(12) United States Patent (10) Patent No.: US 8,226,943 B2 Gurney Et Al

USOO8226943B2

(12) United States Patent (10) Patent No.: US 8,226,943 B2 Gurney et al. (45) Date of Patent: Jul. 24, 2012

(54) ANTIBODIES TO NOTCH RECEPTORS 8,088,617 B2 1/2012 Gurney et al. 2002fOO86014 A1 7/2002 Korman et al. (75) Inventors: Austin L. Gurney, San Francisco, CA 2002/012002/O1228O2 19565 A1 9,8, 2002 WI.Clarke et al.A. (US); Timothy Charles Hoey, 2003, OO82651 A1 5.2003 Gao et al. Hillsborough, CA (US); Edward Thein 2003/00834.65 A1 5/2003 Zimrin et al. 2003/0186290 A1 10, 2003 Tournier-Lasserve et al. Hist(US), Aaron. RESS Ken Sato, Burlingame, A. CA CA 2005/00268312004/0229301 A1 1 2/20051/2004 WangBodmer et al. (US); Yuan Ching Liu, Fremont, CA 2005.0089518 A1 4, 2005 Clarke et al. (US); Maureen Fitch Bruhns, San 2005, 0112121 A1 5/2005 Artavanis-Tsakonas et al. Mateo, CA (US); John A. Lewicki, Los 2005. O142635 A1 6/2005 Tsuchiya et al. Gatos, CA (US) 2005/O187179 A1 8, 2005 Miele et al. s 2005/0232927 A1 10, 2005 Clarke et al. 2006, OO30694 A1 2/2006 Kitajewski et al. (73) Assignee: OncoMed Pharmaceuticals, Inc., 2006/0051325 A1 3/2006 Clarke et al. Redwood City, CA (US) 2006, OO73125 A1 4/2006 Clarke et al. 2006, 0083.682 A1 4/2006 Bergstein (*) Notice: Subject to any disclaimer, the term of this 299;GSG A. 1 3.299; E. al. patent is extended or adjusted under 35 2007.0036801 A1 2/2007 BergsteinergStein U.S.C. 154(b) by 254 days. 2007/0036804 A1 2/2007 Bergstein 2007/004.1984 A1 2/2007 Bergstein (21) Appl. No.: 12/499,627 2007,0196047 A9 8, 2007 Lewner et al. 2007/0212737 A1 9, 2007 Clarke et al. (22) Filed: L. 8, 2009 2007,0265246 A1 11/2007 Clevers et al. 9 2008/0076670 A1 3/2008 Sivan et al. O O 2008. O11294.0 A1 5/2008 Liaw (65) Prior Publication Data 2008.0118520 A1 5.2008 Li et al. 2008. O131434 A1 6/2008 Lewicki et al. US 2010/01 11958 A1 May 6, 2010 2008. O131908 A1 6, 2008 Li et al. O O 2008. O132423 A1 6/2008 Kondo Related U.S. Application Data 2008. O178305 A1 7, 2008 Clarke et al. (60) Provisional application No. 61/112,699, filed on Nov. (Continued) 7, 2008, provisional application No. 61/112,701, filed on Nov. 7, 2008, provisional application No. FOREIGN PATENT DOCUMENTS 61/079,095, filed on Jul. 8, 2008. EP O 662827 B2 T 1995 (Continued) (51) Int. Cl. A 6LX39/395 (2006.01) C07K 6/28 (2006.01) OTHER PUBLICATIONS C07K 4/705 (2006.01) Al-Hajj et al., “Prospective Identification of Tumorigenic Breast CI2N5/00 (2006.01) Cancer Cells”. Cell Biology 100:3983-3988 (2003), Proceedings of (52) U.S. Cl...... 424/130.1; 424/133.1; 424/141.1; the National Academy of Science, 700 11th Street, NW Suite 450 424/143.1; 435/326; 435/331; 435/334:530/350; Washington, DC 20001. 530/387.1:530/388.1:530/388.15:530/388.22 Continued (58) Field of Classification Search ...... None (Continued) See application file for complete search history. Primary Examiner — Bridget E Bunner (56) References Cited (74) Attorney, Agent, or Firm — Sterne, Kessler, Golstein & Fox P.L.L.C. U.S. PATENT DOCUMENTS 5,648.464 A 7, 1997 Artavanis-Tsakonas et al. 5,786, 158 A 7, 1998 Artavanis-Tsakonas et al. (57) ABSTRACT 5,789,195 A 8, 1998 Artavanis-Tsakonas et al. 6,004,528 A 12/1999 Bergstein The present invention relates to Notch-binding agents and 6,080,588 A 6, 2000 Glick Notch antagonists and methods of using the agents and/or 6,083,904 A 7/2000 Artavanis-Tsakonas antagonists for treating diseases such as cancer. The present 6,090,922 A 7/2000 Artavanis-Tsakonas et al. invention provides antibodies that specifically bind to a non 6,180,370 B1 1/2001 Queen et al. 6,379,925 B1 4/2002 Kitajewski et al. ligand binding region of the extracellular domain of one or 6,537,775 B1 3/2003 Tournier-Lasserve et al. more human Notch receptor, such as Notch2 and/or Notch3. 6,689,744 B2 2/2004 Gao et al. and inhibit tumor growth. The present invention further pro 6,984.522 B2 1/2006 Clarke et al. vides methods of treating cancer, the methods comprising 7,091,323 B2 * 8/2006 Pan et al...... 530,388.15 administering a therapeutically effective amount of an anti 7,115,360 B2 10/2006 Clarke et al. 7.432,364 B2 * 10/2008 Pan et al...... 536,23.53 body that specifically binds to a non-ligand binding region of 7,632,926 B2 12/2009 Kim et al. the extracellular domain of a human Notch receptor protein 7,713,710 B2 5, 2010 Clarke et al. and inhibits tumor growth. 7,754.206 B2 7, 2010 Clarke et al. 7,850,961 B2 12/2010 Clarke et al. 7.919,092 B2 * 4/2011 Lewicki et al...... 424,141.1 23 Claims, 44 Drawing Sheets US 8,226,943 B2 Page 2

U.S. PATENT DOCUMENTS Lymphoblastic Neoplasms”. Cell, 66:649-661 (1991), Cell Press, 50 2008/O187532 A1 8/2008 Gurney et al. Church Street, Cambridge, Massachusetts 02138. 2008. O1884.05 A1 8, 2008 Di Fiore et al. Gale et al., “Haploinsufficiency of Delta-Like 4 Ligand Results in 2008. O194022 A1 8, 2008 Clarke et al. Embryonic Lethality Due to Major Defects in Arterial and Vascular 2008, 0226621 A1 9/2008 Fung et al. Development”, PNAS, 101: 15949-15954 (2004), National Academy 2008/0260734 A1 10, 2008 Clarke et al. of Science, 700 11th Street, NW Suite 450 Washington, DC 20001. 2009,0004205 A1 1/2009 Clarke et al. Gallahan et al., “Expression of a Truncated Int3 Gene in Developing 2009/002885.6 A1 1/2009 Chen et al. Secretory Mammary Epithelium Specifically Retards Lobular Dif 2009/0047285 A1 2/2009 Gurney et al. ferentiation Resulting in Tumorigenesis', Cancer Research, 2009, 0208491 A1 8/2009 Gurney et al. 56:1775-1785 (1996), American Association for Cancer Research, 2011 OO33481 A1 2/2011 Clarke et al. Inc, Public Ledger Bldg., Suite 816, 150 South Independence Mall 2011/0092378 A1 4/2011 Clarke et al. West, Philadelphia, PA 19106-3483. 2011/O195065 A1 8/2011 Lewicki et al. Gridley, T., "Notch signaling and inherited disease syndromes.” FOREIGN PATENT DOCUMENTS Human Molecular Genetics 12:R9-R13 (2003), Oxford University WO WO94,07474 A1 4f1994 Press. WO WO97/37004 A1 10, 1997 Gridley, T., “Notch signaling during vascular development.” PNAS, WO WO 97.45.143 A1 12/1997 98:5377-5378 (2001), National Academy of Sciences, Washington, WO WO98,57621 A1 12, 1998 DC 20001. WO WOOOf2O576 A2 4/2000 Gridley, T., “Vessel guidance.” Nature, 445:722-723 (2007) Nature WO WOOO,52143 A2 9, 2000 Publishing Group, New York, NY 10013-1917, USA. WO WO O2/OO576 A1 1, 2002 Gridley, T., “Notch Signaling in Vertebrate Development and Dis WO WO O2, 12447 A2 2, 2002 ease.” Mol. Cell. Neurosci,9:103-108, (1997), Academic Press, 6277 WO WO O2, 18544 A2 3, 2002 Sea Harbor Drive, Orlando, FL 32887-4900. WO WO 03/042246 A2 5, 2003 Hadland et al., “A requirement for Notchl distinguishes 2 phases of WO WO 03/0505O2 A2 6, 2003 WO WOO3,062273 A2 T 2003 definitive hematopoiesis during development.” Blood, 104:3097 WO WO 04/001004 A2 12/2003 3105 (2004), The American Society of Hematology. WO WO 2004/091383 A2 10, 2004 Hainaud et al., “The Role of the Vascular Endothelial Growth Factor WO WO 2005/026334 A2 3, 2005 Delta-like 4 Ligand. Notch4-Ephrin B2 Cascade in Tumor Vessel WO WO 2005/O54434 A2 6, 2005 Remodeling and Endothelial Cell Functions.” Cancer Res, 66:8501 WO WO 2005, O74633 A2 8, 2005 8510, (2006), American Association for Cancer Research. WO WO 2006/110581 A2 10, 2006 Hallahan et al., “The Smo Al Mouse Model Reveals that Notch Sig WO WO 2008/O51797 A3 5, 2008 naling is Critical for the Growth and Survival of Some Hedgehog WO WO 2008/057144 A2 5, 2008 Induced Medulloblastomas', Cancer Research, 64.7794-7800 WO WO 2008.076960 A2 6, 2008 (2004), American Association for Cancer Research, Philadelphia, PA WO WO 2008/091641 A2 T 2008 19106-4404. WO WO 2008, 108910 A2 9, 2008 WO WO 2008. 136848 A2 11/2008 Hitoshi et al., “Notch Pathway Molecules are Essential for Tile Main WO WO 2009,025867 A2 2, 2009 tenance, but not the Generation of Mammalian Neural Stem Cells'. WO WO 2009/035522 A1 3, 2009 Genes &. Development, 16:846-858 (2002), Cold Spring Harbor WO WO 2010.005567 A2 1, 2010 Laboratory Press, Cold Spring Harbor Laboratory Press 500 Sun nyside Boulevard Woodbury, New York 11797. OTHER PUBLICATIONS Iso et al., “Notch Signaling in Vascular Development'. Arterioscler Thrombosis and Vascular Biology, 23:543-553 (2003), Lippincott Arias et al., "Csl-Independent Notch Signalling: A Checkpoint in Williams & Wilkins, Philadelphia, PA 19106. Ceu Fate Decisions. During Development?”, Current Opinion in Jhappan et al., “Expression of an Activated Notch-Related Int-3 Genetics & Development, 12:524-533 (2002), Elsevier Science Ltd, Transgene Interferes with Cell Differentiation and Induces The Boulevard, Langford Lane, Kidlington, Oxford, OX5 1 GB, UK. Neoplastic Transformation in Mammary and Salivary Glands', Artavanis-Tsakonas et al., “Notch Signaling: Cell Fate Control and Genes & Development, 6:345-355 (1992), Cold Spring Harbor Labo Signal Integration in Development”. Science 284:770-776 (1999), ratory Press, Box 100, 1 Bungtown Road, Cold Spring Harbor, New American Association for the Advancement of Science, 1200 New York 11724-2203 York Avenue, NW, Washington, DC 20005. Joutel and Tournier-Lasserve. “Notch Signalling Pathway and Brennan and Brown, “Is There a Role for Notch Signalling in Human Human Diseases”. Seminars in Cell & Departmental Biology, 9:619 Breast Cancer?', Breast Cancer Research, 5:69-75 (2003), BioMed 625 (1998), Academic Press, Orlando, FL 32887. Central Ltd, London WC1X8HL, United Kingdom. Joutelet al., “Notch3 Mutations in Cadasil, A Herediraty Adult Onset Brennan et al., “Repression by Notch is Required Before Wingless Consition Causing Stroke and Dementia', Nature, 383:707-710 Signalling During Muscle Progenitor Cell Development in (1996), Macmillan Magazines Ltd., 4 Little Essex Street, London Drosophila'. Current Biology, 9:707-710 (1991), Current Biology WC2R3LF. Publications, 34-42 Cleveland Street, London W1 P GLE, UK. Karanu et al., “The Notch Ligand Jagged-L Represents a Novel Cole et al., “The Ebv-Hybridoma Technique and its Application to Growth Factor of Human Hematopoietic StemCells”. J. Exp. Med, Human Lung Cancer’. Monoclonal Antibodies and Cancer Therapy, 192: 1365-1372 (Nov. 6, 2000), The Rockefeller University Press, 77-96 (1985), Alan R. Liss, Inc., 41 East 11th Street, New York, NY 1114 First Avenue, New York, 10021. 10003. Kidd et al., “Sequence of the Notch Locus of Drosophila Del Amo et al., “Cloning, Analysis, and Chromosomal Localization melanogaster: Relationship of the Encoded Protein to Mammalian of Notch-1, a Mouse Homolog of Drospohila Notch.” Genomics, Clotting and Growth Factors'. Molecular and Cellular Biology, 6: 15:259-264 (1993), Academic Press, Inc. 3094-3108 (1986), American Society for Microbiology, 1913 I St., Domenga et al., “Notch3 is required for arterial identity and matura NW, Washington, DC 20006. tion of vascular smooth muscle cells.” Genes & Development, Kopper and Hajdu"Tumor Stem Cells'. Pathology Oncology 18:2730-2735 (2004), Cold Spring Harbor Laboratory Press. Research, 10:69-73 (2004), Arányi Lajos Foundation, Budapest. Duncan et al., “Integration of Notch and Wnt Signaling in Krebs et al., “Notch Signaling is Essential for Vascular Hematopoietic StemCell Maintenance', Nature Immunology 6:314 Morphogenesis in Mice'. Genes & Development, 14:1343-1352 322 (2005), Nature Publishing Group, 345 Park Avenue South, New (2000), Cold Spring Harbor Laboratory Press, Box 100, 1 Bungtown York, NY 10010-1707. Road, Cold Spring Harbor, New York 11724-2203. Ellisen et al., "Tan 1. The Human Homolog of the Drosophila Notch Kuukasjärvi et al., “Genetic Heterogeneity and Clonal Evolution Gene, Is Broken by Chromosomal Translocations in T Underlying Development of Asynchronous Metastasis in Human US 8,226,943 B2 Page 3

Breast Cancer', Cancer Research, 57: 1597-1604 (Apr. 15, 1997), Suzuki et al., “Imbalanced Expression of Tan-L and Human Notch4 American Association for Cancer Research, Inc., P.O. Box 3000, in Endometrial Cancers'. International Journal of Oncology, 17: Denville, NJ 7834. 1131-1139 (2000), Spandidos-publications, Athens 116 10, Greece. Lapidot et al., “A Cell Initiating Human Acute Myeloid Leukaemia Swiateket al., “Notchl is essential for postimplantation development after Transplantation into SCID Mice", Nature, 367:645-648 (1994), in mice.” Genes & Development, 8:707-719. (1994) Cold Spring Macmillan Magazines Ltd., 4 Little Essex Street, London WC2R Harbor Laboratory. 3LF. Takeshita et al., “Crictical Role of Endothelial Notchl Signaling in Lawrence et al., “Notch Signaling Targets the Wingless Responsive Postnatal Angiogenesis.” Cir. Res. 100:70-78 (2007), American ness of a UbX Visceral Mesoderm Enhancer in Drosophila'. Current Heart Association, Inc. Tavares et al., “Inhibition of Vascular Endothelium by the Notch Biology, 11:375-385 (2001), Cell Press, 1100 Massachusetts Ligand Delta-4 Unveils a Novel Therapeutic Target.” Vascular Wall Avenue, Cambridge, MA 02138. Biology, Poster Board ii-Session: 115-II. Abstractii 1944, pp. 531a, Leethanakul et al., “Distinct Pattern of Expression of Differentiation (2003), American Society of Hematology, San Diego, California. and Growth-Related Genes in Squamous Cell Carcinomas of the Uyttendaele et al., “Notch4 and Wnt-L Proteins Function to Regulate Head and Neck Revealed by the Use of Laser Capture Microdissec Branching Morphogenesis of Malnmary Epithelial Cells in an tion and Cdna Arrays'. Oncogene, 19:3220-3224 (2000), Nature Opposing Fashion”. Developmental Biology, 196:204-217 (1998), Publishing Group, Houndmills, Basingstoke, Hampshire RG21 6XS, Academic Press, Orlando, FL 32887-4900. UK. Van Es and Clevers, “Notch and Wnt Inhibitors as Potential New Leong and Karsan, “Recent insights into the role of Notch signaling Drugs for Intestinal Neoplastic Disease'. Trends in Molecular Medi in tumorigenesis.” Blood, 107:2223-2233 (2006), American Society cine, 11: 496-502 (2005), Elsevier, London, UK WCIX 8RR. of Hematology. Van Limpt et al., "Sage Analysis of Neuroblastoma Reveals a High Leong et al., “Activated Notch4 Inhibits Angiogenesis: Role of Expression of the Human Homologue of the Drosophila Delta Bl-Integrin Activartion.” Mol. Cell. Biol., 22:2830-2841, (2002) Gene”. Medical and Pediatric Oncology, 35:554-558 (2000), Wiley American Society for Microbiology. Liss, Inc. 605. Third Avenue, New York, NY 10158-0012. McCright et al., “Defects in Development of the Kidney, Heart and Varnum-Finney et al., “Pluripotent, Cytokine-dependent, Eye Vasculature in Mice Homozygous for a Hypomorphic Notch2 Hematopoietic StemCells are Immortalized by Constitutive Notch1 Mutation”. Development, 128:491-502 (2001), The Company of Signaling”. Nature Medicine, 6:1278-1281 (2000), Nature Publish Biologists Limited, Bidder Building, 140 Cowley Road, Cambridge ing Group, New York, NY 10013-1917, USA. CB4 ODL, UK. Weijzen et al., “Activation of Notch-L Signaling Maintains the Mohr, "Character Caused by Mutation of an Entire Region of a Neoplastic Phenotype in Human Ras-Transformed Cells', Nature Chromosome in Drosophila', Genetics, 4:275-282 (1919), The Medicine, 8:979-986 (2002), Nature Publishing Group, New York, Genetics Society of America, Genetics Mellon Institute, Box I 4400 NY 10013-1917, USA. Fifth Avenue Pittsburgh, Pennsylvania 15213-2683. Wharton et al., “Nucleotide Sequence from the Neurogenic Locus Parr et al., “The Possible Correlation of Notch-1 and Notch-2 with Notch Implies a Gene Product that Shares Homology with Proteins Clinical Outcome and Tumor Clinicpathological Parameters in Containing Egf-Like Repeats”. Cell, 43:567-581 (1985), Cell Press, Human Breast Cancer', International Journal of Molecular Medi 50 Church Street, Cambridge, Massachusetts 02138. cine, 14:779-786 (2004), Springer Verlag, Tiergartenstasse 17,69121 Xu et al., “Regions of Drosophila Notch that Contribute to Ligand Heidelberg, Germany. Binding and the Modulatory Influence of Fringe'. The Journal of Pear and Aster, “T Cell Acute Lymphoblastic Leukemia Lymphoma: Biological Chemistry, 280: 30158-30165 (2005), American Society A Human Cancer Commonly Associated with Aberrant Notchl Sig for Biochemistry and Molecular Biology, Inc., 9650 Rockville Pike, naling”. Current Opinion in Hematology, 11:426-433 (2004), Lip Bethesda, MD 20814 U.S.A. pincott Williams & Wilkins, Philadelphia, PA 19106. Xue et al., “Embryonic Lethality and Vascular Defects in Mice Lack Politi et al., “Notch in Mammary Gland Development and Breast ing the Notch Ligand Jagged 1'. Human Molecular Genetics, 8: 723 Cancer'. Seminars in Cancer Biology, 14:341-347 (2004), Academic 730 (1999), Oxford University Press, McLean, VA 22101-0850, Press, 6277 Sea Harbor Drive, Orlando, FL. 32887-4900. USA. Purow et al., “Expression of Notch-1 and Its Ligands, Delta-Like-1 Zagouras et al., “Alterations in Notch Signaling in Neoplastic and Jagged-1, is Critical for Glioma Cell Survival and Proliferation'. Lesions of the Human Cervix”, PNAS, 92: 6414-6418 (1995), Clinical Research, 65:2354-2363 (2005), American Association for National Academy of Sciences, Washington, DC 20001. Cancer Research, Philadelphia, PA 19106-4404. The Extended European Search Report issued in European Applica Rae et al., “Novel Association of a Diverse Range of Genes with tion No. EP07 777 332.3, on Aug. 11, 2009 (10 pages). Renal Cell Carcinoma as Identified by Differential Display”. Inter. J. Kei Sakamoto et al., “Distinct roles of EGF repeats for the Notch Cancer,88:726-732 (2000), John Wiley & Sons Inc, 350 Main Street, signaling system.” Experimental Cell Research, 2005, 281-291, Malden MA 02148, USA. 302(2), Elsevier, Orlando, FL, XP-004649921. Rebay et al., “Specific Egf Repeats of Notch Mediate Interactions Li Shao et al., “Fringe modifies O-fucose on mouse Notch1 at epi with Delta and Serrate: Implications for Notch as a Multifunctional dermal growth factor-like repeats within the ligand-binding site and Receptor, Cell, 67:687-699 (1991), Cell Press, 50 Church Street, the Abruptex region.” The Journal of Biological Chemistry, 2003, Cambridge, Massachusetts 02138. 7775-7782, 278(10), American Society for Biochemistry and Reya et al., “Stem Cells, Cancer and Cancer Stem Cells', Nature, Molecular Biology, Bethesda, MD, XP-002538409. 414:105-111 (2001), Nature Publishing Group, New York, NY Nils Peters et al., “CADASIL-associated Notch3 mutations have 10013-1917, USA. differential effects both onligand binding and ligand-induced Notch3 Robey et al., “An Activated Form of Notch Influences the Choice receptor signaling through RBP-Jk.” Experimental Cell Research, Between Cd4 and CdS T Cell Lineages”. Cell, 87:483-492 (1996), 2004, 454-464, 299 (2), Elsevier, Orlando, FL, XP-004537012. Cell Press, 50 Church Street, Cambridge, Massachusetts 02138. Shimizu, K., et al., “Physical 1-15 interaction of Delta1, Jagged 1, and Smith et al., "Constitutive Expression of a Truncated Int3 Gene in Jagged2 with Notch1 and Notch3 receptors.” Biochem. Biophys. Mouse Mammary Epithelium Impairs Differentiation and Functional Res. Commun. 276:385-389, Academic Press, United States (2000). Development”. Cell Growth & Differentiation, 6: 563-577 (1995), Rand, M., et al., "Calcium binding to tandem repeats of EGF-like American Association for Cancer Research, Philadelphia, PA 19106 modules. Expression and characterization of the EGF-like modules 4404. of human Notch-1 implicated in receptor-ligand interactions.” Pro Soriano et al., “Expression of an Activated Notch4(Int-3) tein Science 6:2059-2071, Cambridge University Press, United Oncoprotein Disrupts Morphogenesis and Induces an Invasive Phe Kingdom (1997). notype in Mammary Epithelial Cells in Vitro”. Intl. J. Cancer, 86: Hambleton, S., et al., “Structural and Functional Properties of the 652-659 (2000), John Wiley & Sons Inc, 350 Main Street, Malden Human Notch-I Ligand Binding Region.” Structure 12:2173–2183, MA 02148, USA. Current Biology, Ltd., United States (2004). US 8,226,943 B2 Page 4

Miele, L., Gamma-Secretase and Notch Signaling: Novel Therapeu Jehn, B.M., et al., “Cutting edge: protective effects of Notch-1 on tic Targets in Breast Cancer, DTIC (Online), accessed at http://www. TCR-induced apoptosis,” J. Immunol. 162:635-638. The American dtic.mil/cgi-bin/GetTRDoc?Location=U2&doc=GetTRDoc.pdf Association of Immunologists, United States (1999). &AD=ADA446389 (retrieved on Jan. 12, 2010). Jundt, F., et al., “Activated Notch1 signaling promotes tumor cell Dikic, I., et al., “Notch: Implications of endogenous inhibitors for proliferation and Survival in Hodgkin and anaplastic large cell therapy,” Bioessays 32:481-487. John Wiley & Sons, United States lymphoma.” Blood 99:3398-3403. The American Society of Hema (2010). tology, United States (2002). Lin, L., et al., “Targeting Specific Regions of the Notch3 Ligand Lee, J-S, et al., “Intracisternal Type A Particle-Mediated Activation of the Notch4/int3 Gene in a Mouse Mammary Tumor: Generation of Binding Domain Induces Apoptosis and Inhibits Tumor Growth in Truncated Notch4/int3 mRNAs by Retroviral Splicing Events.” J. Lung Cancer.” Can. Res. 70: 632-638, American Assoc. for Cancer Virol. 73:5166-5171, American Society for Microbiology, United Research, United States (2010). States (1999). Bheeshmachar, G., et al., “Evidence for a Role for Notch Signaling in Lee, S-H, et al., “Mutational analysis of NOTCH1,2,3 and 4 genes in the Cytokine-Dependent Survival of Activated T cells,” J. Immunol. commonsolid cancers and acute leukemias. APMIS115:1357-1363, 177:5041-5050, XP008112523, American Association of Immu The Authors Journal Compilation, United States (2007). nologists, Inc., United States (2006). Li, K., et al., “Modulation of Notch Signaling by Antibodies Specific Extended European Search Report of European Appl. No. 08 72 for the Extracellular Negative Regulatory Region of NOTCH3.J. 4737.5, European Patent Office, Munich, Germany, dated Sep. 24. Biol. Chem. 283:8046-8054. The American Society for Biochemistry 2010. and Molecular Biology, Inc., United States (2008). “Biologicals Product: Mouse Monoclonal anti-Notch 1 (A6) anti Li, L., et al., “The Human Homolog of Rat Jagged 1 Expressed by body datasheet.” XP008115324, NOVUS, accessed at http://www. Marrow Stroma Inhibits Differentiation of 32D Cells through Inter novusbio.com/data sheet.pdf data sheet/5985, downloaded action with Notch1.” Immunity 8:43-55, Cell Press, United States 2008. (1998). Allenspach, E.J., et al., “Notch Signaling in Cancer.” Cancer Biol. Li, L., et al., "Cloning, Characterization, and the Complete 56.8- 1:466-476, Landes Bioscience, United States (2002). Kilobase DNA Sequence of the Human NOTCH4 Gene.” Genomics Armstrong. F., et al., “NOTCH is a key regulator of human T-cell 51:45-48, Academic Press, United States (1998). acute leukemia initiating cell activity.” Blood 113:1730-1740, The Lindsell, C.E., et al., "Jagged: A Mammalian Ligand That Activates American Society of Hematology, United States (2009). Notch1.” Cell 80:909-917, Cell Press, United States (1995). Bellavia, D., et al., “Constitutive activtion of NF-KB and T-cell leu Liu, Z. et al., “Notch1 loss of heterozygosity causes cascular tumors kemia/lymphoma in Notch3 transgenic mice.” EMBO.J. 19:3337 and lethal hemorrhage in mice.” J. Clin. Invest. 121(2):800-8, Ameri 3348, Oxford University Press, United States (2000). can Society for Clinical Investigation, United States (Feb. 2011:Epub Callahan, R. & Raafat, A. “Notch Signaling in Mammary Gland Jan. 25, 2011). Tumorigenesis.” Journal of Mammary Gland Biology and Neoplasia Miele, L., & Osborne, B., "Arbiter of Differentiation and Death: 6:23-36, Plenum Publishing Corporation, United States (2001). Notch Signaling Meets Apoptosis.” J. Cell Physiol. 181:393-409, Campbell, A.M., “Monoclonal antibody technology.” vol. 13, pp. Wiley-Liss, Inc., United States (1999). v-29, Elsevier Science Publishers B.V. The Netherlands, 1984. Nam, Y., et al., “Notch signaling as a therapeutic target. Curr. Opin. Cox, C.V., et al., "Characterization of acute lymphoblastic leukemia Chem. Biol. 6:501-509, Elsevier Science Ltd., Holland (2002). progenitor cells.” Blood 104:2919-2925. The American Society of Pelegrin, A., et al., “Immunotargeting of tumors: State of the art and Hematology, United States (2004). prospects in 2000).” Bull. Cancer 87(11):777-91, John Libbey Deftos, M.L., et al., “Correlating notch signaling with thymocyte Eurotext, France (Nov. 2000) in the English language. maturation.” Immunity 9:777-786, Cell Press, United States (1998). Pelegrin, A., et al., “Immunotargeting of tumors: State of the art and English language Abstract of WIPO Patent Publication No. WO prospects in 2000).” Bull. Cancer 87(11):777-91, Johon Libbey 02/00576A1, Jan. 3, 2002. Eurotext, France (Nov. 2000) in the French language. Fleming, R.J., et al., “The Notch receptor and its ligands.” Trends in Sambandam, A., et al., “Notch signaling controls the generation and Cell Biol. 7:437-441, Elsevier Science Ltd., The Netherlands (1997). differentiation of early T lineage progenitors.” Nature Immunol. Fre, S., et al., “Notch signals control the fate of immature progenitor 6:663-670, Nature Publishing Group, England (2005). cells in the intestine.” Nature 435:964-968, Nature Publishing Group, Sugaya, K., et al., “Gene organization of human NOTCH4 and England (2005). (CTG)n polymorphism in this human counterpart gene of mouse Gallahan, D., and Callahan, R., “The mouse mammary tumor asso proto-oncogene Int3,' Gene 189:235-244. Elsevier Science B.V. ciated gene INT3 is a unique member of the NOTCH gene family Holland (1997). (NOTCH4).” Oncogene 14:1838-1890, Stockton Press, United States Summons to attend oral proceedingspursuant to Rule 115(1) EPC for (1997). European Patent Application 05722705.0-2402/1718767, European Grabher, C., et al., “Notch 1 activation in the molecular pathogensis Patent Office, Germany, mailed on Feb. 9, 2011. of T-cell acute lymphoblastic leukaemia,” Nature Reviews Cancer Thelu, J., et al., “Notch signaling is linked to epidermal cell differ 6:347-359, Nature Publishing Group, England (2006). entiation level in basal cell carcinoma, psoriasis and wound healing.” Imatani, A. and Callahan, R., “Identification of a novel NOTCH-4/ BMC Dermatology 2:7, BioMed Central, England (2002). INT-3 RNA species encoding, an activated gene product in certain Van Es, J.H., et al., “Notch/y-secretase inhibition turns proliferative human tumor cell lines.” Oncogene 19:223-231, Macmillan Publish cells in intestinal crypts and adenomas into goblet cells.” Nature ers Ltd., England (2000). 435:959-963, Nature Publishing Group, England (2005). International Search Report for International Application No. PCT/ Weng, A.P., and Aster, J.C., “Multiple niches for Notch in cancer. US08/00884, United States Patent and Trademark Office, U.S.A., context is everything.” Curr. Opin. Genet. Dev. 14(1):48-54. Elsevier, mailed on Oct. 1, 2008. England (Feb. 2004). International Search Report for International Application No. PCT/ Weng, A.P. et al., “Activating Mutations of NOTCH1 in Human T US09/03995, United States Patent and Trademark Office, U.S.A., Cell Acute Lymphoblastic Leukemia,” Science 306:269-271, Nature mailed on Mar. 2, 2010. Publishing Group, England (2004). International Search Report for International Application No. PCT/ Weng, A.P. et al., “Growth Suppression of Pre-T Acute US2008/00 1948, USPTO, mailed on Oct. 15, 2008. Lymphoblastic Leukemia Cells by Inhibition of Notch Signaling.” Jang, M.S., et al..."Notch signaling as a target in multimodality cancer Mol. Cell Biol. 23:655-644, American Society for Microbiology, therapy,” Curr: Opin. Mol. Ther. 2(1):55-65. Thomson Reuters (Sci United States (2003). entific) Ltd., England (Feb. 2000). Duan, Z. et al., “A Novel Notch Protein, N2N, Targeted by Jarriault, S., et al., “Signaling downstream of activated mammalian Neutrophil Elastase and Implicated in Hereditary Neutropenia.” Mol. Notch.” Nature 377:355-358. Nature Publishing Group, England Cell. Biol. 24(1):58-70, American Society for Microbiology, United (1995). States (Jan. 2004). US 8,226,943 B2 Page 5

Huang, E.Y., et al., "Surface Expression of Notch1 on Thymocytes: 3:895-902, American Association for Cancer Research, United States Correlation with the Double-Negative to Double-Positive Transi (2004). tion.”.J. Immunol. 171(5): 2296-304, American Association of Immu Pei, Z. And Baker, N., “Competition between Delta and the Abruptex nologists, United States (Sep. 1, 2003). domain of Notch.” BMC Dev. Biol. 8:4, BioMed Central, United Santa Cruz Biotechnology, Inc., “Notch 2 (25-255): sc-5545 Kingdom (2008). datasheet,' downloaded on Dec. 2, 2009. Luo, B., et al., “Isolation and functional analysis of a cDNA for Axelson, H., “Notch signaling and cancer: emerging complexity.” human Jagged2, a gene encoding a ligand for the Notch1 receptor.” Semin. Cancer Biol. 14:317-319, Elsevier Ltd., England (2004). Mol. Cell. Biol. 17:6057-6067. American Society for Microbiology, Curry, C.L., et al., “Gamma secretase inhibitor blocks Notch activa United States (1997). tion and induces apoptosis in Kaposi's sarcoma tumor cells.” International Search Report for International Application No. PCT/ Oncogene 24:6333-6344, Nature Publishing Group, England (2005). US09/03994, ISA/US, Alexandria, Virginia, USA, mailed on Jul. 23, Dontu, G., et al., “Role of Notch signaling in cell-fate determination 2010. of human mammary stem/progenitor cells. Breast Cancer Res. International Search Report for International Application No. PCT/ 6:R605-R615, BioMed Central Ltd., England (2004). US 1 1/21135. International Searching Authority, Alexandria, Vir Harper, J.A., et al., “Notch signaling in development and disease.” ginia, United States, mailed Jul. 20, 2011. Clin. Genet. 64:461-472, Blackwell Munksgaard, Denmark (2003). NCBI Entrez, GenBank Report, Accession No. P01724. Burstein, Y. Hopfer, O., et al., “The Notch pathway in ovarian carcinomas and and Schechter, I, Entry Date Jul. 21, 1986, last updated Nov. 4, 2008. adenomas.” Br. J. Cancer 93:709-718, Cancer Research UK, England NCBI Entrez, GenBank Report, Accession No. Q8VDC9, SEMBI, (2005). P. Entry Date Mar. 1, 2002, last updated Oct. 31, 2006. Maillard, I., et al., “Mastermind critically regulates Notch-mediated Written Opinion of the International Searching Authority for Inter lymphoid cell fate decisions.” Blood 104: 1696-1702. The American national Application No. PCT/US 1 1/21 135, International Searching Society of Hematology, United States (2004). Authority, Alexandria, Virginia, United States, mailed Jul. 20, 2011. Qin, J.Z. et al., “p53-independent NOXA induction overcomes apoptotic resistance of malignant melanomas.” Mol. Cancer Ther. * cited by examiner U.S. Patent Jul. 24, 2012 Sheet 1 of 44 US 8,226,943 B2

sier Ou . A Y w 8 GeLOE) -- gld re C) s 2 5. (s s t 0.05 Ele OL

SEESA

CO Ea o e 3. 2. S. C 3. s

S R 9 ELESEESA U.S. Patent Jul. 24, 2012 Sheet 2 of 44 US 8,226,943 B2

9.In?š?H(II puefi]]fiu?x|30|q t

OO R3333333338 t Bertro-sue

9.InÃ¡HOI fiulpu?qZN?

8 O 2011 U.S. Patent Jul. 24, 2012 Sheet 3 of 44 US 8,226,943 B2

- a CVO Z

C CO n a w LX d LL | X s - H C/O Z

CD C/O Y U.S. Patent Jul. 24, 2012 Sheet 4 of 44 US 8,226,943 B2

sa 3 &: : . 8.- O -BY-Luss

:::::::::::::: ZEtion mir -z-rot

H CD

esCD Litton

mir

a s ... 3

-- Livio

3 viol

; ::: ; ; ; ; ; ; Fibol U.S. Patent Jul. 24, 2012 Sheet 5 of 44 US 8,226,943 B2

Figure 2

GFP only hNotch1 hNotch2 MFI= 115 MF-274

hNotch4 MFI= 135

U.S. Patent Jul. 24, 2012 Sheet 9 of 44 US 8,226,943 B2

g 5

& XXX:S&S.

seekesekees X i

Na N sur Seator area. U.S. Patent Jul. 24, 2012 Sheet 10 of 44 US 8,226,943 B2 Figure 4B

s 5 4 3 2 & & Y -- H -- hJag1 H - GS

Figure 4C

a -- H -- hag2 H - GS + 59R1 U.S. Patent Jul. 24, 2012 Sheet 11 of 44 US 8,226,943 B2

Figure 5A

PE13 BREAST TUMOR

H Control Ab A 59R1

20 25 30 35 40 45 Days Post Cell injection U.S. Patent Jul. 24, 2012 Sheet 12 of 44 US 8,226,943 B2

Figure 5B

T3 BREAST TUMOR

H Control Ab mA 59R1

Days Post Cell injection U.S. Patent Jul. 24, 2012 Sheet 13 of 44 US 8,226,943 B2

Figure 5C

COLO205 COLONTUMOR

20 18) 6

2 O) 8

AC) 20

" p < 0.001, 59Rf relative to 1B7.11 U.S. Patent Jul. 24, 2012 Sheet 14 of 44 US 8,226,943 B2

Figure 5D

PN4 PANCREATIC TUMOR

8 1600 1400 1200 O)

at 5ing/kg Bf 11 " p < 0.001, 59R relative to B7-11 15995 U.S. Patent Jul. 24, 2012 Sheet 15 of 44 US 8,226,943 B2

Figure 5E

PE13 BREAST TUMOR

5OO

25 30 35 5 5 55 5) Day

si5mg/kg 1B if out 15mg/kg 59r1 " p < 0.05, 59R1 relative to 1B7.11 U.S. Patent Jul. 24, 2012 Sheet 16 of 44 US 8,226,943 B2

Figure 5F

T3 BREAST TUMOR

1200

1000

800

600

400

200

O 18 25 39 42 Days After Tumor injection

B711 59R " p < 0.001, 59R1 relative to 1 B7.11

U.S. Patent Jul. 24, 2012 Sheet 18 of 44 US 8,226,943 B2

Figure 7

B51 BREAST TUMOR GROWTH (DAY 72)

o w ; O O

*: p < 0.05 vs. Control *: p < 0.05 vs. Taxol U.S. Patent Jul. 24, 2012 Sheet 19 of 44 US 8,226,943 B2

Figure 8

PN4 PANCREATIC TUMOR

1000 H Control Ab -v-Anti-Notch23 d 800 - A - Gemcitabine s 600 --O-Anti-Notch23+Gem o 400 O 200

Days Post Treatment U.S. Patent Jul. 24, 2012 Sheet 20 of 44 US 8,226,943 B2

Figure 9

M4 MELANOMA

600

500 - Control Ab 400 -V- Anti-Notch23 5 300 g 200 2 100 p = 0.001 vs. Control Ab U.S. Patent Jul. 24, 2012 Sheet 21 of 44 US 8,226,943 B2

Figure 10

C28 COLONTUMOR

H Control Ab - Are Irinotecan -v-Anti-Notch23 --O-Anti-Notch23+lrinotecan

p = 0.03 vs. Control Ab **p F 0.01 VS. Irinotecan U.S. Patent Jul. 24, 2012 Sheet 22 of 44 US 8,226,943 B2

Figure 11A

COLO205 COLONTUMOR

-H 5ngkg LZ 5- - - 5mg/kg 59Rf On -H 5mg/kg Awastir -- 15mg/kg 59R1+15mg/kg Awastin

3D 35 8 Day U.S. Patent Jul. 24, 2012 Sheet 23 of 44 US 8,226,943 B2

Figure 11B

C8 COLONTUMOR

H 15 mg/kg L2 -- 15mg/kg 59 R

U.S. Patent Jul. 24, 2012 Sheet 24 of 44 US 8,226,943 B2

Figure 11C

PN8 PANCREATIC TUMOR

U.S. Patent Jul. 24, 2012 Sheet 25 of 44 US 8,226,943 B2

Figure 11D

B34 BREAST TUMIOR

-- 15mg/kg LZ -- 15mgig 59Rf

as 5 t 5. Day U.S. Patent Jul. 24, 2012 Sheet 26 of 44 US 8,226,943 B2

Figure 11E

B39 BREAST TUMIOR

--5mg/kg L2 --5mg/kg 59Rf

U.S. Patent Jul. 24, 2012 Sheet 27 of 44 US 8,226,943 B2

Figure 11F

B44 BREAST TUMOR

--5 regrks B7 it 2000 --5ngkg 59Rf

U.S. Patent Jul. 24, 2012 Sheet 28 of 44 US 8,226,943 B2

Figure 11G

PE13 BREAST TUMOR

2O H15mg/kg B7.11 75 - 15mg/kg 59R1

U.S. Patent Jul. 24, 2012 Sheet 29 of 44 US 8,226,943 B2

Figure 11H

T1 BREAST TUMOR

H15mg/kg LZ

U.S. Patent US 8,226,943 B2

B44 PE13 ge

107

U.S. Patent Jul. 24, 2012 Sheet 32 of 44 US 8,226,943 B2

Figure 12C

RGS5 Colo25 B29 B34

#oo11816816uigi

B44 PE13 T1 ne

gas

N q s s |21by?6ugl, s

PN8

U.S. Patent Jul. 24, 2012 Sheet 34 of 44 US 8,226,943 B2 Figure 12E

ANGPT2 Cole.205 B29

PE13

U.S. Patent Jul. 24, 2012 Sheet 35 of 44 US 8,226,943 B2

ÇI?InãIH

effeuaoued eyefjeuffy U.S. Patent US 8,226,943 B2

ÞI9.Inf??I U.S. Patent US 8,226,943 B2

&############ZNueUun?

