGATTTTGAAGTCGCAGGGCCACCTCATCACCTTGACCATGAGCTCAACTCATAATTAACTTGT TCTTTACACAGGAGGACCATGGCCAGCCATTATTTGGGGTCCAGTTCAACTGGCACAGTAAAGAAGGAGACCCA CTGGTGTTTGCTACAGTTGGGAGCAACAGAGTAAGTATCTTTGGCATCACATAAACCATGTGGAAAGTGTAATA GCCAACACATGTAAAATACAGACTCATGTGCCACCTGTCACTGCTGACTATGTGATGTCCTTAATTTACCAGGT AACCCTGTACGAGTGCCATTCCCAAGGAGAGATCCGACTCCTGCAGTCATACGTGGATGCCGATGCAGATGAGA ACTTCTACACCTGCGCCTGGACCTTTGACACCAGTACAAGCCATCCCCTCCTGGCCGTGGCGGGGTCACGTGGC ATCATTCGGGTGATCAACCACATCACCATGCAGTGTATCAAGGTGGGTCAATTTCCAAGTAGTTGTATCCGATA CACCAGGGATGGAATTTACATTTCTGCATAAGGGAGGGATTAGTTGTGCCATCTCTGAATAGTTTTGTTGTTTT TTAATGCAGCACTATGTTGGTCACGGGAACGCCATCAACGAGCTCAAGTTCCACCCCAGAGACCCCAACCTCCT GCTATCCGTCAGCAAAGGTAGAACAACTAGACACCATAGCTAGGACTTCATATTTTCTCGACTGACCTGACTTT TTGAGAACTAAACGATTTACATTTAGGAATGATTTCTAATCTGTATGTATTTACATCATTAACAGAATGACTTG ACATAAAATGGACTGTGTGAATATCTCATCAGCTTTGTGTTTTGCCTTTAGACCACGCCCTTCGTCTGTGGAAC ATCCAAACAGACACACTGGTGGCCATCTTTGGAGGTGTAGAGGGACATAGAGATGAGGTCCTCAGTGCAGTGAG TACACGACCACAACCATCTCTTATTGGCTTTCTTGATCAATAGGAGTCAGGGATTTCTATGTGTATGTGACCAT TGAAAATGGCAATACAATATGGAACACACACAAAAAAAGGAAATGAGAGATGAATGATATAATAATGAAAAATG TCTCTGCGCCAGGACTTTGACCTGCTAGGTGAGAAGATCATGTCGTGTGGAATGGACCACTCTCTGAAGCTCTG GACGATCAACTCAGAGAGGATGCAGAAAGCCATTCACGGGTCCTATGAATACAACCCTTCCAAGACAAACAGGT GAACATATTGGTTGTGGGCAACAAACGTACGTGTATTCCCATTTATATATTTCAGTCATTCAGCAGACTTTTAT ACACAACACAGCACGTTCAAATAACAGGGCTGAACAATTGCATATTAGGAAAATAGTACAGTGTTGTCAGGATA CAGTCAGAATCTCACATCTTTCATTTAACCTTTATTTAACTAGGCAAGTCAGTTAAGAACAAATTCTTGTTTAC AATGACTGTGTAGGAACAGTGGGTTAACTGCCTTGTTCAGGGGCAGAACGACAGATTTTTACCTTGTCAACTCG GGGATTCGATCTAGCACCCTTTCGGTTACTGGCCCAACGCTCTAGCCACTAGGCTACCTGATGCCCCGAACTGT TGATTTTCAACTTGAAAATGTTTGCTCCTTTAACCGATGATTCTGTCTTCTTACAGGCCATGGGTCTCTCAGAA GATCCACTTCCCTGACTTCTCTACCAGAGACATCCACAGGAACTATGTGGACTGCGTACGCTGGCTGGGAGATC TGATTTTATCCAAGGTAAGACTGTGAGAATCTTTTTGTTCAAACATTCTGTTATTAGGTTGTGGATCCCATTGT GACCCTCATAACCCGACTCCTTTGGTCTGTTCCTCCCCTGACCTGACCAGTCGTGTGAGAACGCTATTGTGTGT TGGAAACCAGGGAAGATGGAGGACGATATTGACCGCATCAAACCAAACGAGTCCAACGTGACAATCCTGGGTCG CTTCGACTACAGCCAGTGTGACATCTGGTACATGCGTTTCTCCATGGACTTCTGGCAGAAGGTAGAGATGATAT TTCCCCTTCCGTTGTCTGTGGCTTTGTGGAATCCCTTATCTGCTACTGTTCATTCCAGTATTGTAAACAAACAG TGGTTTGGTGTCGGAACTTTCTAACTAAATAGATGCAAGTTTGTTGTTTAACATTAAACAGAAAGTATAGTATT GTCTCCACGTAGGAAGTTGTTTGACTATTGAAGTAACACATGTCTTGTCCTACAGATGTTGGCTCTGGGAAACC

122

AAGTGGGGAAACTGTACGTGTGGGACCTTGAGGTAGAGGACCCCCACAAAGCAAAGTAAGAGTCTGTAGGGAAA CTGTACGTGTGGGACCTTGAGGTAGAGGACCCCCACAAAGCAAAGTAAGAGTCTGTAGGGAAACTGTACATGTG GGACCTTGAGGTAGAGGACCCCCACAAAGCAAAGTAAGAGTCCGTAGGGAAACTGTACGTGTGGAGGTGTTGGG GAAGCTACTCAGAAGATTTAGTTGACCAAGCTACCAATTACTTCACACTGGAAGAAGTTAAGCTACACTAAATA ACGTTTATTTTGAAACTAGTTACTTTCACAAACTACTTTGTGAAAGATCATCAATACATTATGTTAACAATCTG TCATTTATCCTAATTATATAGGGTAACATTTGTATTTTTGCCTAAATAGACATATCCAAACCTAATCATTTTTC ATGGTCATAAACAGTAACTGGTAATGTTGTATAGTTTAGAAAGGTCTGGAACTAGCCTTTCTGGTAAATGTTGT TATAACTTTCCGAGGTGTACTCTCTTTTTAGAACACAAGTACATGGTACAAATATGAACAAACAAATTCTAAAC GACTTAGTATAAGATTTCCCATTTCTTAACAGTGAAATAAATATAATCTAAATGTCCACTGAGCAGCACAGAGA CACCATTCACATGGGTGCAGACTCGTTACAACTTCTGTCTGTGACCAAGAGAACGCAGTCTTTCAATTCTATGA AATTATTTAGTGTTTTATTTATTTTGAAAGCTCTAAATCCATCTGAGAATTTCACAGCGAGATGAAACCACAAC AGCTGGACTCAGACTGTCATATGCCATTTCTCAGGCTCACTTGTTCAGAGGAAATTGATTCTTTGTCTGGATTG GCCAGAGAATGTGACACATCACTCCCTATGAACATGAAGTGTCACGTTTCAGACCCCACAAGTCCGCGCCACTG AGAGAGTGGAAACAGAGAGCAGACAAAATGGGTCTTTGTGCCACTTTAAGGTACAGGACACTATGGCGTTCAGA GGGCTTTGTACACCAAAATGTCGGTCAGAACCAGTCCAGAACCGCTCAGTCCCCCCATACAGGGGACTTAACAT CTAAGAGGTTTTAAACAAAATGTTTCAAATGAGAATTAGACAGGTCTGATGCTGAGAAAGGACATGTTTGCCTA CTTTGCCCATATTACATTTTTTACAAAAGAAATTGCTAAAAAGTTCACTTCTGAAAACATAAAGAATTGAAAGG ACCCGGAAAGTTAAGAGTTAACCTCCCACCAATACACCTCACCTAAGCAGTGGTCCATGCCTAGATGGTAGACT GCCTGAGAGAAGTGAAGGCCAGTAGAGCACCACTCTCCTTGTTATGTATCATATTCCAGGGCTGTGACAGAGAC CTCACAGAATAATTAGACAGATATTTCAGGGGATGTATAAATGTGAAGCATCCGCTTGGCGTTTCCATTCACTA CCAAATATGGTAGTGAGAGAAAGCCAAGTGGCCGGCAGTGGGAGAAGCTGGAGCAAGATGGATTTTGTCCGACA TTCTGCAAATGTGTCGTTTTCAACAGTTTGTCCTCAATACAGTTCTGTTCCCAAAGCTGCAGTCTGTTACGAAC AGAGTGGACTACATTTTAAAGACTTTACCCTTTGCTAAAGTAAAAAAAAAAAAAGGCATTGTTTAAAAGGAGTG CAAAGGCAAATTGAGATATTGCACATGTGCATTGCAAAGTAGGCGTTCACTAACAGCGATATGCAAATATATAC TACAACGCGCCAATAGGATCTCGCAAGCTCATGCTTGGCCCTGCCCAGCCCCTTGCTTGGCCCTGCCCAGCCCC TTGCTTGGCCCTGCCCAGCCCCTTGCTTGGCTCTGCCCACTGACTCATTTGTTCTCATTTGAAATGACGGGCGG TGGTCTCTTAGTTTAGTTATAACAATCTTCGGAGACACTGTCTTTCTGTTTCACCAAATACATTCTAACCTGGC TCTCTGTTTCAGGTGCACCATCCTCACCCTCCCAAGATGCACCTCTGCCATCAGACAGACCAGCTTCAGCCGTG ACAGCAGTATCCTGATTGCAGTCTGTGACGACGCCTCTAT

123

>GnRH3B GTGTACACTGACTTCACCTCTTAACACATTATAAATATGTTTGTTTCCATCAAATGCAGTTTGAAGCTTATGCA CTAAGCAGGTGCCATTAGTGACGTTTAGTGTCCATTAGGCACTTAGTGTGTCACACCTGTGGAGAAGGGATTCT AATCCTGATGACACAGACTGTTCCATGTCTAACGACCCCTATAAAAGGGACTCATGATATTCCCACCACAGTGT AGGAAGGAATACACAGAACGGAGAAAGTATGTGATTCATATAAGTATATTTCAAATTGTTAACTAATGTGCATT TGTGGGTAGTTCATATATACTGTACAATGTGCATATTCAATAGGTAATCATTGCAAAATGATCGCAAACTTCTG CTTGATGTAAAAATACATTATTTTTGACGATCACATTTAGCTGATATTTGACTAGCTTTCTTTCCAGCTCCCAT GGATCTTAGCAACAGAACGGTCGTGCAGGTGGTGGTGTTGGCGTTGGTAGCGCAGGTCACGCTCTCTCAGCACT GGTCGTATGGCTGGCTACCTGGAGGGAAGAGAAGTGTTGGGGAGCTGGAGGCCACCATCAAGGCAAGTACTATT TACCTCTACCTGTAACTACTGTTACAGCTATGTCTACATGTGCATACTGTACATGTAATTGTCCTTTAAGGAAA TCTACTGTGTCTTGAAAACCTGTGAACATTTAAATGTGGCATTTATCGGGATAGTTTGTGTGGAATATTAGTTC AAGAGGCCTTTTCAAGAGTATATTGGCAATGTATATTAATTAAACTCTGTAAGTGTGTTGCATAAATGGTATAT GGGTAATAGCCTTACAAATTCCTCCTACATATTGCTATCCAGATGATGGACACAGGAGGTGTAGTGGTTCTTCC TGAGGAGACAAGTGCACATGTCTCAGAGAGACTGAGACCATATGATGTAGTAAGTAGTCATATTAATTTATTAG GTTAGATATTGTATTCATTGTATTCCTAATGGCCAATTATTTATGTTTCATCTGAAGATGCTACATTTTCTCCT GGTAAAATATGTTGTAAACAATATACCAAAGTATCTGAAATAAATGTTTAGATAAGAGTAATGGCTGACAAATG GAAATCTTCCCTGAATTTAGCGAAGTGATACCTATAAATGTAGGGAGACAATGTTGCTCATGTCTGACACATCA GTATAATATACAACATAAAGTAGACTTCTGAAGTTAACGCTTTGATTTCCCTAGATATTGAAGAAATGGATGCC CCATAAATAAacaactgagaccattattcacgaaagaagcgagaagacaacatcaagcagac

124

>G0S2 TCGGTGTGGTTCTCACCTCACACGTAATGGTCTTCCTGAAAGTGTAATTGCAGCCATATTACGCACCATCACTT CAAGGAAGACTGCCACGGCCAAGAACCATAAAGAGGGGAAAGGTTGAGTCTACTTTGCAAATGGCATGAGAATA CAGAACATGAGTGGGAATCCCAGGATTCCAGATAGTGATATGTGACAATGGAATTTTATAGTTGACTTTACAAC CTTGGTCTGACTGGCAGTCACATTTTGAAGAATGTGAGTGAAACTGGAGTGTGAAAAGTAGCCTGTTTAACAGT CACCAAGGTCTGAAAATGTGAAACGTATTTTATTATTGCCATTTCAGTATTGCCGAAATGACAACACATGGCAC TCTGTGACTAGTGACCAGATTATTTCACAACAGAACCAGACGACTGCCTTCCTCCTCTTGTCCTGCTTTGGGAA ATCATGTCAAAGGGCATGGTGCTTCGCACGAGCGCGCACAAACACACACACACGCTTATCTAGAGCAACTTACA GGGGCAATTCTGGTTAAGTGCCTTGCTCAAGGGCACAGACAGATTTTTCACCTTGTCAGCTCAGGGATTCAAAC CAACGACCTTTCGGTTACTGGCCAAACGCTCTTAACCGCTAGGCTACCTGTCACCCCACATCCAATTTAACTTC ATCAATGTATCAACAATGTCAATATATACTGTAAATCCATTTGTTGTGGATACCCATAGGCTAAAGCACTGGAG GTCTAAGAGGCATTGGGACTTCCGTAAAGCTCTCAATACTACTTTGTTTGATTAGGAATGAACCTAACACTGCA GCTGGGGCATTCCAACCAATAAAGGGGTGGTACAGAGATAAATTGATTGAGGGGATAGTACTCTAACATTAAAT AATTATCATTGGATACAGGTCAACCTCTCCTGATGGTGTTTAATGTACACAACACTGGACATAAACCGACCAAC CACACAATGGTCAATGTTCAGCAACATGTGTATAGTGTTAGTCTTAGCTCTCTTTATTCTTCATTGTGGAGTTG TCAATTCCCTAATATAAAATAATAGTAGACACTTTGCAAAGACTCAGGAGAGAGAGTATTGGAAGTGGGTTCAG GTCGAGCATAGCTACCGCTGGTGTTTGTCTTACTGTTTCACAAAATGTTCATTCTTAGGATTAACTATCTGCCT AGTTCAACTTCAAAGTTTTGCAGGTAGATGAGACCCACAAAATGGGTCAGATTTTCACCTTTGACATAATGAGA CTTTCTTTATTTGATGACACATCAGCAAACGTTGGACTTCATTGTAGAACTAACACTCATTGCACTGTTTAGAA GCAGCAAGATTGATGGGTTTCTGTAGATGTATTACGTACCATCATAGACTACCACGCTGACTAGATGGTGGCTG ATGAGTGATGAATGCTTTTCATGTTATAATACTGCAGTAATACAGTAGCCTATATAGCACTACTACACTTATTA AAGATACATTCCGGGATCCTAAGCACTTACAAATTTGTGACATATTGTACAAATTATAATTTGTAACATACCTA CATTTCGTAGGATATGTTACATCCTGACATTTTTAGTTGTTATGCATTTCGTTCAATATGTTACAAATTACAAT TCGTACAATATGTTACATATTGAACGAATTGGAATTTGTAACATACCATACGAATTGTATCCTAAGCACTTACA AATTTGTAACATATTGTACGAATTGTAATTTGTAACATATTGAACGAAATGCATAACAACTAAAAATGTCAGGA CGTAACATATCCTACGAAATGGATGATGTACAATTTTCGGGGACCGTTTTGGCTCGTGAGCACGACTTTCAAAA CAACTGGCTGAAATTATACAAAAGCTGTACAAAACCACACAATTTGTACCTCTGTTTCATGACTAAAACACATG TGACTCACGTGATATTACTTGCACAATATATTTTGGCAAGTTGGGTTTTTTTCAGTGACCTTGCCTTTGTACCG ACTCTTGGCTGTTTCCAAAACAGCCCTGGATGCCATTATAGAGTGCATCAGATATTGAAGACATTGCCTCAAAG CAGTTGACTCCAACACTGCACTTCCTCAACACCCATCGTCATGAATATTCATAATTTGACACTTTGTGGGAGTT GATGTGGATCTCCTTGTGTATAAAACCCAGCACCTCTCATTGCATCTTTGcttggggatgcttgactaagacga aatctaaggaaagcatttaacaggtccctatacaggtaagtacatttaaatattttcagctctgttctgtgcag tcttcattcaatcttattcagaattgaagagtgtaatctacattgtctgaatatattatcagtgatatattatt taatacattatgattatcataaaatgtacagcggtcagtactaataattacgctaatttgttttagtttaatta ccacatttgcagagtcattaaacagcctattatttatgacatttccttttccctcaatagactgaacttgagac aATGGAGACCATAAACGAGATCATTCCATTCGCTAAGGAGATGCTGAGCCAGAGGCCCAGTCGAGGCATGATGA AGGTGTACCTGCTGGGTTCTACCCTGGCATTTTTTGGAGTTGTCGGTGGGCTGGTGGAAACGGTCTGCATGCCA TTTTGTGAACAGGAGCCATTAGATGAGGAAATGATCAAGCTGATCACAGAGGAGAAGAAGAGGCAAATGCTGGA GCCAGAGATAACCACTGTCGAGCCTGATGTTGTGGATGAGTTGCAAACAGAGATTGATGCTAAGAAGCCACTGG AAGGTCGTCAGAGGAGGGCGTCTATCAGGTCACCTGCCTGTTGAagatgcactgcaacaacatcttatgttaca cacactaatgaaaccaacactcagaacacaaaatgtggtgaaataagctgtcaaccaggcaatcaaaagagatt gcacttggtgatttttgtcatgataatttggccatgtttagggaccccttgacttattattaatgagaagagaa gaggctgaatggatggatggacgaatgcaacaacaagctacagtgatgactggctgctgggcagcagaagctct gtgactgattgagaatttgtattttcttttggcttcctaataaacctattttaggttaccactgggtcatgaac tggttaatgtcaaacagtgctgtgagtagtctactgtagcctatctaattatttatataaaccctagatgactg ttttaaagccactgcacaggtctttttgtactccattgtaaaaaatattttggaagctatagaaatgcatttat aaatgtgtatattcgtttttgctaagtatattctattacatacacattgatgcatacatttcaattgtattatg

125 tgaactgaacataaaaacaaaaaaataaagacattaataaaaacATTTTCCTTAAATGAGTTTTTTTCTACCGG AAATGATGCCGTTTTGTTTTTCTGTCTGTCGTGTGCCTAGCAAGCTAGGCGAACACTTTTGTTGTCAGAAAGGT GTGACTTTGTGAAATAACGATTTGGGAGCAAATAAACAACCTACCGTGCAGATGGCGGACCCTGCGGTGATGGC GGGTGGATTCAGTGCTATAGTAGGGGTAAATAAGATTGTCATATGTAAGCTAACTTGGCTACAATGTTAGCCAC CATCAGGCTAGCTTGTCAACATAACGTTAGGTTAACTACAATGGTTGTAAATCGCCTGTCTGTCCAAATTAAAC TAGCACATTAAAACACATTTTACCTCCTCAAATGACATCCATTAGCTAGCTACGTTTAAACGAATGTTTTTTTT AAAGGAAAGTCGGTTAAGAACAAATTCGTATTTACAATGGCGGCCTAGGAACAGTGGGTTAACTGCCTTGTTCA GGAGCAGAACGACAGATTTTTACCTTGTCAGCTCGGGGAGTCGATCTCACGTAAACCGTACATCGCCTTGGTCC GTACAATTTCCCTTATTTTAGCGCCCCAAAAACGTAATAATTACAGATCAACTGTAATGTCAATAACATTGTAA AGCACAATTTCTCCCCTTTCCAACATAATCAATTACATGACATAAACGCTGCCCGTTTCTGCATAATTCAAGCA GGCAATGAGCCCCATCGGGTCTTTTTAAAAATGGCGGGTGGGGAAGCGAAACTAATGCGTGATAGTGAGGAGAG ATGTTGTGTGGGAAAATTGCTTTTTTTCACTCGCCTCTAAAATGTAAATAAAACCCTAAAGAGTTTATATAATG TGCCATTACATACATATTTGAAGGTTTGTGTCGAATTTGAATCAGGTTTTTAGGGCGGTGCTAAAGTGATCTTA TAAGTAAACAGCGGCTTTGAGAATGATGATCGCATGCAATGATGACGAAAAAAATGACGGTCGCTGTCCATTTC TTGTTTTTAAAGGATGATAGAAGTGCTACACCTGGTGGAGAGATATTGTAAGACAGAAATAGTTGCTTTATGCG TGCTGTACGTTACGACATGACACGTCAAGATGTAATGGAGGTCCGTTCTTTCAACTTTTCTCCAATACTATAGT CATTACCATGTCGATCAACGCTTGAATAGAAACCTAGTTCACACCCCCTATTTTGACGTCAACACACAGTCCCA TTAGTTTTCTTTGTAGCCTCGTTTGAATGTTGCGGTTGCACACATTTGTACGGAATGGGGAGAGTTTACGTTTG CAACCTTTCGGTTACTCGCCCAACGCTCTAACCACTAGGCTACTTCCCACCCCCGTTGTTGACTTGCTGTTCAC AATCACGTCATGCC

126

>BMAL ATGAATGAGTTCATGTCCCCCAGCTCCACCGAGCTGATCAGCAGCTCCATCAACACCCAAGGCATGGACTACAC CCGCAAGAGGAAGGGCAGCACCTCCGACTACCAGTAAGCACCTACTGTAACCATCGTCAAATCATTGTGGCCTT GCACTCAGTCACCTTAGTCTCCCCCCATCCTCCCACCAGTCGGTGCTGAAGATGATGGGTTCACTGAGTTTTAC AGTTAAGATGTAGTAATTAACGCTCCGACTTTGCTAGCCATAGTTATGGGGAAATTTGCACATCCTGCAATACC CTTTAAAAAAAATGGTATTGTGCTATATTGACTCATTTGTAAGTACAGTCATTTTCCTGCCATCTGTTACTGAT CCACAGTCATCTGACAACAATGATTCATGCGTTCTTTTTTTCTTTACAGAATTGATGGATTTTCTTTTGAGTAA GTAAGAAACGGTTTCAATTTTTTTTAACCTTTTGTCTGTTAGGCTTACCTTATTTTTGTTGAGGGGGGACACTG AATAGTGTAGTGCAAATGGATAGTAGGAAACTGTTAAACATTATTCTTAATCTAACGTGGTTCAGTAAAACTAA TGGCATCTGATTATCTTCCACAGCGAGAGCAGTATGGATACAGACAAGGATAAGCTTAGGTAAGAGTTTTGGCA GCAAAAAGCATGAATTACAGTATAAAGAAAAGCTTAGTTTTGCCATGTTATTGGTTATAAATTGTACAGGGGAG ACGGATGTTGGGTTAAGATAGTGGTTTCACTGCAAAATTGAGTAGGTGTTCATCTATTTTCATAGGTGAGGGTT ATATACACGGTGTAGAAAACATTAGAAACACCTTCCTAATATTGAGTTGCACCTCCTTTTACTCTCAGAACAGC CTCCGTTTGCCGGGTCATACAAGGTTTTTTATTTATTTGTATTTATTTAACTAGGCAAGTCAGTTAAGAACAAA TTCTTATTTTACCCCGGTCAAACCCTCCCCTAACCCAGATGATGCTGGGCCAATTGTGCGCCACCCTATGGGAC TCCCGATCACGGCCGGTTGTCATACAGCCTGGGATCGAACCAGGGTCTGTTGTGAAGCCTCTAGCACTGAGATG CAGTGCCTTAGACAGCTGCGCAACTCGGGAGAGGTGTCAAGTGTTCCACAGGGATGCTGCCCCATGTTGACTCC AATGCTTCCCACAGTTGTCTTTGGCTGGACCACCTTTGGGTGGTAGGACCATTCTTGATACACACAGGAAACTG TTAAGTATGGAAAACCCCAGCAGCTTTGCAGTTCTTGACCCACTCAAACTGGTGCATACTGTACCCTGTTCAAA GGCACTTAAATATTTTGTCTGGCCCATTCCCCTTCTGAATGGCACACAGACACAATCAATGTGTCAATTGTCTC AAGGCTTAAAAATCCTTCTTTAACCTGTCTCCTCCCCTTCCTCTACACTGATTTTGAAGTGGATTTAACAATTG ACATCAATAAGGGATCATAGCTTTCAACTGGTCATTATGTCATGGAAAAAGCAGGTGTTCCTAATGTTTTGTAC ACTCCACTCAGTGTATGTACCATTACATAACCTGTGTGGAACAGTGGCGAAGGGATACGTTTCCTACTAAAACG TCTCTCCTTTTTTTCCTTCCTCCAGGGATTGTGGTGATCATCAGGGGCGGATCAAAAATGCCAGGTACCCAGAC TCATTCCCGAATTCCTAATGTTTCACTTAAGTCTCTGTCGGCAATGAATATGCATAGTGTTTCCACTGACCTGG CACGTGGTTAAACTCCAGGATAAAATATATTAGAATCTCTCTTTCCAGGGTGAATTAAATGCTCCTTTTTAATT AGACAGAGAAAGCCTCGTGTCCCATCGATGAATAGGCACTTTATATAGTCTATAGATTGCACTGTGTAACAGAA GGACTGGGAGTTCTAACAGTTTGCTTTCTGCTACTCTGCCAATAGGGAGGCACACAGTCAGATTGAGAAGAGGC GCAGAGACAAGATGAACAGCTTTATAGACGAGCTGGCAGCGCTAGTGCCTACTTGCAACGCTATGTCCCGCAAG CTGGACAAACTCACAGTTCTACGCATGGCTGTTCAGCATATGAAGACATTACGAGGTGAGATGCAGACAAAGAC GGCAGGCAAATTATCATTGGACATCAAAGAGGTTGTAACTTGATCATTAAATAATTAAAATACTACTTTTTCTG TTTCTGTACAGGCGCAGCGAACCCATACACAGAGGCGAACTACAAGCCGTCTTTCCTGTCCGATGATGAATTGA AGCACTTAATATTGAGGGTATGTTCAAGCACTCCTCTATCTCCTCTCTGCTAAGTTGCTCTCTGGGTAAGCCTG ATGACAAAAACCTCATTATTTTAGGCTGCTGATGGCTTTCTGTTTGTCGTCGGATGCGATCGTGGGAAGATCCT CTTCGTCTCTGAGTCTGTTTACAAGATCCTCAACTATAGCCAGGTACGTCTACATTCCCGTCCAATGTCCTACT GTTATACTATATTCGCCGTTGTACTATGTCAGACCATATCTGAGCTCACAAATGTTAATTTCCAGTCAATCCCT CTCTCCCCAGAATGACCTAATTGGCCAGAGTCTGTTTGATTACCTGCATCCTAAAGACATCGCCAAAGTCAAGG AGCAACTGTCGTCATCGGATACAGCACCCCGAGAGCGACTCATCGACGCCAAAAGTAAACTCCCTCCTGGGGGG GGGGGGGGTCTTAAATACATTATTAATGCTTCATGTCTTAGTAGATACTGAATGTAAATACTGCTTTGTGCCTT ATGGTAATAATATTGTGAATTGTTTTTAGATACTACTGCACTGTTAGCGCTAGGAACACAAGCATTTCGCTACA CCCGCAATAACATCTTCTAAATATGTGTATATGACCAATACAATGTGATTTGATGCCAGTTGCCAAAATACTGG CAGTTTACCTGCTATATTATGTGTGTAAACAGCATGATTTATGTTGCACCGTAAATGTATAGACCATGTACCTT ATAAGAGTAGAATGCTTTTAACATTGTATGCAAGTTATTTCTAAAGCTATTGTGGATGATTAGCCCACAATGTT GAGCAGTGGTCTTATACGATTTGATTGTTCTCCCCCAGCTGGCCTGCCAGTGAAGACTGACATTACCCCTGGGC CGTCTAGACTGTGCTCCGGAGCCAGACGTTCTTTCTTCTGCCGTATGAAATGTAACCGGCCCTACGTCAAAACG GAGGACAAGGACTTCCCCTCCACCTGCTCAAAAAAGAAAGGTTCCTATCTCAAGATCTAGGCCTCCTATCCTGC TATCTTTATTTTGTTTACTCAGAAACCTGGCATCACCGATCATTAGCATCATGCTAGCATTACAATGAGAGCAC

127

AGGATGTATGCTACTGTGTACCAAATGGCTAAACAATATGCTTATTGTTGAACTAAATATTATTTTATTTTATT TCACCTTTATTTAACCAGGTAGGCTAGTTGAGAACAAGTTCTCATTTACAACTGCGACCTGGCCAAGATAAAGC AAAGCAGTGCGACACAAACAACAACACTGAGTTACACATGGAATAAATAAACATAGTCAATAACACAATAGGAA GGGGGGAAAAGGCCGTAGTGCAGGCAAGAAATATTGATGTGCTGCGATTTAAAACCATTTAGTAAGAAAAGCTG CGTAGGTCATGCAAAACAGAATGCAAATCTCCAGTTGAGCTCTCGCTGAATATTCTAGTGCTAATTAATATTTT ATCTAGGAAAACGTTCTCTCTTTGATTGACCGTTGATTCAGATACAGGCTAGTATTACTTGTTTGCTTAACTTG TGGTTTTCTCATTAAATCAGTCATTTAACGCTTGACCTTAAGTCATGGCCCACCGATGTAAACCGATGGATAAC TTACCATTGTGTGGGAGGAAATCTTTTTATAATGGTTATTTTTTACCTTCAGCTGACCGCAAGAGCTTCTGCAC GATCCACAGTACTGGCTACCTGAAGAGCTGGCCGCCCAACAAGATGGGTTTGGACGATGACAACGAGCCCGACA ACGAGCCCGACAACGAGGGCTGTAACCTCAGCTGCCTGGTGGCCATCGGCCGGCTGCACCCCCACATCATCCCC CAGCCCTCCCATGAGGACATCCTCGTCAAACCCACCGAATACGTCTCCCGCCACGCCATCGACGGGAAGTTCGT CTTTGTTGACCAGAGGTACGATGATAAAGCGTATGCCTTAATTTTACTATGACATTTTTGGTTTATGATTATAT GTGTGCTAGTCATTCATCAAGTTGGCCAATGAAACACACATTTTAGAAGTATGGTTTAAACTAATACTTGAAGA GGCAACAAATCATATGTAAATTCTCATCTTCAACCACCGTTCACCCAAAATAGCCCATCTACACCAGCCTACCG ACATGGGCTTGTCAAGGGAGGTTCAGCCTCACTATATTTGATGAATTAATCTCCTGCTAACAGCTTGACACCTC ACAGGCCATTATTACTCATGATGAAGGGTAATCAAACTTTCATAAAAATGTCAGTGAACTGATTCATGTTCATA GAAAACGCTCCGGTGACATTTTTAAAGACTTGTCAAAAACAATTAGAAAAGCACAGAGTTTCTTATCTATCTTC TCTATTCAGGGCCACAGCCATTCTTGCGTATTTACCCCAGGAGCTTCTAGGCACCTCCTTCTACGAGTATTTTC ATCAAGATGATATTGGTCACCTGGCAGAATGTCACAGACAAGGTATGGGATCAACTGTCCGGCACGACACATTT CTTTGTGATTTACATCTTACTATATTTAGTCACCACATTTTGTTTTCTGAACTTACATCCGGGGTATCTTGTTT CACAGTGCTGCAAATGAGAGAAAAGATCAACACAAACTGTTACAAGTTCAAGATTAAAGATGGCTCCTTCATCA CGCTGAGAAGCTGCTGGTTTAGTTTCATGAATCCCTGGACAAAAGAGGTGGAGTACATTGTCTCCACAAACACA GTGGTCTCGTAAGTCGCCCTTCTCTCTCTATCCTAGCTATGAAGTTTACATGGGAAGGAATACTGTAGATATTT GAAGTGGTGCTTCATTGATTGTTGTAGAGCTAACTGGTAGTGTTTATTCAGTGGATGTACTGTTTTAGCGCTTG AAACACTGGTCCTGATGTTGCTGTCTGAATGCTCCTCTAGATGCAGTATGCTAGACGGTGCAGACCCCTATCCT CAGTCTGCTGCTTCCCCCACAGCCTCTATGGACAGTGTGCTGACGTCAGAAGGTGAAATTGAATGTTGTAAAAG AAAGCATGCTTTTCTACATATGAAGGAGATGTCAGCTGATTCTCTCTGTACACCAACATACAACTATAATGAAT AGCTTTCTTTTTGATAATATAGTGTGTCTGTGTTTCAAAATTCTAAAGCATCCGTTGAGATCTCGCAACAAGAC TCGGTATAGAAGCATTGGACCAAATGTGAAAATGCAATGTTCTCAGTCAGTCCAGGAGCAGGCAATGTGATTGT CATATGTGTGATTGCAGGTGGAGGGAGACGGGCTATTCAGACGGTGCCAGGCATCCCTGGCGGAACACGGGCAG GTGCCGGCAAGATCGGCCGTATGATCGCAGAGGAGGTGATGGAGATTCAGAGGTGAGAAATGGAGAGAGTTTAG GCAGAAAATGGATGACGCCTTCTTAATAGTTGCAGAACCATTTTAAAACAACAGAGACCATAAAGCCTCTCGTT CGGTTATAACTTTTCTCTACTCGTCTCCCTGCTCTCAGGTATCGATACACCCTTCATCAAAAATGTACAGGCTT GCAAATGAATCTGTTCAGTTAGGCTACGTCAGCTGTGATGAATTACCTGGAGCTGAAGGTGTTTTAGATGATTA TCTCACAGAACCCTGGTGTAACGGTATTGTCTGTTCTTCTCTCTAACAGGACCAGAGGCTCAACACCCTCTAGC TGTGGCTCCAGCCCCCTGAACATCAGCACCCCCCCTCCAGACTGCTCTCCAGGGAGCAAGAGGGTGAGTCTAAG GGAGACTCACAATAAGAACCTCCAATAGAACTGTCTGGCACAAGAAATTGATACATTGCTCGCATCGCTGATTG GATGTTGTGCTGATCCACTATTGTCTGTTGGGTACTTGAAGTCAGGCATCTGTCCTGTGGCTGAAAGCTGGTCT TACATCTAGACCTGCACTGACCTATTTTGTTCTTGCAGATTCAAAATGGTGGGACACCAGACCTTCCGTCGGCA GGAACACTACCAGGAGGACCTGACTCCATTGGATACCCATACTCCAACCAGTCCATTATGAGTAAGTAACCATG CCCACAATTTTCAACAAATGTTCCAAACACTAATATTACAAACACGGAATCCTCCCCATTTCAAGTGATGTGTA GTATTTGTGCAGGGAAAATCTAAACTGTACAGTATCAAAAACCAGTCATGTAACTGACTACAGTGTTTTCCCTC ACCACCCCTGTAGGTGACAACTCTCATCTCAGCATTGACATCATGGACGAGCCAGGCTCCAGCAGCCCCAGTAA CGATGAGGCAGCCAT

128

>kiss1r CCAGTGTGAGGGCAGGCAGATGTAAAATACTTGTTTCACCTGCAAACAGCCAAGATTATTTTGTTACTTTCTTT TCTCAGGTGACTGTTCAAGCCACCTGCATTACACTCACTGCTATGAGTGGGGACCGCTGCTATGTCACAGTCTA CCCCCTGAAGTCCTTACGCCATCGCACTACACGAGTCGCCATGGTAGTTAGCATCTGCATATGGATCGGTAAGT CAGATGCTACCCTACCTGAACTTATAGCAAACCATGGATTTTTGGTTCAACGCATTGTGAACACTAACATTTTC TACAAAATTCAACTAATGAAATGTTGTTTTTTAAAGGTTCCTTCATTCTATCCACCCCGATTTTCATGTACCAG AGAATTGAGGAGGGCTACTGGTATGGACCAAGACACTACTGCATGGAGAGGTTTCCCTCAAAGACCCAGGAGAG GGCTTTCATCCTGTACCAGTTCATAGCTGCCTACCTACTACCTGTCATCACCATCTCCTTCTGCTACACACTCA TGCTGAAGAGGGTGGGCCAGCCGTCAGTGGAACCAGTAGACAATAATTACCAGGTATGGAAAGAACATTACTTT GGGTGTTCCTTTATGACAGTTTACAACTTTAATAGGTGCACTCCTTTGTCAAGGTTACACAATGAAAGCATGAG TTCATATTTGGATCCCTTCCAATTTTCAGGTATTCTACAGTATGTTCATATAGACCCTTAGCCTGTGGCCATGA TTTGAACTACATACAGTTTAGGTCATTTCTAAGCCCATCACAGTGGTAGTGAGGTAACTTAACATTTCTACCAC AGGTCCACCTGTTGTCTGAGAGGACTGTCACTCTGAGGAGTAAGATCTCCAAGATGGTGGTGGTGATTGTCCTG CTATTCACCATCTGCTGGGGGCCTATCCAGCTCTTCGCCCTGTTCCAGTCCTTCTACCCCAACTACAGGGTCAA CTACGCCACCTATAAGATCAAGACCTGGGCTAACTGCATGTCCTACGCTAACTCCTCCATCAACCCAATCGTTT ACGGCTTCATGGGAGCCAGTTTCCGCAAGTCTTTCAAGAAGACTTTCCCCTTCTGTTTGAACAGAAGGGGAAAG ACAGCAGTGTCATGTCACGCGTGGCTAAT

129

>Clock1a CAGAAGAGCATCGACTTCCTACGCAAGCATAAAGGTAAAGACCTCTCCTCCTAGCCCTCGGAAATCAACATGTC TGGAAGAATAGGAACATTTCTGTGTTTTTACCAAGCTGTCTGAGTATTTAACATCAGTAACTCCCCCATCTGTG TTTCTGTCAGAAATAGCTGCGCAGTCAGAGTCGAGTGAGATCCGACAGGACTGGAAACCTCCTTTTCTTAGTAA TGAAGAGTTCACACAGCTGATGCTGGAGGTCAGTGGCACTTGACACACTAAAGTACAGTAGTTTGCACATCCTT TCACTAAGAAGTATCCTGAAAGAAAGGATGTCAGTCCAAGGATATCAGTAGCAACATTCTGTACTGTTTTTGTA GTTAACTGAAGAAGGTTGACAACGAAACGTCTGTGAATTTTTTTCCCTGCCTGCTGTGTAAGCAAGAAAACCCC CCCACCCTTTTTGGTTTAACGCACCAAGGACTATTCAAGTTCAAGGTTGAGCGCAATGGTACCTGTTTTCTACA TAGTTCACTTTCTCACATTCTATTTTGCAAGTAGATGGTGTTTTAACACACTGTTTTGTATCTGCTAGGCATTA GACGGCTTCTTCCTAGCAATTATGACAGATGGGAACATAATCTATGTCTCAGAGAGTGTTACATCTCTACTGGA ACATCTTCCTGTAAGTATTCACTCCATGCATATACATGAGTTAATGCCTACAGTATGTGAGGTTGACATCCATG ACCAAGGATGACATACATGTGTGTGTTGGTTTCAGTCTGACCTGGTGGATCAGAACCTGTTGAACTTCCTGCCC CTGGGGGAACATTCAGACGTGTATAAAGCCCTGTCGTCTCACATACTGGAGGGAGAGACGCTAACGCCAGAGTA TCTCAAGAGTAAGTACTGGAGTTGTTTCAGTATTGTCTAGTAGTTTCTATCATGTTCATGGTCTAAATGGCCTA TGTCAAGTTTTGGCCACAGCATGCCATGAGTAGATGATTTGTTTCAGAACTAGATGAGTTTATTTAAACCAAGT CTATCAAATTGTACTCTGCTTTATTGTATGATTTAATTTGTTTTCAGCGAAAAACCAGTTAGAATTCTGTTGCC ACATGCTCCGAGGGACGATCGACCCCAAAGAGCCTCCTGTGTATGAGTATGTTAAGTTCATCGGAAACTTCAAG TCCCTGAATAATGGTAAGTTTTCATTATATTGATTTAGGAAAAATTTGACTTTGAATGTAGTACACAAGTAGCT GGCCTGTATTTGGTTTGTGACCATAAATGCACTTAGACCGACCAAAAGGCAACAATTACTAATTTTCCCTTTCT CCTATAGTGCCTAACTCAACTCGAAATGGCTTGGAAGGGGTGATCCAGCGGTCACTCCGGCCCGCTTTTGAGGA CCGAGTCTGTTTCATAGCAACTGTGAGATTAGCCAAACCACAGTTTATCAAGGTAAAACAATTGGAATTCTAGA GACTTATATATCACAGACTGCATATTTCGTTAGCTAGGTAACCAAATATGTCTAATGTTGTACTGTAAAGTGTT CTTAGTAGGAGCACTGTAAATTATTTTCTTTGTATGAGATGTAAACATCTAGTTTTTCTTAATTCACCCCACAG GAGATGTGCACTGTTGAAGAACCCAATGAAGAATTCACCTCTAGACACAGCTTAGAATGGAAGTTCCTCTTCTT GGACCACAGGTAATGTGTGCTGTCTATATCCATGTCTGTGTGTGTGCTTACTTGCCTATGTCATGCAAGAGAGA GTTAGCCTCTAGCTGTGTGAGACTCAGCACATCAGTCAGAACACAGACCCAGTGAGAGTGTGTTTGGGTTAACT CTGTTAGCTGGCTGCTATGTTCTATATCTGGGCCAGTCAGTCGGCTTGCTCTCTAGAGGAAACAGCTCTGAGTC TCAACCGTTTAGGAGCAACAGCACTAGATGGAGTACTTAGTGTTTCACTGCTACTGAAAACCTTGATTATATGG ACCTTTGTAGACACTATGTCCAGAGGTTAATACAATGCTTTGTATGGGGTTTTAATGTGTCATTACTGCTTAAA AGGCTGAGAAACTGTATATCATTGTATTTAAATGGGTTATGCTGTCAAATTAATAACATTGCTTGTTTATCTCC CCAGGGCTCCGCCCATAATAGGTTACCTGCCGTTTGAGGTTCTGGGTACATCTGGATATGACTACTACCACGTA GATGACCTGGAGACACTGGCCAAATGCCACGAACACTGTGAGTCATATTTTTTTTGTCGTATTTGTGTATTTTG TAAGTGCACATTTTATGAGTGTGTTTGTGTTTTACTGTCCCATGTACAGATCTGTGACATCATCTCTCTCCTCT CTCTCTCTCTTGCTGCATTCTGCAGTAATGCAGTATGGGAAGGGGAAATCGTGCTACTACAGGTTTCTCACCAA AGGTCAACAGTGGATCTGGCTCCAAACCCATTACTACATCACCTACCACCAGTGGAACTCCAGGCCCGAGTTCA TCGTCTGCACGCACACTGTCGTCAGGTGAAGATCGACTAAGCACTAAAAAGGATATTCATATGCATATCTCGCA ACAAGTATCAATGTGTCAGTCATACTACATATAACCAGCAGTATTGCATTGACATCCTAAACACTATCACATAC ACCACCATCGGGCATGGTGTTCAACACTGTCTCTCTCTTGTGGAGCAGCTATGCTGAGGTGAGGGCTGAACAGC GCAGAGAGCTGGGGATTGTTGAGGAGTCACCGCCAGAGATCTCTGCAGTAGATAAGGTGAGACACTTATAAGAC CAATGTGAGAACTTGCTGACCACTGACCATAAGAAATCACTGAGCAGGAATAAAGAGATGGCTGAGTTTGGTTA ATGAGGTCTTGTTCAGTTTAAGGGATACGATGTCTCACTGTCTGTGACTCTCACTGGAGTAAGACATGGTTAAG TGCTCAGACAACAAGGAGGATGTGAAAACATCTTTGGTGAGCAAACAGTGGGGTTATGGGTTTTGAATGCGTCC TTCAATCCCAGTAGTACGATCCTTCTTTTCACCAATCCAACTGTGTTAGATCAGTGATTACCTCATGCAAGGGA GGAAGGAAGGATGTATTTCCCAAGTGTTCTAACAAGGCTTGGGAGTTCTAGTAGTGAGTCTCTACTGACTGTTC TCTCTGCTCTCTCATCTCACAGCAGTCTCAGGACTCTGGTTCTGAGTCTCAACACCAGCTCAACACCTCCAGTC TGAAGGAGGCCCTAGATGGCTTTGACCGCAGCCGGACGCCCTCGGCCTCCTCACACAGCTCCCGCAAGTCCTCG TCCCACACTGCCATCTCCAACCCAGCCTGTAAGCGCTGACCACATGACGTTACTACATCCATCTTGTCTAATAT

