Research Collection
Doctoral Thesis
Functionality of the FB_MR5 fire blight resistance gene of Malus x robusta 5
Author(s): Kost, Thomas D.
Publication Date: 2016
Permanent Link: https://doi.org/10.3929/ethz-a-010656323
Rights / License: In Copyright - Non-Commercial Use Permitted
This page was generated automatically upon download from the ETH Zurich Research Collection. For more information please consult the Terms of use.
ETH Library DISS. ETH NO. 23355
FUNCTIONALITY OF THE FB_MR5 FIRE BLIGHT RESISTANCE GENE OF Malus ×robusta 5
A thesis submitted to attain the degree of
DOCTOR OF SCIENCES of ETH ZURICH
(Dr. sc. ETH Zurich)
presented by
THOMAS DOMINIQUE KOST
MSc in Biology, University of Zurich (UZH)
born on 31.03.1987
citizen of Wädenswil (ZH)
accepted on the recommendation of
Prof. Dr. Bruce A. McDonald, examiner
Dr. Giovanni A. L. Broggini, co-examiner
Dr. ir. Henk J. Schouten, co-examiner
2016
The Rose Family
The rose is a rose, And was always a rose. But now the theory goes That the apple's a rose, And the pear is, and so's The plum, I suppose. The dear only knows What will next prove a rose. You, of course, are a rose-- But were always a rose.
Robert Frost (1874-1963) Abstract
Abstract Fire blight is a disease triggered by the bacterium Ewinia amylovora that threatens global apple and pear production. The number of effective approaches to manage fire blight is limited, and useful strategies against this disease consist mainly of eradication of the complete orchard (or heavy pruning), treatment with biocontrol agents, application of copper or aluminium sulphate containing chemicals or the use of antibiotics. A more environmentally friendly approach is the use of fire blight resistant cultivars, but albeit such cultivars exist, the consumers and producers prefer popular fire blight susceptible cultivars that meet their expectations in terms of fruit quality and agronomic properties. The breeding for fire blight resistant cultivars is one of the major apple breeding goals in Switzerland, but crossing always results in novel varieties that must succeed in outcompeting well-established susceptible cultivars. Biotechnology could circumvent this problem, amending susceptible established cultivars with resistance genes without affecting other cultivar properties. Such an approach, where only apple genes controlled by their respective native regulatory sequences are present in the final product, is defined as the cisgenic approach. Recently, the identification of a candidate resistance gene (FB_MR5) responsible for the fire blight resistance of the wild apple accession Malus ×robusta 5 was reported, but no confirmation of the functionality of this gene had previously been performed, whereas transgenic lines carrying FB_MR5 had been generated from the fire blight susceptible cultivar 'Gala Galaxy'.
In a first experiment the previously developed transgenic lines containing FB_MR5 were tested for their level of fire blight resistance in the greenhouse (chapter 1). It was shown that integration of FB_MR5 leads to fire blight resistance in the usually highly fire blight susceptible cultivar 'Gala Galaxy'. Moreover the functionality of FB_MR5 was confirmed under a strong promotor and terminator as well as under its native regulatory elements (as present in the original wild apple), indicating that it is a promising resistance gene (a so-called “cisgene”) and could therefore be used to develop a cisgenic apple line. Further inoculations performed by our partners at the Julius-Kühn Institute in Germany revealed that a mutant strain of E. amylovora, that carries a deletion of a sequence coding for an effector protein, bypasses the recognition by FB_MR5. FB_MR5 is the first cloned fire blight resistance gene and the investigated transgenic lines represent an ideal tool to investigate the resistance response triggered by FB_MR5.
This first finding formed the fundament for two further aims of this thesis: i) the development of fire blight resistant apple lines that could match the definition of “cisgenic” (chapter 2) and ii) to get insights into the FB_MR5-mediated transcriptional defense response after contact with E. amylovora (chapter 3).
Four cisgenic lines were generated by transforming the fire blight susceptible cultivar 'Gala Galaxy' with FB_MR5 controlled by its native regulatory sequences using Agrobacterium tumefaciens. Two different vectors were used in order to obtain genotypes free of any apple foreign genes, whose use as selectable marker is unavoidable to achieve efficient transformation in apple. After transformation, these vectors allowed the removal of the unwanted apple foreign genes. The four cisgenic lines resulted as being significantly more fire blight resistant than the untransformed genotype 'Gala Galaxy', and symptoms were reduced in average from 85.3 % percentage lesion length (in 'Gala Galaxy') to 13.4 % (in the four cisgenic lines) percentage lesion length. One of those lines, line C44.4.146, was further characterized and showed a single gene insertion of the FB_MR5 resistance gene in chromosome 16. In C44.4.146 a similar FB_MR5 transcription level as in conventionally bred accessions i Abstract and no significant deviation from conventional cultivars were found considering several investigated morphological traits (annex to chapter 2). Line C44.4.146 will possibly be investigated in a field trial. A cisgenic line with enhanced durability was attempted to be developed by pyramiding FB_MR5 into the fire blight robust variety 'Ladina', although no cisgenic lines could be regenerated so far.
Eventually the lines used to confirm the functionality of FB_MR5 were used to investigate the transcriptional defense response triggered by the FB_MR5 specific recognition of the pathogen. Normally the comparison of fire blight resistant (FB_MR5) genotypes with susceptible cultivars is hampered by the heterozygosity of apple. In this thesis the transcriptome of a transgenic, fire blight resistant 'Gala Galaxy' line (amended with FB_MR5) and a line of the susceptible untransformed 'Gala Galaxy' wild-type were compared. To understand if and how FB_MR5 modulates the 'Gala Galaxy' transcriptome after contact with E. amylovora, an RNASeq-based approach on three biological replicates, 24 hours post fire blight inoculation by scissors was performed and differentially expressed transcripts were identified. In this comparison 206 transcripts were differentially expressed. More transcripts related to photosynthesis and secondary metabolites were observed in the susceptible plants than in the resistant ones. In resistant plants transcripts involved in protein modification, transport, cell-wall synthesis and biotic stress were more abundant. Despite application of three biological replicates and a very similar genetic background, no clear transcriptional response related to known defense response was observed. It is probable that the FB_MR5-dependent reaction is not only of transcriptional nature, and further investigations are needed to understand whether the reaction involves post-translational modification of already existing proteins.
ii Zusammenfassung
Zusammenfassung Feuerbrand ist eine bakterielle Krankheit welche durch das Bakterium Erwinia amylovora ausgelöst wird und weltweit die Apfel und Birnen Produktion gefährdet. Die Anzahl an effektiven Bekämpfungsstrategien um Feuerbrand zu bewältigen ist limitiert. Hilfreiche Strategien basieren hauptsächlich auf dem Zurückschneiden ganzer Obstanlagen, Behandlungen mit biologischen Kontrollorganismen, oder Chemikalien welche Kupfer oder Aluminium Sulfat enthalten oder Antibiotika. Eine umweltfreundlichere Methode ist die Verwendung von Feuerbrand resistenten Sorten. Obschon solche Sorten existieren, bevorzugen die Konsumenten und Produzenten die bekannten, Feuerbrand anfälligen Sorten, aufgrund ihrer Fruchtqualität und agronomischen Eigenschaften. Die Züchtung feuerbrandrobuster Sorten ist eines der Hauptziele der Apfelzüchtung in der Schweiz, aber bei einer Kreuzung entstehen jedes Mal neue Sorten, welche sich zuerst erfolgreich gegen die bereits etablierten Sorten durchsetzen müssen. Die Biotechnologie könnte dieses Problem umgehen, da sich damit sehr anfällige Sorten mit Resistenzgenen verbessern lassen, ohne weitere Sorteneigenschaften zu beeinflussen. Ein solcher Ansatz, bei dem im Endprodukt nur Apfel-Gene, unter Kontrolle ihrer entsprechenden, natürlichen regulatorischen Sequenzen vorhanden sind, wird als cisgener Ansatz bezeichnet. Kürzlich wurde von einem Kandidat Resistenzgen (FB_MR5) berichtet, welches für die Feuerbrand Resistenz des Wildapfels Malus ×robusta 5 verantwortlich sei. Obgleich bereits transgene Linien aus der Feuerbrand anfälligen Sorte 'Gala Galaxy', welche FB_MR5 tragen, erschaffen wurden, konnte bisher nicht nachgewiesen werden ob dieses Gen auch funktioniert.