U.S. Patent Jul. 24, 2012 Sheet 39 of 44 US 8,226,943 B2

Figure 6A

E3 Beast at

i. ran SSR1 E 1000 - x & SRS 80 sts 600 e is 308 s r

{ 28 Cois a star

1600 w8 Coff". A 1400 are S3R; 1200 SS3R8 1 OOOs 800 600 400 2OO U.S. Patent Jul. 24, 2012 Sheet 40 of 44 US 8,226,943 B2

Figure 6 C

Casis is:{}: 83r

r&r is is r: 33 8- 3Rs

Days After Tumor injectio: U.S. Patent Jul. 24, 2012 Sheet 41 of 44 US 8,226,943 B2

Figure 17

PN8 Pancreatic Tumor 17A

ana last dose E Of gem H. Gemcitabine o he 59R1+Gem On 59R5--Gem o D 5 E

33 38 43 48 53 58 63 68 73 78 83 88 Days Post Treatment

PE13 Breast Tumor

17B irAbS + Abs only 250 o H. Taxol-Control Ab 200 E -O Taxol--AntiNotch23 (59R5) 150 s o D 10 5 50 H O O 10 20 30 40 50 60 70 80 90 100 110 Days Post Cell injection U.S. Patent Jul. 24, 2012 Sheet 42 of 44 US 8,226,943 B2

Figure 18

Stroma tumor

al ControlmAB 5 59Rf 3 59rs 4. vi 2 e > 3 O 2 2 1 Z

Heyl Notch3 RGSS Co31 O4. ENRA EGLN3 U.S. Patent US 8,226,943 B2

*2** * gºººººººººººç********** «¿$¢ *i,*

Figure 19B

or Growth Ray FS O.05

0.04

O.03

0.02

0.01

O.OO U.S. Patent Jul. 24, 2012 Sheet 44 of 44 US 8,226,943 B2

Figure 19C

arror Growth ay 88

Contro sa, SSR fierciaire E. Gerck & -59R

*: } { {.{S vs. Ci to: *: ; K: , Sws. Genicitatite Figure 19)

