Changes in Contractile Protein Expression Are Linked to Ventricular Stiffness in Infants with Pulmonary Hypertension Or Right Ve
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P. -
Gene Symbol Gene Description ACVR1B Activin a Receptor, Type IB
Table S1. Kinase clones included in human kinase cDNA library for yeast two-hybrid screening Gene Symbol Gene Description ACVR1B activin A receptor, type IB ADCK2 aarF domain containing kinase 2 ADCK4 aarF domain containing kinase 4 AGK multiple substrate lipid kinase;MULK AK1 adenylate kinase 1 AK3 adenylate kinase 3 like 1 AK3L1 adenylate kinase 3 ALDH18A1 aldehyde dehydrogenase 18 family, member A1;ALDH18A1 ALK anaplastic lymphoma kinase (Ki-1) ALPK1 alpha-kinase 1 ALPK2 alpha-kinase 2 AMHR2 anti-Mullerian hormone receptor, type II ARAF v-raf murine sarcoma 3611 viral oncogene homolog 1 ARSG arylsulfatase G;ARSG AURKB aurora kinase B AURKC aurora kinase C BCKDK branched chain alpha-ketoacid dehydrogenase kinase BMPR1A bone morphogenetic protein receptor, type IA BMPR2 bone morphogenetic protein receptor, type II (serine/threonine kinase) BRAF v-raf murine sarcoma viral oncogene homolog B1 BRD3 bromodomain containing 3 BRD4 bromodomain containing 4 BTK Bruton agammaglobulinemia tyrosine kinase BUB1 BUB1 budding uninhibited by benzimidazoles 1 homolog (yeast) BUB1B BUB1 budding uninhibited by benzimidazoles 1 homolog beta (yeast) C9orf98 chromosome 9 open reading frame 98;C9orf98 CABC1 chaperone, ABC1 activity of bc1 complex like (S. pombe) CALM1 calmodulin 1 (phosphorylase kinase, delta) CALM2 calmodulin 2 (phosphorylase kinase, delta) CALM3 calmodulin 3 (phosphorylase kinase, delta) CAMK1 calcium/calmodulin-dependent protein kinase I CAMK2A calcium/calmodulin-dependent protein kinase (CaM kinase) II alpha CAMK2B calcium/calmodulin-dependent -
The Role of Z-Disc Proteins in Myopathy and Cardiomyopathy
International Journal of Molecular Sciences Review The Role of Z-disc Proteins in Myopathy and Cardiomyopathy Kirsty Wadmore 1,†, Amar J. Azad 1,† and Katja Gehmlich 1,2,* 1 Institute of Cardiovascular Sciences, College of Medical and Dental Sciences, University of Birmingham, Birmingham B15 2TT, UK; [email protected] (K.W.); [email protected] (A.J.A.) 2 Division of Cardiovascular Medicine, Radcliffe Department of Medicine and British Heart Foundation Centre of Research Excellence Oxford, University of Oxford, Oxford OX3 9DU, UK * Correspondence: [email protected]; Tel.: +44-121-414-8259 † These authors contributed equally. Abstract: The Z-disc acts as a protein-rich structure to tether thin filament in the contractile units, the sarcomeres, of striated muscle cells. Proteins found in the Z-disc are integral for maintaining the architecture of the sarcomere. They also enable it to function as a (bio-mechanical) signalling hub. Numerous proteins interact in the Z-disc to facilitate force transduction and intracellular signalling in both cardiac and skeletal muscle. This review will focus on six key Z-disc proteins: α-actinin 2, filamin C, myopalladin, myotilin, telethonin and Z-disc alternatively spliced PDZ-motif (ZASP), which have all been linked to myopathies and cardiomyopathies. We will summarise pathogenic variants identified in the six genes coding for these proteins and look at their involvement in myopathy and cardiomyopathy. Listing the Minor Allele Frequency (MAF) of these variants in the Genome Aggregation Database (GnomAD) version 3.1 will help to critically re-evaluate pathogenicity based on variant frequency in normal population cohorts. -
UNIVERSITY of CALIFORNIA, SAN DIEGO Functional Analysis of Sall4
