Louisiana State University LSU Digital Commons

LSU Doctoral Dissertations Graduate School

2015 Stimulation of Escherichia coli DNA Damage Inducible DNA Helicase DinG by the Single- stranded DNA Binding Protein SSB Zishuo Cheng Louisiana State University and Agricultural and Mechanical College, [email protected]

Follow this and additional works at: https://digitalcommons.lsu.edu/gradschool_dissertations

Recommended Citation Cheng, Zishuo, "Stimulation of Escherichia coli DNA Damage Inducible DNA Helicase DinG by the Single-stranded DNA Binding Protein SSB" (2015). LSU Doctoral Dissertations. 3413. https://digitalcommons.lsu.edu/gradschool_dissertations/3413

This Dissertation is brought to you for free and open access by the Graduate School at LSU Digital Commons. It has been accepted for inclusion in LSU Doctoral Dissertations by an authorized graduate school editor of LSU Digital Commons. For more information, please [email protected].

STIMULATION OF ESCHERICHIA COLI DNA DAMAGE INDUCIBLE DNA HELICASE DING BY THE SINGLE-STRANDED DNA BINDING PROTEIN SSB

A Dissertation

Submitted to the Graduate Faculty of the Louisiana State University and Agricultural and Mechanical College in partial fulfillment of the requirements for the degree of Doctor of Philosophy

in

The Department of Biological Sciences

by Zishuo Cheng B.S., Wuhan University, 2007 M.S., Chinese Academy of Sciences, 2010 December 2015 ACKNOWLEDGEMENTS

My heartfelt thankfulness goes to those who helped me fulfill this dissertation on various aspects.

I would like to express deepest gratitude to my major professor Dr. Huangen

Ding who has supported and inspired me all the way through my Ph.D. research progress.

My graduate studies would not be so meaningful without his guidance and encouragement. Committee members including Bing-Hao Luo, John R. Battista and

Yong-Hwan Lee are also the ones I sincerely thank for their patience and insights on my work. I also thank Dean’s representative Dr. Luigi G Marzilli for his time and help.

The colleagues contribute a lot in my accomplishment of laboratory work. I thank

Jeonghoon Lee for his instruction on mass spectroscopy. In the meantime, my current lab members, Aaron Landry, Md. Julkernine Julfiker, Yiming Wang and Jing Yang share a great deal of experiments, insightful researches and friendship with me and I do cherish the experiences.

Lastly and especially I thank my beloved parents Mr. and Mrs. Cheng and dearest

Na Sun who unconditionally support and accompany me with love.

ii TABLE OF CONTENTS

ACKNOWLEDGEMENTS ...... ii

LIST OF FIGURES ...... iv

ABSTRACT ...... v

CHAPTER 1. INTRODUCTION ...... 1

CHAPTER 2. STIMULATION OF ESCHERICHIA COLI DNA DAMAGE INDUCIBLE DNA HELICASE DING BY THE SINGLE-STRANDED DNA BINDING PROTEIN SSB ...... 25

CHAPTER 3. IRON AND ZINC BINDING ACTIVITY OF ESCHERICHIA COLI TOPOISOMERASE I HOMOLOG YRDD ...... 42

CHAPTER 4. CONCLUSIONS ...... 57

APPENDIX: PERMISSION TO INCLUDE PUBLISHED WORK ...... 58

VITA ...... 60

iii LIST OF FIGURES

Figure 1.1 Iron-sulfur clusters...... 2

Figure 1.2 The isc gene cluster in E.coli...... 3

Figure 1.3 The proposed USA model for iron-sulfur cluster assembly...... 7

Figure 1.4 E.coli DinG is closely related to human DNA helicases XPD and BACH1. .... 9

Figure 2.1 Purification of E. coli DinG and SSB ...... 29

Figure 2.2 Gel filtration analyses of the SSB/DinG protein complex ...... 30

Figure 2.3 Protein co-precipitation analyses of SSB and DinG ...... 32

Figure 2.4 E. coli SSB stimulates the DinG DNA helicase activity ...... 33

Figure 2.5 SSB mutant F177C inhibits the DinG DNA helicase activity ...... 35

Figure 3.1 The E. coli topoisomerase I homolog YrdD binds a mononuclear iron center 47

Figure 3.2 Competition of iron and zinc binding in YrdD in E. coli cells ...... 48

Figure 3.3 The Zn-bound YrdD has the ssDNA binding activity ...... 50

Figure 3.4 The Zn-bound YrdD protects ssDNA from DNase I digestion ...... 52

iv ABSTRACT

We investigate the regulation of an E.coli iron-sulfur protein DNA damage inducible DNA helicase (DinG) by single-stranded DNA binding protein (SSB). We find that SSB can form a stable protein complex with DinG and stimulate the DinG DNA helicase activity. On the other hand, SSB mutant that retains the single-stranded DNA binding activity but fails to form a protein complex with DinG becomes a potent inhibitor for the DinG DNA helicase. The results indicate SSB stimulates the DinG DNA helicase activity via direct protein-protein interaction. The results from these studies suggest that iron-sulfur proteins are regulated not only by intracellular metal homeostasis but also by specific protein factors in cells.

We also describe a novel iron binding protein YrdD in E.coli cell. YrdD is a homolog of the C-terminal zinc-binding region of E.coli topoisomerase I. Purified YrdD contains both zinc and iron. Supplement of exogenous zinc in the growth medium abolishes the iron binding of YrdD in E. coli cells, indicating that iron and zinc may compete for the same metal binding sites in the protein. While the zinc-bound YrdD is able to bind single-stranded (ss) DNA and protect ssDNA from the DNase I digestion in vitro, the iron-bound YrdD has very little or no binding activity for ssDNA, suggesting that the zinc-bound YrdD may have an important role in DNA repair by interacting with ssDNA in cells.

v CHAPTER 1. INTRODUCTION

1.1 Iron-sulfur clusters

The oldest and most versatile inorganic cofactor is probably iron-sulfur cluster (1).

In the anaerobic atmosphere of ancient earth, iron-sulfur cluster may already exist (2).

Following the discovery of ferredoxin as an iron-sulfur cluster containing protein in the

1960s (3), over 500 unique iron-sulfur proteins have been discovered in Achaea, bacteria, plants and animals (4).

Although more complex structures exist, the chemically simplest iron-sulfur clusters are [2Fe-2S] and [4Fe-4S] types (Figure 1.1) (5). Iron-sulfur clusters are usually coordinated by cysteine or histidine residues in protein (6). They participate in physiological possesses such as photosynthesis and respiration, nitrogen fixation, DNA synthesis and repair, ribosome biogenesis, lipoic acid and heme biosynthesis, and regulation of gene expression (7).

The most common function of iron-sulfur cluster is electron transfer because iron can readily donate or accept electrons (8). For examples, iron-sulfur clusters in mitochondrial complex I facilitate efficient capture of chemical energy from NADH as electron moves through respiratory chain complexes (9). Another function of iron-sulfur cluster is directly involved in enzyme catalysis. For example, a non protein-coordinated

Fe at one edge of a [4Fe-4S] cluster in aconitase protein serves as a Lewis acid to assist

H2O abstraction from aconitate, which is converted to isocitrate (10). A third role of iron- sulfur cluster is acting as a sensor of environmental or intracellular conditions to regulate gene express. Examples include the bacterial transcription factors FNR SoxR, IscR, and mammalian IRP1 (11-13). For example, SoxR [2Fe-2S] cluster, while principally serving

1 as a sensor for superoxide, can also be activated by NO (14). The nitrosylated SoxR will activate transcription similar to that of SoxR with an oxidized [2Fe-2S] clusters (15).

Figure 1.1 Iron-sulfur clusters. A), a [2Fe-2S] cluster. B), a [4Fe-4S] cluster. Both clusters are depicted with the iron atoms coordinated with sulfhydrl gourps (RS).

1.2 Iron-sulfur cluster biogenesis

Iron-sulfur cluster proteins are ubiquitous in biological systems, and the mechanism by which these clusters are assembled is not yet fully understood. Iron-sulfur clusters can form spontaneously under anaerobic conditions in vitro using ferrous iron and sulfide in the presence of a reducing agent (16). However, iron and sulfide at high concentrations, are highly toxic to cells (4). As free iron and sulfide ions can produce reactive oxygen species (ROS) via Fenton chemistry which result in macromolecular damage in cells (17). Throughout evolution, organisms have adapted complex systems to efficiently assemble iron-sulfur clusters in proteins.

Recent studies have identified three types of biosynthetic machineries: NIF, ISC and SUF, for iron-sulfur cluster assembly (18-20). The NIF system is specific for maturation of nitrogenase in Azotobacter vinelandii and other nitrogen fixing bacteria.

2 The ISC system is for housekeeping iron-sulfur proteins. While, the SUF has a similar function as ISC except they are expressed only under oxidative-stress conditions or iron starvation condition (21). During evolution, the ISC system might be transferred to eukaryotes by endosymbiosis, whereas plastids host the SUF system (22,23). In eukaryotic cells, mitochordric are the primary sites for iron-sulfur cluster biogenesis. The iron-sulfur cluster assembly proteins in cytosol and nuclei appears to require the assistance of mitochondrial ISC assembly machinery, a mitochondrial ISC export system and the essential cytosolic iron-sulfur protein assembly (CIA) machinery (7).

1.3 Iron-sulfur cluster in E. coli

E. coli, as the model organism, provides great insight into the details of iron- sulfur cluster biosynthesis and delivery to apo-proteins (24). The iscRSUA-hscBA-fdx-

IscX gene cluster in E.coli encodes eight proteins (25).

Figure 1.2 The isc gene cluster in E.coli. The encoded proteins and their number of amino acids are listed below the respective genes. A, IscR is a [2Fe-2S] protein and repressor of the ISC gene cluster. B, IscS, IscU and IscA comprise the basal assembly machinery. C, Co-chaperones HscB and HscA stimulate iron-sulfur cluster delivery to recipient proteins. D, Ferredoxin(Fdx) is a [2Fe- 2S] protein predicted to provide electrons for iron-sulfur cluster maturation. E, IscX is predicted to interact with IscS and IscU to modulate iron-sulfur cluster assembly.

3 IscR, containing a [2Fe-2S] cluster, is a transcriptional repressor that represses the expression of ISC gene cluster (26). The repression activity of IscR prevents wasteful iron-sulfur cluster assembly if iron-sulfur clusters in cells are abundant. During oxidative stress or iron starvation condition, IscR lacking an iron-sulfur cluster is generated, which fails to repress the ISC gene cluster and leads to an increase of iron-sulfur cluster assembly (27).

IscS is a pyridoxal phosphate (PLP)-dependant cysteine deslfurase that extracts sulfur from L-cysteine. This enzymatic reaction generates a sulfur atom that is picked up by the conserved C328 residue and transferred to IscU (28). IscS can also transfer sulfur for biosynthesis of thiamine (29,30).

IscU is a scaffold protein upon which nascent iron-sulfur clusters are built (31). In vitro studies of IscU showed that [2Fe-2S] clusters are assembled in IscU first. Two [2Fe-

2S] clusters maybe converted to [4Fe-4S] cluster (32), which can be transferred subsequently to apo-aconitase (33). IscU contains three highly conserved cysteine residues, and one conserved histidine residues and a conserved “LPPVK” motif (4).

Many steps are involved in iron-sulfur cluster assembly on IscU (34,35). This process, however, is inhibited by bacterial frataxin protein CyaY, which is external to the isc operon (36,37).

IscA is another key member of the iron-sulfur cluster assembly machinery in E.coli (24,38). The protein is highly conserved among aerobic organisms from bacteria to humans (39). Biochemical studies have shown that IscA may act as an alternative scaffold (40,41) or intermediate carrier for iron-sulfur cluster biogenesis(42-

44). However, unlike other scaffold proteins such as IscU (45,46), E. coli IscA has a

4 unique and strong iron binding activity in vitro (47-49) and in vivo(50) . Structurally, E. coli IscA is a homodimer with three conserved cysteine residues (Cys-35, Cys-99 and

Cys-101) from each monomer forming a “cysteine pocket” between two monomers

(51,52) .The site-directed mutagenesis studies showed that the “cysteine pocket” is essential for the iron binding activity in vitro (53) and for the physiological function of

IscA in E. coli cells (54). The “cysteine pocket” in IscA appears to be highly flexible to accommodate a mononuclear iron or an iron-sulfur cluster without significant change of the structure (55) .

Recent studies further showed that iron binding activity of IscA is conserved, as

IscA homologues from Azotobacter vinelandii (56), Saccharomyces cerevisiae (57), and human (58) also have a strong iron binding activity. Furthermore, the iron center in IscA can be mobilized by L-cysteine (59) and transferred for iron-sulfur cluster assembly in target proteins in vitro (49), suggesting that IscA may act as an iron chaperone to deliver iron for iron-sulfur cluster biogenesis. In addition, substitution of the highly conserved residue tyrosine 40 with phenylalanine (Y40F) in IscA results in a mutant protein that has a diminished iron binding affinity but retains the iron-sulfur cluster binding activity.

Genetic complementation studies showed that the IscA Y40F mutant is inactive in vivo, suggesting that the iron binding activity is essential for the function of IscA in iron-sulfur cluster biogenesis (60). In human cells, depletion of IscA1 results in deficiency of iron- sulfur cluster assembly in mitochondria and cytosol. In A. vinelandii, depletion of IscA homologue leads to a null growth phenotype when cells are cultured under the oxygen- elevated conditions (61). In E. coli, deletion of iscA and its paralogue sufA also produces a null growth phenotype in M9 minimal media under aerobic conditions (54,62). Further

5 studies revealed that deletion of iscA and sufA blocks the [4Fe-4S] cluster assembly without significant effect on the [2Fe-2S] cluster assembly in E. coli cells under aerobic growth conditions (63), suggesting that IscA/SufA may have a crucial role for the [4Fe-

4S] cluster assembly in E. coli cells. Consistent with this idea, other research groups have also reported that IscA homologues are essential for the [4Fe-4S] cluster assembly in S. cerevisiae (57) and human cells (64).