130

GATGTCATCTGTCCTGAGAGCTTCTTTGATCCTAAGAGTAAGGTGTTTGTTTTTTCCTTCTCAGCACCTAAGCT TAAGACAGACAGGGGTACACCGGGATGCCAGTCCGTCTCTGCTATTGAGATGACATCACAGCGAAGATCATCCA TCAGCAGTCAGGTCAGAGTGGGTTTCTTTCAGCTTGCGGTCAAGCCTCTCTCTATATTTGATAGTGATTTGGTT CCTAATGTAGTTCCTGTGCTTGTATCCAACAGCAATCGATGAGCTCCCAGCACACCCAGAACACAGGGCAGAAC ATGACCCCGTCCATGGTTCCACAACAACAACCGCAGCAACAACAACAACTGCAACAGCAGCAACCACCACCTCA ACAGCAGCAGCTTCAGATCCAGCCCAGTGTCCAGGTGAGAAATCTTCCTCATGATTGTAATTTGGCAGTTTCTT TTGCTAGAGTCAGTGACACAGAAACTCAACAACAGCAAAAATTGTCCTCTCACTATCAACTGCGTTTATTTTCA GCAAACTTAACATGTGTAAATGTTTGTATGAACATAACAATATTCAACAACTGAGACATACACTGTCACTAACA GAAATTTAATAATGTGTCCCTGAACAAAGGGGGGGTCAAAAGTAACAGTCAGTATCTGGTGTGGCCACCAGCTG CATTAAGTACTGCAGTGCATCTCCTCCTCATGGACAGCACCAGATTTGCCAGGTCTTGCTGTGAGATGTTACCC CACTCTTCCACCAAGACAACTGCAAGTTCCCAGACATTTCTGGGGGGAATGGCCCTAGCCCTCGCCCTCCGATC CAACAGGTCCCAGACGTGCTCAATGGGATTGAGATCCGGGCTCTTTGCTGGCCATGGCAGAACACTGACATTCC TGTCTTGCAGGAAATCATGCACAGAATGAGCCGTGTGGTTGGTGGCATTGTCATGCTGGAGGGTCATATCAGTA TGAGCCTGCAGGAAGGGTACCACATGAGGGAGGAGGATGTCTTCCCTGTAACGCACAGCGTTGAGAATGTCTGC TCTGCAATGACAACAAGCTCAGTCCGAGGATGCTGTGACACACCGCCCCAGACCACGACGGACCCTCCACCTCC AAATCGATCCCGCTCCAGAGTACAGGCCTCGGTGTAACGCGCATTCCTTCGAAGATAAACACGAATCCGACCAT CACCCTGGTGAGACAAAACCGCGACTCGTCAGTGAAGAGCACTTTTTGCCAGTCCTATCTGGGCCAGTGACGGT GGGTTTGTGCCCACAGGCGACATTGTTGCCGGTGATTTCTGATGAGGACCTGCCTTACAACAGGCCTACAAGCC CTCAGTCCAGCCTCTCTCAGCCTATTGCGAACAGTCTGAGCACTGATGGAGGGATTGTGCGTTCCTGGTGTAAC TCGGGCAGTTGTTGTTGCCATCCTGTACCTGTCCCGCAGGTGTGATGTTCGAATGTATCGCTCCTGTGCAGGAG TTGTTACACGTGGTTCTGCCACTGCGAGGATGATCAGCTGTCCGTCCTGTCTCCCTGTAGCGCTGTCTTAGGCG TCTCACAGTACGGACATTGCAATTTATTGCTCTGGCTACATCTGCAGTCCTCATGCCTCCTTGCAGCATGCCTA AGGCATGATGAGCAGGGACCCTGGGCATCTTTCTTTTGGTGTTTTTCAGAGTCAGTAGAAAGGCCTCTTTAGTG TCCTAGGTTTTCATAACTGTGACCTTAATTGCCTACCGTCTGTAAGCTGTTAGTGTCTTAACAACCGTTCCACA GGTGCATGTTCGTTAATTGTTTATGGTTCATTGAACAAGCATGGGAAACAGTGTTTAAACCCTTTACAATGAAG ATCTATGAAGTTATTTGGATTTTTACGAATTATCTTTGAAAGACAGTTAACTTTGTTAGCCCATGGTACAGTTT TCCACCCAGCTGGACGCAATGCAGCACCTGAAGGATCAGCTGGAGCAGAGGACCAGGATGATCGAGGCCAACAT CCAGAGGCAGCAGCAGGAGCTCAGGCAGATCCAGGAAGAGCTCAACAAGGTGCAGGGCCATGGCCTACAGGTGA GCACTGCCCCCTAATGTCTGTCTGGGGAATAGCGCTATTGGGCCTCATATACTAACCACCTGCCCTCTTATGTA GAACTGTGTGAGTACTTGAACCAAAATGTCTGCACATTTGCGTGGATGCATGCATCTGTCATTATGCCTGTGTT TGTCTATGAAAGGAGATTCGTCTTACTCTGTGGTATTTGCTCTGGTGCAGATGTTTCTCCAGCCGGGTACAAGT GGGCTGAGCCTGGGCTCTGTGCAGCTGGCACACGGGACCACCATGCAGCCAGGGGGTGCTCTCACCATGCATGG CCAAGTGGTGTCTGCAGGCAGTCTGCAGGGCAGCACTCCACAGCAGCATACGGTCCAACAACAACCCCAGCAGC AGTCCCAGCCCCAACAACAGAACCTGTTACGAGACACCAGCTCTGTCCTCTCACAGTCTTCAGTGCGGTCGACC CACTCTCTGCCGCCCCAGCAGAGTGCCCTGCCGGCTTCCCTCTACAACACCATGATGATCTCTCAGCCCAACCA GGCCAATGTGGTCCAGATCGCTACCAACTTGGCCCAGAACAGCAGCAACAACACAGCTGCCATGGCAAACTTTG CCCAGGACCGCTCGGGACAGATCAGGTACACGATGCCACCAACAGGGTATGTTCTCCTCTCACTCGGTATGCGC CACACTCAGTGGCTGATGTTACTGAGAAATATGCTGATTATCCACAGGATTTGCATACATTTTCATGTGTCTGT TTTAAAAAATCTGTTGCTCATTCATTACCACCCTCACTCCCTCATCTCTCTCAGGTTCCCTGCTGGCTCTCAGT TGCTGACTAAGCTGGTGACTGGGCCGATGGCGTGTGGAGCGGT

131

>Kiss2 ttggattttgacagaATGAGAATGCTGGCATTTTTCCTTGTTTGTGCAATAACTCGCCAGTATGGAACATGGGG AACTCCAACGCATGGATTTGGGTGGACAGATATCCCAGGTAATTTCTTGATTTGATATATTCTAATTACTTTTG GATTTCTTACAGGTTCATTTTCTTCTCATAATGTCCTGAGCCCAAACGTTGTAATATCCAAAAGTAATAAGCTA AGAAAATTCGGTTTTATCATTTGATGCTCTCTCTTTTCTCTCAGGACAAACACCTGCTAAGGTGCAAGTGGGGC ACTCTGTGGTGAGGAGAAGCGAGATTGTCAGTCCGAATTTACCTGGCGATGCGAACCTTTGTTACCTTTTGAAA GATGAAGACCAGCAACAAATGATCTGCAAACATCGTTTAACTCGGACCAGCAAATTCAACGTCAACCCGTTTGG GCTCCGATTTGGAAAGCGCGACAAATTTGACCCATCCAAGGCCAGCCTCATAAGATCCAGGACAAGCAAACTGT TGCCTATTCTACTGTACCTCCGAGAACTAGAAGTTCCTGCCTAAATTGACACGCATTTTCTCTTCCCAAGAAGG AACCAATATTTAAACAACGGAGACTGTCAATTTCTTAATGTTGTAGCAGTTATAGCAGCGTCGTTATAGCGCGT CACTCATGAGGTAAAGAATGTGTGTGTCATATTGTCTACTTGTAAGTTGGG

132

>Clock1b GTCCGTCTCTGCTATTGAGATGACATCACAGCGAAGGTCGTCTGTCAGCAGTCAGGTCAGTGTGGGCTTT CTTCCGCTTGCGGTCACCGCATCTTTATTTTTGATAGTAATCTGGTTCATAATGTAGTTCCTGTTTTTGT CTCCAACAGCAATCAATGAGCTCCCAGCACACCCAGAATACAGGGCAGAACATGGCCCCTTCCATTGTTT CACAACAACATCATCAACAGCAGAGGCAGCAGCAACCACAACCCCCACGGCAACAGCAGCAACCACCACC ACAACAGCAGCAACCACCACCACAACAGCAGCAACCACCACCACAACAGCAGCAACCACCACCACAACAG CAGCAGCAACCGCCACAAGAGCAGCAACTGCCACAACAGCAGCATCTGCCGATCCTGTCCAGTGTCCAGG TGAGAAATCTCTCGCAGGACTGTAATTTCGCAGTGTCAGTGACAGAAATGTTCAATTATAATGAGCCATC CACAAACATCCCTTATTTTTCATATTTGCTAGCCCATGGTACCGTTCTCCACCCAGCTGGATGCCATGCA GCACCTGAAGGATCAGCTAGAGCAGAGGACCAGGAGGATTGAGGCCAACATCCAGAGGCAGCAGCAAGAG CTCAGGCAGATCCAGGAGGAGCTCCAGAAGGTGCAGGGCCAGGGCCTACAGGTTAGCACTGCCCCCTGCT GTCTGTCTCGGGAACAGCACTATAAGGGCCCCATATATTGACCATGGCCCTCTTATGTAGAGCTGGGAAA GGGTACTTGAACCAAAATGTCTGCTTACATTTGTGTGGATGCATGCATGTGTCATGCCTGTGTTTTTCTA TGTAAGAAGAGTCTTACCATGTGGTATTTTCTCTGGTGCAGATGTTCCTCCAACAGGGTGCAGGTGGGCT GAGCCTGAGCTCTGTGCAGCTGGCCCAGGGGACCACCATGCAGCCAGGTGGCGCTCTCAACATGCAGGGT CAGGTGGTGTCTGCAGGCAACCTGCAGGGCAGTACTCAGCAGCAGCACACGGTTCAACGGCAACCTCAGC AGCAGGCCCAGCCTCAACAACAGAACCTGCTACAAGACACCAGCTCTGTCCTCTCACAGTCTTTTGTGAG GTCGACTCACTCTCTGCCGCCCCAGCAGAGTGCCCTGCCGGCCTCCCTCTACAACACCATGATGATCTCT CAACCCAACCAGGCCAATGTGGTCCAGATAGCCAACAGCCTGGCCCAGAACAGCAGCAACAACACTGCTA CTGTGGCAACCTTTGCCCAGGACCGCTCGGGACAGATCAGGTACATGATGCCATTAACAGGGTTTATTCT CCTCTCACTCAGCAGCTGATTGTTGCTGAGAACTATAATGATTATCCAAGGGATTTGCATACATTTTTTG TGTGTGGTTCTTATGTTGCTAATTTATTGCCACCCTCTCTCCCTCATCTCTCTCAGGTTCCCAGCTGGCT CTCAGTTGCTGACTAAGCTGGTGACT

133

Supplementary Table 4.1 Variants from candidate genes detected in each fish (12 early spawners, 12 late spawners). For each gene, the variants position relative to the reference sequence (bp) and reference nucleotide is given. The coverage (number of reads aligning to the variant position), quality score and allele frequencies (The presence of nucleotides A, C, G or T, and deletions or insertions given as percentage of reads) are given for each variant. The mutation is described in the last column as either a SNP, deletion (del) or insertion (ins).

Early 1 Ref. Ref. Gene Seq. Coverage Score A % C % G % T % Ins % Del % Mutation Call Nucl. Position dec1 1362 G 6620 30.4 44.49 0.11 55.35 0.06 0 0 G>AG dec1 1535 G 6884 27.5 44.9 0.01 55 0.09 0 0 G>AG Eed 279 T 1510 24.5 0.07 0 0 20.4 0 79.54 delT Eed 629 T 2310 26.2 0.04 81.26 0.09 18.61 0 0 T>C Eed 899 A 2667 22.6 66.52 33.37 0 0.11 0 0 A>AC Eed 1652 C 2536 25.5 0.08 53.55 46.14 0.2 0 0.04 C>CG Eed 1886 C 2995 21.6 34.76 65.18 0 0.07 0 0 C>AC Eed 2080 C 2762 22.7 0.11 29.18 0.04 0 0 70.67 delC Eed 2084 A 2793 21.6 28.28 0.04 71.64 0.04 0 0 A>G Eed 2157 A 3044 22.5 35.81 0 64.19 0 0 0 A>AG Eed 2178 A 3162 25.6 21.47 0.32 0.03 0 0 78.18 delAA Eed 2179 A 3211 26.3 66.21 1.21 0 0.16 0 32.42 - Eed 2455 A 2887 27.3 19.05 0.1 80.78 0.07 0 0 A>G Eed 2508 G 2948 26.2 0.34 0.03 35.85 0.03 0 63.74 delGTCAGGATACA Eed 2509 T 2949 19.6 0.34 31.3 0 4.61 0 63.75 -;T>C Eed 2510 C 2950 26.2 0 36.24 0.03 0.03 0.03 63.69 - Eed 2511 A 2937 25.9 35.99 0 0.03 0 0 63.98 - Eed 2512 G 2877 26.4 0 0 34.17 0 0 65.83 - Eed 2513 G 2883 26.4 2.53 0.1 31.77 0.07 0 65.52 - Eed 2514 A 2866 26.7 33.71 0.35 0.03 0 0 65.91 - Eed 2515 T 2855 26.7 0 0 0.04 33.7 0 66.27 - Eed 2516 A 2793 27.1 31.87 0.21 0.14 0.04 0.04 67.74 - Eed 2517 C 2799 27.2 0.32 32.01 0 0.36 0 67.31 - Eed 2518 A 2798 27.2 31.34 0 0.25 0.21 0 68.19 - Eed 2509 T 2949 19.6 0.34 31.3 0 4.61 0 63.75 -;T>C Eed 2513 G 2883 26.4 2.53 0.1 31.77 0.07 0 65.52 - Eed 2530 A 3064 17.3 98.24 0.1 0.13 0.65 61.36 0.88 insA

134

Early 1 Ref. Ref. Gene Seq. Coverage Score A % C % G % T % Ins % Del % Mutation Call Nucl. Position Eed 2531 C 3060 18.2 63.69 35.07 0.03 0.33 0.13 0.88 C>AC Eed 2538 C 3124 21 0.1 39.63 0.1 59.28 0 0.9 C>CT Eed 2585 G 3012 27.5 35.59 0.03 64.31 0.03 0 0.03 G>AG Eed 2597 T 2935 26.5 0.07 0 64.94 34.99 0 0 T>GT Eed 2610 T 2787 26.7 0.11 35.27 0.18 64.44 0 0 T>CT Eed 2629 A 2541 25.1 34.08 0.04 65.76 0.12 0 0 A>AG Eed 2648 T 2379 26.1 0.13 34.51 0.08 65.28 0 0 T>CT Eed 2688 G 2632 23.9 39.97 0.11 59.84 0.08 0 0 G>AG Eed 2703 G 2791 26.4 40.59 0.29 58.44 0.68 0 0 G>AG Eed 2768 T 2818 24.6 44.11 0.11 0.11 55.68 0 0 T>AT Eed 2855 C 2897 21.4 0.07 63.27 0.14 36.52 0 0 C>CT Eed 3028 T 2606 21.4 0.04 44.74 0 55.22 0 0 T>CT Eed 3236 T 2860 25 0 62.2 0.14 37.66 0 0 T>CT Eed 3249 A 2854 24.5 62.3 0.14 37.53 0.04 0 0 A>AG Eed 3370 A 2571 23.8 18.98 0.08 80.82 0.08 0.04 0.04 A>G Eed 3469 T 3385 27.8 0.92 40.03 0.56 57.99 0 0.5 T>CT Eed 3548 A 2817 23.6 16.51 0.11 82.89 0.14 0.04 0.35 A>G Eed 3588 A 2596 25.6 68.57 0 0.19 30.86 0 0.39 A>AT Eed 3610 C 2526 26.3 0.08 68.29 0 31.43 0 0.2 C>CT Eed 3759 T 2740 22.4 0.07 0.04 35.26 64.64 0 0 T>GT Eed 4041 A 2567 24.7 55.43 0.04 44.49 0.04 0 0 A>AG Eed 4127 A 2987 25.1 100 0 0 0 0 0 G>A Eed 4148 T 2898 25.9 0.07 0.07 35.47 64.39 0 0 T>GT Eed 4161 A 2830 25.9 62.61 0.07 36.89 0.42 0.11 0 A>AG Eed 4162 T 2828 27.3 0 0.07 0.04 99.86 35.18 0.04 insT Eed 4185 A 2743 26 36.38 0.04 63.51 0.07 0 0 A>AG Eed 4219 A 2508 25.9 18.42 0 81.46 0.12 0 0 A>G Eed 4222 T 2590 20.7 0 0.04 53.44 46.1 0 0.42 T>GT Eed 4224 G 2575 20.4 53.09 0.19 46.56 0.16 0 0 G>AG Eed 4249 T 2608 25.6 0.08 45.13 0.08 54.72 0 0 T>CT Eed 4274 T 2759 26.8 0.07 81.73 0.04 18.16 0 0 T>C Eed 4363 A 2629 26.2 51.31 0.04 48.54 0.11 0 0 A>AG Eed 4556 A 3050 23.6 52.82 0.1 46.98 0.1 0 0 A>AG Eed 4593 G 3274 22.7 46.7 0.06 53.12 0.12 0 0 G>AG Eed 4602 A 3197 22.4 46.29 0.06 0.03 53.58 0 0.03 A>AT Eed 4603 C 3213 27.6 80.21 19.7 0.03 0.03 0 0.03 C>A Eed 4648 T 3145 25.9 0.03 47.09 0.03 52.85 0 0 T>CT Eed 4649 A 3146 25.9 52.89 47.01 0.03 0.06 0 0 A>AC Eed 4673 T 2972 24 0.03 0.47 0.1 54.37 0 45.02 delTTAA

135

Early 1 Ref. Ref. Gene Seq. Coverage Score A % C % G % T % Ins % Del % Mutation Call Nucl. Position Eed 4674 T 2973 24 0.03 0.5 0.27 54.46 0 44.74 - Eed 4675 A 2971 19.5 54.63 0.44 0.2 0.03 0 44.7 - Eed 4676 A 2957 19.5 54.62 0.03 0.54 0 0 44.81 - Eed 4678 A 3017 20.4 56.31 0.1 0.13 0.03 0 43.42 delAGTTA Eed 4679 G 3020 20 0.7 0 55.5 0 0 43.81 - Eed 4680 T 3021 20 0.63 0.13 0.07 55.11 0 44.06 - Eed 4681 T 3026 19.7 0.03 0.03 1.16 54.79 0 43.99 - Eed 4682 A 3046 20 55.12 0 1.28 0 0 43.6 - Eed 4685 C 3032 20.4 0.16 54.85 0.03 0.07 0 44.89 delCTCCCA Eed 4686 T 3007 20.4 0.1 0.13 0.1 54.41 0 45.26 - Eed 4687 C 3021 25.5 0.07 54.78 0.03 0.07 0 45.05 - Eed 4688 C 2988 25.7 0.07 54.95 0 0 0 44.98 - Eed 4689 C 3003 25.4 0.03 54.55 0 0.1 0 45.32 - Eed 4690 A 2982 25.4 54.23 0.1 0.03 0 0 45.64 - Eed 4704 C 2812 21.9 0.07 53.52 46.41 0 0 0 C>CG Eed 4791 T 2736 24.4 0.15 42.11 0.04 57.71 0 0 T>CT Eed 4824 T 2740 22.7 0 0 48.39 51.61 0 0 T>GT Eed 4923 T 2745 25.1 46.08 0.22 0.18 53.52 0 0 T>AT Eed 4930 A 2763 26.3 56.57 0 0.04 43.39 0 0 A>AT Eed 5074 A 2419 26.9 7.61 0.04 0 0 0.83 92.35 delAA Eed 5075 A 2423 26.4 49.69 0 0.04 0 0 50.27 - Eed 5107 C 2359 26.3 0.34 48.54 0.13 51 0 0 C>CT Eed 5138 T 2219 25.8 0.09 47.68 0.18 52.05 0 0 T>CT Eed 5140 G 2212 25.6 0.05 0.09 52.49 47.38 0 0 G>GT GnRH3B 353 A 3645 27.8 49.05 0.03 50.89 0.03 0 0 A>AG G0S2 180 A 706 22.5 52.41 0 0 0 0 47.59 delATAGTGAT G0S2 181 T 710 22.5 0 0 0 52.68 0 47.32 - G0S2 182 A 712 22.5 52.81 0 0 0 0 47.19 - G0S2 183 G 734 22.9 0 0 54.22 0 0 45.78 - G0S2 184 T 741 22.9 0.13 0.13 0 54.39 0 45.34 - G0S2 185 G 748 22.9 0 0 55.08 0 0 44.92 - G0S2 186 A 757 23 54.95 0 0.66 0.13 0 44.25 - G0S2 187 T 766 23 0 0 1.04 55.22 0 43.73 - G0S2 1157 G 2536 25.5 0.04 0.12 51.62 48.23 0 0 G>GT G0S2 1359 A 2515 26.8 53.16 0.12 0.12 46.6 0 0 A>AT G0S2 1426 C 2511 24.9 0.08 53.48 0 46.44 0 0 C>CT G0S2 1519 G 2654 26.2 46.08 0 53.84 0.08 0 0 G>AG G0S2 2424 A 2866 25.9 50.91 49.09 0 0 0 0 A>AC G0S2 2427 T 2853 25.6 0.07 49.07 0.04 50.82 0 0 T>CT

136

Early 1 Ref. Ref. Gene Seq. Coverage Score A % C % G % T % Ins % Del % Mutation Call Nucl. Position G0S2 2476 T 2668 27 0 0 48.76 51.24 0 0 T>GT G0S2 2512 G 2636 25 48.41 0 51.59 0 0 0 G>AG G0S2 2535 G 2786 27.2 49.21 0.11 50.65 0.04 0 0 G>AG G0S2 2583 C 2768 27.1 0.07 50.58 0.04 49.31 0 0 C>CT G0S2 2628 A 2834 27 50.07 49.47 0.39 0.04 0 0.04 A>AC G0S2 2750 C 2539 24.1 0.16 50.37 0.12 49.35 0 0 C>CT G0S2 2874 A 2222 22.6 51.35 48.51 0.05 0.09 0 0 A>AC G0S2 2878 T 2165 22.8 0.05 49.28 0.14 50.53 0 0 T>CT G0S2 3969 T 1724 20.4 51.33 0.29 0.52 47.85 0 0 T>AT G0S2 3978 C 1743 19.4 2.41 49.23 0 0.4 0.06 47.96 delC G0S2 3979 C 1735 20.9 0.29 99.19 0.17 0.35 47.72 0 insT G0S2 4005 T 1749 23.5 0.06 0.06 47.23 52.66 0 0 T>GT G0S2 4112 A 1448 22.3 49.1 50.76 0.07 0.07 0 0 A>AC G0S2 4420 A 1698 25.5 50.29 0.12 0.24 0 0 49.35 delATGACGGTC G0S2 4421 T 1690 25.5 0 0.3 0.06 50.06 0 49.59 - G0S2 4422 G 1715 25.3 0.06 0 51.02 0.12 0 48.8 - G0S2 4423 A 1718 25 51.22 0 0.06 0 0 48.72 - G0S2 4424 C 1721 25 0 51.13 0 0.17 0.06 48.69 - G0S2 4425 G 1724 25 0.23 0 51.04 0.12 0.12 48.61 - G0S2 4426 G 1725 25.1 0.06 0 51.3 0.06 0 48.58 - G0S2 4427 T 1738 25.1 0.12 0.12 0.23 51.32 0 48.22 - G0S2 4428 C 1739 25.1 0.06 51.7 0.06 0 0.12 48.19 - G0S2 4550 T 1543 23.6 0.19 47.63 0.06 52.11 0 0 T>CT G0S2 4637 T 1362 24.5 0.07 0 45.89 54.04 0 0 T>GT BMAL 396 C 1758 22.4 47.55 52.39 0 0.06 0 0 C>AC BMAL 791 C 1457 22.6 48.59 51.27 0.14 0 0 0 C>AC BMAL 1229 A 1783 24.9 52.44 0.22 0.56 0 0 46.78 delA BMAL 1261 A 1675 24.9 49.49 0.06 50.39 0.06 0 0 A>AG BMAL 1786 A 1996 25.9 51.25 0.05 0.15 0.05 0 48.5 delAA BMAL 1787 A 2000 25.9 50.95 0.2 0.2 0.25 0 48.4 - BMAL 1808 A 2206 25.8 49.64 50.23 0.05 0.05 0 0.05 A>AC BMAL 2333 T 1809 22.7 47.54 0.17 0 52.29 0 0 T>AT BMAL 2413 T 2444 25.4 0.04 48.61 0.16 51.19 0 0 T>CT BMAL 2696 A 783 17.3 50.32 0.51 48.91 0 0 0.26 A>AG BMAL 2944 A 1906 24.6 52.15 0 47.74 0.1 0 0 A>AG BMAL 3131 G 1789 24.8 0.11 47.23 52.66 0 0 0 G>CG BMAL 3325 T 1967 22.8 0.05 48.09 0.1 51.75 0 0 T>CT BMAL 4141 C 981 21.1 0 100 0 0 0 0 A>C BMAL 4167 T 844 22.8 0.12 0.47 53.44 45.97 0 0 T>GT

137

Early 1 Ref. Ref. Gene Seq. Coverage Score A % C % G % T % Ins % Del % Mutation Call Nucl. Position BMAL 4741 A 1461 24.5 50.99 0.14 48.87 0 0 0 A>AG BMAL 4753 T 1473 24.7 0 52.07 0.07 47.86 0 0 T>CT BMAL 5353 G 1881 24.5 49.12 0 50.82 0.05 0 0 G>AG Clock1b 1400 G 34 12.2 0 0 70.59 29.41 0 0 G>GT

Early 2 Ref. Ref. Gene Seq. Coverage Score A % C % G % T % Ins % Del % Mutation Call Nucl. Position dec1 342 T 3156 27.9 37.71 0.03 0 61.57 0.06 0.7 T>AT dec1 1212 A 3194 24.6 68.94 0.09 0.38 0.03 2 30.56 delAC dec1 1213 C 3232 24.6 0.4 69.15 0.09 0.19 0.06 30.17 - dec1 2056 G 3214 27.7 41.16 0.16 58.46 0.19 0 0.03 G>AG Eed 1652 C 3180 27.4 0.16 6.51 92.89 0.44 0 0 C>G Eed 2247 A 3528 26.2 55.67 0.09 0.11 44.13 0 0 A>AT Eed 2455 A 3586 28.3 42.22 0.03 57.64 0.11 0 0 A>AG Eed 2629 A 3023 25.7 56.14 0.1 43.63 0.07 0 0.07 A>AG Eed 2688 G 3270 26.2 53.88 0.03 46.06 0.03 0.03 0 G>AG Eed 2703 G 3533 26.3 41.86 0.23 57.66 0.25 0 0 G>AG Eed 2768 T 3776 28.5 95.44 0.05 0.19 4.32 0 0 T>A Eed 2852 G 3500 23.9 48.57 0.09 51.31 0.03 0 0 G>AG Eed 3236 T 3625 26.1 0.06 43.31 0.06 56.58 0 0 T>CT Eed 3304 T 3546 27.7 48.22 0.06 0.06 51.64 0 0.03 T>AT Eed 3317 G 3417 26.5 0.03 0.15 57.48 42.35 0 0 G>GT Eed 3370 A 3311 23.8 60.07 0.09 39.66 0.18 0.03 0 A>AG Eed 3469 T 5211 28.7 0.88 40.64 0.4 57.86 0.02 0.21 T>CT Eed 3532 T 4353 27.9 0.71 38.18 0.48 60.46 0 0.16 T>CT Eed 3562 G 3902 27.8 32.27 0.21 66.56 0.21 0 0.77 G>AG Eed 3588 A 3587 28.3 60.64 0.14 0.2 38.19 0 0.84 A>AT Eed 3595 C 3616 27.5 0.22 58.13 0.11 40.76 0 0.77 C>CT Eed 4161 A 3381 26.1 47.12 0.18 52.06 0.65 0.27 0 A>AG Eed 4162 T 3380 27.6 0 0 0 100 50.3 0 insT Eed 4219 A 3046 22.2 53.22 0.07 46.55 0.03 0 0.13 A>AG Eed 4222 T 3094 22 0.1 0.1 45.93 53.43 0 0.45 T>GT Eed 4224 G 3047 21.8 46.01 0.07 53.92 0 0 0 G>AG Eed 4262 T 3230 27.7 0.06 53.25 0.03 46.66 0 0 T>CT Eed 4274 T 3387 25.3 0.06 48.24 0.03 51.67 0 0 T>CT Eed 4363 A 3711 27.3 48.85 0.08 51.01 0.05 0 0 A>AG Eed 4418 T 3592 27.7 0.08 99.64 0.06 0.22 0 0 T>C

138

Early 2 Ref. Ref. Gene Seq. Coverage Score A % C % G % T % Ins % Del % Mutation Call Nucl. Position Eed 4497 A 3162 26.9 49.65 0 0.19 50.13 0 0.03 A>AT Eed 4531 A 3479 26.8 53.66 46.28 0.03 0 0 0.03 A>AC Eed 4556 A 3463 26 52.56 0.09 47.13 0.23 0 0 A>AG Eed 4580 G 3641 26.9 0 0 46.44 53.56 0 0 G>GT Eed 4602 A 3647 20.4 46.59 0 0.05 53.36 0 0 A>AT Eed 4603 C 3655 20.4 0.14 46.54 0 53.32 0 0 C>CT Eed 4648 T 3711 28.2 0.03 53.73 0.08 46.16 0.03 0 T>CT Eed 4649 A 3712 27.6 0.16 99.73 0 0.11 0 0 A>C Eed 4673 T 3574 23.8 0.11 0.73 0.08 56.24 0 42.84 delTTAA Eed 4674 T 3575 23.5 0.03 0.76 0.45 56.34 0.03 42.43 - Eed 4675 A 3574 19 56.83 0.78 0.03 0 0 42.36 - Eed 4678 A 3732 20.7 59.91 0.16 0.19 0 0 39.74 delAGTTA Eed 4679 G 3736 20.5 1.12 0.05 58.32 0.05 0 40.44 - Eed 4680 T 3732 20.5 1.29 0.08 0.08 57.93 0.03 40.62 - Eed 4681 T 3760 20.3 0.08 0.03 1.97 57.69 0 40.24 - Eed 4682 A 3797 20.5 57.73 0.05 2.37 0 0.03 39.85 - Eed 4685 C 3769 21.7 0.13 57.68 0.11 0 0 42.08 delCTCCCA Eed 4686 T 3716 21.6 0.13 0.22 0.16 56.81 0 42.68 - Eed 4687 C 3723 27 0.11 57.19 0 0.03 0 42.68 - Eed 4688 C 3679 27.5 0.03 57.52 0 0.08 0 42.38 - Eed 4689 C 3700 27.3 0.05 56.89 0 0.05 0 43 - Eed 4690 A 3682 27.5 56.36 0.14 0.24 0.08 0 43.18 - Eed 4704 C 3425 26.7 0.15 6.42 93.31 0.12 0 0 C>G Eed 4923 T 3465 28.1 92.24 0.26 0.29 7.22 0 0 T>A Eed 4930 A 3490 21 7.22 0.09 0.17 92.52 0 0 A>T Eed 4935 G 3513 26.8 0.06 92.54 7.26 0.14 0 0 G>C Eed 5044 C 2976 21.7 45.73 54.2 0 0 0 0.07 C>AC Eed 5045 A 2999 21.7 54.45 0.03 45.42 0.07 0.03 0.03 A>AG Eed 5051 A 2964 21.7 52.87 0.13 0.1 46.83 0 0.07 A>AT Eed 5074 A 2985 25.7 2.65 0 0 0 0.13 97.35 delAAAAAA Eed 5075 A 2981 26.5 9.12 0.03 0.1 0.07 0 90.67 - Eed 5076 A 2984 27.4 37.37 0.03 0.1 0 0 62.5 - Eed 5077 A 2986 26.9 50.6 0.03 0.03 0.17 0 49.16 - Eed 5078 A 2983 27.1 53.1 0 0.07 0.03 0 46.8 - Eed 5079 A 2985 27.1 53.4 0 0.07 0.07 0 46.47 - Eed 5138 T 2916 26.8 0.07 99.66 0.03 0.24 0 0 T>C Eed 5140 G 2917 25.1 0.03 0.1 0.21 99.59 0 0.07 G>T Eed 5185 A 2486 26.5 53.9 0.24 45.82 0.04 0 0 A>AG Eed 5264 C 2109 24.1 0 57.89 0.05 36.46 0 5.6 C>CT

139

Early 2 Ref. Ref. Gene Seq. Coverage Score A % C % G % T % Ins % Del % Mutation Call Nucl. Position Eed 5269 C 2164 20.9 0.05 59.1 0.05 35.3 0 5.5 C>CT Eed 5275 C 2237 17.4 42.47 57.17 0.09 0.09 0 0.18 C>AC Eed 5283 G 2296 19.9 0.04 0.09 60.19 0.13 0 39.55 delG Eed 5285 C 2332 19.2 0.13 54.33 0 38.98 0 6.56 C>CT GnRH3B 794 T 3136 23.9 0.03 0.1 50.1 49.71 0 0.06 T>GT GnRH3B 1026 C 2811 23 51.62 48.24 0 0.14 0 0 C>AC G0S2 991 T 3321 25.5 0.09 47.61 0 52.3 0 0 T>CT G0S2 1399 G 3434 28.1 99.77 0.12 0.09 0.03 0 0 G>A G0S2 1706 T 3487 27.9 50.79 0.03 0.06 48.9 0 0.23 T>AT G0S2 1791 C 3435 26.9 0.06 49.78 0.09 50.07 0 0 C>CT G0S2 1792 G 3455 27 0 0.03 50.04 49.93 0 0 G>GT G0S2 4112 A 2222 23.1 51.89 48.06 0.05 0 0 0 A>AC G0S2 4397 C 2584 26.4 0.08 50.43 0 49.5 0 0 C>CT BMAL 396 C 1893 22.4 48.6 51.4 0 0 0 0 C>AC BMAL 1229 A 2142 24.7 52.94 0.14 0.51 0 0 46.41 delA BMAL 1261 A 1974 24.1 48.58 0.05 51.37 0 0 0 A>AG BMAL 1786 A 2125 25.6 49.6 0.19 0.33 0 0 49.88 delAA BMAL 1787 A 2128 25.9 49.91 0.19 0 0.19 0 49.72 - BMAL 1808 A 2349 25.2 46.74 53.13 0.13 0 0 0 A>AC BMAL 2333 T 2083 22.1 47.86 0.14 0.1 51.85 0 0.05 T>AT BMAL 2413 T 2617 26.2 0 47.84 0 52.16 0 0 T>CT BMAL 2696 A 855 17.1 52.16 0.12 47.72 0 0 0 A>AG BMAL 2944 A 2137 25 51.05 0.05 48.67 0.23 0 0 A>AG BMAL 3131 G 2162 24.9 0 51.71 48.15 0.05 0 0.09 G>CG BMAL 3325 T 2263 23.4 0.04 49.85 0 50.11 0 0 T>CT BMAL 4141 C 1098 21.1 0 100 0 0 0 0 A>C BMAL 4167 T 942 22.7 0.21 0 53.29 46.39 0 0.11 T>GT BMAL 4741 A 1591 24.5 48.77 0 51.23 0 0 0 A>AG BMAL 4753 T 1592 25.5 0 48.62 0 51.38 0 0 T>CT BMAL 5353 G 2209 24.7 52.33 0 47.62 0.05 0 0 G>AG Kiss1r 152 C 1068 21.7 0.19 51.12 0.19 48.5 0 0 C>CT Clock1b 692 C 73 12.3 0 64.38 34.25 0 0 1.37 C>CG Clock1b 710 G 85 15.3 37.65 0 62.35 0 0 0 G>AG Clock1b 1392 C 41 9.8 39.02 60.98 0 0 0 0 C>AC Clock1b 1394 T 41 10.4 0 0 0 100 53.66 0 insT Clock1b 1400 G 41 12 0 0 39.02 60.98 0 0 G>GT

140

Early3 Ref. Ref. Gene Seq. Coverage Score A % C % G % T % Ins % Del % Mutation Call Nucl Position dec2 523 G 6664 29.8 0 0.02 26.67 73.32 0 0 G>T dec2 697 A 6611 16.2 28.23 0.06 0.15 71.56 1.42 0 A>T dec2 698 A 6551 16.2 0.55 0.03 0.12 99.3 0 0 A>T dec2 699 A 6554 16.2 27.1 0.02 0.05 72.84 0.02 0 A>T dec2 701 A 6515 16.2 26.58 0.08 0.06 73.28 0 0 A>T dec2 703 A 6480 16.4 26.51 0.02 0.05 69.81 0 3.61 A>T dec2 1053 C 7497 30.9 67.53 32.4 0.03 0.04 0.01 0 C>AC dec2 1294 C 6120 29.3 0.1 31.29 0.21 68.4 0 0 C>CT dec2 997 T 6768 26.5 0.03 0.01 30.19 69.74 0 0.03 T>GT Eed 279 T 1918 25.1 0.16 0 0 34.88 0 64.96 delT Eed 629 T 2666 26.7 0.04 62.75 0.15 37.06 0 0 T>CT Eed 1652 C 2682 26.3 0.04 34.94 64.73 0.26 0 0.04 C>CG Eed 2178 A 3314 27.8 34.43 0.63 0.06 0 0 64.88 delA Eed 2375 A 2851 22.8 66.92 0.07 32.94 0.07 0 0 A>AG Eed 2455 A 3352 27.2 0.21 0.09 99.64 0.06 0 0 A>G Eed 2629 A 2866 23.1 62.35 0.14 37.4 0.1 0.03 0 A>AG Eed 2688 G 2799 26.9 67.2 0.07 32.62 0.11 0 0 G>AG Eed 2768 T 2889 27.2 67.08 0.21 0.14 32.57 0 0 T>AT Eed 2852 G 3028 23.5 66.15 0.1 33.72 0.03 0 0 G>AG Eed 3028 T 2897 23.1 0.03 65.52 0.03 34.41 0 0 T>CT Eed 3236 T 3117 27.6 0.06 33.69 0.1 66.15 0 0 T>CT Eed 3469 T 3602 26.9 1.36 32.15 0.61 65.52 0 0.36 T>CT Eed 3499 G 3257 26.9 57.11 0.18 42.25 0.21 0 0.25 G>AG Eed 3525 A 3276 26.3 41.58 0.21 0.76 57.17 0 0.27 A>AT Eed 3532 T 3246 24.9 0.83 31.36 0.68 66.88 0 0.25 T>CT Eed 3562 G 3117 23.9 78.12 0.26 20.98 0.32 0 0.32 G>A Eed 3588 A 3000 24.9 11.4 0.03 0.43 87.93 0 0.2 A>T Eed 3782 T 2900 26.8 0.1 0.1 32 67.76 0 0.03 T>GT Eed 4041 A 2598 24.7 31.83 0.04 68.09 0.04 0 0 A>AG Eed 4127 A 2935 26.8 36.39 0.03 63.51 0.07 0 0 A>AG Eed 4161 A 2948 25.7 62.86 0.03 36.26 0.85 0 0 A>AG Eed 4162 T 2946 27.1 0 0 0 99.97 34.56 0.03 insT Eed 4215 C 2813 15.8 0.11 63.03 0.07 36.79 0 0 C>CT Eed 4219 A 2696 20.5 0.11 0.07 99.67 0.15 0 0 A>G Eed 4222 T 2805 21.1 0.04 0.04 99.68 0.25 0 0 T>G Eed 4224 G 2772 21 99.68 0.18 0.04 0.11 0 0 G>A Eed 4249 T 2709 23.8 0.11 65.12 0.15 34.63 0 0 T>CT Eed 4274 T 2754 27.3 0 99.96 0 0.04 0 0 T>C Eed 4418 T 2566 25.8 0.23 66.48 0.12 33.16 0 0 T>CT