UNIVERSITY OF CALIFORNIA, SAN DIEGO Functional analysis of Sall4 in modulating embryonic stem cell fate A dissertation submitted in partial satisfaction of the requirements for the degree Doctor of Philosophy in Molecular Pathology by Pei Jen A. Lee Committee in charge: Professor Steven Briggs, Chair Professor Geoff Rosenfeld, Co-Chair Professor Alexander Hoffmann Professor Randall Johnson Professor Mark Mercola 2009 Copyright Pei Jen A. Lee, 2009 All rights reserved. The dissertation of Pei Jen A. Lee is approved, and it is acceptable in quality and form for publication on microfilm and electronically: ______________________________________________________________ ______________________________________________________________ ______________________________________________________________ ______________________________________________________________ Co-Chair ______________________________________________________________ Chair University of California, San Diego 2009 iii Dedicated to my parents, my brother ,and my husband for their love and support iv Table of Contents Signature Page……………………………………………………………………….…iii Dedication…...…………………………………………………………………………..iv Table of Contents……………………………………………………………………….v List of Figures…………………………………………………………………………...vi List of Tables………………………………………………….………………………...ix Curriculum vitae…………………………………………………………………………x Acknowledgement………………………………………………….……….……..…...xi Abstract………………………………………………………………..…………….....xiii Chapter 1 Introduction ..…………………………………………………………………………….1 Chapter 2 Materials and Methods……………………………………………………………..…12 -
Study for Pathogenesis of Congenital Cholesteatoma with Comparison of Proteins Expressed in Congenital Cholesteatoma, Acquired C
Study for pathogenesis of congenital cholesteatoma with comparison of proteins expressed in congenital cholesteatoma, acquired cholesteatoma and skin of the external auditory canal through proteomics Seung Ho Shin Department of Medicine The Graduate School, Yonsei University Study for pathogenesis of congenital cholesteatoma with comparison of proteins expressed in congenital cholesteatoma, acquired cholesteatoma and skin of the external auditory canal through proteomics Directed by Professor Jae Young Choi The Doctoral Dissertation submitted to the Department of Medicine, the Graduate School of Yonsei University in partial fulfillment of the requirements for the degree of Doctor of Philosophy Seung Ho Shin June 2014 ACKNOWLEDGEMENTS In the initial period of my fellowship, I wrote a book, Temporal Bone Dissection Manual as a coauthor with Professor Won Sang Lee, Ho-Ki Lee and Jae Young Choi. Through this book, I learned about much knowledge from them. Professor Jae Young Choi advised me to go for a Ph.D. I admitted graduate school for a Ph.D. in 2007. In my doctoral course, he has instructed me in detail on the basic research. He has demonstrated precise and delicate laboratory techniques and showed outstanding ability to create new ideas. Also, he has often said to me that a researcher must be honest to his colleagues and even to himself. After the summer of 2013, he gave me an idea for this paper, which was for congenital cholesteatoma analysis with proteomics. He always displayed endless energy and enthusiasm for scientific experiments even after many demanding surgeries. His passion motivated me to follow suit and seven months of our work at last bore fruit. -
A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated. -
Protein Identities in Evs Isolated from U87-MG GBM Cells As Determined by NG LC-MS/MS
Protein identities in EVs isolated from U87-MG GBM cells as determined by NG LC-MS/MS. No. Accession Description Σ Coverage Σ# Proteins Σ# Unique Peptides Σ# Peptides Σ# PSMs # AAs MW [kDa] calc. pI 1 A8MS94 Putative golgin subfamily A member 2-like protein 5 OS=Homo sapiens PE=5 SV=2 - [GG2L5_HUMAN] 100 1 1 7 88 110 12,03704523 5,681152344 2 P60660 Myosin light polypeptide 6 OS=Homo sapiens GN=MYL6 PE=1 SV=2 - [MYL6_HUMAN] 100 3 5 17 173 151 16,91913397 4,652832031 3 Q6ZYL4 General transcription factor IIH subunit 5 OS=Homo sapiens GN=GTF2H5 PE=1 SV=1 - [TF2H5_HUMAN] 98,59 1 1 4 13 71 8,048185945 4,652832031 4 P60709 Actin, cytoplasmic 1 OS=Homo sapiens GN=ACTB PE=1 SV=1 - [ACTB_HUMAN] 97,6 5 5 35 917 375 41,70973209 5,478027344 5 P13489 Ribonuclease inhibitor OS=Homo sapiens GN=RNH1 PE=1 SV=2 - [RINI_HUMAN] 96,75 1 12 37 173 461 49,94108966 4,817871094 6 P09382 Galectin-1 OS=Homo sapiens GN=LGALS1 PE=1 SV=2 - [LEG1_HUMAN] 96,3 1 7 14 283 135 14,70620005 5,503417969 7 P60174 Triosephosphate isomerase OS=Homo sapiens GN=TPI1 PE=1 SV=3 - [TPIS_HUMAN] 95,1 3 16 25 375 286 30,77169764 5,922363281 8 P04406 Glyceraldehyde-3-phosphate dehydrogenase OS=Homo sapiens GN=GAPDH PE=1 SV=3 - [G3P_HUMAN] 94,63 2 13 31 509 335 36,03039959 8,455566406 9 Q15185 Prostaglandin E synthase 3 OS=Homo sapiens GN=PTGES3 PE=1 SV=1 - [TEBP_HUMAN] 93,13 1 5 12 74 160 18,68541938 4,538574219 10 P09417 Dihydropteridine reductase OS=Homo sapiens GN=QDPR PE=1 SV=2 - [DHPR_HUMAN] 93,03 1 1 17 69 244 25,77302971 7,371582031 11 P01911 HLA class II histocompatibility antigen, -