In einem ersten Experiment wurden die zuvor entwickelten, transgenen, FB_MR5 tragenden Linien im Gewächshaus auf ihre Feuerbrandresistenz getestet (Kapitel 1). Es konnte gezeigt werden, dass das Einführen von FB_MR5, in der sonst hoch Feuerbrand anfälligen Sorte 'Gala Galaxy' zu Feuerbrandresistenz führt. Zudem wurde gezeigt, dass FB_MR5 ein vielversprechendes Resistenzgen (ein sogenanntes „Cisgen“) ist, da es nebst Kontrolle durch einen starken Promotor auch unter Kontrolle durch seine natürlichen regulatorischen Elemente zu Feuerbrandresistenz führt. Folglich könnte dieses Gen verwendet werden um eine cisgene Apfelline zu entwickeln. Bei weiteren Experimenten, welche von unseren Partnern am Julius-Kühn Institut in Deutschland durchgeführt wurden, wurden Bakterienstämme identifiziert, welche eine Punktmutation aufwiesen und dadurch eine Erkennung durch FB_MR5 umgehen konnten. Abgesehen von dieser Tatsache ist FB_MR5 das erste klonierte Feuerbrandresistenzgen und die untersuchten transgenen Linien sind ein ideales Werkzeug um die Resistenz Reaktion, welche durch FB_MR5 ausgelöst wird, zu untersuchen.
Diese erste Erkenntnis bildet das Fundament für zwei weitere Ziele dieser Doktorarbeit: i) Die Entwicklung Feuerbrand resistenter Apfel Linien, welche der Definition von „cisgen“ entsprechen (Kapitel 2) und ii) Einsicht zu gewinnen in die, durch FB_MR5 ausgelöste transkriptionelle Verteidigungs Reaktion nach Kontakt mit E. amylovora (Kapitel 3).
Mittels Agrobacterium tumefaciens vermittelter Transformation konnten vier cisgene Linien generiert werden, welche FB_MR5 unter Kontrolle seiner natürlichen regulatorischen Elemente enthalten. Dazu wurden zwei unterschiedliche Vektoren verwendet, welche dazu dienten 'Gala Galaxy' Genotypen zu erstellen, welche letztendlich frei von Fremdgenen sind. Fremdgene sind für die effiziente Transformation im Apfel unvermeidlich. Die vier cisgenen Linien zeigten signifikant höhere Feuerbrand Resistenz im Vergleich zum untransformierten 'Gala Galaxy' Genotypen. Die durchschnittlichen Krankheitssymptome reduzierten sich von 85.3 % prozentueller Lesionslänge (in 'Gala Galaxy') auf 13.4 % prozentueller Lesionslänge (in den vier cisgenen Linien). Eine dieser Linien, Linie C44.4.146, wurde genauer untersucht und wies eine einzelne Insertion des Resistenzgenes FB_MR5 in ihrem Erbgut im iii Zusammenfassung
Chromosom 16 auf. Die Transkription des Resistenzgens in C44.4.146 war ähnlich zu derjenigen in konventionell gezüchteten Linien. Zudem wurden in mehreren untersuchten morphologischen Eigenschaften keine signifikanten Abweichungen zu konventionellen Sorten festgestellt (Anhang von Kapitel 2). Die Linie C44.4.146 wird vermutlich in einem Freilandversuch genauer untersucht werden. Es wurde versucht eine cisgene Linie mit verbesserter Beständigkeit zu entwickeln, indem FB_MR5 in die Feuerbrand robuste Sorte 'Ladina' eingebaut wurde. Mit diesem Ansatz konnte bisher keine cisgene Linie regeneriert werden.
Letztendlich wurden die Linien, welche zur Bestimmung der Funktionalität von FB_MR5 dienten verwendet um die, spezifisch durch Pathogen-Erkennung mittels FB_MR5 ausgelöste, transkriptionelle Verteidigungs Reaktion zu untersuchen. Normalerweise wird der Vergleich von Feuerbrand resistenten (FB_MR5) Genotypen mit anfälligen Sorten durch die Heterozygosität des Apfels behindert. In dieser Arbeit wurde das, mit FB_MR5 ergänzte Transkriptome einer transgenen, Feuerbrand resistenten 'Gala Galaxy' Linie mit demjenigen einer anfälligen untransformierten 'Gala Galaxy' wildtyp-Linie verglichen. Um zu verstehen ob und wie FB_MR5 das 'Gala Galaxy' Transkriptom nach Kontakt mit E. amylovora verändert, wurde 24 Stunden nach Inokulation mit E. amylovora ein RNASeq basierter Ansatz mit drei biologischen Wiederholungen durchgeführt. In diesem Vergleich wurden 206 Transkripte gefunden, die sich unterschieden. In den Feuerbrand anfälligen Pflanzen wurden mehr Transkripte welche in Zusammenhang mit Photosynthese oder sekundärem Metabolismus standen nachgewiesen als in den resistenten Pflanzen. In den Feuerbrand resistenten Pflanzen waren Transkripte welche in Zusammenhang mit Protein-Modifikation, Transport, Zell-Wand-Aufbau und biotischem Stress standen häufiger vertreten. Trotz der Verwendung dreier biologischen Wiederholungen und eines sehr ähnlichen genetischen Hintergrundes konnte keine klare transkriptionelle Antwort in Zusammenhang mit bekannten Verteidigungs Reaktionen beobachtet werden. Es ist wahrscheinlich dass die FB_MR5 abhängige Reaktion nicht nur durch Transkription reguliert wird und weitere Forschung ist notwendig um herauszufinden ob diese Reaktion posttranslationale Veränderungen von bereits vorhandenen Proteinen beinhaltet.
iv Table of contents
Table of Contents Abstract ...... i Zusammenfassung ...... iii General Introduction ...... - 1 - The host Malus × domestica...... - 2 - History of the domesticated apple ...... - 2 - Economic importance of apple ...... - 2 - Genetic Background ...... - 2 - Apple attributes and conventional breeding ...... - 3 - Important diseases in apple ...... - 3 - Fire blight ...... - 4 - Biology of Erwinia amylovora ...... - 4 - Host range ...... - 6 - Historical review of disease distribution ...... - 6 - Economic importance of fire blight ...... - 7 - Disease management strategies ...... - 7 - Resistance breeding and fire blight resistant apples ...... - 8 - The cisgene FB_MR5 ...... - 9 - Defense response in plants ...... - 10 - R-gene mediated defense and models ...... - 10 - Investigation of transcriptional changes induced by FB_MR5 recognition of Ea by NGS...... - 11 - The cisgenic approach with FB_MR5 ...... - 12 - Aims of this thesis ...... - 13 - References ...... - 14 - Chapter 1) Proof of functionality of FB_MR5 ...... - 22 - Abstract ...... - 23 - Introduction ...... - 24 - Experimental Procedures ...... - 26 - Artificial fire blight inoculation / Measures to avoid bias ...... - 26 - Statistical analysis ...... - 27 - Results ...... - 28 - Discussion ...... - 32 - Conclusion ...... - 34 - Acknowledgment ...... - 35 - References ...... - 36 - Supplementary Material ...... - 38 -
v Table of contents
Chapter 2) Development of the first cisgenic apple with increased resistance to fire blight ...... - 50 - Abstract ...... - 51 - Introduction ...... - 52 - Results ...... - 54 - Generation of the cisgenic line C44.4.146...... - 54 - Copy number of C44.4.146 ...... - 58 - Integration site of C44.4.146 ...... - 59 - Transcription level of FB_MR5 ...... - 60 - Fire blight resistance of the cisgenic line C44.4.146 ...... - 61 - Discussion ...... - 64 - Experimental procedures ...... - 66 - Generation of the cisgenic line C44.4.146...... - 66 - Fire blight resistance test of the cisgenic line C44.4.146 ...... - 67 - Copy number of C44.4.146 ...... - 68 - Integration site of C44.4.146 ...... - 68 - Transcription level of FB_MR5 ...... - 68 - Statistical analysis ...... - 69 - Acknowledgements ...... - 70 - References ...... - 71 - Supporting Information ...... - 75 - Annex to Chapter 2) The development of further cisgenic, fire blight resistant apples ...... - 82 - Morphological observation performed on the line C44.4.146
Introduction ...... - 83 - Experimental procedures ...... - 83 - Results ...... - 83 - Development of further cisgenic apple lines carrying the FB_MR5 resistance gene
Introduction ...... - 86 - Experimental procedures ...... - 86 - Results ...... - 88 -
vi Table of contents
Chapter 3) Investigation of fire blight resistance cascade triggered by FB_MR5 using RNASeq ... - 94 - Abstract ...... - 95 - Introduction ...... - 96 - Results ...... - 98 - Library construction ...... - 98 - De novo assembly ...... - 98 - Mapping...... - 99 - House-keeping genes ...... - 99 - Differentially expressed transcripts between 'Gala Galaxy' and T41D plants 24 hpi with Ea. - 100 - Discussion ...... - 112 - Conclusion ...... - 116 - Experimental procedures ...... - 117 - Plant material ...... - 117 - Fire blight inoculation and sample collection ...... - 117 - RNA isolation ...... - 117 - RNA Integrity number ...... - 117 - Library preparation, sequencing and quality control ...... - 117 - De novo assembly ...... - 118 - Quality control of plants ...... - 118 - Identification of differentially expressed genes ...... - 118 - Functional homologies and binning to known pathways ...... - 118 - List with top candidates ...... - 118 - Mapping of house-keeping genes ...... - 118 - Acknowledgment ...... - 119 - References ...... - 120 - Supporting Information for chapter 3 ...... - 126 - Index of supplementary tables and figures ...... - 126 - General conclusion and outlook ...... - 172 - Acknowledgments ...... - 176 - Curriculum Vitae ...... - 177 -
vii to my rose General Introduction
General Introduction
- 1 - General Introduction
General Introduction The host Malus × domestica The cultivated apple (Malus × domestica Borkh.) is worldwide one of the most popular horticultural fruit crops of the temperate climates (Zohary, 2004). It belongs to the Rosacea family (Kalkman, 2004) with other important fruits and ornamental plants such as pear (Pyrus spp.), cherry (Prunus avium), peach (prunus persica), apricots (Prunus armeniaca), strawberries (Fragaria spp.) brambles such as blackberries (Rubus spp.), almond (Prunus amygdalus) and also roses (Rosa spp.). Rosacea belong to the rosids, which are a big monophyletic clade that contains about 30 % of all flowering plants and in 2005 a worldwide annual consumer value for rosaceous plants and their products was estimated of over 180 billion US$ (Hummer and Janick, 2009).