141

Early3 Ref. Ref. Gene Seq. Coverage Score A % C % G % T % Ins % Del % Mutation Call Nucl Position Eed 4531 A 3034 26.9 37.48 62.43 0 0 0 0.1 A>AC Eed 4580 G 3251 27.7 0.03 0 35.9 64.01 0 0.06 G>GT Eed 4593 G 3292 21.6 63.46 0.09 36.33 0.12 0 0 G>AG Eed 4603 C 3300 13.9 36.82 0.03 0.03 63.12 0 0 C>AT Eed 4649 A 3319 27.2 36.22 63.75 0 0.03 0 0 A>AC Eed 4704 C 2847 20.8 0.32 37.3 62.31 0.07 0 0 C>CG Eed 4824 T 2643 27 0.08 0.11 64.13 35.68 0 0 T>GT Eed 4849 A 2434 24.5 66.23 0 0.08 33.61 0 0.08 A>AT Eed 4923 T 2727 27.1 64.25 0.15 0.4 35.17 0 0.04 T>AT Eed 4930 A 2988 21.1 35.37 0.17 0 64.46 0 0 A>AT Eed 4935 G 3054 26.4 0.23 65.85 33.79 0.13 0 0 G>CG Eed 5044 C 2802 26.6 64.03 35.8 0.11 0.04 0 0.04 C>AC Eed 5045 A 2844 25.8 36.43 0.11 63.4 0 0 0.07 A>AG Eed 5074 A 2813 26.6 5.15 0.04 0 0 0.21 94.81 delAAAAAA Eed 5075 A 2804 26.9 22.18 0 0 0 0 77.82 - Eed 5076 A 2799 27.2 32.76 0.04 0 0.04 0 67.17 - Eed 5077 A 2797 26.9 36.04 0.07 0 0.04 0 63.85 - Eed 5078 A 2798 26.9 36.42 0.04 0.04 0 0 63.51 - Eed 5079 A 2799 26.9 36.44 0.07 0.04 0.07 0 63.38 - Eed 5107 C 2712 27.4 0.33 63.38 0.11 36.17 0 0 C>CT Eed 5138 T 2504 26.2 0.04 63.26 0.24 36.46 0 0 T>CT Eed 5140 G 2504 26.2 0.16 0.04 36.58 63.22 0 0 G>GT Eed 5185 A 2125 26 34.64 0.14 65.13 0.09 0 0 A>AG delTGCTTGGCCCT Eed 5212 T 2009 24.5 0.25 0.1 0.3 68.89 0 30.46 GCCCAGCCCCT Eed 5213 G 2012 24.5 0.1 0 69.33 0.15 0 30.42 - Eed 5214 C 2010 24.5 0.05 69.4 0 0.1 0 30.45 - Eed 5215 T 1994 24.7 0.2 0 0.15 68.96 0 30.69 - Eed 5216 T 1996 24.7 0 0.25 0.2 68.89 0 30.66 - Eed 5217 G 1928 24.1 0.21 0 67.89 0.21 0 31.69 - Eed 5218 G 1936 24.1 0.1 0 68.08 0.1 0 31.71 - Eed 5219 C 1936 24.1 0.26 67.25 0.41 0.26 0 31.82 - Eed 5220 C 1926 24.3 0.26 67.6 0.16 0.05 0 31.93 - Eed 5221 C 1906 24.6 0.16 67.37 0.05 0.16 0 32.27 - Eed 5222 T 1830 23.6 0.11 0.16 0.33 65.79 0 33.61 - Eed 5223 G 1840 23.9 0 0.05 66.36 0.22 0 33.37 - Eed 5224 C 1840 23.9 0 66.36 0.11 0.16 0 33.37 - Eed 5225 C 1838 23.9 0.11 66.43 0.05 0 0 33.41 - Eed 5226 C 1836 23.9 0.05 66.34 0 0.16 0 33.44 - Eed 5227 A 1773 24.1 64.86 0.11 0.39 0 0 34.63 -

142

Early3 Ref. Ref. Gene Seq. Coverage Score A % C % G % T % Ins % Del % Mutation Call Nucl Position Eed 5228 G 1780 24.1 0.17 0.06 65.17 0.06 0 34.55 - Eed 5229 C 1771 23.8 0.06 65.16 0 0.06 0 34.73 - Eed 5230 C 1773 24.1 0.06 65.14 0.06 0.06 0 34.69 - Eed 5231 C 1771 24.1 0.06 65.1 0.06 0.06 0 34.73 - Eed 5232 C 1717 24.5 0 64.07 0 0.12 0 35.82 - Eed 5233 T 1731 24.5 0.06 0.23 0.12 64.07 0 35.53 - Eed 5264 C 1785 22.5 0 37.82 0.06 55.74 0 6.39 C>CT Eed 5269 C 1844 20.6 0 39.05 0.05 54.66 0 6.24 C>CT Eed 5275 C 1915 16.7 61.62 37.55 0.05 0.42 0 0.37 C>AC Eed 5283 G 1961 18.7 0 0.05 41.36 0.1 0 58.49 delG Eed 5285 C 1984 18.7 0.05 34.27 0.1 58.01 0 7.56 C>CT GnRH3B 274 C 3980 27.3 47.39 52.59 0 0.03 0 0 C>AC GnRH3B 353 A 5963 29.8 52.76 0.08 47.11 0.03 0 0.02 A>AG GnRH3B 794 T 6417 26.3 0.17 0.05 46.69 53.08 0 0.02 T>GT G0S2 180 A 885 23.5 51.86 0.34 0 0.11 0 47.68 delATAGTGAT G0S2 181 T 894 23.5 0 0 0 52.8 0 47.2 - G0S2 182 A 896 23.3 52.68 0 0.11 0.11 0 47.1 - G0S2 183 G 920 23.6 0.22 0 53.8 0.11 0 45.87 - G0S2 184 T 922 23.7 0.22 0 0.11 54.01 0 45.66 - G0S2 185 G 926 23.7 0 0 54.54 0 0 45.46 - G0S2 186 A 939 23.2 54.63 0.11 0.32 0 0 44.94 - G0S2 187 T 944 23.3 0 0 0.32 54.98 0 44.7 - G0S2 909 C 2757 27.4 0.07 54.23 0 45.7 0 0 C>CT G0S2 1359 A 2832 25.1 100 0 0 0 0 0 T>A G0S2 1519 G 3161 27.1 44.54 0.03 55.3 0.09 0 0.03 G>AG G0S2 1575 A 2973 27.4 55.06 0.17 44.1 0.54 0.03 0.13 A>AG G0S2 2424 A 3782 26.5 46.11 53.75 0.05 0.05 0 0.03 A>AC G0S2 2427 T 3765 26.5 0.11 53.63 0.03 46.22 0 0.03 T>CT G0S2 2476 T 3715 25.1 0 0 0 100 0 0 G>T G0S2 2512 G 3430 25.9 44.66 0 55.31 0.03 0 0 G>AG G0S2 2535 G 3459 25.1 0 0 100 0 0 0 A>G G0S2 2583 C 3432 28.2 0.29 47.73 0.26 51.72 0 0 C>CT G0S2 2628 A 3514 27.4 47.07 52.7 0.14 0.09 0 0 A>AC G0S2 2857 A 2921 26.2 53.75 0.14 0.14 45.98 0 0 A>AT G0S2 2874 A 3127 27.8 0.22 99.65 0 0.13 0 0 A>C G0S2 2878 T 3056 26.3 0.23 99.71 0 0.07 0 0 T>C G0S2 3969 T 2066 20.3 55.76 0.24 0.05 43.95 0 0 T>AT G0S2 3978 C 2093 20.3 1.96 46.25 0.05 0.33 0.19 51.41 delC G0S2 3979 C 2099 19.7 0.05 99.57 0.05 0.29 44.78 0.05 insT

143

Early3 Ref. Ref. Gene Seq. Coverage Score A % C % G % T % Ins % Del % Mutation Call Nucl Position G0S2 4005 T 2111 20.1 0 0 0 100 0 0 G>T G0S2 4112 A 1810 23.9 0.28 99.61 0 0.06 0 0.06 A>C G0S2 4420 A 2346 26.9 0.43 0 0.21 0 0 99.36 delATGACGGTC G0S2 4421 T 2346 26.9 0 0.21 0 0.17 0 99.62 - G0S2 4422 G 2341 26.9 0 0 0.21 0 0 99.79 - G0S2 4423 A 2341 26.9 0.21 0 0 0 0 99.79 - G0S2 4424 C 2341 26.9 0 0.17 0 0 0 99.83 - G0S2 4425 G 2341 26.9 0 0 0.17 0 0.09 99.83 - G0S2 4426 G 2341 26.9 0 0 0.17 0 0.09 99.83 - G0S2 4427 T 2341 26.9 0 0 0 0.17 0 99.83 - G0S2 4428 C 2341 25.5 0 0.38 0 0 0 99.62 - G0S2 4513 C 2020 25.8 0 51.88 0 48.07 0 0.05 C>CT G0S2 4550 T 1895 19.6 0 49.29 0.11 50.61 0 0 T>CT G0S2 4551 G 1891 19.4 49.23 0.05 50.66 0.05 0 0 G>AG G0S2 4558 C 1916 21.2 0.05 50.37 0 49.58 0 0 C>CT G0S2 4637 T 1708 20.1 0 0 0 100 0 0 G>T G0S2 4645 C 1697 25.5 0.12 50.8 0.06 49.03 0 0 C>CT BMAL 2172 A 2577 22 2.29 0 0 0 0 97.71 delAA BMAL 2173 A 2576 22.9 0.5 0.04 2.02 0.08 0 97.36 - BMAL 2654 C 2551 25.8 99.53 0.31 0.12 0.04 0 0 C>A BMAL 2733 G 1823 14.9 0 0.16 49.53 0.71 5.87 49.59 delG BMAL 2764 A 1652 25.3 0.12 0.06 0.06 99.76 0 0 A>T BMAL 3324 A 4004 28.1 0.02 0.2 0.1 99.68 0 0 A>T BMAL 3459 A 3635 28.4 0.17 0.03 0.08 99.64 0 0.08 A>T BMAL 3796 T 3830 23.1 0 0.1 0 3.66 0 96.24 delTTGA BMAL 3797 T 3836 23.9 0 0.03 0 3.91 0 96.06 - BMAL 3798 G 3844 24.8 0 0.39 3.77 0 0 95.84 - BMAL 3799 A 3845 23.4 2.96 0.05 0.03 0.57 0 96.38 - BMAL 4796 C 3521 27.6 0.11 0.28 0 99.6 0 0 C>T BMAL 5877 A 3204 27.9 0.16 0.22 0.09 99.5 0 0.03 A>T Kiss1r 152 C 2422 24 0.21 52.73 0.04 47.03 0 0 C>CT Clock1a 718 A 3159 25.1 48.75 50.97 0.13 0.16 0 0 A>AC Clock1b 401 G 37 6.2 59.46 0 40.54 0 0 0 G>AG Clock1b 692 C 96 14.2 0 64.58 35.42 0 0 0 C>CG Clock1b 710 G 101 15.3 35.64 0 64.36 0 0 0 G>AG Clock1b 1392 C 48 10.9 64.58 35.42 0 0 0 0 C>AC

144

Early 4

Ref. Seq. Ref. Gene Coverage Score A % C % G % T % Ins % Del % Mutation Call Position Nucl.

dec1 693 C 2489 26.8 0.04 51.51 0.08 48.37 0 0 C>CT dec1 2056 G 2258 24.8 49.69 0.31 49.91 0.09 0 0 G>AG dec2 698 A 2080 25.6 1.15 0.05 0.1 98.65 0 0.05 A>T dec2 997 T 1623 22.2 0 0 46.21 53.67 0 0.12 T>GT Eed 1652 C 1146 22.5 0 43.37 56.54 0.09 0 0 C>CG Eed 2455 A 1398 24 25.04 0 74.82 0.14 0 0 A>G Eed 2688 G 1175 22 32.51 0 67.49 0 0 0 G>AG Eed 2768 T 1196 24.4 58.53 0.08 0.17 41.22 0 0 T>AT Eed 2852 G 1275 20.5 57.96 0.08 41.96 0 0 0 G>AG Eed 2967 C 1267 23.7 0 99.76 0.08 0.16 31.65 0 insC Eed 3236 T 1437 23.4 0 57.13 0.14 42.73 0 0 T>CT Eed 3304 T 1418 22.9 35.97 0.14 0.35 63.54 0 0 T>AT Eed 3469 T 1536 23.9 1.63 53.19 0.52 43.95 0 0.72 T>CT Eed 3499 G 1348 23.2 32.64 0.15 66.77 0.3 0 0.15 G>AG Eed 3525 A 1319 23.4 67.93 0.3 0.83 30.55 1.59 0.38 A>AT Eed 3532 T 1346 24.9 2.23 59.36 0.74 37.3 0 0.37 T>CT Eed 3562 G 1199 22.1 49.46 0.08 48.96 0.42 0 1.08 G>AG Eed 3588 A 1118 23.8 46.42 0 1.88 50.63 1.52 1.07 A>AT Eed 3759 T 1105 20.5 0.18 0 63.71 36.11 0 0 T>GT Eed 3782 T 1282 23 0 0.16 53.67 46.18 0 0 T>GT Eed 4027 A 1313 23.3 43.87 55.98 0.08 0.08 0 0 A>AC Eed 4127 A 1235 24.3 30.12 0 69.64 0.24 0 0 A>AG Eed 4161 A 1184 23.1 100 0 0 0 0 0 G>A Eed 4219 A 1031 23.7 12.03 0 87.88 0.1 0 0 A>G Eed 4222 T 1048 18.1 0.1 0.29 31.39 68.03 0 0.19 T>GT Eed 4224 G 1037 18.3 31.24 0.19 68.47 0.1 0 0 G>AG Eed 4249 T 1052 22.6 0.38 75.67 0.1 23.76 0 0.1 T>C Eed 4274 T 1053 22.6 0.09 85.09 0 14.81 0 0 T>C Eed 4363 A 1091 24.2 55 0.18 44.82 0 0 0 A>AG Eed 4418 T 1075 24.1 0.37 46.98 0.28 52.37 0 0 T>CT Eed 4466 C 1080 23.2 30.56 69.35 0 0.09 0 0 C>AC Eed 4531 A 1306 24.1 68.53 31.32 0 0.08 0 0.08 A>AC Eed 4556 A 1367 21.4 45.35 0.15 54.43 0.07 0 0 A>AG Eed 4580 G 1582 22.4 0.06 0.06 53.79 45.95 0 0.13 G>GT Eed 4603 C 1675 19.3 19.76 0.24 0.06 79.94 0 0 C>T Eed 4648 T 1676 25.7 0.24 67.54 0 32.22 0 0 T>CT Eed 4649 A 1673 25.4 0.18 99.58 0 0.24 0 0 A>C Eed 4704 C 1537 21.7 0.13 10.87 88.87 0.13 0 0 C>G Eed 4791 T 1378 20.9 0 64.8 0.15 35.05 0 0 T>CT

145

Early 4

Ref. Seq. Ref. Gene Coverage Score A % C % G % T % Ins % Del % Mutation Call Position Nucl.

Eed 4824 T 1529 24.3 0 0 77.44 22.56 0 0 T>G Eed 4930 A 1413 22.6 36.23 0.28 0.21 63.27 0 0 A>AT Eed 4935 G 1448 22.4 0.07 63.54 36.05 0.35 0 0 G>CG Eed 5044 C 1209 24.3 66.42 33 0.25 0.25 0 0.08 C>AC Eed 5045 A 1223 24.3 34.18 0 65.82 0 0 0 A>AG Eed 5074 A 1245 23.6 4.58 0 0.16 0 0.08 95.26 delAAAAAA Eed 5075 A 1243 24.6 11.91 0 0 0 0 88.09 - Eed 5076 A 1241 24.6 30.7 0.08 0.24 0.08 0.08 68.9 - Eed 5077 A 1243 21.9 58.57 0 0.08 0 0.08 41.35 - Eed 5078 A 1246 22.4 65.49 0 0.16 0 0 34.35 - Eed 5079 A 1243 22.7 65.97 0 0.08 0.08 0 33.87 - Eed 5138 T 1128 24.2 0.18 99.29 0 0.44 0 0.09 T>C Eed 5140 G 1127 24.2 0.09 0.09 0.53 99.29 0 0 G>T Eed 5185 A 968 21.6 26.34 0.62 72.93 0.1 0 0 A>G delTGCTTGGCCCT Eed 5212 T 899 21.4 0.11 0.22 0 67.85 0.67 31.81 GCCCAGCCCCT Eed 5213 G 900 21.4 0.22 0 68 0 0.11 31.78 - Eed 5214 C 900 21.4 0.11 68 0 0.11 0 31.78 - Eed 5215 T 895 21.6 0 0.22 0 67.82 0 31.96 - Eed 5216 T 896 21.6 0 0.11 0 67.97 0 31.92 - Eed 5217 G 870 21.5 0 0.11 67.24 0 0 32.64 - Eed 5218 G 873 21.5 0 0.23 66.9 0.11 0 32.76 - Eed 5219 C 873 21.5 0 66.78 0.11 0.34 0 32.76 - Eed 5220 C 869 21.7 0.12 66.51 0.46 0 0 32.91 - Eed 5221 C 868 21.7 0.12 66.82 0 0.12 0 32.95 - Eed 5222 T 834 21.6 0 0.12 0.24 65.35 0 34.29 - Eed 5223 G 839 21.6 0.12 0 65.67 0.12 0.12 34.09 - Eed 5224 C 840 21.6 0 65.71 0.12 0.12 0 34.05 - Eed 5225 C 840 21.6 0 65.95 0 0 0 34.05 - Eed 5226 C 840 21.6 0 65.71 0 0.24 0.36 34.05 - Eed 5227 A 801 21.5 64.17 0 0.12 0 0 35.71 - Eed 5228 G 804 21.2 0.12 0 64.18 0.12 0 35.57 - Eed 5229 C 799 21 0 64.21 0 0 0.13 35.79 - Eed 5230 C 799 21 0 64.21 0 0 0.13 35.79 - Eed 5231 C 800 21 0.25 64 0 0 0 35.75 - Eed 5232 C 786 21.4 0 63.61 0 0 0.13 36.39 - Eed 5233 T 788 21.2 0 0.25 0.13 63.32 0.13 36.29 - Eed 5264 C 741 20.8 0 24.02 0 66.67 0 9.31 C>T Eed 5269 C 751 16.7 0 37.55 0.13 53.13 0.13 9.19 C>CT

146

Early 4

Ref. Seq. Ref. Gene Coverage Score A % C % G % T % Ins % Del % Mutation Call Position Nucl.

Eed 5275 C 717 13.9 69.18 30.26 0.28 0 0 0.28 C>AC Eed 5283 G 710 18.4 0.14 0 39.01 0.42 0.28 60.42 delG Eed 5285 C 709 17.6 0 29.2 0 60.65 0 10.16 C>T GnRH3B 274 C 1325 24.6 46.42 53.58 0 0 0 0 C>AC GnRH3B 331 A 1868 24.5 43.47 0.21 0.11 56.21 0 0 A>AT GnRH3B 360 G 2049 25.6 55.88 0.05 43.97 0.1 0 0 G>AG GnRH3B 411 C 2165 25 0.09 44.16 0.05 55.7 0 0 C>CT GnRH3B 794 T 2206 24.2 0 0.23 44.38 55.39 0 0 T>GT GnRH3B 1210 T 149 16 59.73 0 0 40.27 0 0 T>AT G0S2 180 A 265 19.3 0.75 0 0 0 0 99.25 delATAGTGAT G0S2 181 T 265 18.9 0 0 0 0.38 0 99.62 - G0S2 182 A 265 18.9 0.38 0 0 0 0 99.62 - G0S2 183 G 265 17.2 0 0 0.75 0 0 99.25 - G0S2 184 T 265 19.3 0 0 0 0.75 0 99.25 - G0S2 185 G 265 19.3 0 0 0.75 0 0 99.25 - G0S2 186 A 266 18.7 1.13 0 0 0 0 98.87 - G0S2 187 T 266 17.2 0 0 0.38 0.38 0 99.25 - G0S2 485 A 963 19.7 63.34 35.83 0.31 0.21 0.31 0.31 A>AC insACACACACACA G0S2 486 A 956 20.2 99.79 0 0 0.21 38.08 0 CATACACAC G0S2 1157 G 1220 24.5 0 0 0.41 99.59 0 0 G>T G0S2 1426 C 1065 22.2 0 0.19 0.09 99.72 0 0 C>T G0S2 1654 G 793 22.2 47.92 0 50.57 1.13 0 0.38 G>AG BMAL 597 A 950 21.4 54 45.89 0.11 0 0 0 A>AC BMAL 791 C 813 23.1 59.53 40.34 0.12 0 0 0 C>AC BMAL 826 G 731 22.1 43.09 0 56.91 0 0 0 G>AG BMAL 986 C 769 18.8 47.07 52.8 0 0.13 0 0 C>AC BMAL 1229 A 798 22.6 0.5 0.38 1.13 0.25 0 97.74 delA BMAL 1261 A 789 21.8 0.13 0.13 99.37 0.25 0 0.13 A>G BMAL 1318 T 714 22.3 0 0.28 99.3 0.42 0.14 0 T>G BMAL 1808 A 1054 24 0.09 99.91 0 0 0 0 A>C BMAL 2172 A 945 20.8 5.19 0.11 0 0 0 94.71 delAA BMAL 2173 A 945 20.8 0.32 0 5.08 0 0 94.6 - BMAL 2413 T 1201 21.8 0.08 42.71 0 57.2 0 0 T>CT BMAL 2654 C 538 19.7 64.5 35.5 0 0 0 0 C>AC BMAL 2764 A 341 18.9 37.24 0 0 62.76 0 0 A>AT BMAL 2944 A 1036 22.6 55.41 0.1 44.31 0.1 0 0.1 A>AG BMAL 3131 G 954 23.2 0.1 44.65 55.03 0 0 0.21 G>CG BMAL 3324 A 1191 24.2 47.36 0.17 0.08 52.23 0 0.17 A>AT

147

Early 4

Ref. Seq. Ref. Gene Coverage Score A % C % G % T % Ins % Del % Mutation Call Position Nucl.

BMAL 3344 T 1098 20.8 0 0 0.09 99.82 47.54 0.09 insT BMAL 3348 C 1096 21.3 0.18 51.19 0 48.63 0 0 C>CT BMAL 3459 A 776 22.6 47.16 0 0 52.45 0 0.39 A>AT BMAL 3796 T 701 19.9 0 0.14 0 53.35 0 46.5 delTTGA BMAL 3797 T 700 19.9 0 0.14 0 53.29 0 46.57 - BMAL 3798 G 701 19.9 0.14 0.14 53.35 0 0 46.36 - BMAL 3799 A 699 20.1 53.08 0.29 0.14 0.14 0 46.35 - BMAL 4741 A 666 22.2 50.9 0 49.1 0 0 0 A>AG BMAL 4796 C 729 20.5 0.27 52.13 0 47.6 0 0 C>CT BMAL 5100 G 1039 20.1 0.29 48.7 51.01 0 0 0 G>CG BMAL 5877 A 670 22.4 49.55 0 0.15 50 0 0.3 A>AT Kiss1r 966 C 1386 22.8 0 48.56 0.14 51.3 0 0 C>CT Clock1b 1394 T 87 15.5 0 0 0 100 88.51 0 insT Clock1b 1400 G 87 15.5 0 0 0 100 0 0 G>T Kiss2 86 A 15853 33.8 54.05 1.68 44.24 0.02 0 0 A>AG Kiss2 172 T 15731 33.5 0.07 44.35 0 55.58 0 0 T>CT Kiss2 309 G 13849 31.6 0.06 0.06 54.47 45.39 0 0.01 G>GT Kiss2 532 G 11957 31.2 0.06 46.32 53.59 0.03 0 0 G>CG

Early 5 Ref. Ref. Gene Seq. Coverage Score A % C % G % T % Ins % Del % Mutation Call Nucl. Position dec2 523 G 4570 28.9 0 0.11 27.81 72.08 0 0 G>T dec2 697 A 3943 18.1 28.68 0 0.08 71.24 1.42 0 A>T dec2 698 A 3895 17.5 0.41 0 0.05 99.54 0.08 0 A>T dec2 699 A 3900 17.9 27.59 0.03 0.08 72.31 0 0 A>T dec2 701 A 3884 18.1 27.27 0 0 72.73 0 0 A>T dec2 703 A 3869 18.1 26.98 0 0 69.19 0 3.83 A>T dec2 1053 C 4320 28.7 68.77 31.11 0.07 0.05 0 0 C>AC dec2 1294 C 4255 28 0.05 31.09 0.19 68.67 0 0 C>CT Eed 279 T 1519 25.1 0 0 0 100 100 0 insT Eed 324 G 1766 20.6 0.06 53.74 46.15 0.06 0 0 G>CG Eed 629 T 2326 25.1 0 0 0 100 0 0 C>T Eed 2157 A 2559 23.3 20.32 0.04 79.6 0.04 0 0 A>G Eed 2178 A 2633 25.1 100 0 0 0 100 0 insA Eed 2375 A 2470 27 0.12 0.04 99.72 0.12 0 0 A>G Eed 2455 A 2424 25.9 20.09 0 79.87 0.04 0 0 A>G Eed 2597 T 2410 25.5 18.51 0.04 81.33 0.04 0 0.08 T>G

148

Early 5 Ref. Ref. Gene Seq. Coverage Score A % C % G % T % Ins % Del % Mutation Call Nucl. Position Eed 2629 A 2079 23.2 18.71 0 81.05 0.1 0 0.14 A>G Eed 3028 T 2341 25.1 0 0 0 100 0 0 C>T Eed 3297 T 2312 26.8 0.04 0 0.04 47.62 0 52.29 delTTG Eed 3298 T 2297 26.5 0.04 0 0.09 47.32 0 52.55 - Eed 3299 G 2303 26.5 0 0.13 47.46 0.09 0 52.32 - Eed 3469 T 4577 28 0.61 42.84 0.59 55.84 0 0.11 T>CT Eed 3562 G 3799 26 38.83 0.05 60.73 0.26 0 0.13 G>AG Eed 3588 A 3321 26.4 46.55 0.06 0.09 53.24 0 0.06 A>AT Eed 3759 T 2198 21.4 0.14 0.14 84.39 15.29 0 0.05 T>G Eed 3782 T 2282 25.3 0 0 99.87 0.09 0 0.04 T>G Eed 4041 A 2143 25.1 100 0 0 0 0 0 G>A Eed 4127 A 2338 25.1 100 0 0 0 0 0 G>A Eed 4162 T 2405 26.9 0 0 0 100 98.63 0 insT Eed 4215 C 2293 17.1 0 16.7 0 83.3 0 0 C>T Eed 4219 A 2195 17.1 0.27 0.05 99.64 0.05 0 0 A>G Eed 4222 T 2274 17.6 0.04 0 99.82 0.09 0 0.04 T>G Eed 4224 G 2256 17.6 99.65 0.09 0.27 0 0 0 G>A Eed 4249 T 2196 23.1 0 0 0 100 0 0 C>T Eed 4274 T 2214 26.6 0 99.68 0 0.32 0 0 T>C Eed 4593 G 2860 25.1 0 100 0 0 0 0 A>G Eed 4603 C 2900 27.6 99.93 0.03 0 0.03 0 0 C>A Eed 4824 T 2418 25.1 0 0 0 100 0 0 G>T Eed 4849 A 2163 23.5 14.66 0.05 0.09 85.21 0 0 A>T Eed 5074 A 2224 26.3 9.26 0 0.04 0.04 0.4 90.65 delAA Eed 5075 A 2228 25.6 48.2 0.04 0 0.09 0 51.66 - Eed 5107 C 2169 24.4 0.32 0.23 0.05 99.4 0 0 C>T G0S2 485 A 2981 25.4 65.18 32.41 0.2 0.03 0.07 2.18 A>AC G0S2 991 T 2865 26.6 0.14 99.72 0 0.1 0 0.03 T>C G0S2 1399 G 2804 27.5 99.64 0.07 0.25 0.04 0 0 G>A G0S2 4112 A 1830 25.8 0.05 99.78 0 0.16 0 0 A>C G0S2 4397 C 2210 25 0.05 0.09 0.09 99.77 0 0 C>T BMAL 597 A 1862 24.7 0.21 99.57 0 0.21 0 0 A>C BMAL 826 G 1563 25.2 99.74 0.13 0 0.06 0 0.06 G>A BMAL 986 C 1772 24 99.27 0.34 0.34 0.06 0 0 C>A BMAL 1229 A 2063 25.3 0.24 0.29 0.73 0.19 0 98.55 delA BMAL 1261 A 2000 26.2 0.15 0.05 99.7 0.1 0 0 A>G BMAL 1318 T 1809 25.8 0.06 0.17 99.56 0.22 0 0 T>G BMAL 1808 A 2129 26.5 0.19 99.77 0 0.05 0 0 A>C BMAL 2172 A 2140 20.1 5.7 0 0.09 0 0 94.21 delAA

149

Early 5 Ref. Ref. Gene Seq. Coverage Score A % C % G % T % Ins % Del % Mutation Call Nucl. Position BMAL 2173 A 2139 20.4 0.56 0.14 5.05 0.05 0.05 94.2 - BMAL 2413 T 2370 26.6 0.04 99.24 0.04 0.68 0 0 T>C BMAL 2944 A 2094 26.5 0.1 0.05 99.86 0 0 0 A>G BMAL 3131 G 2072 25.1 0.14 99.86 0 0 0 0 G>C BMAL 3344 T 2126 26 0 0 0 99.62 98.07 0.38 insT BMAL 3348 C 2123 26.5 0 0.38 0.05 99.58 0 0 C>T BMAL 4741 A 1552 25.3 0 0.06 99.81 0.13 0 0 A>G BMAL 5100 G 2228 26.6 0.04 99.91 0 0.04 0 0 G>C Clock1b 401 G 50 13.3 72 0 28 0 0 0 G>AG Clock1b 1394 T 78 14.8 0 0 0 100 35.9 0 insT Clock1b 1400 G 78 14.9 0 0 58.97 41.03 0 0 G>GT

Early 6 Ref. Ref. Gene Seq. Coverage Score A % C % G % T % Ins % Del % Mutation Call Nucl. Position dec2 523 G 6084 29.2 0.02 0.03 35.7 64.2 0 0.05 G>GT dec2 697 A 5199 18.5 40.51 0.08 0.13 59.26 0.88 0.02 A>AT dec2 698 A 5061 17.3 38.11 0.08 0.06 61.73 0.02 0.02 A>AT dec2 699 A 5055 17.3 38.02 0.02 0.06 61.88 0 0.02 A>AT dec2 701 A 5033 17.5 37.83 0.06 0.04 62.05 0 0.02 A>AT dec2 703 A 5017 17.9 37.51 0.04 0.08 59.58 0 2.79 A>AT dec2 1053 C 5814 28.5 58.72 41.23 0 0.03 0 0.02 C>AC dec2 1294 C 5210 28.4 0.12 41.52 0.23 58.14 0 0 C>CT Eed 279 T 1435 25.1 0 0 0 100 100 0 insT Eed 324 G 1587 22.4 0.19 56.46 43.23 0.06 0 0.06 G>CG Eed 629 T 2162 25.1 0 0 0 100 0 0 C>T Eed 2157 A 2535 24.9 18.15 0 81.78 0.08 0 0 A>G Eed 2178 A 2595 25.1 100 0 0 0 100 0 insA Eed 2375 A 2398 26.1 0 0 99.92 0.08 0 0 A>G Eed 2455 A 2357 25.7 20.32 0.08 79.55 0.04 0 0 A>G Eed 2597 T 2435 25 18.81 0.04 80.99 0.16 0.04 0 T>G Eed 2629 A 2129 25.6 19.21 0 80.7 0.05 0 0.05 A>G Eed 3028 T 2047 25.1 0 0 0 100 0 0 C>T Eed 3297 T 2396 26.7 0 0.04 0 47.16 0 52.8 delTTG Eed 3298 T 2380 26.4 0.04 0 0 46.81 0 53.15 - Eed 3299 G 2400 26.7 0.04 0.08 47.25 0.12 0 52.5 - Eed 3469 T 4287 29 0.79 41.31 0.44 57.34 0 0.12 T>CT Eed 3562 G 3546 24.3 39.65 0.25 59.81 0.2 0.03 0.08 G>AG

150

Early 6 Ref. Ref. Gene Seq. Coverage Score A % C % G % T % Ins % Del % Mutation Call Nucl. Position Eed 3588 A 3078 25.6 45.84 0.13 0.13 53.87 0.03 0.03 A>AT Eed 3759 T 2076 23.1 0 0 82.37 17.63 0 0 T>G Eed 3782 T 2157 25.2 0 0 99.86 0.14 0 0 T>G Eed 4041 A 1964 25.1 100 0 0 0 0 0 G>A Eed 4127 A 2069 25.1 100 0 0 0 0 0 G>A Eed 4162 T 2101 26.5 0 0 0 100 99.24 0 insT Eed 4215 C 2008 17 0.05 19.02 0.05 80.88 0 0 C>T Eed 4219 A 1932 17.2 0 0 99.95 0.05 0 0 A>G Eed 4222 T 2015 17.3 0.1 0.05 99.65 0.2 0 0 T>G Eed 4224 G 2009 17 99.7 0.1 0.1 0.1 0 0 G>A Eed 4249 T 1933 23.1 0 0 0 100 0 0 C>T Eed 4274 T 1898 25 0.11 99.74 0.05 0.11 0 0 T>C Eed 4593 G 2441 25.1 0 100 0 0 0 0 A>G Eed 4603 C 2452 27 99.88 0.04 0 0.08 0 0 C>A Eed 4824 T 2016 25.1 0 0 0 100 0 0 G>T Eed 4849 A 1939 24.7 15.94 0.05 0.1 83.91 0 0 A>T Eed 5074 A 1843 25.4 7.7 0 0 0 0.54 92.3 delAA Eed 5075 A 1849 26 47.16 0.11 0.05 0.16 0 52.51 - Eed 5107 C 1804 22.3 0.67 0.22 0.17 98.95 0 0 C>T GnRH3B 331 A 2926 27.6 48.5 0.07 0.07 51.37 0 0 A>AT GnRH3B 360 G 3237 27.4 50.57 0.19 49.21 0.03 0 0 G>AG GnRH3B 411 C 3402 27.9 0.15 49.44 0.03 50.38 0 0 C>CT GnRH3B 1210 T 343 19.3 47.81 0 0 52.19 0 0 T>AT G0S2 180 A 944 21.8 49.26 0.11 0.21 0 0 50.42 delATAGTGAT G0S2 181 T 955 22.6 0 0.1 0.1 49.84 0 49.95 - G0S2 182 A 957 22.6 49.95 0.1 0 0.1 0 49.84 - G0S2 183 G 980 23.1 0 0 51.33 0 0 48.67 - G0S2 184 T 989 23.4 0 0.1 0.2 51.47 0 48.23 - G0S2 185 G 992 23.7 0 0 51.92 0.1 0 47.98 - G0S2 186 A 1004 23.5 52.49 0 0 0 0 47.51 - G0S2 187 T 1007 23.5 0 0.2 0.79 51.64 0 47.37 - G0S2 485 A 3024 23.8 64.65 32.94 0.3 0.13 0.07 1.98 A>AC G0S2 909 C 2977 26 0.03 54.05 0.13 45.78 0 0 C>CT G0S2 991 T 2831 25.8 0.07 52.6 0 47.33 0 0 T>CT G0S2 1359 A 2917 27.6 47.41 0.14 0.1 52.35 0 0 A>AT G0S2 1399 G 2886 26.8 52.36 0 47.61 0.03 0.03 0 G>AG G0S2 1575 A 2440 26.7 50.94 0.04 48.52 0.37 0.08 0.12 A>AG G0S2 2476 T 3189 26.2 0.06 0 50.27 49.64 0 0.03 T>GT G0S2 2535 G 3435 27.1 50.28 0.06 49.52 0.12 0 0.03 G>AG

151

Early 6 Ref. Ref. Gene Seq. Coverage Score A % C % G % T % Ins % Del % Mutation Call Nucl. Position G0S2 2857 A 2822 26.1 53.51 0.11 0.07 46.31 0 0 A>AT G0S2 2874 A 2925 24.5 52.14 47.66 0.07 0.14 0 0 A>AC G0S2 2878 T 2861 24.2 0 48.23 0.03 51.73 0 0 T>CT G0S2 4005 T 2172 25.2 0 0 52.53 47.47 0 0 T>GT G0S2 4112 A 1925 26 0.26 99.74 0 0 0 0 A>C G0S2 4397 C 2294 26.5 0.04 49.96 0 50 0 0 C>CT G0S2 4420 A 2350 25 50.98 0 0.3 0.04 0 48.68 delATGACGGTC G0S2 4421 T 2344 25 0 0.21 0.13 50.81 0 48.85 - G0S2 4422 G 2376 25.9 0 0 51.81 0 0 48.19 - G0S2 4423 A 2386 26.1 51.84 0 0.17 0 0 47.99 - G0S2 4424 C 2389 26.1 0 52.03 0 0.04 0 47.93 - G0S2 4425 G 2389 26.2 0 0 51.99 0.08 0 47.93 - G0S2 4426 G 2390 26.4 0 0 52.01 0.08 0 47.91 - G0S2 4427 T 2392 26.4 0.04 0.21 0 51.88 0 47.87 - G0S2 4428 C 2392 26.4 0.13 52.13 0.04 0 0 47.7 - G0S2 4513 C 2100 25.1 0.05 49.29 0.05 50.62 0 0 C>CT G0S2 4551 G 2046 20.3 51.61 0.1 48.24 0.05 0 0 G>AG G0S2 4558 C 2073 20.5 0.24 48.05 0 51.71 0 0 C>CT G0S2 4637 T 1863 25.5 0.11 0.05 50.83 49.01 0 0 T>GT G0S2 4645 C 1842 25.8 0.22 50.27 0.05 49.4 0 0.05 C>CT BMAL 791 C 993 23.8 95.57 4.33 0.1 0 0 0 C>A BMAL 1229 A 1201 24.5 0.42 0.42 1.25 0.33 0 97.59 delA BMAL 1261 A 1140 22.6 0.09 0.18 99.74 0 0 0 A>G BMAL 1318 T 1046 23.8 0 0.1 99.9 0 0 0 T>G BMAL 1808 A 1406 24.3 0.28 99.72 0 0 0 0 A>C BMAL 2172 A 1178 21 6.28 0 0 0 0 93.72 delAA BMAL 2173 A 1177 21.2 0.68 0 5.52 0 0 93.8 - BMAL 2654 C 717 22.3 94.42 5.44 0.14 0 0 0 C>A BMAL 2733 G 386 10.5 0 0 63.21 0.26 8.29 36.53 delG BMAL 2764 A 357 19.3 4.76 0 0.28 94.96 0 0 A>T BMAL 3324 A 1268 23.4 7.41 0.08 0.24 92.27 0 0 A>T BMAL 3459 A 1059 24.1 6.04 0 0.09 93.58 0 0.28 A>T BMAL 3796 T 993 20.2 0 0 0.1 13.39 0 86.51 delTTGA BMAL 3797 T 994 20.7 0 0 0 13.68 0 86.32 - BMAL 3798 G 998 21.2 0 0.6 13.43 0 0 85.97 - BMAL 3799 A 997 21.7 13.34 0.1 0 0.6 0 85.96 - BMAL 4796 C 918 21.4 0.11 7.73 0 92.16 0 0 C>T BMAL 5877 A 948 22 8.23 0 0.11 90.72 0 0.95 A>T Kiss1r 152 C 2648 25.1 0 50.45 0.08 49.47 0 0 C>CT

152

Early 6 Ref. Ref. Gene Seq. Coverage Score A % C % G % T % Ins % Del % Mutation Call Nucl. Position Clock1b 465 G 94 15.8 0 0 42.55 57.45 0 0 G>GT Clock1b 1394 T 76 13.8 0 0 0 98.68 36.84 1.32 insT Clock1b 1400 G 76 14.7 1.32 0 56.58 40.79 0 1.32 G>GT

Early 7 Ref. Ref. Gene Seq. Coverage Score A % C % G % T % Ins % Del % Mutation Call Nucl. Position dec1 565 G 21524 30.7 51.13 0.07 48.76 0.04 0 0 G>AG dec1 953 T 19687 31.5 0.07 0.05 51.02 48.85 0 0.01 T>GT dec1 1362 G 26441 34.5 47.6 0.08 52.26 0.07 0 0 G>AG dec1 1535 G 23970 31.4 48.82 0.01 51.15 0.03 0 0 G>AG dec1 2056 G 23661 33.8 51.05 0.15 48.74 0.05 0 0.01 G>AG dec1 2501 T 56 11.2 0 98.21 0 0 0 1.79 T>C dec2 698 A 6629 29.5 0.18 0.02 0.08 99.73 0 0 A>T dec2 997 T 7953 29.2 0.03 0.03 49.55 50.38 0 0.01 T>GT Eed 1652 C 6431 28.6 0.06 55.59 44.05 0.3 0 0 C>CG Eed 1821 A 6822 30.6 51.45 0.1 48.36 0.06 0 0.03 A>AG Eed 2129 C 6527 26.7 0.05 51.39 0.03 48.52 0 0.02 C>CT Eed 2247 A 6885 29.9 5.52 0.07 0.04 94.36 0 0 A>T Eed 2455 A 6230 29 42.94 0.02 57 0.05 0 0 A>AG Eed 2629 A 6075 25.6 58.7 0.05 41.15 0.1 0 0 A>AG Eed 2703 G 6582 30.1 40.93 0.32 58.39 0.36 0 0 G>AG Eed 2768 T 6392 29.6 42.21 0.08 0.05 57.65 0 0.02 T>AT Eed 2967 C 6378 29.1 0.02 99.98 0 0 50.08 0 insC Eed 3304 T 6499 29.8 47.61 0 0.08 52.3 0 0.02 T>AT Eed 3317 G 6235 27.8 0.05 0.43 59.36 40.14 0 0.02 G>GT Eed 3370 A 5891 27.6 61.14 0.03 38.6 0.19 0.03 0.03 A>AG Eed 3469 T 11744 31.5 0.66 58.29 0.3 40.74 0.01 0.02 T>CT Eed 3532 T 10358 31.4 1.42 35.88 0.42 62.24 0.02 0.04 T>CT Eed 3595 C 5913 26.7 0.98 43.38 0.1 54.42 0.02 1.12 C>CT Eed 3724 T 4035 17.8 0.1 30.01 0.1 66.86 0 2.92 T>CT Eed 3725 T 4060 18 0 31.01 0.05 66.33 0.07 2.61 T>CT Eed 3726 T 4071 18 0.02 31.25 0.07 66.08 0 2.58 T>CT Eed 3730 A 4108 18.6 65.04 0.19 0.05 0 0 34.71 delA Eed 3759 T 4576 24.7 0.02 0.02 46.48 53.47 0 0 T>GT Eed 3782 T 5387 28.5 0.06 0.07 46.61 53.24 0 0.02 T>GT