HscB and HscA are chaperone proteins. HscA, which has ATPase activity, can bind to IscU in the canonical Hsp70 nucleotide-dependent manner. The C-terminal domain of HscB can also bind to IscU, whereas the N-terminal of HscB is responsible for interacting with HscA and stimulating its ATPase activity, promoting the transfer of cluster from IscU to recipient protein (65).

Ferredoxin contains a stable [2Fe-2S] cluster coordinated by four-conserved cysteine residue. Although its function is not fully understood, ferredoxin is predicted to act as the electron donor for iron-sulfur assembly on IscU due to its association with IscS and its ability to reductively couple two [2Fe-2S] clusters to form a [4Fe-4S] cluster on

IscU (66-68).

IscX is a small acidic protein whose physiological role has been unclear (25).

Recently, IscX has been proposed as a possible iron donor for iron-sulfur cluster biogenesis (69). However, like frataxin, IscX has a weak iron binding activity (70), deletion of IscX has very little effect on iron-sulfur proteins in E.coli cells, indicating that IscX may have functions other than directly providing iron for iron-sulfur cluster assembly under physiological conditions.

6

Figure 1.3 The proposed USA model for iron-sulfur cluster assembly. A, L-cysteine first extracts iron from IscA by thiol exchange. B, IscS catalyzes the desulfurization of Fe-bound L-cysteine. C, IscS releases L-alanine and harbors the Fe-S moiety with in a persulfid bond, which is transferred to IscU. D, Additional iron and sulfur builds the [Fe-S] cluster on IscU.

1.4 Iron-sulfur cluster biogenesis and human diseases

The iron-sulfur cluster biogenesis is fundamental to a variety of cellular processes. Homologous ISC-assembly proteins within eukaryotes mitochondria, along with the cytosolic iron-sulfur cluster assembly system, produce nearly all iron-sulfur clusters inside cell (71,72). Because DNA helicases (73), DNA polymerase (74), transcription factors (75), DNA glycosylases and the electron transport complexes among others require iron-sulfur clusters, it is not surprising that disruption of iron-sulfur cluster biogenesis causes human diseases. For example, diminished expression of frataxin causes

Friedreich’s ataxia (FRDA) (76). Low expression of Glutaredoxin 5, which can accommodate a [2Fe-2S] cluster, is associated with deficient sideroblastic (77). Splicing defect in ISCU is linked to myopathy (78,79). Recent evidence also suggests that degraded iron-sulfur clusters form ROS, which lead to oxidative damage in the brains of

Parkinson’s disease patients (80,81).

7 1.5 Iron-sulfur cluster protein DinG

The DNA damage-inducible protein DinG was initially identified from genetic screening in response to DNA-damaging agents in E. coli (82-84). The sequence analysis predicted that E. coli DinG is a member of the superfamily 2 DNA helicases (85).

Purified E. coli DinG has an ATP-dependent helicase activity that unwinds double- stranded DNA (86), DNA–RNA duplex, D-loops, and R-loops (87) , indicating that DinG may have an important role in recombinational DNA repair and resumption of replication following DNA damage (87). Although the physiological function of DinG is not fully understood, recent studies suggested that DinG may act to remove R-loops or together with other DNA helicases Rep and UvrD to promote replication across highly transcribed regions in E. coli genome (88) . Nevertheless, deletion of the gene dinG has only a mild effect on E. coli cell viability and sensitivity to UV radiation (89), likely because of redundant helicase activities in cells.

Structurally, E. coli DinG is closely related to yeast DNA helicase Rad3 (90) and human DNA helicases Xeroderma pigmentosum factor D (XPD) (91,92) ,

FANCJ/BACH1 (BRCA1-associated C-terminal helicase) (93) , CHLR1 (a DNA helicase involving in sister chromatid cohesion) (94) , and RTEL1 (a regulator of telomere length)

(95) ( Figure 1.4) . XPD is a member of both the transcription initiation complex TFIIH of RNA polymerase II and the nucleotide excision repair pathway (91,92). Inherited mutations in XPD have been linked to at least three human diseases: xeroderma pigmentosum, Cockayne syndrome, and trichothiodystrophy (91). BACH1 has been shown to physically interact with the BRCT motifs of BRCA1 (breast cancer 1 protein)

(96). Inherited mutations in BACH1 have been implicated in deficiency of the cross-link

8 repair pathway in Fanconi anemia patients (97). Surprisingly, recent studies have revealed that XPD homologs from Sulfolobus acidocaldarius (90), andFerroplasma acidarmanus(98) contain an iron-sulfur cluster located between the Walker A and B motifs in the N terminus of the protein and that the iron-sulfur cluster is essential for helicase activity (90,98) . Mutations that affect iron-sulfur cluster binding or stability in

XPD abolish helicase activity (90) . X-ray crystallographic studies further revealed that the [4Fe-4S] cluster is located in the vicinity of the DNA-binding site of XPD (99-101).

Furthermore, like yeast Rad3 (90) and human XPD, E. coli DinG contains a

[4Fe–4S] cluster that is essential for the DNA helicase activity (102). While the redox property and physiological role of the iron–sulfur cluster in XPD/Rad3 still remain elusive (103,104), we previously reported that the [4Fe–4S] cluster in E. coli DinG is stable and the DNA helicase activity remains fully active after the protein is exposed to

100-fold excess of hydrogen peroxide (102) . On the other hand, reduction of the [4Fe–

4S] cluster in DinG reversibly switches off the DNA helicase activity, suggesting that the helicase activity could be regulated by intracellular redox potentials via the [4Fe–4S] cluster (102).

Figure 1.4 E.coli DinG is closely related to human DNA helicases XPD and BACH1. The identity (red) and similarity (blue) between DinG, XPD, and BACH1 in the regions of helicase motifs.

9 1.6 Iron binding of Topoisomerases and its homolog YrdD

Zinc is an essential trace metal that facilitates correct folding of proteins, stabilizes the domain structure, and plays important catalytic roles in enzymes (105). In E. coli, zinc accumulates to similar levels as calcium and iron (~0.2 mM) under normal growth conditions (106). Depletion of zinc in growth medium results in slow-growth phenotype and activation of zinc uptake systems (107), indicating that zinc has crucial roles in E. coli cells.

DNA topoisomerases are absolutely essential to solve topological problems arising from double-helical structure of DNA. DNA topoisomerases are widely distributed in organisms ranging from bacteria to humans (108), and are essential for

DNA replication, transcription, recombination, and chromatin remodeling (109,110).

Topoisomerases have two subfamilies: Type I topoisomerases (Topo I) introduce transient DNA single-stranded breaks in order to change the topological linking number of a double-stranded DNA molecule , whereas type II topoisomerases (Topo II) introduce transient double-stranded breaks and change the linking number (110).

E. coli topoisomerase I (TopA) belongs to type I subfamily (111,112). When gene topA encoding topoisomerase I is deleted, the mutant E. coli cells are not viable at low temperature (<30°C) (113), and are hypersensitive to high temperature (>50°C) or oxidative stresses (114,115). Structurally, E. coli TopA has an N-terminal catalytic fragment (67 kDa) and a C-terminal zinc-binding region (30 kDa). While the N-terminal catalytic fragment is sufficient for cleaving the single-stranded DNA, the C-terminal zinc-binding region is required for relaxing the negatively supercoiled DNA (116,117) and for interacting with RNA polymerase (118) . The crystal structure of the E.

10 coli TopA N-terminal fragment revealed that the catalytic core has a toroidal fold enclosing a central hole to accommodate substrate DNA (119,120). However, the crystal structure of full-length E. coli TopA containing both the N-terminal fragment and the C- terminal zinc-binding region is still not available.

It has also been reported that the enzyme activity of topoisomerase I is regulated by the C-terminal and N-terminal domain interactions and by divalent metal ions such as

Mg2+ and Mn2+. In previous studies, we found that E. coli TopA is able to bind not only zinc, but also iron in E. coli cells, depending on the iron and zinc contents in the growth medium. Whereas the zinc-bound TopA is active to relax the negatively supercoiled

DNA, the iron-bound TopA has very little or no such enzyme activity. Furthermore, excess iron in the M9 minimal medium is able to compete with the zinc binding in TopA in E. coli cells and attenuates the TopA topoisomerase activity. The results suggested that

TopA topoisomerase activity may be regulated by the iron and zinc binding in E. coli cells (121).

Genome-wide search revealed that E. coli has two topoisomerase I homologs: topoisomerase III and a function-unknown protein YrdD. Topoisomerase III is homologous to the N-terminal domain of topoisomerase I and has a crucial role in genomic stability (122) and chromosome segregation (123). On the other hand, YrdD is homologous to the C-terminal zinc-binding region of topoisomerase I. YrdD is highly conserved among proteobacteria and enterobacteria. Although the function of YrdD is unknown, recent genetic studies indicated that YrdD may have an important role in DNA repair as inactivation of YrdD suppresses the severe growth inhibition phenotype of an E. coli mutant with deletions of the key DNA recombination repair protein RecA and the

11 bacterial dNTPase RdgB which removes non-canonical DNA precursors such as dIPT in cells (124).

1.8 References

1. Dupont, C. L., Butcher, A., Valas, R. E., Bourne, P. E., and Caetano-Anolles, G. (2010) History of biological metal utilization inferred through phylogenomic analysis of protein structures. Proc Natl Acad Sci U S A 107, 10567-10572

2. Martin, W., Baross, J., Kelley, D., and Russell, M. J. (2008) Hydrothermal vents and the origin of life. Nat Rev Microbiol 6, 805-814

3. Tagawa, K., and Arnon, D. I. (1962) Ferredoxins as electron carriers in photosynthesis and in the biological production and consumption of hydrogen gas. Nature 195, 537-543

4. Johnson, D. C., Dean, D. R., Smith, A. D., and Johnson, M. K. (2005) Structure, function, and formation of biological iron-sulfur clusters. Annu Rev Biochem 74, 247-281

5. Peters, J. W., Stowell, M. H., Soltis, S. M., Finnegan, M. G., Johnson, M. K., and Rees, D. C. (1997) Redox-dependent structural changes in the nitrogenase P- cluster. Biochemistry-Us 36, 1181-1187

6. Meyer, J. (2008) Iron-sulfur protein folds, iron-sulfur chemistry, and evolution. J Biol Inorg Chem 13, 157-170

7. Lill, R., Broderick, J. B., and Dean, D. R. (2015) Special issue on iron-sulfur proteins: Structure, function, biogenesis and diseases. Biochim Biophys Acta 1853, 1251-1252

8. Beinert, H. (2000) Iron-sulfur proteins: ancient structures, still full of surprises. J Biol Inorg Chem 5, 2-15

9. Hirst, J. (2010) Towards the molecular mechanism of respiratory complex I. Biochem J 425, 327-339

12 10. Lauble, H., and Stout, C. D. (1995) Steric and conformational features of the aconitase mechanism. Proteins 22, 1-11

11. Kiley, P. J., and Beinert, H. (2003) The role of Fe-S proteins in sensing and regulation in bacteria. Curr Opin Microbiol 6, 181-185

12. Rouault, T. A. (2006) The role of iron regulatory proteins in mammalian iron homeostasis and disease. Nat Chem Biol 2, 406-414

13. Muckenthaler, M. U., Galy, B., and Hentze, M. W. (2008) Systemic iron homeostasis and the iron-responsive element/iron-regulatory protein (IRE/IRP) regulatory network. Annu Rev Nutr 28, 197-213

14. Ding, H., and Demple, B. (2000) Direct nitric oxide signal transduction via nitrosylation of iron-sulfur centers in the SoxR transcription activator. Proc Natl Acad Sci U S A 97, 5146-5150

15. Hidalgo, E., and Demple, B. (1994) An iron-sulfur center essential for transcriptional activation by the redox-sensing SoxR protein. Embo J 13, 138-146

16. Malkin, R., and Rabinowitz, J. C. (1966) The reconstitution of clostridial ferredoxin. Biochem Biophys Res Commun 23, 822-827

17. Liochev, S. L. (1996) The role of iron-sulfur clusters in in vivo hydroxyl radical production. Free Radic Res 25, 369-384

18. Zheng, L. M., Cash, V. L., Flint, D. H., and Dean, D. R. (1998) Assembly of iron- sulfur clusters - Identification of an iscSUA-hscBA-fdx gene cluster from Azotobacter vinelandii. J Biol Chem 273, 13264-13272

19. Takahashi, Y., and Tokumoto, U. (2002) A third bacterial system for the assembly of iron-sulfur clusters with homologs in archaea and plastids. J Biol Chem 277, 28380-28383

20. Takahashi, Y., and Nakamura, M. (1999) Functional assignment of the ORF2- iscS-iscU-iscA-hscB-hscA-fdx-ORF3 gene cluster involved in the assembly of Fe-S clusters in Escherichia coli. J Biochem 126, 917-926

13 21. Wayne Outten, F. (2015) Recent advances in the Suf Fe-S cluster biogenesis pathway: Beyond the Proteobacteria. Biochim Biophys Acta 1853, 1464-1469

22. Lill, R., and Muhlenhoff, U. (2006) Iron-sulfur protein biogenesis in eukaryotes: Components and mechanisms. Annu Rev Cell Dev Bi 22, 457-486