or grow asy 38

0.05m. $ it's > 0.04 S SSRS is axi 0.03 axis-SSRS 0.02 CD d 0.01 0.00

*: p < 0.05 vs. Control *: p < 0.05 vs. Taxol US 8,226,943 B2 1. 2 ANTIBODIES TO NOTCH RECEPTORS The extracellular domain of the Notch receptor interacts with that of its ligands, typically on adjacent cells, resulting in two CROSS-REFERENCE TO RELATED proteolytic cleavages of Notch, one extracellular cleavage APPLICATIONS mediated by an ADAM (A Disintegrin And Metallopepti dase) protease and one cleavage within the transmembrane This application claims the priority benefit of U.S. Provi domain mediated by gamma secretase. This latter cleavage sional Application No. 61/112,699, filed Nov. 7, 2008, U.S. generates the Notch intracellular domain (ICD), which then Provisional Application No. 61/112,701, filed Nov. 7, 2008, enters the nucleus where it activates the CBF1, Suppressor of and U.S. Provisional Application No. 61/079,095, filed Jul. 8, Hairless Su(H), Lag-2 (CSL) family of transcription factors 2008, each of which is hereby incorporated by reference 10 as the major downstream effectors to increase transcription of herein in its entirety. nuclear basic helix-loop-helix transcription factors of the Hairy and Enhancer of Split E(spl) family (Artavanis et al., BACKGROUND OF THE INVENTION 1999, Science 284:770; Brennan and Brown, 2003, Breast Cancer Res. 5:69; Iso et al., 2003, Arterioscler. Thromb. Vasc. 1. Field of the Invention 15 Biol. 23:543). Alternative intracellular pathways involving The present invention relates to compositions comprising the cytoplasmic protein Deltex identified in Drosophila may an agent that binds a human Notch receptor and methods of also exist in mammals (Martinez et al., 2002, Curr. Opin. using those compositions for the treatment of cancer and Genet. Dev. 12:524-33), and this Deltex-dependent pathway other diseases. More specifically, the present invention pro may act to suppress expression of Wnt target genes (Brennan vides, for example, antibodies that specifically bind to a non et al., 1999, Curr. Biol. 9:707-710; Lawrence et al., 2001, ligand binding region of the extracellular domain of a human Curr. Biol. 11:375-85). Notch receptor and inhibit tumor growth. The present inven Mammalian Notch receptors undergo cleavage to form the tion further provides methods of treating cancer, the method mature receptor and also following ligand binding to activate comprising administering a therapeutically effective amount downstream signaling. A furin-like protease cleaves the of an antibody that specifically binds to a non-ligand binding 25 Notch receptors during maturation to generate juxtamem region of the extracellular domain of a human Notch receptor brane heterodimers that comprise a non-covalently associ protein and inhibits tumor growth. ated extracellular Subunit and a transmembrane Subunit held 2. Background together in an auto-inhibitory state. Ligand binding relieves The Notch signaling pathway is one of several critical this inhibition and induces cleavage of the Notch receptor by regulators of embryonic pattern formation, post-embryonic 30 an ADAM-type metalloprotease and a gamma-secretase, the tissue maintenance, and stem cell biology. More specifically, latter of which releases the intracellular domain (ICD) into Notch signaling is involved in the process of lateral inhibition the cytoplasm, allowing it to translocate into the nucleus to between adjacent cell fates and plays an important role in cell activate gene transcription. Cleavage by ADAM occurs fate determination during asymmetric cell divisions. Unregu within the non-ligand binding cleavage domain within the lated Notch signaling is associated with numerous human 35 membrane proximal negative regulatory region. cancers where it can alter the developmental fate of tumor Hematopoietic stem cells (HSCs) are the best understood cells to maintain them in an undifferentiated and proliferative stem cells in the body, and Notch signaling is implicated in state (Brennan and Brown, 2003, Breast Cancer Res. 5:69). their normal maintenance as well as in leukemic transforma Thus carcinogenesis can proceed by usurping homeostatic tion (Kopper & Hajdu, 2004, Pathol. Oncol. Res. 10:69-73). mechanisms controlling normal development and tissue 40 HSCs are a rare population of cells that reside in a stromal repair by stem cell populations (Beachy et al., 2004, Nature niche within the adult bone marrow. These cells are charac 432:324). terized both by a unique gene expression profile as well as an The Notch receptor was first identified in Drosophila ability to continuously give rise to more differentiated pro mutants with haploinsufficiency resulting in notches at the genitor cells to reconstitute the entire hematopoietic system. wing margin, whereas loss-of-function produces an embry 45 Constitutive activation of Notch1 signaling in HSCs and pro onic lethal “neurogenic' phenotype where cells of the epider genitor cells establishes immortalized cell lines that generate mis switch fate to neural tissue (Moohr, 1919, Genet. 4:252: both lymphoid and myeloid cells in vitro and in long-term Poulson, 1937, PNAS 23:133; Poulson, 1940, J. Exp. Zool. reconstitution assays (Varnum-Finney et al., 2000, Nat. Med. 83:271). The Notch receptor is a single-pass transmembrane 6:1278-81), and the presence of Jagged1 increases engraft receptor containing numerous tandem epidermal growth fac 50 ment of human bone marrow cell populations enriched for tor (EGF)-like repeats and three cysteine-rich Notch/LIN-12 HSCs (Karanu et al., 2000, J. Exp. Med. 192: 1365-72). More repeats within a large extracellular domain (Wharton et al., recently, Notch signaling has been demonstrated in HSCs in 1985, Cell 43:567; Kidd et al., 1986, Mol. Cell. Biol. 6:3094; vivo and shown to be involved in inhibiting HSC differentia reviewed in Artavanis et al., 1999, Science 284:770). Four tion. Furthermore, Notch signaling appears to be required for mammalian Notch proteins have been identified (Notch1. 55 Wnt-mediated HSC self-renewal (Duncan et al., 2005, Nat. Notch2. Notch3, and Notch4), and mutations in these recep Immunol. 6:314). tors invariably result in developmental abnormalities and The Notch signaling pathway also plays a central role in the human pathologies including several cancers as described in maintenance of neural stem cells and is implicated in their detail below (Gridley, 1997, Mol. Cell. Neurosci. 9:103; Jou normal maintenance as well as in brain cancers (Kopper & tel & Tournier-Lasserve, 1998, Semin. Cell Dev. Biol. 9:619 60 Hajdu, 2004, Pathol. Oncol. Res. 10:69-73: Purow et al., 25). 2005, Cancer Res.65:2353-63; Hallahanet al., 2004, Cancer Notch receptors are activated by single-pass transmem Res. 64.7794-800). Neural stem cells give rise to all neuronal brane ligands of the Delta, Serrated, Lag-2 (DSL) family. and glial cells in the mammalian nervous system during There are five known Notch ligands in mammals: Delta-like 1 development, and more recently have been identified in the (DLL1), Delta-like 3 (DLL3), Delta-like 4 (DLL4), Jagged 1 65 adult brain (Gage, 2000, Science 287: 1433-8). Mice deficient (JAG1) and Jagged 2 (JAG2) characterized by a DSL domain for Notch1; the Notch target genes Hes1, 3, and 5; and a and tandem EGF-like repeats within the extracellular domain. regulator of Notch signaling presenilin1 (PS1) show US 8,226,943 B2 3 4 decreased numbers of embryonic neural stem cells. Further al., 1999, Hum. Mel. Genet. 8:723-30; Hrabe de Angelis et al., more, adult neural stem cells are reduced in the brains of PS1 1997, Nature 386:717-21; McCright et al., 2001, Dev. 128: heterozygote mice (Nakamura et al., 2000, J. Neurosci. 491-502). In humans, mutations in Jagged 1 are associated 20:283-93; Hitoshi et al., 2002, Genes Dev. 16:846-58). The with Alagille syndrome, a developmental disorder that reduction in neural stem cells appears to result from their includes vascular defects, and mutations in Notch3 are premature differentiation into neurons (Hatakeyama et al., responsible for an inherited vascular dementia (Cadasil) in 2004, Dev. 131:5539-50) suggesting that Notch signaling which vessel homeostasis is defective (Joutel et al., 1996, regulates neural stem cell differentiation and self-renewal. Nature 383:707-10). Aberrant Notch signaling is implicated in a number of Anti-Notch antibodies and their possible use as anti-cancer human cancers. The Notch1 gene in humans was first identi 10 therapeutics have been previously reported. See, e.g., U.S. fied in a subset of T-cell acute lymphoblastic leukemias as a Patent Application Publication No. 2008/0131434, which is translocated locus resulting in activation of the Notch path incorporated by reference herein in its entirety. See also Inter way (Ellisen et al., 1991, Cell 66:649-61). Constitutive acti national Publication NOS. WO 2008/057144 and WO 2008/ Vation of Notch1 signaling in T-cells in mouse models simi 076960, as well as U.S. Patent Application Publication Nos. larly generates T-cell lymphomas Suggesting a causative role 15 2008/0226621, 2008/01 18520, and 2008/013 1908. (Robey et al., 1996, Cell 87:483-92: Pear et al., 1996, J. Exp. Med. 183:2283-91; Yan et al., 2001, Blood 98:3793-9: Bella BRIEF SUMMARY OF THE INVENTION via et al., 2000, EMBO.J. 19:3337-48). Notch1 point muta tions, insertions, and deletions producing aberrant Notch1 The present invention provides novel Notch-binding signaling have also been found to be frequently present in agents and novel antagonists of one or more human Notch both childhood and adult T-cell acute lymphoblastic leuke receptors, as well as methods of using those agents and mia/lymphoma (Pear & Aster, 2004, Curr: Opin. Hematol. antagonists. The present invention further provides novel 11:416–33). polypeptides. Such as antibodies that bind one or more human The frequent insertion of the mouse mammary tumor virus Notch receptors, fragments of Such antibodies, and other into both the Notch1 and Notch4 locus in mammary tumors 25 polypeptides related to such antibodies. In certain embodi and the resulting activated Notch protein fragments first ments, the invention provides antagonists of human Notch2 implicated Notch signaling in breast cancer (Gallahan & Cal and/or human Notch3, including, but not limited to, antibod lahan, 1987, J. Virol. 61:66-74; Brennan & Brown, 2003, ies that specifically bind human Notch2 and/or human Breast Cancer Res. 5:69; Politi et al., 2004, Semin. Cancer Notch3. As used herein, the phrase “Notch2 and/or Notch3 Biol. 14:341-7). Further studies in transgenic mice have con 30 means “Notch2.” “Notch3, or “both Notch2 and Notch3. In firmed a role for Notch in ductal branching during normal certain embodiments, the antibodies or otherantagonists bind mammary gland development, and a constitutively active to a region of the Notch receptor that is outside of the ligand form of Notch4 in mammary epithelial cells inhibits epithe binding domain (e.g., EGF10 of Notch2 or EGF9 of Notch3). lial differentiation and results in tumorigenesis (Jhappan et In certain embodiments, the antibodies specifically bind al., 1992, Genes & Dev. 6:345-5; Gallahan et al., 1996, Can 35 human Notch2. In certain embodiments, the antibodies spe cer Res. 56:1775-85; Smith et al., 1995, Cell Growth Differ: cifically bind both human Notch2 and human Notch3. In 6:563-77; Soriano et al., 2000, Int. J. Cancer 86:652-9; Uyt Some embodiments, the antibodies specifically bind human tendaele et al., 1998, Dev. Biol. 196:204-17; Politietal., 2004, Notch3. Polynucleotides comprising nucleic acid sequences Semin. Cancer Biol. 14:341-7). Evidence for a role for Notch encoding the polypeptides are also provided, as are vectors in human breast cancer is provided by data showing the 40 comprising the polynucleotides. Cells comprising the expression of Notch receptors in breast carcinomas and their polypeptides and/or polynucleotides of the invention are fur correlation with clinical outcome (Weijzen et al., 2002, Nat. ther provided. Compositions (e.g., pharmaceutical composi Med. 8:979-86; Parret al., 2004, Int. J. Mol. Med. 14:779-86). tions) comprising the novel Notch antagonists are also pro Furthermore, overexpression of the Notch pathway has been vided. Methods of using the agents and antagonists are also observed in cervical cancers (Zagouras et al., 1995, PNAS 45 provided, such as methods of using the Notch antagonists to 92:6414-8), renal cell carcinomas (Rae et al., 2000, Int. J. inhibit tumor growth, reduce the tumorigenicity of tumors, Cancer88:726-32), head and neck Squamous cell carcinomas inhibit angiogenesis, and/or treat cancer or other diseases (Leethanakul et al., 2000. Oncogene 19:3220-4), endometrial associated with angiogenesis. cancers (Suzuki et al., 2000, Int. J. Oncol. 17: 1131-9), and In one aspect, the invention provides an agent (e.g., an neuroblastomas (van Limpt et al., 2000, Med. Pediatr. Oncol. 50 antibody) that specifically binds to an EGF10 domain (or an 35:554-8), suggestive of a potential role for Notch in the equivalent of an EGF10 domain) of one or more human Notch development of a number of neoplasms. Interestingly, Notch receptors. In certain embodiments, the agent is an antibody. In signaling may play a role in the maintenance of the undiffer certain embodiments, the agent is an antagonist. In certain entiated State of Apc-mutant neoplastic cells of the colon (van embodiments, the agent specifically binds to EGF10 of Es & Clevers, 2005, Trends in Mol. Med 11:496-502). 55 human Notch2 and/or EGF9 of human Notch3. EGF9 is the The Notch pathway is also involved in multiple aspects of EGF within human Notch3 that is equivalent to EGF10 in the vascular development including proliferation, migration, other human Notch receptors Notch1, Notch2, and Notch4. In Smooth muscle differentiation, angiogenesis and arterial some embodiments, the agent specifically binds to EGF10 of venous differentiation (Isoet al., 2003, Arterioscler: Thromb. Notch 2. In some embodiments, the agent specifically binds Vasc. Biol. 23:543). For example, homozygous null muta 60 to EGF10 of Notch 2 and to EGF9 of Notch 3. In some tions in Notch1/4 and Jagged 1 as well as heterozygous loss of embodiments, the agent specifically binds to EGF9 of Notch DLL4 result in severe though variable defects in arterial 3. In other embodiments, the agent binds to at least part of the development and yolk sac vascularization. Furthermore, sequence HKGAL (SEQ ID NO:28) within Notch2 EGF10. DLL 1-deficient and Notch2-hypomorphic mice embryos In some embodiments, the agent binds to at least part of the show hemorrhaging that likely results from poor develop 65 sequence HEDAI (SEQID NO:29) within Notch3 EGF9. ment of vascular structures (Gale et al., 2004, PNAS, 101: In certain embodiments of each of the aforementioned 15949-54; Krebs et al., 2000, Genes Dev. 14:1343-52; Xue et aspects or embodiments, as well as other aspects and/or US 8,226,943 B2 5 6 embodiments described elsewhere herein, the agent inhibits light chain CDR1 comprising RASQSVRSNYLA (SEQ ID binding of a ligand to human Notch2 and/or Notch3. In some NO:8), or a variant thereof comprising 1, 2, 3, or 4 conserva embodiments, the agent inhibits binding of a ligand to human tive amino acid substitutions; a light chain CDR2 comprising Notch2. In some embodiments, the agent inhibits binding of GASSRAT (SEQID NO:9), or a variant thereofcomprising 1, a ligand to Notch2 and Notch3. In other embodiments, the 5 2, 3, or 4 conservative amino acid substitutions; and/or a light agent inhibits binding of a ligand to Notch3. In certain chain CDR3 comprising QQYSNFPI (SEQ ID NO:10), or a embodiments, the ligand is DLL4, JAG1 or JAG2. In other variant thereof comprising 1, 2, 3, or 4 conservative amino embodiments, the agent inhibits signaling of human Notch2 acid Substitutions. Pharmaceutical compositions comprising and/or Notch3. In some embodiments, the agent inhibits sig the antibody and methods of using the antibody for Such uses naling of human Notch2. In some embodiments, the agent 10 as inhibiting angiogenesis, inhibiting tumor growth, reducing inhibits signaling of Notch2 and Notch3. In other embodi the tumorigenicity of a tumor, and/or treating cancer are also ments, the agent inhibits signaling of Notch3. In some provided. embodiments Notch2 and/or Notch3 signaling is induced by In another aspect, the invention provides an antibody that DLL4, JAG1 or JAG2. Pharmaceutical compositions com specifically binds human Notch2 and/or Notch3, wherein the prising the agent and methods of using the agent for Such uses 15 antibody comprises (a) a heavy chain CDR1 comprising SSS as inhibiting angiogenesis, inhibiting tumor growth, reducing GMS (SEQ ID NO:5), a heavy chain CDR2 comprising the tumorigenicity of a tumor, and/or treating cancer are also VIASSGSNTYYADSVKG (SEQID NO:6), and/or a heavy provided. chain CDR3 comprising (G/S)(I/S)F(F/Y)(A/P)(I/T/S/N) In a further aspect, the invention provides an antibody that (SEQID NO:30); and/or (b) a light chain CDR1 comprising specifically binds human Notch2 and/or Notch3, wherein the RASQSVRSNYLA (SEQ ID NO:8), a light chain CDR2 antibody comprises (a) aheavy chain CDR1 comprising SSS comprising GASSRAT (SEQID NO:9), and/or a light chain GMS (SEQ ID NO:5), a heavy chain CDR2 comprising CDR3 comprising QQYSNFPI (SEQ ID NO:10). In some VIASSGSNTYYADSVKG (SEQID NO:6), and/or a heavy embodiments, the antibody comprises a heavy chain CDR3 chain CDR3 comprising SIFYTT (SEQ ID NO:51); and/or comprising SIFYPT (SEQ ID NO:22). In some embodi (b) a light chain CDR1 comprising RASQSVRSNYLA (SEQ 25 ments, the antibody comprises a heavy chain CDR3 compris ID NO:8), a light chain CDR2 comprising GASSRAT (SEQ ing SSSFFAS (SEQ ID NO:23). In other embodiments, the IDNO:9), and/or alight chain CDR3 comprising QQYSNFPI antibody comprises a heavy chain CDR3 comprising SSF (SEQ ID NO:10). In some embodiments, the antibody com YAS (SEQID NO:24). In certain embodiments, the antibody prises (a) aheavy chain CDR1 comprising SSSGMS (SEQID comprises aheavy chain CDR3 comprising SSFFAT (SEQID NO:5), or a variant thereof comprising 1, 2, 3, or 4 conserva 30 NO:25). In some embodiments, the antibody comprises a tive amino acid substitutions; a heavy chain CDR2 compris heavy chain CDR3 comprising SIFYPS (SEQID NO:26). In ing VIASSGSNTYYADSVKG (SEQID NO:6), or a variant yet other embodiments, the antibody comprises aheavy chain thereof comprising 1, 2, 3, or 4 conservative amino acid CDR3 comprising SSFFAN (SEQID NO:27). Pharmaceuti substitutions; and/or a heavy chain CDR3 comprising cal compositions comprising the antibody and methods of SIFYTT (SEQID NO:51), or a variant thereof comprising 1, 35 using the antibody for Such uses as inhibiting angiogenesis, 2, 3, or 4 conservative amino acid Substitutions; and/or (b) a inhibiting tumor growth, reducing the tumorigenicity of a light chain CDR1 comprising RASQSVRSNYLA (SEQ ID tumor, and/or treating cancer are also provided. NO:8), or a variant thereof comprising 1, 2, 3, or 4 conserva In another aspect, the invention provides a polypeptide that tive amino acid substitutions; a light chain CDR2 comprising comprises: (a) a polypeptide (e.g., a heavy chain variable GASSRAT (SEQID NO:9), or a variant thereofcomprising 1, 40 region) having at least about 80% sequence identity to SEQ 2, 3, or 4 conservative amino acid substitutions; and/or a light ID NO:50, SEQID NO:14, SEQID NO:40, SEQID NO:52, chain CDR3 comprising QQYSNFPI (SEQ ID NO:10), or a SEQ ID NO:53, SEQ ID NO:54, SEQ ID NO:55, SEQ ID variant thereof comprising 1, 2, 3, or 4 conservative amino NO:56, SEQID NO:57, or SEQID NO:20 (with or without acid Substitutions. Pharmaceutical compositions comprising signal sequence); and/or (b) a polypeptide (e.g., a light chain the antibody and methods of using the antibody for Such uses 45 variable region) having at least about 80% sequence identity as inhibiting angiogenesis, inhibiting tumor growth, reducing to SEQID NO:13, SEQID NO:19 or SEQID NO:39 (with or the tumorigenicity of a tumor, and/or treating cancer are also without signal sequence). In certain embodiments, the provided. polypeptide is an antibody. In certain embodiments, the In a further aspect, the invention provides an antibody that polypeptide specifically binds human Notch2 and/or Notch3. specifically binds human Notch2 and/or Notch3, wherein the 50 In some embodiments, the polypeptide specifically binds to antibody comprises (a) aheavy chain CDR1 comprising SSS human Notch2. In some embodiments, the polypeptide binds GMS (SEQ ID NO:5), a heavy chain CDR2 comprising to Notch2 and Notch3. In other embodiments, the polypep VIASSGSNTYYADSVKG (SEQID NO:6), and/or a heavy tide binds to Notch3. In certain embodiments, the polypeptide chain CDR3 comprising GIFFAI (SEQID NO:7); and/or (b) comprises a polypeptide having at least about 85%, at least a light chain CDR1 comprising RASQSVRSNYLA (SEQID 55 about 90%, at least about 95%, at least about 98%, or about NO:8), a light chain CDR2 comprising GASSRAT (SEQ ID 100% sequence identity to SEQID NO:14, SEQID NO:13, or NO:9), and/or a light chain CDR3 comprising QQYSNFPI SEQ ID NO:50. Pharmaceutical compositions comprising (SEQID NO:10). In certain embodiments, the antibody spe the polypeptide and methods of using the polypeptide for cifically binds Notch2. In some embodiments, the antibody Such uses as inhibiting angiogenesis, inhibiting tumor comprises (a) a heavy chain CDR1 comprising SSSGMS 60 growth, reducing the tumorigenicity of a tumor, and/or treat (SEQ ID NO:5), or a variant thereof comprising 1, 2, 3, or 4 ing cancer are also provided. conservative amino acid substitutions; a heavy chain CDR2 In still another aspect, the invention provides a polypeptide comprising VIASSGSNTYYADSVKG (SEQID NO:6), or a (e.g., an antibody or a heavy chain or light chain of an anti variant thereof comprising 1, 2, 3, or 4 conservative amino body) comprising: (a) a polypeptide having at least about acid Substitutions; and/or a heavy chain CDR3 comprising 65 80% sequence identity to SEQID NO:49, SEQID NO:16, or GIFFAI (SEQID NO:7), or a variant thereof comprising 1,2, SEQID NO:2 (with or without signal sequence); and/or (b) a 3, or 4 conservative amino acid Substitutions; and/or (b) a polypeptide having at least about 80% sequence identity to US 8,226,943 B2 7 8 SEQ ID NO:18, or SEQ ID NO:4 (with or without signal In a further aspect, the antibody competes for specific sequence. In certain embodiments, the polypeptide comprises binding to human Notch2 and/or Notch3 with an antibody a polypeptide having at least about 85%, at least about 90%, comprising a heavy chain variable region comprising SEQID at least about 95%, at least about 98%, or about 100% NO:50 and a light chain variable region comprising SEQID sequence identity to SEQID NO:39 or SEQID NO:40. Phar NO:13. In some embodiments, the antibody competes for maceutical compositions comprising the antibodies and specific binding with a 59R5 antibody comprising the heavy methods of treating cancer comprising administering thera chain and light chain of SEQID NOs: 49 and 18, respectively, peutically effective amounts of the antibodies are also pro or as encoded by the DNA deposited with the ATCC on Jul. 6, vided. 2009, and assigned designation number PTA-10170. In some 10 embodiments, the antibody competes for binding to human In another aspect, the invention provides a polypeptide Notch2. In some embodiments, the antibody competes for (e.g., an antibody or a heavy chain or light chain of an anti binding to human Notch2 and Notch3. In other embodiments, body) comprises: (a) a polypeptide having at least about 80% the antibody competes for binding to human Notch3. Phar sequence identity to SEQID NO:50; and/or (b) a polypeptide maceutical compositions comprising the antibody and meth having at least about 80% sequence identity to SEQ ID 15 ods of using the antibody for Such uses as inhibiting angio NO:13. In certain embodiments, the polypeptide comprises a genesis, inhibiting tumor growth, reducing the polypeptide having at least about 85%, at least about 90%, at tumorigenicity of a tumor, and/or treating cancer are also least about 95%, at least about 98%, or about 100% sequence provided. identity to SEQ ID NO:50 or SEQ ID NO:13. In certain In certain other aspects, the invention provides a polypep embodiments, the polypeptide is an antibody that binds tide (with or without a signal sequence) comprising a human Notch2 and/or human Notch3. Pharmaceutical com sequence selected from the group consisting of SEQ ID positions comprising the antibodies and methods of treating NO:2, SEQID NO:4, SEQID NO:16, SEQID NO:18, SEQ cancer comprising administering therapeutically effective ID NO:13, SEQID NO:14, SEQID NO:39, SEQID NO:40, amounts of the antibodies are also provided. SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:49, SEQ ID In another aspect, the invention provides an antibody that 25 NO:50, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:54, comprises, consists, or consists essentially of a 59R1 IgG2 SEQID NO:55, SEQID NO:56, and SEQID NO:57, as well antibody comprising the heavy chain and light chain of SEQ as a polynucleotide encoding Such a polypeptide. In certain ID NOs: 16 and 18 (with or without signal sequence), respec embodiments, the polypeptide is an antibody. In certain tively, or as encoded by the DNA deposited with the American embodiments, the antibody specifically binds to human Type Culture Collection (ATCC), 10801 University Boule 30 Notch2 and/or human Notch3. In certain embodiments, the vard, Manassas, Va., USA, under the conditions of the Budap antibody specifically binds to human Notch2. In certain est Treaty on Oct. 15, 2008, and assigned designation number embodiments, the antibody specifically binds to human PTA-9547. Pharmaceutical compositions comprising the Notch2 and human Notch3. In certain embodiments, the anti antibody and methods of using the antibody for Such uses as body specifically binds to human Notch3. In another aspect, inhibiting angiogenesis, inhibiting tumor growth, reducing 35 the invention provides a polynucleotide comprising a the tumorigenicity of a tumor, and/or treating cancer are also sequence selected from the group consisting of SEQ ID provided. NO:1, SEQID NO:3, SEQID NO:15, SEQID NO:17, SEQ In an additional aspect, the invention provides an antibody ID NO:47, SEQID NO:48, SEQID NO:58, SEQID NO. 59 that comprises, consists or consists essentially of a 59R5 and SEQID NO:60. IgG2 antibody comprising the heavy chain and light chain of 40 In another aspect, the invention provides a method of SEQ ID NO:49 and SEQ ID NO:18 (with or without signal modulating the function of pericytes and/or vascular Smooth sequence), respectively, or as encoded by the DNA deposited muscle cells in a subject (e.g., at the site of a tumor or other with the ATCC on Jul. 6, 2009, and assigned designation aberrant angiogenesis in the Subject). In certain embodi number PTA-10170. Pharmaceutical compositions compris ments, the method comprises administering an effective ing the antibody and methods of using the antibody for Such 45 amount of an agent that specifically binds human Notch2 uses as inhibiting angiogenesis, inhibiting tumor growth, and/or human Notch3 to the subject. In certain embodiments, reducing the tumorigenicity of a tumor, and/or treating cancer the agent is an antibody. In some embodiments, the agent is an are also provided. antibody described in any one of the aforementioned aspects In another aspect, the invention provides an antibody that and/or embodiments, as well as other aspects and/or embodi competes for specific binding to human Notch2 and/or 50 ments described herein. In certain embodiments, the agent is Notch3 with an antibody comprising a heavy chain variable an antagonist. In certain embodiments, the agent specifically region comprising SEQID NO:14 and a light chain variable binds to and is an antagonist of human Notch3. In certain region comprising SEQID NO:13. In certain embodiments, embodiments, the modulation of the function of the pericytes the antibody competes for specific binding with a 59R1 IgG2 and/or vascular smooth muscle cells results in inhibition of antibody comprising the heavy chain and light chain of SEQ 55 angiogenesis and/or tumor growth. ID NOs: 16 and 18 (with or without signal sequence), respec In still another aspect, the invention provides a method of tively, or as encoded by the DNA deposited with the ATCC on inhibiting angiogenesis (e.g., tumor angiogenesis) in a Sub Oct. 15, 2008, and assigned designation number PTA-9547. ject. In certain embodiments, the method comprises admin In some embodiments, the antibody competes for binding to istering to the Subject an effective amount of an agent that human Notch2. In some embodiments, the antibody com 60 specifically binds human Notch2 and/or human Notch3. In petes for binding to human Notch2 and Notch3. In other certain embodiments, the agent is an antagonist. In some embodiments, the antibody competes for binding to human embodiments, the agent specifically binds to and is an antago Notch3. Pharmaceutical compositions comprising the anti nist of human Notch2. In certain embodiments, the agent body and methods of using the antibody for Such uses as specifically binds to and is an antagonist of human Notch3. In inhibiting angiogenesis, inhibiting tumor growth, reducing 65 Some embodiments, the agent is an antagonist of both Notch2 the tumorigenicity of a tumor, and/or treating cancer are also and Notch3. In some embodiments, the antagonist is an anti provided. body. In certain embodiments, the agent is an antibody. In US 8,226,943 B2 10 Some embodiments, the agent is an antibody described in any and if the two or more human Notch receptors comprise one of the aforementioned aspects and/or embodiments, as Notch3, the antibody binds to EGF9 of Notch3. In certain well as other aspects and/or embodiments described herein. embodiments, the non-ligand binding region is not EGF4. In In some embodiments, the antagonist is not an antibody. In certain embodiments, the two or more human Notch receptors Some embodiments, the method of inhibiting angiogenesis comprise Notch2. In certain embodiments, the two or more further comprises administering to the Subject an antagonist human Notch receptors comprise Notch3. In still further of vascular endothelial cell growth factor (VEGF) or of a embodiments, the two or more human Notch receptors com VEGF receptor. In certain embodiments, the method is a prise Notch2 and Notch3. In certain embodiments, the anti method of inhibiting angiogenesis by modulating the func body is an antagonist of the two or more human Notch recep tion of pericytes and/or vascular Smooth muscle cells. 10 In a further aspect, the invention provides a method of tors. In certain embodiments, the antibody inhibits tumor inhibiting growth of a tumor in a Subject. In certain embodi growth. Pharmaceutical compositions comprising the anti ments, the method comprises administering to the Subject a bodies and methods of treating cancer comprising adminis therapeutically effective amount of an antagonist of human tering therapeutically effective amounts of the antibodies are Notch2 and/or human Notch3. In certain embodiments, the 15 also provided. antagonist is an antibody that specifically binds human In yet another aspect, the invention provides an isolated Notch2. In some embodiments, the antagonist is an antibody antibody that specifically binds to a non-ligand binding that specifically binds both human Notch2 and human region of an extracellular domain of a human Notch2 receptor Notch3. In certain embodiments, the antagonist is an anti and inhibits tumor growth, wherein the non-ligand binding body that specifically binds human Notch3. In some embodi region comprises or consists of EGF repeat 10 of the human ments, the antagonist is an antibody described in any one of Notch2 receptor (e.g., SEQ ID NO:36). In some embodi the aforementioned aspects and/or embodiments, as well as ments, the antibody does not bind to any region of human other aspects and/or embodiments described herein. In cer Notch2 outside of EGF repeat 10. In certain embodiments, tain embodiments, the tumor comprises a deletion or other the antibody also specifically binds to EGF repeat 10 (or mutation in the phosphatase and tensin homolog (PTEN) 25 equivalent) of at least one additional human Notch receptor gene. In certain embodiments, the tumor is a breast tumor. (e.g., EGF9 of Notch3). In some embodiments, the antibody In a still further aspect, the invention provides a method of binds to human Notch2 EGF10 and Notch3 EGF9. Pharma selecting a subject for treatment with a human Notch2 and/or ceutical compositions comprising the antibodies and meth human Notch3 antagonist. In certain embodiments, the ods of treating cancer comprising administering therapeuti method comprises (a) determining if the tumor comprises a 30 cally effective amounts of the antibodies are also provided. deletion or mutation in the phosphatase and tensin homolog In yet another aspect, the invention provides an isolated (PTEN) gene; and (b) selecting the subject for treatment with antibody that specifically binds to a non-ligand binding a Notch2 and/or Notch3 antagonist if the tumor comprises the region of an extracellular domain of a human Notch3 receptor deletion or mutation. In some embodiments, the Subject is and inhibits tumor growth, wherein the non-ligand binding treated with a Notch2 antagonist. In some embodiments, the 35 region comprises or consists of EGF repeat 9 of the human subject is treated with an antagonist of Notch2 and Notch3. In Notch3 receptor (equivalent to EGF10 in the other Notch Some embodiments, the Subject is treated with an antagonist receptors). In some embodiments, the antibody does not bind of Notch3. In some embodiments the antagonist is an anti to any region of human Notch3 outside of EGF repeat 9. In body. In certain embodiments, the tumor is a breast tumor. certain embodiments, the antibody also specifically binds to In another aspect, the invention provides an antibody that 40 EGF repeat 10 of at least one additional human Notch recep specifically binds to a non-ligand binding region of an extra tor. In some embodiments, the antibody binds to human cellular domain of at least one human Notch receptor (e.g., 1, Notch3 EGF9 and Notch2 EGF10. Pharmaceutical composi 2, 3, or 4. Notch receptors). In certain embodiments, the non tions comprising the antibodies and methods of treating can ligand binding region comprises or consists of EGF repeat 10 cer comprising administering therapeutically effective of a human Notch receptor (or an equivalent of EGF10, such 45 amounts of the antibodies are also provided. as EGF9 of human Notch3). In some embodiments, the anti In a still further aspect, the invention provides an antibody body inhibits tumor growth. In some embodiments, the anti that binds a non-ligand binding region of an extracellular body inhibits binding of a ligand to a Notch receptor. In domain of a human Notch receptor and comprises: (a) a heavy certain embodiments, the antibody inhibits signaling by the chain CDR1 comprising SSSGMS (SEQ ID NO:5), a heavy Notch receptor. In some embodiments, the Notch receptor is 50 chain CDR2 comprising VIASSGSNTYYADSVKG (SEQ a human Notch1, Notch2, Notch3, or Notch4 receptor. In ID NO:6), and/or a heavy chain CDR3 comprising GIFFAI certain embodiments, the antibody specifically binds to (SEQ ID NO:7); and/or (b) a light chain CDR1 comprising Notch2 (for example, EGF10 of Notch2). In certain embodi RASQSVRSNYLA (SEQ ID NO:8), a light chain CDR2 ments, the antibody specifically binds to Notch2 and at least comprising GASSRAT (SEQID NO:9), and/or a light chain one additional Notch receptor. In certain embodiments, the 55 CDR3 comprising QQYSNFPI (SEQ ID NO:10). In certain additional Notch receptor is Notch3. Pharmaceutical compo embodiments, the human Notch receptor is Notch2. In certain sitions comprising the antibodies and methods of treating embodiments, the antibody binds to EGF10 of a human cancer comprising administering therapeutically effective Notch2 receptor and/or EGF9 of a human Notch3 receptor. In amounts of the antibodies are also provided. an additional aspect, the invention provides an antibody that In an additional aspect, the invention provides an antibody 60 competes with Such an antibody for specific binding to a that specifically binds to two or more (i.e., at least two or two, non-ligand binding region of an extracellular domain of three, or four) human Notch receptors. In certain embodi Notch2 in a competitive binding assay. Pharmaceutical com ments, the antibody specifically binds to a non-ligand binding positions comprising the antibodies and methods of treating region of an extracellular domain of the two or more human cancer comprising administering therapeutically effective Notch receptors. In certain embodiments, if the two or more 65 amounts of the antibodies are also provided. Methods of human Notch receptors comprise Notch1, Notch2, or Notch4, inhibiting angiogenesis comprising administering the com the antibody binds to EGF10 of Notch1, Notch2, or Notch4, positions are also provided. US 8,226,943 B2 11 12 In another aspect, the invention provides an antibody that In certain embodiments of each of the aforementioned binds a non-ligand binding region of an extracellular domain aspects or embodiments, as well as other aspects and/or of a human Notch receptor and comprises: (a) a heavy chain embodiments described elsewhere herein, the antagonist or CDR1 comprising SSSGMS (SEQ ID NO:5), a heavy chain antibody is administered to a Subject in combination with an CDR2 comprising VIASSGSNTYYADSVKG (SEQ ID additional treatment for cancer. In certain embodiments, the NO:6), and/or a heavy chain CDR3 comprising SIFYTT additional treatment for cancer comprises radiation therapy, (SEQID NO:51); and/or (b) a light chain CDR1 comprising chemotherapy, and/or an additional antibody therapeutic. In RASQSVRSNYLA (SEQ ID NO:8), a light chain CDR2 Some embodiments, the additional treatment for cancer com comprising GASSRAT (SEQID NO:9), and/or a light chain prises a chemotherapeutic agent. In certain embodiments, the 10 chemotherapy comprises paclitaxel (e.g., TAXOL), irinote CDR3 comprising QQYSNFPI (SEQ ID NO:10). In certain can, gemcitabine, and/or oxaliplatin. In certain embodiments, embodiments, the human Notch receptor is Notch2. In some the additional antibody therapeutic is an antibody that spe embodiments, the antibody binds to the human Notch2 and cifically binds a human Notch receptor (e.g., Notch1, 2, 3, or Notch3 receptors. In certain embodiments, the antibody binds 4) or a human Notch receptor ligand (e.g., DLL4 or JAG1). In to EGF 10 of a human Notch2 receptor and/or EGF9 of a 15 Some embodiments, the additional antibody therapeutic is an human Notch3 receptor. In another embodiment, the inven anti-DLL4 antibody. In certain alternative embodiments, the tion provides an antibody that competes with Such an anti additional antibody therapeutic is an antibody that specifi body for specific binding to a non-ligand binding region of an cally binds vascular endothelial cell growth factor (VEGF). In extracellular domain of Notch2 in a competitive binding certain embodiments, the additional therapeutic binds a assay. Pharmaceutical compositions comprising the antibod VEGF receptor. ies and methods of treating cancer comprising administering In certain embodiments of each of the aforementioned therapeutically effective amounts of the antibodies are also aspects or embodiments, as well as other aspects and/or provided. Methods of inhibiting angiogenesis comprising embodiments described elsewhere herein, the antibody is administering the compositions are also provided. administered to a Subject in combination with a second thera In certain embodiments of each of the aforementioned 25 peutic agent that is an anti-angiogenic agent. aspects or embodiments, as well as other aspects and/or Cell lines (e.g., hybridoma cell lines) comprising or pro embodiments described elsewhere herein, the antibody spe ducing the antibodies or other polypeptides described herein cifically binds to both human Notch2 and human Notch3. are further provided by the invention. Polynucleotides (e.g., In certain embodiments of each of the aforementioned vectors) comprising the polynucleotides described herein, aspects or embodiments, as well as other aspects and/or 30 including polynucleotides encoding the polypeptides or the embodiments described elsewhere herein, the antibody is a light chain variable regions or heavy chain variable regions of recombinant antibody. In certain embodiments, the antibody the antibodies described herein are also provided, as are cell is a monoclonal antibody. In certain embodiments, the anti lines comprising Such polynucleotides. body is a chimeric antibody. In certain embodiments, the In certain embodiments, the present invention provides a antibody is a humanized antibody. In certain embodiments, 35 method of treating cancer, wherein the cancer comprises can the antibody is a human antibody. In some embodiments, the cer stem cells, comprising administering to the Subject a antibody is monovalent, bivalent or multivalent. In certain therapeutically effective amount of an antibody which binds embodiments, the antibody is a monospecific antibody. In a Notch receptor. In a more particular aspect, the present certain embodiments, an individual antigen-binding site of invention provides a method of treating cancer, wherein the the antibody binds (or is capable of binding) a non-ligand 40 cancer comprises stem cells expressing one or more Notch binding region of the extracellular domain of more than one receptor family members, comprising administering to the human Notch receptor (e.g., Notch2 and Notch3). In certain subject a therapeutically effective amount of an antibody that alternative embodiments, the antibody is a bispecific anti binds those Notch receptor family members. The present body. In certain embodiments, the antibody is an IgG1 anti invention provides antibodies that bind to the non-ligand body. In certain embodiments, the antibody is an IgG2 anti 45 binding domain of the extracellular domain of a human Notch body. In certain embodiments, the antibody is conjugated to a receptor and are therapeutically effective against cancer. cytotoxic moiety. In certain embodiments, the antibody is Thus, in certain embodiments, the present invention provides isolated. In still further embodiments, the antibody is substan an antibody that specifically binds to a non-ligand binding tially pure. region of the extracellular domain of a human Notch receptor In certain embodiments of each of the aforementioned 50 and that inhibits tumor growth. In certain embodiments, the aspects or embodiments, as well as other aspects and/or present invention further provides a method of treating can embodiments described elsewhere herein, the cancer or cer, the method comprising administering a therapeutically tumor treated with the antibody is a breast, colorectal, lung, effective amount of an antibody that specifically binds to a pancreatic, prostate, or head and neck cancer or tumor. In non-ligand binding region of the extracellular domain of a certain embodiments, the cancer or tumor is melanoma. In 55 human Notch receptor protein and inhibits tumor growth. certain embodiments, the cancer or tumor is a breast cancer or Various advantages in using an antibody that binds Notch tumor. In certain embodiments, the cancer or tumor is a col receptor family members or the ligands to those Notch recep orectal cancer or tumor. In certain embodiments, the cancer or tors to treat Such cancers are contemplated herein. In some tumor is a pancreatic cancer or tumor. In certain embodi embodiments, certain Notch receptors are highly expressed in ments, the cancer or tumor is a prostate cancer or tumor. 60 certain solid tumors, for example, breast and colon, and this In certain embodiments of each of the aforementioned provides a sink for active drug where the drug binds to the aspects or embodiments, as well as other aspects and/or Notch receptor. Antibodies that bind overexpressed Notch embodiments described elsewhere herein, the methods of receptors are anticipated to have a better safety profile than treating cancer comprise inhibiting tumor growth. In certain currently available chemotherapeutic drugs. embodiments, the methods of treating cancer comprise 65 The invention further provides a method of treating cancer reducing the tumorigenicity of tumors (e.g., by reducing the in a human, wherein the cancer comprising cancer stem cells frequency of cancer stem cells in the tumor). is not characterized by overexpression by the cancer stem cell US 8,226,943 B2 13 14 of one or more Notch receptors, comprising administering to The invention additionally provides: an antibody (e.g., a the human a therapeutically effective amount of an antibody human antibody or a humanized antibody) which binds Notch which binds to a Notch receptor and blocks ligand activation and blocks ligand activation of a Notch receptor, a composi of a Notch receptor. tion comprising the antibody and a pharmaceutically accept The invention further provides a method of treating cancer able carrier, and an immunoconjugate comprising the anti in a human comprising administering to the human therapeu body conjugated with a cytotoxic agent. tically effective amounts of (a) a first antibody which binds a In one aspect, the invention provides an isolated polynucle Notch receptor and inhibits growth or proliferation of cancer otide encoding any of the antibodies or polypeptides of the stem cells which overexpress Notch receptors; and (b) a sec aforementioned aspects or embodiments, as well as other ond antibody which binds a Notch receptor and blocks ligand 10 aspects and/or embodiments described elsewhere herein. In activation of a Notch receptor. Some embodiments, the invention provides a vector compris The invention also provides a method of treating cancer, ing the polynucleotide. In some embodiments, a host cell wherein the cancer is selected from the group consisting of comprises the polynucleotide or the vector. In other embodi breast, colon, rectal and colorectal cancer, comprising admin ments, a process of producing the antibody comprises cultur istering a therapeutically effective amount of an antibody 15 ing a host cell comprising the polynucleotide so that the which binds Notch. The invention also provides another polynucleotide is expressed and, optionally, further com method of treating cancer, wherein the cancer is selected from prises recovering the antibody from the host cell culture (e.g., the group consisting of breast, colon, pancreatic, prostate, from the host cell culture medium). lung, rectal and colorectal cancer, comprising administering a Moreover, the invention provides an isolated polynucle therapeutically effective amount of an antibody that blocks otide encoding a humanized or human antibody as described ligand activation of a Notch receptor. The invention also in the aforementioned embodiments or aspects, as well as provides still another method of treating cancer, wherein the described elsewhere herein; a vector comprising the poly cancer is selected from the group consisting of breast, colon, nucleotide; a host cell comprising the polynucleotide or the pancreatic, prostate, lung, rectal and colorectal cancer, com vector; as well as a process of producing the antibody com prising administering atherapeutically effective amount of an 25 prising culturing a host cell comprising the polynucleotide so antibody that binds Notch and an antibody that blocks ligand that the polynucleotide is expressed and, optionally, further activation of a Notch receptor. comprising recovering the antibody from the host cell culture In further embodiments, the invention provides articles of (e.g., from the host cell culture medium). manufacture for use (among other things) in the above meth The invention further pertains to an immunoconjugate ods. For example, the invention provides an article of manu 30 comprising an antibody that binds Notch conjugated to one or facture comprising a container and a composition contained more calicheamicin molecules, and the use of Such conju therein, wherein the composition comprises an antibody that gates for treating a Notch expressing cancer, e.g., a cancer in binds Notch, and further comprises a package insert indicat which cancer stem cells overexpress Notch. ing that the composition can be used to treat a cancer com Where aspects or embodiments of the invention are prising cancer stem cells. In some embodiments, the inven 35 described in terms of a Markush group or other grouping of tion provides an article of manufacture comprising a alternatives, including, but not limited to, groups of alterna container and a composition contained therein, wherein the tives separated by “and/or” or “or the present invention composition comprises an antibody that binds Notch, and encompasses not only the entire group listed as a whole, but further comprises a package insert indicating that the com each member of the group individually and all possible sub position can be used to treat cancer comprising cancer stem 40 groups of the main group, but also the main group absent one cells that express one or more Notch receptors. or more of the group members. The present invention also In certain embodiments, the invention additionally pertains envisages the explicit exclusion of one or more of any of the to an article of manufacture comprising a container and a group members in the claimed invention. For example, lan composition contained therein, wherein the composition guage such as “X and/or Y’ encompasses “X” individually, comprises an antibody which binds a Notch receptor and 45 “Y” individually, as well as “X” and “Y” together. blocksligand activation of a Notch receptor, and further com prises a package insert indicating that the composition can be BRIEF DESCRIPTION OF THE used to treat cancer, wherein the cancer comprises cancer DRAWINGS/FIGURES stem cells that are not characterized by overexpression of the Notch receptor. 50 FIG. 1: 59R1 antibodies and variants bind human Notch2 In certain embodiments, an article of manufacture is pro and block ligand binding. (A) FACS analysis of binding by vided which comprises (a) a first container with a composi 59R1 Fab to human Notch2. “Clone 1 is 59R1 Fab which tion contained therein, wherein the composition comprises a was shown to bind human Notch2 on stably transfected first antibody that binds a Notch receptor and inhibits growth HEK293 cells. “Clone 5’ is the Fab of a different clone of cancer cells comprising cancer stem cells overexpressing 55 isolated from the phage library which did not bind Notch2. Notch; and (b) a second container with a composition con (B) FACS analysis of blocking of ligand (JAG1) binding by tained therein, wherein the composition comprises a second 59R1 Fab. “Clone 1 is 59R1 Fab which was shown to block antibody which binds Notch and blocks ligand activation of a binding of a hagged 1 ECD-Fc fusion to human Notch2 on Notch receptor. stably transfected HEK293 cells. “Clone 5” is the Fab of a In some embodiments, a further article of manufacture is 60 different clone isolated from the phage library which did not provided which comprises a container and a composition block ligand binding in the assay. (C) FACS analysis of bind contained therein, wherein the composition comprises an ing of 59R1 IgG2 antibody to human Notch2 on stably trans antibody which binds Notch and blocks ligand activation of a fected HEK293 cells.59R1 IgG2antibody was shown to bind Notch receptor, and further comprises a package insert indi human Notch2 on stably transfected HEK293 cells. (D) cating that the composition can be used to treat a cancer 65 FACS analysis of blocking of ligand (DLL4) binding by 59R1 selected from the group consisting of colon, pancreatic, pros IgG2 antibody. 59R1 IgG2 antibody was shown to block tate, lung, rectal and colorectal cancer. binding of a hDLL4 ECD-Fc fusion to human Notch2 on US 8,226,943 B2 15 16 stably transfected HEK293 cells. (E) Affinity maturation Tumors. NOD/SCID mice injected with PN4 pancreatic strategy for heavy chain CDR3 of 59R1. The parental tumor cells were treated with control antibody (squares) or sequence of the heavy chain CDR3 of 59R1 is shown boxed. anti-Notch2/3 antibody 59R1 (diamonds) after tumor volume Allowed residue changes are as indicated below the parental reached an a size between 65 to 200 mm. Mean tumor sequence in the figure. (F) Screening of affinity maturated 5 Volume (y-axis, mm) was measured across time (X-axis, days 59R1 sequences for JAG1 blocking ability. Improved variants post cell injection). Treatment with 59R1 antibodies inhibited are indicated with arrows. tumor growth compared to control (*** p<0.001 after day FIG. 2: FACS analysis of cross-reactivity of the 59R1 IgG2 70). (E) Anti-Notch2/3 (59R1) Inhibits the Growth of PE13 antibody to the four human Notch homologues. 59R1 was Breast Tumors. NOD/SCID mice injected with PE13 breast found to bind hNotch2 and hNotch3 on transiently trans 10 tumor cells were treated with control antibody (squares) or fected HEK-293 cells but was found to not exhibit significant anti-Notch2/3 antibody 59R1 (diamonds) after tumor volume binding to hNotch1 and hNotch4 on the same cells. reached a size between 65 to 200 mm. Mean tumor volume FIG. 3: Epitope mapping of 59R1 antibody. (A) Anti (y-axis, mm) was measured across time (X-axis, days post Notch2/3 antibody 59R1 binds to EGF repeat 10 of human cell injection). Treatment with 59R1 antibodies inhibited Notch2. Supernatant from HEK 293 cells expressing recom 15 tumor growth compared to control (p<0.05 after day 57). (F) binant Notch2-Fc fusion proteins with the indicated EGF Anti-Notch2/3 (59R1) Inhibits the Growth of T3 Breast repeats of Notch2 between 1 and 12 (X-axis) were used in Tumors. NOD/SCID mice injected with T3 breast tumor cells ELISA with anti-Notch2/3 antibody 59R1. The OD (y-axis) were treated with control antibody (solid bars) or anti indicated antibody binding (hatched bars) only to Notch2 Notch2/3 antibody 59R1 (open bars) after tumor volume fusion proteins comprising EGF repeat 10. (The figure shows reached a size between 65 to 200 mm. Mean tumor volume data obtained from two separate experiments which are was measured on days 18, 25, 39, and 42 post cell injection. shown separately in the top and bottom graphs.) (B) EGF Treatment with 59R1 antibodies inhibited tumor growth com Repeats 11 and 12 are not involved in anti-Notch2/3 antibody pared to control (*** p<0.001 on day 42). 59R1 binding to full length hNotch2. FACS analysis of HEK FIG. 6: Anti-Notch2/3 antibody 59R1 delays B51 breast 293 cells transfected with green fluorescent protein (GFP) 25 tumor recurrence after paclitaxel treatment. (X-axis) alone (top left) or co-transfected with GFP and either FIG. 7: Anti-Notch2/3 antibody 59R1 decreases cancer full length Notch2 intactor with full length Notch2 with EGF stem cell frequency in B51 breast tumor. repeat 11 deleted (AEGF11) or EGF repeat 12 deleted FIG. 8: In combination with gemcitabine, anti-Notch2/3 (AEGF12). Binding of 59R1 is indicated along the y-axis antibody 59R1 inhibits the growth of PN4 pancreatic tumors. (PE) to all three Notch2 proteins in GFP-expressing cells. (C) 30 FIG. 9: Anti-Notch2/3 antibody 59R1 inhibits tumor EGF repeat 10 is involved in anti-Notch2/3 antibody 59R1 growth in an M4 melanoma Xenograft model. binding to full-length hNotch2, but not in ligand binding. FIG.10: Anti-Notch2/3 antibody 59R1 inhibits the growth Binding by an anti-Notch2 antibody 59M70 that binds to of C28 colon tumors alone and in combination with irinote EGF1-4 of hNotch2 is indicated as “anti-Notch2 binding.” Ca. Binding by DLL4 is indicated as “ligand binding.” 35 FIG. 11:59R1 IgG2 antibody significantly inhibits tumor FIG. 4: Anti-Notch2/3 antibody 59R1 inhibits Notch2 sig growth of established human tumor xenografts in vivo. Estab naling in luciferase reporter assays. (A)59R1 blocks hDLL4 lished Colo-205 (A), C8 (B), PN8 (C), B34 (D), B39 (E), B44 induced Notch2 reporter activity. (B) 59R1 blocks hAG1 (F), PE-13 (G) and T1 (H) tumors (s.c., n=10 per group) were induced Notch2 reporter activity (C) 59R1 blocks hAG2 treated at 15 mg/kg once a week with the indicated antibodies induced Notch2 reporter activity 40 (1B711, LZ-1 control antibody, black squares; 59R1, black FIG. 5: Notch2/3 Receptor Antibody 59R1 Inhibits Tumor triangles; AVASTIN, black circles; AVASTIN+59R1, black Formation and Growth. In vivo. (A) Anti-Notch2/3 (59R1) diamonds). Tumor Volume (X-axis) is plotted over time Inhibits the Formation of PE13 Breast Tumors. NOD/SCID (y-axis). In the Colo-205 xenograft model, combination mice injected with PE13 breast tumor cells were treated with therapy of 59R1 with AVASTIN was significantly more effec control antibody (squares) or anti-Notch2/3 antibody 59R1 45 tive than either antibody treatment alone. In FIGS. 11B-11H, (open triangles) two days after cell injection and tumor Vol asterisks indicate significant tumor-growth inhibition at day ume (y-axis, mm) was measured across time (X-axis, days shown: *, P<0.05; **, P<0.01: ***, P<0.001, Student's t-test; post cell injection). Treatment with 59R1 antibodies signifi Symbols, mean: bars, SEM. cantly inhibited tumor formation compared to control. FIG. 12: Relative expression levels of selected genes are (p<0.001) (B) Anti-Notch2/3 (59R1) Inhibits Formation of 50 significantly regulated by 59R1 treatment in various T3 Breast Tumors. NOD/SCID mice injected with T3 breast xenograft tumor models. Expression levels of HEYL (A), tumor cells were treated with control antibody (squares) or Notch3 (B), RGS5 (C), ANGPT1 (D) and ANGPT2 (E) were anti-Notch2/3 antibody 59R1 (open triangles) two days after individually tested by TaqMan(R) analysis from previously cellinjection, and tumor volume (y-axis, mm) was measured tested Xenograft models. Notably, lack of estrogen (ne) abro across time (X-axis, days post cell injection). Treatment with 55 gates effect of 59R1 in reducing ANGPT1 and ANGPT2 59R1 antibodies significantly inhibited tumor formation expression in host stroma of Tl harboring mice. Open circles compared to control. (p<0.001) (C) Anti-Notch2/3 (59R1) correspond to individual tumors analyzed. Horizontal line, Inhibits the Growth of Colo-205 Colon Tumors. 6-8 week-old Ca. immunodeficient bg/nu XID female mice on a Swiss CD-1 FIG. 13: The tumor suppressor PTEN gene is deleted in background injected with Colo-205 colon tumor cells were 60 many of the breast tumors in which 59R1 showed anti-tumor treated with control antibody (squares) or anti-Notch2/3 anti efficacy. The PTEN exon, Affymetrix probe distribution, and body 59R1 (diamonds) after tumor volume reached a size the deletions in the PTEN gene in chromosome 10 are shown. between 65 to 200 mm. Mean tumor volume (y-axis, mm) The thick and thin gray-shaded bars indicate the homozygous was measured across time (X-axis, days post cell injection). and heterozygous deletions of the chromosome fragments, Treatment with 59R1 antibodies inhibited tumor growth com 65 respectively. pared to control (*** p<0.001 after day 40). (D) Anti FIG. 14. Epitope mapping of 59R1 antibody. (A) Protein Notch2/3 (59R1) Inhibits the Growth of PN4 Pancreatic alignment of human Notch homologues. The alignment was US 8,226,943 B2 17 18 performed by Clone Manager Software. The EGF 10 repeat ment, processed and serial titrations of human cells from each of human Notch 1 (residues 356-418 of SEQ ID NO:45), the four treatment groups were transplanted into a new set of Notch2 (residues 359-421 of SEQ ID NO: 31), and Notch4 mice (n=10 per cell dose). Tumor growth rate was determined (residues 376-439 of SEQID NO:46) and the equivalent EGF after 75 days. Tumor growth rate after 75 days of growth was in human Notch3, EGF9 (residues 335-397 of SEQID NO: used to calculate the CSC frequency using the L-calc program 32), is as indicated. The boxed area indicates a region con (Stem Cell Technologies, Inc.). (B) Cancer stem cell fre taining one or more amino acid(s) that make up at least part of quency in PE13 breast tumors after treatment with 59R1 the 59R1 epitope as defined by FACS binding of 59R1 IgG2 and/or taxol. (C) Cancer stem cell frequency in PN4 pancre antibody to an hNotch2 H385NAL 388-89 SN mutant (FIG. atic tumors after treatment with 59R1 and/or gemcitabine. 14B) and to an hNotch1 construct in which aa 382-386 have 10 (D) Cancer stem cell frequency in PE13 breast tumors after been mutated to correspond to the hNotch2 sequence (FIG. treatment with 59R5 and/or taxol. A single asterisk indicates 14C). (B) 59R1 IgG2 antibody binds to hNotch2, but not a a statistically significant difference (p<0.05) vs. the control mutant hNotch2 in which certain EGF 10 residues have been antibody treated group and a double asterisk indicates a sig mutated to hNotch1 residues (H385N AL 388-89 SN). (C) nificant difference vs. the taxol and control antibody treated 59R1 IgG2 antibody does not bind to hNotch1, but does bind 15 group. to a mutant hNotch1 in which certain EGF 10 residues (aa 382-387) have been mutated to match the hNotch2 residues DETAILED DESCRIPTION OF THE INVENTION 385-389. FIG. 15. In vitro characterization of 59R5. (A) FIG. 15A The present invention provides novel agents, including, but shows that antibody 59R5 is able to block ligand-induced not limited to polypeptides Such as antibodies, that bind to signaling of Notch2 and Notch3. PC3 tumor cells were tran one or more human Notch receptors, such as Notch2 and/or siently transfected with human or mouse Notch receptor Notch3. The Notch-binding agents include antagonists of the (hN2, human Notch2; mN2, murine Notch2; hN3, human human Notch receptor(s). Related polypeptides and poly Notch3; mN3, murine Notch3) and GFP inducible reporter nucleotides, compositions comprising the Notch-binding construct. Transfected cells were incubated with different 25 agents, and methods of making the Notch-binding agents are concentrations of antibody 59R1 and 59R5 in the presence of also provided. Methods of using the novel Notch-binding passively immobilized DLL4 Fc. (B) FIG. 15B shows that agents, such as methods of inhibiting tumor growth, inhibit 59R5 binds to a similar epitope as 59R1. HEK 293 cells were ing angiogenesis, and/or treating cancer or other angiogen transiently transfected with expression vectors encoding esis-related disease, are further provided. human Notch2, human Notch1, or human Notch1 with resi 30 The present invention further identifies molecules (e.g., dues 382-386 mutated to the corresponding human Notch2 antibodies) that specifically bind to a non-ligand binding residues. Cells were also co-transfected with a plasmid region of the extracellular domain of a human Notch receptor encoding green fluorescent protein (GFP) to mark those cells and inhibit tumor growth in vivo. The ligand binding region of that received transfected plasmid. Cells were incubated with Notch, which is necessary and Sufficient for ligand binding, 59R1 or 59R5 and fluorescent secondary antibody and then 35 has been identified as EGF repeats 11 and 12, Suggesting this examined by FACS. The regions highlighted by the boxes region of the Notch receptor is important in Notch signaling suggest that cells transfected with the indicated Notch expres and tumorigenesis (Rebay et al., 1991, Cell 67:687; Lei et al., Sion vector were able to bind to 59R1 or 59R5. 