153

Early 7 Ref. Ref. Gene Seq. Coverage Score A % C % G % T % Ins % Del % Mutation Call Nucl. Position Eed 4027 A 5842 29.7 49.64 50.22 0.09 0.05 0 0 A>AC Eed 4127 A 5993 29.2 47.41 0.1 52.39 0.1 0 0 A>AG Eed 4161 A 6084 28.6 47.34 0.26 51.64 0.76 0.25 0 A>AG Eed 4162 T 6084 29.9 0.02 0.03 0.03 99.92 49.42 0 insT Eed 4219 A 5641 28.1 52.97 0.04 46.89 0.11 0 0 A>AG Eed 4262 T 5759 29 0.14 53.43 0.03 46.4 0 0 T>CT Eed 4274 T 5844 26.7 0.07 47.84 0.02 52.07 0 0 T>CT Eed 4363 A 6275 30.3 0.05 0.02 99.82 0.1 0 0.02 A>G Eed 4418 T 5792 29.4 0.19 50.93 0.1 48.77 0 0 T>CT Eed 4466 C 4733 29 47.29 52.67 0.04 0 0 0 C>AC Eed 4491 C 4495 26.5 0.09 99.89 0 0 36.8 0.02 insC Eed 4497 A 5117 27.4 51.59 0.47 0 47.92 0.06 0.02 A>AT Eed 4602 A 6469 23.1 47.66 0.05 0.06 52.22 0 0.02 A>AT Eed 4603 C 6477 23.1 0.05 47.58 0.03 52.32 0 0.02 C>CT Eed 4648 T 6213 29.7 0.06 99.77 0.03 0.11 0 0.02 T>C Eed 4649 A 6211 30 0.05 99.81 0.03 0.11 0 0 A>C Eed 4673 T 5963 25.9 0.13 0.7 0.13 59.23 0 39.8 delTTAA Eed 4674 T 5966 25.6 0.07 0.74 0.35 59.37 0 39.47 - Eed 4675 A 5974 20.7 59.81 0.77 0.02 0.02 0 39.39 - Eed 4676 A 5942 20.9 59.32 0.15 0.98 0 0 39.55 - Eed 4678 A 6246 22.3 62.76 0.22 0.18 0.02 0 36.82 delAGTTA Eed 4679 G 6251 22 1.07 0.06 61.32 0.05 0 37.5 - Eed 4680 T 6249 22 1.2 0.26 0.19 60.63 0 37.72 - Eed 4681 T 6269 21.8 0.16 0.16 1.79 60.3 0.02 37.6 - Eed 4682 A 6331 22.1 60.57 0 2.23 0.02 0.03 37.18 - Eed 4685 C 6268 23 0.1 60.04 0.26 0.03 0 39.58 delCTCCCA Eed 4686 T 6194 23 0.19 0.1 0.15 59.51 0 40.05 - Eed 4687 C 6219 28.7 0.14 60.04 0.02 0 0 39.8 - Eed 4688 C 6126 29.5 0.03 60.24 0.02 0.08 0 39.63 - Eed 4689 C 6167 29 0.08 59.46 0 0.08 0 40.38 - Eed 4690 A 6121 29.2 58.88 0.08 0.2 0.08 0 40.76 - Eed 4704 C 5743 28.3 0.07 5.85 94.03 0.05 0 0 C>G Eed 4923 T 5975 29.1 46.56 0.2 0.15 53.09 0 0 T>AT Eed 4930 A 6148 27.5 6.46 0.02 0.02 93.51 0 0 A>T Eed 4935 G 6205 27.5 0.08 93.17 6.49 0.26 0 0 G>C Eed 5044 C 5590 23.9 46.19 53.65 0.11 0.05 0 0 C>AC Eed 5045 A 5693 23.5 53.86 0.11 45.97 0.05 0 0.02 A>AG Eed 5051 A 5649 23.2 54.35 0.23 0.07 45.35 0 0 A>AT Eed 5074 A 5719 29.6 2.38 0.02 0 0 0.12 97.6 delAAA

154

Early 7 Ref. Ref. Gene Seq. Coverage Score A % C % G % T % Ins % Del % Mutation Call Nucl. Position Eed 5075 A 5719 29.6 8.71 0.02 0 0.02 0 91.26 - Eed 5076 A 5734 30 41.66 0.03 0.17 0.12 0.02 58 - Eed 5138 T 5425 29.1 0.06 99.87 0 0.07 0 0 T>C Eed 5140 G 5429 29.7 0.07 0.15 0.11 99.67 0 0 G>T Eed 5185 A 4675 28.9 51.79 0.06 48.09 0.06 0 0 A>AG Eed 5264 C 3814 26 0.08 57.39 0.03 37.05 0.03 5.45 C>CT Eed 5269 C 3950 22.1 0.05 58.73 0.03 35.9 0 5.29 C>CT Eed 5275 C 4064 18.6 42.5 56.91 0.12 0.12 0.02 0.34 C>AC Eed 5283 G 4218 21.8 0.14 0.02 59.32 0.31 0 40.21 delG Eed 5285 C 4298 20.9 0.07 53.51 0 40 0.02 6.42 C>CT GnRH3B 353 A 4561 28.6 49.9 0.07 49.99 0.04 0 0 A>AG GnRH3B 794 T 4901 25.5 0.06 0.04 50.58 49.26 0 0.06 T>GT GnRH3B 1026 C 4691 26.3 51.18 48.69 0.04 0.04 0 0.04 C>AC G0S2 180 A 2774 25.8 50.94 0.14 0 0 0 48.92 delATAGTGAT G0S2 181 T 2798 26.1 0 0.04 0.04 51.39 0 48.53 - G0S2 182 A 2805 26.1 51.44 0.14 0.04 0 0 48.38 - G0S2 183 G 2896 26.2 0.07 0 52.97 0 0 46.96 - G0S2 184 T 2908 26.2 0.14 0.21 0.1 52.79 0 46.77 - G0S2 185 G 2919 26.3 0 0.03 53.34 0.03 0 46.59 - G0S2 186 A 2967 26 53.93 0.07 0.2 0.03 0 45.77 - G0S2 187 T 2973 26 0.03 0.13 0.37 53.78 0 45.68 - G0S2 991 T 6874 30.2 0.09 51.45 0.06 48.37 0 0.03 T>CT G0S2 1157 G 8080 30.2 0.04 0.04 50.17 49.72 0 0.04 G>GT G0S2 1399 G 6941 30 48.98 0.12 50.83 0.04 0.01 0.03 G>AG G0S2 1426 C 6726 29.9 0.12 49.97 0.01 49.88 0 0.01 C>CT G0S2 4112 A 5434 28.5 49.85 50.02 0.06 0.04 0 0.04 A>AC G0S2 4397 C 6772 29.9 0.09 49.11 0.01 50.78 0 0 C>CT BMAL 791 C 4050 28.7 99.83 0.05 0.07 0.02 0 0.02 C>A BMAL 1229 A 5354 29.7 0.17 0.37 0.62 0.21 0 98.64 delA BMAL 1261 A 4779 28.1 44.84 0.02 55.05 0.08 0 0 A>AG BMAL 1318 T 4068 28.3 0.05 0.17 53.05 46.71 0 0.02 T>GT BMAL 1786 A 4807 26.9 53.36 0.04 0.04 0.02 0 46.54 delAA BMAL 1787 A 4825 26.9 53.1 0.21 0.06 0.35 0 46.28 - BMAL 1808 A 5285 29 0.15 99.83 0 0.02 0 0 A>C BMAL 2172 A 4325 26.3 51.75 0.05 0 0 0 48.21 delAA BMAL 2173 A 4320 26.3 49.51 0.09 2.18 0.02 0 48.19 - BMAL 2413 T 5149 26.9 0.14 46.65 0.1 53.12 0 0 T>CT BMAL 2654 C 2920 24.5 58.8 41.13 0 0.07 0 0 C>AC BMAL 2764 A 1416 24 38.49 0.28 0 61.23 0 0 A>AT

155

Early 7 Ref. Ref. Gene Seq. Coverage Score A % C % G % T % Ins % Del % Mutation Call Nucl. Position BMAL 2944 A 5142 28.7 52.59 0.06 47.14 0.21 0 0 A>AG BMAL 3131 G 4495 27 0.02 47.65 52.3 0.02 0 0 G>CG BMAL 3324 A 5003 25.8 47.49 0.06 0.06 51.97 0 0.42 A>AT BMAL 3325 T 4999 25.8 0.02 52.03 0.06 47.87 0 0.02 T>CT BMAL 3459 A 4025 28.4 50.76 0.1 0.07 48.99 0 0.07 A>AT BMAL 3796 T 4058 25 0 0.12 0.1 56.58 0 43.2 delTTGA BMAL 3797 T 4059 25 0 0.05 0 56.81 0 43.14 - BMAL 3798 G 4075 25.3 0 0.74 56.22 0 0 43.04 - BMAL 3799 A 4069 25.3 55.59 0.25 0.15 0.79 0 43.23 - BMAL 4141 C 2502 18.1 55.08 44.68 0.08 0.16 0.12 0 C>AC BMAL 4167 T 2392 26.4 0.08 0.29 53.55 46.07 0 0 T>GT BMAL 4741 A 3691 26.7 51.72 0.11 48.14 0.03 0 0 A>AG BMAL 4753 T 3643 27.2 0.05 51.5 0.05 48.39 0 0 T>CT BMAL 4796 C 3630 25.5 0 50.39 0 49.61 0 0 C>CT BMAL 5353 G 4725 27.2 47.94 0.06 51.92 0.08 0 0 G>AG BMAL 5877 A 4069 26.4 49 0.17 0.1 50.63 0 0.1 A>AT Clock1a 1612 C 7463 30.3 50.62 49.27 0.03 0.08 0 0 C>AC Clock1a 1636 G 7455 28.1 0.08 50.56 49.23 0.13 0 0 G>CG Clock1a 3915 T 6363 30 49.54 0.05 0.02 50.4 0 0 T>AT Clock1a 4003 T 6326 28.5 0.02 0 51.5 48.48 0 0 T>GT Clock1a 4031 G 6301 30 51.55 0.08 48.31 0.05 0 0.02 G>AG Clock1a 4470 A 5920 29.7 49.92 0.07 49.92 0.1 0 0 A>AG Clock1a 6219 T 2937 26 46.75 0.41 0.03 48.96 0.07 3.85 T>AT Clock1b 401 G 96 14.4 51.04 0 48.96 0 0 0 G>AG

Early 8 Ref. Ref. Gene Seq. Coverage Score A % C % G % T % Ins % Del % Mutation Call Nucl. Position dec1 565 G 14369 29.1 51.59 0.04 48.31 0.03 0 0.02 G>AG dec1 953 T 11485 30.1 0.05 0.03 51.68 48.23 0 0.01 T>GT dec1 1362 G 18335 33.3 47.59 0.06 52.23 0.11 0 0.01 G>AG dec1 1535 G 16663 29.6 48.05 0.03 51.85 0.07 0 0 G>AG dec1 2056 G 18948 33.4 51.8 0.17 47.93 0.07 0 0.03 G>AG dec2 698 A 2711 26.5 61.01 0.11 0.07 38.8 0.04 0 A>AT Eed 273 C 2807 27.2 0.04 69.08 0.04 30.82 0 0.04 C>CT Eed 279 T 2802 26.4 0 0 0 53.57 0 46.43 delT Eed 289 C 2821 27.2 30.45 69.48 0.04 0.04 0 0 C>AC Eed 324 G 3097 25.3 0.03 53.66 46.11 0.16 0 0.03 G>CG

156

Early 8 Ref. Ref. Gene Seq. Coverage Score A % C % G % T % Ins % Del % Mutation Call Nucl. Position Eed 366 T 3264 28 0 30.39 0.06 69.52 0 0.03 T>CT Eed 367 T 3266 28 0.12 0.06 30.4 69.38 0 0.03 T>GT Eed 485 T 3468 26.2 0.26 0.29 30.68 68.77 0 0 T>GT Eed 629 T 4056 27.9 0.1 47.39 0.02 52.47 0 0.02 T>CT Eed 1320 G 4412 27.9 0.11 0.14 69.51 30.05 0 0.18 G>GT Eed 1566 G 3749 26.2 0 30.83 68.98 0.19 0.03 0 G>CG Eed 1720 T 3644 26.9 0.03 0.16 32 67.81 0 0 T>GT Eed 2178 A 4779 29.3 52.44 0.59 0.06 0 0.04 46.91 delA Eed 2375 A 3907 24 48.17 0.05 51.75 0.03 0 0 A>AG Eed 2455 A 4380 28.7 0.21 0.05 99.68 0.07 0 0 A>G Eed 2629 A 4040 25.8 48.79 0.02 50.94 0.07 0 0.17 A>AG Eed 2855 C 4094 26.4 0.15 66.29 0.02 33.54 0 0 C>CT Eed 3028 T 4220 25.4 0.02 31.54 0.05 68.39 0 0 T>CT Eed 3236 T 4249 27.7 0 53.05 0.07 46.88 0 0 T>CT Eed 3297 T 4139 27.7 0 0.05 0.07 48.1 0 51.78 delTTG Eed 3298 T 4105 27.9 0.02 0 0.05 47.77 0 52.16 - Eed 3299 G 4081 28.5 0.07 0.17 47.44 0.02 0 52.29 - Eed 3304 T 4097 27.9 45.03 0.02 0.05 54.77 0 0.12 T>AT Eed 3469 T 8274 30.6 0.79 46.22 0.42 52.51 0 0.06 T>CT Eed 3532 T 7768 30.1 0.54 36.01 0.37 63.04 0 0.04 T>CT Eed 3595 C 5441 27.1 0.17 58.98 0.07 40.38 0 0.4 C>CT Eed 3759 T 3669 23.5 0 0.11 58.63 41.26 0 0 T>GT Eed 3782 T 3685 28.4 0.08 0 57.88 42.04 0 0 T>GT Eed 4041 A 3239 24.6 53.26 0 46.68 0.06 0 0 A>AG Eed 4127 A 3797 27.1 53.88 0.03 46.01 0.08 0 0 A>AG Eed 4161 A 3835 28 11.21 0 88.71 0.08 0.1 0 A>G Eed 4162 T 3833 28.6 0 0 0 100 87.53 0 insT Eed 4215 C 3711 18.4 0.05 42.68 0.03 57.24 0 0 C>CT Eed 4219 A 3365 17.9 33.14 0.09 66.75 0 0 0.03 A>AG Eed 4222 T 3465 17.1 0.06 0.06 53.77 46 0 0.12 T>GT Eed 4224 G 3439 17.1 53.65 0.15 46.18 0.03 0 0 G>AG Eed 4249 T 3464 26.8 0.12 45.18 0.03 54.68 0 0 T>CT Eed 4262 T 3595 26.3 0.06 32.21 0.11 67.62 0 0 T>CT Eed 4274 T 3700 27.3 0.03 67.84 0 32.14 0 0 T>CT Eed 4363 A 3878 28.3 68.54 0.08 31.25 0.13 0 0 A>AG Eed 4418 T 3664 27 0.25 31.52 0.44 67.79 0 0 T>CT Eed 4580 G 3994 26.7 0.1 0.03 69.35 30.52 0 0 G>GT Eed 4593 G 3971 22.8 44.62 0.05 55.28 0.05 0 0 G>AG Eed 4603 C 3976 6.7 54.38 0.13 0.08 45.27 0 0.15 C>AT

157

Early 8 Ref. Ref. Gene Seq. Coverage Score A % C % G % T % Ins % Del % Mutation Call Nucl. Position Eed 4648 T 4063 27 0.07 47.28 0.05 52.6 0 0 T>CT Eed 4649 A 4063 27 52.6 47.23 0.1 0.07 0 0 A>AC Eed 4791 T 3195 27.6 0.09 71.33 0.06 28.51 0 0 T>C Eed 4824 T 3288 25.1 0 0 0 100 0 0 G>T Eed 4849 A 3422 26.7 47.31 0.06 0.06 52.4 0 0.18 A>AT Eed 5074 A 3874 28 11.02 0 0.1 0 0.98 88.87 delAA Eed 5075 A 3880 28.6 58.58 0 0.13 0.03 0 41.26 - Eed 5107 C 3663 27.3 0.74 46.49 0.05 52.69 0 0.03 C>CT Eed 5138 T 3334 26.1 0.09 45.65 0.06 54.2 0 0 T>CT Eed 5140 G 3305 26.1 0.15 0.06 54.22 45.57 0 0 G>GT GnRH3B 274 C 2031 25.3 40.37 59.58 0.05 0 0 0 C>AC GnRH3B 794 T 3979 28.3 0.05 0 99.85 0.1 0 0 T>G GnRH3B 913 A 2676 24.5 44.69 0.07 55.16 0.07 0 0 A>AG GnRH3B 1210 T 383 19.8 57.96 0 0.26 41.78 0 0 T>AT G0S2 180 A 1506 25.1 48.61 0 0 0.2 0 51.2 delATAGTGAT G0S2 181 T 1517 24.8 0 0 0 49.11 0 50.89 - G0S2 182 A 1517 24.9 48.98 0.07 0.07 0 0 50.89 - G0S2 183 G 1553 24.9 0 0 50.16 0.06 0 49.77 - G0S2 184 T 1562 24.7 0.19 0.32 0 50 0 49.49 - G0S2 185 G 1566 25 0 0 50.7 0 0 49.3 - G0S2 186 A 1591 25.3 51.23 0.06 0.13 0.06 0 48.52 - G0S2 187 T 1597 25.3 0 0.06 0.75 50.85 0 48.34 - G0S2 1157 G 4672 28.4 0.02 0.02 51.26 48.69 0 0 G>GT G0S2 1399 G 3909 27.5 50.01 0.2 49.68 0.1 0 0 G>AG G0S2 1426 C 3844 27.4 0.18 51.12 0 48.65 0 0.05 C>CT G0S2 2476 T 4106 27.3 0 0 49.49 50.51 0 0 T>GT G0S2 2535 G 4607 27.5 49.66 0.07 50.21 0.07 0 0 G>AG G0S2 2857 A 4398 28.1 49.25 0.16 0.2 50.39 0 0 A>AT G0S2 2874 A 4339 26.6 49.04 50.8 0.09 0.07 0 0 A>AC G0S2 2878 T 4199 26.2 0.05 50.85 0.07 49.04 0 0 T>CT G0S2 4005 T 3361 26.7 0.03 0.03 47.9 52.04 0 0 T>GT G0S2 4112 A 2933 25.1 50.77 49.06 0.1 0.07 0 0 A>AC G0S2 4301 C 2533 26.3 0.08 54.6 0 45.32 0 0 C>CT G0S2 4420 A 3746 25.9 49.81 0.05 0.03 0.03 0 50.08 delATGACGGTC G0S2 4421 T 3739 26.2 0.03 0.03 0 49.77 0 50.17 - G0S2 4422 G 3775 26.5 0 0 50.3 0 0 49.7 - G0S2 4423 A 3778 26.8 50 0.08 0.26 0 0 49.66 - G0S2 4424 C 3781 26.8 0.03 50.28 0 0.08 0 49.62 - G0S2 4425 G 3780 26.8 0.11 0 50.21 0.11 0 49.58 -

158

Early 8 Ref. Ref. Gene Seq. Coverage Score A % C % G % T % Ins % Del % Mutation Call Nucl. Position G0S2 4426 G 3779 26.8 0.03 0 50.25 0.08 0 49.64 - G0S2 4427 T 3781 26.8 0.03 0.05 0.24 50.07 0 49.62 - G0S2 4428 C 3782 26.8 0.08 50.26 0 0.08 0 49.58 - G0S2 4513 C 3303 26.1 0.09 48.56 0.06 51.29 0 0 C>CT G0S2 4551 G 3066 22.5 51.27 0 48.66 0.03 0 0.03 G>AG G0S2 4558 C 3038 21.6 0.1 49.47 0 50.43 0 0 C>CT G0S2 4637 T 2781 27.2 0.07 0.07 50.02 49.84 0 0 T>GT G0S2 4645 C 2764 26.6 0.11 49.6 0.11 50.18 0 0 C>CT BMAL 2172 A 4412 23.5 3.22 0 0 0 0 96.78 delAA BMAL 2173 A 4415 23.8 0.2 0.11 2.97 0.09 0 96.63 - BMAL 2413 T 6783 27.8 0.03 45.75 0.12 54.11 0 0 T>CT BMAL 2654 C 4014 26.7 62.26 37.67 0.05 0.02 0.02 0 C>AC BMAL 2733 G 2201 10.9 0 0.09 68.65 0.23 17.95 31.03 delG BMAL 2764 A 2320 25.8 34.83 0.09 0.22 64.87 0 0 A>AT BMAL 2944 A 7522 30 52.88 0.03 46.93 0.15 0 0.01 A>AG BMAL 3131 G 6870 28.4 0.03 47.32 52.58 0.06 0 0.01 G>CG BMAL 3324 A 7251 30.7 46.46 0.29 0.15 52.93 0 0.17 A>AT BMAL 3344 T 6765 26.9 0.01 0.1 0.1 99.69 45.51 0.09 insT BMAL 3348 C 6734 27.5 0.07 53.4 0.03 46.5 0 0 C>CT BMAL 3459 A 5221 27.6 50.62 0.15 0.06 49.09 0 0.08 A>AT BMAL 3796 T 6379 27 0 0.09 0.02 56.48 0 43.41 delTTGA BMAL 3797 T 6373 27 0 0.16 0.05 56.38 0 43.42 - BMAL 3798 G 6394 27.3 0.02 0.52 56.19 0.06 0 43.21 - BMAL 3799 A 6388 27.3 55.73 0.16 0.02 0.58 0 43.52 - BMAL 4741 A 6166 30.2 49.37 0.16 50.39 0.05 0 0.03 A>AG BMAL 4796 C 6241 27.2 0.11 50.55 0.05 49.25 0 0.03 C>CT BMAL 5100 G 7675 25.3 0.05 48.9 50.98 0.07 0 0 G>CG BMAL 5877 A 5954 27.9 48.52 0.15 0.12 51.18 0 0.03 A>AT Clock1b 1394 T 155 16.6 0 0 0 100 40.65 0 insT Clock1b 1400 G 152 14.3 0 0 51.32 48.68 0 0 G>GT Kiss2 532 G 9543 31.1 0.04 47.61 52.3 0.04 0 0.01 G>CG

159

Early 9 Ref. Ref. Gene Seq. Coverage Score A % C % G % T % Ins % Del % Mutation Call Nucl. Position dec1 396 A 5241 29.3 42.4 0 57.57 0.04 0 0 A>AG dec1 953 T 6379 28.8 0.08 0.02 54.8 45.09 0 0.02 T>GT dec1 1362 G 9978 31.5 44.8 0.05 55.08 0.07 0.01 0 G>AG dec1 1535 G 9122 30.9 99.53 0.02 0.42 0.03 0 0 G>A dec1 2435 G 2370 21.2 46.58 0.3 52.95 0.17 0 0 G>AG dec2 990 A 2752 27.1 50.25 0.07 0.04 0 0 49.64 delATCAAATTTGAT dec2 991 T 2754 27.1 0.04 0.04 0 50.25 0 49.67 - dec2 992 C 2748 27.1 0.04 50.11 0.11 0 0 49.75 - dec2 993 A 2741 27.1 50.13 0 0 0 0 49.87 - dec2 994 A 2751 27.1 50.02 0.07 0.07 0.15 0 49.69 - dec2 995 A 2752 27.1 50.25 0.04 0 0 0 49.71 - dec2 996 T 2780 27.2 0 0 0.07 50.72 0 49.21 - dec2 997 T 2765 26.9 0 0 0.07 50.45 0 49.48 - dec2 998 T 2769 26.9 0 0.11 0.11 50.45 0 49.33 - dec2 999 G 2767 26.9 0.04 0 50.52 0.04 0 49.4 - dec2 1000 A 2770 26.9 50.43 0.07 0.07 0.04 0 49.39 - dec2 1001 T 2770 27.1 0 0.22 0 50.47 0 49.31 - Eed 279 T 2125 26.2 0 0.05 0 29.46 0 70.49 delT Eed 324 G 2441 23.7 0 30.27 69.52 0.16 0 0.04 G>CG Eed 629 T 3674 27.3 0.14 70.63 0.05 29.18 0 0 T>C Eed 1652 C 3725 27.9 0 29.42 70.12 0.46 0 0 C>G Eed 2080 C 3984 23.8 0.05 48.57 0.03 0 0 51.36 delC Eed 2084 A 4067 23 47.38 0.07 52.37 0.12 0 0.05 A>AG Eed 2178 A 5022 28.9 28.26 0.46 0.02 0 0 71.27 delA Eed 2435 A 4094 27.9 54.62 0.12 45.19 0.07 0 0 A>AG Eed 2455 A 4149 27.9 24.78 0.02 75.01 0.19 0 0 A>G Eed 2629 A 3852 27.6 2.1 0 97.77 0.1 0 0.03 A>G Eed 2703 G 3770 28.2 67.48 0.34 31.7 0.45 0 0.03 G>AG Eed 2768 T 3628 28 71.72 0.22 0.06 27.98 0 0.03 T>A Eed 3028 T 3782 25.6 0 71.31 0.03 28.64 0 0.03 T>C Eed 3370 A 3726 25.6 29.41 0.05 70.45 0.08 0.03 0 A>G Eed 3469 T 6622 29.5 1.24 56.58 0.5 41.23 0.05 0.45 T>CT Eed 3532 T 6127 29 1.16 33.52 0.67 64.34 0 0.31 T>CT Eed 3562 G 5423 24.4 33.97 0.11 65.2 0.26 0 0.46 G>AG Eed 3588 A 4934 26.2 47.06 0.18 0.2 51.95 0 0.61 A>AT Eed 3702 C 4091 27.6 0.15 57.93 0.02 41.9 0 0 C>CT Eed 3759 T 3700 21.2 0.19 0.08 59.57 40.14 0 0.03 T>GT Eed 3782 T 3959 27.5 0.05 0.05 30.99 68.91 0 0 T>GT

160

Early 9 Ref. Ref. Gene Seq. Coverage Score A % C % G % T % Ins % Del % Mutation Call Nucl. Position Eed 4011 T 3752 27.3 0.03 42.56 0.16 57.25 0.05 0 T>CT Eed 4018 T 3692 22.8 0.08 44.66 0.05 55.2 0 0 T>CT Eed 4027 A 3705 27.6 55.95 43.91 0.08 0.05 0.03 0 A>AC Eed 4041 A 3656 26.1 27.02 0 72.89 0.08 0 0 A>G Eed 4127 A 4044 25.1 100 0 0 0 0 0 G>A Eed 4161 A 4021 28.2 40.24 0.17 58.99 0.57 0.17 0.02 A>AG Eed 4162 T 4021 28.2 0.02 0.02 0.05 99.9 57.05 0 insT Eed 4215 C 3871 27.7 0.03 67.3 0.1 32.58 0 0 C>CT Eed 4219 A 3622 27.1 28.02 0.11 71.84 0.03 0 0 A>G Eed 4249 T 3876 27.7 0.08 70.98 0.08 28.82 0 0.05 T>C Eed 4274 T 4090 27.3 0.05 71.54 0.05 28.36 0 0 T>C Eed 4363 A 4309 27.8 29.26 0.07 70.53 0.14 0 0 A>G Eed 4556 A 4819 24.9 31.27 0 68.52 0.21 0 0 A>AG Eed 4593 G 5258 29.3 69.3 0.1 30.49 0.11 0 0 G>AG Eed 4602 A 5195 24 69.24 0.13 0.06 30.55 0 0.02 A>AT Eed 4603 C 5226 29 70.26 29.31 0.08 0.17 0 0.17 C>A Eed 4648 T 5291 27.6 0.04 69.67 0.09 30.2 0.02 0 T>CT Eed 4649 A 5291 27.3 30.3 69.61 0.02 0.08 0 0 A>AC Eed 4673 T 5031 26.5 0.06 0.7 0.14 32.06 0 67.04 delTTAA Eed 4674 T 5030 26.8 0.04 0.8 0.54 32.09 0 66.54 - Eed 4675 A 5031 21.5 32.7 0.8 0.02 0.04 0 66.45 - Eed 4676 A 5009 21.2 32.1 0.22 0.96 0 0 66.72 - Eed 4678 A 5127 22.7 35.6 0.25 0.21 0 0 63.94 delAGTTA Eed 4679 G 5129 22.5 1.15 0.06 33.83 0.04 0.02 64.92 - Eed 4680 T 5133 22.5 1.17 0.04 0.21 33.26 0 65.32 - Eed 4681 T 5169 22 0.17 0.04 1.92 33.06 0 64.81 - Eed 4682 A 5207 22 33.19 0.04 2.44 0.02 0 64.32 - Eed 4685 C 5181 23.2 0.08 32.79 0.17 0.08 0 66.88 delCTCCCA Eed 4686 T 5161 23.2 0.23 0.14 0.08 32.44 0 67.12 - Eed 4687 C 5165 28.6 0 32.82 0.06 0.06 0 67.07 - Eed 4688 C 5145 29.5 0.12 33.84 0.08 0 0 65.97 - Eed 4689 C 5157 29.2 0.08 32.65 0 0.02 0 67.25 - Eed 4690 A 5137 29.2 32.2 0.02 0.18 0.08 0 67.53 - Eed 4704 C 5045 23.8 0.08 31.56 68.34 0.02 0 0 C>CG Eed 4718 C 4938 25.6 38.74 61.18 0.02 0.06 0 0 C>AC Eed 4791 T 5090 27.8 0.16 61.98 0.04 37.82 0 0 T>CT Eed 4824 T 5137 27.2 0.08 0 68.99 30.93 0.02 0 T>GT Eed 4923 T 4565 26.2 69.59 0.22 0.35 29.81 0 0.02 T>A

161

Early 9 Ref. Ref. Gene Seq. Coverage Score A % C % G % T % Ins % Del % Mutation Call Nucl. Position Eed 4930 A 4628 28.9 32.93 0.06 0.06 66.92 0 0.02 A>AT Eed 4935 G 4786 9.6 0.15 30.92 30.05 38.88 0 0 G>TC Eed 5074 A 3720 27.2 8.25 0 0 0.03 0.73 91.72 delAA Eed 5075 A 3722 28.2 44.57 0.03 0.16 0.05 0 55.19 - Eed 5138 T 3309 27.7 0.09 70.66 0.09 29.16 0 0 T>C Eed 5140 G 3307 27.5 0.09 0.18 29.21 70.52 0 0 G>T GnRH3B 331 A 4669 28.9 49.2 0.06 0.11 50.63 0 0 A>AT GnRH3B 360 G 4878 29.4 50.43 0.02 49.53 0.02 0 0 G>AG GnRH3B 411 C 5121 29 0.14 50.42 0.06 49.38 0 0 C>CT GnRH3B 1210 T 573 21.2 48.17 0 0 51.83 0 0 T>AT G0S2 1359 A 3861 27.7 51.41 0.36 0.1 48.12 0 0 A>AT G0S2 1399 G 3887 26.6 47.11 0.03 52.79 0.08 0 0 G>AG G0S2 1519 G 3783 26 44.38 0.08 55.09 0.29 0 0.16 G>AG G0S2 2424 A 4278 24.9 50.02 49.91 0.05 0.02 0 0 A>AC G0S2 2427 T 4260 24.8 0 49.84 0.02 50.14 0 0 T>CT G0S2 2476 T 4318 25.1 0 0 0 100 0 0 G>T G0S2 2512 G 3960 26.6 49.49 0.1 50.33 0.08 0 0 G>AG G0S2 2535 G 4111 25.1 0 0 100 0 0 0 A>G G0S2 2583 C 3970 28.4 0.18 51.71 0.13 47.98 0 0 C>CT G0S2 2628 A 4075 28.2 50.58 49.03 0.25 0.12 0 0.02 A>AC G0S2 2857 A 3143 27 49.98 0.22 0.22 49.57 0 0 A>AT G0S2 2874 A 3235 27.6 0.19 99.69 0.09 0.03 0 0 A>C G0S2 2878 T 3137 26.9 0.03 99.78 0.03 0.16 0 0 T>C G0S2 3969 T 2316 21.5 48.32 0.17 0.17 51.34 0 0 T>AT G0S2 3978 C 2360 21.5 2.33 52.92 0.13 0.17 0.17 44.45 delC G0S2 3979 C 2362 21.7 0.13 99.66 0.04 0.17 51.69 0 insT G0S2 4005 T 2413 25.1 0 0 0 100 0 0 G>T G0S2 4112 A 2073 26.2 0.19 99.66 0 0.1 0 0.05 A>C G0S2 4301 C 1923 23.7 0.05 53.82 0.1 45.97 0 0.05 C>CT G0S2 4420 A 2844 27.3 0.14 0 0.11 0 0 99.75 delATGACGGTC G0S2 4421 T 2844 27 0 0.11 0 0.07 0 99.82 - G0S2 4422 G 2841 27.6 0 0 0.04 0 0 99.96 - G0S2 4423 A 2841 27 0.07 0 0 0 0 99.93 - G0S2 4424 C 2841 27.6 0 0.04 0 0 0 99.96 - G0S2 4425 G 2841 27.6 0 0 0.18 0 0 99.82 - G0S2 4426 G 2842 27.6 0.04 0 0 0 0 99.96 - G0S2 4427 T 2843 26.7 0.07 0 0 0.04 0 99.89 - G0S2 4428 C 2843 26.2 0.07 0.21 0 0 0 99.72 -

162

Early 9 Ref. Ref. Gene Seq. Coverage Score A % C % G % T % Ins % Del % Mutation Call Nucl. Position G0S2 4513 C 2491 25.7 0 51.59 0.08 48.33 0 0 C>CT G0S2 4550 T 2270 20.3 0.13 50.93 0 48.9 0 0.04 T>CT G0S2 4551 G 2265 20.1 50.6 0.04 49.32 0.04 0 0 G>AG G0S2 4558 C 2179 20 0.23 50.3 0.05 49.43 0 0 C>CT G0S2 4637 T 1995 20.1 0 0 0 100 0 0 G>T G0S2 4645 C 1983 26.3 0 53.61 0.05 46.34 0 0 C>CT BMAL 597 A 1729 24.2 54.31 45.34 0 0.29 0 0.06 A>AC BMAL 791 C 1652 24 56.96 42.92 0.06 0.06 0 0 C>AC BMAL 826 G 1601 24.9 45.91 0 54.09 0 0 0 G>AG BMAL 986 C 1907 22.4 46.88 52.7 0.21 0.16 0 0.05 C>AC BMAL 1229 A 2063 26.1 0.24 0.24 1.21 0.29 0 98.01 delA BMAL 1261 A 1951 26.2 0 0 99.9 0.1 0 0 A>G BMAL 1318 T 1730 25.4 0.17 0.12 99.13 0.4 0.06 0.17 T>G BMAL 1808 A 1891 26.1 0 99.84 0 0.11 0 0.05 A>C BMAL 2172 A 1674 23.1 4.24 0 0 0 0 95.76 delAA BMAL 2173 A 1676 23.1 0.12 0.18 4 0.06 0 95.64 - BMAL 2413 T 1821 23.1 0 43.33 0.11 56.56 0 0 T>CT BMAL 2654 C 1013 21 61.4 38.5 0 0.1 0.1 0 C>AC BMAL 2764 A 588 21.8 33.67 0 0.17 66.16 0 0 A>AT BMAL 2944 A 2249 26.5 50.96 0.04 48.87 0.13 0 0 A>AG BMAL 3131 G 2088 23.7 0 46.5 53.3 0.1 0 0.1 G>CG BMAL 3324 A 1997 26.2 44.67 0.3 0.25 54.73 0 0.05 A>AT BMAL 3344 T 1876 20.3 0.05 0.32 0 99.31 43.71 0.32 insT BMAL 3348 C 1869 20.8 0 55.27 0 44.68 0 0.05 C>CT BMAL 3459 A 1583 24.2 45.17 0.06 0 54.58 0 0.19 A>AT BMAL 3796 T 1395 23.3 0 0 0.14 54.84 0 45.02 delTTGA BMAL 3797 T 1394 23.3 0.14 0.07 0.07 54.66 0 45.05 - BMAL 3798 G 1397 23.3 0.07 0.36 54.55 0.07 0 44.95 - BMAL 3799 A 1394 23.3 53.87 0.14 0.14 0.43 0 45.41 - BMAL 4741 A 1307 23.8 50.34 0.23 49.35 0.08 0 0 A>AG BMAL 4796 C 1393 22 0.14 46.88 0.07 52.91 0 0 C>CT BMAL 5100 G 1945 20.1 0.26 45.55 54.09 0.1 0 0 G>CG BMAL 5877 A 1577 23.6 48.7 0.25 0.44 50.54 0 0.06 A>AT Clock1b 401 G 72 13.6 54.17 0 45.83 0 0 0 G>AG Clock1b 1394 T 113 14.9 0 0 0 100 41.59 0 insT Clock1b 1400 G 111 15.3 0 0 45.05 52.25 0 2.7 G>GT

163

Early 10 Ref. Ref. Seq. Coverag Scor Ins Gene Nucl A % C % G % T % Del % Mutation Call Positi e e % . on dec1 1362 G 5517 28.8 99.2 0.18 0.56 0.05 0 0 G>A dec1 1535 G 5066 28.6 99.59 0.02 0.38 0.02 0 0 G>A dec2 698 A 1637 24.6 58.34 0.18 0.06 41.42 0 0 A>AT dec2 997 T 1717 24.4 0 0.06 40.01 59.93 0 0 T>GT Eed 1652 C 3622 27.3 0 24.96 74.49 0.52 0 0.03 C>G Eed 2247 A 3377 27.2 22.65 0.03 0.09 77.23 0 0 A>T Eed 2508 G 3269 26 0.09 0 30.25 0 0 69.65 delGTCAGGATACA Eed 2509 T 3269 26 0.09 0.03 0.03 30.16 0 69.68 - Eed 2510 C 3268 26 0 30.26 0 0 0 69.74 - Eed 2511 A 3262 26 30.1 0 0.03 0 0 69.87 - Eed 2512 G 3250 26.3 0.06 0 29.57 0 0 70.37 - Eed 2513 G 3241 22 28.91 0.12 0.43 0 0 70.53 - Eed 2514 A 3235 26.8 29.21 0.12 0 0 0 70.66 - Eed 2515 T 3230 26.8 0.06 0 0 29.04 0 70.9 - Eed 2516 A 3225 27.9 0.56 0.4 0.03 0.03 0.09 98.98 - Eed 2517 C 3225 27.1 0.12 28.87 0 0.16 0 70.85 - Eed 2518 A 3227 27.1 0.34 0.03 0.12 0.06 0 99.44 - Eed 2509 T 3269 26 0.09 0.03 0.03 30.16 0 69.68 - Eed 2513 G 3241 22 28.91 0.12 0.43 0 0 70.53 - 71.1 Eed 2530 A 3469 18.8 72.76 0 0 0.35 26.9 insA 2 Eed 2531 C 3468 19 72.35 0.55 0.12 0.06 0.12 26.93 C>A Eed 2538 C 3427 19.4 0.03 0.38 0.15 72.69 0 26.76 C>T Eed 2629 A 3133 23 25.38 0.03 74.43 0 0 0.16 A>G Eed 2703 G 3419 27.3 72.83 0.47 26.26 0.44 0 0 G>A Eed 2768 T 3486 28.1 77.54 0.06 0.11 22.2 0 0.09 T>A Eed 3236 T 3303 27.7 0.06 74.93 0.03 24.98 0 0 T>C Eed 3304 T 3457 28.1 99.91 0 0.06 0.03 0 0 T>A Eed 3317 G 3339 26.3 0.03 0.3 25.01 74.66 0 0 G>T Eed 3370 A 3290 26.6 27.66 0.06 71.95 0.3 0.06 0.03 A>G Eed 3469 T 7544 29.1 1.3 53.38 0.36 44.87 0.03 0.09 T>CT Eed 3532 T 7167 30.8 0.64 33.32 0.82 65.09 0 0.13 T>CT Eed 3595 C 4405 25.5 0.25 31.46 0.14 66.79 0 1.36 C>CT Eed 3759 T 2701 22.5 0.04 0.04 77.97 21.95 0 0 T>G 98.9 Eed 4162 T 2970 27.4 0 0 0 100 0 insT 6 Eed 4262 T 3115 26.1 0.19 99.49 0 0.32 0 0 T>C Eed 4363 A 3295 26.9 0.06 0 99.91 0.03 0 0 A>G Eed 4418 T 3271 27.1 0 99.72 0 0.28 0 0 T>C

164

Early 10 Ref. Ref. Seq. Coverag Scor Ins Gene Nucl A % C % G % T % Del % Mutation Call Positi e e % . on Eed 4497 A 3318 24.6 25.11 0.18 0.15 74.56 0 0 A>T Eed 4556 A 3802 26.5 26.85 0.05 72.94 0.16 0 0 A>G Eed 4648 T 4248 28.6 0.02 99.76 0 0.16 0 0.05 T>C Eed 4649 A 4254 28.9 0.07 99.88 0 0.02 0 0.02 A>C Eed 4673 T 4038 26.1 0.02 1.02 0.1 28.93 0 69.94 delTTAA Eed 4674 T 4040 26.4 0.02 0.99 0.67 29.01 0 69.31 - Eed 4675 A 4052 21.2 29.84 1.09 0 0.02 0 69.05 - Eed 4676 A 4023 21.1 29.13 0.2 1.14 0.02 0 69.5 - Eed 4678 A 4126 22.6 33.16 0.17 0.15 0 0 66.53 delAGTTA Eed 4679 G 4127 22.4 1.48 0 30.94 0.02 0 67.56 - Eed 4680 T 4131 22.4 1.53 0.12 0.19 30.4 0 67.76 - Eed 4681 T 4162 22.2 0.19 0.05 2.35 30.11 0.02 67.3 - Eed 4682 A 4193 22.2 30.31 0.02 2.98 0 0 66.68 - Eed 4685 C 4150 23.1 0.02 29.9 0.24 0 0 69.83 delCTCCCA Eed 4686 T 4131 23.3 0.31 0.05 0.02 29.46 0 70.15 - Eed 4687 C 4132 28.8 0 29.84 0 0.05 0 70.11 - Eed 4688 C 4115 28.2 0.02 30.81 0 0 0 69.16 - Eed 4689 C 4118 28.2 0.02 29.55 0 0 0 70.42 - Eed 4690 A 4104 27.9 29.26 0.05 0 0.02 0 70.66 - Eed 4704 C 3902 24.2 0.1 26.32 73.55 0 0 0.03 C>G Eed 4791 T 3735 22.7 0.16 74.7 0 25.14 0 0 T>C Eed 4923 T 3622 27.1 71.87 0.22 0.33 27.58 0 0 T>A Eed 4930 A 3529 20.6 26.58 0.03 0.03 73.36 0 0 A>T Eed 4935 G 3611 25.2 0.06 74.47 25.39 0.08 0 0 G>C Eed 5051 A 2940 26.2 22.93 0.03 0 77.04 0 0 A>T Eed 5074 A 2950 26.2 3.66 0 0 0 0.17 96.34 delAA Eed 5075 A 2953 26.2 20.59 0 0.2 0.07 0 79.14 - Eed 5138 T 2752 27.4 0.18 99.78 0 0.04 0 0 T>C Eed 5140 G 2742 25.7 0 0.22 0.07 99.71 0 0 G>T GnRH3B 274 C 1784 24.6 46.97 53.03 0 0 0 0 C>AC GnRH3B 794 T 2929 27.5 0 0.03 99.93 0.03 0 0 T>G GnRH3B 913 A 2171 24.9 42.51 0 57.44 0.05 0 0 A>AG GnRH3B 1210 T 265 19.1 54.34 0 0 45.66 0 0 T>AT G0S2 180 A 1297 24.8 0.23 0 0 0 0 99.77 delATAGTGAT G0S2 181 T 1297 24.8 0 0 0 0 0 100 - G0S2 182 A 1297 24.8 0 0 0 0 0 100 - G0S2 183 G 1297 24.8 0 0 0.15 0 0 99.85 - G0S2 184 T 1298 24.8 0 0 0 0.31 0 99.69 - G0S2 185 G 1298 24.8 0 0 0.31 0 0 99.69 -