23. Lill, R., and Muhlenhoff, U. (2008) Maturation of iron-sulfur proteins in eukaryotes: Mechanisms, connected processes, and diseases. Annu Rev Biochem 77, 669-700

24. Roche, B., Aussel, L., Ezraty, B., Mandin, P., Py, B., and Barras, F. (2013) Iron/sulfur proteins biogenesis in prokaryotes: formation, regulation and diversity. Biochim Biophys Acta 1827, 455-469

25. Tokumoto, U., and Takahashi, Y. (2001) Genetic analysis of the isc operon in Escherichia coli involved in the biogenesis of cellular iron-sulfur proteins. J Biochem 130, 63-71

26. Schwartz, C. J., Giel, J. L., Patschkowski, T., Luther, C., Ruzicka, F. J., Beinert, H., and Kiley, P. J. (2001) IscR, an Fe-S cluster-containing transcription factor, represses expression of Escherichia coli genes encoding Fe-S cluster assembly proteins. Proc Natl Acad Sci U S A 98, 14895-14900

27. Giel, J. L., Nesbit, A. D., Mettert, E. L., Fleischhacker, A. S., Wanta, B. T., and Kiley, P. J. (2013) Regulation of iron-sulphur cluster homeostasis through transcriptional control of the Isc pathway by [2Fe-2S]-IscR in Escherichia coli. Mol Microbiol 87, 478-492

28. Smith, A. D., Agar, J. N., Johnson, K. A., Frazzon, J., Amster, I. J., Dean, D. R., and Johnson, M. K. (2001) Sulfur transfer from IscS to IscU: the first step in iron- sulfur cluster biosynthesis. J Am Chem Soc 123, 11103-11104

29. Kambampati, R., and Lauhon, C. T. (1999) IscS is a sulfurtransferase for the in vitro biosynthesis of 4-thiouridine in Escherichia coli tRNA. Biochemistry-Us 38, 16561-16568

30. Lauhon, C. T., and Kambampati, R. (2000) The iscS gene in Escherichia coli is required for the biosynthesis of 4-thiouridine, thiamin, and NAD. J Biol Chem 275, 20096-20103

14 31. Shi, R., Proteau, A., Villarroya, M., Moukadiri, I., Zhang, L., Trempe, J. F., Matte, A., Armengod, M. E., and Cygler, M. (2010) Structural basis for Fe-S cluster assembly and tRNA thiolation mediated by IscS protein-protein interactions. PLoS Biol 8, e1000354

32. Agar, J. N., Krebs, C., Frazzon, J., Huynh, B. H., Dean, D. R., and Johnson, M. K. (2000) IscU as a scaffold for iron-sulfur cluster biosynthesis: Sequential assembly of [2Fe-2S] and [4Fe-4S] clusters in IscU. Biochemistry-Us 39, 7856-7862

33. Unciuleac, M. C., Chandramouli, K., Naik, S., Mayer, S., Huynh, B. H., Johnson, M. K., and Dean, D. R. (2007) In vitro activation of apo-aconitase using a [4Fe- 4S] cluster-loaded form of the IscU [Fe-S] cluster scaffolding protein. Biochemistry-Us 46, 6812-6821

34. Bandyopadhyay, S., Chandramouli, K., and Johnson, M. K. (2008) Iron-sulfur cluster biosynthesis. Biochem Soc Trans 36, 1112-1119

35. Markley, J. L., Kim, J. H., Dai, Z., Bothe, J. R., Cai, K., Frederick, R. O., and Tonelli, M. (2013) Metamorphic protein IscU alternates conformations in the course of its role as the scaffold protein for iron-sulfur cluster biosynthesis and delivery. FEBS Lett 587, 1172-1179

36. Adinolfi, S., Iannuzzi, C., Prischi, F., Pastore, C., Iametti, S., Martin, S. R., Bonomi, F., and Pastore, A. (2009) Bacterial frataxin CyaY is the gatekeeper of iron-sulfur cluster formation catalyzed by IscS. Nat Struct Mol Biol 16, 390-396

37. Prischi, F., Konarev, P. V., Iannuzzi, C., Pastore, C., Adinolfi, S., Martin, S. R., Svergun, D. I., and Pastore, A. (2010) Structural bases for the interaction of frataxin with the central components of iron-sulphur cluster assembly. Nat Commun 1

38. Zheng, L., Cash, V. L., Flint, D. H., and Dean, D. R. (1998) Assembly of iron- sulfur clusters. Identification of an iscSUA-hscBA-fdx gene cluster from Azotobacter vinelandii. J Biol Chem 273, 13264-13272

39. Vinella, D., Brochier-Armanet, C., Loiseau, L., Talla, E., and Barras, F. (2009) Iron-sulfur (Fe/S) protein biogenesis: phylogenomic and genetic studies of A-type carriers. PLoS Genet 5, e1000497

15 40. Krebs, C., Agar, J. N., Smith, A. D., Frazzon, J., Dean, D. R., Huynh, B. H., and Johnson, M. K. (2001) IscA, an alternate scaffold for Fe-S cluster biosynthesis. Biochemistry-Us 40, 14069-14080

41. Ollagnier-de-Choudens, S., Mattioli, T., Takahashi, Y., and Fontecave, M. (2001) Iron-sulfur cluster assembly: characterization of IscA and evidence for a specific and functional complex with ferredoxin. J Biol Chem 276, 22604-22607

42. Mapolelo, D. T., Zhang, B., Naik, S. G., Huynh, B. H., and Johnson, M. K. (2012) Spectroscopic and functional characterization of iron-sulfur cluster-bound forms of Azotobacter vinelandii (Nif)IscA. Biochemistry-Us 51, 8071-8084

43. Mapolelo, D. T., Zhang, B., Randeniya, S., Albetel, A. N., Li, H., Couturier, J., Outten, C. E., Rouhier, N., and Johnson, M. K. (2013) Monothiol glutaredoxins and A-type proteins: partners in Fe-S cluster trafficking. Dalton Trans 42, 3107- 3115

44. Vinella, D., Loiseau, L., Ollagnier de Choudens, S., Fontecave, M., and Barras, F. (2013) In vivo [Fe-S] cluster acquisition by IscR and NsrR, two stress regulators in Escherichia coli. Mol Microbiol 87, 493-508

45. Agar, J. N., Krebs, C., Frazzon, J., Huynh, B. H., Dean, D. R., and Johnson, M. K. (2000) IscU as a scaffold for iron-sulfur cluster biosynthesis: sequential assembly of [2Fe-2S] and [4Fe-4S] clusters in IscU. Biochemistry-Us 39, 7856-7862

46. Raulfs, E. C., O'Carroll, I. P., Dos Santos, P. C., Unciuleac, M. C., and Dean, D. R. (2008) In vivo iron-sulfur cluster formation. Proc Natl Acad Sci U S A 105, 8591-8596

47. Ding, H., and Clark, R. J. (2004) Characterization of iron binding in IscA, an ancient iron-sulphur cluster assembly protein. Biochem J 379, 433-440

48. Ding, H., Harrison, K., and Lu, J. (2005) Thioredoxin reductase system mediates iron binding in IscA and iron delivery for the iron-sulfur cluster assembly in IscU. J Biol Chem 280, 30432-30437

49. Yang, J., Bitoun, J. P., and Ding, H. (2006) Interplay of IscA and IscU in biogenesis of iron-sulfur clusters. J Biol Chem 281, 27956-27963

16 50. Wang, W., Huang, H., Tan, G., Si, F., Liu, M., Landry, A. P., Lu, J., and Ding, H. (2010) In vivo evidence for the iron-binding activity of an iron-sulfur cluster assembly protein IscA in Escherichia coli. Biochem J 432, 429-436

51. Bilder, P. W., Ding, H., and Newcomer, M. E. (2004) Crystal structure of the ancient, Fe-S scaffold IscA reveals a novel protein fold. Biochemistry-Us 43, 133- 139

52. Cupp-Vickery, J. R., Silberg, J. J., Ta, D. T., and Vickery, L. E. (2004) Crystal structure of IscA, an iron-sulfur cluster assembly protein from Escherichia coli. J Mol Biol 338, 127-137

53. Ding, H., Clark, R. J., and Ding, B. (2004) IscA mediates iron delivery for assembly of iron-sulfur clusters in IscU under the limited accessible free iron conditions. J Biol Chem 279, 37499-37504

54. Lu, J., Yang, J., Tan, G., and Ding, H. (2008) Complementary roles of SufA and IscA in the biogenesis of iron-sulfur clusters in Escherichia coli. Biochem J 409, 535-543

55. Wada, K., Hasegawa, Y., Gong, Z., Minami, Y., Fukuyama, K., and Takahashi, Y. (2005) Crystal structure of Escherichia coli SufA involved in biosynthesis of iron-sulfur clusters: implications for a functional dimer. FEBS Lett 579, 6543- 6548

56. Mapolelo, D. T., Zhang, B., Naik, S. G., Huynh, B. H., and Johnson, M. K. (2012) Spectroscopic and functional characterization of iron-bound forms of Azotobacter vinelandii (Nif)IscA. Biochemistry-Us 51, 8056-8070

57. Muhlenhoff, U., Richter, N., Pines, O., Pierik, A. J., and Lill, R. (2011) Specialized function of yeast Isa1 and Isa2 proteins in the maturation of mitochondrial [4Fe-4S] proteins. J Biol Chem 286, 41205-41216

58. Lu, J., Bitoun, J. P., Tan, G., Wang, W., Min, W., and Ding, H. (2010) Iron- binding activity of human iron-sulfur cluster assembly protein hIscA1. Biochem J 428, 125-131

59. Ding, B., Smith, E. S., and Ding, H. (2005) Mobilization of the iron centre in IscA for the iron-sulphur cluster assembly in IscU. Biochem J 389, 797-802

17 60. Landry, A. P., Cheng, Z., and Ding, H. (2013) Iron binding activity is essential for the function of IscA in iron-sulphur cluster biogenesis. Dalton Trans 42, 3100- 3106

61. Johnson, D. C., Unciuleac, M. C., and Dean, D. R. (2006) Controlled expression and functional analysis of iron-sulfur cluster biosynthetic components within Azotobacter vinelandii. J Bacteriol 188, 7551-7561

62. Mettert, E. L., Outten, F. W., Wanta, B., and Kiley, P. J. (2008) The impact of O(2) on the Fe-S cluster biogenesis requirements of Escherichia coli FNR. J Mol Biol 384, 798-811

63. Tan, G., Lu, J., Bitoun, J. P., Huang, H., and Ding, H. (2009) IscA/SufA paralogues are required for the [4Fe-4S] cluster assembly in enzymes of multiple physiological pathways in Escherichia coli under aerobic growth conditions. Biochem J 420, 463-472

64. Sheftel, A. D., Wilbrecht, C., Stehling, O., Niggemeyer, B., Elsasser, H. P., Muhlenhoff, U., and Lill, R. (2012) The human mitochondrial ISCA1, ISCA2, and IBA57 proteins are required for [4Fe-4S] protein maturation. Mol Biol Cell 23, 1157-1166

65. Silberg, J. J., Tapley, T. L., Hoff, K. G., and Vickery, L. E. (2004) Regulation of the HscA ATPase reaction cycle by the co-chaperone HscB and the iron-sulfur cluster assembly protein IscU. J Biol Chem 279, 53924-53931

66. Kim, J. H., Frederick, R. O., Reinen, N. M., Troupis, A. T., and Markley, J. L. (2013) [2Fe-2S]-ferredoxin binds directly to cysteine desulfurase and supplies an electron for iron-sulfur cluster assembly but is displaced by the scaffold protein or bacterial frataxin. J Am Chem Soc 135, 8117-8120

67. Yan, R., Konarev, P. V., Iannuzzi, C., Adinolfi, S., Roche, B., Kelly, G., Simon, L., Martin, S. R., Py, B., Barras, F., Svergun, D. I., and Pastore, A. (2013) Ferredoxin competes with bacterial frataxin in binding to the desulfurase IscS. J Biol Chem 288, 24777-24787

68. Chandramouli, K., Unciuleac, M. C., Naik, S., Dean, D. R., Huynh, B. H., and Johnson, M. K. (2007) Formation and properties of [4Fe-4S] clusters on the IscU scaffold protein. Biochemistry-Us 46, 6804-6811

18 69. Kim, J. H., Bothe, J. R., Frederick, R. O., Holder, J. C., and Markley, J. L. (2014) Role of IscX in iron-sulfur cluster biogenesis in Escherichia coli. J Am Chem Soc 136, 7933-7942

70. Pastore, C., Adinolfi, S., Huynen, M. A., Rybin, V., Martin, S., Mayer, M., Bukau, B., and Pastore, A. (2006) YfhJ, a molecular adaptor in iron-sulfur cluster formation or a frataxin-like protein? Structure 14, 857-867

71. Lill, R., Hoffmann, B., Molik, S., Pierik, A. J., Rietzschel, N., Stehling, O., Uzarska, M. A., Webert, H., Wilbrecht, C., and Muhlenhoff, U. (2012) The role of mitochondria in cellular iron-sulfur protein biogenesis and iron metabolism. Biochim Biophys Acta 1823, 1491-1508

72. Netz, D. J. A., Mascarenhas, J., Stehling, O., Pierik, A. J., and Lill, R. (2014) Maturation of cytosolic and nuclear iron-sulfur proteins. Trends Cell Biol 24, 303- 312

73. Wu, Y., and Brosh, R. M., Jr. (2012) DNA helicase and helicase-nuclease enzymes with a conserved iron-sulfur cluster. Nucleic Acids Res 40, 4247-4260