History of the domesticated apple It is presumed that the domesticated apple (Malus × domestica Borkh.) originated from an interspecific hybridization, more precisely from a cross between the wild Central Asian apple Malus sieversii and a European apple called Malus sylvestris and originated in Central Asia in the region where Kazakhstan is located today (Harris et al., 2002; Kellerhals, 2009; Velasco et al., 2010; Cornille et al., 2012; Cornille et al., 2014). The region of Central Asia also shows the largest diversity for the genus Malus in general.
Apples have already been cultivated in Europe and in Asia in the antiquity and they were known by the Greeks as well as by the Romans (Janick and Moore, 1996). It is presumed that before the cultivation of apple by humans the major dispersers for crab apples were birds while for common apples large herbivores such as bears and wild horses were considered as the major disperser of apple seeds. Yet also camels and even dung beetles may have been involved (Juniper and Mabberley, 2006).
Economic importance of apple Apple is one of the top produced fruits worldwide with an increasing production that rose from 71 million tons in 2010 to 81 million tons in 2013 (faostat.fao.org). Most apples are produced in Asia (51.8 million tons) followed by Europe (16 million tons) and America (10 million tons). According to faostat the country where most apples were harvested in 2013 was China (39.7 Mt) followed by USA (4.1 Mt) Turkey (3.1 Mt) and Poland (2.9 Mt). Furthermore in 2012 an area of 4.8 million hectares in over 90 countries was used for global apple production (faostat.fao.org). Albeit apples fit to different climates, they are best adapted to the cold temperate zone of 35-50° latitude (Kellerhals, 2009).
Genetic Background Most haploid Rosacea have among seven and nine chromosomes. Rosoidea as roses, strawberries and raspberries possess normally seven and rarely eight chromosomes while Amygdaloidea as cherries, peaches, plums, apricots and almonds show eight chromosomes (Evans and Campbell, 2002). Pyreae, containing apple and pear amongst others, indicate a characteristic number of 17 chromosomes. Pyreae have been considered for over 50 years as an example for allopolyploidy between Spiraeoidea (x = 9) and Amygdaleoidea (x = 8) (Chevreau et al., 1985; Phipps et al., 1991). A molecular phylogeny study indicated that Pyreae could have originated by an aneuploidy event between two sister taxa with each (x=9) as in Gillenia or after autopolyploidization of an Gillenia-like ancestor (Phipps et al., 1991). Insights into the genome of 'Golden Delicious' confirmed tracks of a genome duplication and supports the hypothesis of a Gillenia-like ancestor. Morever the estimated timing for such a genome-wide- duplication was in agreement with archeobotanical data which predicted a date of roughly 48-50 Mya (Velasco et al., 2010). - 2 - General Introduction
Recently a draft genome of the domesticated apple (Malus × domestica) was conducted using the diploid apple cultivar 'Golden Delicious' as reported by Velasco et al. (2010). It has 17 chromosomes and an estimated size of 742.3 Mbps. And at that time point it showed the highest reported total number of genes (57,386) among all sequenced plant genomes. Today it is ranked in on position twelve of the largest land plant genomes with white spruce (Picea glauca) in the lead. The majority of apples are diploids (2n = 34) (Way et al., 1991). Nevertheless some triploids as for instance Jonagold and tetraploid apples exist as well (Kellerhals, 2009).
Albeit there are over 6000 (Smith, 1971) listed cultivars (bred varieties that have been developed intentionally and often bearing an individual name) and landraces (locally and traditionally adapted apples which developed beyond specific breeding intension) a dozen of cultivars dominate the world apple market. Those commercially important cultivars are ‘Golden Delicious‘, ‘Delicious‘, ‘Cox’s Orange Pippin‘, ‘Rome Beauty‘, ‘Granny Smith‘, ‘McIntosh‘, ‘Jonathan‘, ‘Braeburn‘, ‘Fuji‘ ,‘Gala‘ and ‘Jonagold‘ (Janick and Moore, 1996; Turchek, 2004; Gardiner et al., 2007).
Apple attributes and conventional breeding There are some apple attributes, which make breeding a very difficult attempt. Those characteristics are in particular self-incompatibility, a high level of heterozygosity and a long juvenile phase. (Peace and Norelli, 2009). For these reasons apple breeding is a time consuming and labor-intense approach. Anyway because of consumers local varying flavor preference (Heng et al., 2005) and the view that apple are a natural, traditional and healthy product (Boyer and Liu, 2004), worldwide a high demand arose. Therefore in the last 70 years apple breeding with the main focus to create new cultivars with high fruit quality (shape, color and storage properties) and yield as well as increased resistance to the most important diseases has become more and more important (Kellerhals and Meyer, 1994; Laurens, 1996; Sansavini et al., 2004; Janick, 2006; Lespinasse, 2007; Kellerhals, 2009; Peil et al., 2011).
Important diseases in apple The fact that apple are mostly planted in monocultures (only a few vegetatively propagated clones per orchard) increases the risk of occurrences of pests and diseases. Around 260 species of fungi and bacteria that attack apple were reported in the U.S Department of Agriculture Handbook 165 (Alfieri et al., 1984). A selection of economically important diseases for apple was summed up by Way (1991). Summarized, the main diseases of the cultivated apple triggered by fungus are apple scab and powdery mildew, triggered by Venturia inaequalis and Podosphaera leucotricha (Butt, 1973), respectively. Apple scab is the reason why on average ten to 15 fungicide spray applications per season are unavoidable. For example in the Netherlands annual crop losses of 80 % were predicted when the 15 to 22 fungicide applications were skipped (Holb et al., 2003). There are more fungus triggered apple diseases specifically the rusts. Most rusts require two variable hosts to survive. Very common in eastern North America is the cedar-apple rust (Aldwinckle et al., 1977) caused by Gymnosporangium juniperi- virginianae Schwein. Another economically important apple disease is the nectria cancer triggered by Nectria galligena which mainly kills young trees (Turchek, 2004). Other examples for important apple diseases are crown rot (Phytophthora cactorum) and valsa cancer disease (Valsa ceratosperma). Moreover aphids (Kellerhals, 2009) as the woolly apple aphids (Eriosoma lanigerum), rosy apple aphids (Dysaphis plantaginea) or leaf-curling aphids (Dysaphis devecta) are an example from over 400 insects and mites that attack commercial apple cultivars (Way et al., 1991). In addition several nematodes, viruses and mycoplasmas can also affect apples (Jones and Aldwinckle, 1990). Albeit there are that
- 3 - General Introduction many known apple diseases (Rose et al., 1951) fire blight is the most destructive disease for apple and pear and in addition it is very difficult to treat.
Fire blight Fire blight is triggered by the bacterium Erwinia amylovora, which was first described in 1882 (Burrill, 1882) and at that time called Micrococcus amylovorus and accidentally misspelled as M. amylivorus in the publication in the “American Naturalist” (Arthur, 1886). The pathogen was identified as an accumulation of Gram-negative, filamentous, rod-shaped enterobacteria (Van der Zwet et al., 2012). They move very fast through the shoot tip of their host and trigger necrosis which results briefly after infection in the formation of a characteristic shepherd crock and later, at an increased state of infection, gives infected plants a view as if they would have been burned by fire. This characteristic trait explains the origin of the fire blight diseases name.