4-6 Weeks Old Female C57BL/6 Mice Obtained from Jackson Labs Were Used for Cell Isolation
Methods Mice: 4-6 weeks old female C57BL/6 mice obtained from Jackson labs were used for cell isolation. Female Foxp3-IRES-GFP reporter mice (1), backcrossed to B6/C57 background for 10 generations, were used for the isolation of naïve CD4 and naïve CD8 cells for the RNAseq experiments. The mice were housed in pathogen-free animal facility in the La Jolla Institute for Allergy and Immunology and were used according to protocols approved by the Institutional Animal Care and use Committee. Preparation of cells: Subsets of thymocytes were isolated by cell sorting as previously described (2), after cell surface staining using CD4 (GK1.5), CD8 (53-6.7), CD3ε (145- 2C11), CD24 (M1/69) (all from Biolegend). DP cells: CD4+CD8 int/hi; CD4 SP cells: CD4CD3 hi, CD24 int/lo; CD8 SP cells: CD8 int/hi CD4 CD3 hi, CD24 int/lo (Fig S2). Peripheral subsets were isolated after pooling spleen and lymph nodes. T cells were enriched by negative isolation using Dynabeads (Dynabeads untouched mouse T cells, 11413D, Invitrogen). After surface staining for CD4 (GK1.5), CD8 (53-6.7), CD62L (MEL-14), CD25 (PC61) and CD44 (IM7), naïve CD4+CD62L hiCD25-CD44lo and naïve CD8+CD62L hiCD25-CD44lo were obtained by sorting (BD FACS Aria). Additionally, for the RNAseq experiments, CD4 and CD8 naïve cells were isolated by sorting T cells from the Foxp3- IRES-GFP mice: CD4+CD62LhiCD25–CD44lo GFP(FOXP3)– and CD8+CD62LhiCD25– CD44lo GFP(FOXP3)– (antibodies were from Biolegend). In some cases, naïve CD4 cells were cultured in vitro under Th1 or Th2 polarizing conditions (3, 4). -
Identification of the Key Micrornas and Mirna- Mrna Interaction Networks During the Ovarian Development of Hens
Article Identification of the Key microRNAs and miRNA- mRNA Interaction Networks During the Ovarian Development of Hens Jing Li †, Chong Li †, Qi Li, Wen-Ting Li, Hong Li, Guo-Xi Li, Xiang-Tao Kang, Xiao-Jun Liu and Ya-Dong Tian * College of Animal Science and Technology, Henan Agricultural University, Zhengzhou 450046, China; [email protected] (J.L.); [email protected] (C.L.); [email protected] (Q.L.); [email protected] (W.-T.L.); [email protected] (H.L.); [email protected] (G.-X.L.); [email protected] (X.-T.K.); [email protected] (X.-J.L.) * Correspondence: [email protected] † These two authors contributed equally to this work. Received: 27 July 2020; Accepted: 15 September 2020; Published: date Supplementary Material Animals 2020, 10, x; doi: www.mdpi.com/journal/animals Animals 2020, 10, x 2 of 24 Table 1. The list of the interaction network, the expression levels and Pearson’s correlation coefficient of DE miRNAs and DE mRNAs. Expression Level ( TPM) Expression Level ( FPKM) sRNA Transcript Id Gene Id Gene Name Correlatio 15W 20W 30W 68W 15W 20W 30W 68W gga-miR-1560-3p 3.253 6.030 4.295 2.565 ENSGALT00000087050 ENSGALG00000005902 RAB7A 17.832 0.031 6.674 0.077 -0.324 gga-miR-143-3p 25118.987 49390.256 87681.664 32277.275 ENSGALT00000069072 ENSGALG00000041760 CLTCL1 2.189 0.000 1.321 1.252 -0.268 gga-miR-7472-5p 0.054 0.264 0.466 0.000 ENSGALT00000066785 ENSGALG00000014582 CADM1 6.810 2.342 0.000 0.000 -0.394 gga-miR-7472-5p 0.054 0.264 0.466 0.000 ENSGALT00000033172 ENSGALG00000008121 CYP17A1 722.987 -
Spatiotemporal Single-Cell Analysis Reveals Critical Roles of Mechano-Sensing Genes at the Border Zone in Remodeling After Myocardial Infarction