74. Netz, D. J., Stith, C. M., Stumpfig, M., Kopf, G., Vogel, D., Genau, H. M., Stodola, J. L., Lill, R., Burgers, P. M., and Pierik, A. J. (2012) Eukaryotic DNA polymerases require an iron-sulfur cluster for the formation of active complexes. Nat Chem Biol 8, 125-132

75. Kobayashi, K., Fujikawa, M., and Kozawa, T. (2014) Oxidative stress sensing by the iron-sulfur cluster in the transcription factor, SoxR. J Inorg Biochem 133, 87- 91

76. Martelli, A., and Puccio, H. (2014) Dysregulation of cellular iron metabolism in Friedreich ataxia: from primary iron-sulfur cluster deficit to mitochondrial iron accumulation. Front Pharmacol 5, 130

77. Ye, H., Jeong, S. Y., Ghosh, M. C., Kovtunovych, G., Silvestri, L., Ortillo, D., Uchida, N., Tisdale, J., Camaschella, C., and Rouault, T. A. (2010) Glutaredoxin 5 deficiency causes sideroblastic anemia by specifically impairing heme biosynthesis and depleting cytosolic iron in human erythroblasts. J Clin Invest 120, 1749-1761

19 78. Stehling, O., Wilbrecht, C., and Lill, R. (2014) Mitochondrial iron-sulfur protein biogenesis and human disease. Biochimie 100, 61-77

79. Rouault, T. A. (2012) Biogenesis of iron-sulfur clusters in mammalian cells: new insights and relevance to human disease. Dis Model Mech 5, 155-164

80. Isaya, G. (2014) Mitochondrial iron-sulfur cluster dysfunction in neurodegenerative disease. Front Pharmacol 5, 29

81. Exner, N., Lutz, A. K., Haass, C., and Winklhofer, K. F. (2012) Mitochondrial dysfunction in Parkinson's disease: molecular mechanisms and pathophysiological consequences. Embo J 31, 3038-3062

82. Lewis, L. K., Jenkins, M. E., and Mount, D. W. (1992) Isolation of DNA Damage-Inducible Promoters in Escherichia-Coli - Regulation of Polb (Dina), Ding, and Dinh by Lexa Repressor. Journal of Bacteriology 174, 3377-3385

83. Van Dyk, T. K., DeRose, E. J., and Gonye, G. E. (2001) LuxArray, a high- density, genomewide transcription analysis of Escherichia coli using bioluminescent reporter strains. Journal of Bacteriology 183, 5496-5505

84. Fernandez de Henestrosa, A. R., Ogi, T., Aoyagi, S., Chafin, D., Hayes, J. J., Ohmori, H., and Woodgate, R. (2000) Identification of additional genes belonging to the LexA regulon in Escherichia coli. Mol Microbiol 35, 1560-1572

85. Koonin, E. V. (1993) Escherichia-Coli Ding Gene Encodes a Putative DNA Helicase Related to a Group of Eukaryotic Helicases Including Rad3 Protein. Nucleic Acids Research 21, 1497-1497

86. Voloshin, O. N., Vanevski, F., Khil, P. P., and Camerini-Otero, R. D. (2003) Characterization of the DNA damage-inducible helicase DinG from Escherichia coli. J Biol Chem 278, 28284-28293

87. Voloshin, O. N., and Camerini-Otero, R. D. (2007) The DinG protein from Escherichia coli is a structure-specific helicase. J Biol Chem 282, 18437-18447

88. Boubakri, H., de Septenville, A. L., Viguera, E., and Michel, B. (2010) The helicases DinG, Rep and UvrD cooperate to promote replication across transcription units in vivo (vol 29, pg 278, 2010). Embo J 29, 278-278

20 89. Voloshin, O. N., Vanevski, F., Khil, P. P., and Camerini-Otero, R. D. (2003) Characterization of the DNA damage-inducible helicase DinG from Escherichia coli. J Biol Chem 278, 28284-28293

90. Rudolf, J., Makrantoni, V., Ingledew, W. J., Stark, M. J. R., and White, M. F. (2006) The DNA repair helicases XPD and FancJ have essential iron-sulfur domains. Mol Cell 23, 801-808

91. Lehmann, A. R. (2001) The xeroderma pigmentosum group D (XPD) gene: one gene, two functions, three diseases. Gene Dev 15, 15-23

92. Coin, F., Oksenych, V., and Egly, J. M. (2007) Distinct roles for the XPB/p52 and XPD/p44 subcomplexes of TFIIH in damaged DNA opening during nucleotide excision repair. Mol Cell 26, 245-256

93. Gupta, R., Sharma, S., Sommers, J. A., Jin, Z., Cantor, S. B., and Brosh, R. M. (2005) Analysis of the DNA substrate specificity of the human BACH1 helicase associated with breast cancer. J Biol Chem 280, 25450-25460

94. Wu, Y. L., Sommers, J. A., Khan, I., de Winter, J. P., and Brosh, R. M. (2012) Biochemical Characterization of Warsaw Breakage Syndrome Helicase. J Biol Chem 287, 1007-1021

95. Uringa, E. J., Youds, J. L., Lisaingo, K., Lansdorp, P. M., and Boulton, S. J. (2011) RTEL1: an essential helicase for telomere maintenance and the regulation of homologous recombination. Nucleic Acids Research 39, 1647-1655

96. Cantor, S., Drapkin, R., Zhang, F., Lin, Y. F., Han, J. L., Pamidi, S., and Livingston, D. M. (2004) The BRCA1-associated protein BACH1 is a DNA helicase targeted by clinically relevant inactivating mutations (vol 101, pg 2357, 2004). P Natl Acad Sci USA 101, 6834-6834

97. Litman, R., Peng, M., Jin, Z., Zhang, F., Zhang, J. R., Powell, S., Andreassen, P. R., and Cantor, S. B. (2005) BACH1 is critical for homologous recombination and appears to be the Fanconi anemia gene product FANCJ. Cancer Cell 8, 255- 265

98. Pugh, R. A., Honda, M., Leesley, H., Thomas, A., Lin, Y. Y., Nilges, M. J., Cann, I. K. O., and Spies, M. (2008) The iron-containing domain is essential in Rad3 helicases for coupling of ATP hydrolysis to DNA translocation and for targeting

21 the helicase to the single-stranded DNA-double-stranded DNA junction. J Biol Chem 283, 1732-1743

99. Liu, H., Rudolf, J., Johnson, K. A., McMahon, S. A., Oke, M., Carter, L., McRobbie, A. M., Brown, S. E., Naismith, J. H., and White, M. F. (2008) Structure of the DNA repair helicase XPD. Cell 133, 801-812

100. Fan, L., Fuss, J. O., Cheng, Q. J., Arvai, A. S., Hammel, M., Roberts, V. A., Cooper, P. K., and Tainer, J. A. (2008) XPD helicase structures and activities: Insights into the cancer and aging phenotypes from XPD mutations. Cell 133, 789-800

101. Wolski, S. C., Kuper, J., Hanzelmann, P., Truglio, J. J., Croteau, D. L., Van Houten, B., and Kisker, C. (2008) Crystal structure of the FeS cluster-containing nucleotide excision repair helicase XPD. Plos Biology 6, 1332-1342

102. Ren, B., Duan, X., and Ding, H. (2009) Redox control of the DNA damage- inducible protein DinG helicase activity via its iron-sulfur cluster. J Biol Chem 284, 4829-4835

103. White, M. F. (2009) Structure, function and evolution of the XPD family of iron- sulfur-containing 5'-->3' DNA helicases. Biochem Soc Trans 37, 547-551

104. White, M. F., and Dillingham, M. S. (2012) Iron-sulphur clusters in nucleic acid processing enzymes. Curr Opin Struct Biol 22, 94-100

105. Berg, J. M., and Shi, Y. G. (1996) The galvanization of biology: A growing appreciation for the roles of zinc. Science 271, 1081-1085

106. Outten, C. E., and O'Halloran, T. V. (2001) Femtomolar sensitivity of metalloregulatory proteins controlling zinc homeostasis. Science 292, 2488-2492

107. Graham, A. I., Hunt, S., Stokes, S. L., Bramall, N., Bunch, J., Cox, A. G., McLeod, C. W., and Poole, R. K. (2009) Severe Zinc Depletion of Escherichia coli ROLES FOR HIGH AFFINITY ZINC BINDING BY ZinT, ZINC TRANSPORT AND ZINC-INDEPENDENT PROTEINS. J Biol Chem 284, 18377-18389

22 108. Forterre, P., and Gadelle, D. (2009) Phylogenomics of DNA topoisomerases: their origin and putative roles in the emergence of modern organisms. Nucleic Acids Research 37, 679-692

109. Champoux, J. J. (2001) DNA topoisomerases: structure, function, and mechanism. Annu Rev Biochem 70, 369-413

110. Schoeffler, A. J., and Berger, J. M. (2008) DNA topoisomerases: harnessing and constraining energy to govern chromosome topology. Q Rev Biophys 41, 41-101

111. Wang, J. C. (2002) Cellular roles of DNA topoisomerases: a molecular perspective. Nat Rev Mol Cell Biol 3, 430-440

112. Tse-Dinh, Y. C. (2009) Bacterial topoisomerase I as a target for discovery of antibacterial compounds. Nucleic Acids Research 37, 731-737

113. Stupina, V. A., and Wang, J. C. (2005) Viability of Escherichia coli topA mutants lacking DNA topoisomerase I. J Biol Chem 280, 355-360

114. Qi, H. Y., Menzel, R., and Tse-Dinh, Y. C. (1999) Increased thermosensitivity associated with topoisomerase I deletion and promoter mutations in Escherichia coli. Fems Microbiol Lett 178, 141-146

115. Tse-Dinh, Y. C. (2000) Increased sensitivity to oxidative challenges associated with topA deletion in Escherichia coli. Journal of Bacteriology 182, 829-832

116. Tsedinh, Y. C. (1991) Zinc(Ii) Coordination in Escherichia-Coli DNA Topoisomerase-I Is Required for Cleavable Complex-Formation with DNA. J Biol Chem 266, 14317-14320

117. Ahumada, A., and Tse-Dinh, Y. C. (2002) The role of the Zn(II) binding domain in the mechanism of E. coli DNA topoisomerase I. Bmc Biochem 3

118. Cheng, B. K., Zhu, C. X., Ji, C. L., Ahumada, A., and Tse-Dinh, Y. C. (2003) Direct interaction between Escherichia coli RNA polymerase and the zinc ribbon domains of DNA topoisomerase I. J Biol Chem 278, 30705-30710

23 119. Lima, C. D., Wang, J. C., and Mondragon, A. (1994) Three-dimensional structure of the 67K N-terminal fragment of E. coli DNA topoisomerase I. Nature 367, 138-146

120. Baker, N. M., Rajan, R., and Mondragon, A. (2009) Structural studies of type I topoisomerases. Nucleic Acids Res 37, 693-701

121. Lu, J., Wang, W., Tan, G., Landry, A. P., Yi, P., Si, F., Ren, Y., and Ding, H. (2011) Escherichia coli topoisomerase I is an iron and zinc binding protein. Biometals 24, 729-736

122. Suski, C., and Marians, K. J. (2008) Resolution of converging replication forks by RecQ and topoisomerase III. Mol Cell 30, 779-789

123. Perez-Cheeks, B. A., Lee, C., Hayama, R., and Marians, K. J. (2012) A role for topoisomerase III in Escherichia coli chromosome segregation. Mol Microbiol 86, 1007-1022

124. Budke, B., and Kuzminov, A. (2010) Production of clastogenic DNA precursors by the nucleotide metabolism in Escherichia coli. Mol Microbiol 75, 230-245

24 CHAPTER 2. STIMULATION OF ESCHERICHIA COLI DNA DAMAGE INDUCIBLE DNA HELICASE DING BY THE SINGLE-STRANDED DNA BINDING PROTEIN SSB

2.1 Introduction

Escherichia coli gene dinG (DNA damage inducible gene G) is a member of the regulon induced by DNA damaging agents (1). Purified E. coli DinG has an ATP- dependent helicase activity that unwinds double-stranded DNA (2), DNA-RNA duplex,

D-loops, and R-loops (3). Although the physiological function of DinG has not been fully understood, recent studies suggested that DinG may act to remove R-loops or together with other DNA helicases Rep and UvrD to promote replication across highly transcribed regions in E. coli genome (4). Structurally, E. coli DinG belongs to superfamily II DNA helicases with 5’ to 3’ direction (2), and is closely related to yeast

DNA helicase Rad3 (5) and human DNA helicases XPD (Xeroderma pigmentosum factor

D) (6,7), FANCJ/BACH1 (BRCA1-associated C-terminal helicase) (8), CHLR1 (a DNA helicase involving in sister chromatid cohesion) (9), and RTEL1 (a regulator of telomere length) (10). Furthermore, like yeast Rad3 (5) and human XPD (11-14), E. coli DinG contains a [4Fe-4S] cluster that is essential for the DNA helicase activity (15). While the redox property and physiological role of the iron-sulfur cluster in XPD/Rad3 still remain elusive (16,17), we previously reported that the [4Fe-4S] cluster in E. coli DinG is stable and the DNA helicase activity remains fully active after the protein is exposed to 100- fold excess of hydrogen peroxide (15). On the other hand, reduction of the [4Fe-4S] cluster in DinG reversibly switches off the DNA helicase activity, suggesting that the

This chapter previously appeared as Zishuo Cheng, Aimee Caillet, Binbin Ren, Huangen Ding, Stimulation of Escherichia coli DNA damage inducible DNA helicase DinG by the single-stranded DNA binding protein SSB, 10/01/2012. It is reprinted by permission of Elsevier.