2003, Dev. 130:6411; Hambleton et al., 2004, Structure FIG. 16. Notch receptor antibody 59R5 inhibits tumor 12:2173). Unexpectedly, antibodies that bind outside the formation and growth in vivo. FIG. 16A shows in vivo treat 40 ligand binding domain of the extracellular domain of human ment of PE13 breast tumor cells with antibody 59R5. FIG. Notch receptor have been found to inhibit tumor cell growth 16B shows in vivo treatment of C28 colon cells with antibody in vivo (see U.S. Patent Publication No. 2008/0131434, 59R5. FIG. 16C shows in vivo treatment of Colo205 colon incorporated by reference herein in its entirety). Thus, anti cells with antibody 59R5. bodies that bind outside the ligand binding domain of the FIG. 17. In vivo treatment of tumors using Notch2/3 anti 45 extracellular domain of one or more of the human Notch body 59R5 in combination treatment. (A) Mice were injected receptors Notch1, Notch2. Notch3, and Notch4 have with PN8 pancreatic tumor cells. Tumors were allowed to value as potential cancer therapeutics. grow for 33 days until they had reached an average volume of An antibody that specifically binds to an epitope contain 120 mm3. The animals were treated with gemcitabine at 20 ing residues within EGF repeat 10 of human Notch2 has now mg/kg once per week for four week in combination with 50 been identified (Examples 1 and 3 and FIGS. 3A-3C). The either control Ab (squares), 59R1 (triangles), or 59R5 antibody, 59R1, inhibits binding of ligand to Notch2 (Ex (circles). (B) Mice were injected with PE13 breast tumor ample 1 and FIGS. 1A-1D) and inhibits ligand-induced cells. Tumors were allowed to grow for 40 days before treat Notch2 signaling (Example 4 and FIG. 4A-4C), despite bind ments were initiated. The animals were treated with TAXOL ing to Notch2 in a region outside of the ligand-binding region. at 15 mg/kg twice per week for 5 weeks, plus either control 55 59R1 also specifically binds human Notch3 (Example 2 and antibody (squares) or 59R5 (circles). After 5 weeks, the FIG. 2). The antibody has been found to prevent or inhibit TAXOL treatments were stopped and the antibody treatments tumor cell growth in vivo in a variety of different xenograft continued. models, either alone or in combination with a second anti FIG. 18. Regulation of gene expression in tumors after cancer agent (Examples 5, 6, 7, and 9 and FIGS. 5A-F 6, treatment with antibody 59R5. FIG. 18 shows expression 60 8-10, and 11A-H). The antibody has also been shown to levels of selected genes in Stromal cells and selected human reduce the tumorigenicity of a tumor in vivo in multiple genes in PE13 tumor cells after treatment with 59R1,59R5, or Xenograft models by reducing the frequency of cancer stem control antibody. cells (Examples 8 and 23 and FIGS. 7 and 19 A-C). In addi FIG. 19. Reduction of PE13 breast cancer Stem cell fre tion, treatment with 59R1 was found to downregulate expres quency by 59R1. (A) Established tumors were treated with 65 sion of RGS5 (a marker for pericytes and/or vascular smooth control antibody, taxol plus control antibody, 59R1, or taxol muscle cells). Notch3, and HeyL in the stroma of various plus 59R1. Tumors were harvested after three weeks of treat tumors (Example 10 and FIGS. 12A-E) and to upregulate US 8,226,943 B2 19 20 hypoxia in breast and colon tumors (Example 11). Without An “Fv antibody” refers to the minimal antibody fragment being bound by theory, these data indicate that the 59R1 that contains a complete antigen-recognition and -binding antibody has an inhibitory effect on tumor angiogenesis that site either as two-chains, in which one heavy and one light is due, at least in part, to modulation of the function of peri chain variable domain form a non-covalent dimer, or as a cytes and/or vascular Smooth muscle cells. Treatment with single-chain (scFV), in which one heavy and one light chain 59R1 was also found to regulate additional genes in breast variable domain are covalently linked by a flexible peptide tumors. Cell cycle gene pathways, myc-activating genes and linker so that the two chains associate in a similar dimeric several stem cell gene sets were found to be down-regulated structure. In this configuration the complementary determin by 59R1 (Example 22). ing regions (CDRs) of each variable domain interact to define 10 the antigen-binding specificity of the Fv dimer. Alternatively An additional human antibody, 59R5, has also been devel a single variable domain (or half of an Fv) can be used to oped. 59R5 has properties that are similar to 59R1, such as recognize and bind antigen, although generally with lower similar binding affinity to Notch2 and Notch3 and similarities affinity. or overlap in their epitopes (Example 13 and FIG. 15B). A "monoclonal antibody” as used herein refers to homog Antibody 59R5 has been shown to have similar activity as 15 enous antibody population involved in the highly specific 59R1 in blocking Notch2 and Notch 3 signaling (Example 13 recognition and binding of a single antigenic determinant, or and FIG. 15A). The 59R5 antibody has also been shown to epitope. This is in contrast to polyclonal antibodies that typi inhibit tumor growth in vivo in several Xenograft models, cally include different antibodies directed against different either alone or in combination with a second anti-cancer antigenic determinants. The term "monoclonal antibody' agent (Examples 14 and 15 and FIGS. 16A-C and 17A-B). In encompasses both intact and full-length monoclonal antibod addition, treatment with 59R5, like 59R1, was found to down ies as well as antibody fragments (such as Fab, Fab'. F(ab')2. regulate expression of RGS5, Notch3, and HeyL in the stroma FV), single chain (scFV) mutants, fusion proteins comprising of various tumors, and 59R5 was also found to regulate the an antibody portion, and any other modified immunoglobulin expression of human genes ID4, EDNRA, and EGLN3 in molecule comprising an antigen recognition site. Further tumor cells to a similar extent as 59R1 (Example 16). 59R5 25 more, “monoclonal antibody refers to such antibodies made was further shown to reduce the tumorigenicity in vivo in a in any number of manners including, but not limited to, by Xenograft model by reducing the frequency of cancer stem hybridoma, phage selection, recombinant expression, and cells (Example 23 and 19D). transgenic animals. As used herein, the term “humanized antibody' refers to DEFINITIONS 30 forms of non-human (e.g., murine) antibodies that are specific immunoglobulin chains, chimeric immunoglobulins, or frag An “antagonist of a Notch receptor is a term that includes ments thereof that contain minimal non-human sequences. any molecule that partially or fully blocks, inhibits, or neu Typically, humanized antibodies are human immunoglobu tralizes a biological activity of the Notch pathway. Suitable lins in which residues from the complementary determining antagonist molecules specifically include antagonistantibod 35 region (CDR) are replaced by residues from the CDR of a ies or antibody fragments. non-human species (e.g. mouse, rat, rabbit, hamster, etc.) that The term “antibody' is used to mean an immunoglobulin have the desired specificity, affinity, and capability. In some molecule that recognizes and specifically binds to a target, instances, the Fv framework region (FR) residues of a human Such as a protein, polypeptide, peptide, carbohydrate, poly immunoglobulin are replaced with the corresponding resi nucleotide, lipid, or combinations of the foregoing etc., 40 dues in an antibody from a non-human species that has the through at least one antigen recognition site within the Vari desired specificity, affinity, and capability. The humanized able region of the immunoglobulin molecule. As used herein, antibody can be further modified by the substitution of addi the term encompasses intact polyclonal antibodies, intact tional residue either in the Fv framework region and/or within monoclonal antibodies, antibody fragments (such as Fab, the replaced non-human residues to refine and optimize anti Fab'. F(ab'), and Fv fragments), single chain Fv (sclv) 45 body specificity, affinity, and/or capability. In general, the mutants, multispecific antibodies Such as bispecific antibod humanized antibody will comprise substantially all of at least ies generated from at least two intact antibodies, fusion pro one, and typically two or three, variable domains containing teins comprising an antibody portion, and any other modified all or substantially all of the CDR regions that correspond to immunoglobulin molecule comprising an antigen recogni the non-human immunoglobulin whereas all or Substantially tion site so long as the antibodies exhibit the desired biologi 50 all of the FR regions are those of a human immunoglobulin cal activity. An antibody can be of any the five major classes consensus sequence. The humanized antibody can also com of immunoglobulins: IgA, Ig), IgE, IgG, and IgM, or Sub prise at least a portion of an immunoglobulin constant region classes (isotypes) thereof (e.g., IgG1, IgG2, IgG3, IgG4. or domain (Fc), typically that of a human immunoglobulin. IgA1 and IgA2), based on the identity of their heavy-chain Examples of methods used to generate humanized antibodies constant domains referred to as alpha, delta, epsilon, gamma, 55 are described in U.S. Pat. No. 5.225,539, herein incorporated and mu, respectively. The different classes of immunoglobu by reference. lins have different and well known subunit structures and A “variable region' of an antibody refers to the variable three-dimensional configurations. Antibodies can be naked or region of the antibody light chain or the variable region of the conjugated to other molecules such as toxins, radioisotopes, antibody heavy chain, either alone or in combination. The etc. 60 variable regions of the heavy and light chain each consist of As used herein, the term “antibody fragment” refers to a four framework regions (FR) connected by three complemen portion of an intact antibody and refers to the antigenic deter tarity determining regions (CDRS) also known as hyperVari mining variable regions of an intact antibody. Examples of able regions. The CDRs in each chain are held together in antibody fragments include, but are not limited to Fab, Fab', close proximity by the FRs and, with the CDRs from the other F(ab'), and FV fragments, linear antibodies, single chain 65 chain, contribute to the formation of the antigen-binding site antibodies, and multispecific antibodies formed from anti of antibodies. There are at least two techniques for determin body fragments. ing CDRs: (1) an approach based on cross-species sequence US 8,226,943 B2 21 22 variability (i.e., Kabat et al. Sequences of Proteins of Immu peting antibodies) include antibodies binding to the same nological Interest, (5th ed., 1991, National Institutes of epitope as the reference antibody and antibodies binding to an Health, Bethesda Md.)); and (2) an approach based on crys adjacent epitope Sufficiently proximal to the epitope bound by tallographic studies of antigen-antibody complexes (Al-lazi the reference antibody for steric hindrance to occur. Usually, kani et al 1997, J. Molec. Biol. 273:927-948)). In addition, when a competing antibody is present in excess, it will inhibit combinations of these two approaches are sometimes used in specific binding of a reference antibody to a common antigen the art to determine CDRs. by at least 50 or 75%. The term “human antibody' as used herein means an anti That an antibody “selectively binds” or “specifically body produced by a human or an antibody having an amino binds' to an epitope or receptor means that the antibody reacts acid sequence corresponding to an antibody produced by a 10 or associates more frequently, more rapidly, with greater human made using any of the techniques known in the art. duration, with greater affinity, or with some combination of This definition of a human antibody includes intact or full the above to the epitope or receptor than with alternative length antibodies, fragments thereof, and/or antibodies com substances, including unrelated proteins. “Selectively binds” prising at least one human heavy and/or light chain polypep or “specifically binds' means, for instance, that an antibody tide Such as, for example, an antibody comprising murine 15 binds to a protein with a K, of about 0.1 mM or less, more light chain and human heavy chain polypeptides. usually about 1 uM or less. “Selectively binds” or “specifi “Hybrid antibodies' are immunoglobulin molecules in cally binds” means at times that an antibody binds to a protein which pairs of heavy and light chains from antibodies with with a K, of about 0.1 mM or less, at times about 1 uMorless, different antigenic determinant regions are assembled at times about 0.1 uM or less, at times about 0.01 uM or less, together so that two different epitopes or two different anti and at times about 1 nM or less. Because of the sequence gens can be recognized and bound by the resulting tetramer. identity between homologous proteins in different species, The term "chimeric antibodies' refers to antibodies specific binding can include an antibody that recognizes a wherein the amino acid sequence of the immunoglobulin Notch receptor in more than one species. Likewise, because molecule is derived from two or more species. Typically, the of homology between different Notch receptors (e.g., Notch2 variable region of both light and heavy chains corresponds to 25 and Notch3) in certain regions of the polypeptide sequences the variable region of antibodies derived from one species of of the receptors, specific binding can include an antibody that mammals (e.g. mouse, rat, rabbit, etc.) with the desired speci recognizes more than one Notch receptor. It is understood ficity, affinity, and capability while the constant regions are that, in certain embodiments, an antibody or binding moiety homologous to the sequences in antibodies derived from that specifically binds to a first target may or may not specifi another (usually human) to avoid eliciting an immune 30 cally bind to a second target. As such, “specific binding does response in that species. not necessarily require (although it can include) exclusive The term "epitope' or “antigenic determinant” are used binding, i.e. binding to a single target. Thus, an antibody may, interchangeably herein and refer to that portion of an antigen in certain embodiments, specifically bind to more than one capable of being recognized and specifically bound by a target (e.g., human Notch2 and Notch3). In certain embodi particular antibody. When the antigen is a polypeptide, 35 ments, the multiple targets may be bound by the same anti epitopes can be formed both from contiguous amino acids gen-binding site on the antibody. For example, an antibody and noncontiguous amino acids juxtaposed by tertiary fold may, in certain instances, comprise two identical antigen ing of a protein. Epitopes formed from contiguous amino binding sites, each of which specifically binds two or more acids are typically retained upon protein denaturing, whereas human Notch receptors (e.g., human Notch2 and Notch3). In epitopes formed by tertiary folding are typically lost upon 40 certain alternative embodiments, an antibody may be bispe protein denaturing. An epitope typically includes at least 3, cific and comprise at least two antigen-binding sites with and more usually, at least 5 or 8-10 amino acids in a unique differing specificities. By way of non-limiting example, a spatial conformation. bispecific antibody may comprise one antigen-binding site Competition between antibodies is determined by an assay that recognizes an epitope on one Notch receptor, Such as in which the immunoglobulin under study inhibits specific 45 human Notch2, and further comprises a second, different binding of a reference antibody to a common antigen. Numer antigen-binding site that recognizes a different epitope on a ous types of competitive binding assays are known, for second Notch receptor, such as human Notch3. Generally, but example: Solid phase direct or indirect radioimmunoassay not necessarily, reference to “binding herein means “specific (RIA), Solid phase direct or indirect enzyme immunoassay binding.” (EIA), sandwich competition assay (see Stahli et al., 1983, 50 As used herein, the terms “non-specific binding and Methods in Enzymology 9:242-253); solid phase direct “background binding when used in reference to the interac biotin-avidin EIA (see Kirkland et al., J. Immunol. 1986, tion of an antibody and a protein or peptide refer to an inter 137:3614-3619); solid phase direct labeled assay, solid phase action that is not dependent on the presence of a particular direct labeled sandwich assay (see Harlow and Lane, 1988, structure (i.e., the antibody is binding to proteins in general Antibodies, A Laboratory Manual, Cold Spring Harbor 55 rather that a particular structure such as an epitope). Press); solid phase direct label RIA using 1-125 label (see The terms “isolated' or “purified’ refer to material that is Morel et al., 1988, Molec. Immunol. 25(1):7-15); solid phase Substantially or essentially free from components that nor direct biotin-avidin EIA (Cheung et al., 1990, Virology 176: mally accompany it in its native state. Purity and homogene 546-552); and direct labeled RIA (Moldenhauer et al., 1990, ity are typically determined using analytical chemistry tech Scand. J. Immunol. 32:77-82). Typically, such an assay 60 niques such as polyacrylamide gel electrophoresis or high involves the use of purified antigenbound to a solid surface or performance liquid chromatography. A protein (e.g. an anti cells bearing either of these, an unlabeled test immunoglobu body) or nucleic acid that is the predominant species present lin and a labeled reference immunoglobulin. Competitive in a preparation is Substantially purified. In particular, an inhibition is measured by determining the amount of label isolated nucleic acid is separated from open reading frames bound to the solid surface or cells in the presence of the test 65 that naturally flank the gene and encode proteins other than immunoglobulin. Usually the test immunoglobulin is present protein encoded by the gene. An isolated antibody is sepa in excess. Antibodies identified by competition assay (com rated from other non-immunoglobulin proteins and from US 8,226,943 B2 23 24 other immunoglobulin proteins with different antigen bind As used herein, the “tumorigenicity' of a tumor refers to ing specificity. It can also mean that the nucleic acid or protein the ability of a random sample of cells from the tumor to form is at least 85% pure, at least 95% pure, and in some embodi palpable tumors upon serial transplantation into immuno ments, at least 99% pure. compromised mice. As used herein, the terms "cancer and "cancerous” refer to As used herein, the terms 'stem cell cancer marker” or or describe the physiological condition in mammals in which “cancer stem cell marker” or “tumor stem cell marker” or a population of cells are characterized by unregulated cell 'solid tumor stem cell marker” refer to a gene or genes or a growth. Examples of cancer include, but are not limited to, protein, polypeptide, or peptide expressed by the gene or carcinoma, lymphoma, blastoma, sarcoma, and leukemia. genes whose expression level, alone or in combination with More particular examples of such cancers include Squamous 10 other genes, is correlated with the presence of tumorigenic cell cancer, Small-cell lung cancer, non-Small cell lung can cancer cells compared to non-tumorigenic cells. The correla cer, adenocarcinoma of the lung, squamous carcinoma of the tion can relate to either an increased or decreased expression lung, cancer of the peritoneum, hepatocellular cancer, gas of the gene (e.g., increased or decreased levels of mRNA or trointestinal cancer, pancreatic cancer, glioblastoma, cervical the peptide encoded by the gene). cancer, ovarian cancer, liver cancer, bladder cancer, 15 The terms "cancer stem cell gene signature' or "tumor hepatoma, breast cancer, colon cancer, colorectal cancer, stem cell gene signature' or "cancer stem cell signature are endometrial or uterine carcinoma, salivary gland carcinoma, used interchangeably herein to refer to gene signatures com kidney cancer, liver cancer, prostate cancer, Vulval cancer, prising genes differentially expressed in cancer stem cells thyroid cancer, hepatic carcinoma and various types of head compared to other cells or population of cells, for example and neck cancer. normal breast epithelial tissue. In some embodiments the The terms “proliferative disorder” and “proliferative dis cancer stem cell gene signatures comprise genes differen ease' refer to disorders associated with abnormal cell prolif tially expressed in cancer stem cells versus normal breast eration Such as cancer. epithelium by a fold change, for example by 2 fold reduced “Tumor and “neoplasm' as used herein refer to any mass and/or elevated expression, and further limited by using a of tissue that result from excessive cell growth or prolifera 25 statistical analysis such as, for example, by the P value of a tion, either benign (noncancerous) or malignant (cancerous) t-test across multiple samples. In another embodiment, the including pre-cancerous lesions. genes differentially expressed in cancer stem cells are divided "Metastasis' as used herein refers to the process by which into cancer stem cell gene signatures based on the correlation a cancer spreads or transfers from the site of origin to other of their expression with a chosen gene in combination with regions of the body with the development of a similar cancer 30 their fold or percentage expression change. Cancer stem cell ous lesion at the new location. A "metastatic' or “metastasiz signatures are predictive both retrospectively and prospec ing cell is one that loses adhesive contacts with neighboring tively of an aspect of clinical variability, including but not cells and migrates via the bloodstream or lymph from the limited to metastasis and death. primary site of disease to invade neighboring body structures. The term “genetic test” as used herein refers to procedures As used herein, the term “subject” refers to any animal 35 whereby the genetic make-up of a patient or a patient tumor (e.g., a mammal), including, but not limited to humans, non sample is analyzed. The analysis can include detection of human primates, rodents, and the like, which is to be the DNA, RNA, chromosomes, proteins or metabolites to detect recipient of a particular treatment. Typically, the terms “sub heritable or Somatic disease-related genotypes or karyotypes ject' and “patient are used interchangeably herein in refer for clinical purposes. ence to a human Subject. 40 As used herein, the terms “biopsy' or “biopsy tissue' refer The terms "cancer stem cell' or “tumor stem cell' or “solid to a sample of tissue or fluid that is removed from a subject for tumor stem cell are used interchangeably herein and refer to the purpose of determining if the sample contains cancerous a population of cells from a solid tumor that: (1) have exten tissue. In some embodiments, biopsy tissue or fluid is sive proliferative capacity; 2) are capable of asymmetric cell obtained because a Subject is Suspected of having cancer. The division to generate one or more kinds of differentiated prog 45 biopsy tissue or fluid is then examined for the presence or eny with reduced proliferative or developmental potential; absence of cancer. and (3) are capable of symmetric cell divisions for self-re As used herein an “acceptable pharmaceutical carrier' newal or self-maintenance. These properties of "cancer stem refers to any material that, when combined with an active cells' or "tumorstem cells' or “solid tumorstem cells' confer ingredient of a pharmaceutical composition Such as an anti on those cancer stem cells the ability to form palpable tumors 50 body, allows the antibody, for example, to retain its biological upon serial transplantation into an immunocompromised activity. In addition, an “acceptable pharmaceutical carrier mouse compared to the majority of tumor cells that fail to does not trigger an immune response in a recipient Subject. form tumors. Cancer stem cells undergo self-renewal versus Examples include, but are not limited to, any of the standard differentiation in a chaotic manner to form tumors with pharmaceutical carriers such as a phosphate buffered saline abnormal cell types that can change over time as mutations 55 Solution, water, and various oil/water emulsions. Some dilu OCCU. ents for aerosol or parenteral administration are phosphate The terms “cancer cell' or “tumor cell and grammatical buffered saline or normal (0.9%) saline. equivalents refer to the total population of cells derived from The term “therapeutically effective amount” refers to an a tumor including both non-tumorigenic cells, which com amount of an antibody, polypeptide, polynucleotide, Small prise the bulk of the tumor cell population, and tumorigenic 60 organic molecule, or other drug effective to “treat a disease stem cells (cancer stem cells). or disorder in a Subject or mammal. In the case of cancer, the As used herein “tumorigenic’ refers to the functional fea therapeutically effective amount of the drug can reduce the tures of a Solid tumor stem cell including the properties of number of cancer cells; reduce the tumor size: inhibit or stop self-renewal (giving rise to additional tumorigenic cancer cancer cell infiltration into peripheral organs; inhibit and stop stem cells) and proliferation to generate all other tumor cells 65 tumor metastasis; inhibit and stop tumor growth; relieve to (giving rise to differentiated and thus non-tumorigenic tumor Some extent one or more of the symptoms associated with the cells) that allow solid tumor stem cells to form a tumor. cancer, or a combination of such effects on cancer cells. To the US 8,226,943 B2 25 26 extent the drug prevents growth and/or kills existing cancer sequences termed “introns' or “intervening regions” or cells, it can be referred to as cytostatic and/or cytotoxic. “intervening sequences'. Introns are segments of a gene that Terms such as “treating or “treatment’ or “to treat' or are transcribed into nuclear RNA (hnRNA); introns can con “alleviating or “to alleviate' refer to both 1) therapeutic tain regulatory elements such as enhancers. Introns are measures that cure, slow down, lessen symptoms of, and/or 5 removed or “spliced out from the nuclear or primary tran halt progression of a diagnosed pathologic condition or dis script; introns therefore are absent in the messenger RNA order and 2) prophylactic or preventative measures that pre (mRNA) transcript. The mRNA functions during translation vent or slow the development of a targeted pathologic condi to specify the sequence or order of amino acids in a nascent tion or disorder. Thus those in need of treatment include those polypeptide. In addition to containing introns, genomic forms already with the disorder; those prone to have the disorder; 10 and those in whom the disorder is to be prevented. In some of agene can also include sequences located on both the 5' and embodiments, a subject is successfully “treated for cancer 3' end of the sequences that are present on the RNA transcript. according to the methods of the present invention if the These sequences are referred to as “flanking sequences or patient shows one or more of the following: a reduction in the regions (these flanking sequences are located 5' or 3' to the number of or complete absence of cancer cells; a reduction in 15 non-translated sequences present on the mRNA transcript). the tumor size; inhibition of or an absence of cancer cell The 5' flanking region can contain regulatory sequences Such infiltration into peripheral organs including the spread of as promoters and enhancers that control or influence the tran cancer into Soft tissue and bone; inhibition of oran absence of Scription of the gene. The 3' flanking region can contain tumor metastasis; inhibition or an absence of tumor growth; sequences that direct the termination of transcription, post relief of one or more symptoms associated with the specific transcriptional cleavage, and polyadenylation. cancer, reduced morbidity and mortality; and improvement in The term “recombinant' when used with reference to a quality of life. Thus, in certain embodiments, treatment of cell, nucleic acid, protein or vector indicates that the cell, cancer comprises inhibition of tumor growth in a subject. nucleic acid, protein or vector has been modified by the intro As used herein, the terms “polynucleotide' or “nucleic duction of a heterologous nucleic acid or protein, the alter acid refer to a polymer composed of a multiplicity of nucle 25 ation of a native nucleic acid or protein, or that the cell is otide units (ribonucleotide or deoxyribonucleotide or related derived from a cell so modified. Thus, e.g., recombinant cells structural variants) linked via phosphodiester bonds, includ express genes that are not found within the native (non-re ing but not limited to, DNA or RNA. The term encompasses combinant) form of the cell or express native genes that are sequences that include any of the known base analogs of DNA overexpressed or otherwise abnormally expressed such as, and RNA including, but not limited to, 4-acetyl cytosine, 30 for example, expressed as non-naturally occurring fragments 8-hydroxy-N-6-methyladenosine, aziridinylcytosine, or splice variants. By the term “recombinant nucleic acid pseudoisocytosine, 5-(carboxyhydroxylmethyl) uracil, herein is meant nucleic acid, originally formed in vitro, in 5-fluorouracil, 5-bromouracil, 5-carboxymethylaminom general, by the manipulation of nucleic acid, e.g., using poly ethyl 2-thiouracil, 5-carboxymethylaminomethyluracil, merases and endonucleases, in a form not normally found in dihydrouracil, inosine, N6-isopentenyladenine, 1-methylad 35 nature. In this manner, operably linkage of different enine, 1-methylpseudouracil, 1-methylguanine, 1-methyli sequences is achieved. Thus an isolated nucleic acid, in a nosine, 2.2-dimethylguanine, 2-methyladenine, 2-meth linear form, or an expression vector formed in vitro by ligat ylguanine, 3-methylcytosine, 5-methylcytosine, ing DNA molecules that are not normally joined, are both N6-methyladenine, 7-methylguanine, 5-methylaminomethy considered recombinant for the purposes of this invention. It luracil, 5-methoxyaminomethyl 2-thiouracil, beta-D-manno 40 is understood that once a recombinant nucleic acid is made Syldueosine, 5'-methoxycarbonylmethyluracil, 5-methox and introduced into a host cell or organism, it will replicate yuracil, 2-methylthio-N-6-isopentenyladenine, uracil-5- non-recombinantly, i.e., using the in vivo cellular machinery oxyacetic acid methylester, uracil-5-oxyacetic acid, of the host cell rather than in vitro manipulations; however, oxybutoxosine, pseudouracil, queosine, 2-thiocytosine, Such nucleic acids, once produced recombinantly, although 5-methyl-2 thiouracil, 2-thiouracil, 4-thiouracil, 5-methylu 45 Subsequently replicated non-recombinantly, are still consid racil, N-uracil-5-oxyacetic acid methylester, uracil-5-oxy ered recombinant for the purposes of the invention. Similarly, acetic acid, and 2,6-diaminopurine. a “recombinant protein' is a protein made using recombinant The term “gene' refers to a nucleic acid (e.g., DNA) techniques, i.e., through the expression of a recombinant sequence that comprises coding sequences necessary for the nucleic acid as depicted above. production of a polypeptide, precursor, or RNA (e.g., rRNA, 50 As used herein, the term “vector” is used in reference to tRNA). The polypeptide can be encoded by a full length nucleic acid molecules that transfer DNA segment(s) from coding sequence or by any portion of the coding sequence so one cell to another. The term "vehicle' is sometimes used long as the desired activity or functional properties (e.g., interchangeably with “vector.” Vectors are often derived from enzymatic activity, ligand binding, signal transduction, plasmids, bacteriophages, or plant or animal viruses. immunogenicity, etc.) of the full-length polypeptide or frag 55 As used herein, the term “gene expression” refers to the ment are retained. The term also encompasses the coding process of converting genetic information encoded in a gene region of a structural gene and the sequences located adjacent into RNA (e.g., mRNA, rRNA, tRNA, or snRNA) through to the coding region on both the 5' and 3' ends for a distance “transcription of the gene (e.g., via the enzymatic action of of about 1 kb or more on either end such that the gene an RNA polymerase), and for protein encoding genes, into corresponds to the length of the full-length mRNA. 60 protein through “translation of mRNA. Gene expression can Sequences located 5' of the coding region and present on the be regulated at many stages in the process. "Up-regulation' or mRNA are referred to as 5' non-translated sequences. “activation” refers to regulation that increases the production Sequences located 3' or downstream of the coding region and of gene expression products (e.g., RNA or protein), while present on the mRNA are referred to as 3' non-translated “down-regulation” or “repression” refers to regulation that sequences. The term “gene' encompasses both cDNA and 65 decrease production. Molecules (e.g., transcription factors) genomic forms of a gene. A genomic form or clone of a gene that are involved in up-regulation or down-regulation are contains the coding region interrupted with non-coding often called “activators' and “repressors’, respectively. US 8,226,943 B2 27 28 The terms “polypeptide' or “peptide' or “protein’ or “pro Arginine (R), Lysine (K); 5) Isoleucine (I), Leucine (L), tein fragment” are used interchangeably herein to refer to a Methionine (M), Valine (V); 6) Phenylalanine (F), Tyrosine polymer of amino acid residues. The terms apply to amino (Y), Tryptophan (W); 7) Serine (S), Threonine (T); and 8) acid polymers in which one or more amino acid residue is an Cysteine (C), Methionine (M) (see, e.g., Creighton, Proteins artificial chemical mimetic of a corresponding naturally (1984)). (See, also, Table 1 herein). occurring amino acid, as well as to naturally occurring amino As used in the present disclosure and claims, the singular acid polymers and non-naturally occurring amino acid poly forms “a”, “an and “the include plural forms unless the CS. context clearly dictates otherwise. The term “amino acid refers to naturally occurring and It is understood that wherever embodiments are described synthetic amino acids, as well as amino acid analogs and 10 amino acid mimetics that function similarly to the naturally herein with the language "comprising otherwise analogous occurring amino acids. Naturally occurring amino acids are embodiments described in terms of “consisting of and/or those encoded by the genetic code, as well as those amino “consisting essentially of are also provided. acids that are later modified, e.g., hydroxyproline, gamma Certain Embodiments of the Present Invention carboxyglutamate, and O-phosphoserine. Amino acid ana 15 logs refers to compounds that have the same basic chemical structure as a naturally occurring amino acid, e.g., an alpha The present invention provides compositions and methods carbon that is bound to a hydrogen, a carboxyl group, an for studying, diagnosing, characterizing, and treating cancer. amino group, and an R group, e.g., homoserine, norleucine, In particular, in certain embodiments, the present invention methionine sulfoxide, methionine methyl sulfonium. Such provides agents, including antagonists, that bind Notch analogs can have modified R groups (e.g., norleucine) or receptors and methods of using the agents or antagonists to modified peptide backbones, but retain the same basic chemi inhibit tumor growth and treat cancer or other disease in cal structure as a naturally occurring amino acid. Amino acid human patients. In certain embodiments, the antagonists are mimetics refers to chemical compounds that have a structure antibodies that specifically recognize one or more human that is different from the general chemical structure of an 25 Notch receptors. amino acid, but that functions similarly to a naturally occur In one aspect, the present invention provides an antibody ring amino acid. that specifically binds to a non-ligand binding region of the “Conservatively modified variants' applies to both amino extracellular domain of a human Notch receptor. In some acid and nucleic acid sequences. “Amino acid variants' refers embodiments, the antibody that specifically binds to a non to amino acid sequences. With respect to particular nucleic 30 ligand binding region of the extracellular domain of a human acid sequences, conservatively modified variants refers to Notch receptor inhibits growth of tumors. In certain embodi those nucleic acids which encode identical or essentially ments, the antibody that specifically binds to a non-ligand identical amino acid sequences, or where the nucleic acid binding region of the extracellular domain of a human Notch does not encode an amino acid sequence, to essentially iden receptor and inhibits tumor growth, specifically binds to a tical or associated (e.g., naturally contiguous) sequences. 35 non-ligand binding region of the extracellular domain of at Because of the degeneracy of the genetic code, a large number least two Notch receptor family members. In certain embodi of functionally identical nucleic acids encode most proteins. ments, the antibody binds to a non-ligand binding region of For instance, the codons GCA, GCC, GCG and GCU all the extracellular domain of Notch2 and/or Notch3 receptor. In encode the amino acidalanine. Thus, at every position where Some embodiments, the antibody binds to a non-ligand bind analanine is specified by a codon, the codon can be altered to 40 ing region of the human Notch2. In some embodiments, the another of the corresponding codons described without alter antibody binds to a non-ligand binding region of the extra ing the encoded polypeptide. Such nucleic acid variations are cellular domain of Notch2 and Notch3. In some embodi “silent variations,” which are one species of conservatively ments, the antibody binds to a non-ligand binding region of modified variations. Every nucleic acid sequence herein the human Notch3. In some embodiments, the antibody binds which encodes a polypeptide also describes silent variations 45 to Notch1 and/or Notch4. of the nucleic acid. It is recognized that in certain contexts In certain embodiments, the antibody that specifically each codon in a nucleic acid (except AUG, which is ordinarily binds to a non-ligand binding region of the extracellular the only codon for methionine, and TGG, which is ordinarily domain of a human Notch receptor and inhibits tumor growth the only codon for tryptophan) can be modified to yield a is a monoclonal antibody. In certain embodiments, the anti functionally identical molecule. Accordingly, silent varia 50 body that specifically binds to a non-ligand binding region of tions of a nucleic acid which encodes a polypeptide is implicit the extracellular domain of a human Notch receptor and in a described sequence with respect to the expression prod inhibits growth of tumors is a chimeric antibody. In certain uct, but not with respect to actual probe sequences. As to embodiments, the antibody that specifically binds to a non amino acid sequences, it will be recognized that individual ligand binding region of the extracellular domain of a human Substitutions, deletions or additions to a nucleic acid, peptide, 55 Notch receptor and inhibits growth of tumors is a humanized polypeptide, or protein sequence which alters, adds or deletes antibody. In certain embodiments, the antibody that specifi a singleamino acidora Small percentage of amino acids in the cally binds to a non-ligand binding region of the extracellular encoded sequence is a “conservatively modified variant” domain of a human Notch receptor and inhibits tumor growth including where the alteration results in the substitution of an is a human antibody. In certain embodiments, the antibody amino acid with a chemically similar amino acid. Such con 60 that specifically binds to a non-ligand binding region of the servatively modified variants are in addition to and do not extracellular domain of a human Notch receptor and inhibits exclude polymorphic variants, interspecies homologs, and tumor growth is a monospecific antibody. In certain embodi alleles of the invention. Tables providing functionally similar ments, the antibody that specifically binds to a non-ligand amino acids useful for conservative amino acid Substitutions binding region of the extracellular domain of a human Notch are well known in the art. Typical conservative substitutions 65 receptor and inhibits tumor growth is a bispecific antibody. In include: 1) Alanine (A), Glycine (G); 2) Aspartic acid (D), certain embodiments, the present invention provides a hybri Glutamic acid (E); 3) Asparagine (N), Glutamine (Q); 4) doma producing an antibody that specifically binds to a non US 8,226,943 B2 29 30 ligand binding region of the extracellular domain of a human prises administering a therapeutically effective amount of an Notch receptor and inhibits tumor growth. antibody that specifically binds to a non-ligand binding In certain embodiments the present invention provides an region of the extracellular domain of a human Notch receptor antibody that specifically binds to a non-ligand binding comprising EGF repeat 10 (or the equivalent if Notch3) and region comprising EGF repeats 1-10 of the extracellular 5 inhibits tumor growth. In certain embodiments, the method of domain of a human Notch receptor and inhibits tumor growth. treating cancer comprises administering a therapeutically In certain embodiments the present invention provides an effective amount of an antibody that specifically binds to a antibody that specifically binds to a non-ligand binding non-ligand binding region of the extracellular domain of a region comprising EGF repeat 10 (or equivalent) of the extra human Notch receptor comprising EGF repeats 13-36 and cellular domain of a human Notch receptor and inhibits tumor 10 inhibits tumor growth. In certain embodiments, the method of growth. In certain embodiments the present invention pro treating cancer comprises administering a therapeutically vides an antibody that specifically binds to a non-ligand bind effective amount of an antibody that specifically binds to a ing region comprising EGF repeats 13-36 of the extracellular non-ligand binding region of the extracellular domain of a domain of a human Notch receptor and inhibits tumor growth. human Notch receptor comprising EGF repeat 4 and inhibits Certain embodiments provide an antibody that specifically 15 tumor growth. In certain embodiments, the method of treating binds to a non-ligand binding region comprising EGF repeats cancer comprises administering a therapeutically effective 4 of the extracellular domain of a human Notch receptor and amount of an antibody that specifically binds to a non-ligand inhibits tumor growth. Certain embodiments provide an anti binding region of the extracellular domain of a human Notch body that specifically binds to a non-ligand binding region receptor comprising EGF repeat 4 and inhibits tumor growth. comprising EGF repeat 13 of the extracellular domain of a In certain other embodiments, the antibody that is adminis human Notch receptor and inhibits tumor growth. In certain tered specifically binds to the LNR-HD domain of a human embodiments, the antibody specifically binds to a non-ligand Notch receptor. binding region comprising the LNR-HD domain and inhibits In certain embodiments, the method of treating cancer tumor growth. comprises administering a therapeutically effective amount In certain embodiments the present invention provides a 25 of an antibody conjugated to a cytotoxic moiety that specifi method of treating cancer in a subject in need thereof com cally binds to a non-ligand binding region of the extracellular prising administering to the Subject atherapeutically effective domain of a human Notch receptor and inhibits tumor growth. amount of an antibody that specifically binds to a non-ligand In certain embodiments, the method of treating cancer com binding region of the extracellular domain of a human Notch prises administering a therapeutically effective amount of an receptor protein and inhibits tumor growth in the Subject. In 30 antibody that specifically binds to a non-ligand binding certain embodiments, the method of treating cancer com region of the extracellular domain of a human Notch receptor prises administering a therapeutically effective amount of an and inhibits tumor growth in combination with radiation antibody that specifically binds to at least two Notch receptor therapy. In certain embodiments, the method of treating can family members and inhibits tumor growth. In certain cer comprises administering a therapeutically effective embodiments, the method of treating cancer in a Subject in 35 amount of an antibody that specifically binds to a non-ligand need thereof comprises administering to the Subject a thera binding region of the extracellular domain of a human Notch peutically effective amount of an antibody that specifically receptor and inhibits tumor growth in combination with che binds to a non-ligand binding region of the extracellular motherapy. In certain embodiments, the method of treating domain of Notch2 and/or Notch3 receptor and inhibits tumor cancer comprises administering a therapeutically effective growth. 40 amount of an antibody that specifically binds to a non-ligand In certain embodiments, the method of treating cancer binding region of the extracellular domain of a human Notch comprises administering a therapeutically effective amount receptor and inhibits tumor growth that are from a breast of a monoclonal antibody that specifically binds to a non tumor, colorectal tumor, lung tumor, pancreatic tumor, pros ligand binding region of the extracellular domain of a human tate tumor, or a head and neck tumor. Notch receptor and inhibits tumor growth. In certain embodi 45 In certain embodiments, the method of treating cancer ments, the method of treating cancer comprises administering comprises identifying patients for treatment with the anti atherapeutically effective amount of a chimericantibody that body that specifically binds to a non-ligand binding region of specifically binds to a non-ligand binding region of the extra the extracellular domain of a human Notch receptor using a cellular domain of a human Notch receptor and inhibits tumor genetic test; and administering a therapeutically effective growth. In certain embodiments, the method of treating can 50 amount of an antibody that specifically binds to a non-ligand cer comprises administering a therapeutically effective binding region of the extracellular domain of a human Notch amount of a humanized antibody that specifically binds to a receptor and inhibits tumor growth. In certain embodiments, non-ligand binding region of the extracellular domain of a the method of treating cancer comprises identifying patients human Notch receptor and inhibits tumor growth. In certain for treatment with the antibody that specifically binds to a embodiments, the method of treating cancer comprises 55 non-ligand binding region of the extracellular domain of a administering a therapeutically effective amount of a human human Notch receptor using a genetic test that detects a antibody that specifically binds to a non-ligand binding cancer stem cell signature; and administering a therapeuti region of the extracellular domain of a human Notch receptor cally effective amount of an antibody that specifically binds and inhibits tumor growth. In some embodiments, the anti to a non-ligand binding region of the extracellular domain of body is a monospecific antibody. In some embodiments, the 60 a human Notch receptor and inhibits tumor growth. antibody is a bispecific antibody. In certain embodiments, the present invention provides a In certain embodiments, the method of treating cancer method of identifying a molecule that binds to a non-ligand comprises administering a therapeutically effective amount binding region of an extracellular domain of a human Notch of an antibody that specifically binds to a non-ligand binding receptor and inhibits tumor growth, the method comprising: i) region of the extracellular domain of a human Notch receptor 65 incubating the molecule with the non-ligand binding domain comprising EGF repeats 1-10 and inhibits tumor growth. In of the extracellular domain of a human Notch receptor; ii) certain embodiments, the method of treating cancer com determining if the molecule binds to the non-ligand binding US 8,226,943 B2 31 32 region of the extracellular domain of the human Notch recep (e.g., SEQID NO:14) and/or the light chain variable region tor; and iii) determining if the molecule inhibits tumor (e.g., SEQID NO:13) of such a 59R1 antibody. The invention growth. In certain embodiments, the invention provides a further provides polypeptides or antibodies comprising one method of identifying a molecule that binds to a non-ligand or more (e.g., 1, 2, or 3) of the heavy chain CDRs, and/or one binding region of an extracellular domain of a human Notch 5 or more of the light chain CDRs of the 59R1 antibody. In still receptor and inhibits tumor growth, the method comprising: i) further embodiments, the invention provides antibodies that incubating the molecule with the non-ligand binding domain bind to the same epitope as the 59R1 antibody or antibodies of the extracellular domain of a human Notch receptor com that compete for specific binding to human Notch2 and/or prising EGF repeats 1-10; ii) determining if the molecule Notch3 with the 59R1 antibody. binds to the non-ligand binding region of the extracellular 10 domain of the human Notch receptor comprising EGF repeats In another aspect, the invention provides a 59R5 antibody 1-10; and iii) determining if the molecule inhibits tumor comprising the heavy chain and light chain sequences pro growth. In certain embodiments, the invention provides a vided in SEQ ID NOs:49 and 18 (with or without signal method of identifying a molecule that binds to a non-ligand sequence), respectively, or as encoded by the DNA deposited binding region of an extracellular domain of a human Notch 15 with ATCC on Jul. 6, 2009 and assigned designation number receptor and inhibits tumor growth, the method comprising: i) PTA-10170. The invention further provides polypeptides or incubating the molecule with the non-ligand binding domain antibodies that comprise the heavy chain variable region and/ of the extracellular domain of a human Notch receptor com or the light chain variable region sequences SEQID NO:50 prising EGF repeat 10 (or equivalent if Notch3); ii) determin and/or SEQ ID NO:13. The invention further provides ing if the molecule binds to the non-ligand binding region of polypeptides orantibodies comprising one or more (e.g., 1, 2, the extracellular domain of the human Notch receptor com or 3) of the heavy chain CDRs and/or one or more of the light prising EGF repeat 10 (or equivalent if Notch3); and iii) chain CDRs of the 59R5 antibody. In still further embodi determining if the molecule inhibits tumor growth. In certain ments, the invention provides antibodies that bind to the same embodiments, the invention provides a method of identifying epitope as the 59R5 antibody or antibodies that compete for a molecule that binds to a non-ligand binding region of an 25 specific binding to human Notch2 and/or Notch3 with the extracellular domain of a human Notch receptor and inhibits 59R5 antibody. tumor growth, the method comprising: i) incubating the mol In certain additional embodiments, the invention provides ecule with the non-ligand binding domain of the extracellular an antibody that specifically binds to two or more (i.e., at least domain of a human Notch receptor comprising EGF repeats two or two, three, or four) human Notch receptors. In certain 13-36; ii) determining if the molecule binds to the non-ligand 30 embodiments, the antibody specifically binds to a non-ligand binding region of the extracellular domain of the human Notch receptor comprising EGF repeats 13-36; and iii) deter binding region of an extracellular domain of the two or more mining if the molecule inhibits tumor growth. human Notch receptors. In certain embodiments, the anti In certain embodiments, the present invention provides a body is a monospecific antibody that specifically binds to a pharmaceutical composition comprising an antibody that 35 non-ligand binding region of an extracellular domain of the specifically binds to a non-ligand binding region of the extra two or more human Notch receptors. In certain embodiments, cellular domain of a human Notch receptor and inhibits tumor the antibody binds to EGF10 of Notch1, Notch2, or Notch4, growth. and/or to EGF9 of Notch3. In certain embodiments, the non In certain embodiments, the present invention provides a ligand binding region to which the antibody binds is not method of making an antibody that specifically binds to a 40 EGF4 or does not comprise EGF4. In certain embodiments, non-ligand binding region of the extracellular domain of a the two or more human Notch receptors comprise Notch2 human Notch receptor and inhibits tumor growth. and/or Notch3. In certain embodiments, the two or more In certain embodiments, the present invention provides an human Notch receptors comprise Notch2 and Notch3. In isolated nucleic acid that encodes an antibody that specifi certain embodiments, the antibody is an antagonist of the two cally binds to a non-ligand binding region of the extracellular 45 or more human Notch receptors. domain of a human Notch receptor and inhibits tumor growth. The invention further provides a method of modulating the In some embodiments, the invention provides an agent function of pericytes and/or vascular Smooth muscle cells in (e.g., an antibody) that specifically binds to an EGF10 domain a subject, wherein the method comprises administering to the (or an equivalent of an EGF10 domain if Notch3) of one or Subject an effective amount of an agent that specifically binds more human Notch receptors. In certain embodiments, the 50 human Notch2 and/or human Notch3. In certain embodi agent is an antibody. In certain embodiments, the agent is an ments, the agent is an antibody. In certain embodiments, the antagonist. In certain embodiments, the agent specifically agent is an antagonist. binds to EGF10 of human Notch2 and/or EGF9 of human The invention further provides a method of inhibiting Notch3. EGF9 is the EGF within human Notch3 that is angiogenesis in a Subject, comprising the step of administer equivalent to EGF10 in the other human Notch receptors 55 ing to the Subject an effective amount of an agent that spe Notch1, Notch2, and Notch4. In certain embodiments, the cifically binds human Notch2 and/or human Notch3. In cer agent specifically binds human Notch2. In certain embodi tain embodiments, the agent is an antibody. In certain ments, the agent specifically binds human Notch2 and embodiments, the agent is an antagonist. In certain embodi Notch3. In certain embodiments, the agent specifically binds ments, the antagonist is an antagonist of Notch2. In certain human Notch3. 60 embodiments, the antagonist is an antagonist of Notch3. In In one aspect, the invention provides a 59R1 antibody certain embodiments, the antagonist is an antagonist of comprising the heavy chain and light chain sequences pro Notch2 and Notch3. In some embodiments, the method of vided in SEQ ID NOs: 16 and 18 (with or without signal inhibiting angiogenesis comprises modulating the function of sequence), respectively, or as encoded by the DNA deposited pericytes and/or vascular Smooth muscle cells. In some with ATCC on Oct. 15, 2008, and assigned designation num 65 embodiments, the angiogenesis is tumor angiogenesis. ber PTA-9547. The invention further provides polypeptides In certain embodiments, the Notch-binding agent is an or antibodies that comprise the heavy chain variable region antagonist of the human Notch receptor(s) to which it spe US 8,226,943 B2 33 34 cifically binds. In some alternative embodiments, the Notch binds to at least part of the sequence HKGAL (SEQ ID binding agent is an agonist of the human Notch receptor(s) to NO:28) within human Notch2 EGF10. In certain embodi which it specifically binds. ments, the agent orantagonist also binds to other amino acids In certain embodiments, the agent that specifically binds to within human Notch2 EGF10 (e.g., the entire epitope of an one or more Notch receptor(s) and is an antagonist of the one anti-Notch2 antibody is not necessarily contained entirely or more Notch receptor(s) inhibits at least about 10%, at least within the sequence HKGAL). In certain embodiments, the about 20%, at least about 30%, at least about 50%, at least Notch-binding agent or antagonist further specifically binds about 75%, at least about 90%, or about 100% of one or more to at least one additional human Notch receptor (e.g., Notch1. activities of the bound Notch receptor(s). Notch3, or Notch4). In certain embodiments, the Notch-bind In certain embodiments, the antagonist of one or more 10 ing agent orantagonist that binds to EGF10 of human Notch2 human Notch receptor(s) (e.g., Notch2 and/or Notch3) has further binds to an EGF10 domain of human Notch1, an one or more of the following effects: inhibit ligand binding to EGF9 domain of human Notch3, and/or an EGF10 domain of the one or more human Notch receptors, inhibit ligand-in human Notch4. In certain embodiments, the additional duced signaling by the one or more Notch receptors; inhibit human Notch receptor is human Notch3. proliferation of tumor cells; reduce the tumorigenicity of a 15 In certain embodiments, the Notch-binding agent or tumor by reducing the frequency of cancer stem cells in the antagonist (e.g., antibody) binds to an EGF9 domain of tumor, inhibit tumor growth; increase Survival, trigger cell human Notch3. As is apparent from the homology between death of tumor cells; inhibitangiogenesis; or prevent metasta the sequences of the extracellular domains of human Notch2 sis of tumor cells. and human Notch3, EGF9 is the EGF that is the functional/ In certain embodiments, the antagonist has one or more of structural equivalent of Notch2 EGF10 in human Notch3. In the following effects: interference with the expression of a certain embodiments, the Notch-binding agent or antagonist Notch receptor; interference with activation of a Notch recep does not bind to any region of the human Notch3 outside of tor signal transduction pathway by, for example, Sterically EGF9. In certain embodiments, the agent or antagonist binds inhibiting interactions between the Notch receptor and one or to at least part of the sequence HEDAI (SEQ ID NO:29) more of its ligands, or binding to a human Notch receptor and 25 within the human Notch3 EGF9 domain. HEDAI (SEQ ID triggering cell death or inhibiting cell proliferation. NO:29) is the sequence within the Notch3 EGF9 domain that In certain embodiments, antagonists againsta Notch recep corresponds to sequence HKGAL (SEQ ID NO:28) within tor, such as Notch2 or Notch3, act extracellularly to act upon human Notch2 EGF10. In certain embodiments, the agent or or inhibit the function of the Notch receptor. In certain antagonist also binds to other amino acids within human embodiments, an antagonist is a small molecule that binds to 30 Notch3 EGF9. In certain embodiments, the Notch-binding the extracellular domain of a Notch receptor. In certain agent or antagonist binds to an EGF10 domain of at least one embodiments, an antagonist of a Notch receptor is proteina additional human Notch receptor (e.g., Notch1, Notch2, and/ ceous. In some embodiments, proteinaceous antagonists of a or Notch4). In certain embodiments, the additional human Notch receptor are antibodies that specifically bind to an Notch receptor is human Notch2. Such as an agent orantago extracellular epitope of a Notch receptor. Extracellular bind 35 nist that binds to an EGF10 domain of human Notch2. In ing of an antagonist against a Notch receptor can inhibit the certain embodiments, the Notch-binding agent or antagonist signaling of a Notch receptor protein by inhibiting intrinsic does not bind to any region of the human Notch2 outside of activation (e.g., kinase activity) of a Notch receptor and/or by EGF10. In certain embodiments, the agent or antagonist sterically inhibiting the interaction, for example, of a Notch binds to at least part of the sequence HKGAL (SEQ ID receptor with one of its ligands. Furthermore, extracellular 40 NO:28) within human Notch2 EGF10. In some embodi binding of an antagonist against a Notch receptor can down ments, the agent orantagonist is a monospecific antibody that regulate cell-surface expression of a Notch receptor Such as, binds to at least part of the sequence HKGAL (SEQ ID for example, by internalization of a Notch receptor and/or NO:28) in Notch2 and also binds to at least part of the decreasing cell Surface trafficking of a Notch receptor. sequence HEDAI (SEQID NO:29) in Notch3. In certain embodiments, the Notch-binding agent or 45 In certain alternative embodiments, the Notch-binding antagonist (e.g., antibody) specifically binds to a non-ligand agent orantagonist binds to a portion of the non-ligand bind binding region of an extracellular domain of at least one ing region of an extracellular domain of a Notch1, Notch2, or human Notch receptor, wherein the non-ligand binding Notch4 receptor in a region other than EGF10 or a Notch3 region comprises EGF repeat 10 (or the equivalent if Notch3). receptor in a region other than EGF9. For example, in certain In certain embodiments, the agent or antagonist specifically 50 embodiments, the agent or antagonist binds to the LNR-HD binds to Notch2. In certain embodiments, the agent orantago domain of one or more Notch receptors. In certain embodi nist specifically binds to Notch3. In certain embodiments, the ments, the agent or antagonist binds to EGF1, EGF2, EGF3, agent or antagonist specifically binds to both human Notch2 EGF4, EGF5, EGF6, EGF7, EGF9, EGF10, EGF13, EGF14, and human Notch3. EGF15, EGF16, EGF17, EGF18, EGF19, EGF20, EGF21, In certain embodiments, the Notch-binding agent or 55 EGF22, EGF23, EGF24, EGF25, EGF26, EGF27, EGF28, antagonist (e.g., antibody) specifically binds to an EGF10 EGF29, EGF30, EGF31, EGF32, EGF33, EGF34, EGF35, domain of human Notch2. In certain embodiments, the and/or EGF36 of an extracellular domain of one or more Notch-binding agent orantagonist does not bind to any region Notch receptors. of the human Notch2 outside of the EGF 10 domain. In In certain embodiments, the Notch-binding agent or certain alternative embodiments, the Notch-binding agent or 60 antagonist binds to the ligand binding region of an extracel antagonist that specifically binds to an EGF10 domain of lular domain of one or more human Notch receptors. Thus, in human Notch2, also further binds to another region of human certain embodiments, the Notch-binding agent or antagonist Notch2. In other words, in some embodiments, the entire may bind to EGF11 and/or EGF12 of Notch 1, 2, or 4 (Rebay epitope of the agent or antagonist falls within EGF10. In et al., 1991, Cell 67:687; Lei et al., 2003, Dev. 130:6411; certain other embodiments, the epitope of the agent orantago 65 Hambleton et al., 2004, Structure 12:2173) or EGF10 and/or nist that binds to human Notch2 partially overlaps with EGF11 of Notch3 (Peters et al., 2004, Experimental Cell EGF10. In certain embodiments, the agent or antagonist Research, 299:454-464). US 8,226,943 B2 35 36 In certain embodiments, the Notch-binding agent (e.g., tumor cells. In certain embodiments, antagonists of a Notch antibody) specifically binds to two or more human Notch receptor trigger cell death via a conjugated toxin, chemo receptors (e.g., Notch1, Notch2, Notch3, and/or Notch4). In therapeutic agent, radioisotope, or other such agent. For other words, in certain embodiments, the agent or antibody example, an antibody against a Notch receptor is conjugated binds at least two human Notch receptors (i.e., two, three, or to a toxin that is activated in tumor cells expressing the Notch four human Notch receptors). Encompassed are agents and receptor by protein internalization. In other embodiments, antibodies that specifically bind to two human Notch family antagonists of a Notch receptor mediate cell death of a cell receptors (e.g., Notch2 and Notch3, Notch1 and Notch2, expressing the Notch receptor via antibody-dependent cellu Notch1 and Notch3, Notch1 and Notch4, Notch2 and Notch4, lar cytotoxicity (ADCC). ADCC involves cell lysis by effec or Notch3 and Notch4). Agents and antibodies that specifi 10 tor cells that recognize the Fc portion of an antibody. Many cally bind to three human Notch receptor family members are lymphocytes, monocytes, tissue macrophages, granulocytes also envisioned (e.g., agents and antibodies that specifically and eosinophils, for example, have Fc receptors and can bind to Notch1, Notch2, and Notch3, Notch1, Notch2, and mediate cytolysis (Dillman, 1994, J. Clin. Oncol. 12:1497). Notch4, or Notch2. Notch3, and Notch4), as are agents and In Some embodiments, an antagonist of a Notch receptor is an antibodies that specifically bind to four human Notch recep 15 antibody that triggers cell death of cell expressing a Notch tor family members (e.g., agents and antibodies that specifi receptor by activating complement-dependent cytotoxicity cally bind to Notch1, Notch2, Notch3 and Notch4). In certain (CDC). CDC involves binding of serum complement to the Fc embodiments, the agent or antibody specifically binds to both portion an antibody and Subsequent activation of the comple human Notch2 and Notch3. In certain alternative embodi ment protein cascade, resulting in cell membrane damage and ments, the agent orantibody specifically binds to both human eventual cell death. Biological activity of antibodies is known Notch1 and Notch2. In some embodiments, the agent or anti to be determined, to a large extent, by the constant domains or body specifically binds to both human Notch1 and Notch3. In Fc region of the antibody molecule (Uananue and Benacerraf, still further embodiments, the agent or antibody specifically Textbook of Immunology, 2nd Edition, Williams & Wilkins, binds to both human Notch1 and Notch4. In certain embodi p. 218 (1984)). Antibodies of different classes and subclasses ments, the agent or antibody is an antagonist of the two or 25 differ in this respect, as do antibodies of the same subclass but more human Notch receptors. from different species. Of human antibodies, IgM is the most In certain embodiments, the Notch-binding agent or efficient class of antibodies to bind complement, followed by antagonist binds to a Notch receptor (e.g., Notch2 and/or IgG1, IgG3, and IgG2 whereas IgG4 appears quite deficient Notch3) with a dissociation constant of about 1 uM or less, in activating the complement cascade (Dillman, 1994, J. Clin. about 100 nM or less, about 40 nM or less, about 20 nM or 30 Oncol. 