Biology of Erwinia amylovora In spite of extensive studies, only few convenient possibilities for overwintering of E. amylovora were found. It is assumed that the pathogen passes its entire life in direct contact with the living host (figure 1). Therefore cankers are the location where living cells get released to disperse the disease. With the increasing temperature in spring, in holdover cankers (from the previous year), E. amylovora cells from the previous season secrete bacterial ooze, the main source for primary inoculum (Rosen, 1929; Paulin, 1981). Albeit it was shown that E. amylovora can be transported over large distances by biotic and abiotic vectors (Bazzi et al., 1994) it is contradictory that often ooze were released temporarily after first infection and not before. It is also surprising that flies and ants (Thomas and Ark, 1934), which did not visit flowers, were attracted by the ooze while other insects were shown to come only accidentally in contact with oozes and that bees were not attracted by them (Aldwinckle and Zwet, 1979).
- 4 - General Introduction
Figure 1) Simplified disease cycle of fire blight. Figure from the Revised Draft IRA Report for Importation of Apples from New Zealand (2004), Australian Government Department of Agriculture, Fisheries and Forestry.
A recently picked up hypothesis considers that in the beginning of spring, beside overwintering in previously infected fruit mummies (Anderson, 1952) and cancers on rootstocks of host plants also symptomless infected shoots could deal as a possible primary infection inoculum (Crepel and Maes, 2000). For instance up to ten colony forming units (cfu) of E. amylovora per flower were reported from symptomless pears, (Thomson, 2000). E amylovora is known to be able to multiply epiphytically on the surface of apples trees (Steiner, 2001). Furthermore resident E. amylovora cells have been reported in non-host tree tissue without visible symptoms (Weißhaupt et al., 2015) but have rarely been investigated in depth so far. A study, where the E amylovora was reported on dandelion blossoms (Taraxacum officinale) close-by infected pear trees, (Moltmann and Viehrig, 2007) was published, while in another study the pathogen could not be detected on weeds or corn located directly under infected threes (Paulin, 1981). Nonetheless the conditions in non-host blossoms could be similar as in naturally infected host blossoms that showed no disease symptoms, where up to 3.4 x 106 cells per blossom were identified by qPCR (Hinze et al., 2015). Weißhaupt et al. (2015) reported that 20 % of non-host plant blossoms (293 samples of 16 species) collected below but also over 4 m afar infected trees were tested positive for E amylovora. It was also shown that under low relative humidity E. amylovora can survive at least for a year in the dried ooze (Rosen, 1938).
However, under experimental conditions washed E. amylovora cells died within two days after exposure to high humidity or solar radiation (Geesteranus and de Vries, 1984), confirming the assumption that E. amylovora is in general a bad epiphyte. Moreover, if high populations of epiphytical
- 5 - General Introduction
E. amylovora were observed in the field, they declined rapidly from 90 % to 7 % of investigated leaves during two dry days (Thomson and Gouk, 1998). This indicates that the most vulnerable phase for the pathogen is during the insect-driven dissemination, when the bacteria cannot hide endophytically and are exposed to the hostile environment.
In this phase E. amylovora and ooze get transported from active cancers to flowers by insects as flies and ants (Thomas and Ark, 1934), by rain (Miller, 1929) or by wind (Keil et al., 1966). On stigmas of flowers they start growing in the ideal, nectar containing surface. From there the pathogen can get washed into the floral cup by rain or dew and enter the nectarial cups through nectarthodes (Bubán and Orosz-Kovács, 2003). Beside infection through pistils, the shoot tip and the leaves offer a vulnerable target for infection by E. amylovora through natural openings or injured tissue created by insects or hail (Keil et al., 1966). E. amylovora can migrate rapidly if they get sucked into the xylem vessels. There, invading bacteria can survive for at least one season and somehow escape from the xylem containment into the cortical parenchym (Vanneste and Eden-Green, 2000). The first disease symptoms in a susceptible host are blossoms that get blighted, followed by heavy necrotic symptoms at the pedicel, peduncle and spur. From there the bacteria migrate to the main branches and leaves where they start to form ooze, a milky-orange colored exudate. This ooze formation beside the stem as well as a shepherd’s crook-like shoot tip are characteristic indicators for the initiation of fire blight infection (Bubán and Orosz-Kovács, 2003). In susceptible host the necrogenic pathogen was reported to migrate 15 cm within 7 hours (Lewis and Goodman, 1965) and to lead to a progression of up to 3.0 cm necrotic tissue per day (Brooks, 1926; Rosen, 1936). Finally production of cancer, penetration into the branches and sometimes dissemination into the trunk or rootstock is observed (Vanneste and Eden-Green, 2000).
After the cell transport from cankers to blossoms a secondary inoculum is generated by ooze formation for further blossom infections (Thomson, 2000). It is assumed that the major dispersal vectors from flower to flower are honey bees Apis mellifera (Vanneste, 2000; Alexandrova et al., 2002; Porrini et al., 2002; Sabatini et al., 2006), wind and rain (Van Der Zwet and Keil, 1979; McManus and Jones, 1994). Nevertheless several additional biotic vectors have been discovered. Birds as well as many insects including wasps (Vespula sp.), flies (Cynomyopsis cadaverina), aphids (Aphis sp.), leafhoppers (Empoasca sp.) and pear psylla (Psylla pyricola) play a role in the dispersal of fire blight (Way et al., 1991). Also man himself is a vector, which can spread the disease by equipment, pruning tools, fruits, budwood, hands, clothing and shoes if they were in contact with infected plant material and/or incorrectly decontaminated (Stewart, 1913).
Host range Several genera of the Rosaceae are highly affected by fire blight in particular Pyrus (pears) and Malus (apples) but also rosaceous plants, Cotoneaster, Cydonia, Pyracantha, Crataegus and Sorbus (Van Der Zwet and Keil, 1979). Most commercially important apple cultivars are highly susceptible to fire blight e.g ‘Braeburn‘,‘Fuji‘,‘Fuji 2‘,‘Gala‘,‘ Jonagold‘, ‘Honeycrisp‘,‘Idared‘, ‘Jonagold‘ or ‘Mutsu‘ (Turchek, 2004). But some less susceptible cultivars are known e.g. ‘Delicious’, ‘Liberty’, ‘Prima’, ‘Priscilla’, ‘Stayman’ and ‘Sinesap’ (Turchek, 2004; Kellerhals, 2009).
Historical review of disease distribution Fire blight was first observed in 1780 in the Judson valley in New York State (Denning, 1794). The disease spread first across North America (Eastern USA), subsequently to Canada and during the next approximately 135 years expanded to every corner of the USA and led to regular losses of pome fruit. - 6 -
General Introduction
In 1943 fire blight was reported in Mexico and in 1959 in Chile (Van der Zwet and Keil, 1979). The distribution away from the American continent occurred first in Japan in 1903 (Uyeda, 1903), followed by New Zealand in 1919 (Campbell, 1920), Europe 1959 (Hodgkin and Fletcher, 1965; Billing and Berrie, 2002) and Egypt in 1964 (El-Helaly et al., 1964) and is considered as human derived by shipment of wood and bud wood. The distance between USA and the isolated islands (3500 to 14,000 km) is much bigger than the known distribution by animals (Van Der Zwet and Keil, 1979) as starlings (Sturnus vulgaris, 1000 km) or honey bees (0.6 to 13 km summarized by Beekman and Ratnieks, 2000) and they are separated by the sea. Therefore the sudden occurrence of the disease on completely isolated regions as New Zealand, Japan and UK are assumed to be due to trading. The first report of fire blight on the European mainland came from the Netherlands in 1966 (Service, 1970) and indicates an introduction via England. Afterwards the disease continued to spread in Europe and reached step by step Denmark in 1968, Wester Germany in 1971, and Belgium and France in 1972 (Bonn and van der Zwet, 2000). The disease appeared in Switzerland and Austria in 1989 (Grimm and Vogelsanger, 1989) and 1993 (Keck et al., 1995), respectively. While fire blight was reported in 46 countries in 1995 (Van der Zwet, 1995) the number of reports is still increasing (Plantwise KnowledgeBank, 2015).