25 helicase activity could be regulated by intracellular redox potentials via the [4Fe-4S] cluster (15).

Exposure to DNA damaging agents would dramatically increase the number of single-stranded DNA (ssDNA) ends. In response, cells utilize the specialized ssDNA binding proteins (SSB) to protect ssDNA ends from further damage or re-annealing (18-

20). Importantly, recent studies further showed that SSB not only binds ssDNA but also interacts with a diverse group of DNA processing enzymes (see review (21)). Since both

SSB and DinG are highly induced when E. coli cells are subject to DNA damaging agents

(18), it would be of interest to explore the possible regulation of the DinG DNA helicase activity by SSB. In this study, we report that E. coli SSB is able to form a stable protein complex with DinG and to stimulate the DinG DNA helicase activity. A possible mechanism underlying the SSB-mediated stimulation of the DinG DNA helicase activity will be discussed.

2.2 Materials and Methods

Protein preparation

A DNA fragment encoding the single-stranded DNA binding protein (SSB) was

PCR-amplified from E. coli genomic DNA using two primers, SSB-1, 5’-

GGAGACACGCATATGGCCAGCAGAG-3’, and SSB-2, 5’-

ATTGTGCTAAGCACAAATCAGAACG-3’. The PCR product was digested with NdeI and BlpI, and ligated into an expression vector pET28b+. The cloned DNA fragment was confirmed by DNA sequencing and introduced into an E. coli strain BL21. Recombinant

SSB was overproduced in the E. coli cells grown in LB media under aerobic conditions.

26 Cell extracts were treated with DNase (10 units/mL) to remove DNA before protein was purified as previously described in (15). The N-terminal his-tag in SSB was removed by digestion with thrombin overnight and protein was re-purified using Mono-Q column.

Purified SSB contains three extra amino acid residues (Gly-Ser-His) in N-terminus and an intact C-terminus which is responsible for specific interaction with multiple DNA processing proteins (21). SSB mutant F177C (Phe-177 to Cys) was constructed using the

Quikchange mutagenesis kit (Stratagene), and confirmed by DNA sequencing. SSB mutant protein was purified as described for wild-type SSB. Purified wild-type SSB and

SSB mutant F177C showed the same ssDNA binding activity, as reported previously by others (22). Recombinant E. coli DNA helicase DinG was purified as described in (15).

The purity of purified proteins was analyzed using SDS-polyacrylamide electrophoresis.

The protein concentration of purified SSB and DinG was estimated from the absorption peak at 280 nm using an extinction coefficient of 27.9 and 78.7 mM-1cm-1, respectively.

The bacteriophage single-stranded DNA binding protein gp32 (19) was purchased from

New England BioLab.

Protein-protein interaction analyses

A gel filtration column (SuperdexTM 200 (10/300GL)) attached to the ÄKTA

FPLC system (GE Healthcare Life Sciences) was used for the protein complex analyses.

The column was calibrated using the standard gel filtration protein markers (Sigma). For each run, protein sample (500 mL) was loaded onto the column and eluted with buffer containing NaCl (500 mM) and Tris (20 mM, pH 8.0) at a flow rate of 0.5 mL/min inside a 4oC refrigerator. Eluted fractions (0.5 mL) were collected and aliquots were subject to the SDS polyacrylamide electrophoresis.

27 The protein-protein interactions were also analyzed using the protein co- precipitation approaches following the procedure described in (23). Unlike most proteins, E. coli SSB precipitates at 150 g/liter ammonium sulfate. If a protein forms a complex with SSB, the protein will co-precipitate with SSB in the presence of 150 g/liter ammonium sulfate in solution (23).

DNA helicase activity assay

The DNA helicase activity of E. coli DinG was analyzed following the procedure described by Voloshin et al. (2) with slight modifications (15). Briefly, an oligonucleotide

(5'CCGTAACACTGAGTTTCGTCACCAGTACAAACTACAACGCCTGTAGCATTC

CACA-3') was labeled with 32P-g-ATP using polynucleotide kinase (New England

BioLab). The 32P-labeled oligonucleotide (0.2 mM) was annealed to M13mp18 ssDNA

(0.1 mg/mL) (Fisher Scientific) in annealing buffer containing Tris (50 mM, pH 7.5),

o NaCl (50 mM) and MgCl2 (10 mM). The DNA solution was heated at 85 C for 5 min and cooled to room temperature over 3 hours. The annealed DNA duplex was purified using a gel filtration spin-column Chromaspin 400 (Clontech co.) pre-equilibrated with annealing buffer. The annealed substrate (at a final concentration of 2 nM) was incubated with indicated concentrations of DinG protein in 20 mL the reaction solution containing Tris (50 mM, pH 7.5), NaCl (100 mM), MgCl2 (5 mM), dithiothreitol (2 mM), glycerol (5%), and ATP (2 mM) at 30oC for 10 min. For each experiment, two controls in which the substrate was either denatured by heating at 85 °C for 5 min or incubated at

30oC for 10 min without any enzymes were included. The reactions were terminated by adding 4 ml stop solution (containing 6% SDS, 60 mM EDTA and 0.3% Bromophenol

28 Blue). The reaction products were separated on 1% TAE agarose gel, transferred to nitrocellulose membranes, and exposed to x-ray films overnight for quantification of the reaction products.

2.3 Results and Discussion

E. coli DinG forms a stable protein complex with single-stranded DNA binding protein SSB

To explore the possible interaction between the DNA-damage inducible proteins

DinG and SSB (18), we purified both proteins from E. coli cells as described in Materials and Methods. The SDS PAGE gel analysis showed that both proteins were purified to a single-band (Figure 2.1A). While purified DinG had an absorption peak at 403 nm of the

[4Fe-4S] cluster (15), purified SSB only had the 280 nm protein absorption peak (Figure

2.1B).

Figure 2.1 Purification of E. coli DinG and SSB A), SDS-PAGE gel of purified E. coli DinG and SSB. Lane M, molecular weight markers; lane 1, purified SSB; lane 2, purified DinG. B), UV-vis absorption spectrum of purified E. coli SSB (spectrum 1) and DinG (spectrum 2). The proteins were dissolved in buffer containing NaCl (500 mM) and Tris (20 mM, pH 8.0). The contraction of SSB and DinG shown in B0 was 22 and 10 µM, respectively.

29 Figure 2.2A shows the gel filtration profiles of purified SSB and DinG. While purified E. coli SSB formed a tetramer with an apparent molecular weight of ~134 kDa, as reported previously (19,24), purified E. coli DinG existed as a monomer with an apparent molecular weight of ~78 kDa. However, when a mix of DinG and SSB was loaded onto the gel filtration column, a new elution peak with an apparent molecular weight of ~200 kDa appeared. The SDS-PAGE analyses of eluted fractions showed that the new elution peak contained both DinG and SSB (Figure 2.2A, bottom panel).

Figure 2.2 Gel filtration analyses of the SSB/DinG protein complex A), gel filtration profiles of SSB, DinG and a mix of SSB and DinG. Top panel, gel filtration profiles of SSB (80 µM) (trace 1), DinG (20 µM) (trace 2), and a mix of SSB (80 µM) and DinG (20 µM) (trace 3). The proteins were dissolved in buffer containing NaCl (500 mM) and Tris (20 mM, pH 8.0) and eluted from the gel filtration column using the same buffer. The molecular weights of the standard gel filtration protein markers were labeled on x-axis. Bottom panel, SDS gel photos of the fractions (26 to 35) eluted from the gel filtration column. The protein bands were indicated on the left side. B), gel filtration profiles of SSB mutant F177C, DinG and a mix of SSB mutant F177C and DinG. Top panel, gel filtration profiles of SSB mutant F177C (SSB-M) (80 µM) (trace 1), DinG (20 µM) (trace 2), and a mix of SSB-M (80 µM) and DinG (20 µM) (trace 3). The molecular weights of the standard gel filtration protein markers were labeled on X- axis. Bottom panel, SDS gel photos of the fractions (26 to 35) eluted from the gel filtration column. The protein bands were indicated on the left side. Data are representative of three independent experiments.

30 Because SSB and DinG are both the DNA binding proteins, any DNA contamination could contribute to formation of SSB/DinG complex. Using DNA indicator ethidium bromide, we were unable to detect any DNA in the protein samples.

We also treated the protein samples with DNase before the gel filtration analyses, and found that the elution profiles were essentially identical when the protein samples were treated with or without DNase, further suggesting that formation of SSB/DinG complex does not depend on DNA.

E. coli SSB contains an N-terminal oligonucleotide/oligosaccharide binding domain serving as the ssDNA binding site and the C-terminal highly conserved end (Asp-

Asp-Asp-Ile-Pro-Phe) involving in the protein-protein interaction with multiple DNA processing enzymes (21). To examine whether the C-terminal end of SSB is involved in the protein-protein interaction with DinG, we constructed an E. coli SSB mutant in which the C-terminal end residue Phe-177 was replaced with Cys (F177C). Consistent with the previous report (22), we found that purified SSB mutant F177C formed a tetramer

(Figure 2.2B) and retained the same DNA binding activity as wild-type SSB (data not shown). However, when a mix of SSB mutant F177C and DinG was loaded onto the gel filtration column, a broad elution profile corresponding to the combination of the peaks of SSB mutant F177C and DinG was observed (Figure 2.2B). The SDS-PAGE analyses of the eluted fractions confirmed that, unlike wild-type SSB, SSB mutant F177C failed to form a stable protein complex with DinG (Figure 2.2B, bottom panel).

To further explore the protein-protein interaction between SSB and DinG, we adapted protein co-precipitation approaches following the procedures described in (23).

Unlike other proteins, SSB precipitates at a low concentration of ammonium sulfate in

31 solution. Any protein that forms a stable protein complex with SSB would co-precipitate with SSB (23). As shown in Figure 2.3A, wild-type SSB co-precipitated a significant amount of DinG in the presence of 150 g/liter ammonium sulfate. In contrast, SSB mutant F177C failed to co-precipitate any DinG under the same experimental conditions

(Figure 2.3B). Thus, wild-type SSB, but not SSB mutant Y177C, is able to form a stable protein complex with DinG via specific protein-protein interaction.

Figure 2.3 Protein co-precipitation analyses of SSB and DinG E. coli DinG (20 µM), SSB (panel A) or SSB mutant F177C (pane B) (80 µM) in buffer containing Tris (10 mM, pH 7.2) NaCl (150 mM), and glycerol (10% (v/v)) was incubated with ammonium sulfate (150 g/liter) in various solutions as indicated by + symbols. After incubation, samples were centrifuged. Pellet (P) and supernatant (S) fractions were loaded on the SDS polyacrylamide gel. The results are representative of three independent experiments.

32 E. coli SSB enhances the DinG DNA helicase activity

Formation of SSB/DinG complex led to an idea that SSB may modulate the DinG

DNA helicase activity via protein-protein interaction. Using the previously established

DNA helicase activity assay (2), we explored the effect of SSB on the DinG DNA helicase activity. Figure 2.4A shows that addition of SSB indeed stimulated the DinG

DNA helicase activity by at least two folds. We also analyzed the DinG DNA helicase activity in the presence of a fixed concentration of DinG and increasing concentrations of

SSB, and found that as the SSB concentration was gradually increased, the DinG DNA helicase activity was progressively increased (Figure 2.4B). A 5-10 fold excess of SSB required for stimulating the DinG DNA helicase activity (Figure 2.4B) could be due to the substrate ssDNA M13 plasmid which may titrate out SSB in the reaction solution.

Nevertheless, the results clearly suggest that E. coli SSB is able to stimulate the DinG

DNA helicase activity under the experimental conditions.

Figure 2.4 E. coli SSB stimulates the DinG DNA helicase activity A), purified DinG was incubated with the 32P-radioactive-labeled substrate and ATP with or without SSB at 30°C for 15 min. Lane H, the sample was heated at 85°C for 5 min. Lane 1, no DinG. Lanes 2 to 4, with 25, 50 and 100 nM DinG. Lanes 5 to 7, with 1 µM SSB and 25, 50 and 100 nM DinG). Lane 8, no DinG and 1 µM SSB only. B), purified DinG was incubated with the 32P-radioactive-labeled substrate (2 nM), ATP (2 mM) and SSB at 30°C for 15 min. Lane H, the sample was heated at 85°C for 5 min. Lane 1, no DinG or SSB. Lanes 2 to 6, with 50 nM DinG and 0,50, 100, 250, 500 nM SSB, respectively. Similar results were obtained from three independent experiments.

33 SSB mutant F177C is a potent inhibitor for the DinG DNA helicase

As a single-stranded DNA binding protein, SSB may regulate the DinG DNA helicase activity by binding to ssDNA, a substrate/product of the DNA helicase. If a protein that binds ssDNA could stimulate the DinG DNA helicase activity, we expect that

SSB mutant F177C which retains the same ssDNA binding activity as wild-type SSB should also stimulate the DinG DNA helicase activity.

To our surprise, unlike wild-type SSB, SSB mutant F177C not only failed to enhance the DinG DNA helicase activity but inhibited the DinG DNA helicase activity

(Figure 2.5A). To further explore whether other ssDNA binding proteins could inhibit the DinG DNA helicase activity, we used bacteriophage protein gp32, a structurally unrelated ssDNA binding protein (19) and found that gp32 had an even stronger inhibitory effect on the DinG DNA helicase activity (Figure 2.5B). Thus, the specific protein-protein interaction between wild-type SSB and DinG is likely responsible for stimulation of the DinG DNA helicase activity by SSB. On the other hand, the ssDNA binding activity of SSB appears to inhibit the DinG DNA helicase activity.