165

Early 10 Ref. Ref. Seq. Coverag Scor Ins Gene Nucl A % C % G % T % Del % Mutation Call Positi e e % . on G0S2 186 A 1305 22.9 0.84 0 0 0 0 99.16 - G0S2 187 T 1306 22.6 0 0 0.54 0.15 0 99.31 - 30.7 insACACACACACACA G0S2 486 A 4239 24.6 99.62 0.17 0.05 0.05 0.12 6 TACACAC G0S2 1157 G 4468 27.8 0.07 0 0.18 99.73 0 0.02 G>T G0S2 1426 C 4509 29.2 0 0.09 0.04 99.84 0 0.02 C>T G0S2 2750 C 4220 26.6 0.17 51.28 0.12 48.41 0 0.02 C>CT G0S2 3704 C 2596 13.7 1.93 53.85 0 0.23 0 43.99 delC G0S2 3706 G 2617 13.5 0.08 3.06 54.64 0 0 42.22 delG G0S2 3709 T 2638 14 0 40.03 0 59.63 1.59 0.34 T>CT G0S2 3711 G 2707 14.2 0.52 0.3 60.18 0.22 0 38.79 delGC G0S2 3712 C 2708 14.2 0 61.19 0.04 0 0 38.77 - G0S2 3714 T 2721 14 0.07 6.65 0 54.72 0 38.55 delTGTC G0S2 3715 G 2722 17.1 6.25 0.48 54.22 0.29 0 38.76 - G0S2 3716 T 2738 17.4 0.47 0.07 0 61.07 0 38.39 - G0S2 3717 C 2762 20 0.11 54.2 0.04 1.34 0 44.32 - G0S2 4112 A 2868 24.2 43.79 56.17 0 0.03 0 0 A>AC delGCCCCATCGGGTC G0S2 4153 G 2655 25.3 0.08 0 44.26 0 0 55.67 TTTTTAAAAATGGC G0S2 4154 C 2624 24.5 0 43.1 0.53 0 0 56.36 - G0S2 4155 C 2620 24.5 0.04 43.05 0.46 0 0 56.45 - G0S2 4156 C 2614 24.2 0.11 42.77 0 0.54 0 56.58 - G0S2 4157 C 2629 24.5 0.11 43.1 0.49 0.04 0 56.26 - G0S2 4158 A 2630 24.5 43.27 0 0.49 0 0 56.24 - G0S2 4159 T 2634 24.5 0 0 0.49 43.36 0 56.15 - G0S2 4160 C 2632 24.5 0 43.2 0.53 0.08 0 56.19 - G0S2 4161 G 2632 24.2 0.46 0 43.39 0 0 56.16 - G0S2 4162 G 2629 24.2 0.46 0 43.29 0.04 0 56.22 - G0S2 4163 G 2635 24.2 0.23 0.04 43.53 0.08 0 56.13 - G0S2 4164 T 2635 24.2 0.08 0.53 0.04 43.23 0 56.13 - G0S2 4165 C 2635 24.2 0.08 43 0.49 0.3 0 56.13 - G0S2 4166 T 2632 23.9 0.42 0.53 0.04 42.78 0 56.23 - G0S2 4167 T 2629 23.9 0.61 0 0 43.13 0 56.26 - G0S2 4168 T 2609 23.6 0.34 0.11 0 42.85 0 56.69 - G0S2 4169 T 2609 23.6 0 0.04 0.46 42.81 0 56.69 - G0S2 4170 T 2607 23.6 0 0.35 0 42.96 0 56.69 - G0S2 4171 A 2607 23.6 43.27 0.04 0 0 0 56.69 - G0S2 4172 A 2606 23.6 42.86 0.08 0.35 0 0 56.72 - G0S2 4173 A 2602 23.6 42.81 0 0.35 0 0 56.84 -

166

Early 10 Ref. Ref. Seq. Coverag Scor Ins Gene Nucl A % C % G % T % Del % Mutation Call Positi e e % . on G0S2 4174 A 2602 23.4 42.81 0.35 0 0 0 56.84 - G0S2 4175 A 2602 23.4 43.04 0.04 0.08 0 0 56.84 - G0S2 4176 T 2600 23.4 0.35 0 0.15 42.62 0 56.88 - G0S2 4177 G 2602 23.4 0.04 0 42.81 0.35 0 56.8 - G0S2 4178 G 2602 23.4 0.08 0 43.16 0 0 56.76 - G0S2 4179 C 2598 23.4 0.42 42.61 0 0.12 0 56.85 - G0S2 4730 A 1393 24.6 57 0 0.07 0 0.07 42.93 delACGTTTGCA G0S2 4731 C 1378 24.3 0.22 56.39 0 0 0 43.4 - G0S2 4732 G 1288 21.8 0.23 2.72 50.78 0 0 46.27 - G0S2 4733 T 1242 23 0 0.32 0.08 51.85 0 47.75 - G0S2 4734 T 1241 23 0 0.24 0.08 51.89 0 47.78 - G0S2 4735 T 1223 23.4 0.25 0 0 51.27 0 48.49 - G0S2 4736 G 1221 23.1 0.25 0 50.94 0 0 48.81 - G0S2 4737 C 1220 23.1 0.08 50.82 0 0 0 49.1 - G0S2 4738 A 1212 22.9 50.33 0 0.25 0 0 49.42 - BMAL 2172 A 3065 25.5 53.12 0.03 0.1 0.03 0 46.72 delAA BMAL 2173 A 3067 25.5 52.2 0.03 1.11 0 0 46.66 - BMAL 2333 T 4168 25.5 49.21 0.05 0.07 50.67 0 0 T>AT BMAL 2654 C 3527 26.3 50.75 49.14 0.03 0.09 0 0 C>AC BMAL 2696 A 2452 25.5 46.41 0.2 53.22 0.12 0 0.04 A>AG BMAL 2733 G 2147 15.6 0 0.19 55.75 0.19 8.06 43.88 delG BMAL 2764 A 2178 23.5 50.28 0.23 0.09 49.4 0 0 A>AT BMAL 3324 A 5083 28 49.73 0.16 0.26 49.73 0 0.12 A>AT BMAL 3459 A 4451 28.5 49.9 0.02 0.02 49.81 0 0.25 A>AT BMAL 3796 T 4222 25.7 0.07 0.12 0.05 57.25 0 42.52 delTTGA BMAL 3797 T 4223 25.7 0 0.12 0 57.35 0 42.53 - BMAL 3798 G 4238 26 0.05 0.54 56.91 0.05 0 42.45 - BMAL 3799 A 4229 26 56.63 0.14 0.12 0.59 0 42.52 - BMAL 4141 C 2690 20.7 53.27 46.43 0.3 0 0.04 0 C>AC BMAL 4796 C 4087 26.2 0.1 51.75 0.02 48.13 0 0 C>CT BMAL 5877 A 4203 26.8 52.41 0.14 0.07 47.32 0 0.05 A>AT Clock1b 401 G 25 10.9 68 0 32 0 0 0 G>AG Kiss2 532 G 10041 31 0.05 46.85 53.01 0.09 0 0 G>CG

167

Early 11 Ref. Ref. Gene Seq. Coverage Score A % C % G % T % Ins % Del % Mutation Call Nucl. Position dec1 565 G 6339 26.9 48.95 0.05 50.95 0.05 0 0 G>AG dec1 953 T 5831 27.3 0.02 0.02 50.85 49.1 0 0.02 T>GT dec1 2056 G 6943 29.1 49.72 0.09 50.05 0.07 0.03 0.07 G>AG dec1 2114 C 7032 30.3 0.09 48.81 0.16 50.91 0 0.04 C>CT dec2 698 A 4473 28.5 60.68 0.09 0.11 39.12 0.02 0 A>AT dec2 997 T 5245 25.7 0.02 0 40.23 59.75 0 0 T>GT Eed 279 T 2167 25.7 0.14 0 0 22.1 0 77.76 delT Eed 629 T 4059 28.4 0.1 79.11 0.02 20.77 0 0 T>C Eed 899 A 4079 24.7 53.25 46.68 0.02 0.05 0 0 A>AC Eed 1886 C 4244 25.7 46.82 53.06 0.05 0.07 0 0 C>AC Eed 2157 A 4979 25.3 62.62 0.06 37.26 0.06 0 0 A>AG Eed 2170 A 5056 20.9 37.64 0.02 0.16 9.14 0 53.05 delAC Eed 2171 C 5050 21.5 0.06 46.75 0.02 0.1 0 53.07 - Eed 2172 A 4992 21.9 46.01 0 0.12 53.73 0 0.14 A>AT Eed 2178 A 5006 23.6 34.76 0.02 0.12 0 0 65.1 delAA Eed 2179 A 5081 23.2 52.37 2.03 0 0 0 45.6 - Eed 2247 A 5084 27.5 67.58 0 0.22 32.2 0 0 A>AT Eed 2375 A 4671 21.9 64.48 0.09 35.41 0.02 0 0 A>AG Eed 2455 A 4745 27.8 34.98 0.02 64.91 0.08 0 0 A>AG Eed 2508 G 4705 27.8 0.09 0.02 59.77 0.02 0 40.11 delGTCAGGATACA Eed 2509 T 4715 2 0.02 41.76 0.04 18.15 0.02 40.02 -;T>C Eed 2510 C 4710 27.8 0.02 59.85 0 0.06 0.04 40.06 - Eed 2511 A 4671 28.1 59.45 0.04 0.09 0.02 0 40.4 - Eed 2512 G 4556 28 0.09 0 58.3 0.02 0 41.59 - Eed 2513 G 4601 23 16.52 0.04 42.08 0.09 0 41.27 - Eed 2514 A 4569 27.7 58.33 0.04 0.07 0.02 0 41.54 - Eed 2515 T 4559 27.7 0.04 0.02 0.07 58.26 0 41.61 - Eed 2516 A 4457 28.8 42.74 0.27 0.11 0.04 0.02 56.83 - Eed 2517 C 4485 26.8 0.18 57.55 0 0.04 0 42.23 - Eed 2518 A 4477 28.5 42.6 0 0.16 0.25 0 57 - Eed 2509 T 4715 2 0.02 41.76 0.04 18.15 0.02 40.02 -;T>C Eed 2513 G 4601 23 16.52 0.04 42.08 0.09 0 41.27 - Eed 2530 A 4761 17.5 87.02 0 0.15 0.17 38.77 12.67 insA Eed 2531 C 4758 18.1 40.42 46.66 0.02 0.23 0.11 12.67 C>AC Eed 2538 C 4991 20.4 0.1 51.27 0 36.61 0 12.02 C>CT Eed 2585 G 5013 28.9 46.72 0.04 53.2 0.04 0 0 G>AG Eed 2597 T 4845 24.5 14.49 0.06 39.09 46.36 0 0 T>GT Eed 2610 T 4734 28.7 0.08 47.15 0.02 52.75 0 0 T>CT Eed 2629 A 4366 25.5 60.97 0 38.96 0.02 0 0.05 A>AG

168

Early 11 Ref. Ref. Gene Seq. Coverage Score A % C % G % T % Ins % Del % Mutation Call Nucl. Position Eed 2648 T 4136 26.8 0.05 45.09 0.07 54.62 0.05 0.17 T>CT Eed 2688 G 4503 26.4 48.21 0.02 51.7 0.04 0 0.02 G>AG Eed 2855 C 4697 26.3 0.04 52.65 0.02 47.29 0 0 C>CT Eed 3028 T 4375 24.6 0.02 30.33 0.02 69.6 0 0.02 T>CT Eed 3236 T 4434 27.6 0.07 51.15 0.07 48.71 0 0 T>CT Eed 3249 A 4437 27.3 51.09 0.11 48.68 0.11 0 0 A>AG Eed 3370 A 4241 27.7 34.54 0 65.36 0.09 0 0 A>AG Eed 3548 A 5697 26.6 21.7 0.12 77.25 0.09 0 0.84 A>G Eed 3610 C 4354 25.8 0.09 58.04 0.05 41.41 0 0.41 C>CT Eed 3759 T 3976 20.6 0 0.03 40.62 59.31 0 0.05 T>GT Eed 3782 T 4022 27.3 0 0 33.27 66.71 0 0.02 T>GT Eed 4041 A 3827 25.1 100 0 0 0 0 0 G>A Eed 4127 A 4439 28.2 66.48 0.09 33.39 0.02 0 0.02 A>AG Eed 4148 T 4364 27.6 0.02 0 44.5 55.48 0 0 T>GT Eed 4161 A 4347 28.4 43.8 0.09 55.51 0.6 0.05 0 A>AG Eed 4162 T 4343 28.4 0.07 0.05 0.05 99.84 53.79 0 insT Eed 4185 A 4311 28.7 44.7 0.02 55.28 0 0 0 A>AG Eed 4219 A 3919 22 20.87 0.03 78.97 0.08 0 0.05 A>G Eed 4222 T 4072 22.5 0.07 0.07 79.2 20.43 0 0.22 T>G Eed 4224 G 4065 22.3 78.67 0.07 21.18 0.07 0 0 G>A Eed 4249 T 4263 26.6 0.09 33.66 0.07 66.17 0 0 T>CT Eed 4274 T 4536 28.5 0.07 79.1 0 20.83 0 0 T>C Eed 4593 G 4855 25.1 0 100 0 0 0 0 A>G Eed 4602 A 4790 28.7 22.09 0.02 0 77.89 0 0 A>T Eed 4603 C 4861 29.3 78.15 21.64 0.04 0 0 0.16 C>A Eed 4791 T 4545 28.6 0.07 59.87 0.04 40.02 0 0 T>CT Eed 4824 T 4437 24.7 0.02 0.05 38.16 61.78 0 0 T>GT Eed 5074 A 3645 27.8 7.43 0 0 0 0.44 92.57 delAA Eed 5075 A 3647 28.4 40.17 0.03 0 0.05 0 59.75 - Eed 5107 C 3494 26.5 0.6 21.78 0.09 77.53 0.03 0 C>T GnRH3B 331 A 3276 27.1 51.8 0.03 0.12 48.02 0 0.03 A>AT GnRH3B 360 G 3432 27.3 47.79 0.03 52.16 0.03 0 0 G>AG GnRH3B 411 C 3605 27.8 0.08 51.04 0 48.88 0 0 C>CT GnRH3B 1210 T 425 18.3 53.41 0 0.24 46.35 0 0 T>AT G0S2 991 T 4742 27.2 0.21 50.25 0.02 49.49 0 0.02 T>CT G0S2 1399 G 5037 29.2 99.84 0.04 0.12 0 0 0 G>A G0S2 2476 T 5053 27.1 0 0 51.3 48.7 0 0 T>GT G0S2 2535 G 5265 29.1 50.48 0.02 49.48 0.02 0 0 G>AG G0S2 2857 A 4657 28.6 47.52 0.11 0.15 52.2 0 0.02 A>AT

169

Early 11 Ref. Ref. Gene Seq. Coverage Score A % C % G % T % Ins % Del % Mutation Call Nucl. Position G0S2 2874 A 4543 25.3 47.08 52.74 0.11 0.04 0 0.02 A>AC G0S2 2878 T 4417 24.9 0.02 53.09 0.07 46.8 0 0.02 T>CT G0S2 4005 T 3072 26.7 0.2 0.2 49.32 50.29 0 0 T>GT G0S2 4112 A 2883 26 0.14 99.79 0 0.07 0 0 A>C G0S2 4301 C 2641 23.9 0.04 53.65 0 46.27 0 0.04 C>CT G0S2 4397 C 3671 28.1 0 51.89 0.08 48.03 0 0 C>CT G0S2 4420 A 3683 25 47.62 0 0.14 0 0 52.24 delATGACGGTC G0S2 4421 T 3668 25 0 0.03 0.14 47.38 0 52.45 - G0S2 4422 G 3728 25.9 0.05 0 48.34 0 0 51.61 - G0S2 4423 A 3737 26.2 48.3 0.05 0.13 0.03 0 51.49 - G0S2 4424 C 3740 26.2 0.03 48.45 0 0.08 0 51.44 - G0S2 4425 G 3741 26.2 0.21 0 48.38 0 0 51.4 - G0S2 4426 G 3735 26.2 0.03 0 48.38 0.08 0 51.51 - G0S2 4427 T 3739 26.2 0 0.03 0.08 48.44 0 51.46 - G0S2 4428 C 3736 26.2 0.11 48.39 0 0 0 51.5 - G0S2 4513 C 3195 25.4 0.13 47.73 0.03 52.11 0 0 C>CT G0S2 4551 G 3001 22.4 52.12 0.03 47.82 0.03 0 0 G>AG G0S2 4558 C 2994 20.4 0 47.86 0 52.14 0 0 C>CT G0S2 4637 T 2602 26.4 0.04 0.19 49.35 50.42 0 0 T>GT G0S2 4645 C 2559 25.8 0.08 49.51 0 50.41 0 0 C>CT BMAL 791 C 2262 26.7 100 0 0 0 0 0 C>A BMAL 1229 A 3059 27.2 0.42 0.07 0.59 0.16 0.03 98.76 delA BMAL 1261 A 2936 27.3 0.17 0.07 99.73 0 0 0.03 A>G BMAL 1318 T 2691 26.6 0.11 0.11 99.7 0.07 0 0 T>G BMAL 1808 A 2650 27.2 0.11 99.89 0 0 0 0 A>C BMAL 2172 A 2487 22.2 5.67 0 0 0 0 94.33 delAA BMAL 2173 A 2485 21.9 0.48 0 5.15 0 0 94.37 - BMAL 2654 C 1578 25.2 99.37 0.51 0.13 0 0 0 C>A BMAL 2733 G 998 13.1 0.1 0.2 64.13 0.1 10.62 35.47 delG BMAL 2764 A 916 23.3 0.11 0.22 0.22 99.45 0 0 A>T BMAL 3324 A 2520 26.2 0.08 0.2 0.12 99.52 0 0.08 A>T BMAL 3459 A 2019 26.3 0.2 0 0 99.8 0 0 A>T BMAL 3796 T 1897 20.6 0 0 0 4.11 0 95.89 delTTGA BMAL 3797 T 1897 20.6 0 0 0 4.16 0 95.84 - BMAL 3798 G 1902 21.6 0 0.37 4.1 0 0 95.53 - BMAL 3799 A 1902 21.3 3.42 0.11 0 0.63 0 95.85 - BMAL 4796 C 1958 24.8 0.05 0.31 0.05 99.59 0 0 C>T BMAL 5877 A 2290 26.2 0.09 0.13 0.04 99.61 0 0.13 A>T Kiss1r 152 C 1919 24.1 0.1 54.56 0.05 45.28 0 0 C>CT

170

Early 11 Ref. Ref. Gene Seq. Coverage Score A % C % G % T % Ins % Del % Mutation Call Nucl. Position Clock1b 401 G 131 14.6 66.41 0 33.59 0 0 0 G>AG Clock1b 465 G 231 16.2 0 0 66.67 33.33 0 0 G>GT

Early 12 Ref. Ref. Gene Seq. Coverage Score A % C % G % T % Ins % Del % Mutation Call Nucl. Position dec1 565 G 3285 23.5 51.72 0 48.25 0 0 0.03 G>AG dec1 693 C 3367 27 0 50.43 0.03 49.54 0 0 C>CT dec1 953 T 2951 25.4 0.07 0 51.91 48.02 0 0 T>GT dec1 2056 G 3555 27.3 98.96 0.28 0.62 0.11 0 0.03 G>A dec2 990 A 1358 24.9 51.69 0 0 0 0 48.31 delATCAAATTTGAT dec2 991 T 1358 25 0.07 0.07 0 51.47 0 48.38 - dec2 992 C 1351 24.9 0 51.3 0.07 0 0 48.63 - dec2 993 A 1348 24.7 51.11 0.07 0.07 0 0 48.74 - dec2 994 A 1346 24.9 51.04 0.07 0 0.07 0 48.81 - dec2 995 A 1348 24.9 51.26 0 0 0 0 48.74 - dec2 996 T 1365 24.5 0 0 0.07 51.79 0 48.13 - dec2 997 T 1358 24.2 0 0 0 51.62 0 48.38 - dec2 998 T 1356 24.2 0.07 0 0 51.55 0 48.38 - dec2 999 G 1354 24.2 0 0 51.48 0 0 48.52 - dec2 1000 A 1356 24.2 51.03 0.37 0.07 0.07 0 48.45 - dec2 1001 T 1354 24.2 0 0.3 0 51.18 0 48.52 - Eed 279 T 783 21.8 0.13 0 0 18.14 0 81.74 delT Eed 629 T 1465 24.4 0 82.66 0.07 17.27 0 0 T>C Eed 2178 A 1859 24.5 16.89 0.27 0 0 0.05 82.84 delA Eed 2247 A 1756 25 19.76 0 0.06 80.18 0 0 A>T Eed 2455 A 1688 23.6 0.12 0.12 99.7 0.06 0 0 A>G Eed 2457 G 1699 24.2 49.68 0 50.32 0 0 0 G>AG Eed 3028 T 1585 25.2 0 81.07 0.06 18.8 0 0.06 T>C Eed 3304 T 1672 25.7 57.83 0 0 42.17 0 0 T>AT Eed 3469 T 1830 22.9 2.13 40.11 0.44 55.79 0.16 1.53 T>CT Eed 3532 T 1535 21.3 1.69 35.37 0.72 61.69 0.07 0.52 T>CT Eed 3610 C 1161 23.2 0.17 47.55 0.34 45.13 0.09 6.8 C>CT Eed 3759 T 1386 25.1 0 0 0 100 0 0 G>T Eed 3782 T 1486 23.6 0 0 95.42 4.44 0 0.13 T>G Eed 4041 A 1550 23.1 16.71 0.06 83.23 0 0 0 A>G Eed 4049 T 1546 23.9 0 0.06 52.13 47.8 0 0 T>GT Eed 4127 A 1649 25.4 42.87 0 57.06 0.06 0 0 A>AG

171

Early 12 Ref. Ref. Gene Seq. Coverage Score A % C % G % T % Ins % Del % Mutation Call Nucl. Position Eed 4161 A 1606 24 28.33 0.31 70.73 0.62 0.37 0 A>G Eed 4162 T 1603 24.3 0 0.06 0 99.88 69.31 0.06 insT Eed 4219 A 1466 23.7 54.84 0 45.02 0.14 0 0 A>AG Eed 4249 T 1579 24.4 0.06 83.22 0.06 16.66 0 0 T>C Eed 4262 T 1592 25 0.06 51.44 0.06 48.43 0 0 T>CT Eed 4274 T 1624 24.5 0 49.2 0 50.8 0 0 T>CT Eed 4363 A 1664 24.9 21.51 0.06 78.37 0 0 0.06 A>G Eed 4418 T 1568 23.1 0.26 51.85 0.13 47.7 0 0.06 T>CT Eed 4556 A 1846 22.9 69.56 0.11 30.07 0.27 0 0 A>AG Eed 4580 G 2014 23.9 0.05 0.1 51.19 48.66 0 0 G>GT Eed 4593 G 2076 21.4 83.91 0.14 15.85 0.1 0 0 G>A Eed 4603 C 2100 19.7 16.05 0.05 0 83.9 0 0 C>T Eed 4648 T 2129 26.2 0 84.36 0 15.64 0 0 T>C Eed 4649 A 2126 26.2 15.52 84.48 0 0 0 0 A>C Eed 4704 C 1869 17.9 0.16 65.22 34.51 0.11 0 0 C>CG Eed 4775 T 1692 25.2 0 0 0 58.98 0 41.02 delTTG Eed 4776 T 1701 25.2 0 2.06 0.12 57.08 0 40.74 - Eed 4777 G 1701 25.5 0.82 1.94 56.61 0 0 40.62 - Eed 4791 T 1649 23.8 0.06 57 0.06 42.87 0 0 T>CT Eed 4793 C 1655 23.8 0 57.34 0.06 42.6 0 0 C>CT Eed 4824 T 1737 24.5 0.06 0 78.07 21.82 0 0.06 T>G Eed 4930 A 1672 25.2 63.1 0.18 0.06 36.6 0 0.06 A>AT Eed 4935 G 1718 24.5 0.12 37.43 62.28 0.12 0 0.06 G>CG Eed 5044 C 1531 24.8 31.68 68.06 0.07 0.13 0 0.07 C>AC Eed 5045 A 1538 25.1 68.21 0.13 31.34 0.26 0 0.07 A>AG Eed 5074 A 1507 24.2 3.38 0 0 0 0.33 96.62 delAAA Eed 5075 A 1508 24.5 15.05 0 0 0 0 84.95 - Eed 5076 A 1507 24.3 27.21 0.07 0.2 0 0 72.53 - Eed 5138 T 1364 23.7 0.07 84.38 0.07 15.4 0 0.07 T>C Eed 5140 G 1357 23.4 0 0.07 15.48 84.38 0 0.07 G>T Eed 5185 A 1223 24.6 67.7 0.74 31.56 0 0 0 A>AG G0S2 1359 A 1126 24.3 52.04 0.44 0.09 47.42 0 0 A>AT G0S2 1399 G 1134 23.3 50 0 49.91 0.09 0 0 G>AG G0S2 1519 G 1188 21.8 43.77 0 55.89 0.08 0 0.25 G>AG G0S2 2424 A 1440 20.3 46.94 53.06 0 0 0 0 A>AC G0S2 2427 T 1435 20.3 0.21 53.03 0 46.76 0 0 T>CT G0S2 2476 T 1472 24.1 0 0 0 100 0 0 G>T G0S2 2512 G 1347 22.8 49.22 0 50.78 0 0 0 G>AG G0S2 2535 G 1409 20.1 0 100 0 0 0 0 A>G

172

Early 12 Ref. Ref. Gene Seq. Coverage Score A % C % G % T % Ins % Del % Mutation Call Nucl. Position G0S2 2583 C 1383 24.5 0.22 50.69 0.07 49.02 0 0 C>CT G0S2 2628 A 1423 24.6 46.03 53.62 0.21 0.14 0 0 A>AC G0S2 2857 A 1053 23.1 54.13 0 0.28 45.58 0 0 A>AT G0S2 2874 A 1112 24.2 0.09 99.91 0 0 0 0 A>C G0S2 2878 T 1083 24.1 0.09 99.91 0 0 0 0 T>C G0S2 3969 T 626 17.5 50.32 0 0 49.68 0 0 T>AT G0S2 3978 C 631 17.3 1.74 50.08 0 0.32 0 47.86 delC G0S2 3979 C 628 15.8 0.16 99.2 0 0.64 48.57 0 insT G0S2 4005 T 633 18.1 0 0 0 100 0 0 G>T G0S2 4112 A 550 21.5 0.18 99.82 0 0 0 0 A>C G0S2 4301 C 518 21.1 0 54.05 0 45.95 0 0 C>CT G0S2 4420 A 684 22.6 0 0 0 0 0 100 delATGACGGTC G0S2 4421 T 684 22.6 0 0 0 0 0 100 - G0S2 4422 G 684 22.6 0 0 0 0 0 100 - G0S2 4423 A 684 22.6 0 0 0 0 0 100 - G0S2 4424 C 684 22.6 0 0 0 0 0 100 - G0S2 4425 G 684 22.6 0 0 0.15 0 0 99.85 - G0S2 4426 G 684 22.6 0 0 0.15 0 0 99.85 - G0S2 4427 T 684 22.6 0 0 0 0.15 0 99.85 - G0S2 4428 C 684 22.6 0 0 0 0 0 100 - G0S2 4513 C 589 19.6 0 55.35 0.34 44.31 0 0 C>CT G0S2 4550 T 559 17.5 0 46.87 0 52.95 0 0.18 T>CT G0S2 4551 G 555 16.9 46.85 0.36 52.79 0 0 0 G>AG G0S2 4558 C 557 16.6 0 52.6 0 47.4 0 0 C>CT G0S2 4637 T 483 18.1 0 0 0 100 0 0 G>T G0S2 4645 C 483 19.9 0 51.35 0.21 48.45 0 0 C>CT BMAL 396 C 594 18.9 48.32 51.68 0 0 0 0 C>AC BMAL 597 A 680 21 53.53 46.32 0 0.15 0 0 A>AC BMAL 826 G 607 19.5 43.99 0 55.85 0.16 0 0 G>AG BMAL 986 C 691 17.1 46.02 53.98 0 0 0 0 C>AC BMAL 1229 A 996 22 55.22 0 0.4 0 0 44.38 delA BMAL 1261 A 963 23.1 0.21 0.1 99.58 0.1 0 0 A>G BMAL 1318 T 750 20.2 0 0.4 49.07 50.53 0 0 T>GT BMAL 1808 A 733 19.1 52.8 47.2 0 0 0 0 A>AC BMAL 2172 A 774 21.8 54.26 0.13 0.13 0 0 45.48 delAA BMAL 2173 A 774 21.8 53.36 0.13 1.03 0 0 45.48 - BMAL 2333 T 788 18.1 43.91 0.25 0 55.84 0 0 T>AT BMAL 2413 T 980 23.1 0.1 43.47 0 56.43 0 0 T>CT BMAL 2696 A 326 18 50.31 0.31 49.39 0 0 0 A>AG

173

Early 12 Ref. Ref. Gene Seq. Coverage Score A % C % G % T % Ins % Del % Mutation Call Nucl. Position BMAL 2944 A 746 22.5 57.1 0 42.76 0.13 0 0 A>AG BMAL 3131 G 719 21.1 0.28 43.12 56.19 0.14 0 0.28 G>CG BMAL 3344 T 689 16.9 0 0 0 99.71 48.04 0.29 insT BMAL 3348 C 686 17.1 0.15 51.31 0 48.54 0 0 C>CT BMAL 4141 C 307 13.6 45.28 54.07 0.33 0 0 0.33 C>AC BMAL 4741 A 508 21.3 56.89 0 42.91 0.2 0 0 A>AG BMAL 5100 G 757 18.5 0.26 50.07 49.41 0.26 0 0 G>CG Clock1b 401 G 49 13.5 59.18 0 40.82 0 0 0 G>AG Clock1b 692 C 213 17.1 0 57.75 41.31 0.94 0 0 C>CG Clock1b 710 G 222 18 39.19 0 60.81 0 0 0 G>AG Clock1b 1392 C 77 14.6 50.65 49.35 0 0 0 0 C>AC

Late 806 Ref. Ref. Ins Gene Seq. Coverage Score A % C % G % T % Del % Mutation Call Nucl % Position dec1 565 G 6287 28.8 46.94 0.06 52.95 0.03 0 0.02 G>AG dec1 953 T 6793 29.9 0.01 0.01 47.23 52.73 0 0.01 T>GT dec1 2056 G 7713 30 48 0.21 51.74 0.04 0 0.01 G>AG dec2 698 A 4800 28.7 0.54 0 0.1 99.35 0 0 A>T dec2 997 T 5413 28.2 0.02 0.02 49.97 49.97 0 0.02 T>GT Eed 1652 C 3113 25.3 0 0.06 99.16 0.77 0 0 C>G Eed 2178 A 3672 27 1.23 0.14 0 0 0 98.64 delA Eed 2247 A 3360 27 67.53 0.09 0.15 32.2 0 0.03 A>AT Eed 2455 A 3414 27 54.48 0 45.46 0.06 0 0 A>AG delGTCAGGATA Eed 2508 G 3395 28.1 0.06 0.03 27.6 0.03 0 72.28 CA Eed 2509 T 3395 28.1 0.06 0 0.03 27.63 0 72.28 - Eed 2510 C 3394 28.1 0.03 27.67 0 0 0 72.3 - Eed 2511 A 3392 28.1 27.54 0.03 0 0 0 72.44 - Eed 2512 G 3383 27.8 0.03 0 26.72 0 0 73.25 - Eed 2513 G 3369 23.9 25.79 0.18 0.65 0.12 0 73.26 - Eed 2514 A 3365 27.5 26.66 0.06 0.03 0 0 73.25 - Eed 2515 T 3362 27.5 0.03 0 0 26.32 0 73.65 - Eed 2516 A 3359 27.2 0.83 0.36 0.03 0.12 0 98.66 - Eed 2517 C 3359 27 0.3 26.32 0 0.06 0 73.33 - Eed 2518 A 3360 26.4 0.06 0 0.15 0.33 0 99.46 - Eed 2509 T 3395 28.1 0.06 0 0.03 27.63 0 72.28 - Eed 2513 G 3369 23.9 25.79 0.18 0.65 0.12 0 73.26 -

174

Late 806 Ref. Ref. Ins Gene Seq. Coverage Score A % C % G % T % Del % Mutation Call Nucl % Position 72.7 Eed 2530 A 3526 19.7 74.33 0 0 0.09 25.58 insA 7 Eed 2531 C 3519 19.3 73.74 0.28 0.17 0.17 0.06 25.63 C>A Eed 2538 C 3507 19.5 0.14 0.17 0.09 74.11 0 25.49 C>T Eed 2629 A 3102 27.8 42.71 0.03 57.22 0.03 0 0 A>AG Eed 2688 G 3257 27.7 44.67 0.03 55.23 0.06 0 0 G>AG Eed 2703 G 3435 27.9 54.76 0.49 44.34 0.41 0.03 0 G>AG Eed 2768 T 3579 27.7 99.89 0.06 0 0.03 0 0.03 T>A Eed 2852 G 3232 27.1 69.31 0.34 30.29 0.06 0 0 G>AG Eed 3236 T 3535 28 0.03 54.4 0.06 45.52 0 0 T>CT Eed 3304 T 3495 27.4 55.42 0.09 0.14 44.35 0 0 T>AT Eed 3317 G 3434 28.2 0 0.06 44.38 55.56 0 0 G>GT Eed 3370 A 3120 25 46.15 0.1 53.62 0.13 0.03 0 A>AG Eed 3469 T 4320 28.7 1.62 49.77 0.69 46.99 0.05 0.93 T>CT Eed 3499 G 4089 27.7 30.23 0.1 68.94 0.29 0 0.44 G>AG Eed 3532 T 4172 27.7 1.03 48.13 0.7 49.66 0 0.48 T>CT Eed 3562 G 3784 27.9 44.82 0.13 53.96 0.26 0.03 0.82 G>AG Eed 3588 A 3648 26.7 45.37 0.08 0.33 53.37 0 0.85 A>AT Eed 4161 A 3110 27 63.83 0.1 35.66 0.42 0.03 0 A>AG Eed 4162 T 3109 27.6 0.03 0.06 0.03 99.87 35 0 insT Eed 4219 A 2878 27 35.72 0.03 64.14 0.07 0 0.03 A>AG Eed 4222 T 2917 21.9 0.07 0.24 39.39 60.1 0 0.21 T>GT Eed 4224 G 2893 22.1 39.3 0.03 60.59 0.07 0 0 G>AG Eed 4249 T 3233 27.9 0.03 77.2 0 22.73 0 0.03 T>C Eed 4262 T 3328 27.8 0.06 36.84 0.06 63.04 0 0 T>CT Eed 4274 T 3392 27 0.06 63.83 0 36.11 0 0 T>CT Eed 4363 A 3363 27.8 63.87 0.18 35.77 0.18 0 0 A>AG Eed 4418 T 3168 26.2 0.19 77.24 0.09 22.47 0 0 T>C Eed 4497 A 2841 26.4 63.46 0.07 0 36.4 0 0.07 A>AT Eed 4531 A 3154 27.6 58.59 41.34 0 0 0.03 0.06 A>AC Eed 4556 A 3140 27.6 41.91 0.06 57.96 0.06 0 0 A>AG Eed 4580 G 3325 27.8 0.09 0.09 57.38 42.44 0 0 G>GT Eed 4602 A 3348 26.9 33.84 0.03 0.06 66.07 0 0 A>AT Eed 4603 C 3365 15.8 23.3 33.67 0.03 43 0 0 C>CT Eed 4648 T 3491 28 0.09 57.52 0.06 42.34 0 0 T>CT Eed 4649 A 3494 28.2 0.11 99.83 0 0.03 0 0.03 A>C Eed 4673 T 3323 25.5 0.06 0.39 0.12 67.14 0 32.29 delTTAA Eed 4674 T 3321 25.8 0 0.18 0.3 67.51 0 32.01 - Eed 4675 A 3314 20.7 67.65 0.18 0.06 0.03 0 32.08 - Eed 4676 A 3295 20.9 67.34 0.06 0.33 0 0 32.26 -

175

Late 806 Ref. Ref. Ins Gene Seq. Coverage Score A % C % G % T % Del % Mutation Call Nucl % Position Eed 4678 A 3461 21.7 69.72 0.09 0.06 0 0 30.14 delAGTTA Eed 4679 G 3463 21.5 0.4 0.03 69.04 0.06 0 30.46 - Eed 4680 T 3469 21.5 0.32 0.17 0.06 68.78 0 30.67 - Eed 4681 T 3478 21.5 0.06 0.03 0.63 68.69 0 30.59 - Eed 4682 A 3501 21.5 68.67 0.03 0.8 0.03 0 30.48 - Eed 4685 C 3472 21.7 0.06 68.75 0.12 0.09 0 30.99 delCTCCCA Eed 4686 T 3452 21.7 0.14 0.52 0.23 67.93 0 31.17 - Eed 4687 C 3462 26.8 0.12 68.72 0.03 0 0 31.14 - Eed 4688 C 3418 27 0.12 69.16 0.03 0 0 30.69 - Eed 4689 C 3428 27 0.09 68.44 0.03 0.06 0 31.39 - Eed 4690 A 3402 27 68.02 0.03 0.29 0.06 0 31.6 - Eed 4704 C 3241 26.8 0.03 0.03 99.81 0.12 0 0 C>G Eed 4791 T 2924 26.4 0.03 77.5 0.14 22.33 0 0 T>C Eed 4824 T 3109 25.3 0 0.19 78.9 20.91 0 0 T>G Eed 4923 T 3170 27.3 78.11 0.16 0.25 21.48 0 0 T>A Eed 4930 A 3295 22.4 21.12 0.15 0.06 78.66 0 0 A>T Eed 4935 G 3331 27.7 0.03 79.35 20.44 0.18 0 0 G>C Eed 5044 C 2928 22.3 42.49 57.34 0.07 0.03 0 0.07 C>AC Eed 5045 A 2950 22.4 57.46 0.07 42.37 0.07 0 0.03 A>AG Eed 5051 A 2851 21.6 64.19 0.04 0.18 35.57 0 0.04 A>AT Eed 5074 A 2855 25.8 1.89 0 0.04 0.04 0.04 98.04 delAAAAAA Eed 5075 A 2854 26.3 6.8 0.07 0 0.04 0 93.1 - Eed 5076 A 2849 26.7 41.07 0.04 0.04 0 0 58.86 - Eed 5077 A 2850 27.3 53.54 0.04 0.04 0.07 0 46.32 - Eed 5078 A 2850 27 56 0 0.04 0.04 0 43.93 - Eed 5079 A 2849 27 56.12 0.04 0.07 0.07 0 43.7 - Eed 5138 T 2554 26.6 0.04 99.61 0 0.35 0 0 T>C Eed 5140 G 2548 26.3 0.16 0.08 0.59 99.18 0 0 G>T Eed 5185 A 2196 26.4 55.28 2 42.67 0.05 0 0 A>AG Eed 5264 C 1639 24.6 0 51.01 0 43.62 0.06 5.37 C>CT Eed 5269 C 1636 19.9 0.06 64.43 0 30.32 0 5.2 C>CT Eed 5275 C 1578 16 38.91 60.27 0.06 0.25 0 0.51 C>AC Eed 5283 G 1521 20.5 0.07 0.07 64.56 0.07 0 35.24 delG Eed 5285 C 1508 19.9 0 58.42 0.07 35.41 0.13 6.1 C>CT GnRH3B 331 A 3660 27.5 50.66 0.08 0.08 49.18 0 0 A>AT GnRH3B 360 G 3984 28.1 48.29 0.1 51.53 0.08 0 0 G>AG GnRH3B 411 C 4198 28.6 0.1 50.91 0.02 48.98 0 0 C>CT GnRH3B 1210 T 277 17.8 50.9 0 0.36 48.74 0 0 T>AT G0S2 180 A 616 22.2 0 0 0 0 0 100 delATAGTGAT

176

Late 806 Ref. Ref. Ins Gene Seq. Coverage Score A % C % G % T % Del % Mutation Call Nucl % Position G0S2 181 T 616 22.2 0 0 0 0 0 100 - G0S2 182 A 616 22.2 0 0 0 0 0 100 - G0S2 183 G 616 22.2 0 0 0 0 0 100 - G0S2 184 T 616 22.2 0 0 0 0 0 100 - G0S2 185 G 616 22.2 0 0 0 0 0 100 - G0S2 186 A 617 22.3 0.49 0 0 0 0 99.51 - G0S2 187 T 617 22.3 0 0 0.16 0.32 0 99.51 - 38.9 insACACACACA G0S2 486 A 2149 23.1 99.63 0 0.19 0.09 0.09 5 CACATACACAC G0S2 1157 G 3137 27.5 0 0.1 0.1 99.81 0 0 G>T G0S2 1426 C 2284 26.8 0.04 0 0.04 99.91 0 0 C>T BMAL 597 A 1556 24.4 52.38 47.49 0.06 0.06 0 0 A>AC BMAL 791 C 1422 24.1 53.52 46.34 0.14 0 0 0 C>AC BMAL 826 G 1410 24 47.45 0.07 52.41 0 0 0.07 G>AG BMAL 986 C 1573 21.6 46.47 53.08 0.45 0 0 0 C>AC BMAL 1229 A 1730 23.9 0.46 0.64 0.98 0.12 0 97.8 delA BMAL 1261 A 1741 25.5 0.23 0.11 99.66 0 0 0 A>G BMAL 1318 T 1622 24.2 0.31 0 99.38 0.31 0 0 T>G BMAL 1808 A 1716 24.9 0.17 99.77 0 0.06 0 0 A>C BMAL 2172 A 1413 23 5.24 0 0.14 0 0 94.62 delAA BMAL 2173 A 1412 22.8 0.21 0.07 5.17 0 0 94.55 - BMAL 2413 T 1477 24.2 0.14 46.72 0 53.15 0 0 T>CT BMAL 2654 C 779 19.3 63.29 36.59 0 0.13 0 0 C>AC 21.7 BMAL 2733 G 473 7.2 0 0.42 68.29 0.63 30.66 delG 8 BMAL 2764 A 479 17.7 32.99 0 0.42 66.6 0 0 A>AT BMAL 2944 A 1560 24.7 52.88 0 47.05 0.06 0 0 A>AG BMAL 3131 G 1415 23.5 0.28 46.5 53.22 0 0 0 G>CG BMAL 3324 A 1545 24.3 47.57 0.13 0.06 52.1 0 0.13 A>AT 47.1 BMAL 3344 T 1432 23.4 0 0 0.07 99.86 0.07 insT 4 BMAL 3348 C 1422 23.6 0.14 51.76 0.07 48.03 0 0 C>CT BMAL 3459 A 1287 24.5 48.8 0.16 0.23 50.82 0 0 A>AT BMAL 3796 T 1190 23.7 0.08 0 0 54.71 0 45.21 delTTGA BMAL 3797 T 1186 23.5 0 0 0.08 54.38 0 45.53 - BMAL 3798 G 1187 23.7 0 0.42 54.09 0 0 45.49 - BMAL 3799 A 1181 23.9 53.43 0.08 0 0.51 0 45.98 - BMAL 4741 A 1208 22.8 53.81 0 46.19 0 0 0 A>AG BMAL 4796 C 1221 22.8 0.25 48.24 0.08 51.43 0 0 C>CT BMAL 5100 G 1441 22.9 0 47.33 52.67 0 0 0 G>CG BMAL 5877 A 1440 25.1 49.44 0.28 0 50.28 0 0 A>AT

177

Late 806 Ref. Ref. Ins Gene Seq. Coverage Score A % C % G % T % Del % Mutation Call Nucl % Position Kiss1r 152 C 2283 23.3 0.13 51.55 0 48.31 0 0 C>CT Clock1b 401 G 66 12.9 66.67 0 33.33 0 0 0 G>AG Clock1b 406 T 80 14.6 37.5 1.25 0 61.25 0 0 T>AT Clock1b 507 T 148 17.1 0 0 42.57 57.43 0 0 T>GT Clock1b 514 A 150 17.3 56.67 43.33 0 0 0 0 A>AC Clock1b 533 C 157 17.4 43.31 56.69 0 0 0 0 C>AC