Economic importance of fire blight Fire blight is an important, worldwide threat for apple and pear production. As mentioned in the part economic importance of apple, it is obvious that fire blight, being able to destroy whole orchards in single season. The global costs for eradication, antibiotics, protective chemicals, equipment, machines and fuel for application are immense especially in places with frequent fire blight incidences as (USA, Europe and Turkey). This is mainly the case as all apple cultivars that dominate the world apple market are susceptible to fire blight as for example cultivars, ‘Braeburn‘, ‘Fuji‘, ‘Gala‘, ‘Golden Delicious‘, ‘Jonagold‘ and ‘Pink Lady (Norelli et al., 2003; Turchek, 2004). Growers in USA spend for example about 2.8 million US$ for antibiotics (Gianessi et al., 2002). In single years with heavy epidemics costs to fight fire blight can reach several million US$ as reported in south-western Michigan (3.8 million US$) (Van Der Zwet and Beer, 1995), or (2 million US$) Switzerland in 2000 (Hasler et al., 2002). Fire blight management costs in Switzerland have been reported to exceed 100 million US$ during the last 20 years (Bravin, 2014).
Disease management strategies As weather conditions are crucial for the successful invasion of E. amylovora, sophisticated forecasting models as for instance the freely accessible MaryBlytTM (Lightner and Steiner, 1992) have been generated. MaryBlytTM assesses the risk for infection by monitoring and prediction of temperature, humidity and development state of blossoms and allows farmers a precise prediction for best application of fire blight restricting products.
Beside eradication (heavy pruning) of infected plants, a broad spectrum of biocontrol agents (antagonists) and chemicals (including antibiotics) as well as combinations of products to keep away, slow up growth or kill E. amylovora have been studied in-depth. The most promising ones to manage fire blight were summarized by Kunz et al (2013) and in a recent study efficacies of several products have been compared (Gusberti et al., 2015). A whole list of chemicals (applied between 1980 and 1996) that showed effects against fire blight was created by Psallidas and Tsiantos (2000). This list contained plant extracts, disinfectants, fungicides, antibiotics and various compounds (Psallidas and Tsiantos, 2000). Summed up, a prominent procedure is the application of chemicals as copper compounds, aluminium sulphate or potassium aluminium sulphate. Especially in organic farming biocontrol
- 7 -
General Introduction strategies that include spraying of antagonists as the bacterium Bacillus subtilis or the yeast-like fungus Aureobasidium pullulans, to limit growth of Erwinia amylovora, are commonly applied (Kunz, 2006; Zeller, 2006).
During its epiphytic life stage, Erwinia amylovora is highly vulnerable to spraying of antibiotics. This strategy to control fire blight has been shown to be persistently very efficient in particular if streptomycin was applied. In Switzerland the application of streptomycin is bound to strict conditions and limited to a single application per year is. The use of different antibiotics to counteract fire blight has been reported (Stockwell and Duffy, 2012). Commonly applied alternative antibiotics were oxytetracycline (McManus et al., 2002), tetracyclins (Ngugi et al., 2011) and kasugamycin (McGhee and Sundin, 2011).
Use of antagonists (Johnson and Stockwell, 1998) and copper compounds often show lower efficiency than application of antibiotics (Psallidas and Tsiantos, 2000). And the frequent spraying of antibiotics into the environment, strongly promoting the selection for antibiotic resistant strains, could be a potential risk for human health. Therefore there is need for alternatives to chemical control against fire blight. A smart approach would be the use of apples that are not affected (resistant) by this disease.
Resistance breeding and fire blight resistant apples Most of the fire blight resistances are found in wild apple genotypes, which develop tiny fruits with bitter taste and are therefore unsuitable for the consumers. Some examples of wild Malus species that are not affected by fire blight or have been forecasted to carry fire blight resistance traits are M. × robusta, M. sublobata, M. × atrosanguinea, M. prunifolia and M. fusca (Aldwinckle and Zwet, 1979). Moreover wild apple species M. baccata (Peil et al., 2013), M. ×robusta var. persicifolia (Milčevičová et al., 2010) and M. sieversii (Fazio et al., 2007) showed high resistance to fire blight. A major QTL (Fb_E) was identified in the ornamental cultivar ‘Evereste’ and in the scab resistant (Vf-mediated) M. floribunda clone 821 (Durel et al., 2009). To generate resistant apple cultivars with great quality, the long lasting and laborious challenge of crossing suitable cultivars is performed in several breeding programs (Kellerhals and Meyer, 1994; Janick and Moore, 1996; Peil et al., 2011). Classical breeding is a very useful approach to obtain apples with increased fire blight resistances but due to the long generation time of five to twelve years, (Flachowsky et al., 2009) and the necessary backcrossing to eliminate unwanted traits, it is very time consuming. In addition the natural variability in fire blight susceptibility within cultivars complicates the determination of resistances.
However there are some cultivars ('Splendor', 'Delicious', 'Northwestern Greening', 'Stayman' and 'Winesap') and some scab-resistant selections ('Macfree', 'Prima', 'Priscilla', 'Enterprise' and 'Liberty') which show high levels of resistance to fire blight (Aldwinckle and Zwet, 1979; Janick and Moore, 1996; Kellerhals, 2009). It is presumed that they achieved fire blight resistance by chance during the selection for scab-resistance (Vf) from Malus floribunda 821 (Lespinasse and Aldwinckle, 2000). A similar selection was conducted on purpose in the Pilnitz apple breeding program (Dresden, Germany), where several so called “Re-cultivars®” as 'Reanda', 'Regia' and 'Rewena' were chosen because they carry the same scab-resistance gene and additionally they showed increased fire blight resistance too (Fischer and Richter, 1998; Fischer, 2004). Moreover the cultivars 'Priscilla' and 'Liberty' show high fire blight resistance levels due to polygenic control (Korban et al., 1988). Moreover a promising level to fire blight resistance has been reported in cultivars 'Fiesta' and 'Nova Easygro' (Keck et al., 1997; Fischer and Fischer, 1999).
- 8 -
General Introduction
In those cultivars several QTL’s have been identified to be involved in fire blight resistance (table 1). So far four major QTLs (probably monogenic resistances) and 13 minor ones of unknown nature have been revealed. Chromosome landing within the region of Fb_E and linkage group 3 of Malus ×robusta 5 led to the prediction of NBS-LRRs (Parravicini et al., 2011; Fahrentrapp et al., 2013).
Table 1) Summary of QTL’s involved in fire blight resistance. Major QTL s are indicated in bold.
Linkage group Origin (QTL) Percentage explained source phenotypical variation LG 3 Malus ×robusta 5 80.0 % Peil et al. (2007) (FB_MR5) Peil et al. (2008) LG 7 'Fiesta' (FBF7) 34.3-46.6 % Calenge et al. (2005) 37.5-38.6 % Khan et al.(2007) LG 10 M. fusca (Mfu10) 66 % Emeriewen et al. (2014) LG 12 'Evereste' (Fb_E) 50.0-70.0 % Durel et al. (2009) or M. floribunda 821 LG 3 'Prima' 5.1-7.5 % Calenge et al. (2005) LG 3 'Fiesta' 4.4-4.9 % Calenge et al. (2005) LG 5 'Florina' 10.1 % Le Roux et al. (2010) LG 5 'Nova Easygro' 7-9 % Malnoy et al. (2012) LG 5 Malus ×robusta 5 8.9-10.2 % Wöhner et al. (2014) LG 7 Malus ×robusta 5 11.7-19.8 % Wöhner et al. (2014) LG 9 'Florina' 6.0 % Malnoy et al. (2012) LG 10 'Florina' 15.3-17 % Le Roux et al. (2010) LG 11 Malus ×robusta 5 6.3-13.8 % Wöhner et al. (2014) LG 12 'Discovery' 5.4 % Calenge et al. (2005) LG 13 'Discovery' 7.9 % Calenge et al. (2005) LG 14 Malus ×robusta 5 5.6-13.8 % Wöhner et al. (2014) LG 15 'Evereste' 6.0 % Durel et al. (2009)
The cisgene FB_MR5 During the last ten years the fire blight resistance of the crabapple genotype Malus ×robusta 5 has been extensively studied. Peil et al. (2007) focused on the inheritance of this resistance using progenies from a cross between the Malus species Malus ×robusta 5 and the fire blight susceptible cultivar 'Idared'. In doing so they discovered a QTL on linkage group (LG) 3 of the genome of Malus ×robusta 5 which explained about 80 % of the phenotypical variation of the progenies (table 1). Following Fahrentrapp et al. (2013) identified the resistance candidate gene FB_MR5 in the same region of the genome. They predicted FB_MR5 to code for a resistance protein with the structure of a CC-NBS-LRR. NBS-LRRs are so far the most abundant members of R-proteins and contain a characteristic nucleotide- binding site (NBS) as well as a leucine-rich repeat (LRR) region (Ellis et al., 2000). The functionality of this putative resistance gene could not be demonstrated by Fahrentrapp, but several transgenic ‘Gala Galaxy’ lines containing FB_MR5 were developed, regenerated and acclimatized to greenhouse conditions by him (2012).