12:1497; Jefferis et al., 1998, Immunol. Rev. 163:59 less, or about 10 nM or less. In certain embodiments, the 76). According to the present invention, antibodies of those agent or antagonist binds one or more human Notch recep classes having the desired biological activity are prepared. tors, such as human Notch2 and/or human Notch3, with a K, The ability of any particular antibody against a Notch of 1 nM or less. In some embodiments, the Notch binding receptor to mediate lysis of the target cell by complement agent is an antibody that binds to Notch2 with a K of about 35 activation and/or ADCC can be assayed. The cells of interest 1 nM or less. In some embodiments, the Notch binding agent are grown and labeled in vitro; the antibody is added to the is an antibody that binds to Notch3 with a K, of about 1 nM cell culture in combination with either serum complement or or less. In certain embodiments, the dissociation constant for immune cells which can be activated by the antigen antibody the agent or antagonist with respect to a particular Notch complexes. Cytolysis of the target cells is detected, for receptor is the dissociation constant determined using a 40 example, by the release of label from the lysed cells. In fact, Notch-Fc fusion protein comprising the Notch extracellular antibodies can be screened using the patients own serum as a domain and/or a portion of the extracellular domain compris Source of complement and/or immune cells. The antibody ing EGF 10 immobilized on a Biacore chip. that is capable of activating complement or mediating ADCC In certain embodiments, the antagonist specifically binds in the in vitro test can then be used therapeutically in that to human Notch3 and inhibits binding of a ligand (e.g., DLL4. 45 particular patient. JAG1, and/or JAG2) to human Notch3 and/or inhibits signal In certain embodiments, the Notch-binding agent or ing of human Notch3. In certain embodiments, the antagonist antagonist is an antibody that does not have one or more specifically binds to human Notch2 and inhibits binding of a effector functions. For instance, in some embodiments, the ligand (e.g., DLL4, JAG1, and/or JAG2) to human Notch2 antibody has no antibody-dependent cellular cytoxicity and/or inhibits signaling of human Notch2. In certain 50 (ADCC) activity and/or no complement-dependent cytoxic embodiments, the antagonist inhibits DLL4-induced Notch2 ity (CDC) activity. In certain embodiments, the antibody does signaling. In certain embodiments, the antagonist inhibits not bind to an Fc receptor and/or complement factors. In DLL4-induced Notch3 signaling. In certain embodiments, certain embodiments, the antibody has no effector function. the antagonist inhibits JAG2-induced Notch2 signaling. In In other embodiments, antagonists of a Notch receptor can certain embodiments, the antagonist inhibits JAG2-induced 55 trigger cell death indirectly by inhibiting angiogenesis. Notch3 signaling. In certain embodiments, the signaling by Angiogenesis is the process by which new blood vessels form Notch2 and/or Notch3 is reduced by at least about 10%, by at from pre-existing vessels and is a fundamental process least about 25%, by at least about 50%, by at least about 75%, required for normal growth, for example, during embryonic by at least about 90%, or by at least about 95%. In certain development, wound healing, and in response to ovulation. embodiments, the binding of one or more ligands to Notch2 60 Solid tumor growth larger than 1-2 mm also requires angio and/or Notch3 is reduced by at least about 10%, by at least genesis to Supply nutrients and oxygen without which tumor about 25%, by at least about 50%, by at least about 75%, by cells die. Thus, in certain embodiments, an antagonist of a at least about 90%, or by at least about 95%. Notch receptor targets vascular cells that express the Notch In some embodiments, antagonists against a Notch recep receptor including, for example, endothelial cells, Smooth tor bind to a Notch receptor and have one or more of the 65 muscle cells or components of the extracellular matrix following effects: inhibit proliferation of tumor cells, trigger required for vascular assembly. In certain embodiments, an cell death directly in tumor cells, or prevent metastasis of antagonist of a Notch receptor (e.g., Notch2 and/or Notch3) US 8,226,943 B2 37 38 targets pericytes and/or vascular Smooth muscle cells. In or Notch3. In some embodiments, the polypeptide specifi other embodiments, an antagonist of a Notch receptor inhibits cally binds Notch2 and Notch3. growth factor signaling required by vascular cell recruitment, The invention further provides a polypeptide comprising assembly, maintenance or Survival. In certain embodiments, SEQ ID NO:13 and/or SEQ ID NO:14. In certain embodi the antagonist modulates the function of pericytes and/or 5 ments, the polypeptide comprises a variable light chain vascular Smooth muscle cells. sequence comprising SEQID NO:13 and/or a variable heavy In certain embodiments the Notch-binding agents or chain sequence comprising SEQID NO:14. In some embodi antagonists (e.g., antibodies), either alone or in combination ments, the polypeptide comprises a variable light chain with a second therapeutic agent, are capable of inhibiting sequence comprising SEQ ID NO:13 and a variable heavy 10 chain sequence comprising SEQ ID NO:14. In certain tumor growth. In certain embodiments, the Notch-binding embodiments, the polypeptide comprises a variable light agents or antagonists are capable of inhibiting tumor growth chain sequence comprising SEQID NO:13 and/or a variable in vivo (e.g., in a Xenograft mouse model and/or in a human heavy chain sequence comprising SEQ ID NO:50. In some having cancer). In certain embodiments, the Notch-binding embodiments, the polypeptide comprises a variable light agents or antagonists are capable of inhibiting tumor growth 15 chain sequence comprising SEQ ID NO:13 and a variable by at least about 10%, at least about 25%, at least about 50%, heavy chain sequence comprising SEQID NO:50. In certain at least about 75%, at least about 90% at a given time point in embodiments, the polypeptide comprises a variable light a xenograft model. In certain embodiments, the Notch-bind chain sequence comprising SEQID NO:13 and/or a variable ing agents or antagonists prevent tumor growth. In certain heavy chain sequence comprising SEQID NO:52. In certain embodiments, the Notch-binding agents or antagonists 20 embodiments, the polypeptide comprises a variable light inhibit tumor recurrence. chain sequence comprising SEQID NO:13 and/or a variable In certain embodiments, the Notch-binding agents are heavy chain sequence comprising SEQID NO:53. In certain capable of reducing the tumorigenicity of a tumor. In certain embodiments, the polypeptide comprises a variable light embodiments, the agent orantibody is capable of reducing the chain sequence comprising SEQID NO:13 and/or a variable tumorigenicity of a tumor comprising cancer stem cells in an 25 heavy chain sequence comprising SEQID NO:54. In certain animal model. Such as a mouse Xenograft model. In certain embodiments, the polypeptide comprises a variable light embodiments, the number or frequency of cancer stem cells chain sequence comprising SEQID NO:13 and/or a variable in a tumor is reduced by at least about two-fold, about three heavy chain sequence comprising SEQID NO:55. In certain fold, about five-fold, about ten-fold, about 50-fold, about embodiments, the polypeptide comprises a variable light 100-fold, or about 1000-fold (e.g., in a xenograft model). In 30 chain sequence comprising SEQID NO:13 and/or a variable certain embodiments, the reduction in the frequency of cancer heavy chain sequence comprising SEQID NO:56. In certain stem cells is determined by limiting dilution assay using an embodiments, the polypeptide comprises a variable light animal model. An example of a limiting dilution assay used to chain sequence comprising SEQID NO:13 and/or a variable test the efficacy of an anti-Notch antibody is provided in heavy chain sequence comprising SEQID NO:57. In certain Example 8, below. Additional examples and guidance regard- 35 embodiments, the polypeptide is an antibody. In certain ing the use of limiting dilution assays to determine a reduction embodiments, the polypeptide specifically binds Notch2 and/ in the number or frequency of cancer stem cells in a tumor can or Notch3. In some embodiments, the polypeptide specifi be found, e.g., in International Publication No. WO 2008/ cally binds Notch2 and Notch3. In some embodiments, the 042236, U.S. Patent Application Publication Nos. 2008/ polypeptide specifically binds human Notch2. In some 0064049, and 2008/0178305, each of which is incorporated 40 embodiments, the polypeptide specifically binds human by reference herein in its entirety. Notch3. The present invention provides a variety of polypeptides, It will be recognized in the art that some amino acid including but not limited to, antibodies and fragments of sequences of the invention can be varied without significant antibodies. In certain embodiments, the polypeptide is iso effect of the structure or function of the protein. If such lated. In certain alternative embodiments, the polypeptide is 45 differences in sequence are contemplated, it should be Substantially pure. remembered that there will be critical areas on the protein In certain embodiments, the polypeptides of the present which determine activity. Thus, the invention further includes invention can be recombinant polypeptides, natural polypep variations of the polypeptides which show substantial activ tides, or synthetic polypeptides comprising the sequence of ity. Such mutants include deletions, insertions, inversions, SEQID NOS:2, 4, 13, 14, 16, 18, 19, 20,39, 40,49, 50, 52,53, 50 repeats, and type substitutions. Guidance concerning which 54, 55, 56, or 57 (with or without the indicated signal amino acid changes are likely to be phenotypically silent can sequences), as well as the polypeptides comprising the be found in Bowie et al., Deciphering the Message in Protein polypeptides encoded by the polynucleotides of SEQ ID Sequences: Tolerance to Amino Acid Substitutions, 1990, NOs: 1, 3, 15, 17, 47, 48, 58, 59, or 60 (with or without the Science 247: 1306-1310. indicated signal sequences). 55 Thus, the fragments, derivatives, or analogs of the polypep The invention provides a polypeptide comprising the tides of the invention can be: (i) one in which one or more of heavy chain and/or the light chain of 59R1 provided in SEQ the amino acid residues are substituted with a conserved or ID NO:16 and/or SEQ ID NO:18, respectively. In certain non-conserved amino acid residue (often a conserved amino embodiments, the polypeptide is an antibody. In certain acid residue) and Such Substituted amino acid residue can or embodiments, the polypeptide specifically binds Notch2 and/ 60 cannot be one encoded by the genetic code; or (ii) one in or Notch3. In some embodiments, the polypeptide specifi which one or more of the amino acid residues includes a cally binds Notch2 and Notch3. Substituent group; or (iii) one in which the mature polypep The invention provides a polypeptide comprising the tide is fused with another compound. Such as a compound to heavy chain and/or the light chain of 59R5 provided in SEQ increase the half-life of the polypeptide (for example, poly ID NO:49 and/or SEQ JD NO:18, respectively. In certain 65 ethylene glycol); or (iv) one in which the additional amino embodiments, the polypeptide is an antibody. In certain acids are fused to the mature polypeptide. Such as a leader or embodiments, the polypeptide specifically binds Notch2 and/ secretory sequence or a sequence which is employed for US 8,226,943 B2 39 40 purification of the mature polypeptide or a proprotein 96%, 97%, 98%, or 99% similarity (at certain times 96%, sequence. Such fragments, derivatives, and analogs are 97%, 98%, or 99% sequence identity) to the polypeptides of deemed to be within the scope of the teachings herein. SEQID NOs: 2, 4, 13, 14, 16, 18, 19, 20, 39, 40, 49, 50, 52, Of particular interest are substitutions of a charged amino 5354, 55,56,or 57. As known in the art, “similarity” between acid with another charged amino acid and with neutral or 5 two polypeptides is determined by comparing the amino acid negatively charged amino acid. The latter results in proteins sequence and its conserved amino acid Substitutes of one with reduced positive charge. Reduced positive charge on a polypeptide to the sequence of a second polypeptide. protein can lead to reduction in protein aggregation and the Fragments or portions of the polypeptides of the present prevention of aggregation is highly desirable. Aggregation of invention can be employed for producing the corresponding proteins can not only result in a loss of activity but can also be 10 full-length polypeptide by peptide synthesis; therefore, the problematic when preparing pharmaceutical formulations, fragments can be employed as intermediates for producing because aggregates can be immunogenic. (Pinckard et al., the full-length polypeptides. Fragments or portions of the 1967, Clin. Exp. Immunol. 2:331-340; Robbins et al., 1987, polynucleotides of the present invention can be used to Syn Diabetes 36:838-845; Cleland et al., 1993, Crit. Rev. Thera thesize full-length polynucleotides of the present invention. peutic Drug Carrier Systems 10:307-377). 15 As indicated, amino acid changes are typically of a minor In certain embodiments, a fragment of the proteins of this nature. Such as conservative amino acid Substitutions that do invention is a portion or all of a protein which is capable of not significantly affect the folding or activity of the protein binding to a Notch receptor protein. This fragment has a high affinity for a Notch receptor or a ligand of a Notch receptor. (see Table 1.) Certain fragments of fusion proteins are protein fragments TABLE 1. comprising at least part of the Notch binding domain of the polypeptide agent or antagonist fused to at least part of a Conservative Amino Acid Substitutions constant region of an immunoglobulin. The affinity is typi Original Amino Acid Exemplary Conservative Substitutions cally in the range of about 10' to 10' M, although the 25 affinity can vary considerably with fragments of different Alanine Valine, Isoleucine, Leucine, Glycine, sizes, ranging from 107 to 10' M. In some embodiments, Serine Arginine Lysine, Histidine, Glutamine, Asparagine the fragment is about 10-110 amino acids in length and com Asparagine Glutamine, Histidine, Lysine, Arginine prises the Notch binding domain of the polypeptide agent or Aspartic Acid Glutamic Acid, Asparagine antagonist linked to at least part of a constant region of an Cysteine Serine, Alanine, Methionine 30 immunoglobulin. Glutamine Asparagine The polypeptides and analogs can be further modified to Glutamic Acid Aspartic Acid, Glutamine Glycine Proline, Alanine contain additional chemical moieties not normally part of the Histidine Asparagine, Glutamine, Lysine, Arginine protein. Those derivatized moieties can improve the solubil Isoleucine Leucine, Valine, Methionine, Alanine, ity, the biological half life or absorption of the protein. The Phenylalanine, Norleucine 35 Leucine Norleucine, Isoleucine, Valine, moieties can also reduce or eliminate any undesirable side Methionine, Alanine, Phenylalanine effects of the proteins and the like. An overview for those Lysine Arginine, Glutamine, Asparagine, moieties can be found in Remington’s Pharmaceutical Sci Histidine ences, 20th ed., Mack Publishing Co., Easton, Pa. (2000). Methionine Leucine, Phenylalanine, Isoleucine, Valine, Cysteine The isolated polypeptides described herein can be pro Phenylalanine Leucine, Valine, Isoleucine, Alanine, 40 duced by any suitable method known in the art. Such methods Tyrosine range from direct protein synthesis methods, to constructing Proline Alanine, Glycine a DNA sequence encoding isolated polypeptide sequences Serine Threonine and expressing those sequences in a suitable transformed Threonine Serine Trytophan Tyrosine, Phenylalanine host. Tyrosine Tryptophan, Phenylalanine, Threonine, 45 In some embodiments of a recombinant method, a DNA Serine sequence is constructed by isolating or synthesizing a DNA Valine Isoleucine, Methionine, Leucine, sequence encoding a wild-type protein of interest. Optionally, Phenylalanine, Alanine, Norleucine the sequence can be mutagenized by site-specific mutagen esis to provide functional analogs thereof. See, e.g. Zoeller et Of course, the number of amino acid substitutions made 50 al., 1984, Proc. Nat. Acad. Sci. USA 81:5662-5066 and U.S. depends on many factors, including those described above. In Pat. No. 4,588,585. Another method of constructing a DNA certain embodiments, the number of substitutions for any sequence encoding a polypeptide of interest would be by given polypeptide will not be more than 50, 40, 30, 25, 20, 15, chemical synthesis using an oligonucleotide synthesizer. 10, or 3. Such oligonucleotides can be designed based on the amino In certain embodiment, the polypeptides and polynucle 55 acid sequence of the desired polypeptide and selecting those otides of the present invention are provided in an isolated codons that are favored in the host cell in which the recom form, and at times are purified to homogeneity. binant polypeptide of interest will be produced. The polypeptides of the present invention include the Standard methods can be applied to synthesize an isolated polypeptides of SEQID NOS: 2, 4, 13, 14, 16, 18, 19, 20, 39, polynucleotide sequence encoding an isolated polypeptide of 40, 49, 50, 52, 53 54, 55, 56, or 57 as well as polypeptides 60 interest. For example, a complete amino acid sequence can be which have at least 90% similarity (at certain times at least used to construct a back-translated gene. Further, a DNA 90% sequence identity) to the polypeptides of SEQID NOs: oligomer containing a nucleotide sequence coding for the 2, 4, 13, 14, 16, 18, 19, 20, 39, 40, 49, 50, 52,5354, 55, 56, particular isolated polypeptide can be synthesized. For or 57 and at least 95% similarity (at certain times at least 95% example, several Small oligonucleotides coding for portions sequence identity) to the polypeptides of SEQID NOS: 2, 4, 65 of the desired polypeptide can be synthesized and then 13, 14, 16, 18, 19, 20, 49, 50, 52, 53 54, 55, 56, or 57 and in ligated. The individual oligonucleotides typically contain 5 still other embodiments, polypeptide which have at least or 3' overhangs for complementary assembly. US 8,226,943 B2 41 42 Once assembled (by synthesis, site-directed mutagenesis, and mammalian cellular hosts are described by Pouwels et al. or another method), the mutant DNA sequences encoding a (Cloning Vectors: A Laboratory Manual, Elsevier, N.Y., particular isolated polypeptide of interest will be inserted into 1985), the relevant disclosure of which is hereby incorporated an expression vector and operatively linked to an expression by reference. control sequence appropriate for expression of the protein in Various mammalian or insect cell culture systems are also a desired host. Proper assembly can be confirmed by nucle advantageously employed to express recombinant protein. otide sequencing, restriction mapping, and expression of a Expression of recombinant proteins in mammalian cells can biologically active polypeptide in a suitable host. As is well be performed because Such proteins are generally correctly known in the art, in order to obtain high expression levels of folded, appropriately modified and completely functional. a transfected gene in a host, the gene is operatively linked to 10 transcriptional and translational expression control Examples of suitable mammalian host cell lines include the sequences that are functional in the chosen expression host. COS-7 lines of monkey kidney cells, described by Gluzman Recombinant expression vectors may be used to amplify 1981, Cell 23:175, and other cell lines capable of expressing and express DNA encoding polypeptides. Recombinant an appropriate vector including, for example, L cells, C127. expression vectors are replicable DNA constructs which have 15 3T3, Chinese hamster ovary (CHO), HeLa and BHK cell synthetic or cDNA-derived DNA fragments encoding a lines. Mammalian expression vectors can comprise nontran Notch receptor fusion or a bioeduivalent analog operatively scribed elements such as an origin of replication, a Suitable linked to suitable transcriptional or translational regulatory promoter and enhancer linked to the gene to be expressed, and elements derived from mammalian, microbial, viral or insect other 5' or 3' flanking nontranscribed sequences, and 5' or 3' genes. A transcriptional unit generally comprises an assem nontranslated sequences, such as necessary ribosome binding bly of (1) a genetic element or elements having a regulatory sites, a polyadenylation site, splice donor and acceptor sites, role in gene expression, for example, transcriptional promot and transcriptional termination sequences. Baculovirus sys ers or enhancers, (2) a structural or coding sequence which is tems for production of heterologous proteins in insect cells transcribed into mRNA and translated into protein, and (3) are reviewed by Luckow and Summers, 1988, Bio/Technol appropriate transcription and translation initiation and termi 25 ogy 6:47. nation sequences, as described in detail below. Such regula The proteins produced by a transformed host can be puri tory elements can include an operator sequence to control fied according to any suitable method. Such standard methods transcription. An origin of replication which usually confers include chromatography (e.g., ion exchange, affinity and siz the ability to replicate in a host and a selection gene to facili ing column chromatography), centrifugation, differential tate recognition of transformants can additionally be incor 30 solubility, or by any other standard technique for protein porated. DNA regions are operatively linked when they are purification. Affinity tags such as hexahistidine, maltose functionally related to each other. For example, DNA for a binding domain, influenza coat sequence and glutathione-S- signal peptide (secretory leader) is operatively linked to DNA transferase can be attached to the protein to allow easy puri for a polypeptide if it is expressed as a precursor which fication by passage over an appropriate affinity column. Iso participates in the secretion of the polypeptide; a promoter is 35 lated proteins can also be physically characterized using Such operatively linked to a coding sequence if it controls the techniques as proteolysis, nuclear magnetic resonance and transcription of the sequence; or a ribosome binding site is X-ray crystallography. operatively linked to a coding sequence if it is positioned so as For example, Supernatants from systems which secrete to permit translation. Generally, “operatively linked' means recombinant protein into culture media can be first concen contiguous and, in the case of secretory leaders, means con 40 trated using a commercially available protein concentration tiguous and in reading frame. Structural elements intended filter, for example, an Amicon or Millipore Pellicon ultrafil for use in yeast expression systems include a leader sequence tration unit. Following the concentration step, the concentrate enabling extracellular secretion of translated protein by a host can be applied to a suitable purification matrix. Alternatively, cell. Alternatively, where recombinant protein is expressed an anion exchange resin can be employed, for example, a without a leader or transport sequence, it can include an 45 matrix or Substrate having pendant diethylaminoethyl N-terminal methionine residue. This residue can optionally (DEAE) groups. The matrices can be acrylamide, agarose, be subsequently cleaved from the expressed recombinant pro dextran, cellulose or other types commonly employed in pro tein to provide a final product. tein purification. Alternatively, a cation exchange step can be The choice of expression control sequence and expression employed. Suitable cation exchangers include various vector will depend upon the choice of host. A wide variety of 50 insoluble matrices comprising Sulfopropyl or carboxymethyl expression host/vector combinations can be employed. Use groups. Finally, one or more reversed-phase high perfor ful expression vectors for eukaryotic hosts, include, for mance liquid chromatography (RP-HPLC) steps employing example, vectors comprising expression control sequences hydrophobic RP-HPLC media, e.g., silica gel having pendant from SV40, bovine papilloma virus, adenovirus and cytome methyl or other aliphatic groups, can be employed to further galovirus. Useful expression vectors for bacterial hosts 55 purify a cancer stem cell protein-Fc composition. Some or all include known bacterial plasmids, such as plasmids from of the foregoing purification steps, in various combinations, Esherichia coli, including pCR1, pBR322, pMB9 and their can also be employed to provide a homogeneous recombinant derivatives, and wider host range plasmids, such as M13 and protein. filamentous single-stranded DNA phages. Recombinant protein produced in bacterial culture is usu Suitable host cells for expression of a polypeptide include 60 ally isolated by initial extraction from cell pellets, followed prokaryotes, yeast, insector higher eukaryotic cells under the by one or more concentration, salting-out, aqueous ion control of appropriate promoters. Prokaryotes include gram exchange or size exclusion chromatography steps. High per negative or gram positive organisms, for example E. coli or formance liquid chromatography (HPLC) can be employed Bacilli. Higher eukaryotic cells include established cell lines for final purification steps. Microbial cells employed in of mammalian origin as described herein. Cell-free transla 65 expression of a recombinant protein can be disrupted by any tion systems could also be employed. Appropriate cloning convenient method, including freeze-thaw cycling, Sonica and expression vectors for use with bacterial, fungal, yeast, tion, mechanical disruption, or use of cell lysing agents. US 8,226,943 B2 43 44 In certain embodiments, the Notch-binding agent or NO:8), or a variant thereof comprising 1, 2, 3, or 4 conserva antagonist comprises an antibody. In certain embodiments, tive amino acid substitutions; a light chain CDR2 comprising the antibody is isolated. In certain embodiments, the antibody GASSRAT (SEQID NO:9), or a variant thereofcomprising 1, is Substantially pure. 2, 3, or 4 conservative amino acid substitutions; and/or a light The present invention provides antibodies that compete for chain CDR3 comprising QQYSNFPI (SEQ ID NO:10), or a specific binding to human Notch2 and/or Notch3 with an variant thereof comprising 1, 2, 3, or 4 conservative amino antibody comprising a heavy chain variable region compris acid substitutions. In certain embodiments, the antibody com ing SEQID NO:14 and a light chain variable region compris prises a heavy chain CDR1 comprising SSSGMS (SEQ ID ing SEQID NO:13. The present invention also provides anti NO:5), a heavy chain CDR2 comprising VIASSGSNTYY bodies that compete for specific binding to human Notch2 10 and/or Notch3 with an antibody that comprises, consists, or ADSVKG (SEQID NO:6), and/or a heavy chain CDR3 com consists essentially of a 59R1 IgG2 antibody comprising the prising SIFYTT (SEQID NO:51). heavy chain and light chain of SEQID NOs: 16 and 18 (with Also provided is an antibody that specifically binds human or without signal sequence), respectively, or as encoded by Notch2 and/or Notch3, wherein the antibody comprises a the DNA deposited with the ATCC on Oct. 15, 2008, and 15 heavy chain CDR1 comprising SSSGMS (SEQ ID NO:5), a assigned designation number PTA-9547. heavy chain CDR2 comprising VIASSGSNTYYADSVKG The invention further provides antibodies that specifically (SEQ ID NO:6), and/or a heavy chain CDR3 comprising bind to one or more Notch receptors, that comprise one, two, (G/I)(I/S)F(F/Y)(AVP)(I/T/S/N) (SEQ ID NO:30). In certain three, four, five, and/or six CDRs of SEQ ID NOS:5-10, embodiments, the heavy chain CDR3 is selected from the 22–27, 30 or 51 with up to four (i.e., 0, 1, 2, 3, or 4) conser group consisting of SIFYPT (SEQID NO:22), SSFFAS (SEQ vative amino acid substitutions (see, e.g., Table 1) per CDR. ID NO:23), SSFYAS (SEQ ID NO:24), SSFFAT (SEQ ID The invention also provides antibodies that specifically bind NO:25), SIFYPS (SEQ ID NO:26), and SSFFAN (SEQ ID to one or more Notch receptors, that comprise one, two, three, NO:27). In certain embodiments, the antibody comprises a four, five, and/or six CDRs of 59R1 (i.e., SEQID NOS:5-10), heavy chain CDR1 comprising SSSGMS (SEQ ID NO:5), a with up to four conservative amino acid Substitutions per 25 heavy chain CDR2 comprising VIASSGSNTYYADSVKG CDR. Thus, the invention provides antibodies that specifi (SEQ ID NO:6), and/or a heavy chain CDR3 comprising cally bind to one or more human Notch receptors that com GIFFAI (SEQID NO:7). In certain embodiments, the heavy prise one, two, three, four, five and/or six of the CDRs of chain CDR(s) are contained within a variable region of an 59R1. In certain embodiments, the antibodies comprise the antibody heavy chain. In certain embodiments, the antibody heavy chain CDR3 of 59R1, with up to four conservative 30 further comprises a light chain CDR1 comprising RASQS amino acid substitutions, and/or the light chain CDR3 of VRSNYLA (SEQID NO:8), a light chain CDR2 comprising 59R1, with up to four conservative amino acid substitutions. GASSRAT (SEQID NO:9), and/or a light chain CDR3 com In some embodiments, the antibody comprises (a) a heavy prising QQYSNFPI (SEQ ID NO:10). In certain embodi chain CDR1 comprising SSSGMS (SEQ ID NO:5), or a ments, the light chain CDR(s) are contained within a variable variant thereof comprising 1, 2, 3, or 4 conservative amino 35 region of an antibody light chain. In certain embodiments, the acid substitutions; aheavy chain CDR2 comprising VIASSG heavy chain CDR(s) and/or the light chain CDR(s) have been SNTYYADSVKG (SEQID NO:6), or a variant thereof.com modified with 1, 2, 3, or 4 conservative amino acid substitu prising 1, 2, 3, or 4 conservative amino acid Substitutions; tions. In certain embodiments, each of the CDR(s) have been and/or a heavy chain CDR3 comprising GIFFAI (SEQ ID modified by no more than 1-2 conservative amino acid Sub NO:7), or a variant thereof comprising 1, 2, 3, or 4 conserva 40 stitutions. tive amino acid substitutions; and/or (b) a light chain CDR1 For example, in certain embodiments, the invention pro comprising RASQSVRSNYLA (SEQID NO:8), or a variant vides an antibody that specifically binds human Notch2 and/ thereof comprising 1, 2, 3, or 4 conservative amino acid or Notch3, wherein the antibody comprises: (a) a heavy chain substitutions; a light chain CDR2 comprising GASSRAT CDR1 comprising SSSGMS (SEQ ID NO:5), a heavy chain (SEQ ID NO:9), or a variant thereof comprising 1, 2, 3, or 4 45 CDR2 comprising VIASSGSNTYYADSVKG (SEQ ID conservative amino acid Substitutions; and/or a light chain NO:6), and a heavy chain CDR3 comprising GIFFAI (SEQ CDR3 comprising QQYSNFPI (SEQID NO:10), or a variant ID NO:7); and/or (b) a light chain CDR1 comprising thereof comprising 1, 2, 3, or 4 conservative amino acid RASQSVRSNYLA (SEQ ID NO:8), a light chain CDR2 Substitutions. comprising GASSR AT (SEQ ID NO:9), and a light chain The invention also provides antibodies that specifically 50 CDR3 comprising QQYSNFPI (SEQ ID NO:10). In some bind to one or more Notch receptors, that comprise one, two, embodiments, the antibody comprises both the indicated light three, four, five, and/or six CDRs of 59R5 (i.e., SEQID NOs: and heavy chain CDRs. 5, 6, 8-10. 51), with up to four conservative amino acid In some embodiments, the invention provides an antibody substitutions per CDR. In certain embodiments, the antibod that specifically binds human Notch2 and/or Notch3, wherein ies comprise the heavy chain CDR3 of 59R5, with up to four 55 the antibody comprises: (a) a heavy chain CDR1 comprising conservative amino acid Substitutions, and/or the light chain SSSGMS (SEQ ID NO:5), a heavy chain CDR2 comprising CDR3 of 59R5, with up to four conservative amino acid VIASSGSNTYYADSVKG (SEQ ID NO:6), and a heavy Substitutions. In some embodiments, the antibody comprises chain CDR3 comprising SIFYTT (SEQ ID NO:51); and/or (a) a heavy chain CDR1 comprising SSSGMS (SEQ ID (b) a light chain CDR1 comprising RASQSVRSNYLA (SEQ NO:5), or a variant thereof comprising 1, 2, 3, or 4 conserva 60 ID NO:8), a light chain CDR2 comprising GASSRAT (SEQ tive amino acid substitutions; a heavy chain CDR2 compris ID NO:9), and a light chain CDR3 comprising QQYSNFPI ing VIASSGSNTYYADSVKG (SEQID NO:6), or a variant (SEQID NO:10). In certain embodiments, the antibody com thereof comprising 1, 2, 3, or 4 conservative amino acid prises both the indicated light and heavy chain CDRs. substitutions; and/or a heavy chain CDR3 comprising The invention further provides an antibody that specifically SIFYTT (SEQID NO:51), or a variant thereof comprising 1, 65 binds human Notch2 and/or Notch3, wherein the antibody 2, 3, or 4 conservative amino acid Substitutions; and/or (b) a comprises a light chain CDR1 comprising RASQSVRS light chain CDR1 comprising RASQSVRSNYLA (SEQ ID NYLA (SEQ ID NO:8), a light chain CDR2 comprising US 8,226,943 B2 45 46 GASSRAT (SEQID NO:9), and/or a light chain CDR3 com individual cells from a sample are isolated, and protein prising QQYSNFPI (SEQID NO:10). expression detected on fixed or live cells by FACS analysis. The invention also provides an antibody that specifically Furthermore, the antibodies can be used on protein arrays to binds human Notch2 and/or Notch3, wherein the antibody detect expression of a Notch receptor, for example, on tumor comprises: (a) a polypeptide having at least about 80%, at cells, in cell lysates, or in other protein samples. In other least about 85%, at least about 90%, at least about 95%, or at embodiments, the antibodies of the present invention are used least about 98% sequence identity to SEQID NO:14 or SEQ to inhibit the growth of tumor cells by contacting the tumor IDNO:20; and/or (b) a polypeptidehaving at least about 80%, cells with the antibodies either in in vitro cell based assays or at least about 85%, at least about 90%, at least about 95%, or in vivo animal models. In still other embodiments, the anti at least about 98% sequence identity to SEQ ID NO:13 or 10 bodies are used to treat cancer in a human patient by admin SEQ ID NO:19. Accordingly, in certain embodiments, the istering a therapeutically effective amount of an antibody antibody comprises (a) a heavy chain variable region having against a Notch receptor. at least about 95% sequence identity to SEQ ID NO:14: Polyclonal antibodies can be prepared by any known and/or (b) a light chain variable region having at least about method. Polyclonal antibodies are raised by immunizing an 95% sequence identity to SEQID NO:13. In certain embodi 15 animal (e.g. a rabbit, rat, mouse, donkey, goat, etc.) by mul ments, the antibody comprises: (a) a polypeptide (e.g., a tiple Subcutaneous or intraperitoneal injections of the relevant heavy chain variable region) comprising SEQID NO:14 or antigen (a purified peptide fragment, full-length recombinant SEQID NO:20; and/or (b) a polypeptide (e.g., a light chain protein, fusion protein, etc.) optionally conjugated to keyhole variable region) comprising SEQ ID NO:13 or SEQ ID limpet hemocyanin (KLH), serum albumin, etc. diluted in NO:19. sterile Saline and combined with an adjuvant (e.g. Complete The invention also provides an antibody that specifically or Incomplete Freund's Adjuvant) to form a stable emulsion. binds human Notch2 and/or Notch3, wherein the antibody The polyclonal antibody is then recovered from blood, ascites comprises: (a) a polypeptide having at least about 80%, at and the like, of an animalso immunized. Collected blood is least about 85%, at least about 90%, at least about 95%, or at clotted, and the serum decanted, clarified by centrifugation, least about 98% sequence identity to SEQID NO:50; and/or 25 and assayed for antibody titer. The polyclonal antibodies can (b) a polypeptide having at least about 80%, at least about be purified from serum or ascites according to standard meth 85%, at least about 90%, at least about 95%, or at least about ods in the art including affinity chromatography, ion-ex 98% sequence identity to SEQ ID NO:13. Accordingly, in change chromatography, gel electrophoresis, dialysis, etc. certain embodiments, the antibody comprises (a) a heavy Monoclonal antibodies can be prepared using hybridoma chain variable region having at least about 95% sequence 30 methods, such as those described by Kohler and Milstein, identity to SEQID NO:50; and/or (b) a light chain variable 1975, Nature 256:495. Using the hybridoma method, a region having at least about 95% sequence identity to SEQID mouse, hamster, or other appropriate host animal, is immu NO:13. In certain embodiments, the antibody comprises: (a) nized as described above to elicit the production by lympho a polypeptide (e.g., a heavy chain variable region) comprising cytes of antibodies that will specifically bind to an immuniz SEQID NO:50; and/or (b) a polypeptide (e.g., a light chain 35 ing antigen. Alternatively, lymphocytes can be immunized in variable region) comprising SEQID NO:13. vitro. Following immunization, the lymphocytes are isolated In certain embodiments, the antagonists are antibodies that and fused with a suitable myeloma cell line using, for can mediate complement-dependent cytotoxicity or anti example, polyethylene glycol, to form hybridoma cells that body-dependent cellular cytotoxicity to kill tumors express can then be selected away from unfused lymphocytes and ing a target antigen. In certain alternative embodiments, the 40 myeloma cells. Hybridomas that produce monoclonal anti antibodies are directly conjugated to toxins or radioisotopes bodies directed specifically against a chosen antigen as deter to mediate tumor cell killing. Furthermore, tumor survival mined by immunoprecipitation, immunoblotting, or by an in depends on neo-vascularization, and in certain embodiments, vitro binding assay Such as radioimmunoassay (RIA) or the antibodies have an anti-angiogenic effect. enzyme-linked immunosorbent assay (ELISA) can then be The present invention provides isolated antibodies against 45 propagated either in vitro culture using standard methods a Notch receptor such as human Notch2 and/or Notch3. The (Goding, Monoclonal Antibodies. Principles and Practice, antibody, or antibody fragment, can be any monoclonal or Academic Press, 1986) or in vivo as ascites tumors in an polyclonal antibody that specifically recognizes the described animal. The monoclonal antibodies can then be purified from Notch receptor. In some embodiments, the present invention the culture medium or ascites fluid as described for poly provides monoclonal antibodies, or fragments thereof, that 50 clonal antibodies above. specifically bind to a Notch receptor described herein. In Alternatively monoclonal antibodies can also be made Some embodiments, the monoclonal antibodies, or fragments using recombinant DNA methods as described in U.S. Pat. thereof, are chimeric or humanized antibodies that specifi No. 4,816,567. The polynucleotides encoding a monoclonal cally bind to the extracellular domain of a Notch receptor antibody are isolated from mature B-cells or hybridoma cell, described herein. In other embodiments, the monoclonal anti 55 such as by RT-PCR using oligonucleotide primers that spe bodies, or fragments thereof, are human antibodies that spe cifically amplify the genes encoding the heavy and light cifically bind to the extracellular domain of a Notch receptor chains of the antibody, and their sequence is determined using described herein. In certain embodiments, the antibodies are conventional procedures. The isolated polynucleotides IgG1 or IgG2 antibodies. encoding the heavy and light chains are then cloned into The antibodies against a Notch receptor find use in the 60 suitable expression vectors, which when transfected into host experimental, diagnostic and therapeutic methods described cells such as E. coli cells, simian COS cells, Chinese hamster herein. In certain embodiments, the antibodies of the present ovary (CHO) cells, or myeloma cells that do not otherwise invention are used to detect the expression of a Notch receptor produce immunoglobulin protein, express monoclonal anti in biological samples such as, for example, a patient tissue bodies in the host cells. Also, recombinant monoclonal anti biopsy, pleural effusion, or blood sample. Tissue biopsies can 65 bodies or fragments thereof of the desired species can be be sectioned and protein detected using, for example, immu isolated from phage display libraries, e.g., as described nofluorescence or immunohistochemistry. Alternatively, herein. US 8,226,943 B2 47 48 The polynucleotide(s) encoding a monoclonal antibody Alternatively, in certain embodiments, the antibodies can further be modified in a number of different manners described herein may be monospecific. For example, in cer using recombinant DNA technology to generate alternative tain embodiments, each of the one or more antigen-binding antibodies. In some embodiments, the constant domains of sites that an antibody contains is capable of binding (or binds) the light and heavy chains of, for example, a mouse mono 5 the same one or more human Notch receptors (e.g., Notch2, clonal antibody can be substituted 1) for those regions of for Notch3, or homologous epitopes on both Notch2 and example, a human antibody to generate a chimeric antibody Notch3). In certain embodiments, an antigen-binding site of a or 2) for a non-immunoglobulin polypeptide to generate a monospecific antibody described herein is capable of binding fusion antibody. In other embodiments, the constant regions (or binds) both the EGF repeat 9 of human Notch3 and EGF are truncated or removed to generate the desired antibody 10 repeat 10 of Notch2. fragment of a monoclonal antibody. Furthermore, site-di Antibody variable domains with the desired binding speci rected or high-density mutagenesis of the variable region can ficities can be fused to immunoglobulin constant domain be used to optimize specificity, affinity, etc. of a monoclonal sequences. The fusion is with an immunoglobulin heavy antibody. chain constant domain, comprising at least part of the hinge, More generally, modified antibodies useful in the present 15 CH2 and CH3 regions. The first heavy chain constant region invention may be obtained or derived from any antibody. (CH1) containing the site necessary for light chain binding Further, the parent or precursor antibody, or fragment thereof, can be present in at least one of the fusions. DNA encoding used to generate the disclosed modified antibodies may be the immunoglobulin heavy chain fusions and, if desired, the murine, human, chimeric, humanized, non-human primate or immunoglobulin light chain, are inserted into separate primatized. In other embodiments the modified antibodies of expression vectors, and are co-transfected into a suitable host the present invention can comprise single chain antibody organism. Further details of generating bispecific antibodies constructs (such as that disclosed in U.S. Pat. No. 5,892.019, can be found in Suresh et al., 1986, Methods in Enzymology which is incorporated herein by reference) having altered 121:210. constant domains as described herein. Consequently, any of Bispecific antibodies can be prepared as full-length anti these types of antibodies modified in accordance with the 25 bodies or antibody fragments. Techniques for generating teachings herein are compatible with this invention. bispecific antibodies from antibody fragments have been According to the present invention, techniques can be described in the literature. For example, bispecific antibodies adapted for the production of single-chain antibodies specific can be prepared using chemical linkage. In addition, Brennan to a polypeptide of the invention (see U.S. Pat. No. 4,946, et al., 1985, Science 229:81 describe a procedure wherein 778). In addition, methods can be adapted for the construction 30 intact antibodies are proteolytically cleaved to generate of Fab expression libraries (Huse et al., 1989, Science 246: F(ab')2 fragments. 1275-1281) to allow rapid and effective identification of Additionally, Fab' fragments can be directly recovered monoclonal Fab fragments with the desired specificity for from E. coli and chemically coupled to form bispecific anti Notch, or derivatives, fragments, analogs or homologs bodies (Shalaby et al., 1992, J. Exp. Med. 175:217-225). thereof. Antibody fragments that contain the idiotypes to a 35 These methods can be used in the production of a fully polypeptide of the invention may be produced by techniques humanized bispecific antibody F(ab') molecule. in the art including, but not limited to: (a) an F(ab')2 fragment Antibodies with more than two valencies are also contem produced by pepsindigestion of an antibody molecule; (b) an plated. For example, trispecific antibodies can be prepared Fab fragment generated by reducing the disulfide bridges of (Tuftet al., 1991, J. Immunol. 147:60). an F(ab') fragment, (c) an Fab fragment generated by the 40 Exemplary bispecific antibodies can bind to two different treatment of the antibody molecule with papain and a reduc epitopes, at least one of which originates in a polypeptide of ing agent, and (d) Fv fragments. the invention. Alternatively, an anti-antigenic arm of an Bispecificantibodies are also within the scope of the inven immunoglobulin molecule can be combined with an arm tion. Bispecific antibodies are monoclonal, preferably human which binds to a triggering molecule on a leukocyte such as a or humanized, antibodies that have binding specificities for at 45 T cell receptor molecule (e.g. CD2, CD3, CD28, or B7), or Fc least two different antigens (or, in certain embodiments, two receptors for IgG so as to focus cellular defense mechanisms different epitopes on the same antigen). In the present case, to the cell expressing the particular antigen. Bispecific anti one of the binding specificities is for an antigenic polypeptide bodies can also be used to direct cytotoxic agents to cells of the invention (Notch, or a fragment thereof), while the which express a particular antigen. These antibodies possess second binding target is any other antigen, and advanta 50 an antigen-binding arm and an arm which binds a cytotoxic geously is a cell Surface protein, or receptor or receptor Sub agent or a radionuclide chelator, such as EOTUBE, DPTA, unit. Bispecific antibodies that comprise one antigen-binding DOTA, or TETA. site that specifically binds one human Notch receptor (e.g., Heteroconjugate antibodies are also within the scope of the Notch2) and further comprise a second, different antigen present invention. Heteroconjugate antibodies are composed binding site that specifically binds a second human Notch 55 of two covalently joined antibodies. Such antibodies have, for receptor (e.g., Notch3) are provided. example, been proposed to target immune cells to unwanted Methods for making bispecific antibodies are known in the cells (U.S. Pat. No. 4,676.980). It is contemplated that the art. Traditionally the recombinant production of bispecific antibodies can be prepared in vitro using known methods in antibodies is based on the co-expression of two immunoglo synthetic protein chemistry, including those involving bulin heavy chain/light chain pairs, where the two heavy 60 crosslinking agents. For example, immunotoxins can be con chains have different specificities (Milstein and Cuello, 1983, structed using a disulfide exchange reaction or by forming a Nature 305:537-539). Because of the random assortment of thioether bond. Examples of suitable reagents for this purpose immunoglobulin heavy and light chains, these hybridomas include iminothiolate and methyl-4-mercaptobutyrimidate. (quadromas) produce a potential mixture often different anti For the purposes of the present invention, it should be body molecules, of which only one has the correct bispecific 65 appreciated that modified antibodies can comprise any type structure. The purification of the correct molecule is usually of variable region that provides for the association of the accomplished by affinity chromatography. antibody with the polypeptides of Notch. In this regard, the US 8,226,943 B2 49 50 variable region may comprise or be derived from any type of fragments on the Surface of the phage particle. Because the mammal that can be induced to mount a humoral response filamentous particle contains a single-stranded DNA copy of and generate immunoglobulins against the desired tumor the phage genome, selections based on the functional prop associated antigen. As such, the variable region of the modi erties of the antibody also result in selection of the gene fied antibodies can be, for example, of human, murine, non encoding the antibody exhibiting those properties. Thus, the human primate (e.g. cynomolgus monkeys, macaques, etc.) phage mimics some of the properties of the B-cell. Phage or lupine origin. In some embodiments both the variable and display can be performed in a variety of formats. Several constant regions of the modified immunoglobulins are Sources of V-gene segments can be used for phage display. A human. In other embodiments the variable regions of com diverse array of anti-oxazolone antibodies have been isolated patible antibodies (usually derived from a non-human source) 10 from a small random combinatorial library of V genes derived can be engineered or specifically tailored to improve the from the spleens of immunized mice. A repertoire of V genes binding properties or reduce the immunogenicity of the mol from unimmunized human donors can be constructed and ecule. In this respect, variable regions useful in the present antibodies to a diverse array of antigens (including self-anti invention can be humanized or otherwise altered through the gens) can be isolated. Methods of selecting human antibodies inclusion of imported amino acid sequences. 15 from a phage library, where that phage library expresses In some embodiments, of the present invention the mono human antibodies are well known in the art (Vaughan et al., clonal antibody against a Notch receptor is a humanized 1996, Nature Biotechnology 14:309-314; Sheets et al., 1998, antibody. Humanized antibodies are antibodies that contain PNAS95:6157-6162; Hoogenboom and Winter, 1991, J. Mol. minimal sequences from non-human (e.g., murine) antibod Biol. 227:381; McCafferty et al., 1990, Nature 348:552-554; ies within the variable regions. Such antibodies are used Clackson et al., 1991, Nature 352:624-628; and Marks et al., therapeutically to reduce antigenicity and HAMA (human 1991, J. Mol. Biol., 222:581-597). Techniques for the genera anti-mouse antibody) responses when administered to a tion and use of antibody phage libraries are also described in human Subject. In practice, humanized antibodies are typi U.S. Pat. Nos. 5,969,108; 6,172,197; 5,885,793; 6,521,404; cally human antibodies with minimum to no non-human 6,544,731; 6,555,313; 6,582,915; 6,593,081; 6,300,064; sequences. A human antibody is an antibody produced by a 25 6,653,068; 6,706,484; and 7,264,963; and Rothe et al., 2008, human or an antibody having an amino acid sequence corre J. Mol. Bio. 376:1182-1200 (each of which is incorporated by sponding to an antibody produced by a human. reference in its entirety). Affinity maturation strategies, such Humanized antibodies can be produced using various tech as chain shuffling (Marks et al., 1992, Bio/Technology niques known in the art. An antibody can be humanized by 10:779-783, incorporated by reference in its entirety), are substituting the CDR of a human antibody with that of a 30 known in the art and may be employed to generate high non-human antibody (e.g., mouse, rat, rabbit, hamster, etc.) affinity human antibodies. having the desired specificity, affinity, and/or capability Human antibodies can also be directly prepared using vari (Jones et al., 1986, Nature 321:522-525; Riechmann et al., ous techniques known in the art. Immortalized human B 1988, Nature 332:323-327; Verhoeyen et al., 1988, Science lymphocytes immunized in vitro or isolated from an immu 239:1534-1536). The humanized antibody can be further 35 nized individual that produce an antibody directed against a modified by the substitution of additional residues either in target antigen can be generated. (See, for example, Cole et al., the Fv framework region and/or within the replaced non 1985, Monoclonal Antibodies and Cancer Therapy, Alan R. human residues to refine and optimize antibody specificity, Liss, p. 77; Boerner et al., 1991, J. Immunol., 147 (1):86-95; affinity, and/or capability. U.S. Pat. Nos. 5,750,373; 5,567,610; and 5,229,275). As an alternative to humanization, human antibodies can 40 It will be appreciated that grafting the entire non-human be generated. Human antibodies can be prepared using Vari variable domains onto human constant regions will produce ous techniques known in the art, including from transgenic “classic' chimeric antibodies. In the context of the present animals, phage libraries, and in vitro activated human B cells. application the term "chimeric antibodies' will be held to For example, it is now possible to produce transgenic ani mean any antibody wherein the immunoreactive region or site mals (e.g., mice) containing human immunoglobulin loci that 45 is obtained or derived from a first species and the constant are capable, upon immunization, of producing a full reper region (which may be intact, partial or modified in accor toire of human antibodies in the absence of endogenous dance with this invention) is obtained from a second species. immunoglobulin production. For example, it has been In some embodiments, the antigenbinding region or site will described that the homozygous deletion of the antibody be from a non-human source (e.g., mouse) and the constant heavy-chain joining region (J) gene in chimeric and germ 50 region is human. While the immunogenic specificity of the line mutant mice results in complete inhibition of endogenous variable region is not generally affected by its source, a antibody production. Transfer of the human germ-line immu human constant region is less likely to elicit an immune noglobulin gene array into Such germ-line mutant mice will response from a human Subject than would the constant result in the production of human antibodies upon antigen region from a non-human source. challenge. See, e.g., Jakobovits et al., 1993, Proc. Natl. Acad. 55 The variable domains in both the heavy and light chains are Sci. USA 90:2551: Jakobovits et al., 1993, Nature 362:255 altered by at least partial replacement of one or more CDRs 258; Bruggemann et al., 1993, Year in Immuno. 7:33; U.S. and, if necessary, by partial framework region replacement Pat. Nos. 5,545,806; 5,569,825: 5,591,669; 5,545,807; 5,545, and sequence modification. Although the CDRS may be 807: 5,625,126; 5,633,425; and 5,661.016; and WO derived from an antibody of the same class or even Subclass as 97/17852. 60 the antibody from which the framework regions are derived, Alternatively, phage display technology can be used to it is envisaged that the CDRs will be derived from an antibody produce human antibodies and antibody fragments in vitro, of different class and preferably from an antibody from a from immunoglobulin variable (V) domain gene repertoires different species. It must be emphasized that it may not be from unimmunized donors. According to this technique, anti necessary to replace all of the CDRs with the complete CDRs body V domain genes are cloned in-frame into either a major 65 from the donor variable region to transfer the antigenbinding or minor coat protein gene of a filamentous bacteriophage, capacity of one variable domain to another. Rather, it may such as M13 or fa, and displayed as functional antibody only be necessary to transfer those residues that are necessary US 8,226,943 B2 51 52 to maintain the activity of the antigen binding site. Given the cytotoxin. Yet other modifications of the constant region may explanations set forth in U.S. Pat. Nos. 5,585,089: 5,693,761; be used to eliminate disulfide linkages or oligosaccharide and 5,693.762, it will be well within the art, either by carrying moieties that allow for enhanced localization due to increased out routine experimentation or by trial and error testing to antigen specificity or antibody flexibility. Similarly, modifi obtain a functional antibody with reduced immunogenicity. cations to the constant region in accordance with this inven Alterations to the variable region notwithstanding, it will tion may easily be made using well known biochemical or be appreciated that the modified antibodies of this invention molecular engineering techniques. will comprise antibodies, or immunoreactive fragments It will be noted that the modified antibodies may be engi thereof, in which at least a fraction of one or more of the neered to fuse the CH3 domain directly to the hinge region of constant region domains has been deleted or otherwise 10 the respective modified antibodies. In other constructs it may altered so as to provide desired biochemical and/or biological be desirable to provide a peptide spacer between the hinge characteristics such as increased tumor localization or region and the modified CH2 and/or CH3 domains. For reduced serum half-life when compared with an antibody of example, compatible constructs could be expressed wherein approximately the same immunogenicity comprising a native the CH2 domain has been deleted and the remaining CH3 or unaltered constant region. In some embodiments, the con 15 domain (modified or unmodified) isjoined to the hinge region stant region of the modified antibodies will comprise a human with a 5-20 amino acid spacer. Such a spacer may be added, constant region. Modifications to the constant region compat for instance, to ensure that the regulatory elements of the ible with this invention comprise additions, deletions or sub constant domain remain free and accessible or that the hinge stitutions of one or more amino acids in one or more domains. region remains flexible. However, it should be noted that That is, the modified antibodies disclosed herein may com amino acid spacers may, in Some cases, prove to be immuno prise alterations or modifications to one or more of the three genic and elicit an unwanted immune response against the heavy chain constant domains (CH1, CH2 or CH3) and/or to construct. Accordingly, any spacer added to the construct the light chain constant domain (CL). In some embodiments should be relatively non-immunogenic or, even omitted alto of the invention, modified constant regions wherein one or gether if the desired biochemical and/or biological qualities more domains are partially or entirely deleted are contem 25 of the modified antibodies are to be maintained. plated. In other embodiments, the modified antibodies will Besides the deletion of whole constant region domains, it comprise domain deleted constructs or variants wherein the will be appreciated that the antibodies of the present invention entire CH2 domain has been removed (ACH2 constructs). In may be provided by the partial deletion or substitution of a still other embodiments, the omitted constant region domain few or even a singleamino acid. For example, the mutation of will be replaced by a short amino acid spacer (e.g., 10 resi 30 a single amino acid in selected areas of the CH2 domain may dues) that provides some of the molecular flexibility typically be enough to substantially reduce Fc binding and thereby imparted by the absent constant region. increase tumor localization. Similarly, it may be desirable to Besides their configuration, it is known in the art that the simply delete that part of one or more constant region constant region mediates several effector functions. For domains that control the effector function (e.g., complement example, binding of the C1 component of complement to 35 Cld binding) to be modulated. Such partial deletions of the antibodies activates the complement system. Activation of constant regions may improve selected characteristics of the complement is important in the opsonization and lysis of cell antibody (serum half-life) while leaving other desirable func pathogens. The activation of complement also stimulates the tions associated with the Subject constant region domain inflammatory response and can also be involved in autoim intact. Moreover, as alluded to above, the constant regions of mune hypersensitivity. Further, antibodies bind to cells via 40 the disclosed antibodies may be modified through the muta the Fc region, with a Fc receptor site on the antibody Fc region tion or Substitution of one or more amino acids that enhances binding to a Fc receptor (FcR) on a cell. There are a number the profile of the resulting construct. In this respect it may be of Fc receptors which are specific for different classes of possible to disrupt the activity provided by a conserved bind antibody, including IgG (gamma receptors), IgE (epsilon ing site (e.g., Fc binding) while Substantially maintaining the receptors), IgA (alpha receptors) and IgM (mu receptors). 45 configuration and immunogenic profile of the modified anti Binding of antibody to Fc receptors on cell Surfaces triggers body. Yet other embodiments may comprise the addition of a number of important and diverse biological responses one or more amino acids to the constant region to enhance including engulfment and destruction of antibody-coated par desirable characteristics such as effector function or provide ticles, clearance of immune complexes, lysis of antibody for more cytotoxin or carbohydrate attachment. In Such coated target cells by killer cells (called antibody-dependent 50 embodiments it can be desirable to insert or replicate specific cell-mediated cytotoxicity, or ADCC), release of inflamma sequences derived from selected constant region domains. tory mediators, placental transfer and control of immunoglo This invention also encompasses bispecific antibodies that bulin production. Although various Fc receptors and receptor specifically recognize a Notch receptor. Bispecific antibodies sites have been studied to a certain extent, there is still much are antibodies that are capable of specifically recognizing and which is unknown about their location, structure and func 55 binding at least two different epitopes. The different epitopes tioning. can either be within the same molecule (e.g., the same Notch While not limiting the scope of the present invention, it is receptor polypeptide) or on different molecules. For example, believed that antibodies comprising constant regions modi the antibodies can specifically recognize and bind a Notch fied as described herein provide for altered effector functions receptor as well as, for example, 1) an effector molecule on a that, in turn, affect the biological profile of the administered 60 leukocyte such as a T-cell receptor (e.g., CD3) or Fc receptor antibody. For example, the deletion or inactivation (through (e.g., CD64. CD32, or CD16) or 2) a cytotoxic agent as point mutations or other means) of a constant region domain described in detail herein. Bispecific antibodies can be intact may reduce Fc receptor binding of the circulating modified antibodies or antibody fragments. Techniques for making antibody thereby increasing tumor localization. In other cases bispecific antibodies are common in the art (Millstein et al., it may be that constant region modifications, consistent with 65 1983, Nature 305:537-539; Brennan et al., 1985, Science this invention, moderate complement binding and thus reduce 229:81; Suresh et al., 1986, Methods in Enzymol. 121:120; the serum halflife and nonspecific association of a conjugated Traunecker et al., 1991, EMBO.J. 10:3655-3659; Shalaby et US 8,226,943 B2 53 54 al., 1992, J. Exp. Med 175:217-225; Kostelny et al., 1992, J. pounds (such as bis(p-azidobenzoyl) hexanediamine), bis Immunol. 