The observation that wild-type SSB and SSB mutant F177C have an opposite effect on the DinG DNA helicase activity demonstrates the crucial role of the C-terminal end F-177 in SSB. It has been reported that mutation of F177C in SSB severely impairs the E. coli cell’s viability (22), and F177 may directly interact with multiple DNA processing enzymes (21). Here we show that SSB mutant F177C, which retains the ssDNA binding activity as wild-type SSB (22), fails to form a stable SSB/DinG/ complex. We envision that formation of SSB/DinG complex may subtly alter the structure of both proteins: for DinG, binding of SSB may lead to an enhanced DNA

34 helicase activity; for SSB, binding of DinG may weaken the ssDNA binding activity. As a consequence, specific protein-protein interaction between SSB and DinG stimulates the

DinG DNA helicase activity. In contrast, SSB mutant F177C does not form a stable protein complex with DinG, thus fails to stimulate the DinG DNA helicase activity.

Instead, the ssDNA binding activity of SSB mutant F177C effectively blocks the access of DinG to substrate ssDNA and inhibits the DinG DNA helicase activity. In line with this idea, we found that while wild-type SSB can enhance the endogenous ATPase activity of DinG, SSB mutant F177C effectively inhibits the ATPase activity of DinG

(unpublished data). Nevertheless, additional experiments are required to illustrate molecular details of the SSB-mediated activation of the DinG DNA helicase activity.

Figure 2.5 SSB mutant F177C inhibits the DinG DNA helicase activity A), purified DinG was incubated with the 32P-radioactive-labeled substrate (2 nM) and ATP (2 mM) with or without SSB mutant F177C at 30°C for 15 min. Lane H, the sample was heated at 85°C for 5 min. Lane 1, no DinG. Lanes 2 to 4, with 50, 100 and 200 nM DinG. Lanes 5 to 8, with 1 µM SSB mutant F177C and 0, 50, 100, and 200 nM DinG. B), purified DinG was incubated with the 32P-radioactive-labeled substrate (2 nM) and ATP (2 mM) with or without bacteriophage protein gp32 at 30°C for 15 min. Lane H, the sample was heated at 85°C for 5 min. Lane 1, no DinG. Lanes 2 to 4, with 50, 100 and 200 nM DinG. Lanes 5 to 8, with 500 nM gp32 and 0, 50, 100, and 200 nM DinG. Data are representative of three independent experiments.

The known proteins that interact with E. coli SSB include the primase for DNA replication DnaG (25), exonuclease I (26), the DNA helicase RecQ (23,24), uracil DNA glycosylase (27), the c subunit of DNA polymerase III (28), DNA polymerase V (29),

35 topoisomerase III (30), the replication re-start protein DNA helicase PriA (31), DNA helicase RecG (32), recombination mediator RecO (33,34), and the maintenance of genome stability protein A (35). In a number of of the SSB-binding proteins, a hydrophobic pocket and basic residues have been identified for accommodation of the C- terminal end Phe-177 and Asp residues of SSB (21,24,33,36). In Gram-positive Bacillus subtilis, SSB has also been shown to recruit DNA helicases PriA and RecG and recombination mediator RecO, and to re-start the arrested chromosomal replication forks

(37). In archaea, the single-stranded DNA binding protein RPA (Replication Protein A) has been shown to interact with DNA helicase XPD (38,39) and RNA polymerase (40).

In eukaryotes, RPA interacts with DNA polymerase a (41) and DNA helicase

FANCJ/BACH1 (42,43), and is likely responsible for coordinating repair of double- stranded DNA breaks (44). In this context, we propose that E. coli DinG is a new member of the DNA processing protein family that can be regulated by SSB. When cells are subject to DNA damaging agents, DinG together with other DNA repair proteins including SSB are highly induced (1,18), and SSB in turn stimulates the activity of the

DinG DNA helicase and other DNA repair enzymes to promote efficient repair of DNA damage.

4.4 References

1. Lewis, L. K., Jenkins, M. E., and Mount, D. W. (1992) Isolation of DNA damage- inducible promoters in Escherichia coli: regulation of polB (dinA), dinG, and dinH by LexA repressor. J Bacteriol 174, 3377-3385

2. Voloshin, O. N., Vanevski, F., Khil, P. P., and Camerini-Otero, R. D. (2003) Characterization of the DNA damage-inducible helicase DinG from Escherichia coli. J Biol Chem 278, 28284-28293

36 3. Voloshin, O. N., and Camerini-Otero, R. D. (2007) The DinG protein from Escherichia coli is a structure-specific helicase. J Biol Chem 282, 18437-18447

4. Boubakri, H., de Septenville, A. L., Viguera, E., and Michel, B. (2010) The helicases DinG, Rep and UvrD cooperate to promote replication across transcription units in vivo. EMBO J 29, 145-157

5. Rudolf, J., Makrantoni, V., Ingledew, W. J., Stark, M. J. R., and White, M. F. (2006) The DNA Repair Helicases XPD and FancJ Have Essential Iron-Sulfur Domains. Molecular Cell 23, 801-808

6. Lehmann, A. R. (2001) The xeroderma pigmentosum group D (XPD) gene: one gene, two functions, three diseases. Genes Dev 15, 15-23

7. Coin, F., Oksenych, V., and Egly, J. M. (2007) Distinct roles for the XPB/p52 and XPD/p44 subcomplexes of TFIIH in damaged DNA opening during nucleotide excision repair. Mol Cell 26, 245-256

8. Gupta, R., Sharma, S., Sommers, J. A., Jin, Z., Cantor, S. B., and Brosh, R. M., Jr. (2005) Analysis of the DNA substrate specificity of the human BACH1 helicase associated with breast cancer. J Biol Chem 280, 25450-25460

9. Wu, Y., Sommers, J. A., Khan, I., de Winter, J. P., and Brosh, R. M., Jr. (2012) Biochemical characterization of Warsaw breakage syndrome helicase. J Biol Chem 287, 1007-1021

10. Uringa, E. J., Youds, J. L., Lisaingo, K., Lansdorp, P. M., and Boulton, S. J. (2011) RTEL1: an essential helicase for telomere maintenance and the regulation of homologous recombination. Nucleic Acids Res 39, 1647-1655

11. Pugh, R. A., Honda, M., Leesley, H., Thomas, A., Lin, Y., Nilges, M. J., Cann, I. K., and Spies, M. (2008) The iron-containing domain is essential in Rad3 helicases for coupling of ATP hydrolysis to DNA translocation and for targeting the helicase to the single-stranded DNA-double-stranded DNA junction. J Biol Chem 283, 1732-1743

12. Liu, H., Rudolf, J., Johnson, K. A., McMahon, S. A., Oke, M., Carter, L., McRobbie, A. M., Brown, S. E., Naismith, J. H., and White, M. F. (2008) Structure of the DNA repair helicase XPD. Cell 133, 801-812

37 13. Fan, L., Fuss, J. O., Cheng, Q. J., Arvai, A. S., Hammel, M., Roberts, V. A., Cooper, P. K., and Tainer, J. A. (2008) XPD helicase structures and activities: insights into the cancer and aging phenotypes from XPD mutations. Cell 133, 789-800

14. Wolski, S. C., Kuper, J., Hanzelmann, P., Truglio, J. J., Croteau, D. L., Van Houten, B., and Kisker, C. (2008) Crystal structure of the FeS cluster-containing nucleotide excision repair helicase XPD. PLoS Biol 6, e149

15. Ren, B., Duan, X., and Ding, H. (2009) Redox control of the DNA damage- inducible protein DinG helicase activity via its iron-sulfur cluster. J Biol Chem 284, 4829-4835

16. White, M. F. (2009) Structure, function and evolution of the XPD family of iron- sulfur-containing 5'-->3' DNA helicases. Biochem Soc Trans 37, 547-551

17. White, M. F., and Dillingham, M. S. (2012) Iron–sulphur clusters in nucleic acid processing enzymes. Current Opinion in Structural Biology 22, 94-100

18. Fernandez De Henestrosa, A. R., Ogi, T., Aoyagi, S., Chafin, D., Hayes, J. J., Ohmori, H., and Woodgate, R. (2000) Identification of additional genes belonging to the LexA regulon in Escherichia coli. Mol Microbiol 35, 1560-1572

19. Chase, J. W., and Williams, K. R. (1986) Single-stranded DNA binding proteins required for DNA replication. Annu Rev Biochem 55, 103-136

20. Lohman, T. M., and Ferrari, M. E. (1994) Escherichia coli single-stranded DNA- binding protein: multiple DNA-binding modes and cooperativities. Annu Rev Biochem 63, 527-570

21. Shereda, R. D., Kozlov, A. G., Lohman, T. M., Cox, M. M., and Keck, J. L. (2008) SSB as an organizer/mobilizer of genome maintenance complexes. Crit Rev Biochem Mol Biol 43, 289-318

22. Genschel, J., Curth, U., and Urbanke, C. (2000) Interaction of E-coli single- stranded DNA binding protein (SSB) with exonuclease I. The carboxy-terminus of SSB is the recognition site for the nuclease. Biol. Chem. 381, 183-192

38 23. Shereda, R. D., Bernstein, D. A., and Keck, J. L. (2007) A Central Role for SSB in Escherichia coli RecQ DNA Helicase Function. Journal of Biological Chemistry 282, 19247-19258

24. Shereda, R. D., Reiter, N. J., Butcher, S. E., and Keck, J. L. (2009) Identification of the SSB binding site on E. coli RecQ reveals a conserved surface for binding SSB's C terminus. J Mol Biol 386, 612-625

25. Yuzhakov, A., Kelman, Z., and O'Donnell, M. (1999) Trading places on DNA--a three-point switch underlies primer handoff from primase to the replicative DNA polymerase. Cell 96, 153-163

26. Lu, D., Myers, A. R., George, N. P., and Keck, J. L. (2011) Mechanism of Exonuclease I stimulation by the single-stranded DNA-binding protein. Nucleic Acids Research 39, 6536-6545

27. Handa, P., Acharya, N., and Varshney, U. (2001) Chimeras between single- stranded DNA-binding proteins from Escherichia coli and Mycobacterium tuberculosis reveal that their C-terminal domains interact with uracil DNA glycosylases. J Biol Chem 276, 16992-16997

28. Witte, G., Urbanke, C., and Curth, U. (2003) DNA polymerase III chi subunit ties single-stranded DNA binding protein to the bacterial replication machinery. Nucleic Acids Res 31, 4434-4440

29. Arad, G., Hendel, A., Urbanke, C., Curth, U., and Livneh, Z. (2008) Single- stranded DNA-binding protein recruits DNA polymerase V to primer termini on RecA-coated DNA. J Biol Chem 283, 8274-8282

30. Suski, C., and Marians, K. J. (2008) Resolution of converging replication forks by RecQ and topoisomerase III. Mol Cell 30, 779-789

31. Cadman, C. J., and McGlynn, P. (2004) PriA helicase and SSB interact physically and functionally. Nucleic Acids Res 32, 6378-6387

32. Buss, J. A., Kimura, Y., and Bianco, P. R. (2008) RecG interacts directly with SSB: implications for stalled replication fork regression. Nucleic Acids Res 36, 7029-7042

39 33. Ryzhikov, M., Koroleva, O., Postnov, D., Tran, A., and Korolev, S. (2011) Mechanism of RecO recruitment to DNA by single-stranded DNA binding protein. Nucleic Acids Research 39, 6305-6314

34. Inoue, J., Nagae, T., Mishima, M., Ito, Y., Shibata, T., and Mikawa, T. (2011) A Mechanism for Single-stranded DNA-binding Protein (SSB) Displacement from Single-stranded DNA upon SSB-RecO Interaction. Journal of Biological Chemistry 286, 6720-6732

35. Page, A. N., George, N. P., Marceau, A. H., Cox, M. M., and Keck, J. L. (2011) Structure and Biochemical Activities of Escherichia coli MgsA. Journal of Biological Chemistry 286, 12075-12085

36. Lu, D., and Keck, J. L. (2008) Structural basis of Escherichia coli single-stranded DNA-binding protein stimulation of exonuclease I. Proc Natl Acad Sci U S A 105, 9169-9174

37. Lecointe, F., Serena, C., Velten, M., Costes, A., McGovern, S., Meile, J. C., Errington, J., Ehrlich, S. D., Noirot, P., and Polard, P. (2007) Anticipating chromosomal replication fork arrest: SSB targets repair DNA helicases to active forks. EMBO J 26, 4239-4251

38. Pugh, R. A., Lin, Y., Eller, C., Leesley, H., Cann, I. K., and Spies, M. (2008) Ferroplasma acidarmanus RPA2 facilitates efficient unwinding of forked DNA substrates by monomers of FacXPD helicase. J Mol Biol 383, 982-998

39. Honda, M., Park, J., Pugh, R. A., Ha, T., and Spies, M. (2009) Single-Molecule Analysis Reveals Differential Effect of ssDNA-Binding Proteins on DNA Translocation by XPD Helicase. Molecular Cell 35, 694-703

40. Richard, D. J., Bell, S. D., and White, M. F. (2004) Physical and functional interaction of the archaeal single‐stranded DNA‐binding protein SSB with RNA polymerase. Nucleic Acids Research 32, 1065-1074

41. Braun, K. A., Lao, Y., He, Z., Ingles, C. J., and Wold, M. S. (1997) Role of protein-protein interactions in the function of replication protein A (RPA): RPA modulates the activity of DNA polymerase alpha by multiple mechanisms. Biochemistry 36, 8443-8454