- 9 -
General Introduction
Defense response in plants Basically active plant defense response is activated by resistance (R)-proteins that recognize the pathogen itself or a molecule produced by it. Two different ways of recognition are differentiated. In the first one pattern recognition receptors (PRR), mainly located extracytosolically in the plasma membrane, recognize a broad spectrum of surface-derived, conserved molecules of a of microbial attacker, by so called pathogen associated patterns (PAMPS) and activate a cascade that activates a basal defense response also called pathogen triggered immunity (PTI). To be precise the recognized structures are not limited to pathogens but to conserved, non-plant structures including non-host organisms and therefore the term microbe associated patterns (MAMPS) would be more appropriate (Zipfel, 2009). Some popular examples for MAMPS are bacterial flagellin (Chinchilla et al., 2006), elongation factor Tu and fungus derived chitin (Zipfel, 2009). The targets of the PRRs are general patterns and are not race-specific.
During the pathogen-plant coevolution for instance some races of enterobacteria managed to inhibit the recognition by the plant, by secreting molecules that block or reprogram the plant defense response. Such molecules are called effectors and in case of E. amylovora they get transferred into the plant cells by a type three secretion system (T3SS). Plants started to recognize such pathogen derived effectors by intracellular R-proteins and developed a second mode of defense called effector triggered immunity (ETI). Leading to the prominent zigzag model which explains the interaction of PTI and ETI by the pathogen intending to bypass the plants defense response and the host trying to recognize the pathogens strategies (Jones and Dangl, 2006). Both, PTI and ETI mechanisms do overlap and activate local as well as systemic resistance (Schwessinger and Zipfel, 2008; Thomma et al., 2011) Obvious defense responses consist in the release of reactive oxygen species (ROS)(Levine et al., 1994; Mehdy, 1994), mitogen-activated protein kinase MAPK cascades (Asai et al. 2002), activation of defense genes as PR-genes, phytoalexins and programmed cell death (HR) (Martin et al. 2003) as well as callose deposition (Gómez‐Gómez et al., 1999) and phytohormone activation of JA and SA (Durrant and Dong, 2004; Bostock, 2005).
R-gene mediated defense and models The perception of pathogens and activation of defense response has initially been predicted in a simple model, where the recognition of effectors (at that time called avirulence (avr) proteins) occurs by direct interaction with the R-gene (Flor, 1971). Albeit some PRR showed direct receptor-ligand interaction, this was shown to be an exception for race-specific R-genes. Such a direct interaction was reported between an R-gene protein from tomato, Pto and avrPto, an effector triggered by Pseudomonas syringae pv. tomato (Scofield et al., 1996; Tang et al., 1996). Another rare case where a direct interaction supported a gene-for-gene interaction was confirmed by yeast-two-hybrid system is in rice in the interaction with the blast fungus Magnaporthe grisea between the effector AVR-Pita and the rice NBS-(leucine rich domain) LRD Pi-ta (Jia et al., 2000).
The lack of confirmation of the direct interaction between R-protein and effector led to the guard hypothesis, where the effector interacts with a third component (possibly a virulence target) in the system, which is monitored or thus “guarded” by the R-gene (Van der Biezen and Jones, 1998a; Dangl and Jones, 2001). Some examples where an R-gene acts as a guard of an effectors virulence target have been reported in the pathosystems of Arabidopsis-P. syringae and tomato-P. syringae. The NB-LRR Prf in tomato monitors Pto, a kinase that measures constitutively the presence of Pst, which in turn interacts directly with the effectors AvrPtoA and AvrPtoB, released by P. syringae pv. tomato (Van der
- 10 -
General Introduction
Biezen and Jones, 1998a; van der Biezen and Jones, 1998b). In A. thaliana the CC-NBS-LRR guard protein RPS5 recognizes cleaving of the kinase PBS1 by the AvrPphB effector, released via T3SS by P. syringae (Shao et al., 2002). The best confirmation for the guard hypothesis was reported for the interaction between A. thaliana and P. syringae. The R-gene RPM1 (resistance to P. syringae pv. maculicola 1) interacts with the RIN4 (RPM1 interacting 4) protein, and RIN4 in turn with the effectors AvrB and AvrRpm1. RIN4 also interacts between the R-gene RPS2 (resistance to P. syringae pv. tomato 2) and the effector AvrRpt2. RIN4 forms a complex with RPM1 and RPS2. AvrB and AvrRpm1 phosphorylate RIN4 and thereby activate RPM1. The effector AvrRpt2 cleaves RIN4 and thereby inhibits this activation. But this cleavage of RIN4 is monitored by RPS2 (Mackey et al., 2002; Axtell and Staskawicz, 2003; Mackey et al., 2003).
Recently further models have been developed that could explain unanswered questions. One is the decoy model which assumes that the effector target (guardee) is a cofactor which is not necessary a true target and therefore not directly involved in immunity but only by mimicking an effector target (van der Hoorn and Kamoun, 2008) and the other is the bait-and-switch-model (Collier and Moffett, 2009).
Homologies between the R-gene FB_MR5 and RPS2 from Arabidopsis have been found and also homologue sequences to RIN4 were located next to FB_MR5 in Malus ×robusta 5 (Fahrentrapp, 2012; Vogt et al., 2013). Moreover in the latter study a gene-for-gene interaction was predicted due to the fact that one single point mutation in AvrRpt2EA stops the involved transcriptional reprogramming and similar mechanisms as for RPS2 and AvrRpt2 in A. thaliana have been predicted (Vogt et al., 2013). A more detailed description of the E. amylovora induced defense response is present in the introduction of the RNASeq experiment in chapter 3.
Investigation of transcriptional changes induced by FB_MR5 recognition of E. amylovora by Next Generation Sequencing. Several investigations aimed at understanding fire blight resistance by comparing susceptible and resistant cultivars using different techniques (Malnoy et al., 2012; Jensen et al., 2012). This approach is hampered by the large differences found between such genotypes as consequence of the high heterozygosity. The above mentioned lines generated by Fahrentrapp (2012) contain FB_MR5 and are the most suitable material, when compared with its wild type, to investigate the transcriptional changes (as well as others) that are due to the FB_MR5 specific pathogen recognition. Instead of investigating the transcription of single gene candidates, there is the option of investigating the complete transcriptional changes without any bias and requirements for prior transcriptome and genome knowledge, represented by full RNA sequencing. By this next generation technique the entire messenger RNA is sequenced and single transcripts are quantified. Due to the decreasing costs and the constantly increasing precision, next generation sequencing by either Illumina’s Genome Analyzer, Applied Biosystems’s SOLiD or Roche’s 454 sequencer, became a powerful methodology for investigation of changes in total RNA (Wang et al., 2009). RNA Sequencing (RNASeq) allows to reveal transcriptional changes in non-model organisms (Morozova et al., 2009) as Malus × domestica and has been previously used to identify transcriptional changes in apple to understand ontogenic resistance to V. inaequalis by Gusberti et al. (2013). Therefore we decided to use this technique to identify and characterize transcripts involved in disease resistance triggered by FB_MR5 in the presented study (chapter 3).
- 11 - General Introduction
The cisgenic approach with FB_MR5 An innovative and promising approach to protect plants from fire blight is the use of genetic modification. The concept of cisgenesis (Schouten et al., 2006) uses genetic engineering to develop plants that carry only genes from sexually compatible plants, similar as in conventional breeding. In Europe genetically modified plants are not accepted by the consumers. However it was shown that there was a higher acceptance for plants that contain only cisgenes (genes from sexually compatible plants) than transgenes (genes from other species) in Europe (Gaskell et al., 2011). But at first, functional cisgenes (QTLs and R-genes) need to be identified before they could eventually be cloned, tested for functionality and inserted into a cultivar of interest. The main advantages of this method is the precise insertion of the minimally needed genetic material to obtain resistance and therefore a bypassing of the issues triggered by linkage drag that slow down conventional breeding. As already several cisgenic apple genotypes carrying scab resistance (Rvi6) or a gene leading to red-fleshing (MdMYB10) have been created in different apple cultivars (Vanblaere et al., 2011; Krens et al., 2015), a cisgenic line bearing several R-genes could be feasible. When a gene of interest is already cloned, the approach to insert such a gene into a cultivar can be much faster (a few years), than in conventional breeding, where around 4 backcrosses (at least 30 to 40 years) would be needed.
In this study the single R-gene FB_MR5, should be used to develop a cultivar with increased fire blight resistance out of a cultivar with a highly fire blight susceptible genetic background. If leading to increased fire blight resistance in a transgenic approach in the greenhouse under its native regulatory elements it would be a promising apple-own trait to create cisgenic, fire blight resistant apples to narrow fire blight. In addition, if functional, this cisgene could be integrated in elite conventional bred cultivars or stacked with other R-genes to create durable fire blight resistant apples.