Late 807 Ref. Ref. Gene Seq. Coverage Score A % C % G % T % Ins % Del % Mutation Call Nucl. Position dec1 565 G 6036 26.8 50.25 0.03 49.65 0.07 0 0 G>AG dec1 693 C 7027 29.4 0.09 51.47 0.04 48.4 0 0 C>CT dec1 953 T 5868 28.8 0 0 51.81 48.18 0 0.02 T>GT dec1 2056 G 9396 31.5 99.07 0.28 0.56 0.06 0 0.02 G>A dec2 698 A 1949 25.9 0.67 0.1 0.05 99.18 0 0 A>T dec2 997 T 2529 25.2 0 0 51.29 48.68 0 0.04 T>GT Eed 279 T 935 21.5 0 0 0.11 27.06 0 72.83 delT Eed 629 T 1729 25.8 0 72.41 0.06 27.53 0 0 T>C Eed 1652 C 1836 24.7 0.05 27.78 71.51 0.65 0 0 C>G Eed 2178 A 2194 26.3 30.77 0.36 0 0 0 68.87 delA Eed 2455 A 1984 24.2 64.87 0.05 34.93 0.1 0 0.05 A>AG Eed 2508 G 1943 24.6 0.87 0 33.71 0 0 65.41 insGTCAGGATACA Eed 2509 T 1942 24.6 0.88 0 0 33.63 0 65.5 - Eed 2510 C 1941 24.6 0 34.52 0 0 0 65.48 - Eed 2511 A 1935 24.6 34.11 0.1 0 0 0 65.79 - Eed 2512 G 1929 24.3 0 0 32.76 0 0 67.24 - Eed 2513 G 1917 19.5 31.61 0.16 1.36 0 0 66.88 -;G>A Eed 2514 A 1917 25.1 32.34 0.94 0 0 0 66.72 - Eed 2515 T 1915 25.4 0.16 0 0 32.79 0 67.05 - Eed 2516 A 1911 24.3 1.99 0.1 0 0 0 97.91 - Eed 2517 C 1915 25.6 0.26 31.85 0.1 0.94 0 66.84 - Eed 2518 A 1915 25.9 0.26 0 0.21 0.52 0 99.01 - Eed 2509 T 1942 24.6 0.88 0 0 33.63 0 65.5 - Eed 2513 G 1917 19.5 31.61 0.16 1.36 0 0 66.88 -;G>A Eed 2519 G 1933 20.4 0.31 0.83 67.72 0.1 0 31.04 - Eed 2523 G 1938 13.6 31.73 0 68.01 0.05 0.15 0.21 G>AG Eed 2529 C 2047 11 0.05 68.54 1.17 0.1 0.05 30.14 delC Eed 2530 A 2047 16 68.88 0 0 1.12 66.98 30 insA

178

Late 807 Ref. Ref. Gene Seq. Coverage Score A % C % G % T % Ins % Del % Mutation Call Nucl. Position Eed 2531 C 2044 16.4 68.15 1.57 0.05 0.24 0.2 29.99 C>A Eed 2532 A 2042 13.5 69.78 0.05 0.15 0 0.24 30.02 delA Eed 2538 C 2044 16.7 0.05 1.71 0.15 68.4 0 29.7 C>T Eed 2629 A 1958 25.1 6.54 0.1 93.26 0.1 0 0 A>G Eed 2703 G 1858 24.9 65.07 0.7 33.8 0.43 0 0 G>AG Eed 2768 T 1799 25.6 68.76 0.17 0.11 30.96 0 0 T>AT Eed 2852 G 2071 24.6 39.11 0 60.89 0 0 0 G>AG Eed 3028 T 1935 23.2 0.1 65.84 0.05 34.01 0 0 T>CT Eed 3304 T 2030 26 70.44 0 0 29.51 0 0.05 T>A Eed 3317 G 2001 25.5 0 0.2 32.98 66.77 0 0.05 G>GT Eed 3370 A 1825 25.2 30.19 0 69.59 0.16 0 0.05 A>AG Eed 3469 T 3128 26.5 1.69 64.32 0.58 32.83 0.03 0.58 T>CT Eed 3532 T 3079 27.8 1.04 46.41 0.84 51.41 0 0.29 T>CT Eed 3588 A 2415 26.2 60.29 0.12 0.41 38.84 0.04 0.33 A>AT Eed 3595 C 2356 23.7 0.21 68.97 0 30.56 0 0.25 C>CT Eed 3782 T 1957 24.3 0 0.15 67.71 32.14 0 0 T>GT Eed 3933 C 1818 24.2 0.06 61.61 0.06 38.28 0 0 C>CT Eed 4027 A 1855 25.8 57.47 42.48 0 0.05 0 0 A>AC Eed 4041 A 1807 25.1 25.4 0 74.54 0.06 0 0 A>G Eed 4127 A 1889 25.3 26.73 0.05 73.11 0.11 0 0 A>G Eed 4148 T 1829 25.2 0.05 0 38.55 61.4 0 0 T>GT Eed 4161 A 1806 24.7 42.08 0.17 57.42 0.33 0.17 0 A>AG Eed 4162 T 1805 25.2 0 0.06 0.06 99.89 56.4 0 insT Eed 4219 A 1723 25.2 30.3 0 69.53 0.12 0.06 0.06 A>AG Eed 4249 T 1867 25.5 0 33.9 0.11 65.99 0 0 T>CT Eed 4262 T 1889 25.1 0.16 30.17 0.11 69.56 0 0 T>CT Eed 4274 T 1913 25.1 0.05 70.31 0 29.64 0 0 T>C Eed 4363 A 1793 24.6 69.55 0.11 30.34 0 0 0 A>AG Eed 4418 T 1680 25.5 0.42 30.3 0.18 69.11 0 0 T>CT Eed 4556 A 1825 24.4 31.78 0 68.16 0.05 0 0 A>AG Eed 4593 G 1958 20.6 71.81 0.1 28.09 0 0 0 G>A Eed 4602 A 1931 21.2 31.8 0 0.1 68.1 0 0 A>AT Eed 4603 C 1951 21 64.58 31.32 0 3.79 0 0.31 C>AC Eed 4648 T 2002 25.8 0.1 73.28 0 26.62 0 0 T>C Eed 4649 A 2001 26 26.69 73.21 0.05 0.05 0 0 A>C Eed 4704 C 1836 22 0 32.46 67.54 0 0 0 C>CG Eed 4791 T 1654 23.5 0.06 64.93 0 35.01 0 0 T>CT Eed 4824 T 1700 25.1 0 0 0 100 0 0 G>T Eed 4923 T 1700 24.2 33.41 0.12 0.06 66.41 0 0 T>AT

179

Late 807 Ref. Ref. Gene Seq. Coverage Score A % C % G % T % Ins % Del % Mutation Call Nucl. Position Eed 4930 A 1763 20.3 65.29 0.06 0.06 34.6 0 0 A>AT Eed 4935 G 1786 25.2 0.06 35.95 64 0 0 0 G>CG Eed 5051 A 1633 23.5 68.65 0.12 0 31.17 0 0.06 A>AT Eed 5074 A 1596 22.6 5.45 0 0 0 0.31 94.55 delAA Eed 5075 A 1597 23.4 25.3 0 0 0 0 74.7 - Eed 5138 T 1378 24 0.15 72.86 0 27 0 0 T>C Eed 5140 G 1376 23.5 0 0.29 27.25 72.46 0 0 G>T GnRH3B 274 C 2055 26.4 41.75 58.2 0 0.05 0 0 C>AC GnRH3B 794 T 4389 28.1 0.09 0 99.54 0.36 0 0 T>G GnRH3B 913 A 2784 26.6 42.92 0 56.93 0.14 0 0 A>AG GnRH3B 1210 T 311 19.3 51.45 0 0.32 48.23 0 0 T>AT G0S2 180 A 899 22.1 53.39 0.11 0.22 0 0 46.27 delATAGTGAT G0S2 181 T 908 22.2 0 0 0 54.19 0 45.81 - G0S2 182 A 909 22.2 54.02 0.22 0 0 0 45.76 - G0S2 183 G 947 22.1 0 0 56.18 0 0 43.82 - G0S2 184 T 951 22.3 0.11 0.21 0 55.94 0 43.74 - G0S2 186 A 972 22.6 57 0 0.1 0.1 0 42.8 - G0S2 187 T 975 22.4 0.21 0 0.31 56.82 0 42.67 - G0S2 1157 G 4379 29 0.05 0.02 53.46 46.38 0 0.09 G>GT G0S2 1399 G 3198 27.7 52.31 0.13 47.53 0.03 0 0 G>AG G0S2 1426 C 3196 27.9 0.16 53.13 0.09 46.56 0 0.06 C>CT G0S2 1706 T 2970 27.4 52.32 0.03 0.03 47.21 0.03 0.4 T>AT G0S2 1791 C 3188 26.4 0.03 46.52 0.06 53.39 0 0 C>CT G0S2 1792 G 3205 26.5 0 0.03 46.61 53.35 0 0 G>GT BMAL 396 C 1662 23.6 48.13 51.74 0 0.12 0 0 C>AC BMAL 470 A 1845 26 50.08 0.11 0 47.32 0 2.49 A>AT BMAL 558 A 1741 25.3 49.34 0.06 0.11 0 0 50.49 delATT BMAL 559 T 1750 25.3 0 0 0.06 49.71 0 50.23 - BMAL 560 T 1746 25.3 0 0.06 0.06 49.6 0 50.29 - BMAL 791 C 1531 25.3 100 0 0 0 0 0 C>A BMAL 1229 A 2370 24.7 0.3 0.38 0.89 0.13 0 98.31 delA BMAL 1261 A 2200 24.2 47.09 0.05 52.77 0.05 0 0.05 A>AG BMAL 1318 T 1811 22.5 0.22 0.11 52.18 47.49 0 0 T>GT BMAL 1808 A 2244 25.6 0.04 99.91 0 0 0 0.04 A>C BMAL 2172 A 1741 25.5 53.82 0 0 0 0 46.18 delAA BMAL 2173 A 1741 25.8 52.21 0.06 1.67 0 0 46.07 - BMAL 2263 C 1530 24.1 0 52.42 0 47.58 0 0 C>CT BMAL 2413 T 2080 24.3 0 47.79 0 52.16 0 0.05 T>CT BMAL 2654 C 1008 22.2 57.14 42.86 0 0 0 0 C>AC

180

Late 807 Ref. Ref. Gene Seq. Coverage Score A % C % G % T % Ins % Del % Mutation Call Nucl. Position BMAL 2733 G 596 11 0 0 65.94 0 16.61 34.06 delG BMAL 2764 A 596 20.7 37.08 0.17 0 62.75 0 0 A>AT BMAL 2944 A 2143 23.9 52.36 0 47.6 0.05 0 0 A>AG BMAL 3131 G 1728 22.4 0 48.78 51.16 0.06 0 0 G>CG BMAL 3324 A 1877 24.7 48.53 0.05 0.16 51.25 0 0 A>AT BMAL 3459 A 1393 24.5 0.22 0.14 0 99.57 0 0.07 A>T BMAL 3796 T 1380 24.7 0.07 0 0 55.51 0 44.42 delTTGA BMAL 3797 T 1378 24.7 0 0 0.07 55.52 0 44.41 - BMAL 3798 G 1378 24.5 0.07 0.15 55.37 0 0 44.41 - BMAL 3799 A 1379 24.7 55.11 0 0.07 0.36 0 44.45 - BMAL 4141 C 1120 20.1 48.84 50.8 0.09 0.27 0.09 0 C>AC BMAL 4186 C 1334 21.4 0.07 50.67 0.37 48.88 0 0 C>CT BMAL 4741 A 1585 25.2 49.09 0.13 50.66 0 0 0.13 A>AG BMAL 4796 C 1628 23.3 0 50.8 0.06 49.08 0 0.06 C>CT BMAL 5100 G 1947 22.8 0 50.85 49.1 0.05 0 0 G>CG BMAL 5866 T 1819 24.4 48.43 0 0.11 51.46 0 0 T>AT BMAL 5877 A 1819 25.2 50.85 0.16 0.05 48.93 0 0 A>AT Kiss1r 152 C 708 19.3 0 52.97 0 47.03 0 0 C>CT Clock1b 401 G 82 13.7 48.78 0 51.22 0 0 0 G>AG Clock1b 406 T 90 13.3 51.11 0 0 48.89 0 0 T>AT Clock1b 507 T 205 15.4 0 0 49.27 50.73 0 0 T>GT Clock1b 514 A 214 16.7 49.07 50.93 0 0 0 0 A>AC Clock1b 533 C 217 16.4 51.15 48.85 0 0 0 0 C>AC

Late 808 Ref. Ref. Gene Seq. Coverage Score A % C % G % T % Ins % Del % Mutation Call Nucl. Position dec1 1362 G 1363 24.9 46.37 0 53.56 0.07 0 0 G>AG dec1 1535 G 1061 13 62.21 0 37.7 0.09 0 0 G>AG dec2 997 T 554 19.7 0 0 55.23 44.77 0 0 T>GT Eed 279 T 63 7.7 0 0 0 11.11 0 88.89 delT Eed 1652 C 1581 24.5 0.25 8.41 90.58 0.76 0 0 C>G Eed 2247 A 120 12.8 43.33 0 0 56.67 0 0 A>AT Eed 2508 G 25 0 0 0 100 0 100 0 insGTCAGGATACA Eed 2509 T 24 0 0 0 0 100 100 0 - Eed 2510 C 24 0 0 100 0 0 100 0 - Eed 2511 A 22 0 100 0 0 0 100 0 - Eed 2512 G 19 0 0 0 100 0 100 0 -

181

Late 808 Ref. Ref. Gene Seq. Coverage Score A % C % G % T % Ins % Del % Mutation Call Nucl. Position Eed 2513 G 18 0 0 0 100 0 100 0 - Eed 2514 A 18 0 100 0 0 0 100 0 - Eed 2515 T 18 0 0 0 0 100 100 0 - Eed 2516 A 17 0 100 0 0 0 100 0 - Eed 2517 C 18 0 0 100 0 0 100 0 - Eed 2518 A 18 0 100 0 0 0 100 0 - Eed 2509 T 24 0 0 0 0 100 100 0 - Eed 2513 G 18 0 0 0 100 0 100 0 - Eed 2531 C 16 0 0 100 0 0 0 0 A>C Eed 2629 A 533 15.8 19.89 0 80.11 0 0 0 A>G Eed 2703 G 884 21.8 83.14 0.68 15.5 0.68 0 0 G>A Eed 2768 T 1056 23.3 89.3 0 0.09 10.61 0 0 T>A Eed 2852 G 1111 19.6 36.63 0.18 63.19 0 0 0 G>AG Eed 3236 T 436 17.9 0 87.84 0 12.16 0 0 T>C Eed 3304 T 126 16.4 100 0 0 0 0 0 T>A Eed 3317 G 89 11.1 0 0 23.6 76.4 0 0 G>T Eed 3370 A 310 19 19.03 0 80.65 0.32 0 0 A>G Eed 3469 T 930 22.7 0.22 65.81 0.22 33.66 0 0.11 T>CT Eed 3532 T 811 22.2 0.25 47.23 0.49 52.03 0 0 T>CT Eed 3595 C 452 19 0.22 57.74 0.22 40.71 0 1.11 C>CT Eed 3933 C 84 14 0 60.71 0 39.29 0 0 C>CT Eed 4127 A 15 0 100 0 0 0 0 0 G>A Eed 4161 A 18 0 100 0 0 0 0 0 G>A Eed 4219 A 226 13.3 66.81 0 33.19 0 0 0 A>AG Eed 4249 T 672 20.2 0.15 62.8 0.15 36.9 0 0 T>CT Eed 4262 T 869 21.7 0 62.49 0.12 37.4 0 0 T>CT Eed 4274 T 1041 22.3 0.1 44.28 0 55.62 0 0 T>CT Eed 4363 A 1559 24.4 40.6 0.06 59.33 0 0 0 A>AG Eed 4418 T 1425 24.1 0.07 60.21 0.07 39.65 0 0 T>CT Eed 4497 A 524 20.4 48.47 0.19 0 51.34 0 0 A>AT Eed 4556 A 274 18.3 13.87 0 86.13 0 0 0 A>G Eed 4602 A 64 10.5 59.38 0 0 40.62 0 0 A>AT Eed 4648 T 42 12.7 0 100 0 0 0 0 T>C Eed 4649 A 42 12.7 0 100 0 0 0 0 A>C Eed 4704 C 516 15.2 0 14.73 85.27 0 0 0 C>G Eed 4791 T 1281 23.2 0.08 61.83 0 38.1 0 0 T>CT Eed 4824 T 1570 21.8 0 0 71.59 28.41 0 0 T>G Eed 4923 T 1381 23.2 54.16 0.22 0.29 45.33 0 0 T>AT Eed 4930 A 1216 18.3 43.75 0 0.33 55.92 0 0 A>AT

182

Late 808 Ref. Ref. Gene Seq. Coverage Score A % C % G % T % Ins % Del % Mutation Call Nucl. Position Eed 4935 G 1214 21.6 0.08 56.51 43.16 0.25 0 0 G>CG Eed 5051 A 347 20 39.77 0 0 60.23 0 0 A>AT Eed 5074 A 227 18.7 2.2 0 0 0 0 97.8 delAAA Eed 5075 A 227 18.7 4.85 0 0 0 0 95.15 - Eed 5076 A 228 17.8 55.7 0 0 0 0 44.3 - Eed 5138 T 360 20.3 0.28 99.44 0 0.28 0 0 T>C Eed 5140 G 360 20.3 0 0 0.28 99.72 0 0 G>T Eed 5300 C 535 20.2 0 66.73 1.68 31.59 1.5 0 C>CT Eed 5301 A 536 20 63.99 1.68 31.72 0 0 2.61 A>AG GnRH3B 353 A 622 21.5 41.8 0 58.04 0.16 0 0 A>AG G0S2 180 A 330 19.3 56.06 0 0 0 0 43.94 delATAGTGAT G0S2 181 T 331 19.1 0 0 0 56.19 0 43.81 - G0S2 182 A 330 19.3 56.06 0 0 0 0 43.94 - G0S2 183 G 338 18.7 0 0 57.1 0 0 42.9 - G0S2 184 T 339 18.5 0 0 0 57.23 0 42.77 - G0S2 185 G 340 18.6 0 0 57.35 0 0 42.65 - G0S2 186 A 345 18.6 57.39 0 0 0.58 0 42.03 - G0S2 187 T 347 18.6 0 0 0.58 57.64 0 41.79 - G0S2 1399 G 887 21.4 58.4 0.11 41.38 0.11 0 0 G>AG G0S2 1426 C 733 22.1 0 62.62 0.14 37.24 0 0 C>CT G0S2 1519 G 34 18.1 0 100 0 0 0 0 A>G G0S2 1706 T 171 17.5 38.6 0 0 61.4 0 0 T>AT G0S2 1791 C 507 19.9 0.2 54.44 0 45.36 0 0 C>CT G0S2 1792 G 510 20.1 0 0 54.9 45.1 0 0 G>GT G0S2 2750 C 2681 26.5 0.11 48.6 0.04 51.25 0 0 C>CT BMAL 597 A 112 15.7 56.25 43.75 0 0 0 0 A>AC BMAL 791 C 213 16.6 53.99 46.01 0 0 0 0 C>AC BMAL 826 G 112 16.2 41.07 0 58.93 0 0 0 G>AG BMAL 1229 A 1382 24 0.14 0.29 0.87 0.22 0 98.48 delA BMAL 1261 A 1303 22.8 0.08 0 99.69 0.23 0 0 A>G BMAL 1318 T 1083 23.7 0.09 0.18 99.72 0 0 0 T>G BMAL 1808 A 125 16.6 0 100 0 0 0 0 A>C BMAL 2172 A 133 3.4 56.39 0 0.75 0 0 42.86 delA BMAL 2173 A 133 2.6 0.75 0 56.39 0 0 42.86 delA;A>G BMAL 2413 T 1158 22 0.17 47.15 0.09 52.5 0 0.09 T>CT BMAL 2654 C 526 17.9 66.16 33.46 0 0.38 0 0 C>AC BMAL 2944 A 689 21.9 54.57 0 45.43 0 0 0 A>AG BMAL 3131 G 1057 19.6 0 47.59 52.32 0.09 0 0 G>CG BMAL 3324 A 788 18.8 31.6 0.25 0.25 67.39 0 0.51 A>AT

183

Late 808 Ref. Ref. Gene Seq. Coverage Score A % C % G % T % Ins % Del % Mutation Call Nucl. Position BMAL 4741 A 177 16.6 44.63 0 55.37 0 0 0 A>AG BMAL 4796 C 241 17.6 0.41 53.11 0 46.47 0 0 C>CT BMAL 5100 G 1167 16 0.17 51.24 48.5 0.09 0 0 G>CG BMAL 5877 A 715 21.8 47.55 0.14 0 52.31 0 0 A>AT Clock1b 1394 T 41 11.9 0 0 0 100 17.07 0 insT Clock1b 1400 G 38 12.6 0 0 68.42 31.58 0 0 G>GT

Late 850 Ref. Ref. Gene Seq. Coverage Score A % C % G % T % Ins % Del % Mutation Call Nucl Position dec1 693 C 4214 28.6 0.05 51.09 0.02 48.84 0 0 C>CT dec1 1362 G 6052 29.5 51.11 0.1 48.74 0.05 0 0 G>AG dec1 1535 G 5832 27 50.43 0.02 49.52 0.03 0 0 G>AG dec1 2056 G 4471 27.9 49.72 0.2 49.99 0.09 0 0 G>AG dec2 698 A 5129 29.5 0.51 0.04 0.1 99.3 0 0.06 A>T dec2 997 T 5711 28.7 0.02 0.02 48.77 51.18 0 0.02 T>GT Eed 1652 C 3208 27.4 0.03 43.36 56.17 0.41 0 0.03 C>CG Eed 1821 A 3567 27.5 67.82 0.06 31.99 0.11 0 0.03 A>AG Eed 2129 C 3881 27.2 0 67.48 0.03 32.49 0 0 C>CT Eed 2157 A 4201 27.4 11.31 0 88.67 0.02 0 0 A>G Eed 2178 A 4339 28.7 13.16 0.07 0 0 0 86.77 delA Eed 2247 A 4226 28.3 38.45 0 0.14 61.38 0 0.02 A>AT Eed 2455 A 4053 27.8 28.25 0 71.72 0.02 0 0 A>G Eed 2597 T 4036 27.5 12.41 0 87.44 0.15 0 0 T>G Eed 2688 G 3690 25.6 40.35 0.08 59.54 0.03 0 0 G>AG Eed 2768 T 3755 27 56.4 0.08 0.08 43.44 0 0 T>AT Eed 2852 G 3953 26.7 37.97 0.1 61.83 0.08 0 0.03 G>AG Eed 3236 T 3762 27.3 0.16 60.31 0 39.47 0 0.05 T>CT Eed 3469 T 5866 28.9 1.65 47.56 0.68 49.78 0.03 0.32 T>CT Eed 3499 G 5363 29.2 33 0.21 66.14 0.37 0 0.28 G>AG Eed 3525 A 5133 28.4 66.1 0.12 1.09 32.3 0.72 0.39 A>AT Eed 3532 T 5041 28.9 1.83 42.37 0.99 54.45 0 0.36 T>CT Eed 3562 G 4240 26.3 44.6 0.19 53.82 0.64 0 0.75 G>AG Eed 3588 A 3704 28.2 49.08 0.03 2.05 47.87 1.4 0.97 A>AT Eed 3759 T 2956 24.5 0 0.03 60.01 39.95 0 0 T>GT Eed 3782 T 3342 27.5 0 0.03 41.74 58.23 0 0 T>GT Eed 4027 A 3254 26.6 65.4 34.36 0.06 0.09 0 0.09 A>AC Eed 4041 A 3168 27.3 10.32 0.09 89.55 0.03 0 0 A>G

184

Late 850 Ref. Ref. Gene Seq. Coverage Score A % C % G % T % Ins % Del % Mutation Call Nucl Position Eed 4127 A 3234 27.7 32.44 0 67.5 0.06 0.06 0 A>AG Eed 4161 A 3154 25.1 100 0 0 0 0 0 G>A Eed 4219 A 2954 27.3 17.74 0.03 82.19 0.03 0 0 A>G Eed 4222 T 3005 21.5 0.27 0.1 48.42 51.11 0 0.1 T>GT

Eed 4224 G 3003 21.5 48.65 0.03 51.28 0.03 0 0 G>AG

Eed 4274 T 3525 26.8 0 81.5 0.03 18.47 0 0 T>C Eed 4363 A 3675 27.9 46.39 0.08 53.52 0 0 0 A>AG Eed 4418 T 3559 28.3 0.11 54.06 0.08 45.72 0 0.03 T>CT Eed 4466 C 3479 26.5 31.7 68.27 0 0.03 0 0 C>AC Eed 4531 A 3774 27.7 63.83 35.98 0.03 0.05 0 0.11 A>AC Eed 4556 A 3749 27.1 49.83 0.03 50.04 0.11 0 0 A>AG Eed 4580 G 3958 27.8 0.03 0 63.62 36.31 0 0.05 G>GT Eed 4593 G 4067 23 86.8 0.12 12.93 0.15 0 0 G>A Eed 4602 A 3969 21.8 17.76 0.03 0.13 82.09 0 0 A>T Eed 4603 C 3988 20.7 13.34 17.68 0.03 68.91 0 0.05 C>T Eed 4648 T 4150 28.8 0.05 51.78 0.1 48.07 0.02 0 T>CT Eed 4649 A 4151 28.2 13.2 86.65 0.05 0.1 0 0 A>C Eed 4704 C 3924 25.4 0.08 12.21 87.61 0.1 0 0 C>G Eed 4923 T 3258 27.6 53.01 0.31 0.25 46.44 0 0 T>AT Eed 4930 A 3449 25.9 14.44 0.12 0.06 85.39 0 0 A>T Eed 4935 G 3475 26.2 0.09 85.21 14.59 0.12 0 0 G>C Eed 5044 C 3109 26.7 67.22 32.65 0.13 0 0 0 C>AC Eed 5045 A 3143 27.3 33.03 0.06 66.75 0.13 0 0.03 A>AG Eed 5074 A 3031 27.1 2.54 0 0 0 0.03 97.46 delAAAAAA Eed 5075 A 3028 27.4 5.58 0 0.03 0 0 94.39 - Eed 5076 A 3024 27.1 24.67 0.07 0.17 0 0 75.1 - Eed 5077 A 3017 27.5 55.29 0 0 0.13 0 44.58 - Eed 5078 A 3010 27.2 63.49 0 0.03 0 0 36.48 - Eed 5079 A 3009 27.2 64.31 0.03 0.03 0 0 35.63 - Eed 5138 T 2729 26.5 0 85.09 0.04 14.88 0 0 T>C Eed 5140 G 2723 26.5 0.07 0.11 14.98 84.83 0 0 G>T Eed 5185 A 2352 25.5 30.23 0.04 69.64 0.09 0 0 A>AG delTGCTTGGCC Eed 5212 T 2266 25.6 0.09 0.09 0 60.72 0 39.1 CTGCCCAGCCC CT Eed 5213 G 2266 25.6 0 0 60.86 0.04 0 39.1 - Eed 5214 C 2265 25.9 0 60.84 0 0.04 0 39.12 - Eed 5215 T 2253 25.9 0 0.13 0.04 60.45 0 39.37 - Eed 5216 T 2249 25.9 0 0 0.04 60.52 0 39.44 -

185

Late 850 Ref. Ref. Gene Seq. Coverage Score A % C % G % T % Ins % Del % Mutation Call Nucl Position Eed 5217 G 2180 25.5 0.09 0 59.08 0.14 0 40.69 - Eed 5218 G 2179 25.5 0.09 0.05 58.93 0.18 0 40.75 - Eed 5219 C 2180 25.8 0 58.85 0.05 0.28 0 40.83 - Eed 5220 C 2180 25.8 0.18 58.81 0.05 0.14 0 40.83 - Eed 5221 C 2170 26 0 58.94 0 0.05 0 41.01 - Eed 5222 T 2098 25.6 0 0.1 0.1 57.53 0 42.28 - Eed 5223 G 2097 25.6 0.05 0 57.42 0.1 0 42.44 - Eed 5224 C 2097 25.6 0 57.51 0 0.05 0 42.44 - Eed 5225 C 2093 25.6 0 57.43 0.1 0 0 42.47 - Eed 5226 C 2092 25.6 0.05 57.41 0 0 0 42.54 - Eed 5227 A 2030 25.8 55.76 0.05 0.3 0.05 0 43.84 - Eed 5228 G 2028 25.5 0.15 0.05 55.92 0 0 43.89 - Eed 5229 C 2010 25.5 0.05 55.32 0.1 0.2 0 44.33 - Eed 5230 C 2007 25.5 0 55.51 0.05 0.1 0 44.34 - Eed 5231 C 2006 25.5 0.05 55.33 0.1 0.15 0 44.37 - Eed 5232 C 1974 25.9 0.1 54.71 0.05 0.05 0 45.09 - Eed 5233 T 1970 25.9 0.1 0.1 0.15 54.47 0 45.18 - Eed 5264 C 1713 24.2 0.12 31.12 0 60.19 0 8.58 C>CT Eed 5269 C 1711 20.2 0 33.43 0.12 57.8 0 8.65 C>CT Eed 5275 C 1743 16.7 67.87 31.27 0.46 0.23 0 0.17 C>AC Eed 5283 G 1753 19.6 0 0 39.19 0.23 0 60.58 delG Eed 5285 C 1761 18.9 0.06 30.44 0 60.31 0 9.2 C>CT GnRH3B 794 T 6245 27.5 0.06 0.06 49.94 49.9 0 0.03 T>GT GnRH3B 913 A 4431 25.5 48.59 0 51.32 0.07 0 0.02 A>AG GnRH3B 1210 T 437 19.5 53.09 0 0.23 46.68 0 0 T>AT G0S2 991 T 3886 28 0.23 50.15 0 49.56 0 0.05 T>CT G0S2 1399 G 3757 28.5 99.84 0.03 0.11 0 0 0.03 G>A G0S2 2476 T 4360 27.5 0 0 50.09 49.91 0 0 T>GT G0S2 2535 G 4452 27.9 50.27 0.13 49.55 0.04 0 0 G>AG G0S2 2857 A 3881 26.9 50.5 0.1 0.05 49.34 0 0 A>AT G0S2 2874 A 3651 27.2 49.71 50.23 0.05 0 0 0 A>AC G0S2 2878 T 3556 27.4 0.08 50.17 0.03 49.72 0 0 T>CT G0S2 4005 T 2457 27 0 0.04 48.68 51.24 0 0.04 T>GT G0S2 4112 A 2287 26.6 0 99.96 0 0 0 0.04 A>C G0S2 4301 C 2117 25.6 0.05 48.46 0 51.49 0 0 C>CT G0S2 4397 C 2944 26.6 0.1 51.32 0 48.54 0 0.03 C>CT G0S2 4420 A 3028 27.5 48.51 0.03 0.3 0 0 51.16 delATGACGGTC G0S2 4421 T 3022 27.5 0 0.07 0.03 48.61 0 51.29 - G0S2 4422 G 3049 27.8 0.1 0 49 0.03 0 50.87 -

186

Late 850 Ref. Ref. Gene Seq. Coverage Score A % C % G % T % Ins % Del % Mutation Call Nucl Position G0S2 4423 A 3052 27.8 48.85 0.03 0.29 0 0 50.82 - G0S2 4424 C 3053 27.8 0.03 49.13 0 0.03 0 50.8 - G0S2 4425 G 3053 27.8 0.03 0 49.2 0 0 50.77 - G0S2 4426 G 3049 27.8 0.03 0 49.1 0 0 50.87 - G0S2 4427 T 3055 27.8 0.03 0.03 0.13 49.03 0 50.77 - G0S2 4428 C 3054 27.8 0.16 49.02 0 0.07 0 50.75 - G0S2 4513 C 2630 27.2 0.04 48.82 0 51.14 0 0 C>CT G0S2 4551 G 2378 21.8 50.34 0.04 49.58 0.04 0 0 G>AG G0S2 4558 C 2319 21.3 0.09 50.24 0 49.68 0 0 C>CT G0S2 4637 T 1890 25.1 0.05 0 50.11 49.84 0 0 T>GT G0S2 4645 C 1854 25 0.11 49.95 0 49.95 0 0 C>CT BMAL 2172 A 2884 23.2 1.32 0 0 0 0 98.68 delAA BMAL 2173 A 2887 23.7 0.24 0.1 1.11 0.1 0 98.44 - BMAL 2413 T 5316 27.3 0.02 44.38 0.06 55.55 0 0 T>CT BMAL 2654 C 3098 25.8 64.91 34.99 0.03 0.06 0 0 C>AC BMAL 2733 G 2189 10.5 0.09 0.32 67.11 0.05 17.63 32.43 delG BMAL 2764 A 2026 23.5 30.55 0.1 0.1 69.25 0 0 A>AT BMAL 2944 A 7084 28.2 54.01 0.01 45.78 0.2 0 0 A>AG BMAL 3131 G 6898 29.3 0.04 46.52 53.35 0.07 0 0.01 G>CG BMAL 3324 A 7433 29.6 48.15 0.23 0.22 51.23 0 0.17 A>AT BMAL 3344 T 7064 27 0.03 0.1 0.04 99.77 48.07 0.06 insT BMAL 3348 C 7039 27.3 0.1 50.93 0.07 48.9 0 0 C>CT BMAL 3459 A 5851 28.2 47.8 0.07 0.02 51.99 0 0.12 A>AT BMAL 3796 T 5398 28 0 0.13 0.04 51.76 0 48.07 delTTGA BMAL 3797 T 5394 28 0 0.07 0.04 51.84 0 48.05 - BMAL 3798 G 5403 28 0.02 0.28 51.67 0.04 0 47.99 - BMAL 3799 A 5395 28 51.23 0.15 0.07 0.33 0 48.21 - BMAL 4741 A 5421 28.6 50.34 0.09 49.4 0.15 0 0.02 A>AG BMAL 4796 C 5436 29.2 0.09 50.68 0 49.21 0 0.02 C>CT BMAL 5100 G 6626 26.1 0.12 50.24 49.59 0.05 0 0 G>CG BMAL 5877 A 5155 29 48.36 0.08 0.17 51.35 0 0.04 A>AT Kiss1r 152 C 970 20.7 0 55.36 0 44.64 0 0 C>CT Clock1b 401 G 98 10.7 44.9 0 55.1 0 0 0 G>AG

Late 851 Ref. Ref. Gene Seq. Coverage Score A % C % G % T % Ins % Del % Mutation Call Nucl. Position dec1 565 G 11593 29.4 52.18 0.04 47.75 0.02 0 0.01 G>AG

187

Late 851 Ref. Ref. Gene Seq. Coverage Score A % C % G % T % Ins % Del % Mutation Call Nucl. Position dec1 953 T 11218 30 0.01 0.06 52.56 47.35 0 0.02 T>GT dec1 1362 G 15271 32.3 47.95 0.09 51.89 0.08 0 0 G>AG dec1 1535 G 14182 29.1 46.74 0 53.2 0.05 0 0.01 G>AG dec1 2056 G 12391 31.6 51.24 0.16 48.51 0.08 0 0.01 G>AG dec1 2114 C 12457 31.3 0.08 48.86 0.13 50.92 0 0.01 C>CT dec1 2501 T 22 7.5 0 100 0 0 0 0 T>C dec2 698 A 7207 30.1 0.21 0.04 0.1 99.64 0 0.01 A>T dec2 997 T 7661 30.6 0 0 99.95 0.05 0 0 T>G Eed 279 T 4016 28.1 0.05 0.02 0.05 21.02 0 78.86 delT Eed 629 T 6670 29.2 0.04 80.04 0.01 19.9 0 0 T>C Eed 1652 C 7104 29.8 0.03 31.28 68.26 0.44 0 0 C>CG Eed 2157 A 8150 29.6 11.17 0 88.75 0.09 0 0 A>G Eed 2178 A 8225 31.2 29.59 0.38 0 0 0.02 70.03 delA Eed 2375 A 7350 25.6 69.82 0.03 30.11 0.04 0 0 A>AG Eed 2455 A 7684 30.9 30.23 0 69.74 0.03 0 0 A>AG Eed 2597 T 7841 30 11.84 0.03 88 0.14 0 0 T>G Eed 2629 A 6954 28.1 64.67 0.01 35.23 0.06 0 0.03 A>AG Eed 2688 G 7247 29.2 53.15 0.04 46.78 0.03 0 0 G>AG Eed 2768 T 7312 30.1 72.02 0.11 0.11 27.76 0 0 T>A Eed 2852 G 7603 25.9 51.74 0.08 48.11 0.07 0 0 G>AG Eed 3028 T 7216 26.4 0.06 81.21 0.03 18.71 0 0 T>C Eed 3236 T 7186 29.2 0.07 47.93 0.08 51.92 0 0 T>CT Eed 3469 T 10782 31.8 0.92 35.17 0.35 63.24 0.04 0.32 T>CT Eed 3499 G 10048 30.7 36.72 0.09 62.94 0.1 0 0.15 G>AG Eed 3525 A 9743 31.5 60.77 0.15 0.52 38.31 0 0.24 A>AT Eed 3532 T 9627 31.1 0.75 37.85 0.56 60.57 0.03 0.27 T>CT Eed 3562 G 8734 29.2 50.09 0.08 48.96 0.26 0 0.61 G>AG Eed 3588 A 8101 30.2 39.59 0.06 0.2 59.52 0.04 0.63 A>AT Eed 3759 T 6633 26.4 0 0 87.52 12.48 0 0 T>G Eed 3782 T 6743 29.9 0.01 0.04 31.38 68.55 0 0.01 T>GT Eed 4041 A 6348 29.1 29.03 0.02 70.87 0.06 0 0.02 A>G Eed 4127 A 7071 29.5 18.48 0.01 81.4 0.08 0.01 0.01 A>G Eed 4161 A 7065 30.4 47.37 0.11 51.88 0.62 0.18 0.01 A>AG Eed 4162 T 7059 29.5 0 0 0 99.99 50.06 0.01 insT Eed 4219 A 6359 23.5 18.67 0.03 81.24 0.06 0 0 A>G Eed 4222 T 6579 24.1 0.11 0.06 81.49 18.33 0 0.02 T>G Eed 4224 G 6518 23.8 81.31 0.12 18.53 0.03 0 0 G>A Eed 4249 T 6573 29.5 0.09 80.24 0.03 19.64 0 0 T>C Eed 4274 T 6970 30 0.04 80.53 0 19.43 0 0 T>C

188

Late 851 Ref. Ref. Gene Seq. Coverage Score A % C % G % T % Ins % Del % Mutation Call Nucl. Position Eed 4418 T 7040 28.8 0.26 69.39 0.14 30.21 0 0 T>CT Eed 4531 A 7317 29.6 52.23 47.66 0 0.03 0 0.08 A>AC Eed 4580 G 7855 29.5 0.03 0.05 52.03 47.87 0 0.03 G>GT Eed 4593 G 7912 25.1 65.66 0.06 34.23 0.04 0.01 0.01 G>AG Eed 4602 A 7821 31 17.41 0.05 0.09 82.44 0 0 A>T Eed 4603 C 7876 12.7 34.14 17.27 0 48.51 0 0.08 C>AT Eed 4649 A 7934 29.8 33.6 66.35 0 0.03 0 0.03 A>AC Eed 4704 C 7208 25.7 0.07 32.84 67.04 0.06 0 0 C>CG Eed 4824 T 7257 30.1 0.04 0.07 82.4 17.49 0 0 T>G Eed 4923 T 7046 30.3 66.59 0.14 0.16 33.11 0 0 T>AT Eed 4930 A 7388 23.7 33.26 0.14 0.08 66.53 0 0 A>AT Eed 4935 G 7533 28.7 0.09 67.64 32.13 0.15 0 0 G>CG Eed 5044 C 6560 29.2 46.98 52.93 0.08 0.02 0 0 C>AC Eed 5045 A 6624 29.2 53.08 0.08 46.75 0.09 0.02 0 A>AG Eed 5074 A 6360 28.8 3.3 0 0.02 0 0.14 96.68 delAAAAAA Eed 5075 A 6355 28.8 14.89 0 0.02 0.03 0 85.07 - Eed 5076 A 6354 29.4 39.35 0 0.06 0.03 0 60.56 - Eed 5077 A 6354 29.4 49.04 0 0.02 0.05 0 50.9 - Eed 5078 A 6350 29.1 50.66 0.02 0 0 0 49.32 - Eed 5079 A 6349 29.4 50.72 0.02 0.06 0 0 49.2 - Eed 5107 C 6200 29 0.27 68.52 0.08 31.13 0 0 C>CT Eed 5138 T 5889 29.4 0.02 68.67 0.1 31.21 0.02 0 T>CT Eed 5140 G 5884 29.4 0.05 0.1 31.32 68.52 0 0 G>GT Eed 5185 A 5140 29.3 49.11 0.21 50.66 0.02 0 0 A>AG Eed 5222 T 4334 28.1 0.02 0.07 0.09 69.73 0 30.09 delT Eed 5227 A 4210 28.6 68.69 0.1 0.17 0.07 0 30.97 delAGCCCCT Eed 5228 G 4232 28.3 0.17 0.02 68.86 0.12 0 30.84 - Eed 5229 C 4203 28.3 0.05 68.76 0 0.12 0 31.07 - Eed 5230 C 4199 28.3 0.02 68.85 0 0.07 0 31.06 - Eed 5231 C 4198 28.3 0.07 68.7 0.05 0.1 0 31.09 - Eed 5232 C 4082 28.5 0 68.08 0 0 0 31.92 - Eed 5233 T 4109 28.8 0.1 0.07 0.17 67.92 0 31.74 - Eed 5264 C 4017 27.9 0.12 51.95 0.05 42.67 0.05 5.2 C>CT Eed 5269 C 4124 22.2 0.1 53.86 0.05 40.96 0.02 5.04 C>CT Eed 5275 C 4264 18.7 46.39 53.05 0.14 0.19 0 0.23 C>AC Eed 5283 G 4383 22.6 0.07 0.14 55.24 0.11 0 44.44 delG Eed 5285 C 4438 21.9 0.09 49.48 0.05 44.55 0 5.84 C>CT G0S2 991 T 8771 31 0 99.77 0.01 0.17 0 0.05 T>C G0S2 1399 G 8854 31.2 99.8 0.03 0.14 0.03 0 0 G>A