148:1547-1553; Gruber et al., 1994, J. Immunol. diazonium derivatives (such as bis-(p-diazoniumbenzoyl)- 152:5368; and U.S. Pat. No. 5,731,168). ethylenediamine), diisocyanates (such as tolyene 2,6- In certain embodiments of the invention, it can be desirable diisocyanate), and bis-active fluorine compounds (such as to use an antibody fragment, rather than an intact antibody, to 1.5-difluoro-2,4-dinitrobenzene). Conjugates of an antibody increase tumor penetration, for example. Various techniques and one or more Small molecule toxins. Such as a calicheami are known for the production of antibody fragments. Tradi cin, maytansinoids, a trichothene, and CC1065, and the tionally, these fragments are derived via proteolytic digestion derivatives of these toxins that have toxin activity, can also be of intact antibodies (for example Morimoto et al., 1993, Jour used. nal of Biochemical and Biophysical Methods 24: 107-117 and 10 Conjugate antibodies are composed of two covalently Brennan et al., 1985, Science, 229:81). However, these frag ments are now typically produced directly by recombinant joined antibodies. Such antibodies have, for example, been host cells as described herein. Thus Fab, Fv, and scFv anti proposed to target immune cells to unwanted cells (U.S. Pat. body fragments can all be expressed in and secreted from E. No. 4,676.980). It is contemplated that the antibodies can be coli or other host cells, thus allowing the production of large 15 prepared in vitro using known methods in synthetic protein amounts of these fragments. Alternatively, such antibody chemistry, including those involving crosslinking agents. For fragments can be isolated from the antibody phage libraries example, immunotoxins can be constructed using a disulfide discussed herein. The antibody fragments can also be linear exchange reaction or by forming a thioether bond. Examples antibodies as described in U.S. Pat. No. 5,641,870, for of suitable reagents for this purpose include iminothiolate and example, and can be monospecific or bispecific. Other tech methyl-4-mercaptobutyrimidate. niques for the production of antibody fragments will be In some embodiments, the antibody of the invention con apparent. tains human Fc regions that are modified to enhance effector It can further be desirable, especially in the case of anti function, for example, antigen-dependent cell-mediated cyto body fragments, to modify an antibody in order to increase its toxicity (ADCC) and/or complement dependent cytotoxicity serum half-life. This can be achieved, for example, by incor 25 (CDC). This can be achieved by introducing one or more poration of a salvage receptor binding epitope into the anti amino acid Substitutions in an Fc region of the antibody. For body fragment by mutation of the appropriate region in the example, cysteine residue(s) can be introduced in the Fc antibody fragment or by incorporating the epitope into a region to allow interchain disulfide bond formation in this peptide tag that is then fused to the antibody fragmentat either region to improve complement-mediated cell killing and anti end or in the middle (e.g., by DNA or peptide synthesis). 30 body-dependent cellular cytotoxicity (ADCC) (Caron et al., The present invention further embraces variants and equivalents which are substantially homologous to the chi 1992, J. Exp Med. 176:1191-1 195: Shopes, 1992, Immunol. meric, humanized and human antibodies, or antibody frag 148:2918-2922). Homodimeric antibodies with enhanced ments thereof, set forth herein. These can contain, for anti-tumor activity can also be prepared using heterobifunc example, conservative Substitution mutations, i.e. the Substi 35 tional cross-linkers as described in Wolff et al., 1993, Cancer tution of one or more amino acids by similar amino acids. For Research 53:2560-2565. Alternatively, an antibody can be example, conservative substitution refers to the substitution engineered which has dual Fc regions (Stevenson et al., 1989, of an amino acid with another within the same general class Anti-Cancer Drug Design 3:219-230). Such as, for example, one acidic amino acid with another Regardless of how useful quantities are obtained, the anti acidic amino acid, one basic amino acid with another basic 40 bodies of the present invention can be used in any one of a amino acid or one neutral amino acid by another neutral number of conjugated (i.e. an immunoconjugate) or uncon amino acid. What is intended by a conservative amino acid jugated forms. The antibodies of this invention can be used in substitution is well known in the art. a nonconjugated or “naked' form to harness the Subjects The invention also pertains to immunoconjugates compris natural defense mechanisms including complement-depen ing an antibody conjugated to a cytotoxic agent. Cytotoxic 45 dent cytotoxicity (CDC) and antibody dependent cellular tox agents include chemotherapeutic agents, growth inhibitory icity (ADCC) to eliminate the malignant cells. In some agents, toxins (e.g., an enzymatically active toxin of bacterial, embodiments, the antibodies can be conjugated to radioiso fungal, plant, or animal origin, or fragments thereof), radio topes, including, but not limited to, 'Y. "I, ''I, 'I, '''In, active isotopes (i.e., a radioconjugate), etc. Chemotherapeu 13. In 212Bi, 103Rh, 'Sim, 7Cu, 7Ga, 16Ho, 77Lu, 186Re tic agents useful in the generation of such immunoconjugates 50 and Reusing any one of a number of well known chelators include, for example, methotrexate, adriamicin, doxorubicin, melphalan, mitomycin C, chlorambucil, daunorubicin or or direct labeling. In other embodiments, the disclosed com other intercalating agents. Enzymatically active toxins and positions can comprise antibodies coupled to drugs, prodrugs fragments thereofthat can be used include diphtheria Achain, or biological response modifiers such as methotrexate, adria nonbinding active fragments of diphtheria toxin, exotoxin A 55 mycin, and lymphokines such as interferon. Still other chain, ricin A chain, abrin A chain, modeccin A chain, alpha embodiments of the present invention comprise the use of sarcin, Aleurites fordii proteins, dianthin proteins, Phytolaca antibodies conjugated to specific biotoxins such as ricin or americana proteins (PAPI, PAPII, and PAP-S), Momordica diptheria toxin. In yet other embodiments the modified anti charantia inhibitor, curcin, crotin, Sapaonaria officinalis bodies can be complexed with other immunologically active inhibitor, gelonin, mitogellin, restrictocin, phenomycin, eno 60 ligands (e.g., antibodies or fragments thereof) wherein the mycin, and the tricothecenes. Conjugates of the antibody and resulting molecule binds to both the neoplastic cell and an cytotoxic agent are made using a variety of bifunctional pro effector cell such as a T cell. The selection of which conju tein-coupling agents such as N-Succinimidyl-3-(2-py gated or unconjugated modified antibody to use will depend ridyldithiol) propionate (SPDP), iminothiolane (IT), bifunc of the type and stage of cancer, use of adjunct treatment (e.g., tional derivatives of imidoesters (such as dimethyl 65 chemotherapy or external radiation) and patient condition. It adipimidate HCL), active esters (such as disuccinimidyl Sub will be appreciated that one could readily make such a selec erate), aldehydes (such as glutareldehyde), bis-azido com tion in view of the teachings herein. US 8,226,943 B2 55 56 The preparation and characterization of anti-Notch anti to a detectable compound Such as an enzymatic Substrate bodies is also taught, e.g., in U.S. Patent Application Publi (e.g., horseradish peroxidase or alkaline phosphatase) to the cation No. 2008/0131434, which is incorporated by reference well, incubating for a period of time and detecting the pres herein in its entirety. ence of the antigen. Alternatively the antibody against a In certain embodiments, the Notch-binding agent or 5 Notch receptor is not conjugated to a detectable compound, antagonist is a polypeptide that is not an antibody. A variety of but instead a second conjugated antibody that recognizes the methods for identifying and producing non-antibody antibody against a Notch receptor is added to the well. Fur polypeptides that bind with high affinity to a protein target are ther, instead of coating the well with the antigen, the antibody known in the art. See, e.g., Skerra, 2007, Curr: Opin. Biotech against a Notch receptor can be coated to the well and a mol., 18:295-304; Hosse et al., 2006, Protein Science, 15:14 10 second antibody conjugated to a detectable compound can be 27: Gill et al., 2006, Curr. Opin. Biotechnol., 17:653-658: added following the addition of the antigen to the coated well. Nygren, 2008, FEBS J., 275:2668-76; and Skerra, 2008, The parameters that can be modified to increase the signal FEBS J., 275:2677-83, each of which is incorporated by detected, as well as other variations of ELISAs are well reference herein in its entirety. In certain embodiments, phage known in the art (see e.g. Ausubel et al., eds, 1994, Current display technology has been used to identify/produce the 15 Protocols in Molecular Biology, Vol. 1, John Wiley & Sons, Notch-binding polypeptide. In certain embodiments, the Inc., New York at 11.2.1). polypeptide comprises a protein scaffold of a type selected The binding affinity of an antibody to a Notch receptor and from the group consisting of protein A, a lipocalin, a fibronec the off-rate of an antibody-antigen interaction can be deter tin domain, an ankyrin consensus repeat domain, and thiore mined by competitive binding assays. One example of a com doxin. petitive binding assay is a radioimmunoassay comprising the In some embodiments, the agent is a non-protein molecule. incubation of labeled antigen (e.g., H or 'I), or fragment or In certain embodiments, the agent is a small molecule. Com variant thereof, with the antibody of interest in the presence of binatorial chemistry libraries and techniques useful in the increasing amounts of unlabeled antigen followed by the identification of non-protein Notch-binding agents are known detection of the antibody bound to the labeled antigen. The to those skilled in the art. See, e.g., Kennedy et al., 2008, J. 25 affinity of the antibody against a Notch receptor and the Comb. Chem., 10:345-354; Dolle etal, 2007, J. Comb. Chem., binding off-rates can be determined from the data by Scat 9:855-902; and Bhattacharyya, 2001, Curr. Med Chem., chard plot analysis. In some embodiments, Biacore kinetic 8:1383-404, each of which is incorporated by reference analysis is used to determine the binding on and off rates of herein in its entirety. In certain further embodiments, the antibodies against a Notch receptor. Biacore kinetic analysis agent is a carbohydrate, a glycosaminoglycan, a glycopro 30 comprises analyzing the binding and dissociation of antibod tein, or a proteoglycan. ies from chips with immobilized Notch antigens on their In certain embodiments, the agent is a nucleic acid surface. aptamer. Aptamers are polynucleotide molecules that have The invention provides isolated polynucleotides encoding been selected (e.g., from random or mutagenized pools) on the polypeptides of SEQID NOS:2, 4, 13, 14, 16, 18, 19, 20, the basis of their ability to bind to another molecule. In some 35 39, 40, 49, 50, 52, 53, 54, 55, 56, or 57 as well as the poly embodiments, the aptamer comprises a DNA polynucleotide. nucleotides of SEQ ID NOs: 1, 3, 15, 17, 47 or 48. The In certain alternative embodiments, the aptamer comprises an polynucleotides of the invention can be in the form of RNA or RNA polynucleotide. In certain embodiments, the aptamer in the form of DNA, wherein DNA includes cDNA, genomic comprises one or more modified nucleic acid residues. Meth DNA, and synthetic DNA. The DNA can be double-stranded ods of generating and screening nucleic acid aptamers for 40 or single-stranded, and if single-stranded it can be the coding binding to proteins are well known in the art. See, e.g., U.S. Strand or non-coding (anti-sense) Strand. Thus, the term Pat. Nos. 5,270,163; 5,683,867; 5,763,595; 6,344,321; 7,368, "polynucleotide encoding a polypeptide' encompasses a 236; 5,582,981; 5,756,291; 5,840,867; 7,312,325; and 7,329, polynucleotide which includes only coding sequences for the 742: International Patent Publication Nos. WO 02/077262: polypeptide as well as a polynucleotide which includes addi WO 03/070984; U.S. Patent Application Publication Nos. 45 tional coding and/or non-coding sequences. In some embodi 2005/0239134; 2005/0124565; and 2008/0227735, each of ments, the invention provides a polynucleotide that hybrid which is incorporated by reference herein in its entirety. izes to a polynucleotide encoding the polypeptides of SEQID The antibodies of the present invention can be assayed for NOs:2, 4, 13, 14, 16, 18, 19, 20, 39, 40, 49, 50, 52,53,54, 55, immunospecific binding by any method known in the art. The 56, or 57. In some embodiments, the polynucleotides hybrid immunoassays which can be used include, but are not limited 50 ize to the polynucleotides of SEQID NOs: 1, 3, 15, 17, 47,48, to, competitive and non-competitive assay Systems using 58, 59 or 60. In some embodiments, the polynucleotides techniques such as Biacore analysis, FACS analysis, immu hybridize under stringent hybridization conditions. nofluorescence, immunocytochemistry, Western blot analy As used herein, the phrases “hybridizes” or “selectively sis, radioimmunoassay, ELISA, 'sandwich immunoassay, hybridizes” or “specifically hybridizes” refer to the binding immunoprecipitation assay, precipitin reaction, gel diffusion 55 or duplexing of a molecule only to a particular nucleotide precipitin reaction, immunodiffusion assay, agglutination sequence under Stringent hybridization conditions when that assay, complement-fixation assay, immunoradiometric assay, sequence is present in a complex mixture (e.g., a library of fluorescent immunoassay, and protein A immunoassay. Such DNAS or RNAs). See, e.g., Andersen (1998) Nucleic Acid assays are routine and well known in the art (see, e.g., Hybridization Springer-Verlag; Ross (ed. 1997) Nucleic Acid Ausubel et al, eds, 1994, Current Protocols in Molecular 60 Hybridization Wiley. Biology, Vol. 1, John Wiley & Sons, Inc., New York, which is As used herein, the phrase “stringent hybridization condi incorporated by reference herein in its entirety). tions’ refers to conditions under which a probe or other poly In some embodiments, of the present invention the immu nucleotide will hybridize to its target subsequence or other nospecificity of an antibody against a Notch receptor is deter complementary sequence, typically in a complex mixture of mined using ELISA. An ELISA assay comprises preparing 65 nucleic acid, but generally to no other sequences. Stringent antigen, coating wells of a 96 well microtiter plate with anti conditions are sequence-dependent and will be different in gen, adding the antibody against a Notch receptor conjugated different circumstances. Longer sequences hybridize specifi US 8,226,943 B2 57 58 cally at higher temperatures. An extensive guide to the prosequence or for a protein having both a prosequence and hybridization of nucleic acids is found in Tijssen, Techniques presequence (leader sequence). in Biochemistry and Molecular Biology Hybridization The polynucleotides of the present invention can also have with Nucleic Probes, “Overview of principles of hybridiza the coding sequence fused in frame to a marker sequence tion and the strategy of nucleic acid assays” (1993). Gener which allows for purification of the polypeptide of the present ally, stringent conditions are selected to be about 5-10° C. invention. For example, the marker sequence can be a hexa lower than the thermal melting point (Tm) for the specific histidine tag supplied by a pCRE-9 vector to provide for puri sequence at a defined ionic strength. The Tm is the tempera fication of the mature polypeptide fused to the marker in the ture (under defined ionic strength, pH, and nucleic concen case of a bacterial host. Or for example, the marker sequence 10 can be a hemagglutinin (HA) tag when a mammalian host, tration) at which 50% of the probes complementary to the e.g. COS-7 cells, is used. The HA tag corresponds to an target hybridize to the target sequence at equilibrium (as the epitope derived from the influenza hemagglutinin protein target sequences are present in excess, at Tm, 50% of the (Wilson et al., 1984, Cell 37:767). probes are occupied at equilibrium). Stringent conditions will Further embodiments of the invention include isolated be those in which the salt concentration is less than about 1.0 15 nucleic acid molecules comprising a polynucleotide having a M sodium ion, typically about 0.01 to 1.0 M sodium ion nucleotide sequence at least 90% identical, 95% identical, concentration (or other salts) at pH 7.0 to 8.3 and the tem and in some embodiments, at least 96%, 97%, 98% or 99% perature is at least about 30°C. for short probes (e.g., 10 to 50 identical to SEQID NOS:1, 3, 15, 17, 47,48, 58, 59 or 60. In nucleotides) and at least about 60° C. for long probes (e.g., Some embodiments, the polynucleotides comprising a nucle greater than 50 nucleotides). Stringent conditions can also be otide sequence at least 90% identical, 95% identical, and in achieved with the addition of destabilizing agents such as some embodiments, at least 96%, 97%, 98% or 99% identical formamide. For high Stringency hybridization, a positive sig hybridize to the polynucleotides of SEQID NOS:1, 3, 15, 17, nal is at least two times background, or 10 times background 47, 48, 58, 59 or 60. In some embodiments, the polynucle hybridization. Exemplary high Stringency or stringent otides comprising a nucleotide sequences at least 90% iden hybridization conditions include: 50% formamide, 5xSSC, 25 tical, 95% identical, and in some embodiments, at least 96%, and 1% SDS incubated at 42° C. or 5xSSC and 1% SDS 97%, 98% or 99% identical hybridize to the polynucleotides incubated at 65° C., with a wash in 0.2xSSC and 0.1% SDS at of SEQ ID NOS:58, 59 or 60. In some embodiments, the 65° C. For PCR, a temperature of about 36° C. is typical for polynucleotides hybridize under stringent hybridization con low stringency amplification, although annealing tempera ditions. In some embodiments, the polynucleotides hybridize tures can vary from about 32°C. to about 48°C. depending on 30 to the polynucleotides of SEQ ID NO:58, 59 or 60 under primer length. For high Stringency PCR amplification, a tem stringent hybridization conditions. By a polynucleotide hav perature of about 62°C. is typical, although high stringency ing a nucleotide sequence at least, for example, 95% “iden annealing temperatures can range from about 50° C. to about tical to a reference nucleotide sequence is intended that the 65°C., depending on the primer length and specificity. Typi nucleotide sequence of the polynucleotide is identical to the cal cycle conditions for both high and low stringency ampli 35 reference sequence except that the polynucleotide sequence fications include a denaturation phase of 90° C. to 95°C. for can include up to five point mutations per each 100 nucle 30-120 sec, an annealing phase lasting 30-120 sec, and an otides of the reference nucleotide sequence. In other words, to extension phase of about 72° C. for 1-2 min. obtain a polynucleotide having a nucleotide sequence at least The present invention further relates to variants of the 95% identical to a reference nucleotide sequence, up to 5% of hereinabove described polynucleotides which encode for 40 the nucleotides in the reference sequence can be deleted or fragments, analogs, and derivatives. The variant of the poly substituted with another nucleotide, or a number of nucle nucleotide can be a naturally occurring allelic variant of the otides up to 5% of the total nucleotides in the reference polynucleotide or a non-naturally occurring variant of the sequence can be inserted into the reference sequence. These polynucleotide. mutations of the reference sequence can occur at the amino As hereinabove indicated, the polynucleotide can have a 45 or carboxy-terminal positions of the reference nucleotide coding sequence which is a naturally occurring allelic variant sequence or anywhere between those terminal positions, of the coding sequence of the disclosed polypeptides. As interspersed either individually among nucleotides in the ref known in the art, an allelic variant is an alternate form of a erence sequence or in one or more contiguous groups within polynucleotide sequence which has a Substitution, deletion or the reference sequence. addition of one or more nucleotides that does not Substan 50 As a practical matter, whether any particular nucleic acid tially alter the function of the encoded polypeptide. molecule has a certainty percent sequence identity to a refer The present invention also includes polynucleotides, ence sequence (for example, has at least about 80%, at least wherein the coding sequence for the mature polypeptide can about 90%, at least about 95%, or at least about 97% sequence be fused in the same reading frame to a polynucleotide which identity to a reference sequence or is 95%,96%.97%, 98% or aids in expression and secretion of a polypeptide from a host 55 99% identical to the reference sequence) can be determined cell, for example, a leader sequence which functions as a conventionally using known computer programs such as the secretory sequence for controlling transport of a polypeptide Bestfit program (Wisconsin Sequence Analysis Package, Ver from the cell. The polypeptide having a leader sequence is a sion 8 for Unix, Genetics Computer Group, University preprotein and can have the leader sequence cleaved by the Research Park, 575 Science Drive, Madison, Wis. 53711). host cell to form the mature form of the polypeptide. The 60 Bestfit uses the local homology algorithm of Smith and polynucleotides can also encode for a proprotein which is the Waterman, 1981, Advances in Applied Mathematics 2: 482 mature protein plus additional 5' amino acid residues. A 489, to find the best segment of homology between two mature protein having a prosequence is a proprotein and is an sequences. When using Bestfit or any other sequence align inactive form of the protein. Once the prosequence is cleaved ment program to determine whether a particular sequence is, an active mature protein remains. 65 for instance, 95% identical to a reference sequence according Thus, for example, the polynucleotide of the present inven to the present invention, the parameters are set, of course, tion can encode for a mature protein, or for a protein having a such that the percentage of identity is calculated over the full US 8,226,943 B2 59 60 length of the reference nucleotide sequence and that gaps in mulation composition containing a homogeneous mixture of homology of up to 5% of the total number of nucleotides in a compound of the present invention, or a non-toxic pharma the reference sequence are allowed. ceutically acceptable salt thereof. The solid preformulation The polynucleotide variants can contain alterations in the composition is then Subdivided into unit dosage forms of the coding regions, non-coding regions, or both. In some embodi type described above. The tablets, pills, etc. of the novel ments the polynucleotide variants contain alterations which composition can be coated or otherwise compounded to pro produce silent Substitutions, additions, or deletions, but do vide a dosage form affording the advantage of prolonged not alter the properties or activities of the encoded polypep action. For example, the tablet or pill can comprise an inner tide. In some embodiments, nucleotide variants are produced composition covered by an outer component. Furthermore, by silent Substitutions due to the degeneracy of the genetic 10 the two components can be separated by an enteric layer that code. Polynucleotide variants can be produced for a variety of serves to resist disintegration and permits the inner compo reasons, e.g., to optimize codon expression for a particular nent to pass intact through the stomach or to be delayed in host Such as changing codons in the human mRNA to those release. A variety of materials can be used for such enteric preferred by a bacterial host such as E. coli. layers or coatings, such materials including a number of The present invention further provides pharmaceutical 15 polymeric acids and mixtures of polymeric acids with Such compositions comprising antagonists (e.g., antibodies) that materials as shellac, cetyl alcohol and cellulose acetate. target a Notch receptor. These pharmaceutical compositions Pharmaceutical formulations include antagonists (e.g., find use in inhibiting tumor cell growth and treating cancer in antibodies) of the present invention complexed with lipo human patients. somes (Epstein, et al., 1985, Proc. Natl. Acad. Sci. USA Formulations are prepared for storage and use by combin 82:3688; Hwang, et al., 1980, Proc. Natl. Acad. Sci. USA ing a purified Notch-binding agent or antagonist (e.g., anti 77:4030; and U.S. Pat. Nos. 4,485,045 and 4,544.545). Lipo body) of the present invention with a pharmaceutically somes with enhanced circulation time are disclosed in U.S. acceptable carrier, excipient, and/or stabilizer as a sterile Pat. No. 5,013,556. Some liposomes can be generated by the lyophilized powder, aqueous solution, etc. (Remington, The reverse phase evaporation with a lipid composition compris Science and Practice of Pharmacy 20th Edition Mack Pub 25 ing phosphatidylcholine, cholesterol, and PEG-derivatized lishing, 2000). Suitable carriers, excipients, or stabilizers phosphatidylethanolamine (PEG-PE). Liposomes are comprise: nontoxic buffers such as phosphate, citrate, and extruded through filters of defined pore size to yield lipo other organic acids; salts such as sodium chloride; antioxi somes with the desired diameter. dants such as ascorbic acid and methionine; preservatives The antagonist (e.g., antibody) can also be entrapped in Such as octadecyldimethylbenzyl ammonium chloride, hex 30 microcapsules. Such microcapsules are prepared, for amethonium chloride, benzalkonium chloride, benzethonium example, by coacervation techniques or by interfacial poly chloride, phenol, butyl or benzyl alcohol, alkyl parabens, merization, for example, hydroxymethylcellulose or gelatin Such as methyl or propyl paraben, catechol, resorcinol, cyclo microcapsules and poly-(methylmethacylate) microcapsules, hexanol, 3-pentanol, and m-cresol; low molecular weight respectively, in colloidal drug delivery systems (for example, polypeptides (less than about 10 amino acid residues); pro 35 liposomes, albumin microspheres, microemulsions, nanopar teins such as serum albumin, gelatin, and immunoglobulins; ticles and nanocapsules) or in macroemulsions as described hydrophilic polymers such as polyvinylpyrrolidone; amino in Remington's, The Science and Practice of Pharmacy, 20th acids such as glycine, glutamine, asparagine, histidine, argi Ed., Mack Publishing (2000). nine, and lysine; carbohydrates Such as monosacchandes, In addition Sustained-release preparations can be prepared. disaccharides, glucose, mannose, and dextrins; chelating 40 Suitable examples of Sustained-release preparations include agents such as EDTA; Sugars such as Sucrose, mannitol, tre semipermeable matrices of Solid hydrophobic polymers con halose and Sorbitol; salt-forming counter-ions such as taining the antibody, which matrices are in the form of shaped Sodium; metal complexes such as Zn-protein complexes; and/ articles (e.g., films or microcapsules). Examples of Sustained or non-ionic surfactants such as TWEEN and polyethylene release matrices include polyesters, hydrogels such as poly glycol (PEG). 45 (2-hydroxyethyl-methacrylate) or poly(V nylalcohol), poly The pharmaceutical composition of the present invention lactides (U.S. Pat. No. 3,773.919), copolymers of L-glutamic can be administered in any number of ways for either local or acid and 7 ethyl-L-glutamate, non-degradable ethylene-vinyl systemic treatment. Administration can be topical (such as to acetate, degradable lactic acid-glycolic acid copolymers such mucous membranes including vaginal and rectal delivery) as the Lupron Depot (injectable microspheres composed of using transdermal patches, ointments, lotions, creams, gels, 50 lactic acid-glycolic acid copolymer and leuprolide acetate), drops, Suppositories, sprays, liquids and powders; pulmonary Sucrose acetate isobutyrate, and poly-D(-)-3-hydroxybutyric (e.g., by inhalation or insufflation of powders or aerosols, acid. including by nebulizer, intratracheal, intranasal, epidermal In certain embodiments, the pharmaceutical compositions and transdermal); oral; or parenteral including intravenous, comprise both the Notch-binding agent or antagonist and a intraarterial. Subcutaneous, intraperitoneal, intratumoral, or 55 second therapeutic agent. In certain embodiments, the second intramuscular injection or infusion; or intracranial (e.g., therapeutic agent is an anti-cancer agent and/or an anti-an intrathecal or intraventricular) administration. giogenic agent. The therapeutic formulation can be in unit dosage form. The present invention provides methods for inhibiting the Such formulations include tablets, pills, capsules, powders, growth or proliferation of tumorigenic cells expressing a granules, solutions or Suspensions in water or non-aqueous 60 Notch receptor using the Notch receptor antagonists media, or Suppositories for oral, parenteral, or rectal admin described herein. In some embodiments, the methods com istration or for administration by inhalation. In solid compo prise inhibiting the growth of tumorigenic cells expressing a sitions such as tablets the principal active ingredient is mixed Notch2 and/or Notch3 receptor using any one the antibodies with a pharmaceutical carrier. Conventional tableting ingre or polypeptides described herein. In some embodiments, the dients include corn starch, lactose, Sucrose, Sorbitol, talc, 65 method of inhibiting the growth of tumorigenic cells express Stearic acid, magnesium Stearate, dicalcium phosphate or ing a Notch receptor comprises contacting the cell with an gums, and other diluents (e.g., water) to form a solid prefor antagonist against a Notch receptor in vitro. For example, an US 8,226,943 B2 61 62 immortalized cell line or a cancer cell line that expresses a other aspects or embodiments described herein. In some Notch receptor is cultured in medium to which is added an embodiments, the Notch antagonist is an antibody. In some antibody which specifically binds to Notch2 and/or Notch3 embodiments, the methods comprise inhibiting Notch3 sig and inhibits cell growth. Or tumor cells and/or tumor stem naling in a cell comprising contacting the cell with an effec cells are isolated from a patient sample such as, for example, tive amount of any of the antibodies or polypeptides of the a tissue biopsy, pleural effusion, or blood sample and cultured aforementioned aspects or embodiments, as well as any other in medium to which is added an antibody which specifically aspects or embodiments described herein. binds to Notch2 and/or Notch3 and inhibits cell growth. In The invention further provides a method of modulating the Some embodiments, the antagonist is an antibody that spe function of pericytes and/or vascular Smooth muscle cells, cifically recognizes an epitope of a Notch2 and/or Notch3 10 comprising administering an effective amount of an antago receptor. nist of human Notch3 to the subject. In some embodiments, In some embodiments, the method of inhibiting the growth the method inhibits angiogenesis by modulating the function or proliferation of tumorigenic cells expressing a Notch of pericytes and/or vascular Smooth muscle cells. In some receptor comprises contacting the cell with an antagonist embodiments, the antagonist is an antibody or polypeptide as against a Notch receptor (e.g., an antagonist of Notch2 and/or 15 described in any of the aforementioned aspects or embodi Notch3) in vivo. In certain embodiments, contacting a tum ments, as well as any other aspects or embodiments described origenic cell with an antagonist to a Notch receptor is under herein. In certain embodiments, the vascular development taken in an animal model. For example, Xenografts express that is inhibited is aberrant vascular development. In certain ing a Notch receptor are grown in immunocompromised mice embodiments, the vascular development that is inhibited is in (e.g., NOD/SCID mice). The mice are administered an a tumor. In certain embodiments, the method further com antagonist to the Notch receptor to inhibit tumor growth. prises administering to the Subject an antagonist of VEGF or Alternatively, cancer stem cells that express a Notch receptor of a VEGF receptor. are isolated from a patient sample Such as, for example, a In addition, the invention provides methods of inhibiting tissue biopsy, pleural effusion, or blood sample and injected angiogenesis or vascular development in a Subject, compris into immunocompromised mice. The mice are then adminis 25 ing administering an effective amount of a Notch antagonist tered an antagonist against the Notch receptorto inhibit tumor to the Subject. In certain embodiments, the Notch antagonist cell growth. In some embodiments, the antagonist of a Notch is a Notch3 antagonist. In certain embodiments, the Notch receptor is administered at the same time or shortly after antagonist is a Notch2 antagonist. In certain embodiments, introduction of tumorigenic cells into the animal to prevent the antagonist is an antagonist of Notch2 and/or 3. In some tumor growth. In other embodiments, the antagonist of a 30 embodiments, the antagonist is an anti-Notch2/3 antibody. In Notch receptor is administered as a therapeutic after the tum Some embodiments, the methods of inhibiting angiogenesis origenic cells have grown to a specified size. In some embodi comprises administering an antibody or polypeptide of any of ments, the antagonist is a Notch receptor protein fusion that the aforementioned aspects or embodiments, as well as any specifically binds to a Notch receptor. In certain embodi other embodiments or aspects described herein. In certain ments, the antagonist is an antibody that specifically recog 35 embodiments, the angiogenesis is tumor angiogenesis. In nizes an epitope of a Notch receptor. In some embodiments, certain embodiments, the vascular development is at the site the antibody is any one of the antibodies or polypeptides of a tumor. In certain alternative embodiments, the angiogen described herein. esis is not tumor angiogenesis. In certain embodiments, the In certain embodiments, contacting a tumorigenic cell with inhibition of angiogenesis or vascular development is due, at an antagonist to a Notch receptor is undertaken in a human 40 least in part, to modulation of the function of pericytes and/or patient diagnosed with cancer. In some embodiments, the vascular Smooth muscle cells. In certain embodiments, the antagonist is an antibody that specifically binds to a Notch method further comprises administering to the Subject an receptor. In other embodiments, the antagonist is an antibody antagonist of vascular endothelial cell growth factor (VEGF) that specifically recognizes an epitope of a Notch receptor. or of a VEGF receptor. For example, the invention provides method of inhibiting 45 Methods of reducing the tumorigenicity of a tumor (e.g., a growth of a tumor in a subject, comprising administering to tumor that comprises cancer stem cells) are also provided. In the Subject atherapeutically effective amount of an antagonist certain embodiments, the methods comprise administering to of human Notch2 and/or Notch3. In some embodiments, the a subject in need thereof (e.g., Subject has a tumor) a thera antagonist is an antibody that binds to Notch2. In some peutically effective amount of the Notch antagonist. In certain embodiments, the antagonist is an antibody that binds to 50 embodiments, the Notch antagonist is an antibody that binds Notch3. In some embodiments, the antagonist is an antibody Notch2. In certain embodiments, the Notch antagonist is an that binds to Notch2 and Notch3. In some embodiments, the antibody that binds Notch3. In certain embodiments, the antagonist is an antibody or polypeptide as described in any Notch antagonist is an antibody that binds Notch2 and one of the aforementioned aspects or embodiments, as well as Notch3. In certain embodiments, the Notch antagonist is an any other aspects or embodiments described herein. In certain 55 antibody or polypeptide of any of the aforementioned aspects embodiments, the tumor comprises an inactivating deletion or embodiments, as well as any other embodiments or aspects or mutation in the phosphatase and tensin homolog (PTEN) described elsewhere herein. In certain embodiments, the fre gene. quency of cancer stem cells in the tumor is reduced by admin The invention further provides methods of inhibiting istration of the antibody. In some embodiments, the tumor is Notch signaling (e.g., Notch2 and/or Notch3) in a cell, com 60 a colorectal tumor, breast tumor, pancreatic tumor or mela prising contacting the cell with an effective amount of the Oa. Notchantagonist. These methods may be in vivo or invitro. In It is further envisioned that the agents and antagonists of Some embodiments, the Notch antagonist is an antibody. In the present invention can be used to treat various conditions some embodiments, the methods comprise inhibiting Notch2 characterized by expression of and/or increased responsive signaling in a cell comprising contacting the cell with an 65 ness of cells to a Notch receptor. The invention provides effective amount of any one of the antibodies or polypeptides methods of treating proliferative disease. Such as cancer, dis of the aforementioned aspects or embodiments, as well as any eases associated with angiogenesis (e.g., angiogenesis-de US 8,226,943 B2 63 64 pendent diseases), and diseases in which the upregulation or Notch2-dependent tumor. In certain embodiments, an anti deregulation of Notch signaling plays a role. body that specifically binds Notch3 (or Notch2 and Notch3) In certain embodiments the disease to be treated with the may be used to inhibit the growth or otherwise target the Notch-binding agents or antagonists is a Notch-related dis Notch3-dependent tumor. In certain embodiments, the tumor ease. In certain embodiments, the disease is characterized by comprises cancer stem cells. upregulation orderegulation of Notch signaling (e.g., Notch2 In certain embodiments, the tumor is homozygotic or het and/or Notch3 signaling). In certain embodiments, the dis erozygotic for an inactivating deletion or mutation in the gene ease or tumor is Notch2 and/or Notch3-dependent. encoding the tumor Suppressor phosphatase and tensin Particularly, it is envisioned that the antagonists (e.g., anti homolog (PTEN). In certain embodiments, the tumor com bodies) against a Notch receptor will be used to treat prolif 10 prising the deletion or mutation is a breast tumor. erative disorders including, but not limited to, benign and The antagonists are administered as an appropriate phar malignant tumors of the kidney, liver, bladder, breast, stom maceutical composition to a human patient according with ach, ovary, colon, rectum, prostate, lung, Vulva, thyroid, head known methods. Suitable methods of administration include and neck, brain (glioblastoma, astrocytoma, medulloblas intravenous administration as a bolus or by continuous infu toma, etc.), blood and lymph (leukemias and lymphomas). In 15 sion over a period of time, by intramuscular, intraperitoneal, certain embodiments, the proliferative disorder that Notch intravenous, intratumoral, intraarterial, intracerobrospinal, binding agent or antagonist is used to treat is colorectal can Subcutaneous, intra-articular, intrasynovial, intrathecal, oral, cer, breast cancer, pancreatic cancer, or melanoma. In certain topical, or inhalation routes. embodiments, the cancer comprises cancer stem cells. In certain embodiments, in addition to administering a In certain embodiments, the tumors treated are solid Notch antagonist, the method or treatment further comprises tumors. Examples of solid tumors that can be treated using a administering a second therapeutic agent (prior to, concur therapeutic composition of the instant invention, for example, rently with, and/or Subsequently to administration of the an antibody that binds Notch include, but are not limited to, Notch antagonist). In certain embodiments, the second thera sarcomas and carcinomas Such as fibrosarcoma, myxosar peutic agent is an anti-cancer and/or anti-angiogenic agent. coma, liposarcoma, chondrosarcoma, osteogenic sarcoma, 25 Pharmaceutical compositions comprising the Notch antago chordoma, angiosarcoma, endotheliosarcoma, lymphan nist and the second therapeutic agent are also provided. giosarcoma, lymphangioendotheliosarcoma, Synovioma, It will be appreciated that the combination of a Notch mesothelioma, Ewings tumor, leiomyosarcoma, rhab antagonist (e.g., antibody) and a second therapeutic agent domyosarcoma, colon carcinoma, pancreatic cancer, breast may be administered in any order or concurrently. In selected cancer, ovarian cancer, prostate cancer, squamous cell carci 30 embodiments, the Notch antagonists will be administered to noma, basal cell carcinoma, adenocarcinoma, Sweat gland patients that have previously undergone treatment with the carcinoma, Sebaceous gland carcinoma, papillary carcinoma, second anti-cancer agent. In certain other embodiments, the papillary adenocarcinomas, cystadenocarcinoma, medullary Notch antagonist and the second therapeutic agent will be carcinoma, bronchogenic carcinoma, renal cell carcinoma, administered Substantially simultaneously or concurrently. hepatoma, bile duct carcinoma, choriocarcinoma, seminoma, 35 For example, a subject may be given the Notch antagonist embryonal carcinoma, Wilms tumor, cervical cancer, tes while undergoing a course of treatment with the second thera ticular tumor, lung carcinoma, Small cell lung carcinoma, peutic agent (e.g., chemotherapy). In certain embodiments, bladder carcinoma, epithelial carcinoma, glioma, astrocy the Notchantagonist will be administered within 1 year of the toma, medulloblastoma, craniopharyngioma, ependymoma, treatment with the second therapeutic agent. In certain alter pinealoma, hemangioblastoma, acoustic neuroma, oligoden 40 native embodiments, the Notch antagonist will be adminis droglioma, meningioma, melanoma, neuroblastoma, and ret tered within 10, 8, 6, 4, or 2 months of any treatment with the inoblastoma. The invention is applicable to sarcomas and second therapeutic agent. In certain other embodiments, the epithelial cancers, such as ovarian cancers and breast cancers. Notch antagonist will be administered within 4, 3, 2, or 1 In certain embodiments, the tumor is a colorectal tumor, week of any treatment with the second therapeutic agent. In breast tumor, pancreatic tumor, or melanoma. In certain 45 Some embodiments, the Notch antagonist will be adminis embodiments, the tumor is an ovarian tumor. In certain tered within 5, 4, 3, 2, or 1 days of any treatment with the embodiments, the tumor is a medulloblastoma. In certain second therapeutic agent. It will further be appreciated that embodiments, the tumor comprises cancer Stem cells. the two agents or treatment may be administered to the Sub In certain embodiments, the disease to be treated with the ject within a matter of hours or minutes (i.e., Substantially Notch-binding agent or antagonist is a disease associated 50 simultaneously). with angiogenesis. In certain embodiments, the disease is Useful classes of anti-cancer agents include, for example, cancer. In certain other embodiments, the disease is not a antitubulin agents, auristatins, DNA minor groove binders, cancerous condition. For example, the disease may be wet DNA replication inhibitors, alkylating agents (e.g., platinum macular degeneration, age related macular degeneration, dia complexes such as cisplatin, mono(platinum), bis(platinum) betic retinopathy, a hemangioma, rheumatoid arthritis, pso 55 and tri-nuclear platinum complexes and carboplatin), anthra riasis, neovascular glaucoma, polycystic ovary disease, cyclines, antibiotics, antifolates, antimetabolites, chemo endometriosis and inflammatory bowel disorders. therapy sensitizers, duocarmycins, etoposides, fluorinated In certain embodiments, the tumor expresses the Notch pyrimidines, ionophores, lexitropsins, nitrosoureas, plati receptor or receptors to which the Notch-binding agent or nols, performing compounds, purine antimetabolites, puro antagonist is targeted. In certain embodiments, the tumor 60 mycins, radiation sensitizers, steroids, taxanes, topoi expresses Notch2 and/or Notch3. In certain embodiments, the Somerase inhibitors, Vinca alkaloids, or the like. In certain tumor overexpresses Notch2 and/or Notch3. In certain embodiments, the second anti-cancer agent is an antimetabo embodiments, the tumor is dependent upon one or more lite, a topoisomerase inhibitor, or an angiogenesis inhibitor. Notch receptors to which the antibody administered specifi Anticancer agents that may be administered in combina cally binds. For example, in certain embodiments, an anti 65 tion with the Notch antagonists include chemotherapeutic body that specifically binds Notch2 (or Notch2 and Notch3) agents. Thus, in Some embodiments, the treatment involves may be used to inhibit the growth or otherwise target the the combined administration of an antagonist of the present US 8,226,943 B2 65 66 invention and a chemotherapeutic agent or cocktail of mul platinum: etoposide (VP-16); ifosfamide: mitomycin C: tiple different chemotherapeutic agents. Treatment with an mitoxantrone; Vincristine; vinorelbine; navelbine; antagonist can occur prior to, concurrently with, or Subse novantrone; teniposide; daunomycin; aminopterin: Xeloda; quent to administration of chemotherapies. Chemotherapies ibandronate:CPT11: topoisomerase inhibitor RFS 2000; dif contemplated by the invention include chemical Substances luoromethylomithine (DMFO); retinoic acid; esperamicins: or drugs which are known in the art and are commercially capecitabine; and pharmaceutically acceptable salts, acids or available. Such as doxorubicin, 5-fluorouracil, cytosine ara derivatives of any of the above. Chemotherapeutic agents also binoside (Ara-C), cyclophosphamide, thiotepa, buSulfan, include anti-hormonal agents that act to regulate or inhibit cytoxin, taxol, methotrexate, cisplatin, melphalan, vinblas hormone action on tumors such as anti-estrogens including tine and carboplatin. Combined administration can include 10 for exampletamoxifen, raloxifene, aromatase inhibiting 4(5)- co-administration, either in a single pharmaceutical formula imidazoles, 4-hydroxytamoxifen, trioxifene, keoxifene, tion or using separate formulations, or consecutive adminis LY 1 17018, onapristone, and toremifene (Fareston); and anti tration in either order but generally within a time period such androgens such as flutamide, nilutamide, bicalutamide, leu that all active agents can exert their biological activities prolide, and goserelin; and pharmaceutically acceptable salts, simultaneously. Preparation and dosing schedules for Such 15 acids or derivatives of any of the above. chemotherapeutic agents can be used according to manufac In certain embodiments, the chemotherapeutic agent is a turers instructions or as determined empirically. Preparation topoisomerase inhibitor. Topoisomerase inhibitors are che and dosing schedules for Such chemotherapy are also motherapy agents that interfere with the action of a topoi described in Chemotherapy Service Ed., M. C. Perry, Will Somerase enzyme (e.g., topoisomerase I or II). Topoi iams & Wilkins, Baltimore, Md. (1992). somerase inhibitors include, but are not limited to, Chemotherapeutic agents useful in the instant invention doxorubicin HCL, daunorubicin citrate, mitoxantrone HCL, also include, but are not limited to, alkylating agents such as actinomycin D, etoposide, topotecan HCL, teniposide (VM thiotepa and cyclophosphamide (CYTOXAN); alkyl sul 26), and irinotecan. In certain embodiments, the second anti fonates such as buSulfan, improSulfan and piposulfan, aziri cancer agent is irinotecan. In certain embodiments, the tumor dines such as benzodopa, carboquone, meturedopa, and ure 25 to be treated is a colorectal tumor and the second anticancer dopa; ethylenimines and methylamelamines including agent is a topoisomerase inhibitor, such as irinotecan. altretamine, triethylenemelamine, trietylenephosphoramide, In certain embodiments, the chemotherapeutic agent is an triethylenethiophosphaoramide and trimethylolomelamime; anti-metabolite. Ananti-metabolite is a chemical with a struc nitrogen mustards Such as chlorambucil, chlornaphazine, ture that is similar to a metabolite required for normal bio cholophosphamide, estramustine, ifosfamide, mechlore 30 chemical reactions, yet different enough to interfere with one thamine, mechlorethamine oxide hydrochloride, melphalan, or more normal functions of cells, such as cell division. Anti novembichin, phenesterine, prednimustine, trofosfamide, metabolites include, but are not limited to, gemcitabine, fluo uracil mustard; nitroSureas such as carmustine, chlorozoto rouracil, capecitabine, methotrexate Sodium, ralitrexed, pem cin, fotemustine, lomustine, nimustine, ranimustine; antibi etrexed, tegafur, cytosine arabinoside, thioguanine, otics such as aclacinomysins, actinomycin, authramycin, aza 35 5-azacytidine, 6-mercaptopurine, azathioprine, 6-thiogua serine, bleomycins, cactinomycin, calicheamicin, carabicin, nine, pentostatin, fludarabine phosphate, and cladribine, as caminomycin, carzinophilin, chromomycins, dactinomycin, well as pharmaceutically acceptable salts, acids, or deriva daunorubicin, detorubicin, 6-diazo-5-oxo-L-norleucine, tives of any of these. In certain embodiments, the second doxorubicin, epirubicin, esorubicin, idarubicin, marcellomy anticancer agent is gemcitabine. In certain embodiments, the cin, mitomycins, mycophenolic acid, nogalamycin, olivomy 40 tumor to be treated is a pancreatic tumor and the second cins, peplomycin, potfiromycin, puromycin, quelamycin, anticancer agent is an anti-metabolite (e.g., gemcitabine). rodorubicin, Streptonigrin, Streptozocin, tubercidin, uben In other embodiments, the treatment involves the com imex, Zinostatin, Zorubicin; anti-metabolites such as methotr bined administration of an antagonist of the present invention exate and 5-fluorouracil (5-FU); folic acid analogues such as and radiation therapy. Treatment with an antagonist can occur denopterin, methotrexate, pteropterin, trimetrexate; purine 45 prior to, concurrently with, or Subsequent to administration of analogs such as fludarabine, 6-mercaptopurine, thiamiprine, radiation therapy. Any dosing schedules for Such radiation thioguanine; pyrimidine analogs such as ancitabine, azaciti therapy can be used. dine, 6-azauridine, carmofur, cytarabine, dideoxyuridine, In other embodiments, the treatment can involve the com doxifluridine, enocitabine, floxuridine, 5-FU; androgens such bined administration of antibodies of the present invention as calusterone, dromostanolone propionate, epitiostanol, 50 with other antibodies against additional tumor associated mepitioStane, testolactone; anti-adrenals such as aminoglute antigens including, but not limited to, antibodies that bind to thimide, mitotane, triloStane; folic acid replenisher such as the EGF receptor (EGFR) (e.g., Erbitux(R), the erbB2 recep frolinic acid; aceglatone; aldophosphamide glycoside; ami tor (HER2) (e.g., HerceptinR), and vascular endothelial nolevulinic acid; amsacrine; bestrabucil; bisantrene; ediatraX growth factor (VEGF) (e.g., AvastinR). In certain alternative ate; defofamine; demecolcine; diaziquone; elformithine; 55 embodiments, the second anti-cancer agent comprises an elliptinium acetate; etoglucid, gallium nitrate; hydroxyurea; antibody that specifically binds to human DLL4 or other lentinan; lonidamine; mitoguaZone; mitoxantrone; mopi ligand of a Notch receptor or an antibody that specifically damol; nitracrine; pentostatin: phenamet; pirarubicin; podo binds to an additional human Notch receptor. Exemplary, phyllinic acid; 2-ethylhydrazide; procarbazine; PSK; razox anti-DLL4 antibodies, are described, for example, in U.S. ane; sizofuran; spirogermanium; tenuaZonic acid; 60 Patent Application Publication No. US 2008/0187532, incor triaziquone; 2.2.2"-trichlorotriethylamine: urethan; vin porated by reference herein in its entirety. Additional anti desine; dacarbazine; mannomustine; mitobronitol; mitolac DLL4 antibodies are described in, e.g., International Patent tol; pipobroman; gacytosine; arabinoside (Ara-C); cyclo Publication Nos. WO 2008/091222 and WO 2008/0793326, phosphamide; thiotepa; taxoids such as paclitaxel (TAXOL) and U.S. Patent Application Publication Nos. US 2008/ and doxetaxel (TAXOTERE, Rhone); chlorambucil; gemcit 65 0014196, US 2008/0175847; US 2008/0181899; and US abine; 6-thioguanine; mercaptopurine; methotrexate; plati 2008/0107648, each of which is incorporated by reference num analogs such as cisplatin and carboplatin: vinblastine; herein in its entirety. Exemplary anti-Notch antibodies, are US 8,226,943 B2 67 68 described, for example, in U.S. Patent Application Publica loss or mutations in the Wnt pathway including, for example, tion No. US 2008/0131434, incorporated by reference herein in APC, AXin2 or beta-catenin. in its entirety. In certain embodiments, the second anti-cancer In another aspect, the present invention provides kits that agent is an inhibitor of Notch signaling. In certain embodi can be used to perform the methods described herein. In some ments, the second anti-cancer agent is an antibody that is an 5 embodiments, a kit comprises an antibody or antibodies spe angiogenesis inhibitor (e.g., an anti-VEGF antibody). In cer cific for a Notch receptor, a purified antibody orantibodies, in tain embodiments, the second therapeutic agent is an anti one or more containers. In some embodiments, a kit further body that specifically binds a VEGF receptor. In certain comprises a Substantially isolated Notch receptor comprising embodiments, the second therapeutic agent is AVASTIN (be an epitope that is specifically immunoreactive with the anti 10 body or antibodies included in the kit, a control antibody that vacizumab), HERCEPTIN (trastuzumab), VECTIBIX (pani does not react with the Notch receptor, and/or a means for tumumab), or ERBITUX (cetuximab). Combined adminis detecting the binding of an antibody to a Notch receptor (Such tration can include co-administration, either in a single as, for example, a fluorescent chromophore, an enzymatic pharmaceutical formulation or using separate formulations, Substrate, a radioactive compound or a luminescent com or consecutive administration in either order but generally 15 pound conjugated to the antibody against a Notch receptor or within a time period such that all active agents can exert their to a second antibody that recognizes the antibody against a biological activities simultaneously. Notch receptor). In other embodiments, a kit comprises Furthermore, treatment can include administration of one reagents specific for the detection of mRNA or cDNA (e.g., or more cytokines (e.g., lymphokines, interleukins, tumor oligonucleotide probes or primers) of one or more Notch necrosis factors, and/or growth factors) or can be accompa receptor. In some embodiments, the kits contain all of the nied by Surgical removal of cancer cells or any other therapy components necessary and/or sufficient to perform a detec deemed necessary by a treating physician. tion assay, including all controls, directions for performing For the treatment of the disease, the appropriate dosage of assays, and any necessary Software for analysis and presen an antagonist of the present invention depends on the type of tation of results. disease to be treated, the severity and course of the disease, 25 A compartment kit includes any kit in which reagents are the responsiveness of the disease, whether the antagonist is contained in separate containers. Such containers include administered for therapeutic or preventative purposes, previ Small glass containers, plastic containers or strips of plastic or ous therapy, patient's clinical history, and so on, all at the paper. Such containers allows one to efficiently transfer discretion of the treating physician. The antagonist can be reagents from one compartment to another compartment Such administered one time or over a series of treatments lasting 30 that the samples and reagents are not cross-contaminated, and from several days to several months, or until a cure is effected the agents or Solutions of each container can be added in a or a diminution of the disease state is achieved (e.g., reduction quantitative fashion from one compartment to another. Such in tumor size). Optimal dosing schedules can be calculated containers will include a container which will accept the test from measurements of drug accumulation in the body of the sample, a container which contains the antibodies or probes patient and will vary depending on the relative potency of an 35 used in the methods, containers which contain wash reagents individual antagonist. The administering physician can easily (such as phosphate buffered saline, Tris-buffers, etc.), and determine optimum dosages, dosing methodologies and rep containers which contain the reagents used to detect the etition rates. In general, dosage is from 0.01 ug to 100 mg per bound antibody or probe. One will readily recognize that the kg of body weight, and can be given once or more daily, disclosed polynucleotides, polypeptides and antibodies of the weekly, monthly or yearly. The treating physician can esti 40 present invention can be readily incorporated into one of the mate repetition rates for dosing based on measured residence established kit formats which are well known in the art. times and concentrations of the drug in bodily fluids or tis In some embodiments, the invention further provides a kit SUS. comprising a Notch-binding agent orantagonistand a second In certain embodiments, the patients under consideration therapeutic agent. In certain embodiments, the Notch-binding for treatment with the Notch antagonist are screened prior to 45 agent or antagonist is an antibody that specifically binds to treatment with the Notchantagonist. In certain embodiments, Notch 2 and/or Notch3. In certain embodiments, the Notch a tumor in a patient or a tumor that has been removed from a binding agent or antagonist is an antibody that specifically patient is tested for the presence of cancer stem cells. In binds to Notch 2 and Notch3. In certain embodiments, the certain embodiments, the tumor is tested for expression of the second therapeutic agent is an anti-cancer agent and/or an one or more Notch receptors (e.g., Notch2 and/or Notch3) to 50 anti-angiogenic agent. which the antagonist binds. In certain embodiments, the In one aspect, the present invention provides a method of tumor is tested for the presence of an inactivating deletion or identifying a molecule that binds to a non-ligand binding mutation in the gene encoding the tumor Suppressor phos region of an extracellular domain of a human Notch receptor phatase and tensin homolog (PTEN). In certain embodi and inhibits tumor growth, the method comprising: i) incu ments, the tumor so tested is a breast tumor. 55 bating the molecule with the non-ligand binding domain of For example, the invention provides a method of selecting the extracellular domain of the human Notch receptor; ii) a subject for treatment with a Notch2 and/or Notch 3 antago determining if the molecule binds to the non-ligand binding nist, wherein the Subject has a tumor or has had a tumor region of the extracellular domain of the human Notch recep removed. In certain embodiments, the method comprises (a) tor; and iii) determining if the molecule inhibits tumor determining if the tumor comprises a deletion or mutation in 60 growth. Molecules that specifically binda non-ligand binding the PTEN gene, and (b) selecting the subject for treatment region of an extracellular domain of a human Notch receptor with the Notch 3 antagonist if the tumor comprises the dele include, but are not limited to, Small organic molecules, tion or mutation. polypeptides, and antibodies. In certain alternative embodiments of the present inven Screening can be performed using any Suitable method tion, patients screened for the presence of colon adenomas or 65 known in the art. In certain embodiments, screening is per polyps are tested for allelic loss and somatic mutations via a formed in vitro. In some embodiments, cells expressing a genetic test. In some embodiments the genetic test screens for non-ligand binding region of the extracellular domain of a US 8,226,943 B2 69 70 human Notch receptor are incubated with a labeled molecule Briefly, 2x10" Fab displaying phage particles were incu and specific binding of the labeled molecule to a non-ligand bated with a passively immobilized, recombinant Notch2 Fc binding region of the extracellular domain of a human Notch fusion protein (SEQID NO:21) comprising the extracellular receptor is determined by FACS analysis. In some embodi- ligand binding site of Notch2 and surrounding EGF repeats ments, a non-ligand binding region of the extracellular 5 (EGF1-12) in round one. The non-specific phage were domain of a human Notch receptor is expressed by phage washed off, and then the specific phage were eluted with DTT. display, and molecules that specifically bind to a non-binding The eluted output was used to infect TG1 F+bacteria, rescued region of the extracellular domain of a human Notch receptor with helper phage, and then Fab display induced with IPTG are identified. Other suitable methods for identifying mol- (0.25 mM). This process was repeated for two additional ecules that specifically bind to a non-ligand binding region of 'rounds and then round three was screened in ELISA against a human Notch receptor include, but are not limited to, passively immobilized recombinant Notch2 (EGF1-12) Fe ELISA, Western (or immuno) blotting, and yeast-two-hybrid. fusion (5 g/ml). Molecules that specifically bind to a non-ligand binding A particular Fab (59R1) was identified that bound the regionare then of tested an extracellular for inhibition domain of tumor of a cell human growth. Notch Testing receptor can human Notch2 receptor and blocked binding- of Jagged 1 to be performed using any suitable method known in the art. In human Notch2 . Binding of the 59R1 Fab to human Notch2 certain embodiments, molecules that specifically bind to non- was verified by FACS assay using a stable human cell line ligand binding region of the extracellular domain of a human HEK-293 which overexpressed human Notch2 (hN2) (FIG. Notch receptor are tested for the ability to inhibit tumor 1A). Fab binding was detected by phycoerythrin (PE)-conju growth in vitro. In some embodiments, molecules that spe- ? gated goat anti-human Fab (Jackson Immunochemicals). The cifically bind a non-ligand binding region of the extracellular 59R1 Fab (referred to in FIG. 1A as clone 1) demonstrated domain of a human Notch receptor are incubated with tumor good binding to hN2. The 59R1 Fab also demonstrated good cells in culture and proliferation of tumor cells in the presence of a molecule that specifically binds a non-ligand binding blocking activity against the Notch ligand human Jagged 1 in region of the extracellular domain of a human Notch receptor 25 a binding assay using the same stable cell line (FIG. 1B). is determined and compared to tumor cells incubated with a Ligand binding and blocking was determined by incubating non-binding control molecule. In certain embodiments, mol- hJagged 1 extracellular domain (ECD) fused to human Fc ecules that Specifically bind to non-ligand binding region of constant region with the cells and Fabs selected from the thefor extracellularthe ability to domain inhibit of tumor a human growth Notch in receptor vivo. In are certain tested phage library and using PE-conjugated goat anti-human Fc embodiments, molecules that specifically bind a non-ligand gamma specific antibodies (Jackson Immunochemicals) for binding region of the extracellular domain of a human Notch detection. receptor are injected into an animal Xenograft model and the The sequences of the VH and VL of the 59R1 Fab are growth of tumors in animals treated with molecules that spe- provided in SEQID NO: 11 and SEQID NO: 12 (including cifically bind to non-ligand binding region of the extracellular N-terminus bacterial signal sequences that are cleaved upon domain of a human Notch receptor is determined and com- secretion), respectively. The CDRs of the 59R1 Fab are as pared to animals treated with a non-binding control molecule. indicated in Table 2 below. TABLE 2 CDRs of 59R1 human Fab and IgG antibodies Heavy Chain Licht Chain