40 42. Suhasini, A. N., Sommers, J. A., Mason, A. C., Voloshin, O. N., Camerini-Otero, R. D., Wold, M. S., and Brosh, R. M., Jr. (2009) FANCJ helicase uniquely senses oxidative base damage in either strand of duplex DNA and is stimulated by replication protein A to unwind the damaged DNA substrate in a strand-specific manner. J Biol Chem 284, 18458-18470

43. Wu, Y., Shin-ya, K., and Brosh, R. M., Jr. (2008) FANCJ helicase defective in Fanconia anemia and breast cancer unwinds G-quadruplex DNA to defend genomic stability. Mol Cell Biol 28, 4116-4128

44. Yan, H., Toczylowski, T., McCane, J., Chen, C., and Liao, S. (2011) Replication protein A promotes 5′→3′ end processing during homology-dependent DNA double-strand break repair. The Journal of Cell Biology 192, 251-261

41 CHAPTER 3. IRON AND ZINC BINDING ACTIVITY OF ESCHERICHIA COLI TOPOISOMERASE I HOMOLOG YRDD

3.1 Introduction

Escherichia coli topoisomerase I belongs to type I subfamily DNA topoisomerases (1,2). The enzyme contains an N-terminal catalytic fragment (67 kDa) and a C-terminal zinc-binding region (30 kDa). While the N-terminal fragment is sufficient for cleaving single-stranded DNA, the C-terminal region is required for relaxing the negatively supercoiled DNA (3,4) and for interacting with RNA polymerase

(5). It has also been reported that the enzyme activity of topoisomerase I is regulated by the C-terminal and N-terminal domain interactions and by divalent metal ions such as

Mg2+ and Mn2+ (6). Genome-wide search revealed that E. coli has two topoisomerase I homologs: topoisomerase III and a function-unknown protein YrdD. Topoisomerase III is homologous to the N-terminal domain of topoisomerase I and has a crucial role in genomic stability (7) and chromosome segregation (8). On the other hand, YrdD is homologous to the C-terminal zinc-binding region of topoisomerase I. YrdD is highly conserved among proteobacteria and enterobacteria. Although the function of YrdD is unknown, recent genetic studies indicated that YrdD may have an important role in DNA repair as inactivation of YrdD suppresses the severe growth inhibition phenotype of an E. coli mutant with deletions of the key DNA recombination repair protein RecA and the bacterial dNTPase RdgB which removes non-canonical DNA precursors such as dIPT in cells (9).

This chapter previously appeared as Zishuo Cheng, Guoqiang Tan, Wu Wang, Xiaolu Su, Aaron P. Landry, Jianxin Lu, Huangen Ding, Iron and zinc binding activity of Escherichia coli topoisomerase I homolog YrdD, 01/29/2014. It is reprinted by permission of Springer.

42 In previous studies, we reported that topoisomerase I is able to bind both iron and zinc in the C-terminal region in E. coli cells, and that unlike the zinc-bound topoisomerase I, the iron-bound enzyme fails to relax the negatively supercoiled DNA

(10). In the present study, we find that YrdD, the homolog of the topoisomerase I C- terminal region, can also bind both iron and zinc in vivo. Furthermore, the zinc-bound

YrdD has a strong binding affinity for single stranded (ss) DNA and protects ssDNA from the DNase I digestion in vitro. In contrast, the iron-bound YrdD has very little or no binding activity for ssDNA. The results suggest that the zinc-bound YrdD may contribute to the DNA repair activity by interacting with ssDNA and that the ssDNA binding activity of YrdD may be regulated by the iron and zinc binding in the metal binding sites in the protein.

3.2 Materials And Methods

Protein purification

The DNA fragment encoding YrdD was amplified from the wild-type E. coli genomic DNA with PCR using two primers: YrdD-1 (5’-

CATGCCATGGCGAAATCAGCACTGTTCAC-3’) and YrdD-2 (5′-

CCCAAGCTTTTCCGCCGAAACCGGCTTTC-3′). The PCR product was digested with restriction enzymes NdeI and HindIII, and ligated to an expression vector pET28b+

(Novagen co). The cloned DNA fragment was confirmed by direct sequencing (Genomic

Facility, LSU). Recombinant YrdD was expressed in E. coli BL21 strain in either LB

(Luria-Bertani) medium or M9 minimal medium supplemented with glucose (0.2%), thiamin (5 mg/ml) and 20 amino acids (each at 10 mg /ml). E. coli YrdD, IscU (11),

43 topoisomerase I (10) and the single-stranded DNA binding protein SSB (12) were purified following the procedure described previously. The molecular weight of purified

YrdD was confirmed by mass spectrometer. The purity of purified protein was over 95% judging from the SDS/PAGE. The protein concentration of YrdD was measured at 280 nm using an extinction coefficient of 9.6 cm-1mM-1.

Metal content analyses

Total iron content in protein samples was determined using an iron indicator

FerroZine following the procedures described in (13). Total zinc content in protein samples was determined using a zinc indicator PAR (4-(2-pyridylazo)-resorcinol) following the procedures in (14). The zinc and iron contents in purified proteins were also measured by the Inductively Coupled Plasma-Emission Spectrometry (ICP-ES)

(Chemical Analysis Laboratory, University of Georgia). Both metal content analyses produced similar results.

The DNA binding activity assay

The DNA binding activity assay was carried out using a fluorescence labeled

40mer (5’-F*-AATTGCGATCTAGCTCGCCAGUAGCGACCTT ATCTGATGA-3’)

(Operon co.). For the single-stranded (ss) DNA binding assay, the fluorescence-labeled

40mer was incubated with protein in buffer containing Tris (20 mM, pH 8.0), NaCl (50 mM), β-mercaptoethanol (1mM), MgCl2 (1mM), and bovine serum albumin (BSA) (0.5 mg/mL). For the double-strand (ds) DNA binding assay, the fluorescence labeled 40mer was annealed to a complementary ssDNA in an annealing buffer containing Tris (50 mM, pH 8.0), NaCl (50 mM), and MgCl2 (10 mM). Prepared dsDNA was incubated with protein in buffer at room temperature for 15 min, and the samples were loaded on to a

44 0.6% agarose gel in TEA (40 mM Tris acetate and 1 mM EDTA, pH 8.0) buffer. The agarose gel was run at 10 V per cm for 30 min at room temperature and photographed in a KODAK Gel Logic 200 Imaging System. The intensity of the DNA bands on agarose gels was quantified using the ImageJ software (NIH).

The DNA protection activity assay

The ssDNA protection activity assays were carried out by incubating ssDNA

(70mer) (5’-

GAATGAAGGTATGCTGCATTAATCATTTCTTTAATTCAGCATAAGTTGTTGTG

TAGGCTGGAGCTGCTTC-3’) (Operon co.) (1M) with indicated concentrations of proteins in reaction solutions containing Tris (20mM, pH 8.0), NaCl (50 mM), β- mercaptoethanol (1 mM), MgCl2 (1 mM), CaCl2 (1.5 mM), and BSA (0.5 mg/mL) at room temperature for 15 minutes. DNase I (Sigma co) was then added to the incubation solutions. Reactions were incubated at 37oC for additional 10 minutes, and terminated by adding 4 mL stop solution (containing SDS (6%), EDTA (60 mM) and Bromophenol

Blue (0.3%)). The products were analyzed by loading the samples on a 0.6% agarose gel in TEA buffer (40 mM Tris acetate and 1 mM EDTA, pH 8.0). The agarose gels were stained with 0.5µg/ml Ethidium Bromide for 30 min and photographed in a KODAK Gel

Logic 200 Imaging System. The amount of ssDNA on agarose gel was quantified using the ImageJ software (NIH), and compared to that of the undigested ssDNA band to obtain the percentage of the ssDNA protection activity (%).

EPR measurements

The electron paramagnetic resonance (EPR) spectra were recorded at X-band on a

Bruker ESR-300 spectrometer equipped with an Oxford Instruments 910 continuous flow

45 cryostat. EPR conditions were: microwave frequency, 9.45 GHz; microwave power, 10 mW; modulation frequency, 100 kHz; modulation amplitude, 2 mT; sample temperature,

10 K; receive gain, 1 x 105.

3.3 Results

E. coli YrdD is an iron and zinc binding protein

When recombinant YrdD is expressed in E. coli cells grown in LB medium, purified YrdD has a reddish color (Figure 3.1 insert). The UV-visible absorption measurements revealed that purified YrdD has three major absorption peaks at 345 nm,

482 nm and 563 nm, indicative of iron binding in the protein (Figure 3.1A). The absorption peaks disappear when the protein is reduced with sodium dithionite and partially restored after the reduced protein is exposed to air (Figure 3.1A), indicating that the iron center in YrdD is redox active. The total metal content analyses of purified

YrdD showed that each YrdD monomer contains 0.46±0.14 iron atoms and 0.62±0.21 zinc atoms (n = 3).

The electron paramagnetic resonance (EPR) was also used to probe the iron binding in YrdD. As shown in Figure 3.1B, purified YrdD has an EPR signal at g = 4.3, reflecting a mononuclear ferric iron center in the protein. Addition of sodium dithionite completely eliminated the EPR signal, confirming that the iron center in YrdD can be reduced with dithionite.

46

Figure 3.1 The E. coli topoisomerase I homolog YrdD binds a mononuclear iron center Recombinant YrdD was purified from E. coli cells grown in LB media under aerobic growth conditions. A), UV-visible absorption spectra of purified YrdD. YrdD (32 µM) (spectrum 1) was reduced with sodium dithionite (1.5 mM) (spectrum 2), followed by exposure to air for 30 min (spectrum 3). Insert is a photograph of purified YrdD (200 µM). B), EPR spectra of purified YrdD. YrdD (200 µM) was dissolved in buffer containing Tris (20 mM, pH 8.0) and NaCl (500 mM) before and after reduced with sodium dithionite (1.5 mM).

Excess zinc in growth media competes off the iron binding in YrdD in E. coli cells

To explore the iron and zinc binding competition in YrdD, the protein is expressed in E. coli cells grown in LB media supplemented with increasing amounts of zinc. Figure 3.2A shows the UV-visible absorption spectra of YrdD proteins purified from the E. coli cells grown in LB media supplemented with different amounts of zinc.

As the concentration of zinc in LB media is increased, the absorption peaks at 345 nm,

482 nm and 563 nm are gradually decreased, and completely eliminated when LB media are supplemented with 0.25 mM ZnSO4. The total metal content analyses revealed that when the concentration of ZnSO4 in LB media is increased from 0 to 0.25 mM, the iron content in YrdD is progressively decreased (Figure 3.2B) with concomitant increase of

47 the zinc binding in YrdD to about three zinc atoms per YrdD monomer (Figure 3.2C) (n

= 3).

Figure 3.2 Competition of iron and zinc binding in YrdD in E. coli cells A), UV-visible absorption spectra of YrdD purified from E. coli cells grown in LB medium supplemented with 0.0 mM (spectrum 1), 0.1 mM (spectrum 2), 0.25 mM

(spectrum 3) and 0.5 mM ZnSO4 (spectrum 4). The concentration of each purified protein was about 80 µM. Insert is a photograph of the SDS polyacrylamide electrophoresis gel of purified YrdD proteins. B), iron contents of YrdD purified from E. coli cells grown in the LB growth medium supplemented with 0.0 mM, 0.1 mM, 0.25 mM and 0.5 mM

ZnSO4. C), zinc contents of YrdD purified fromE. coli cells grown in LB growth medium supplemented with 0.0 mM, 0.1 mM, 0.25 mM and 0.5 mM ZnSO4. The data in B and C are the averages with standard deviation from three independent experiments.

48 The zinc-bound YrdD has the ssDNA binding activity

The C-terminal region of the E. coli topoisomerase I has been shown to have a strong ssDNA binding activity (4). To determine whether YrdD also has the similar

DNA binding activity, we prepared YrdD protein that contains only iron or zinc by expressing the protein in E. coli cells grown in the M9 minimal media supplemented with either iron or zinc, respectively. Figure 3.3A shows the UV-visible absorption spectra of

YrdD purified from the E. coli cells grown in the M9 minimal media supplemented with either iron or zinc. The metal content analyses revealed that the iron-bound YrdD contains 1.2±0.3 iron atom and no zinc per YrdD monomer and the zinc-bound YrdD contains 3.1±0.21 zinc atoms and no iron per YrdD monomer (n=3).

Purified YrdD proteins are then tested for their DNA binding activity. Figure

3.3B shows that the zinc-bound YrdD has a strong binding activity for ssDNA with an almost stoichiometric binding of YrdD to ssDNA (40mer). In contrast, the iron-bound

YrdD has very little or no ssDNA binding activity. In controls, whereas the E. coli single-stranded DNA binding protein SSB forms the SSB-ssDNA complex (12,15), the E. coli iron-sulfur cluster assembly protein IscU, a zinc-bound protein (16), fails to bind any ssDNA (Figure 3.3B), validating the specific ssDNA binding activity of the zinc-bound

YrdD. We also compared the ssDNA binding activity of the zinc-bound YrdD and SSB

(Figure 3.3C). Due to stoichiometric binding of YrdD to ssDNA, we were unable to determine the dissociation constant of the zinc-bound YrdD with ssDNA. Nevertheless, the results clearly demonstrate that the zinc-bound YrdD has a comparable ssDNA binding activity as SSB under the experimental conditions.