- 12 -
Aims of this thesis
Aims of this thesis Fire blight is a bacteria triggered disease that leads to necrosis and devastates global apple and pear production by its fast spreading over whole orchards. Despite intense research only a limited number of tools for an efficient disease management are currently available. Two examples for such common but unsatisfactory tradeoffs are the use of antibiotics and heavy pruning. On this account the disease has been studied in depth during the last decades but still there are only a hand full of promising alternative products in the test stage. In addition conventional breeding for fire blight resistant apples is due to the apples attributes (e.g. self-incompatibility, high heterozygosity and long juvenile phase) a time consuming approach which always leads to a completely new cultivar.
In this thesis the use of genetic engineering to create cisgenic fire blight resistant apples was investigated and it was attempted to reveal the changes in the transcriptome induced by the FB_MR5 specific recognition of the fire blight pathogen. This approach is encouraging because knowing that the QTL on LG3 of the fire blight robust wild apple species Malus ×robusta 5, where the fire blight resistance candidate gene FB_MR5 was isolated from, explained up to 80 % of the phenotypical variation in fire blight susceptibility of progenies between Malus ×robusta 5 and the fire blight susceptible cultivar 'Idared', a promising tool for genetic engineering is available. Transgenic ‘Gala Galaxy’ lines containing FB_MR5 under native regulatory sequences were generated previously (Fahrentrapp, 2012), but a complementation assay to confirm that these lines are effectively resistant to fire blight could not be performed. Moreover if this gene is functional under its native regulatory elements it would fulfill all criteria to be used as a cisgene, following the definition of cisgenesis by Schouten et al. (2006). Such a cisgenic approach would be promising as it could speed up the development of desired cultivars, compared to conventional breeding. Mainly because it could bypass linkage drag by single insertion of essential traits into plants of the same cultivar with presumably similar characteristics.
The aims of this thesis are the following ones: i) To investigate and quantify the fire blight resistance of previously developed transgenic lines containing the fire blight resistance gene candidate FB_MR5 (under native regulatory sequences as well as under control of a strong promoter) and to confirm its functionality (chapter 1). ii) To generate cisgenic apple lines with increased fire blight resistance using the FB_MR5 under native regulatory sequences (chapter 2). For this purpose two different transformation vectors allowing the generation of marker-free genotypes are used. Beside transformation of the very susceptible cultivar ‘Gala Galaxy’ also a more resistant genotype should be transformed, allowing developing genotypes with more durable resistance (annex to chapter 2). The regenerated lines should be possibly investigated in containment to characterize them molecularly and assess fire blight resistance and morphological traits (annex to chapter 2). iii) To investigate by next generation sequencing the transcriptional changes induced by the pathogen recognition through FB_MR5. A transgenic line carrying the FB_MR5 will be compared to the ‘Gala Galaxy’ wild-type and transcriptional changes in response to artificial fire blight inoculation will be revealed. Differentially transcribed genes should be identified and annotated, allowing understanding the defense response that is activated by FB_MR5 (chapter 3).
- 13 - References
References Aldwinckle, H. and Zwet, T. (1979) Recent Progress in Breeding for Fireblight Resistance in Apples and Pears in North America1. EPPO Bulletin 9, 27-34. Aldwinckle, H.S., Lamb, R. and Gustafson, H. (1977) Nature and inheritance of resistance to Gymnosporangium juniperi-virginianae in apple cultivars. Phytopathology 67, 259-266. Alexandrova, M., Cimini, B., Bazzi, C., Carpana, E., Massi, S. and Sabatini, A. (2002) The role of honeybees in spreading Erwinia amylovora. Acta Horticulturae, 55-60. Alfieri, S., Langdon, K., Wehlburg, C. and Kimbrough, J. (1984) Index of plant diseases in Florida. Bull./Florida. Dep. of agriculture and consumer services. Div. of plant industry Bulletin 11, 389 pp. Anonymous 1960 USDA Agriculture Handbook 165, Washington, DC, USA, 531 pp. Anderson, H. (1952) Maintaining virulent cultures of Erwinia amylovora and suggestion of overwinter survival in mummified fruit. Plant Disease Reporter 36, 301-302. Arthur, J.C. (1886) History and biology of pear blight. Proceedings of the Academy of Natural Sciences of Philadelphia, 322-341. Arthur, J.C. (1886) History and biology of pear blight. Proceedings of the Academy of Natural Sciences of Philadelphia, 322-341. Asai, T., Tena, G., Plotnikova, J., Willmann, M.R., Chiu, W.-L., Gomez-Gomez, L., Boller, T., Ausubel, F.M. and Sheen, J. (2002) MAP kinase signalling cascade in Arabidopsis innate immunity. Nature 415, 977-983. Axtell, M.J. and Staskawicz, B.J. (2003) Initiation of RPS2-specified disease resistance in Arabidopsis is coupled to the AvrRpt2-directed elimination of RIN4. Cell 112, 369-377. Bazzi, C., Tagliati, M., Spina, F. and Bendini, L. (1994) Disseminazione di Erwinia amylovora a breve ed a grande distanza. Atti giornate di studio sul colpo di fuoco da, 29-40. Beekman, M. and Ratnieks, F. (2000) Long‐range foraging by the honey‐bee, Apis mellifera L. Functional Ecology 14, 490-496. Billing, E. and Berrie, A. (2002) A re-examination of fire blight epidemiology in England. Acta Horticulturae, 61-68. Bonn, W.G. and van der Zwet, T. (2000) Distribution and economic importance of fire blight. In: Fire blight: the disease and its causative agent, Erwinia amylovora (Vanneste, J.L. ed) pp. 37-53. CABI. Bostock, R.M. (2005) Signal crosstalk and induced resistance: straddling the line between cost and benefit. Annu. Rev. Phytopathol. 43, 545-580. Boyer, J. and Liu, R.H. (2004) Apple phytochemicals and their health benefits. Nutr J 3, 12. Bravin, E. (2013) Forschen für einen nachhaltigen Schweizer Obstbau trotz Feuerbrand Agrarforschung Schweiz. 4, 440–443 Brooks, A.N. (1926) Studies of the epidemiology and control of fireblight of apple. Phytoppathology 16, 665-696. Bubán, T. and Orosz-Kovács, Z. (2003) The nectary as the primary site of infection by Erwinia amylovora (Burr.) Winslow et al.: a mini review. Plant Systematics and Evolution 238, 183- 194. Burrill, T.J. (1882) The bacteria: an account of their nature and effects, together with a systematic description of the species:HW Rohker. Butt, D.J.E.B. (1973) Apple powdery mildew (Podosphaera leucotricha). Resistance testing. East Malling Res. Stn A. Rep., 142-143. Calenge, F., Drouet, D., Denancé, C., Van de Weg, W., Brisset, M.-N., Paulin, J.-P. and Durel, C.-E. (2005) Identification of a major QTL together with several minor additive or epistatic QTLs for
- 14 - References
resistance to fire blight in apple in two related progenies. Theoretical and Applied Genetics 111, 128-135. Campbell, J. (1920) The Orchard; The outbreak of fire blight. New Zealand Journal ofAgriculture 20, 181-182. Chevreau, E., Lespinasse, Y. and Gallet, M. (1985) Inheritance of pollen enzymes and polyploid origin of apple (Malus × domestica Borkh.). Theoretical and applied genetics 71, 268-277. Chinchilla, D., Bauer, Z., Regenass, M., Boller, T. and Felix, G. (2006) The Arabidopsis receptor kinase FLS2 binds flg22 and determines the specificity of flagellin perception. The Plant Cell 18, 465- 476. Collier, S.M. and Moffett, P. (2009) NB-LRRs work a “bait and switch” on pathogens. Trends in plant science 14, 521-529. Cornille, A., Giraud, T., Smulders, M.J., Roldán-Ruiz, I. and Gladieux, P. (2014) The domestication and evolutionary ecology of apples. Trends Genet 30, 57-65. Cornille, A., Gladieux, P., Smulders, M.J., Roldán-Ruiz, I., Laurens, F., Le Cam, B., Nersesyan, A., Clavel, J., Olonova, M. and Feugey, L. (2012) New insight into the history of domesticated apple: secondary contribution of the European wild apple to the genome of cultivated varieties. PLoS Genet 8, e1002703. Crepel, C. and Maes, M. (2000) Hibernation of the fire blight pathogen Erwinia amylovora in host plants. Mededelingen-Faculteit Landbouwkundige en Toegepaste Biologische Wetenschappen, Universiteit Gent 65, 19-25. Dangl, J.L. and Jones, J.D. (2001) Plant pathogens and integrated defence responses to infection. nature 411, 826-833. Denning, W. (1794) On the decay of apple trees. New York Society for the Promotion of Agricultural Arts and Manufacturers Transaction 2, 219-222. Durel, C.E., Denance, C. and Brisset, M.N. (2009) Two distinct major QTL for resistance to fire blight co-localize on linkage group 12 in apple genotypes 'Evereste' and Malus floribunda clone 821. Genome / National Research Council Canada = Genome / Conseil national de recherches Canada 52, 139-147. Durrant, W. and Dong, X. (2004) Systemic acquired resistance. Annu. Rev. Phytopathol. 42, 185-209. El-Helaly, A.F., Abo-el-Dahab, M.K. and El-Goorani, M.A. (1964) The occurrence of the fire blight disease of pear in Egypt. Phytopathologia Mediterranea, 156-163. Ellis, J., Dodds, P. and Pryor, T. (2000) Structure, function and evolution of plant disease resistance genes. Current opinion in plant biology 3, 278-284. Emeriewen, O., Richter, K., Kilian, A., Zini, E., Hanke, M.-V., Malnoy, M. and Peil, A. (2014) Identification of a major quantitative trait locus for resistance to fire blight in the wild apple species Malus fusca. Mol Breeding 34, 407-419. Evans, R.C. and Campbell, C.S. (2002) The origin of the apple subfamily (Maloideae; Rosaceae) is clarified by DNA sequence data from duplicated GBSSI genes. American journal of botany 89, 1478-1484. Fahrentrapp, J. (2012) Fire blight resistance of Malus × robusta 5. pp. 85-85. Eidgenössische Technische Hochschule ETH Zurich. Fahrentrapp, J., Broggini, G.A.L., Kellerhals, M., Peil, A., Richter, K., Zini, E. and Gessler, C. (2013) A candidate gene for fire blight resistance in Malus × robusta 5 is coding for a CC-NBS-LRR. Tree Genetics & Genomes 9, 237-251.