Lead CDR1 CDR2 CDR3 CDR1 CDR2 CDR3

59R1 SSSGMS VIASSGSNTYYADSVKG GIFFAI RASOSVRSNYLA GASSRAT OQYSNFPI (SEQ ID (SEQ ID NO : 6) (SEQ ID (SEQ ID (SEQ ID (SEQ ID NO; 5) NO: 7). NO: 8) NO: 9) NO: 1.O.)

EXAMPLES 50 Variable regions based on those of the 59R1 Fab were cloned into Ig expression vectors containing human IgG2 It is understood that the examples and embodiments heavy-chain and kappa light-chain along with their respective described herein are for illustrative purposes only and that mammalian signal sequences for expression in Chinese Ham various modifications O changes in light thereof will be Sug- ster Ovary (CHO) cells. The VH and VL of the 59R1 IgG gested to persons skilled in the art and are to be included antibody are provided as SEQIDNO; 13 and SEQIDNO:14, within the spirit and purview of this application. respectively. The amino acid sequence of the heavy chain and light chain of the 59R1 IgG antibody (including signal Example 1 sequences) are provided as SEQID NO: 16 and SEQID NO: Production of Human Antibodies to Notch2 18, respectively. The signal sequence at the N-terminus of the amino acid sequence of each of the chains is cleaved upon Human antibodies that specifically recognize the non- secretion. The nucleic acid sequences encoding the heavy and ligand binding portion of the extracellular domain of a light chains of the 59R1 IgG antibody are provided as SEQID Notch2 receptor were isolated using phage display technol- NO: 1 and SEQID NO:3, respectively. Protein Apurification ogy. A synthetic antibody library containing human antibody 65 was used to purify the antibodies. Bacterial plasmid DNA variable domains was screened for specific and high affinity containing a synthetic DNA insert encoding the heavy and recognition of a Notch2 receptor. light chain of the 59R1 IgG2 antibody DNA was deposited as US 8,226,943 B2 71 72 “59R1” with the ATCC, 10801 University Boulevard, Manas Example 2 sas, Va., USA, under the conditions of the Budapest Treaty on Oct. 15, 2008, and assigned designation number PTA-9547. Cross-Reactivity and Binding Affinity of In addition, the 59R1 IgG2 antibody was assayed for its Anti-Notch2/359R1 Antibody ability to block binding of DLL4 to the human Notch 2 5 receptor by FACS analysis. HEK-293 cells stably overex The ability of the 59R1 IgG2 antibody to cross-react with other Notch receptors was determined by FACS assay using pressing human Notch2 were incubated with the antibody at HEK-293 cells transiently transfected with the human various concentration and then detected for hNotch2 binding Notch1, Notch2. Notch3 or Notch4 expression plasmid and (FIG. 1C) by PE-conjugated goat anti-human Fc gamma spe green fluorescent protein (GFP) as a transfection control. cific antibody, or ligand blocking activity (FIG. 1D). Ligand 10 GFP positive cells indicated expression of the transgene. The blocking was determined by incubating the cells with human 59R1 IgG2 was added to the cells at 2 ug/ml and detected by DLL4ECD tagged with the rabbit Fc constant region and the PE-conjugated goat anti-human Fc gamma specific (Jackson 59R1 antibody at a range of concentrations, and then detect Immunochemicals). All Notch constructs were full length. ing the hDLL4 by PE-conjugated donkey anti-rabbit anti The results are shown in FIG.2. As shown in FIG. 2, the 59R1 body. Binding of hNotch2 and ligand blocking activity were 15 IgG2 antibody specifically binds to both human Notch3 and human Notch2, but does not bind significantly to full-length thus confirmed for the 59R1 IgG2 antibody. human Notch1 or human Notch4. A germlined variant of 59R1 (referred to herein as The affinities for human and mouse Notch1, Notch2, “59RGV) was also expressed and purified. The VHand VL Notch3, and Notch4 were determined using a Biacore 2000 of the 59RGV antibody are provided as SEQID NO: 19 and instrument. Briefly, recombinant human and mouse Notch SEQID NO: 20, respectively. The amino acid sequence of the proteins (EGF10-15 for Notch1, 2, & 4: EGF9-14 for Notch3) heavy chain and light chain of the 59RGV antibody (includ were immobilized on a CM5 chip using standard amine based ing signal sequences) are provided as SEQID NO: 2 and SEQ chemistry (NHS/EDC). For hNotch2, EGF1-12 was also IDNO: 4, respectively. The signal sequence at the N-terminus tested for binding. Different antibody concentrations (1-100 of the amino acid sequence of each of the chains is cleaved nM) were injected over the protein surfaces and kinetic data upon secretion. The nucleic acid sequences encoding the 25 were collected over time. The data was fit using the simulta heavy and light chains of the 59RGV antibody are provided as neous global fit equation to yield dissociation constants (K, SEQ ID NO: 15 and SEQID NO: 17, respectively. nM) for each Notch (Table 3). TABLE 3 59R1 IgG Dissociation Constants (KD mNotch1 hNotch1 mNotch2 hNotch2 hNotch2 mNotch3 hNotch3 hNotch4 Ab (nM) (nM) (nM) (nM)* (nM)** (nM) (nM) (nM) 59R1 >10 86.4 O3S <0.1 <0.1 O.13 O.12 NB

*N2(EGF1-12) **N2OEGF 10-155)