49

Figure 3.3 The Zn-bound YrdD has the ssDNA binding activity A), UV-visible absorption spectra of Zn-YrdD and Fe-YrdD. Recombinant YrdD was expressed in E. coli cells grown in M9 minimal media supplemented with 40 µM

Fe(NH4)2(SO4)2 (spectrum 1) or 40 µM ZnSO4 (spectrum 2). The protein concentration was about 16 µM. Insert is a photograph of the SDS polyacrylamide electrophoresis gel of Fe-YrdD (1) and Zn-YrdD (2). B), ssDNA binding activity of YrdD. Zn-YrdD, Fe- YrdD, IscU, and SSB were incubated with the fluorescein-labeled ssDNA (4 µM) at room temperature for 15 min. The samples were loaded onto a 0.6% agarose gel to resolve the protein-ssDNA complex from “free” ssDNA. C), comparison of the ssDNA binding activity of Zn-YrdD and SSB. The fluorescein-labeled ssDNA (4 µM) was incubated with increasing concentrations of Zn-YrdD and SSB at room temperature for 15 min. The samples were loaded onto a 0.6% agarose gel to resolve the protein-ssDNA complex from “free” ssDNA. D), comparison of the ssDNA and dsDNA binding activity of Zn- YrdD. Fluorescein-labeled ssDNA (left panel) or dsDNA (right panel) (4 µM) was incubated with increasing concentrations of Zn-YrdD for 15 min at room temperature. The samples were loaded into a 0.6% agarose gel to resolve the protein-DNA binding complex from “free” DNA. SSB (last lane) had no dsDNA binding activity. The data are representative of three independent experiments.

50 We further explored the binding activity of the zinc-bound YrdD for ssDNA and dsDNA under same experimental conditions. As shown in Figure 3.3D, the zinc-bound

YrdD has much less binding activity for dsDNA than for ssDNA, and SSB has no dsDNA binding activity. These results suggest that the zinc-bound YrdD prefers to bind ssDNA with a high binding affinity over dsDNA, while the iron-bound YrdD has very little or no binding activity for ssDNA or dsDNA.

The zinc-bound YrdD protects ssDNA from the DNase I digestion

The finding that the zinc-bound YrdD binds ssDNA led us to inquire whether

YrdD can protect ssDNA. In the experiments, ssDNA is incubated with a fixed concentration of YrdD and increasing amounts of DNase I. After incubation, the undigested ssDNA is analyzed by the agarose gel electrophoresis. As shown in Figure

3.4A, the zinc-bound YrdD can indeed protect ssDNA from the DNase I digestion, while the iron-bound YrdD has no such an activity. We also compared the ssDNA protection activity of the zinc-bound YrdD, IscU and SSB under the same experimental conditions.

As shown in Figure 3.4B, while the zinc-bound YrdD and SSB can effectively protect ssDNA from the DNase I digestion, IscU and the iron-bound YrdD fail to protect ssDNA from the DNase I digestion.

3.4 Discussion In this study, we report that E. coli YrdD, previously annotated as one of the topoisomerase I homologs, is an iron/zinc binding protein. When recombinant YrdD is expressed in E. coli cells grown in LB media, purified protein contains both iron and zinc.

Increasing zinc content in LB media competes off the iron binding in YrdD in E. coli

51

Figure 3.4 The Zn-bound YrdD protects ssDNA from DNase I digestion A), protective activity of Zn-YrdD and Fe-YrdD on ssDNA. The ssDNA (70mer) (1 µM) was incubated with 8 µM Zn- or Fe-YrdD at room temperature for 15 min, followed by digestion with 0, 10 or 20 µg/ml DNase I for 15 min. The samples were then loaded onto 1% agarose gel for quantification of intact ssDNA. B), protective activity of Zn-YrdD, Fe-YrdD, IscU, and SSB on ssDNA. The ssDNA (70mer) (1 µM) was incubated with indicated concentrations of proteins and treated with DNase I (10 µg/ml) at room temperature for 15 min. The samples were loaded onto 1% agarose gel for quantification of intact ssDNA. The amount of the ssDNA band was analyzed with ImageJ software (NIH) and compared to that of the undigested ssDNA band to obtain the percentage of the ssDNA protection activity (%). The data are the averages with standard deviations from three independent experiments. cells, suggesting that iron and zinc likely share the same binding sites in YrdD. Our results further reveal that the zinc-bound YrdD has a strong binding activity for ssDNA and protects ssDNA from the DNase I digestion. In contrast, the iron-bound YrdD fails to bind ssDNA or protect ssDNA from the DNase I digestion. The results suggest that

52 the zinc-bound YrdD may have an important role in DNA repair by interacting with ssDNA in E. coli cells.

Zinc is an essential trace metal that facilitates correct folding of proteins, stabilizes the domain structure, and plays important catalytic roles in enzymes (17).

Depletion of zinc in growth medium results in slow-growth phenotype and activation of zinc uptake systems in E. coli cells (18). On the other hand, excess zinc is highly toxic to cells (19). Since iron and zinc have a similar ligand binding coordination (20), it is expected that iron and zinc may compete for the metal binding sites in proteins. In the previous studies, we reported that E. coli topoisomerase I is able to bind zinc or iron in the C-terminal zinc-binding region (10). While the zinc-bound topoisomerase I is fully active to unwind the negatively supercoiled DNA, the iron-bound topoisomerase I has very little or no enzyme activity (10). Here, we find that YrdD, a homolog of the C- terminal region of topoisomerase I, is also capable of binding zinc and iron in E. coli cells

(Figure 3.2), supporting the notion that iron and zinc may compete for the metal binding sites in these proteins. Interestingly, only the zinc-bound YrdD can bind ssDNA (Figure

3.3), suggesting that zinc binding may result in subtle structural change of YrdD to facilitate the ssDNA binding and protect ssDNA from the DNase I digestion. It appears that that zinc is a preferred metal for the metal-binding sites in YrdD (Figure 3.3A) and in the C-terminal region of topoisomerase I (4). Nevertheless, deficiency of zinc or excess iron in cells may produce the iron-bound YrdD and topoisomerase I. In this regard, the ssDNA binding activity of YrdD and the enzyme activity of topoisomerase I may be regulated by intracellular iron and zinc contents.

53 The C-terminal region of E. coli topoisomerase I is essential for relaxing the negatively supercoiled DNA (3,4), likely through strong interaction with ssDNA (4) and direct interaction with the N-terminal domain of the protein (6). Here we find that the zinc-bound YrdD, but not the iron-bound YrdD, retains strong binding affinity for ssDNA and relatively weak binding activity for dsDNA (Figure 3.3D). While the physiological function of YrdD remains elusive, our results suggest that YrdD is able to protect ssDNA via interaction with ssDNA. This idea is consistent with the recent study showing that inactivation of the gene encoding YrdD can suppress the severe growth inhibition phenotype of an E. coli mutant with deletion of the DNA recombination repair protein RecA and the bacterial dNTPase RdgB which degrades non-canonical DNA precursors (9). Deficiency of RdgB will result in accumulation of the clastogenic DNA precursors such as dIPT in cells and endonuclease V may nick DNA near the base analogues to initiate excision repair (21). Further inactivation of RecA protein may block recombinational repair, which leads to severe growth inhibition. Deletion of endonuclease V or YrdD appears to inhibit the endonuclease V-initiated repair pathway and suppresses the severe growth inhibition phenotype of the E. coli cells with deletions of RecA and RdgB (9). Thus, YrdD and endonuclease V may work in concert in the

DNA repair pathways. Since YrdD is a relatively small protein (180 amino acids), it is most likely that YrdD will have partners such as endonuclease V for its physiological functions in cells. Additional partners of YrdD remain to be further identified in cells.

3.5 References

1. Wang, J. C. (2002) Cellular roles of DNA topoisomerases: a molecular perspective. Nat Rev Mol Cell Biol 3, 430-440

54 2. Tse-Dinh, Y. C. (2009) Bacterial topoisomerase I as a target for discovery of antibacterial compounds. Nucleic Acids Res 37, 731-737

3. Tse-Dinh, Y. C. (1991) Zinc (II) coordination in Escherichia coli DNA topoisomerase I is required for cleavable complex formation with DNA. J Biol Chem 266, 14317-14320

4. Ahumada, A., and Tse-Dinh, Y. C. (2002) The role of the Zn(II) binding domain in the mechanism of E. coli DNA topoisomerase I. Bmc Biochem 3, 13

5. Cheng, B., Zhu, C. X., Ji, C., Ahumada, A., and Tse-Dinh, Y. C. (2003) Direct interaction between Escherichia coli RNA polymerase and the zinc ribbon domains of DNA topoisomerase I. J Biol Chem 278, 30705-30710

6. Sissi, C., Cheng, B., Lombardo, V., Tse-Dinh, Y. C., and Palumbo, M. (2013) Metal ion and inter-domain interactions as functional networks in E. coli topoisomerase I. Gene 524, 253-260

7. Suski, C., and Marians, K. J. (2008) Resolution of converging replication forks by RecQ and topoisomerase III. Mol Cell 30, 779-789

8. Perez-Cheeks, B. A., Lee, C., Hayama, R., and Marians, K. J. (2012) A role for topoisomerase III in Escherichia coli chromosome segregation. Mol Microbiol 86, 1007-1022

9. Budke, B., and Kuzminov, A. (2010) Production of clastogenic DNA precursors by the nucleotide metabolism in Escherichia coli. Mol Microbiol 75, 230-245

10. Lu, J., Wang, W., Tan, G., Landry, A. P., Yi, P., Si, F., Ren, Y., and Ding, H. (2011) Escherichia coli Topoisomerase I is an Iron and Zinc Binding Protein Biometals Epub ahead of print

11. Yang, J., Bitoun, J. P., and Ding, H. (2006) Interplay of IscA and IscU in biogenesis of iron-sulfur clusters. J Biol Chem 281, 27956-27963

12. Cheng, Z., Caillet, A., Ren, B., and Ding, H. (2012) Stimulation of Escherichia coli DNA damage inducible DNA helicase DinG by the single-stranded DNA binding protein SSB. FEBS Letters 586, 3825-3830

55 13. Cowart, R. E., Singleton, F. L., and Hind, J. S. (1993) A comparison of bathophenanthrolinedisulfonic acid and ferrozine as chelators of iron(II) in reduction reactions. Anal Biochem 211, 151-155

14. Bae, J. B., Park, J. H., Hahn, M. Y., Kim, M. S., and Roe, J. H. (2004) Redox- dependent changes in RsrA, an anti-sigma factor in Streptomyces coelicolor: zinc release and disulfide bond formation. J Mol Biol 335, 425-435

15. Shereda, R. D., Kozlov, A. G., Lohman, T. M., Cox, M. M., and Keck, J. L. (2008) SSB as an organizer/mobilizer of genome maintenance complexes. Crit Rev Biochem Mol Biol 43, 289-318

16. Ramelot, T. A., Cort, J. R., Goldsmith-Fischman, S., Kornhaber, G. J., Xiao, R., Shastry, R., Acton, T. B., Honig, B., Montelione, G. T., and Kennedy, M. A. (2004) Solution NMR structure of the iron-sulfur cluster assembly protein U (IscU) with zinc bound at the active site. J Mol Biol 344, 567-583

17. Berg, J. M., and Shi, Y. G. (1996) The galvanization of biology: A growing appreciation for the roles of zinc. Science 271, 1081-1085

18. Graham, A. I., Hunt, S., Stokes, S. L., Bramall, N., Bunch, J., Cox, A. G., McLeod, C. W., and Poole, R. K. (2009) Severe Zinc Depletion of Escherichia coli: Roles for High Affinity Zinc Binding by ZinT, Zinc Transport and Zinc- Independent Proteins. J Biol Chem 284, 18377-18389

19. Xu, F. F., and Imlay, J. A. (2012) Silver(I), mercury(II), cadmium(II), and zinc(II) target exposed enzymic iron-sulfur clusters when they toxify Escherichia coli. Appl Environ Microbiol 78, 3614-3621

20. Dauter, Z., Wilson, K. S., Sieker, L. C., Moulis, J. M., and Meyer, J. (1996) Zinc- and iron-rubredoxins from Clostridium pasteurianum at atomic resolution: a high- precision model of a ZnS4 coordination unit in a protein. Proc Natl Acad Sci U S A 93, 8836-8840

21. Lukas, L., and Kuzminov, A. (2006) Chromosomal fragmentation is the major consequence of the rdgB defect in Escherichia coli. Genetics 172, 1359-1362

56

CHAPTER 4. CONCLUSIONS

We propose that E.coli DinG is a new member of the DNA processing protein family that can be regulated by single-strand DNA binding protein SSB. When cells are exposing to DNA damaging agents, DinG protein and other DNA repair proteins including SSB are highly induced, and SSB in turn stimulates that activity of the DinG helicase and other DNA repair enzymes to promote efficient repair of DNA damage.

In addition, we find that YrdD, a homolog of E.coli topoisomerase I, is novel iron binding protein. Supplement of exogenous zinc in medium abolishes the iron binding of

YrdD in E.coli cells. While the zinc-bound YrdD can bind ssDNA and protect it from the

DNAse I digestion in vitro, the iron-bound YrdD has no binding activity for ssDNA, suggestion that zinc-bound YrdD have an important role in DNA repair by interaction with ssDNA in cells.

57 APPENDIX: PERMISSION TO INCLUDE PUBLISHED WORK

58

59 VITA

Zishuo Cheng, a native of Beijing, China, received his bachelor’s degree at Wuhan

University in 2007. Thereafter, he received his master’s degree in Chinese Academy of

Sciences. As his interest in biochemistry grew, he made the decision to enter graduate program in the Department of Biological Sciences at Louisiana State University. He will receive his Ph.D. degree in Dec 2015 and will begin his postdoctoral position upon graduation.

60