189

Late 851 Ref. Ref. Gene Seq. Coverage Score A % C % G % T % Ins % Del % Mutation Call Nucl. Position G0S2 4112 A 5455 28.7 0.16 99.73 0 0.09 0 0.02 A>C G0S2 4397 C 6669 30.5 0.03 0.21 0.06 99.7 0 0 C>T BMAL 791 C 3531 28.2 99.94 0 0.06 0 0 0 C>A BMAL 1229 A 4518 28.5 0.31 0.29 0.62 0.09 0 98.69 delA BMAL 1261 A 4435 29.1 0.05 0 99.91 0.05 0 0 A>G BMAL 1318 T 3967 28.5 0.2 0.15 99.5 0.15 0 0 T>G BMAL 1808 A 4061 28.7 0.02 99.98 0 0 0 0 A>C BMAL 2172 A 3952 22.9 4.91 0 0 0 0 95.09 delAA BMAL 2173 A 3950 22.9 0.25 0.03 4.66 0.03 0 95.04 - BMAL 2654 C 2881 27 99.58 0.35 0.07 0 0 0 C>A BMAL 2733 G 1757 13.5 0.06 0.17 67.44 0.4 14.34 31.93 delG BMAL 2764 A 1607 24.7 0.12 0.19 0 99.69 0.06 0 A>T BMAL 3324 A 4082 28.5 0.1 0.15 0.22 99.49 0 0.05 A>T BMAL 3459 A 3482 27.9 0.83 0.03 0.03 99.05 0 0.06 A>T BMAL 3796 T 3339 22.4 0 0.09 0 3.83 0 96.08 delTTGA BMAL 3797 T 3338 22.7 0 0.03 0 3.8 0 96.17 - BMAL 3798 G 3351 23.2 0 0.54 3.67 0 0 95.79 - BMAL 3799 A 3359 22.1 3.13 0.18 0 0.86 0 95.83 - BMAL 4796 C 3206 27.8 0.06 0.22 0.03 99.69 0 0 C>T BMAL 5877 A 3432 27.8 0.06 0.15 0.06 99.56 0 0.17 A>T Kiss1r 152 C 1298 23.3 0.08 51.69 0.08 48.15 0 0 C>CT Clock1b 1394 T 317 19.3 0 0 0 100 31.23 0 insT Clock1b 1400 G 315 18.9 0 0 63.81 36.19 0 0 G>GT

Late 852 Ref. Ref. Gene Seq. Coverage Score A % C % G % T % Ins % Del % Mutation Call Nucl Position dec1 342 T 5692 29.7 38.48 0.02 0 61.23 0 0.28 T>AT dec1 953 T 8989 31.2 0.03 0.02 36.57 63.38 0 0 T>GT dec1 2056 G 10086 31.6 39.69 0.14 60.09 0.06 0 0.02 G>AG dec2 698 A 3616 27.7 0.33 0.08 0.08 99.47 0 0.03 A>T dec2 997 T 3904 28.3 0.03 0.03 49.67 50.2 0 0.08 T>GT Eed 1821 A 3935 27.5 68.95 0.13 30.85 0.05 0 0.03 A>AG Eed 2247 A 3941 28.6 0.15 0.08 0 99.77 0 0 A>T Eed 2455 A 3648 27.2 15.27 0.03 84.68 0.03 0 0 A>G Eed 2457 G 3701 27.6 53.5 0 46.47 0.03 0 0 G>AG Eed 3304 T 3570 26.6 69.38 0.08 0.2 30.34 0 0 T>AT Eed 3469 T 3322 26.1 3.4 42.47 0.48 51.14 0.06 2.5 T>CT

190

Late 852 Ref. Ref. Gene Seq. Coverage Score A % C % G % T % Ins % Del % Mutation Call Nucl Position Eed 3532 T 2960 26.8 1.66 36.49 0.44 60.51 0 0.91 T>CT Eed 3610 C 2351 26.1 0.13 37.56 0.17 52.96 0 9.19 C>CT Eed 3759 T 2967 25.1 0 0 0 100 0 0 G>T Eed 3782 T 3300 26.9 0.06 0 83.27 16.67 0 0 T>G Eed 4027 A 3303 26.7 69 30.82 0.09 0.03 0 0.06 A>AC Eed 4049 T 3190 27.4 0.09 0 54.2 45.67 0 0.03 T>GT Eed 4127 A 3531 26.8 27.9 0 71.99 0.06 0 0.06 A>G Eed 4161 A 3480 27.4 27.56 0.06 72.01 0.32 0.14 0.06 A>G Eed 4162 T 3480 27.9 0.03 0.03 0 99.89 70.98 0.06 insT Eed 4262 T 3598 27.4 0.08 71.79 0.03 28.1 0 0 T>C Eed 4363 A 3476 27.6 0.2 0 99.77 0.03 0 0 A>G Eed 4418 T 3286 25.8 0.21 69.72 0.03 30.04 0 0 T>CT Eed 4556 A 3529 27.4 55.68 0.11 44.18 0 0 0.03 A>AG Eed 4580 G 3676 28.4 0 0.08 44.1 55.77 0 0.05 G>GT Eed 4602 A 3730 22.3 13.57 0.05 0.05 86.3 0 0.03 A>T Eed 4603 C 3734 22.3 0.05 13.6 0.11 86.23 0 0 C>T Eed 4648 T 3877 28.6 0.13 99.74 0 0.13 0 0 T>C Eed 4649 A 3875 28.3 0.05 99.79 0.03 0.13 0 0 A>C Eed 4704 C 3385 25.3 0.09 50.46 49.45 0 0 0 C>CG Eed 4775 T 3012 26.6 0.07 0 0 52.76 0 47.18 delTTG Eed 4776 T 3052 26.9 0 2.75 0.07 50.66 0 46.53 - Eed 4777 G 3053 26.9 1.15 2.72 49.75 0 0 46.38 - Eed 4791 T 3023 27.4 0.03 49.62 0.03 50.31 0 0 T>CT Eed 4793 C 3056 27.7 0.16 49.71 0 50.13 0 0 C>CT Eed 4930 A 3464 25.9 49.77 0.06 0.12 50.06 0 0 A>AT Eed 4935 G 3524 27.1 0.09 50.26 49.6 0.06 0 0 G>CG Eed 5044 C 3040 26.4 32.04 67.83 0.1 0.03 0.03 0 C>AC Eed 5045 A 3051 26.1 67.94 0.1 31.92 0.03 0 0 A>AG Eed 5074 A 2944 27.3 1.56 0 0 0 0 98.44 delAAA Eed 5075 A 2944 27.6 3.57 0 0 0.03 0 96.4 - Eed 5076 A 2945 26.8 18.78 0.03 0.24 0.07 0 80.88 - Eed 5138 T 2616 27.2 0.08 99.73 0 0.19 0 0 T>C Eed 5140 G 2615 26.9 0.08 0.23 0.31 99.39 0 0 G>T Eed 5185 A 2246 26.7 67.01 0.36 32.5 0.13 0 0 A>AG Eed 5275 C 1669 23.9 30.62 68.96 0.18 0.06 0 0.18 C>AC GnRH3B 331 A 3301 27.5 51.01 0 0.12 48.86 0 0 A>AT GnRH3B 360 G 3577 28 48.25 0.08 51.61 0.06 0 0 G>AG GnRH3B 411 C 3709 27.6 0.13 51.28 0 48.58 0 0 C>CT GnRH3B 794 T 3708 25.9 0.11 0.11 49.43 50.35 0 0 T>GT

191

Late 852 Ref. Ref. Gene Seq. Coverage Score A % C % G % T % Ins % Del % Mutation Call Nucl Position GnRH3B 1026 C 2664 24 50.26 49.59 0.04 0.04 0 0.08 C>AC GnRH3B 1210 T 260 18.8 51.54 0 0.77 47.69 0 0 T>AT G0S2 180 A 852 23.4 0.35 0 0 0 0 99.65 delATAGTGAT G0S2 181 T 852 23.4 0 0 0 0 0 100 - G0S2 182 A 852 23.4 0 0 0 0 0 100 - G0S2 183 G 852 23.4 0 0 0.12 0 0 99.88 - G0S2 184 T 852 23.4 0 0 0 0.12 0 99.88 - G0S2 185 G 852 23.4 0 0 0.35 0 0 99.65 - G0S2 186 A 858 21.6 0.82 0 0 0 0 99.18 - G0S2 187 T 860 19.9 0 0 0.81 0.12 0 99.07 - insACACACACA G0S2 486 A 2893 25.7 99.72 0.03 0.1 0.07 38.3 0.07 CACATACACAC G0S2 1157 G 4352 28 0.02 0.09 0.07 99.72 0 0.09 G>T G0S2 1426 C 3272 28 0 0.03 0 99.94 0 0.03 C>T G0S2 1654 G 3308 26.3 48.58 0.09 49.85 1.18 0 0.3 G>AG BMAL 396 C 1288 22.3 45.65 54.19 0.16 0 0 0 C>AC BMAL 470 A 1454 25.2 45.19 0 0 52.13 0 2.68 A>AT BMAL 558 A 1432 24.4 49.02 0 0 0 0 50.98 delATT BMAL 559 T 1436 24.6 0 0.21 0 48.75 0 51.04 - BMAL 560 T 1437 24.6 0 0.21 0 48.92 0 50.87 - BMAL 597 A 1508 24.3 52.98 46.88 0.13 0 0 0 A>AC BMAL 791 C 1365 24.9 52.16 47.69 0 0.15 0 0 C>AC BMAL 826 G 1316 23.6 49.32 0 50.61 0.08 0 0 G>AG BMAL 986 C 1451 23.9 47.48 52.17 0.28 0 0 0.07 C>AC BMAL 1229 A 1560 25.4 0.26 0.13 0.38 0.19 0 99.04 delA BMAL 1261 A 1420 22.8 54.37 0 45.63 0 0 0 A>AG BMAL 1318 T 1153 24.1 0 0.17 45.62 54.21 0 0 T>GT BMAL 1808 A 1649 25.3 0 99.82 0 0.12 0 0.06 A>C BMAL 2172 A 1250 22.7 56 0 0 0.16 0 43.84 delAA BMAL 2173 A 1251 22.9 54.52 0.08 1.52 0.08 0 43.8 - BMAL 2263 C 1009 18.6 0 45.79 0.1 54.11 0 0 C>CT BMAL 2413 T 1314 24.4 0.15 99.54 0 0.3 0 0 T>C BMAL 2944 A 1113 24.3 0.09 0 99.91 0 0 0 A>G BMAL 3131 G 1318 24.8 0.08 99.92 0 0 0 0 G>C BMAL 3344 T 1205 22.6 0 0 0 100 45.15 0 insT BMAL 3348 C 1200 22.8 0.58 53.42 0 46 0 0 C>CT BMAL 3459 A 1005 23.7 48.46 0 0.1 51.34 0 0.1 A>AT BMAL 4141 C 699 19.2 49.07 50.79 0.14 0 0 0 C>AC BMAL 4186 C 835 23 0 48.5 0.48 51.02 0.12 0 C>CT BMAL 4741 A 1226 24.5 0 0 100 0 0 0 A>G

192

Late 852 Ref. Ref. Gene Seq. Coverage Score A % C % G % T % Ins % Del % Mutation Call Nucl Position BMAL 5100 G 1497 24.8 0 99.8 0 0.07 0 0.13 G>C BMAL 5866 T 1209 24.5 50.54 0.08 0.08 49.21 0 0.08 T>AT Kiss1r 152 C 1183 22.5 0.25 48.69 0 51.06 0 0 C>CT Clock1b 401 G 116 14.9 56.9 0 43.1 0 0 0 G>AG

Late 853 Ref. Ref. Gene Seq. Coverage Score A % C % G % T % Ins % Del % Mutation Call Nucl. Position dec1 1362 G 9186 30.3 44.91 0.08 54.94 0.08 0.01 0 G>AG dec1 1535 G 9255 26.5 46.06 0.02 53.85 0.05 0 0.01 G>AG dec2 397 T 3332 25 0 0.06 0.03 99.91 45.17 0 insTATC dec2 698 A 2214 26.4 0.32 0.09 0.18 99.41 0 0 A>T Eed 1652 C 2226 23.8 0.09 12.98 86.79 0.13 0 0 C>G Eed 2178 A 2633 26.7 24.46 0.3 0 0 0 75.24 delA Eed 2455 A 2615 26.6 25.7 0.04 74.15 0.11 0 0 A>G Eed 2688 G 2673 21.8 43.73 0.04 56.12 0.11 0 0 G>AG Eed 2768 T 2738 27.3 67.13 0.04 0.22 32.62 0 0 T>AT Eed 2852 G 2493 20 40.63 0.12 59.01 0.24 0 0 G>AG Eed 2855 C 2457 20.7 0.12 66.79 0.04 33.05 0 0 C>CT Eed 3236 T 2502 24.6 0.04 44.36 0.08 55.52 0 0 T>CT Eed 3304 T 2605 26.9 51.48 0.08 0.12 48.33 0 0 T>AT Eed 3469 T 4176 28.6 0.79 44.35 0.31 54.45 0.05 0.1 T>CT Eed 3532 T 3499 26.3 1.09 34.84 0.86 63.1 0 0.11 T>CT Eed 3588 A 2692 26 63.48 0.07 0.15 35.1 0 1.19 A>AT Eed 3595 C 2693 23.8 0.3 56.81 0.19 41.48 0 1.23 C>CT Eed 4161 A 2162 26 44.17 0.14 54.86 0.83 0.37 0 A>AG Eed 4162 T 2161 26 0 0.14 0.09 99.72 52.43 0.05 insT Eed 4219 A 1992 19.7 55.97 0.05 43.83 0.05 0 0.1 A>AG Eed 4222 T 2027 20.2 0 0.2 43.51 55.94 0 0.35 T>GT Eed 4224 G 2012 20.4 42.94 0.15 56.91 0 0 0 G>AG Eed 4262 T 2301 24.6 0.17 58.02 0.09 41.72 0 0 T>CT Eed 4274 T 2417 24.8 0.17 43.65 0 56.19 0 0 T>CT Eed 4363 A 2636 27 42.87 0.19 56.68 0.27 0 0 A>AG Eed 4418 T 2610 26.1 0.08 99.69 0.15 0.08 0 0 T>C Eed 4531 A 2760 27.2 58.7 41.09 0.04 0 0 0.18 A>AC Eed 4580 G 2985 25.5 0.03 0.1 66.8 33.07 0.03 0 G>GT Eed 4602 A 3001 19.2 26.19 0.07 0.17 73.58 0 0 A>T Eed 4603 C 3006 19.5 0.07 26.21 0.03 73.69 0 0 C>T

193

Late 853 Ref. Ref. Gene Seq. Coverage Score A % C % G % T % Ins % Del % Mutation Call Nucl. Position Eed 4648 T 3091 27.6 0.06 62.25 0.1 37.59 0 0 T>CT Eed 4649 A 3091 27.8 0.06 99.9 0.03 0 0 0 A>C Eed 4704 C 2832 21.1 0.11 32.24 67.58 0.07 0 0 C>CG Eed 4775 T 2517 26.6 0.08 0.12 0.16 69.13 0 30.51 delT Eed 4791 T 2690 22 0.15 68.48 0.04 31.34 0 0 T>CT Eed 4793 C 2714 22.4 0.04 69.01 0.07 30.88 0 0 C>CT Eed 4923 T 2715 25.1 62.06 0.22 0.22 37.5 0.07 0 T>AT Eed 4930 A 2566 19.1 35.62 0.16 0.12 64.11 0 0 A>AT Eed 4935 G 2629 22.6 0.11 65.58 34.27 0.04 0 0 G>CG Eed 5044 C 2212 26.1 37.61 62.12 0.05 0.23 0 0 C>AC Eed 5045 A 2230 25.8 61.79 0.13 38.03 0.04 0 0 A>AG Eed 5074 A 2206 26.3 4.9 0 0.05 0 0.41 95.06 delAAAAAA Eed 5075 A 2203 26.3 21.38 0.09 0.09 0 0.05 78.44 - Eed 5076 A 2197 26.4 46.84 0.14 0.05 0.05 0 52.94 - Eed 5077 A 2193 26.4 56.77 0 0.09 0 0 43.14 - Eed 5078 A 2193 26.4 59.1 0.18 0.09 0 0 40.63 - Eed 5079 A 2191 26.6 59.56 0.05 0.09 0.05 0 40.26 - Eed 5138 T 2088 25.6 0.14 99.76 0.05 0.05 0 0 T>C Eed 5140 G 2084 26.1 0.19 0.29 0.24 99.28 0 0 G>T Eed 5185 A 1759 25.6 60.03 1.02 38.83 0.11 0 0 A>AG Eed 5264 C 1407 21.2 0.14 62.47 0 31.7 0 5.69 C>CT Eed 5269 C 1432 18.4 0.07 63.2 0.07 31.08 0 5.59 C>CT Eed 5275 C 1459 16 37.83 61.41 0.34 0.07 0.07 0.34 C>AC Eed 5283 G 1459 18.2 0.27 0 63.88 0.07 0 35.78 delG Eed 5285 C 1482 17.8 0.13 58.57 0 35.49 0.34 5.8 C>CT GnRH3B 274 C 1799 25.4 46.08 53.86 0 0.06 0 0 C>AC GnRH3B 353 A 2234 25.6 53.94 0 45.97 0.04 0 0.04 A>AG GnRH3B 794 T 2417 24.2 0.25 0.17 49.03 50.56 0 0 T>GT G0S2 180 A 763 21.8 49.8 0.39 0 0 0 49.8 delATAGTGAT G0S2 181 T 766 21.6 0 0.26 0 50.13 0 49.61 - G0S2 182 A 766 21.6 50.39 0 0 0 0 49.61 - G0S2 183 G 791 22.2 0 0 51.83 0 0 48.17 - G0S2 184 T 795 22.2 0.25 0.63 0.13 51.07 0 47.92 - G0S2 185 G 797 22 0 0 52.07 0.13 0 47.8 - G0S2 186 A 806 22.3 52.48 0.12 0.12 0 0 47.27 - G0S2 187 T 807 22.5 0.12 0 0.5 52.17 0 47.21 - G0S2 1157 G 2936 26.5 0.03 0.1 52.49 47.38 0 0 G>GT G0S2 1359 A 3219 27.7 52.5 0.16 0.19 47.16 0 0 A>AT G0S2 1426 C 3358 27 0.09 51.94 0.09 47.77 0 0.12 C>CT

194

Late 853 Ref. Ref. Gene Seq. Coverage Score A % C % G % T % Ins % Del % Mutation Call Nucl. Position G0S2 1519 G 3387 27.6 46.32 0.12 53.44 0.09 0 0.03 G>AG G0S2 2424 A 3873 25.4 49.99 49.96 0 0.05 0 0 A>AC G0S2 2427 T 3852 25.1 0.03 49.79 0.03 50.16 0 0 T>CT G0S2 2476 T 3652 26.9 0.05 0.03 49.59 50.33 0 0 T>GT G0S2 2512 G 3446 26.2 48.43 0.03 51.54 0 0 0 G>AG G0S2 2535 G 3516 27.4 48.41 0.11 51.45 0.03 0 0 G>AG G0S2 2583 C 3404 27 0.26 49.68 0.21 49.85 0.03 0 C>CT G0S2 2628 A 3320 27.8 48.43 51.36 0.15 0.06 0 0 A>AC G0S2 2874 A 2758 24.1 49.31 50.44 0.18 0.07 0 0 A>AC G0S2 2878 T 2654 23.9 0.15 50.68 0.08 49.1 0 0 T>CT G0S2 3969 T 1791 20.8 52.32 0.17 0.56 46.9 0 0.06 T>AT G0S2 3978 C 1818 20 2.09 47.96 0.06 0.22 0.11 49.67 delC G0S2 3979 C 1814 21 0.11 99.5 0.06 0.28 46.69 0.06 insT G0S2 4005 T 1820 24.7 0 0.11 45.11 54.73 0 0.05 T>GT G0S2 4112 A 1616 23.9 47.77 51.79 0.19 0.12 0 0.12 A>AC G0S2 4420 A 2001 25 47.48 0 0.1 0 0 52.42 delATGACGGTC G0S2 4421 T 1996 25.3 0 0.1 0.05 47.19 0 52.66 - G0S2 4422 G 2017 25.8 0 0 47.99 0 0 52.01 - G0S2 4423 A 2023 26.1 47.8 0.1 0.2 0.05 0 51.85 - G0S2 4424 C 2025 26.1 0.05 48.05 0 0 0 51.9 - G0S2 4425 G 2025 26.4 0.1 0.1 47.95 0.05 0 51.8 - G0S2 4426 G 2022 26.4 0.05 0 47.92 0.05 0 51.98 - G0S2 4427 T 2026 26.1 0 0.2 0.15 47.83 0 51.83 - G0S2 4428 C 2027 26.4 0.25 47.95 0 0.05 0 51.75 - G0S2 4550 T 1798 23.3 0 46.22 0 53.78 0 0 T>CT G0S2 4637 T 1497 24.8 0 0.13 47.7 52.17 0 0 T>GT BMAL 396 C 1030 19.1 50.1 49.9 0 0 0 0 C>AC BMAL 401 G 990 19.5 51.41 0.2 48.38 0 0 0 G>AG BMAL 791 C 1239 22.1 51.41 48.51 0 0.08 0 0 C>AC BMAL 891 C 1257 20.7 0.32 49.72 0.08 49.8 0 0.08 C>CT BMAL 1229 A 1741 23.5 51.06 0.34 0.86 0.23 0 47.5 delA BMAL 1261 A 1706 25.3 0.12 0.23 99.41 0.12 0 0.12 A>G BMAL 1318 T 1230 22.5 0 0.08 50.98 48.78 0 0.16 T>GT BMAL 1808 A 1201 20.3 47.79 52.12 0 0.08 0 0 A>AC BMAL 2172 A 1198 21.5 53.34 0.08 0 0 0 46.58 delAA BMAL 2173 A 1199 21.5 51.29 0.17 1.92 0.17 0 46.46 - BMAL 2333 T 1020 20.7 48.82 0.2 0 50.88 0 0.1 T>AT BMAL 2654 C 691 21.2 59.33 40.38 0.14 0.14 0 0 C>AC BMAL 2733 G 441 10.1 0 0.23 60.77 0 12.93 39 delG

195

Late 853 Ref. Ref. Gene Seq. Coverage Score A % C % G % T % Ins % Del % Mutation Call Nucl. Position BMAL 2764 A 443 16.2 45.6 0 0.23 54.18 0 0 A>AT BMAL 3324 A 1155 23.9 46.84 0.17 0.35 52.55 0 0.09 A>AT BMAL 3459 A 1016 22.5 49.21 0.1 0.1 50.49 0 0.1 A>AT BMAL 3796 T 874 19.4 0.11 0.11 0.11 55.72 0 43.94 delTTGA BMAL 3797 T 871 19.2 0 0 0.11 55.57 0 44.32 - BMAL 3798 G 873 19.4 0 0.57 55.1 0 0 44.33 - BMAL 3799 A 874 19.4 54.58 0.11 0.23 0.57 0 44.51 - BMAL 4607 T 1009 22.7 0 49.55 0 49.75 0.1 0.69 T>CT BMAL 4693 T 932 22 0.11 47.42 0 52.25 0 0.21 T>CT BMAL 4741 A 983 23.6 51.07 0 48.93 0 0 0 A>AG BMAL 4781 A 995 9.5 52.66 0.2 47.14 0 0 0 A>AG BMAL 4782 T 994 9.4 0 47.79 0.1 52.11 0 0 T>CT BMAL 4783 G 997 9.4 0 47.04 51.55 1.3 0 0.1 G>CG BMAL 4787 T 991 5.4 0 3.83 0.2 53.08 0 42.89 delT BMAL 4790 A 1114 3.8 55.39 0 44.52 0.09 0 0 A>AG BMAL 4791 C 1105 3.8 0.09 55.29 0.18 44.43 0 0 C>CT BMAL 4794 T 1067 6.9 0 0.09 0.09 99.81 44.61 0 insA BMAL 4796 C 1056 6.7 0 45.45 0.09 54.45 0 0 C>CT BMAL 4797 G 1052 6.7 0.48 44.11 54.47 0.29 0 0.67 G>CG BMAL 4798 G 1058 8.2 45.46 0.09 53.97 0.09 0 0.38 G>AG BMAL 4799 C 1064 8.3 0.28 54.89 0.09 44.74 0 0 C>CT BMAL 5877 A 1009 21 46.58 0.3 0 52.82 0 0.3 A>AT Kiss1r 966 C 1809 21.7 0.11 49.59 0.06 50.25 0 0 C>CT Clock1b 401 G 70 14.6 52.86 0 47.14 0 0 0 G>AG Kiss2 532 G 16446 33.3 0.06 49.24 50.64 0.05 0 0 G>CG

196

Late 854 Ref. Ref. Ins Gene Seq. Coverage Score A % C % G % T % Del % Mutation Call Nucl % Position dec1 1362 G 6219 29.9 43.42 0.1 56.39 0.1 0 0 G>AG dec1 1535 G 6415 27.9 44.05 0.05 55.76 0.14 0 0 G>AG dec2 698 A 2877 27.2 0.21 0.03 0.17 99.55 0 0.03 A>T dec2 997 T 3298 26.9 0.06 0.06 51.58 48.3 0 0 T>GT Eed 1652 C 1891 26.1 0 24.75 74.56 0.69 0 0 C>G Eed 2080 C 2193 23.2 0 27.72 0 0.05 0 72.23 delC Eed 2084 A 2278 23 27 0.09 72.83 0.09 0 0 A>G Eed 2247 A 2709 25.7 57.36 0.07 0.15 42.41 0 0 A>AT Eed 2455 A 2542 27 16.44 0.12 83.32 0.12 0 0 A>G Eed 2629 A 2364 24.2 58.84 0.04 40.95 0.08 0 0.08 A>AG Eed 2688 G 2426 25.6 30.13 0.04 69.5 0.33 0 0 G>AG Eed 2703 G 2490 26.5 40.8 0.48 57.99 0.72 0 0 G>AG Eed 2768 T 2349 25.7 75.31 0.13 0.13 24.39 0 0.04 T>A Eed 3236 T 2635 26.9 0.11 67.36 0.08 32.45 0 0 T>CT Eed 3370 A 2390 22.9 58.16 0 41.8 0.04 0.04 0 A>AG Eed 3469 T 3358 27 2.11 55.03 0.86 41.16 0 0.83 T>CT Eed 3525 A 2900 27.1 59.72 0.07 1.21 38.38 0.31 0.62 A>AT Eed 3532 T 2912 26.8 1.85 42.45 1.06 54.12 0.03 0.52 T>CT Eed 3562 G 2429 22.9 51.79 0.08 46.52 0.62 0 0.99 G>AG Eed 3588 A 2257 23.8 35.09 0.13 1.95 61.63 1.28 1.2 A>AT Eed 3702 C 2094 25.4 0.1 61.84 3.92 32.76 0 1.38 C>CT Eed 3759 T 2039 23.4 0.05 0.1 51.45 48.41 0 0 T>GT Eed 4027 A 2267 25.9 50.37 49.49 0.09 0.04 0 0 A>AC Eed 4127 A 2164 25.8 48.57 0.05 51.25 0.14 0 0 A>AG Eed 4161 A 2105 25.1 100 0 0 0 0 0 G>A Eed 4219 A 1970 25.1 21.57 0.2 78.22 0 0 0 A>G Eed 4224 G 2006 26 30.01 0.2 69.74 0.05 0 0 G>AG Eed 4274 T 2366 25.2 0.13 78.32 0.08 21.47 0 0 T>C Eed 4363 A 2447 26.2 29.71 0 70.09 0.2 0 0 A>G Eed 4418 T 2330 24.7 0.13 51.42 0.39 48.07 0 0 T>CT Eed 4556 A 2664 26.8 26.54 0.08 73.09 0.3 0 0 A>G Eed 4602 A 2671 21.4 45.23 0.07 0.07 54.59 0 0.04 A>AT Eed 4603 C 2681 17.3 24.58 20.55 0.04 54.83 0 0 C>T Eed 4648 T 2820 27.5 0.11 71.91 0.04 27.94 0 0 T>C Eed 4649 A 2818 26.1 0.11 99.86 0.04 0 0 0 A>C Eed 4673 T 2648 25.9 0.04 0.49 0.23 55.89 0 43.35 delTTAA Eed 4674 T 2644 25.9 0 0.42 0.42 56.24 0 42.93 - Eed 4675 A 2652 20.8 56.67 0.34 0.19 0.04 0 42.76 - Eed 4676 A 2641 20.7 56.08 0.49 0.45 0.04 0 42.94 -

197

Late 854 Ref. Ref. Ins Gene Seq. Coverage Score A % C % G % T % Del % Mutation Call Nucl % Position Eed 4678 A 2778 20.9 59.18 0.5 0.22 0.07 0 40.03 delAGTTA Eed 4679 G 2784 20.9 0.5 0.04 58.69 0.18 0 40.59 - Eed 4680 T 2797 20.9 0.54 0.18 0.39 58.21 0 40.69 - Eed 4681 T 2805 20.9 0.39 0.14 0.75 58.18 0 40.53 - Eed 4682 A 2818 20.9 58.66 0.04 0.99 0 0 40.31 - Eed 4685 C 2807 21.3 0.11 58.5 0.39 0.04 0 40.97 delCTCCCA Eed 4686 T 2797 21.3 0.43 0.18 0.04 58.24 0 41.12 - Eed 4687 C 2808 26.6 0.11 58.83 0.04 0.07 0 40.95 - Eed 4688 C 2782 27.2 0.07 59.13 0 0.07 0 40.73 - Eed 4689 C 2796 27.2 0 58.55 0 0 0 41.45 - Eed 4690 A 2790 27.2 58.17 0.07 0.18 0.07 0 41.51 - Eed 4704 C 2721 26.7 0.04 0 99.85 0.11 0 0 C>G Eed 4791 T 2547 26 0 74.44 0.16 25.4 0 0 T>C Eed 4923 T 2331 26.7 76.15 0.34 0.34 23.17 0 0 T>A Eed 4930 A 2359 21 0.08 0.08 0.04 99.79 0 0 A>T Eed 4935 G 2387 20.5 0.17 72.81 0.13 26.85 0 0.04 G>C Eed 5044 C 1980 24.7 55.66 44.14 0.15 0.05 0 0 C>AC Eed 5045 A 1998 24.7 44.39 0.15 55.31 0.15 0.05 0 A>AG Eed 5074 A 1916 26.1 4.44 0 0 0 0.1 95.56 delAAAAA Eed 5075 A 1916 25.6 16.96 0.05 0 0 0 82.99 - Eed 5076 A 1912 24.6 36.4 0 0.21 0.05 0 63.34 - Eed 5077 A 1910 25.1 62.93 0.16 0 0.1 0.05 36.81 - Eed 5078 A 1908 24.9 69.5 0 0.05 0 0 30.45 - Eed 5138 T 1726 25 0 99.42 0.06 0.52 0 0 T>C Eed 5140 G 1729 24.7 0 0.35 0.75 98.9 0 0 G>T Eed 5185 A 1433 22.1 40.61 1.47 57.64 0.28 0 0 A>AG Eed 5264 C 1005 22.2 0.2 42.69 0 47.26 0 9.85 C>CT Eed 5269 C 997 18.3 0.1 44.83 0.1 45.34 0 9.63 C>CT Eed 5275 C 997 14.6 56.47 42.23 0.4 0.1 0 0.8 C>AC Eed 5283 G 987 18.5 0.1 0 49.24 0.2 0 50.46 Eed 5285 C 997 17.6 0 39.72 0.1 50.15 0.1 10.03 C>CT GnRH3B 274 C 1166 24.4 42.02 57.98 0 0 0 0 C>AC GnRH3B 794 T 2283 23.5 0.18 0.44 45.9 53.44 0 0.04 T>GT G0S2 180 A 690 20.2 50.87 0 0.29 0 0 48.84 delATAGTGAT G0S2 181 T 695 20.2 0 0.29 0 51.22 0 48.49 - G0S2 182 A 696 20.2 51.15 0.14 0.29 0 0 48.42 - G0S2 183 G 709 20.5 0 0 52.33 0 0 47.67 - G0S2 184 T 713 20.5 0 0.42 0.14 52.03 0 47.41 - G0S2 185 G 715 20.5 0 0 52.73 0 0 47.27 -

198

Late 854 Ref. Ref. Ins Gene Seq. Coverage Score A % C % G % T % Del % Mutation Call Nucl % Position G0S2 186 A 724 20.3 53.04 0.14 0 0.14 0 46.69 - G0S2 187 T 731 20.6 0 0.68 0.55 52.53 0 46.24 - G0S2 485 A 2696 27.1 67.58 31.38 0.15 0 0.11 0.89 A>AC insACACACACA G0S2 486 A 2686 23.2 99.59 0.3 0 0.04 33.1 0.07 CACATACACAC G0S2 991 T 3214 27.7 0.28 50.19 0.09 49.41 0 0.03 T>CT G0S2 1157 G 3931 27.7 0.03 0.03 50.27 49.68 0 0 G>GT G0S2 1399 G 3063 27 51.71 0.07 48.06 0.16 0 0 G>AG G0S2 1426 C 3056 27.3 0 52.29 0.07 47.61 0.03 0.03 C>CT G0S2 4112 A 1672 24.8 49.88 49.88 0.12 0.06 0 0.06 A>AC G0S2 4397 C 1785 25.1 0 47.84 0 52.1 0 0.06 C>CT BMAL 2172 A 1238 24.2 49.76 0.48 0.16 0 0 49.6 delAA BMAL 2173 A 1240 24.2 49.92 0.24 0.32 0.08 0 49.44 - BMAL 2263 C 1633 22.5 0.18 49.42 0 50.4 0 0 C>CT BMAL 2413 T 2517 26.3 0.08 45.25 0.04 54.63 0 0 T>CT BMAL 2654 C 1312 23.5 61.28 38.49 0.15 0.08 0 0 C>AC 18.5 BMAL 2733 G 991 10.4 0.2 0.1 67.2 0.3 32.19 delG 7 BMAL 2764 A 972 23.3 33.74 0.21 0.21 65.84 0 0 A>AT BMAL 2944 A 3119 24.5 52.65 0.06 47 0.29 0 0 A>AG BMAL 3131 G 2659 25.3 0.11 48.51 51.3 0.08 0 0 G>CG BMAL 3324 A 2716 26.2 49.85 0.15 0.37 49.45 0 0.18 A>AT BMAL 3459 A 2213 26.4 0.18 0.14 0.14 99.37 0 0.18 A>T BMAL 3796 T 2206 25.8 0 0.09 0.05 53.31 0 46.55 delTTGA BMAL 3797 T 2203 25.8 0 0.23 0.09 53.11 0 46.57 - BMAL 3798 G 2203 25.5 0.05 0.09 53.29 0.05 0 46.53 - BMAL 3799 A 2199 25.5 52.61 0.23 0.09 0.18 0 46.88 - BMAL 4141 C 1489 18.9 50.5 49.23 0.13 0.07 0.13 0.07 C>AC BMAL 4186 C 1783 25.6 0.17 50.7 0.73 48.29 0.06 0.11 C>CT BMAL 4741 A 2312 26.3 49.52 0.48 50 0 0 0 A>AG BMAL 4796 C 2392 25.3 0.21 49.54 0.13 50.13 0 0 C>CT BMAL 5100 G 2875 24.5 0.07 53.57 46.33 0.03 0 0 G>CG BMAL 5866 T 2083 26.1 49.98 0.29 0.14 49.59 0 0 T>AT BMAL 5877 A 2081 25.1 52.96 0.24 0.72 46.08 0 0 A>AT Clock1b 401 G 214 17 42.06 0 57.94 0 0 0 G>AG Clock1b 406 T 258 17.6 55.81 0 0.39 43.8 0 0 T>AT Clock1b 507 T 493 21.2 0 0 59.03 40.97 0 0 T>GT Clock1b 514 A 499 21.5 40.48 59.32 0.2 0 0 0 A>AC Clock1b 533 C 524 20.8 61.07 38.93 0 0 0 0 C>AC

199

Late 855 Ref. Ref. Ins Gene Seq. Coverage Score A % C % G % T % Del % Mutation Call Nucl % Position dec1 1362 G 4829 29 99.4 0.1 0.43 0.06 0 0 G>A dec1 1535 G 5009 29.4 99.74 0.04 0.18 0.04 0 0 G>A dec2 698 A 1198 22.8 0.33 0 0.67 99 0 0 A>T Eed 378 G 996 20.5 0 0.3 56.63 43.07 0 0 G>GT Eed 577 C 1533 25.4 0.2 56.03 0.13 43.64 0 0 C>CT Eed 637 A 1502 22 54.79 44.87 0.33 0 0 0 A>AC Eed 857 C 1906 25.9 43.13 56.82 0.05 0 0 0 C>AC Eed 1028 C 1596 21.7 0.25 56.83 0 42.92 0 0 C>CT Eed 1652 C 1518 24.6 0.07 47.36 51.98 0.59 0 0 C>CG Eed 2247 A 1963 26.2 21.96 0.31 0.2 77.53 0 0 A>T Eed 2307 A 1601 21.1 54.4 45.22 0.25 0.12 0 0 A>AC Eed 2375 A 1782 25.9 51.35 0.11 48.37 0.17 0 0 A>AG Eed 2455 A 1983 24.2 52.4 0 47.45 0.15 0 0 A>AG delGTCAGGA Eed 2508 G 2038 23.7 1.23 0 23.65 0 0 75.12 TACA Eed 2509 T 2038 23.7 1.13 0.1 0.05 23.6 0 75.12 - Eed 2510 C 2038 23.7 0.05 24.83 0 0 0.05 75.12 - Eed 2511 A 2034 23.7 24.78 0 0 0 0 75.22 - Eed 2512 G 2024 23.1 0.15 0 22.43 0 0 77.42 - Eed 2513 G 2015 22.7 20.89 0.15 2.18 0.05 0 76.72 - Eed 2514 A 2023 24.7 22.1 1.43 0.05 0 0 76.42 - Eed 2515 T 2021 24.5 0.2 0 0.15 22.71 0 76.94 - Eed 2516 A 2022 24.7 3.12 0.4 0.05 0 0.2 96.44 - Eed 2517 C 2027 24.7 0.54 22 0 1.58 0 75.88 - Eed 2518 A 2032 25.5 0.98 0.05 0.25 0.84 0 97.88 - Eed 2509 T 2038 23.7 1.13 0.1 0.05 23.6 0 75.12 - Eed 2513 G 2015 22.7 20.89 0.15 2.18 0.05 0 76.72 - 74.1 Eed 2530 A 2159 18 76.52 0.09 0 2.55 20.84 insA 1 Eed 2531 C 2156 18.8 74.91 3.2 0.6 0.37 0.14 20.92 C>A Eed 2538 C 2155 18.8 0.14 3.2 0.19 75.45 0 21.02 C>T Eed 2629 A 1870 21.5 51.39 0.16 48.24 0.11 0 0.11 A>AG Eed 2703 G 1945 26.2 50.03 0.46 49.15 0.36 0 0 G>AG Eed 2768 T 1852 25.2 54.64 0.16 0.16 45.03 0 0 T>AT Eed 2855 C 1659 22.3 0 53.83 0.12 46.05 0.06 0 C>CT Eed 2971 A 1719 23.9 52.71 0.06 47.12 0.12 0.06 0 A>AG Eed 3304 T 1774 23.5 48.93 0.11 0.23 50.73 0 0 T>AT Eed 3317 G 1756 25.1 0.06 0.06 49.09 50.8 0 0 G>GT Eed 3370 A 1577 21.4 49.52 0.06 50.22 0.19 0 0 A>AG Eed 3469 T 2205 24.5 1.81 63.67 0.5 33.15 0 0.86 T>CT

200

Late 855 Ref. Ref. Ins Gene Seq. Coverage Score A % C % G % T % Del % Mutation Call Nucl % Position Eed 3532 T 1980 26 1.57 31.06 0.66 66.06 0 0.66 T>CT Eed 3595 C 1671 22.8 0.3 36.33 0.24 60.98 0.18 2.15 C>CT Eed 3759 T 1778 19.9 0.06 0.11 51.52 48.31 0 0 T>GT Eed 3917 T 2021 25 0 0 0.05 60.96 0 38.99 delTGT Eed 3918 G 2032 24.8 0.1 0 61.12 0.05 0 38.73 - Eed 3919 T 1993 25.5 0.45 0 0 59.81 0 39.74 - Eed 4036 A 1897 22.4 56.72 43.23 0 0.05 0 0 A>AC Eed 4049 T 1919 24.8 0.1 0.1 42.99 56.8 0 0 T>GT Eed 4161 A 1968 25.5 69.26 0 30.34 0.41 0.1 0 A>AG Eed 4219 A 1802 25.3 30.58 0.06 69.15 0.11 0 0.11 A>AG Eed 4222 T 1829 20.4 0.16 0.27 45.65 53.8 0 0.11 T>GT Eed 4224 G 1806 20.5 45.74 0.17 53.99 0.11 0 0 G>AG Eed 4249 T 1842 25.9 0.05 76.76 0.05 23.07 0 0.05 T>C Eed 4255 T 1843 21.1 0.16 46.23 0.11 53.5 0.05 0 T>CT Eed 4262 T 1883 25 0.11 31.49 0.11 68.3 0 0 T>CT Eed 4274 T 1889 25.3 0.05 67.5 0.05 32.4 0 0 T>CT Eed 4357 C 1834 18.7 0.27 52.94 0.16 46.62 0 0 C>CT Eed 4360 G 1858 19 46.18 0.16 53.39 0.27 0 0 G>AG Eed 4363 A 1898 25.8 23.66 0.05 76.19 0.11 0 0 A>G Eed 4497 A 1759 23.4 19.67 0.23 0.17 79.93 0.06 0 A>T Eed 4531 A 1886 25 53.71 45.92 0 0.11 0 0.27 A>AC Eed 4556 A 1874 25.3 46.05 0.11 53.52 0.32 0 0 A>AG Eed 4580 G 2033 26.1 0.25 0.15 53.27 46.29 0 0.05 G>GT Eed 4602 A 2088 18.8 35.34 0.1 0.43 64.13 0 0 A>AT Eed 4603 C 2094 15.4 19.63 35.24 0.1 44.94 0 0.1 C>CT Eed 4648 T 2150 26 0.14 99.72 0.05 0.09 0 0 T>C Eed 4649 A 2148 25.2 0.14 99.63 0.09 0.14 0 0 A>C Eed 4673 T 2036 22.1 0.25 0.74 0.15 65.96 0 32.91 delTTAA Eed 4674 T 2036 22.1 0.05 0.49 0.44 66.65 0 32.37 - Eed 4675 A 2032 17.7 67.08 0.44 0.05 0 0 32.43 - Eed 4676 A 2013 17.9 66.32 0.3 0.65 0 0 32.74 - Eed 4678 A 2099 18.8 68.84 0.43 0.14 0.1 0 30.49 delAGTTA Eed 4679 G 2100 18.6 0.71 0.19 67.9 0 0 31.19 - Eed 4680 T 2105 18.4 0.76 0.33 0.24 67.41 0 31.26 - Eed 4681 T 2106 18.4 0.14 0.09 1.19 67.24 0.09 31.34 - Eed 4682 A 2123 18.7 67.83 0 1.41 0 0 30.76 - Eed 4685 C 2109 19.3 0.14 67.43 0.19 0.05 0 32.2 delCTCCCA Eed 4686 T 2089 19 0.1 0.19 0.48 66.73 0 32.5 - Eed 4687 C 2097 23.8 0.33 67.05 0.1 0 0 32.52 -