Spatiotemporal single-cell analysis reveals critical roles of mechano-sensing genes at the border zone in remodeling after myocardial infarction Shintaro Yamada Tokyo University https://orcid.org/0000-0002-3240-358X Toshiyuki Ko The University of Tokyo Satoshi Hatsuse The University of Tokyo Seitaro Nomura The University of Tokyo Bo Zhang The University of Tokyo Zhehao Dai The University of Tokyo https://orcid.org/0000-0002-0363-7563 Shunsuke Inoue The University of Tokyo Masayuki Kubota The University of Tokyo Kosuke Sawami The University of Tokyo Takanobu Yamada The University of Tokyo Tatsuro Sassa The University of Tokyo Mikako Katagiri The University of Tokyo Kanna Fujita The University of Tokyo Manami Katoh The University of Tokyo Masamichi Ito The University of Tokyo Mutsuo Harada Page 1/21 The University of Tokyo Haruhiro Toko The University of Tokyo Norifumi Takeda The University of Tokyo https://orcid.org/0000-0003-4818-3347 Hiroyuki Morita The University of Tokyo Hiroyuki Aburatani The University of Tokyo Issei Komuro ( [email protected] ) The University of Tokyo Graduate School of Medicine Article Keywords: spatiotemporal single-cell analysis, myocardial infarction, left ventricular remodeling. Posted Date: June 22nd, 2021 DOI: https://doi.org/10.21203/rs.3.rs-620498/v1 License: This work is licensed under a Creative Commons Attribution 4.0 International License. Read Full License Page 2/21 Abstract The left ventricular remodeling after myocardial infarction (MI) causes heart failure, but its underlying mechanisms remain largely unknown. Here, we performed an integrative analysis of spatial transcriptomics and single cell RNA-seq in murine MI model and found that mechanical stress-response genes are expressed at the border zone and play a critical role in left ventricular remodeling after MI. -
1 Silencing Branched-Chain Ketoacid Dehydrogenase Or
bioRxiv preprint doi: https://doi.org/10.1101/2020.02.21.960153; this version posted February 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Silencing branched-chain ketoacid dehydrogenase or treatment with branched-chain ketoacids ex vivo inhibits muscle insulin signaling Running title: BCKAs impair insulin signaling Dipsikha Biswas1, PhD, Khoi T. Dao1, BSc, Angella Mercer1, BSc, Andrew Cowie1 , BSc, Luke Duffley1, BSc, Yassine El Hiani2, PhD, Petra C. Kienesberger1, PhD, Thomas Pulinilkunnil1†, PhD 1Department of Biochemistry and Molecular Biology, Dalhousie Medicine New Brunswick, Saint John, New Brunswick, Canada, 2Department of Physiology and Biophysics, Dalhousie University, Halifax, Nova Scotia, Canada. †Correspondence to Thomas Pulinilkunnil, PhD Department of Biochemistry and Molecular Biology, Faculty of Medicine, Dalhousie University Dalhousie Medicine New Brunswick, 100 Tucker Park Road, Saint John E2L4L5, New Brunswick, Canada. Telephone: (506) 636-6973; Fax: (506) 636-6001; email: [email protected]. 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.02.21.960153; this version posted February 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International -
Expression Profiling of Ion Channel Genes Predicts Clinical Outcome in Breast Cancer
UCSF UC San Francisco Previously Published Works Title Expression profiling of ion channel genes predicts clinical outcome in breast cancer Permalink https://escholarship.org/uc/item/1zq9j4nw Journal Molecular Cancer, 12(1) ISSN 1476-4598 Authors Ko, Jae-Hong Ko, Eun A Gu, Wanjun et al. Publication Date 2013-09-22 DOI http://dx.doi.org/10.1186/1476-4598-12-106 Peer reviewed eScholarship.org Powered by the California Digital Library University of California Ko et al. Molecular Cancer 2013, 12:106 http://www.molecular-cancer.com/content/12/1/106 RESEARCH Open Access Expression profiling of ion channel genes predicts clinical outcome in breast cancer Jae-Hong Ko1, Eun A Ko2, Wanjun Gu3, Inja Lim1, Hyoweon Bang1* and Tong Zhou4,5* Abstract Background: Ion channels play a critical role in a wide variety of biological processes, including the development of human cancer. However, the overall impact of ion channels on tumorigenicity in breast cancer remains controversial. Methods: We conduct microarray meta-analysis on 280 ion channel genes. We identify candidate ion channels that are implicated in breast cancer based on gene expression profiling. We test the relationship between the expression of ion channel genes and p53 mutation status, ER status, and histological tumor grade in the discovery cohort. A molecular signature consisting of ion channel genes (IC30) is identified by Spearman’s rank correlation test conducted between tumor grade and gene expression. A risk scoring system is developed based on IC30. We test the prognostic power of IC30 in the discovery and seven validation cohorts by both Cox proportional hazard regression and log-rank test.