Highly hydrophobic CDRs have the potential, in certain Example 3 instances, to allow for unfavorable, non-specific binding by an antibody. Since the amino acid sequence of the heavy chain Epitope Mapping of Anti-Notch2/3 Antibody 59R1 CDR3 of 59R1 had an unusual degree of hydrophobic char To identify antibodies that recognize specific non-ligand acter, variants of 59R1 that contained heavy chain CDR3 binding regions of the Notch receptor extracellular domains, sequences with decreased hydrophobic character were pro- 45 epitope mapping was performed. duced. Heavy chain CDR3 affinity maturation was conducted The binding of anti-Notch2/3 antibodies to supernatant by allowing restricted changes from the parental sequence from HEK 293 cells transfected with sequences encoding (GIFFAI: SEQ ID NO:7) as shown in FIG. 1E. Allowed recombinant human Notch2 Fc fusion proteins comprising amino acids at each position were allowed to change from 50 the full length human Notch2 protein or various human parental residues to the residues indicated in FIG. 1E. Notch2 deletion constructs containing various deletions of Improved variants were isolated by screening them for EGF repeats one to twelve were tested by ELISA. See Table improved JAG1 blocking ability as shown in FIG. 1F (indi 4 below. HEK-293 cells were transiently transfected with cated with arrows). Briefly, Fabs (1 and 10 g/ml) were mixed pcDNA 3.1 (Invitrogen) with hNotch2 cDNA’s encoding for 55 the indicated amino acids fused to the constant region of with hJAG1-rb Fc (preclustered 5 lug/ml to 2 ul/ml PE-con human IgG (hFc). Supernatants were harvested 48 hours jugated donkey anti-rabbit) and then added to hNotch2 stably later. To capture hN2hfc proteins, 96 well plates were first transfected 293 cells. h.JAG1 binding was then assessed using coated with goat anti-human Fc gamma specific IgG (Jackson flow cytometry. Six improved variants (versus 59R1 Fab) Immunochemicals, #109-006-098) at 100 ng per well in were isolated and their HCCDR3 sequences were as follows: 60 sodium bicarbonate buffer overnight at 4. Plates were SIFYPT (SEQID NO:22), SSFFAS (SEQ ID NO:23), SSF washed and blocked in 5% bovine serum/PBS-Tween-20. Supernatants were added to plates and incubated at room YAS (SEQ ID NO:24), SSFFAT (SEQ ID NO:25), SIFYPS temperature for 1 hour. Plates were washed in P135-T. 59R1 (SEQ ID NO:26), and SSFFAN (SEQ ID NO:27). The Fab was added at 10 ug/ml in 5% serum/PBS-T and incubated sequences of the heavy chain variable regions for these vari 65 at room temperature for 1 hour. Plates were washed in PBS-T. ants are sequences SEQID NO:52, SEQID NO:53, SEQ ID Fab binding was detected by goat anti-human Fab specific NO:54, SEQID NO:55, SEQID NO:56, and SEQID NO:57. antibody conjugated to horseradish peroxidase (Thermo, US 8,226,943 B2 73 74 #31414) diluted 1:5000 in 5% serum/PBS-T for 1 hour at generated by QuikChange R mutagenesis (Stratagene) and room temperature. Plates were washed and developed with 1 Verified by sequencing. Binding to the mutants was deter Step Ultra TMB (Thermo, #34028). Plates were read on a mined by FACS analysis (FIGS. 14B and 14C). 59R1 was Perkin Elmer Victor 1420 plate reader. Anti-Notch2/3 59R1 detected by PE-conjugated goat anti-human Fc gamma spe 5 cific antibody (Jackson Immunochemicals, #109-116-170). antibody bound only to Supernatant from cells expressing The amino acids necessary for 59R1 binding to hNotch 2 recombinant Notch2 proteins comprising EGF10, which con were thus determined to be histidine 385, alanine 388, and sists of amino acids 375-417 of human Notch 2. (FIG. 3A). leucine 389 (residues within the boxed hNotch2 sequence shown in FIG. 14A). The corresponding residues in hNotch3 TABLE 4 10 are histidine 361, alanine 364, and isoleucine 365. Human Notch2 deletion constructs Example 4 Construct amino acids Anti-Notch2/3 Antibody 59R1 Inhibits Notch2 hN21-3 1-144 Signaling hN21-4 1-181 15 hN21-5 1-221 hN21-6 1-263 Luciferase reporter assays were used to assay the 59R1 hN21-7 1-301 antibody for its ability to blockhil LL4-, hJAG1-, and hJAG2 hN21-8 1-341 induced Notch2 signaling. hN21-9 1-378 Hela cells that stably overexpress human Notch2 were hN21-10 1-417 hN21-11 1-456 transiently transfected with firefly luciferase with a synthetic hN21-12 1-493 8xCBS promoter (Ong et al., 2006, J. of Biological Chemis hN28-12 296-493 try, 281:5106-5119), pSPORT6 MAML-1, and Renilla hN29-12 326-493 luciferase-CMV as a transfection control. Cells were incu hN210-12 375-493 bated with 100 ng of immobilized hDLL4 (R&D systems) hN2 11-12 413-493 with the indicated antibodies for 16 hours and then assayed hN2 12-12 454-493 25 using Dual-Glo (Promega) according to the manufacturers instructions. Control antibody was at a concentration of 40 Moreover, FACS analysis shows that 59R1 Fab antibody ug/ml. 59R1 IgG2 antibody was titrated, starting at 40 ug/ml. binding was retained when EGF11 or EGF12 were deleted and then diluted by one-fourth. The gamma secretase inhibi tor (GSI) dibenzazepine (DBZ) was used as a control at 1 uM. from full length Notch2 recombinant protein expressed by 30 As shown in FIG. 4A, the 59R1 antibody was found to inhibit HEK 293 cells (FIG.3B). Point mutations were made within hDLL4-induced Notch2 reporter activity. EGF10 of Notch2 fusion proteins and binding of 59R1 to each Hela cells that stably overexpress human Notch2 were EGF10 mutant was determined by FACS analysis. HEK-293 transiently transfected with firefly luciferase with a synthetic cells were transiently transfected with the indicated Notch 8xCBS promoter, pSPORT6 MAML-1, and Renilla expression plasmid and GFP as a transfection control. GFP 35 luciferase-CMV as a transfection control. Cells were incu positive cells indicated expression of the transgene. The 59R1 bated with either 200 ng of immobilized hJAG1 (R&D sys Fab antibody was added to the cells at 10 g/ml and detected tems) or hJAG2 (R&D systems) for 16 hours and then assayed by PE-conjugated goat anti-human (Jackson Immunochemi using Dual-Glo (Promega) according to the manufacturers cals). instructions. 59R1 IgG2 antibody was at a concentration of 40 To verify that loss of EGF repeat 10 does not interfere with 40 ug/ml. The gamma secretase inhibitor (GSI) dibenzazepine ligand binding, a mutant hNotch2 missing amino acids 375 (DBZ) was used as a control at 1 uM. As shown in FIGS. 4B 412 was generated and tested for binding to 59R1, a hNotch2 and 4C, the 59R1 antibody was found to inhibit both hJAG1 monoclonal 59M70 directed against EGF 1-4, and binding to and hJAG2-induced Notch2 reporter activity, respectively. the ligand human DLL4(FIG. 3C). FACS analysis of HEK Example 5 293 cells transiently transfected with the indicated Notch 45 expression plasmid and GFP as a transfection control. GFP Anti-Notch2/3 Antibody 59R1 Prevents. In Vivo positive cells indicate expression of the transgene. Anti Tumor Growth Notch2 (59M70) was added at 20 ug/ml and detected by PE-conjugated goat anti-mouse (Caltag, #3004-4). 59R1 This example describes the use of an anti-Notch2/3 recep (IgG2) was added to the cells at 2 ug/ml and detected by 50 tor antibody (59R1) that binds a non-ligand binding region of PE-conjugated goat anti-human Fc gamma specific (Jackson the Notch receptors (EGF10 of Notch2 and EGF10 of Immunochemicals). Ligand binding was determined by incu Notch3) to prevent tumor growth in a xenograft model. bation of the cells with human DLL4 extracellular domain In certain embodiments, NOD/SCID mice injected with (ECD) fused to rabbit IgG constant region at 5 ug/ml and 50,000 PE13 or T3 breast tumor cells were treated with anti detected by PE-conjugated donkey anti-rabbit. As shown in 55 Notch2/3 antibody 59R1 or control antibody 1B7.11 two days FIG. 3C, ligand and 59M70 both bind to hNotch2 in the following cell injections. Antibodies were dosed at 10 mg/kg absence of EGF 10, but 59R1 does not. twice week. Anti-Notch2/3 antibody 59R1 significantly A comparison analysis of the EGF 10 regions of human reduced both PE13 (FIG.5A) and T3 (FIG.5B) tumor growth Notch1, Notch2, and Notch4 and the EGF 9 region of human compared to control. Notch3 (the equivalent of EGF 10 in the other Notch recep 60 tors) was performed to determine likely binding sites for Example 6 59R1 (FIG. 14A). As a result of the analysis, several point mutants were created within full-length Notch2, converting In Vivo Treatment of Tumors. Using Anti-Notch 2/3 residues within EGF 10 to the corresponding amino acids in Antibody 59R1 human Notch 1. Also, conversely, point mutations were made 65 in hNotch1 EGF 10 converting residues to the corresponding This example describes the use of anti-Notch 2/3 antibod hN2 residues. Mutants in full-length Notch sequences were ies to treat cancer in a Xenograft model. US 8,226,943 B2 75 76 In one experiment, the 1x10" viable Colo-205 colon tumor ing gene GAPDH as an internal control. Changes in tumor cells were injected into 6-8 week-old immunodeficient bg/nu cell gene expression upon Notch2/3 antibody treatment are XID female mice on a Swiss CD-1 background. Tumors were thus determined. allowed to grow to a size of between 65 to 200 mm after In addition, the effect of anti-Notch2/3 antibody treatment which mice were randomized (n=10 perexperimental group), 5 on the presence of cancer stem cells in a tumor may be and antibodies administration begun. Animals were treated assessed. Tumor samples from Notch 2/3 antibody versus with 15 mg/kg of either control 1B7.11 antibodies or anti control antibody treated mice are cut up into Small pieces, Notch2/359R1 antibodies once weekly. Tumor size was mea minced completely using sterile blades, and single cell Sus Sured twice weekly, and tumor Volume was calculated as pensions obtained by enzymatic digestion and mechanical described (see Michieli et al., 2004, Cancer Cell, 6:61-73). 10 disruption. Dissociated tumor cells are then analyzed by Anti-Notch2/3 antibody 59R1 significantly reduced Colo FACS analysis for the presence of tumorigenic cancer stem 205 tumor growth compared to control (FIG.5C). cells based on ESA-, CD44+, CD24-flow, Lin-surface cell In another experiment, anti-Notch2/3 antibodies were marker expression as described in detail above. tested for an effect on pancreatic tumor growth. NOD/SCID The tumorigenicity of cells isolated based on ESA-, mice were injected with 30,000 PN4 pancreatic tumor cells 15 CD44+, CD24-flow, Lin-expression following anti Sub-cu in the right flank, and tumors were allowed to grow Notch2/3 antibody treatment can then assessed. In one until they had reached an average volume of 100 mm. Ani example, 5,000, 1,000, 500, and 100 isolated ESA+, CD44+, mals were randomized and dosing of anti-Notch2/3 antibody CD24-flow, Lin-cancer stem cells from Notch 2/3 antibody 59R1 or control antibody 1B711 was initiated. Antibodies treated versus control antibody treated mice are re-injected were dosed at 15 mg/kg given once per week. Anti-Notch2/3 subcutaneously into the mammary fat pads of NOD/SCID antibody 59R1 significantly reduced PN4 tumor growth com mice. The tumorigenicity of cancer stem cells based on the pared to control (FIG. 5D). number of injected cells required for consistent tumor forma In a further experiment, anti-Notch2/3 antibodies were tion is thus determined. tested for an effect on breast tumor growth. NOD/SCID mice were injected with 50,000 PE13 or T3 breast tumor cells, and 25 Example 7 tumors were allowed to grow to a size of between 65 to 200 mm after which mice were randomized (n=10 per experi Anti-Notch 2/3 Antibody 59R1 Delays Tumor mental group), and antibodies administration begun. Animals Recurrence In Vivo Following Paclitaxel Treatment were treated with 15 mg/kg of either control 1 B7.11 antibod ies or anti-Notch2/3 59R1 antibodies twice weekly. Tumor 30 B51 breast tumor cells (50,000 cells per mouse) were size was measured twice weekly, and tumor Volume was injected sub-cutaneously into the mammary fat pad of NOD calculated as described (see Michieli et al., 2004). Anti SCID mice. Tumors were allowed to grow for 50 days until Notch2/3 antibody 59R1 significantly reduced growth of both they had reached an average volume of ~100 mm. Animals PE13 (FIG. 5E) and TE (FIG. 5F) tumors compared to con were randomized (n=10/group) and treatments were initiated. trol. 35 One group received a control antibody (1B711) at 10 mg/kg At the end point of antibody treatment, tumors may be twice per week and paclitaxel (Taxol) at 15 mg/kg twice per harvested for further analysis. In some embodiments, a por week and the other group received 59R1 at 10 mg/kg twice tion of the tumor is analyzed by immunofluorescence to per week and paclitaxel at 15 mg/kg twice per week. Tumor assess antibody penetration into the tumor and tumor Volumes were measured on the indicated days. Treatments response. A portion of each harvested tumor from anti 40 were carried out for 38 days until the tumor volumes had Notch2/3 antibody treated and control antibody treated mice regressed to ~50 mm, after which the paclitaxel treatments is fresh-frozen in liquid nitrogen, embedded in O.C.T., and were halted and the antibody treatments continued for the cut on a cryostat as 10 Lim sections onto glass slides. Alter duration of the experiment. natively a portion of each tumor is formalin-fixed, paraffin The results are shown in FIG. 6. Tumors were observed to embedded, and cut on a microtome as 10 um section onto 45 recur more rapidly in the control group compared with the glass slides. Sections are post-fixed and incubated with chro group treated with 59R1. mophore labeled antibodies that specifically recognize injected antibodies to detect anti-Notch2/3 antibody or con Example 8 trol antibodies present in the tumor biopsy. Furthermore, antibodies that detect different tumor and tumor recruited cell 50 Anti-Notch 2/3 Antibody 59R1 Decreases the types such as, for example, anti-VE cadherin (CD144) or Frequency of Cancer Stem Cells in a Tumor In Vivo anti-PECAM-1 (CD31) antibodies to detect vascular endot helial cells, anti-Smooth muscle alpha-actin antibodies detect Limiting dilution assays (LDAs) can be used to assess the vascular smooth muscle cells, anti-Ki67 antibodies to detect effect of a Notch-binding agent on Solid tumor cancer stem proliferating cells, TUNEL assays to detect dying cells, and 55 cells and on the tumorigenicity of a tumor comprising the anti-intracellular domain (ICD) Notch fragment antibodies to cancer stem cells. The assays can be sued to determine the detect Notch signaling can be used to assess affects of anti frequency of cancer stem cells in tumors from animals treated body treatment on angiogenesis, tumor growth, and tumor with the Notch-binding agent or other agent and to compare morphology. that frequency to the frequency of cancer stem cells in tumors The effect of anti-Notch2/3 antibody treatment on tumor 60 from control animals. cell gene expression may also be assessed. Total RNA is An LDA was used to assess the effect on the tumorigenicity extracted from a portion of each harvested tumor from of the B51 breast tumors that were treated with the combina Notch2/3 antibody treated and control antibody treated mice tion of control antibody (1B711) plus paclitaxel (Taxol) or and used for quantitative RT-PCR. Expression levels of treated with the combination of 59R1 and paclitaxel, as Notch2/3, components of the Notch2 and/or Notch3 signal 65 described above in Example 7. In addition, the effect of treat ing pathway, as well as cancer stem cell markers including, ment of B51 breast tumors with the control antibody alone or for example, CD44, are analyzed relative to the house-keep 59R1 alone was also determined by LDA. The doses of anti US 8,226,943 B2 77 78 bodies and paclitaxel and the schedule of dosing for the M4 melanoma tumor cells (10,000 cells per mouse) were control antibody group and the 59R1 group were the same as injected subcutaneously into the flank region of NOD-SCID described in Example 7, above for the other two treatment mice. Tumors were allowed to grow for 25 days until they had groups. After three doses of antibodies and/or paclitaxel, reached an average volume of ~80 mm. Animals were ran tumors were harvested, processed and dissociated into single domized into treatment groups (n=10/group) and treatments cells. The human tumor cells were isolated from the xenograft were initiated. One group received a control antibody tumor cells by incubation with biotinylated mouse antibodies (1B711) at 10 mg/kg twice per week and one group received (C-mouse CD45-biotin1:200 dilution and rat C.-mouse H2 59R1 at 10 mg/kg twice per week. Tumor volumes were Kd-biotin1:100 dilution, BioLegend, San Diego, Calif.) on measured on the indicated days. The results are shown in FIG. ice for 30 min, followed by addition of streptavidin-labeled 10 9. Tumor growth was found to be inhibited by 59R1. C28 colon tumor cells (10,000 cells per mouse) were magnetic beads and removal of the mouse cells with the aid of injected subcutaneously into the flank region of NOD-SCID a magnet. The human cells in the Suspension were harvested mice. Tumors were allowed to grow for 24 days until they had and counted. reached an average volume of ~130 mm. Animals were A serial titration of cells (30,90, 270, and 810 cells) from 15 randomized into four treatment groups (n=10/group) and each of the four treatment groups was injected in a 1:1 (v/v) treatments were initiated. One group received a control anti mixture of FACS buffer and Matrigel into a new set of NOD body (1B711) at 10 mg/kg twice per week; one group SCID mice (n=10/group). Tumors were allowed to grow for received irintoecan at 7.5 mg/kg once per week plus the 72 days. The percentage of mice with detectable tumors was control antibody at 10 mg/kg twice per week; one group determined in all groups. The cancer stem cell frequency was received 59R1 at 10 mg/kg twice per week, and the fourth then calculated using L-CalcTM software (StemCell Tech group received the combination of 59R1 at 10 mg/kg twice nologies Inc., downloadable from www.stemcell.com/ per week and irinotecan at 7.5 mg/kg once per week. Tumor search/default.asp). volumes were measured on the indicated days. The results are The results are shown in FIG. 7. The frequency of cancer shown in FIG. 10. Tumor growth was found to be inhibited by stem cells in the tumor in the control-treated mice (“Control') 25 59R1 alone relative to the control antibody group and by the was determined to be 1:66. The frequency of cancer stem cells combination of 59R1 and irinotecan relative to the irinotecan in the tumor in the paclitaxel-treated mice (“Taxol) was group. shown to be 1:25, indicating that treatment with paclitaxel The 59R1 IgG2 antibody was also tested in vivo in the had actually increased the frequency of cancer stem cells in breast tumor xenograft lines OMP-B34, OMP-B39, OMP the tumor by more than two-fold relative to the control. Treat 30 B44, PE13, and UM-T1, the pancreas tumor xenograft line ment with the 59R1 antibody, either alone (“59R1') or in OMP-PN8, and the colon tumor xenograft line OMP-C8. combination with paclitaxel (“Taxol--59R1), on the other These tumor xenograft lines were established by adhering to hand, reduced the frequency of cancer stem cells in the procedures described in Al-Hajjet al., 2003, Proc. Natl. Acad. tumors. The 59R1 antibody alone reduced the cancer stem Sci. USA, 100:3983-3988. Female NOD/SCID immuno cell frequency in the breast tumors by more than two-fold 35 compromised mice 7-10 weeks old were used for the estab relative to the control. Treatment with the combination of lishment of the breast tumor xenografts and male NOD/SCID 59R1 antibody and paclitaxel reduced the frequency of cancer mice were used for the OMP-Pn8 and OMP-C8 tumor-mod stem cells in the tumor by more than about two-fold relative to els (Harlan, Indianapolis, Ind.). The 59R1 IgG2 antibody was treatment with 59R1 alone (p<0.0001), by about 4.5-fold also tested in vivo in a Colo-205 colon tumor xenograft relative to treatment with the control antibody, and by about 40 model. Female immunodeficient bg/nu XID mice on a Swiss twelve-fold relative to treatment with paclitaxel alone. These CD-1 background were used for the Colo-205 xenograft results indicate that treatment with the 59R1 antibody is tumor model. In case of the breast cancer models, slow effective at reducing the tumorigenicity of a breast tumor, releasing estrogen pellets (0.36 mg) had to be implanted. whether given alone or in combination with paclitaxel, even Mice were subcutaneously injected on the right flank with though treatment with paclitaxel alone has the opposite 45 50,000 (OMP-B34, OMP-B39, OMP-B44, PE13, and UM effect. T1) or 1x10" (Colo-205) viable cells, respectively, in a mix ture of PBS (without magnesium or calcium) and Matrigel at Example 9 a 1:1 ratio. The injected total volume per mouse was 200 ul with 50% being Matrigel. Once the tumor had reached a size Additional In Vivo Treatment of Tumors. Using 50 between 65-200 mm, the mice were randomized. Antibodies Anti-Notch 2/3 Antibody 59R1 were administered weekly and tumors measured twice weekly. LZ1 (a human antibody that recognizes lyZozyme) or PN4 pancreatic tumor cells (50,000 cells per mouse) were 1B711 (a murine IgG1 antibody that recognizes the hapten injected subcutaneously into the flank region of Nod-Scid trinitrophenol) was used as a control antibody for treatment of mice. Tumors were allowed to grow for 27 days until they had 55 each tumor type. Tumor Volume was calculated as described reached an average volume of ~120 mm. Animals were Al-Hajjet al. (2003). Data are expressed as the mean and the randomized into four treatment groups (n=10/group) and meantS.E.M. Group means were compared using Students treatments were initiated. One group received a control anti two-tailed, unpaired t-test. Probability (P) values of <0.05 body (1B711) at 10 mg/kg twice per week; one group were interpreted as significantly different. All statistical received gemcitabine at 40 mg/kg once per week plus the 60 analysis was performed using Microsoft EXCEL and Graph control antibody at 10 mg/kg twice per week; one group Pad PRISM. received 59R1 at 10 mg/kg twice per week, and the fourth The results of the additional in vivo experiments in group received the combination of 59R1 at 10 mg/kg twice Colo205, C8, PNA, B34, B39, B44, PE13, and T1 xenograft per week and gemcitabine 40 mg/kg once per week. Tumor models are shown in FIGS. 11A-11H, respectively. As shown volumes were measured on the indicated days. The results are 65 in FIG. 11A, monotherapy with the 59R1 antibody signifi shown in FIG.8. Tumor growth was found to be inhibited by cantly inhibited growth of the Colo205 tumor relative to the the combination of 59R1 and gemcitabine (p<0.001). control antibody (LZ 1) (p<0.01). Combination therapy with US 8,226,943 B2 79 80 59R1 plus the anti-VEGF antibody bevacizumab (AVASTIN) ciated differentially regulated genes in selected tumor provided an even greater inhibition of tumor growth xenograft models (Colo205, B44, PE13, and T1) are shown in Table 5 below. The P-value (PVal) of each gene is the prob (p<0.001) than either 59R1 or bevacizumab alone. In another ability of significant regulation of the gene by 59R1 by chance colorectal xenograft model, C8, 59R1 was likewise shown to using Bayesian t-test. A number of genes including the genes inhibit tumor growth relative to LZ1 control antibody (FIG. encoding regulator of G-protein signaling 5 (RGS5). Notch3. 11B). Similarly, 59R1 was found to inhibit pancreatic tumor and hairy/enhancer-of-split related with YRPW motif-like growth (relative to control antibody) in the PN8 xenograft (HEYL) protein were shown to be significantly down-regu model (FIG. 11C). 59R1 was also shown to inhibit breast lated in the stroma of the 59R1-treated mice relative to the cancer growth relative to a control antibody in each of the five control mice. (By contrast, these particular genes encoding breast cancer xenograft models B34 (FIG. 11D), B39 (FIG. 10 RGS5, Notch3, and HEYL were not found to be significantly 11E), B44 (FIG. 11F), and PE13 (FIG. 11G). The 59R1 down-regulated in the human cells of the tumors.) TABLE 5 Differentially expressed genes in strona of 59R1-treated tumors

Colo205 B44 PE13 T1

Gene Fold pVal Fold pVal Fold pVal Fold pVal 420942 s at (RgS5) -5.52 7.65E-07 -2.43 5.59E-04 -4.23 2.86E-OS -1.18, 9.82E-04 417466 at (Rgs5) -3.39 6.62E-07 -2.22 3.11E-04 -4.03 1.31E-10 - 1.99 4.11E-04 420941 at (Rgs5) -5.10 1.66E-03 -2.09 118E-O3 -2.99 1.35E-05 - 1.97 2.07E-O3 421964 at (Notch3) -3.26 3.7OE-06 -2.03 2.3OE-O3 - 1.91 1.67E-O3 -1.01 8.86E-O 416286 at (RgS4) -3.08. 2.69E-03 -1.57 3.84E-O2 -1.83 6.71E-OS -113 4.47E-O 434141 at (Gucy1a3) -2.49 2.87E-O3 -1.74 1.07E-O2 -418 149E-07 20 S.9SE-O 459713 s at -1.90 190E-O3 -1.70 101E-O2 -7.28 9.89E-10 -2.14 1.79E-04 (Tmem16a) 420872 at -1.94 1.90E-O2 -1.65 7.68E-O3 -3.06 8.52E-10 -1.01 7.13E-O (Gucy1b3) 422789 at (Aldh1a2) -1.73 1.2OE-O2 -4.92 2.42E-O8 -2.17 158E-04 -2.16 9.27E-04 419302 at (Heyl) -3.28 5.61E-O3 -1.12 2.36E-O1 -1.77 5.72E-04 -1.07 2.39E-O2 451501 a at (Ghr) -1.83 1.69E-02 -2.24 2.71E-04 -1.66 8.90E-04 -1.12 3.38E-O 417714 X at (Hba -8.37 2.49E-02 -2.56 4.63E-04 - 1.92 1.06E-O2 42 9.24E-O al/Hba-a2) 428361 X at (Hba -8.91, 193E-O2 -2.42 1.08E-O3 -1.73 4.27E-O2 .73 4.67E-O al/Hba-a2) 452590 a. at (Plac9) -1.61 107E-O2 -1.64 1.22E-O2 -1.62 6.17E-O3 20 7.36E-O 449632 s at -1.72 1.69E-O2 -1.57 112E-O2 -1.63 18OE-04 O7 S.97E-O (Fkbp10) 449280 at (Esm1) 2.07 1.06E-O2 155 3.48E-O2 156 4.35E-02 .18 2.44E-0 418829 a at (Eno2) 1.79 2.92E-O2 1.71 102E-O2 1.54 5.43E-O3 29 9.92E-O2 antibody was likewise found to be effective at inhibiting The expression levels in the stroma from the xenograft tumor growth in the T1 breast cancer model (FIG. 11H), 40 models Colo205, B29, B34, B44, PE13, T1 (without estrogen although it was only effective in the presence of estrogen, treatment), T1 (with estrogen treatment), C8, and PN8 of despite T1 being an estrogen receptor negative tumor. selected genes that had been identified in the microarray analysis as being regulated by treatment with 59R1 (heyl, Example 10 45 notch3, rgs5, angptl, and angpt2) were further analyzed by TaqMan(R) analysis. The results are shown in FIGS. 12A Effect of Treatment with Anti-Notch2/3 Antibody (heyl), 12B (notch3), 12C (rgs5), 12D (angptl), and 12E 59R1 on Gene Regulation in Xenograft Tumor (angpt2). Models The results of the TaqMan(R) analysis confirm that notch3 50 and rgs5 are down-regulated in the Stroma of each of the Gene expression levels in various Xenograft tumor models various tumor types in response to treatment with 59R1 (rela treated with the 59R1 IgG2 antibody were analyzed by tive to control) (FIGS. 12B and C). RGS5 is a well-known microarray analysis. Global gene expression profiling analy marker of pericytes and vascular Smooth muscle cells (Berger sis was performed on Affymetrix HG-U133 plus 2.0 microar et al., 2005, Blood, 105:1094-1101: Lovschall et al., 2007, ray (Affymetrix, Santa Clara, Calif.). Three independent 55 Int. J. Dev. Biol. 51: 715-721; Cho et al., 2003, FASEB.J., RNA samples of xenograft whole tumors from the control and 17:440-2). Notch3 has been identified as being coexpressed treatment groups were isolated and hybridized to the microar with RGS5 in pericytes during angiogenesis and playing an rays according to the manufacturers instructions. Scanned important role in the regulation of the fate of pericytes and array background adjustment and signal intensity normaliza vascular smooth muscle cells (Lovschall et al., 2007, Int. J. tion were performed with GCRMA algorithm in the open 60 Dev. Biol., 51: 715-721; Domenga et al., 2004, Genes & Dev., source bioconductor software (www.bioconductor.org). The 18:2730-2735; Sweeney et al., 2004, FASEB.J., 18:1421-3: expression level of each gene was normalized by Z-score Morrow et al., 2005, Am. J. Physiol. Cell Physiol., 289: transformation across the samples in the control (CTRL) and C1188-C1196). treatment (59R1) groups. Genes differentially expressed In addition, heyl was also confirmed to be downregulated (p<0.05 and fold change >2.0) between the two groups were 65 in the stroma of each of the xenograft models except B34 identified with Bayesian t-test (Baldi et al., 2001, Bioinfor (FIG. 12A). HeyL belongs to the Hey family of downstream matics, 17:509-519. The expression patterns of selected asso transcription factors of Notch signaling (Hey 1, Hey2, and US 8,226,943 B2 81 82 HeyL). The downregulation of heyl by 59R1 suggests that the were significantly more pronounced than in 1B711 treated 59R1 antibody directly affects Notch signaling by downregu tumors (data not shown). AF594-conjugated goat anti-rat lating heyl. F(ab') was used to detect anti-CD31 antibody and FITC Angiopoietin-1 (angptl) and angiopoietin-2 (angpt2) were conjugated goat anti-rabbit antibody was used to detect anti also determined to be down-regulated in the stroma of a pimonidazole antibody. number of the breast cancer models (FIGS. 12D and E). Example 12 ANGPT1 and 2 (angiopoietin-1 and -2) are ligands for the TIE 1 and 2 receptors. TIE receptors, like VEGF, are crucial Breast Tumors Comprising Deletions in the PTEN signaling molecules in neoangiogenesis processes (Jones et Tumor Suppressor Gene are Responsive to al., 2001, Nature Reviews, 2:257-267). 10 Treatment with 59R1 Notably, however, angptl and angpt2 were down-regulated in the stroma of the T1 model when estrogen treatment was DNA samples were prepared from tumor cells of xenograft used (“T1 e”), conditions under which treatment with 59R1 breast cancers. Before the DNA isolation, mouse stroma cells was effective against tumor growth, but not in the stroma of in the Xenograft tumors were depleted using magnetic beads the same model in the absence of estrogen treatment (“T1 15 conjugated with mouse cell specific antibodies. The purified ne'), conditions under which treatment with 59R1 was inef DNA samples were hybridized to Affymetrix Genome-Wide fective against tumor growth (see Example 9, above). Thus, Human SNP Array 6.0 genechip (Affymetrix, Santa Clara, Calif.), which has more than 946,000 probes for the detection the effect of 59R1 on the down-regulation of angiopoietin-1 of copy number variations (CNVs), according to the manu and angiopoietin-2 in the stroma of the T1 tumor is abrogated facturers instructions. The copy number state changes were in the absence of estrogen treatment. One possible explana estimated by Hidden Markov Model (HMM) and their varia tion of this effect is that in the absence of estrogen treatment, tions (CNVs) of each sample were obtained by rank segmen the levels of the growth factors angiopoietin-1 and angiopoi tation analysis using Hapmap270 as baseline. Due to the etin-2 in the T1 stroma are not sufficiently elevated to provide inherent noise in the array, -0.5 and -1.0 log 2 ratios were for measurable decreases in expression levels upon treatment used as the cutoffs for the heterozygous deletion and homozy with the 59R1 antibody. Estrogen has been shown to have 25 gous deletion under the significance threshold <1.0x10 and significant effects on the tumor microenvironment (Banka et minimum number of probes per segment 5. al., 2006, Cancer Res.66:3667-3672). One possible explana FIG.13 shows the exon, Affymetrix probe distribution, and tion of this data is that estrogen leads to a dependence of the the deletions in the gene of the tumor suppressorphosphatase tumor on ANGPT2 signaling, which then leads to sensitivity tensin homolog (PTEN) in chromosome 10. The B29, B34, to 59R1 treatment. 30 B37, B40, B51, T2, T3, and T6 breast tumors were found to have intact PTEN genes in their genomes. The PTEN gene Example 11 was determined to harbor homozygous deletions in B39 tumor, while B44, PE13, and T1 tumors were determined to Anti-Notch2/3 Antibody 59R1 Significantly Induces have heterozygous deletions of this gene. As discussed above, Hypoxia in Colon and Breast Tumors 35 59R1 was determined to have anti-tumor efficacy in each of these four breast tumors comprising homozygous or het Staining for hypoxic regions was performed in Colo-205 erozygous deletions of PTEN. These results suggest that colon tumors and PE-13 breast tumors that had been treated tumors, especially breast tumors, harboring homozygous or either with 59R1 IgG2 antibody or with 1B711 control anti heterozygous PTEN deletions may be particularly suitable body. The staining was performed as described in Ridgway et 40 for treatment with an anti-Notch2/3 antibody such as 59R1. al., 2006, Nature 444: 1083-1087. Briefly, to measure Example 13 hypoxia, pimonidazole-hydrochloride (HypoxyProbe, NPI. Burlington, Mass.), which forms long-lived protein adducts Characterization of 59R5 Antibody at partial pressure of oxygen less than approximately 10 mm Hg, was injected intraperitoneally at 60 mg/kg 1 hr prior to 45 An additional human antibody 59R5 that specifically binds sacrifice. Tumors were then processed for histological analy human Notch 2 and human Notch 3 was identified. The sis, and tumor sections were stained using anti-pimonidazole sequences of the heavy chain and light chain are provided in antibody following manufacturer's protocol (NPI). Photo SEQID NO: 49 and SEQID NO:18, respectively. The heavy graphs were taken using a BX51 microscope (Olympus, Cen chain variable region is provided in SEQID NO:50 and the ter Valley, Pa.). 50 light chain variable region is provide SEQ ID NO:13. The Viable tumor cells were found to be equally present in heavy chain CDR3 sequence of 59R5 comprises SIFYTT, 1B711 and 59R1-treated tumors, as indicated by a relatively SEQID NO:51. The other CDR sequences of 59R5 are iden uniform and dense DAPI stain (data not shown). The number tical to 59R1. Biacore analysis of 59R1 and 59R5 binding of CD31-positive cells also remained unchanged, suggesting affinities indicated that 59R5 had similar binding properties that endothelial cell number was not affected by 59R1 treat 55 for both Notch2 and Notch3 as 59R1. Both antibodies bind ment. In 59R1-treated Colo-205 and PE13 tumors, however, human and murine Notch2 and Notch3 receptors with sub hypoxic regions (as detected by anti-pimonidazole antibody) nanomolar affinity (see Table 6). TABLE 6 IgG Dissociation Constants (KD, nM m-Notch1 h-Notch1 m-Notch2 h-Notch2 m-Notch3 h-Notch3 h-Notch4

59R1 >10 >10 O.65 O.OS O.32 O.19 NB 59R5 >10 >10 O.26 O.OS O.29 O.22 NB US 8,226,943 B2 83 84 59R5 was determined to have similar activity in blocking or control antibody. Antibodies were dosed at 15 mg/kg once Notch2 and Notch3 signaling as 59R1. Receptor activation per week in a “preventative' mode where dosing was initiated was determined in luciferase-based assays. PC3 tumor cells two days after cell injection. FIG.16B shows that both 59R1 were transiently transfected with a human or mouse Notch and 59R5 inhibited the growth of C28 colon tumors. receptor (human Notch2, murine Notch2, human Notch3, or murine Notch3) and GFP inducible reporter construct. Trans In another embodiment, NOD/SCID mice were injected fected cells were incubated with different concentrations of with Colo205 colon tumor cells. The mice were treated with 59R1 or 59R5 antibody in the presence of passively immobi anti-Notch2/3 antibody 59R1, anti-Notch2/3 antibody 59R5 lized DLL4-Fc protein. Notch receptor activation was deter or control antibody. Antibodies were dosed at 15 mg/kg once mined by measuring luciferase activity. As shown in FIG. 10 per week after tumors had been established. FIG.16C shows 15A, 59R5 blocked ligand-induced activation of human that both 59R1 and 59R5 inhibited the growth of Colo208 Notch2, murine Notch2, human Notch3 and murine Notch3 colon tumors at similar levels. receptor signaling at similar levels as 59R1. The binding epitope of 59R5 was determined. As was Example 15 described in Example3 for analysis of antibody 59R1, several 15 point mutants were created within full-length Notch1, con verting residues within EGF10 to the corresponding amino In Vivo Treatment of Tumors. Using Notch2/3 acids in human Notch 2. Mutants in full-length Notch Antibody 59R5 in Combination Treatment sequences were generated by QuikChange R mutagenesis (Stratagene) and verified by sequencing. HEK 293 cells were In one embodiment, NOD/SCID mice were injected with transiently transfected with expression vectors encoding PN8 pancreatic tumor cells. The tumors were allowed to grow human Notch2, human Notch1, or human Notch1 with resi for approximately 33 days until they had reached an average dues 382-386 mutated to the corresponding human Notch2 tumor volume of 150 mm. The mice were treated with gem residues. Cells were also co-transfected with a plasmid citabine at 20 mg/kg once per week for four weeks in com encoding green fluorescent protein (GFP) to mark those cells 25 that received transfected plasmid. Cells were incubated with bination with control antibody, anti-Notch2/3 antibody 59R1, 59R1 or 59R5 and fluorescent secondary antibody and then or anti-Notch2/3 antibody 59R5. As shown in FIG. 17A, examined by FACS. 59R1 and 59R5 were detected by PE antibody 59R5 inhibited tumor growth at a similar level as conjugated goat anti-human Fc gamma specific antibody antibody 59R1 and that combination treatment prolonged (Jackson Immunochemicals, #109-116-170). As shown in 30 tumor recurrence longer than gemcitabine alone. FIG. 15B, 59R5 bound to Notch2 and did not bind to Notch1. However, when amino acids corresponding to Notch2 amino In one embodiment, to evaluate the effect of 59R5 on acids 385-389 were substituted into Notch1,59R5 was able to cancer stem cells, a tumor recurrence study was carried out in bind to the mutated Notch1. This suggested that at least one or the PE13 breast tumor model. NOD/SCID mice were injected more amino acids necessary for 59R5 binding to human 35 with PE13 breast tumor cells. The tumors were allowed to Notch 2 were positioned within amino acids 385-389 (resi grow for 40 days before treatments were initiated. The mice dues in the boxed hNotch2 sequence shown in FIG. 14A) and were treated with taxol at 15 mg/kg twice per week for 5 suggested that 59R5 binds the same epitope as 59R1, or an weeks, in combination with either control antibody or anti epitope similar to, or overlapping with, the epitope of 59R1. Notch 2/3 antibody 59R5. After 5 weeks, the taxol treatments 40 were stopped and the antibody treatments were continued. Example 14 59R5 was observed to significantly delay tumor recurrence In Vivo Treatment of Tumors. Using Notch2/3 after high-dose taxol treatment (FIG. 17B). These results Antibody 59R5 suggest that 59R5 treatment reduces cancer stem cell fre 45 quency. In one embodiment, NOD/SCID mice were injected with A summary of the in vivo activity of 59R1 and 59R5 as PE13 breast tumor cells. The mice were treated with anti described in the preceding embodiments is shown in Table 7. Notch2/3 antibody 59R1, anti-Notch2/3 antibody 59R5, or Tumor Volumes and p values for each experiment are shown control antibody. Antibodies were dosed at 15 mg/kg once per relative to the control group. The PE13, C28 and Colo205 week in a “preventative” mode where dosing was initiated 50 two days after cell injection. FIG. 16A shows that 59R5 studies were carried out as described in Example 14. PN8 treatment inhibited tumor growth by greater than 80%, simi studies were carried out as described above. For the PN8 lar to the effects seen with 59R1. experiment, the control is gemcitabine alone and values for In another embodiment, NOD/SCID mice were injected 59R1 and 59R5 are the combinations with gemcitabine. Anti with C28 colon tumor cells. The mice were treated with bodies were dosed once per week at 15 mg/kg for all experi anti-Notch2/3 antibody 59R1, anti-Notch2/3 antibody 59R5 mentS. TABLE 7

PE13 C28

Tumor Tumor Colo205 PN8 vol p value vol p value Tumor vol p value Tumor vol p value 59R1 O2S retinoids All publications and patents mentioned in the above speci (RARRES1, RARRES3, RBP2), which are similar function fication are herein incorporated by reference. Various modi ally to the putative stem cell marker, ALDH1a1, were up fications and variations of the described method and system regulated by taxol, and then down-regulated with taxol plus of the invention will be apparent to those in the art without 59R1 treatment. Retinoic acid signaling has been shown to be departing from the scope and spirit of the invention. Although linked to cellular differentiation (Appel and Eisen, 2003, the invention has been described in connection with specific Neuron 40:461-4). Taken together, these data show that 59R1 10 has significant effects on gene expression in PE13 breast embodiments, it should be understood that the invention as tumor cells and may begin to elucidate Some of the mecha claimed should not be unduly limited to such specific nisms that underlie the observed decrease in cancer stem cell embodiments. Indeed, various modifications of the described frequency in this tumor following treatment with 59R1 and modes for carrying out the invention which are obvious to taxol combination therapy. 15 those in the relevant fields are intended to be within the scope In another embodiment, a PN4 pancreatic tumor model of the following claims. was used to test for reduction in cancer stem cell frequency Sequences after treatment with 59R1. PN4 pancreatic tumors were treated with control antibody, anti-Notch2/3 59R1, gemcit Human Anti-Notch2/3 Antibody Sequences abine, or a combination of 59R1 and gemcitabine for a period SEQID NO: 1: Nucleotide sequence encoding anti-Notch2/3 of three weeks. Antibodies were dosed at 10 mg/kg, twice per IgG259R1 heavy chain, plus signal sequence. The sequence week and gemcitabine was dosed at 50 mg/kg, twice per encoding the signal sequence is underlined. week. Tumors from each group were harvested and processed to obtain single cell Suspensions. The human tumors cells in the xenograft were isolated and counted. A titration of cells 25 ATGAAACACCTGTGGTTCTTCCTCCTGCTGGTGGCAGCTCCCAGATGGGT (30,90 or 210 cells) were re-injected into NOD-SCID mice (n=10 per group). Tumor growth was assayed on day 84 and CCTGTCCCAGGTGCAATTGGTGGAAAGCGGCGGCGGCCTGGTGCAACCGG tumor initiating cell frequency was calculated from the tumor take rate. The control antibody treated tumors were deter GCGGCAGCCTGCGTCTGAGCTGCGCGGCCTCCGGATTTACCTTTTCTTCT mined to have a tumor initiating cell frequency of 1:137. 30 TCTGGTATGTCTTGGGTGCGCCAAGCCCCTGGGAAGGGTCTCGAGTGGGT Treatment with gemcitabine alone increased the CSC fre quency to 1:61. In contrast, treatment with 59R1 decreased GAGCGTTATCGCTTCTTCTGGTAGCAATAC CTATTATGCGGATAGCGTGA CSC frequency to 1:281 and the combination of 59R1 plus AAGGCCGTTTTACCATTTCACGTGATAATTCGAAAAACACCCTGTATCTG gemcitabine decreased CSC frequency to 1:675 (FIG. 19C). A single asterisk indicates a statistically significant difference 35 CAAATGAACAGCCTGCGTGCGGAAGATACGGCCGTGTATTATTGCGCGCG (p<0.05) vs. the control antibody treated group and a double asterisk indicates a significant difference vs. the gemcitabine TGGTATTTTTTTTGCTATTTGGGGCCAAGGCACCCTGGTGACGGTTAGCT and control antibody treated group. CAGCCAGCACAAAGGGCCCTAGCGTCTTCCCTCTGGCTCCCTGCAGCAGG In another embodiment, a PE13 breast tumor model was AGCACCAGCGAGAGCACAGCCGCCCTGGGCTGCCTGGTCAAGGACTACTT used to test for reduction in cancer stem cell frequency after 40 treatment with 59R5. PE13 breast tumors were treated with CCCCGAACCGGTGACGGTGTCGTGGAACTCAGGCGCTCTGACCAGCGGCG control antibody, anti-Notch 2/3 59R5, taxol, or a combina tion of 59R5 and taxol for a period of three weeks. Antibodies TGCACACCTTCCCAGCTGTCCTACAGTCCTCAGGACTCTACTCCCTCAGC were dosed at 20 mg/kg, once per week and taxol was dosed AGCGTGGTGACCGTGCCCTCCAGCAACTTCGGCACCCAGACCTACACCTG at 15 mg/kg, twice per week. Tumors from each group were 45 harvested and processed to obtain single cell Suspensions. CAACGTAGAT CACAAGCCCAGCAACACCAAGGTGGACAAGACAGTTGAGC The human tumors cells in the Xenograft were isolated and counted. A titration of cells (50, 150 or 450 cells) were re GCAAATGTTGTGTCGAGTGCCCACCGTGCCCAGCACCACCTGTGGCAGGA injected into NOD-SCID mice (n=10 per group). Tumor CCGTCAGTCTTCCTCTTCCCCCCAAAACCCAAGGACACCCTCATGATCTC growth was assayed on day 39 and tumor initiating cell fre 50 quency was calculated from the tumor take rate. The control CCGGACCCCTGAGGTCACGTGCGTGGTGGTGGACGTGAGCCACGAAGACC antibody treated tumors were determined to have a tumor initiating cell frequency of 1:70. Treatment with taxol alone CCGAGGTCCAGTTCAACTGGTACGTGGACGGCGTGGAGGTGCATAATGCC increased the CSC frequency to 1:30. In contrast, treatment AAGACAAAGCCACGGGAGGAGCAGTTCAACAGCACGTTCCGTGTGGTCAG with 59R5 decreased CSC frequency to 1:202 and the com 55 bination of 59R5 plus taxol decreased CSC frequency to CGTCCT CACCGTTGTGCACCAGGACTGGCTGAACGGCAAGGAGTACAAGT 1:382 (FIG. 19D). A single asterisk indicates a statistically GCAAGGTCTCCAACAAAGGCCTCCCAGCCCCCATCGAGAAAACCATCTCC significant difference (p<0.05) vs. the control antibody treated group and a double asterisk indicates a significant AAAACCAAAGGGCAGCCCCGAGAACCACAGGTGTACACCCTGCCCCCATC difference vs. the taxol and control antibody treated group. 60 As observed in other experiments, these results indicated CCGGGAGGAGATGACCAAGAACCAGGTCAGCCTGACCTGCCTGGTCAAAG that 59R1 treatment of PN4 pancreatic tumors and 59R5 GCTTCTACCCCAGCGACATCGCCGTGGAGTGGGAGAGCAATGGGCAGCCG treatment of PE13 breast tumors reduced CSC frequency as a single agent and more dramatically, in combination with GAGAACAACTACAAGACCACACCTCCCATGCTGGACTCCGACGGCTCCTT gemcitabine or taxol treatment, respectively. In contrast, 65 CTTCCTCTACAGCAAGCTCACCGTGGACAAGAGCAGGTGGCAGCAGGGGA treatment with taxol or gemcitabine alone, while effective at reducing tumor Volume, increased the CSC frequency of