201

Late 855 Ref. Ref. Ins Gene Seq. Coverage Score A % C % G % T % Del % Mutation Call Nucl % Position Eed 4688 C 2068 24.3 0.29 67.6 0.05 0.05 0 32.01 - Eed 4689 C 2075 24.3 0.05 66.89 0 0 0 33.06 - Eed 4690 A 2060 24.3 66.17 0.1 0.34 0.1 0 33.3 - Eed 4704 C 1938 26.1 0.21 0 99.69 0.1 0 0 C>G Eed 4791 T 1619 24.8 0.19 33.48 0.12 66.21 0 0 T>CT Eed 4793 C 1624 25.5 0.12 53.69 0.06 46.12 0 0 C>CT Eed 4824 T 1747 22.7 0 0.06 78.02 21.92 0 0 T>G Eed 4829 A 1769 24.6 53.7 46.07 0.11 0.11 0 0 A>AC Eed 4923 T 1803 25.1 78.65 0.5 0.39 20.47 0 0 T>A Eed 4930 A 1813 20.2 20.57 0.11 0.28 79.04 0 0 A>T Eed 4935 G 1859 24.7 0.05 79.51 20.28 0.16 0 0 G>C Eed 5044 C 1593 20.6 42.31 57.44 0.19 0.06 0 0 C>AC Eed 5045 A 1606 20.5 57.04 0.12 42.47 0.37 0 0 A>AG Eed 5051 A 1549 20.2 66.17 0.19 0.19 33.44 0 0 A>AT Eed 5074 A 1573 22.1 2.92 0 0 0 0.06 97.08 delAAAAAA Eed 5075 A 1572 22.6 7.25 0 0 0.06 0 92.68 - Eed 5076 A 1568 25.5 39.03 0.13 0.19 0 0 60.65 - Eed 5077 A 1566 24.9 52.94 0.06 0.13 0.06 0 46.81 - Eed 5078 A 1566 24.9 55.94 0 0 0 0.06 44.06 - Eed 5079 A 1565 24.9 56.36 0.06 0 0 0 43.58 - Eed 5138 T 1477 25.2 0.07 99.46 0 0.47 0 0 T>C Eed 5140 G 1484 25.2 0.07 0.07 0.67 99.19 0 0 G>T delGCCCTGCC Eed 5240 G 945 20.7 0.21 0 59.79 6.67 0 33.33 CAGCCCC Eed 5241 C 945 22.1 0 57.35 2.96 0.32 0 39.37 - Eed 5242 C 944 19.8 3.18 57.42 0 6.04 0 33.37 - Eed 5243 C 941 21.6 0 63.12 0 3.29 0 33.58 - Eed 5244 T 925 21.1 0.11 3.14 0 62.59 0 34.16 - Eed 5245 G 935 21.1 0.11 0 62.99 3.1 0 33.8 - Eed 5246 C 933 21.3 0 65.92 0 0 0 34.08 - Eed 5247 C 932 21.3 0 62.77 3.22 0.11 0 33.91 - Eed 5248 C 929 21.5 0.11 65.77 0.11 0 0 34.02 - Eed 5249 A 908 21.4 64.65 0.22 0.22 0.11 0 34.8 - Eed 5250 G 916 20.4 3.06 4.37 57.97 0.11 0 34.5 - Eed 5251 C 914 20.6 0.11 58.32 3.06 4.05 0 34.46 - Eed 5252 C 896 21.2 0 62.72 2.12 0 0 35.16 - Eed 5253 C 897 20.7 2.01 59.75 0 3.12 0 35.12 - Eed 5254 C 886 21.6 0.11 64.33 0 0.23 0 35.33 - Eed 5283 G 986 22.9 0.1 0 55.38 0 0 44.52 delG GnRH3B 331 A 3595 28 50.29 0.17 0.22 49.24 0 0.08 A>AT

202

Late 855 Ref. Ref. Ins Gene Seq. Coverage Score A % C % G % T % Del % Mutation Call Nucl % Position GnRH3B 353 A 3805 28.3 50.85 0.13 48.96 0.05 0 0 A>AG GnRH3B 360 G 3887 27.8 49.34 0.13 50.45 0.08 0 0 G>AG GnRH3B 411 C 3991 28.1 0.2 50.96 0 48.83 0 0 C>CT GnRH3B 1210 T 284 19.5 48.59 0 0.35 51.06 0 0 T>AT G0S2 180 A 414 20.2 49.76 0 0 0 0 50.24 delATAGTGAT G0S2 181 T 418 20.2 0 0 0.24 50 0 49.76 - G0S2 182 A 419 20.5 50.12 0 0.24 0 0 49.64 - G0S2 183 G 428 20.3 0 0 51.64 0 0 48.36 - G0S2 184 T 430 20.5 0.23 0.47 0.23 50.7 0 48.37 - G0S2 185 G 435 21 0 0.23 51.95 0 0 47.82 - G0S2 186 A 445 20.7 53.03 0.22 0 0 0 46.74 - G0S2 187 T 445 20.7 0 0.22 0.67 52.36 0 46.74 - G0S2 1157 G 1837 24.9 0.05 0.38 47.25 52.31 0 0 G>GT G0S2 1399 G 1534 24.9 47.46 0.2 52.09 0.26 0 0 G>AG G0S2 1426 C 1578 25.5 0.32 47.66 0.06 51.9 0 0.06 C>CT G0S2 2476 T 1853 24.1 0 0 49.87 50.13 0 0 T>GT G0S2 2535 G 1768 23.8 50.11 0.17 49.72 0 0 0 G>AG G0S2 2857 A 1495 25 49.16 0.07 0.4 50.37 0 0 A>AT G0S2 2874 A 1488 21.9 50 50 0 0 0 0 A>AC G0S2 2878 T 1453 21.6 0.14 50.38 0.28 49.21 0 0 T>CT G0S2 4005 T 992 22.9 0 0.1 46.88 53.02 0 0 T>GT G0S2 4112 A 941 22.2 48.78 51.22 0 0 0 0 A>AC G0S2 4301 C 848 22.1 0.12 50.59 0 49.29 0 0 C>CT delATGACGG G0S2 4420 A 1295 24.1 46.1 0.15 0.08 0 0 53.67 TC G0S2 4421 T 1294 24.3 0 0 0.08 46.06 0 53.86 - G0S2 4422 G 1305 23.8 0 0.08 46.51 0 0 53.41 - G0S2 4423 A 1308 23.9 46.25 0 0.38 0.08 0 53.29 - G0S2 4424 C 1310 23.9 0.08 46.72 0 0 0 53.21 - G0S2 4425 G 1309 23.9 0.08 0 46.45 0.23 0 53.25 - G0S2 4426 G 1306 23.8 0 0 46.55 0.08 0 53.37 - G0S2 4427 T 1307 23.9 0 0 0.23 46.44 0 53.33 - G0S2 4428 C 1306 23.8 0.15 46.25 0.15 0.15 0 53.29 - G0S2 4513 C 1089 24.2 0.09 45.82 0.18 53.9 0 0 C>CT G0S2 4551 G 981 17.9 53.01 0.1 46.59 0.2 0 0.1 G>AG G0S2 4558 C 972 18.9 0.1 46.71 0.1 53.09 0 0 C>CT G0S2 4637 T 804 21.8 0.25 0.12 50 49.63 0 0 T>GT G0S2 4645 C 788 22 0.13 49.75 0 50.13 0 0 C>CT BMAL 396 C 861 20.5 47.97 51.68 0 0.35 0 0 C>AC BMAL 470 A 939 23.2 48.14 0.21 0.21 48.56 0 2.88 A>AT

203

Late 855 Ref. Ref. Ins Gene Seq. Coverage Score A % C % G % T % Del % Mutation Call Nucl % Position BMAL 558 A 836 23.3 48.92 0.24 0.12 0 0 50.72 delATT BMAL 559 T 838 22.8 0 0.12 0.12 49.16 0 50.6 - BMAL 560 T 839 23.1 0 0.12 0 49.46 0 50.42 - BMAL 597 A 918 23.1 52.4 47.49 0.11 0 0 0 A>AC BMAL 791 C 797 20 54.71 45.17 0.13 0 0 0 C>AC BMAL 826 G 740 20.7 47.57 0 52.43 0 0 0 G>AG BMAL 986 C 897 19.9 46.71 53.07 0.11 0.11 0 0 C>AC BMAL 1229 A 1165 23.7 0 0.17 0.86 0.09 0 98.88 delA BMAL 1261 A 1053 23.1 52.42 0.28 46.72 0 0 0.57 A>AG BMAL 1318 T 838 22.4 0 0.48 47.14 52.39 0 0 T>GT BMAL 1808 A 881 23.4 0.11 99.77 0 0.11 0 0 A>C BMAL 2172 A 891 20.6 53.09 0 0 0.11 0 46.8 delAA BMAL 2173 A 893 20.6 50.95 0.56 1.79 0 0 46.7 - BMAL 2263 C 722 17 0 46.54 0 53.46 0 0 C>CT BMAL 2413 T 913 22.4 0 99.78 0 0.22 0 0 T>C BMAL 2944 A 869 21.8 0 0 99.65 0.35 0 0 A>G BMAL 3131 G 857 23.3 0.35 99.42 0.23 0 0 0 G>C 43.2 BMAL 3344 T 812 22.9 0.12 0 0.25 99.63 0 insT 3 BMAL 3348 C 803 22.6 0.12 54.92 0.25 44.71 0 0 C>CT BMAL 3459 A 686 20.6 51.17 0.29 0 48.25 0 0.29 A>AT BMAL 4141 C 454 13.3 46.7 53.3 0 0 0 0 C>AC BMAL 4186 C 508 20.6 0 48.43 0.2 51.38 0 0 C>CT BMAL 4741 A 598 22.1 0 0 100 0 0 0 A>G BMAL 5100 G 850 23.3 0 99.65 0.24 0.12 0 0 G>C BMAL 5866 T 699 22.5 51.22 0.14 0.14 48.5 0 0 T>AT Clock1a 1612 C 386 20.4 0.26 34.97 0 63.47 0 1.3 C>CT Clock1a 4003 T 232 18.8 1.29 0 98.28 0.43 0 0 T>G Clock1a 6219 T 475 6.2 25.68 0.84 0 9.05 0 64.42 delTAAAA

204

Late 856 Ref. Ref. Gene Seq. Coverage Score A % C % G % T % Ins % Del % Mutation Call Nucl. Position dec1 565 G 6940 26 47.67 0.1 52.15 0.09 0 0 G>AG dec1 953 T 6838 30.2 0.07 0.01 47.63 52.28 0 0 T>GT dec1 2056 G 7482 29.6 49.01 0.23 50.7 0.07 0 0 G>AG dec1 2114 C 7570 29.7 0.12 51.03 0.3 48.55 0 0 C>CT dec2 698 A 4898 28.5 0.51 0.02 0.12 99.35 0 0 A>T Eed 279 T 2368 25.2 0.08 0 0 20.69 0 79.22 delT Eed 629 T 4399 27.8 0.05 80.72 0 19.23 0 0 T>C Eed 1652 C 5048 29 0.06 18.21 81.18 0.55 0 0 C>G Eed 2178 A 5787 28.8 33.73 0.62 0.03 0 0 65.61 delA Eed 2375 A 5215 23.4 66.96 0.12 32.89 0.04 0 0 A>AG Eed 2455 A 5795 29.7 23.4 0.1 76.39 0.1 0 0 A>G Eed 2629 A 5548 25.3 57.5 0.09 42.36 0.04 0.02 0.02 A>AG Eed 2688 G 5841 27 41.33 0.12 58.45 0.09 0 0.02 G>AG Eed 2768 T 5960 29.4 64.98 0.1 0.22 34.68 0 0.02 T>AT Eed 2852 G 6015 24.3 65.92 0.15 33.87 0.07 0.03 0 G>AG Eed 3028 T 5561 25.6 0.09 82.05 0.02 17.82 0 0.02 T>C Eed 3236 T 5738 28.7 0.03 57.08 0.07 42.82 0 0 T>CT Eed 3304 T 5759 30 40.02 0.02 0.07 59.89 0 0 T>AT Eed 3469 T 8336 31.3 1.03 48.09 0.73 49.65 0.02 0.49 T>CT Eed 3499 G 7442 30.6 31.44 0.17 67.83 0.32 0 0.23 G>AG Eed 3525 A 7179 28.9 66.79 0.15 0.67 32.07 0 0.32 A>AT Eed 3532 T 7218 29.8 0.98 47.69 0.96 50.1 0.03 0.28 T>CT Eed 3562 G 6490 29.2 51.33 0.14 47.7 0.35 0 0.48 G>AG Eed 3588 A 6018 29.2 37.62 0.08 0.25 61.5 0.02 0.55 A>AT Eed 3782 T 5226 28.7 0.06 0.06 42.25 57.62 0 0.02 T>GT Eed 4041 A 5467 27.7 17.56 0.02 82.39 0.04 0 0 A>G Eed 4127 A 5820 29.1 19.62 0.07 80.07 0.22 0.02 0.02 A>G Eed 4161 A 5580 29.6 62.8 0.11 36.63 0.45 0.14 0.02 A>AG Eed 4162 T 5579 29 0 0.02 0.11 99.84 35.13 0.04 insT Eed 4219 A 5064 23.6 16.77 0.06 83.04 0.12 0 0.02 A>G Eed 4222 T 5257 23 0.11 0.08 60.03 39.53 0 0.25 T>GT Eed 4224 G 5225 22.5 59.73 0.15 39.94 0.15 0 0.02 G>AG Eed 4249 T 5535 28 0.02 57.25 0.07 42.6 0 0.05 T>CT Eed 4274 T 5722 27.8 0.12 82.45 0 17.41 0 0.02 T>C Eed 4418 T 5593 28.7 0.23 58.48 0.23 41.03 0 0.02 T>CT Eed 4531 A 6042 29.8 60.03 39.69 0.03 0.02 0 0.23 A>AC Eed 4580 G 6634 29.5 0.12 0.11 41.78 57.96 0 0.03 G>GT Eed 4593 G 6807 24.2 80.36 0.06 19.49 0.09 0 0 G>A Eed 4603 C 6966 9.5 43.27 0.07 0.09 56.43 0 0.14 C>AT

205

Late 856 Ref. Ref. Gene Seq. Coverage Score A % C % G % T % Ins % Del % Mutation Call Nucl. Position Eed 4648 T 7151 30.1 0.01 40.76 0.06 59.15 0 0.01 T>CT Eed 4649 A 7151 30.4 19.19 80.74 0.06 0.01 0.01 0 A>C Eed 4704 C 6816 23.1 0.09 37.21 62.63 0.07 0 0 C>CG Eed 4791 T 6587 24.9 0.08 63.43 0.05 36.45 0 0 T>CT Eed 4824 T 6671 28.9 0.04 0 57.4 42.56 0 0 T>GT Eed 4923 T 6398 27.3 38.82 0.25 0.23 60.69 0 0 T>AT Eed 4930 A 6385 22.3 59.28 0.2 0.11 40.41 0 0 A>AT Eed 4935 G 6519 26.7 0.05 41.65 58.12 0.18 0.03 0 G>CG Eed 5044 C 5344 27.6 42.72 57.15 0.07 0.06 0 0 C>AC Eed 5045 A 5384 27.6 57.11 0.04 42.74 0.11 0 0 A>AG Eed 5074 A 5267 29 5.39 0.06 0.02 0.02 0.09 94.51 delAAAAAA Eed 5075 A 5264 29.6 23.94 0.04 0.02 0 0 76.01 - Eed 5076 A 5254 29.4 46.82 0.04 0.1 0 0 53.05 - Eed 5077 A 5239 29.4 55.37 0.06 0.06 0.02 0 44.49 - Eed 5078 A 5236 29.1 56.88 0.08 0 0.04 0 43.01 - Eed 5079 A 5234 29.1 57.18 0.04 0.04 0.02 0 42.72 - Eed 5138 T 4768 27.8 0.1 82.74 0.06 17.09 0 0 T>C Eed 5140 G 4763 27.5 0.04 0.15 17.3 82.51 0 0 G>T Eed 5185 A 4201 28.6 55.18 1.55 43.23 0.05 0 0 A>AG Eed 5264 C 3263 26.3 0.09 52.19 0.03 43.03 0.03 4.66 C>CT Eed 5275 C 3188 22.2 36.79 62.8 0.13 0.09 0.03 0.19 C>AC Eed 5283 G 3135 20.1 0 0.1 65.77 0.19 0 33.94 Eed 5285 C 3134 19.9 0.1 60.4 0 33.89 0.22 5.62 C>CT GnRH3B 274 C 2252 26.7 100 0 0 0 0 0 C>A GnRH3B 794 T 3413 26.1 0.09 0 99.56 0.35 0 0 T>G G0S2 180 A 1272 24.5 46.38 0.08 0.47 0 0 53.07 delATAGTGAT G0S2 181 T 1283 24.3 0 0.08 0 47.31 0 52.61 - G0S2 182 A 1285 24.5 47.32 0.08 0 0.08 0 52.53 - G0S2 183 G 1307 24.3 0 0 48.58 0 0 51.42 - G0S2 184 T 1316 24.4 0.23 0.3 0.23 47.95 0 51.29 - G0S2 185 G 1316 24.1 0 0 48.71 0 0 51.29 - G0S2 186 A 1328 24.7 49.32 0 0 0 0 50.68 - G0S2 187 T 1336 24.7 0 0 0.3 49.33 0 50.37 - G0S2 485 A 4204 27.1 67.15 31.21 0.1 0.05 0.14 1.5 A>AC G0S2 991 T 4615 28.6 0.26 51.29 0.04 48.41 0 0 T>CT G0S2 1157 G 4654 28 0.19 0.09 50.26 49.44 0 0.02 G>GT G0S2 1399 G 4829 27.9 51.09 0.1 48.75 0.06 0 0 G>AG G0S2 1426 C 4829 28.2 0.1 51.65 0.02 48.21 0 0.02 C>CT G0S2 2750 C 4032 26.1 0.1 50.57 0.05 49.28 0 0 C>CT

206

Late 856 Ref. Ref. Gene Seq. Coverage Score A % C % G % T % Ins % Del % Mutation Call Nucl. Position G0S2 4112 A 2399 23.6 50.52 49.4 0.08 0 0 0 A>AC G0S2 4397 C 2902 27.1 0.03 50.9 0 48.97 0 0.1 C>CT BMAL 396 C 2757 23.5 46.5 53.36 0.07 0.07 0 0 C>AC BMAL 470 A 3112 27.3 47.69 0.03 0 49.81 0 2.47 A>AT BMAL 558 A 3028 27.5 51.32 0 0.13 0.03 0 48.51 delATT BMAL 559 T 3038 27.7 0.07 0.07 0 51.45 0 48.42 - BMAL 560 T 3028 27.5 0 0.17 0.03 51.32 0 48.48 - BMAL 597 A 3257 27.2 51.49 48.42 0.09 0 0 0 A>AC BMAL 791 C 2855 25.8 54.92 45.01 0.07 0 0 0 C>AC BMAL 826 G 2802 25.5 46.97 0.07 52.93 0.04 0 0 G>AG BMAL 986 C 3213 23.1 47.56 52.07 0.22 0.12 0 0.03 C>AC BMAL 1229 A 4431 27.6 0.45 0.23 0.9 0.29 0 98.13 delA BMAL 1261 A 3991 28.1 51.09 0.15 48.31 0.4 0 0.05 A>AG BMAL 1318 T 3079 25.2 0 0.26 45.92 53.75 0.03 0.06 T>GT BMAL 1808 A 3155 27.8 0 99.97 0.03 0 0 0 A>C BMAL 2172 A 3254 22.6 53.23 0.06 0.03 0 0 46.68 delAA BMAL 2173 A 3252 22.6 51.85 0.06 1.41 0.06 0 46.62 - BMAL 2263 C 2948 20.6 0 44.71 0.07 55.22 0 0 C>CT BMAL 2413 T 3165 27.6 0.06 99.12 0.06 0.76 0 0 T>C BMAL 2944 A 3120 25.4 0.19 0 99.58 0.22 0 0 A>G BMAL 3131 G 3081 27.2 0.16 99.71 0 0.06 0 0.06 G>C BMAL 3344 T 2971 22.7 0 0.07 0.13 99.19 44.97 0.61 insT BMAL 3348 C 2956 23.5 0.3 52.91 0.07 46.72 0 0 C>CT BMAL 3459 A 2704 27.1 48.93 0.15 0.04 50.67 0 0.22 A>AT BMAL 4141 C 1716 17.7 51.28 48.48 0 0.23 0.12 0 C>AC BMAL 4186 C 1952 22.7 0.05 46.47 0.61 52.87 0 0 C>CT BMAL 4741 A 2037 25.5 0.15 0.1 99.56 0.2 0 0 A>G BMAL 5100 G 3164 27.8 0.09 99.75 0.09 0.06 0 0 G>C BMAL 5866 T 2570 25.4 51.95 0.23 0.12 47.63 0 0.08 T>AT Kiss1r 966 C 2613 22.8 0 47.03 0.04 52.93 0 0 C>CT Clock1b 401 G 185 17.4 52.97 0.54 46.49 0 0 0 G>AG Clock1b 1394 T 248 18.1 0 0 0 100 52.82 0 insT Clock1b 1400 G 245 18.6 0 0 39.18 60.82 0 0 G>GT Kiss2 532 G 12049 32.3 0.01 49.39 50.54 0.07 0 0 G>CG

207

Late 857 Ref. Ref. Gene Seq. Coverage Score A % C % G % T % Ins % Del % Mutation Call Nucl. Position dec1 565 G 5034 25 47.46 0.08 52.42 0.02 0 0.02 G>AG dec1 953 T 4539 27.1 0.04 0.02 48.49 51.44 0 0 T>GT dec1 2056 G 5156 28.7 46.88 0.12 52.91 0.1 0 0 G>AG dec1 2114 C 5298 28.2 0.09 53.08 0.34 46.49 0 0 C>CT dec2 397 T 964 21.1 0 0 0.1 99.9 43.36 0 insTATC dec2 698 A 757 22.9 0.4 0 0 99.6 0 0 A>T Eed 279 T 783 22.8 0.13 0 0 26.18 0 73.69 delT Eed 629 T 1236 22.9 0.16 77.67 0 22.17 0 0 T>C Eed 1652 C 1481 24 0.14 34.5 65.09 0.27 0 0 C>CG Eed 2178 A 1528 25.4 42.02 0.72 0 0 0.07 57.26 delA Eed 2375 A 1486 20.2 59.08 0 40.85 0.07 0 0 A>AG Eed 2455 A 1672 25.6 0.3 0 99.58 0.12 0 0 A>G Eed 2688 G 1901 21.4 46.03 0.05 53.87 0.05 0 0 G>AG Eed 2768 T 2084 23.7 45.97 0.05 0.05 53.93 0 0 T>AT Eed 2852 G 1908 18.2 48.69 0 51.15 0.16 0 0 G>AG Eed 3028 T 1675 22 0.12 74.09 0.06 25.73 0 0 T>C Eed 3236 T 1628 25.5 0.12 41.77 0.06 58.05 0 0 T>CT Eed 3469 T 2796 26.9 1.11 36.55 0.61 61.37 0 0.36 T>CT Eed 3499 G 2576 26.7 32.96 0.16 66.3 0.35 0 0.23 G>AG Eed 3525 A 2479 25.5 67.89 0.2 0.44 30.9 0 0.56 A>AT Eed 3532 T 2421 25.9 1.24 35.27 0.45 62.58 0.08 0.45 T>CT Eed 3562 G 2034 24.8 42.82 0.2 55.26 0.74 0 0.98 G>AG Eed 3588 A 1813 24.9 47.71 0.06 0.61 50.58 0 1.05 A>AT Eed 4041 A 1368 23.7 25.95 0 73.98 0.07 0 0 A>G Eed 4127 A 1507 24.8 24.75 0.07 75.12 0.07 0 0 A>G Eed 4161 A 1487 25.3 47.34 0.2 52.05 0.4 0.2 0 A>AG Eed 4162 T 1487 24 0.07 0.07 0.2 99.66 50.3 0 insT Eed 4219 A 1355 18.5 26.86 0 72.92 0.15 0 0.07 A>G Eed 4222 T 1406 19.4 0.28 0.14 71.91 27.31 0 0.36 T>G Eed 4224 G 1395 19.4 71.25 0.14 28.39 0.22 0 0 G>A Eed 4249 T 1513 24.3 0.2 73.76 0.13 25.91 0 0 T>C Eed 4262 T 1545 23.6 0.32 30.03 0.13 69.51 0 0 T>CT Eed 4274 T 1588 25.2 0.06 69.52 0.06 30.35 0 0 T>CT Eed 4363 A 1656 25.7 69.02 0.18 30.74 0 0 0.06 A>AG Eed 4418 T 1604 22.7 0.06 74.38 0.19 25.31 0 0.06 T>C Eed 4531 A 1781 24.9 55.64 44.02 0 0 0 0.34 A>AC Eed 4593 G 2038 21.1 73.06 0 26.89 0.05 0 0 G>A Eed 4603 C 2086 18 26.94 0.14 0.05 72.77 0 0.1 C>T Eed 4649 A 2144 24.9 27.01 72.95 0 0.05 0 0 A>C

208

Late 857 Ref. Ref. Gene Seq. Coverage Score A % C % G % T % Ins % Del % Mutation Call Nucl. Position Eed 4704 C 2180 18.8 0.18 60.18 39.63 0 0 0 C>CG Eed 4791 T 2247 21.8 0.22 77.88 0.04 21.85 0 0 T>C Eed 4824 T 2295 24.9 0.09 0 73.99 25.88 0 0.04 T>G Eed 4923 T 1959 24.3 44.77 0.46 0.2 54.57 0 0 T>AT Eed 4930 A 1895 19.2 53.98 0.05 0.16 45.8 0 0 A>AT Eed 4935 G 1936 23 0 47.88 51.96 0.15 0 0 G>CG Eed 5044 C 1578 25.2 47.66 51.96 0.25 0.13 0 0 C>AC Eed 5045 A 1592 25.5 52.64 0.06 47.3 0 0 0 A>AG Eed 5074 A 1540 25.1 6.88 0 0 0 0.65 93.12 delAAAAAA Eed 5075 A 1538 25.1 31.99 0 0 0 0 68.01 - Eed 5076 A 1537 23.8 46.84 0 0.07 0 0 53.09 - Eed 5077 A 1536 23.9 51.37 0.07 0.07 0.13 0 48.37 - Eed 5078 A 1535 24.1 52.25 0.13 0 0 0 47.62 - Eed 5079 A 1535 24.1 52.31 0 0.07 0.07 0 47.56 - Eed 5138 T 1337 22.1 0.15 76.81 0 23.04 0 0 T>C Eed 5140 G 1344 22.1 0.22 0 23.36 76.26 0 0.15 G>T Eed 5185 A 1135 23.3 51.63 1.06 47.14 0.18 0 0 A>AG Eed 5264 C 886 21.4 0 59.03 0.11 34.76 0 6.09 C>CT Eed 5269 C 895 18.1 0.34 61.01 0 32.63 0 6.03 C>CT Eed 5275 C 907 15.2 40.57 58.88 0.11 0.22 0 0.22 C>AC Eed 5283 G 878 18.6 0 0.11 60.02 0.34 0 39.52 delG Eed 5285 C 884 18 0 53.96 0 39.03 0 7.01 C>CT GnRH3B 274 C 1477 23.8 46.51 53.35 0.07 0.07 0 0 C>AC GnRH3B 794 T 2175 24.6 0.05 0.09 99.63 0.18 0 0.05 T>G GnRH3B 1026 C 1684 22.8 56.83 43.11 0 0 0 0.06 C>AC G0S2 991 T 1165 23 0 43.95 0.09 55.71 0 0.26 T>CT G0S2 1359 A 1364 23.7 51.91 0.29 0.37 47.43 0 0 A>AT G0S2 1399 G 1428 23.9 47.2 0 52.38 0.42 0 0 G>AG G0S2 1519 G 1350 23.7 42.89 0.22 56.67 0.07 0 0.15 G>AG G0S2 2424 A 1375 23.5 47.42 52.29 0.15 0.15 0 0 A>AC G0S2 2427 T 1360 23.5 0.07 52.79 0 47.13 0 0 T>CT G0S2 2476 T 1327 24.9 0.15 0 46.27 53.58 0 0 T>GT G0S2 2512 G 1244 23.1 46.78 0 53.14 0.08 0 0 G>AG G0S2 2535 G 1328 24.4 48.27 0 51.66 0.08 0 0 G>AG G0S2 2583 C 1316 24.3 0.3 49.09 0.08 50.53 0 0 C>CT G0S2 2628 A 1297 24.3 49.58 50.12 0.23 0.08 0 0 A>AC G0S2 2874 A 959 21.8 44.63 55.37 0 0 0 0 A>AC G0S2 2878 T 942 21.7 0 55.31 0.11 44.59 0 0 T>CT G0S2 3969 T 672 18.2 47.47 0 0.15 52.38 0 0 T>AT

209

Late 857 Ref. Ref. Gene Seq. Coverage Score A % C % G % T % Ins % Del % Mutation Call Nucl. Position G0S2 3978 C 675 18.2 1.33 54.52 0 0 0.15 44.15 delC G0S2 3979 C 673 17.7 0 100 0 0 53.19 0 insT G0S2 4005 T 657 22.2 0 0 52.82 47.18 0 0 T>GT G0S2 4112 A 575 21.8 0.17 99.83 0 0 0 0 A>C G0S2 4397 C 750 22.7 0 52.4 0 47.6 0 0 C>CT G0S2 4420 A 784 22.1 47.7 0.13 0.13 0 0 52.04 delATGACGGTC G0S2 4421 T 782 22.1 0 0.13 0.13 47.44 0 52.3 - G0S2 4422 G 788 22.6 0.13 0 47.84 0 0 52.03 - G0S2 4423 A 790 22.9 47.72 0.38 0 0 0 51.9 - G0S2 4424 C 790 22.6 0 48.23 0 0 0 51.77 - G0S2 4425 G 790 22.6 0 0.13 48.1 0 0 51.77 - G0S2 4426 G 788 22.6 0.38 0.13 47.59 0 0 51.9 - G0S2 4427 T 788 22.6 0 0.13 0.13 47.84 0 51.9 - G0S2 4428 C 787 22.4 0.13 47.65 0 0.25 0 51.97 - G0S2 4550 T 659 19.5 0.15 50.38 0.15 49.32 0 0 T>CT G0S2 4637 T 606 21.1 0.17 0 49.5 50.33 0 0 T>GT BMAL 2172 A 1987 22.8 54.45 0.1 0 0 0 45.45 delAA BMAL 2173 A 1990 22.8 53.57 0.15 0.95 0 0 45.33 - BMAL 2333 T 2648 23.3 44.75 0.3 0.08 54.87 0 0 T>AT BMAL 2413 T 3107 25.3 0.1 44.77 0.06 55.07 0 0 T>CT BMAL 2944 A 3625 28.1 52 0.08 47.81 0.11 0 0 A>AG BMAL 3131 G 3390 25.3 0.09 45.55 54.28 0.09 0 0 G>CG BMAL 3344 T 3169 23.1 0.03 0.16 0.06 99.68 48 0.06 insT BMAL 3348 C 3162 23.9 0.09 50.76 0.06 49.08 0 0 C>CT BMAL 4141 C 1573 16.2 52.13 47.81 0.06 0 0.06 0 C>AC BMAL 4607 T 2761 27.2 0.07 50.45 0 49.22 0 0.25 T>CT BMAL 4693 T 2664 26.4 0.15 49.32 0.11 50.41 0 0 T>CT BMAL 4741 A 2748 26.9 0.04 0.04 99.85 0.07 0 0 A>G BMAL 4781 A 2499 9.8 47.82 0.04 52.06 0.04 0 0.04 A>AG BMAL 4782 T 2496 9.9 0.04 52.48 0.08 47.36 0.04 0.04 T>CT BMAL 4783 G 2501 9.8 0.2 51.66 47.82 0.28 0 0.04 G>CG BMAL 4787 T 2517 7.6 0.04 6.56 0.16 48.71 0 44.54 delT BMAL 4790 A 2770 5 54.22 0.14 45.27 0.22 0 0.14 A>AG BMAL 4791 C 2764 5 0.14 54.16 0.33 45.3 0 0.07 C>CT BMAL 4794 T 2717 9.6 0.33 0.18 0.04 99.41 44.79 0.04 insA BMAL 4797 G 2709 9.8 0.22 45.04 54.01 0.04 0 0.7 G>CG BMAL 4798 G 2721 11.9 45.72 0.22 53.91 0 0 0.15 G>AG BMAL 4799 C 2739 12 0.04 54.18 0 45.78 0 0 C>CT BMAL 5100 G 3498 21.7 0.09 51 48.86 0.06 0 0 G>CG

210

Late 857 Ref. Ref. Gene Seq. Coverage Score A % C % G % T % Ins % Del % Mutation Call Nucl. Position Clock1b 1394 T 132 15.4 0 0 0 99.24 41.67 0.76 insT Clock1b 1400 G 131 15.2 0.76 0 47.33 51.91 0 0 G>GT

Late 858 Ref. Ref. Gene Seq. Coverage Score A % C % G % T % Ins % Del % Mutation Call Nucl. Position dec1 565 G 7474 27.7 50.52 0.07 49.32 0.09 0 0 G>AG dec1 953 T 7170 28.2 0.01 0.03 51.58 48.37 0 0.01 T>GT dec1 1362 G 9204 30.3 49.3 0.04 50.58 0.07 0 0.01 G>AG dec1 1535 G 9190 28.1 47.73 0.02 52.19 0.07 0 0 G>AG dec1 2056 G 7627 29.4 49.99 0.14 49.81 0.05 0 0 G>AG dec2 698 A 1828 25.7 65.92 0.05 0 34.03 0 0 A>AT dec2 997 T 1935 23 0 0.05 35.35 64.6 0 0 T>GT Eed 1652 C 2990 25.2 0.07 0.1 99.16 0.67 0 0 C>G Eed 2455 A 3044 26.4 62.84 0.03 36.89 0.23 0 0 A>AG Eed 2629 A 2762 25.7 36.89 0.07 62.93 0.04 0 0.07 A>AG Eed 2688 G 2798 24.7 36.67 0.11 63.08 0.14 0 0 G>AG Eed 2703 G 2971 27.6 62.1 0.5 36.96 0.44 0 0 G>AG Eed 2768 T 3240 26.5 99.72 0 0.06 0.22 0 0 T>A Eed 2852 G 2906 25 83.59 0.14 16.21 0.07 0 0 G>A Eed 3236 T 3106 26.4 0.06 59.82 0.1 40.02 0 0 T>CT Eed 3304 T 3143 27.3 59.34 0.03 0.19 40.44 0 0 T>AT Eed 3317 G 3048 24.7 0.1 0.1 40.16 59.65 0 0 G>GT Eed 3370 A 2911 24 39.09 0.03 60.77 0.07 0 0.03 A>AG Eed 3469 T 3476 26.5 1.01 59.61 0.17 38.95 0.03 0.26 T>CT Eed 3532 T 3092 26.7 1.03 64.55 0.36 33.83 0 0.23 T>CT Eed 3562 G 3007 24.4 50.12 0.1 49.19 0.2 0 0.4 G>AG Eed 3588 A 2992 25.7 38.8 0.27 0.2 60.33 0 0.4 A>AT Eed 3782 T 2932 27.6 0.03 0.03 47.48 52.42 0 0.03 T>GT Eed 3933 C 3033 23.8 0.1 53.05 0.03 46.82 0 0 C>CT Eed 4027 A 3064 27.3 51.27 48.53 0.07 0.13 0 0 A>AC Eed 4148 T 3027 25.2 0.1 0.03 49.55 50.31 0 0 T>GT Eed 4161 A 2986 25.1 100 0 0 0 0 0 G>A Eed 4219 A 2676 26.4 17.12 0.04 82.66 0.15 0.04 0.04 A>G Eed 4222 T 2733 21.9 0.11 0.26 33.7 65.64 0 0.29 T>GT Eed 4224 G 2699 21.7 33.68 0.07 66.14 0.11 0 0 G>AG Eed 4249 T 2731 25.1 0.11 52.44 0.11 47.31 0 0.04 T>CT Eed 4274 T 2808 26.6 0.04 82.98 0 16.99 0 0 T>C

211

Late 858 Ref. Ref. Gene Seq. Coverage Score A % C % G % T % Ins % Del % Mutation Call Nucl. Position Eed 4418 T 2646 25.1 0.15 54.16 0.15 45.54 0 0 T>CT Eed 4531 A 2750 27.4 64.91 34.8 0.22 0.04 0 0.04 A>AC Eed 4556 A 2763 25.8 35.43 0.18 64.21 0.18 0 0 A>AG Eed 4580 G 3084 26.1 0.03 0 63.29 36.61 0 0.06 G>GT Eed 4602 A 3145 24.5 17.71 0.1 0.16 82.03 0 0 A>T Eed 4603 C 3150 8.3 46.29 17.81 0.03 35.87 0 0 C>AT Eed 4648 T 3184 27.7 0.09 63.6 0.06 36.24 0 0 T>CT Eed 4649 A 3181 27.7 0.13 99.75 0.03 0.09 0 0 A>C Eed 4704 C 2840 27.4 0.04 0 99.89 0.07 0 0 C>G Eed 4791 T 2465 22.1 0.12 53.23 0.08 46.57 0 0 T>CT Eed 4824 T 2761 26 0.04 0.07 52.95 46.94 0 0 T>GT Eed 4923 T 2923 25.6 52.51 0.24 0.27 46.97 0 0 T>AT Eed 4930 A 2940 21 46.02 0.27 0.14 53.57 0 0 A>AT Eed 4935 G 3030 25.5 0.03 54.79 45.02 0.17 0 0 G>CG Eed 5044 C 2521 25.2 34.59 64.89 0.44 0.08 0 0 C>AC Eed 5045 A 2546 25.2 65.04 0.04 34.84 0.08 0.04 0 A>AG Eed 5074 A 2543 25.2 2.36 0 0.04 0 0.08 97.6 delAAAAAA Eed 5075 A 2541 24.9 7.16 0 0 0 0 92.84 - Eed 5076 A 2543 26.3 43.26 0 0.04 0 0 56.7 - Eed 5077 A 2544 26.3 60.53 0 0.04 0.08 0 39.35 - Eed 5078 A 2541 26.1 64.03 0.04 0.04 0.04 0 35.85 - Eed 5079 A 2542 26.1 64.52 0.12 0.08 0 0 35.29 - Eed 5138 T 2449 25.6 0.12 99.27 0 0.61 0 0 T>C Eed 5140 G 2443 27 0.08 0.29 0.45 99.18 0 0 G>T Eed 5185 A 2061 25.6 60.99 1.65 37.21 0.15 0 0 A>AG Eed 5264 C 1829 22.3 0.11 47.07 0 49.75 0 3.06 C>CT Eed 5300 C 2056 23.2 0.05 56.23 0.88 42.85 0.92 0 C>CT Eed 5301 A 2059 23 53.04 0.83 43.13 0.05 0 2.96 A>AG GnRH3B 331 A 3615 27.8 47.97 0.06 0.17 51.81 0 0 A>AT GnRH3B 353 A 3863 28 49.68 0.03 50.25 0.05 0 0 A>AG GnRH3B 360 G 3987 28.1 50.34 0.08 49.54 0.05 0 0 G>AG GnRH3B 411 C 4278 28.7 0.07 49.91 0.14 49.88 0 0 C>CT GnRH3B 1210 T 445 19.9 45.84 0 0.45 53.71 0 0 T>AT G0S2 180 A 1354 24.9 50.44 0.22 0 0 0 49.34 delATAGTGAT G0S2 181 T 1365 24.7 0 0.07 0 50.84 0 49.08 - G0S2 182 A 1366 24.7 50.59 0.29 0 0.07 0 49.05 - G0S2 183 G 1400 24.8 0 0 52.07 0.07 0 47.86 - G0S2 184 T 1409 24.6 0.21 0.28 0 51.95 0 47.55 - G0S2 185 G 1408 24.6 0 0 52.56 0 0 47.44 -

212

Late 858 Ref. Ref. Gene Seq. Coverage Score A % C % G % T % Ins % Del % Mutation Call Nucl. Position G0S2 186 A 1427 24.9 52.77 0 0.21 0.07 0 46.95 - G0S2 187 T 1431 24.9 0 0.14 0.56 52.48 0 46.82 - G0S2 991 T 3325 26.1 0.24 50.95 0.06 48.75 0 0 T>CT G0S2 1157 G 3719 28.2 0.03 0.05 50.26 49.64 0 0.03 G>GT G0S2 1399 G 3380 27.6 50.09 0.18 49.64 0.09 0 0 G>AG G0S2 1426 C 3299 27.5 0.12 50.71 0.03 49.11 0 0.03 C>CT G0S2 4112 A 2223 23.9 52.99 47.01 0 0 0 0 A>AC G0S2 4397 C 2750 26 0.18 50.29 0.04 49.49 0 0 C>CT BMAL 1214 C 16 7.9 0 0 0 100 0 0 C>T BMAL 1215 C 16 7.8 0 0 100 0 0 0 C>G BMAL 1216 A 16 7.8 0 0 0 100 0 0 A>T BMAL 1353 G 16 9.4 0 0 0 100 0 0 G>T BMAL 1365 T 16 9.4 0 100 0 0 0 0 T>C BMAL 1381 G 19 9.8 0 0 0 100 0 0 G>T BMAL 1458 T 20 10.1 0 0 0 0 0 100 delT BMAL 1507 A 19 10.1 0 100 0 0 5.26 0 A>C BMAL 2172 A 4227 20.8 3.81 0 0.02 0 0 96.17 delAA BMAL 2173 A 4230 21.4 0.26 0.14 3.66 0.17 0 95.77 - BMAL 2413 T 5498 27.4 0.07 45.36 0.04 54.53 0 0 T>CT BMAL 2654 C 3434 26.2 56.96 42.92 0.06 0.06 0 0 C>AC BMAL 2764 A 1974 22.6 38.1 0.15 0 61.75 0.1 0 A>AT BMAL 2944 A 6199 30 50.81 0.08 48.98 0.13 0 0 A>AG BMAL 3131 G 5403 28.5 0.11 48.03 51.79 0.07 0 0 G>CG BMAL 3324 A 6312 29.9 49.03 0.3 0.25 50.22 0.02 0.19 A>AT BMAL 3344 T 6094 26.2 0.03 0.11 0.07 99.67 49.1 0.11 insT BMAL 3348 C 6071 26.8 0.07 49.51 0.08 50.34 0 0 C>CT BMAL 3459 A 5869 29.4 49.31 0.15 0.05 50.33 0 0.15 A>AT BMAL 3796 T 5379 26.4 0.04 0.11 0.02 58.47 0 41.36 delTTGA BMAL 3797 T 5381 26.4 0 0.13 0.04 58.48 0 41.35 - BMAL 3798 G 5406 26.8 0.04 0.72 57.99 0.06 0 41.19 - BMAL 3799 A 5405 26.5 57.56 0.15 0.04 0.78 0 41.48 - BMAL 4741 A 4769 29.3 50.91 0.1 48.9 0.08 0 0 A>AG BMAL 4796 C 4986 25.3 0.1 50.28 0.06 49.52 0 0.04 C>CT BMAL 5100 G 6010 25.2 0.07 50.17 49.75 0.02 0 0 G>CG BMAL 5877 A 4743 27.2 49.27 0.27 0.13 50.33 0 0 A>AT Clock1b 406 T 404 19.4 61.88 0.74 0.25 37.13 0 0 T>AT Clock1b 507 T 816 23.2 0 0 56.37 43.63 0 0 T>GT Clock1b 514 A 814 22.7 44.23 55.77 0 0 0 0 A>AC Clock1b 533 C 808 22.4 55.94 43.81 0.25 0 0 0 C>AC

213

Late 858 Ref. Ref. Gene Seq. Coverage Score A % C % G % T % Ins % Del % Mutation Call Nucl. Position Clock1b 1394 T 530 19.8 0 0 0 100 40.75 0 insT Clock1b 1400 G 516 19.5 0.39 0 50.97 48.64 0 0 G>GT

214