- 15 - General Introduction
Fazio, G., Aldwinckle, H., Volk, G., Richards, C., Janisiewicz, W. and Forsline, P. (2007) Progress in evaluating Malus sieversii for disease resistance and horticultural traits. In: XII EUCARPIA Symposium on Fruit Breeding and Genetics pp. 59-66. Fischer, C. and Richter, K. (1998) Results on fire blight resistance in the Pillnitz apple breeding programme. In: VIII International Workshop on Fire Blight 489 pp. 279-286. Fischer, M. (2004) Die Zukunft: krankheitsresistente Apfelsorten. Erwerbs-Obstbau 46, 1-6. Fischer, M. and Fischer, C. (1999) Evaluation of Malus species and cultivars at the Fruit Genebank Dresden-Pillnitz and its use for apple resistance breeding. Genetic Resources and Crop Evolution 46, 235-241. Flachowsky, H., Hanke, M.V., Peil, A., Strauss, S.H. and Fladung, M. (2009) A review on transgenic approaches to accelerate breeding of woody plants. Plant Breeding 128, 217-226. Flor, H.H. (1971) Current status of the gene-for-gene concept. Annual review of phytopathology 9, 275-296. Gardiner, S., Bus, V., Rusholme, R., Chagné, D. and Rikkerink, E. (2007) Apple. In: Fruits and nuts pp. 1-62. Springer. Gaskell, G., Allansdottir, A., Allum, N., Castro, P., Esmer, Y., Fischler, C., Jackson, J., Kronberger, N., Hampel, J. and Mejlgaard, N. (2011) The 2010 Eurobarometer on the life sciences. Nature biotechnology 29, 113-114. Geesteranus, H.M. and de Vries, P.M. (1984) Survival of Erwinia amylovora bacteria on plant surfaces and their role in epidemiology. In: Third International Workshop on Fire Blight: Bordeaux, France, 12-16 September 1983 p. 55. International Society for Horticultural Science. Gianessi, L.P., Silvers, C., Sankula, S. and Carpender, J. (2002) Plant Biotechnology: Current and Potential Impact for Improving Pest Management in US Agriculture: an Analysis of 40 Case Studies: Executive Summary. National Center for Food and Agricultural Policy. Gómez‐Gómez, L., Felix, G. and Boller, T. (1999) A single locus determines sensitivity to bacterial flagellin in Arabidopsis thaliana. The Plant Journal 18, 277-284. Grimm, R. and Vogelsanger, J. (1989) First record of fire blight in Switzerland. Schweizerische Zeitschrift für Obst-und Weinbau 125, 514-516. Gusberti, M., Gessler, C. and Broggini, G.A. (2013) RNA-Seq analysis reveals candidate genes for ontogenic resistance in Malus-Venturia pathosystem. PLoS One 8, e78457. Gusberti, M., Klemm, U., Meier, M.S., Maurhofer, M. and Hunger-Glaser, I. (2015) Fire Blight Control: The Struggle Goes On. A Comparison of Different Fire Blight Control Methods in Switzerland with Respect to Biosafety, Efficacy and Durability. International journal of environmental research and public health 12, 11422-11447. Harris, S.A., Robinson, J.P. and Juniper, B.E. (2002) Genetic clues to the origin of the apple. Trends Genet 18, 426-430. Hasler, T., Schaerer, H., Holliger, E., Vogelsanger, J., Vignutelli, A. and Schoch, B. (2002) Fire blight situation in Switzerland. Acta horticulturae, 73-80. Heng, Z., Zhengyang, Z., Zhiqiang, W. and Huairui, S. (2005) Analysis of the development trend of the world apple industry [J]. Journal of Fruit Science 1, 010. Hinze, M., Köhl, L., Kunz, S., Weißhaupt, S., Ernst, M., Schmid, A. and Voegele, R.T. (2015) Real‐time PCR detection of Erwinia amylovora on blossoms correlates with subsequent fire blight incidence. Plant Pathology. Hodgkin, B. and Fletcher, J. (1965) The fire blight campaign in southend-on-sea. NAAS Quarterly Review 67, 106-110.
- 16 - References
Holb, I., Heijne, B. and Jeger, M. (2003) Summer epidemics of apple scab: the relationship between measurements and their implications for the development of predictive models and threshold levels under different disease control regimes. Journal of Phytopathology 151, 335- 343. Hummer, K.E. and Janick, J. (2009) Rosaceae: taxonomy, economic importance, genomics. In: Genetics and genomics of Rosaceae pp. 1-17. Springer. Janick, J. (2006) The PRI apple breeding program. Hortscience 41, 8-10. Janick, J. and Moore, J.N. (1996) Fruit breeding, tree and tropical fruits:John Wiley & Sons. Jensen, P.J., Halbrendt, N., Fazio, G., Makalowska, I., Altman, N., Praul, C., Maximova, S.N., Ngugi, H.K., Crassweller, R.M. and Travis, J.W. (2012) Rootstock-regulated gene expression patterns associated with fire blight resistance in apple. BMC genomics 13, 9. Jia, Y., McAdams, S.A., Bryan, G.T., Hershey, H.P. and Valent, B. (2000) Direct interaction of resistance gene and avirulence gene products confers rice blast resistance. The EMBO journal 19, 4004- 4014. Johnson, K. and Stockwell, V. (1998) Management of fire blight: a case study in microbial ecology. Annual review of phytopathology 36, 227-248. Jones, A.L. and Aldwinckle, H. (1990) Compendium of apple and pear diseases:American Phytopathological Society. Jones, J.D. and Dangl, J.L. (2006) The plant immune system. Nature 444, 323-329. Juniper, B.E. and Mabberley, D.J. (2006) The story of the apple:Timber Press Portland, Oregon. Kalkman, C. (2004) Rosaceae. In: Flowering plants· dicotyledons pp. 343-386. Springer. Keck, M., Chartier, R., Lecomte, P., Reich, H. and Paulin, J. (1997) First characterization of Erwinia amylovora isolates from Austria and fire blight susceptibility of some apple genotypes from Central Europe. Zeitschrift für Pflanzenkrankheiten und Pflanzenschutz 104, 17-22. Keck, M., Reich, H., Chartier, R. and Paulin, J.-P. (1995) First record of fire blight (Erwinia amylovora) in Austria preliminary experiments on the survival on fruit boxes. In: VII International Workshop on Fire Blight 411 pp. 9-12. Keil, H., Smale, B. and Wilson, R. (1966) Role of injury and lonbecity of Erwinia amylovora in the epidemiology of fireblight of pear. pp. 464-465. Phytopathology 56. Kellerhals, M. (2009) Introduction to apple (Malus× domestica). In: Genetics and Genomics of Rosaceae pp. 73-84. Springer. Kellerhals, M. and Meyer, M. (1994) Aims of the apple breeding programme at Wädenswil. In: Progress in Temperate Fruit Breeding pp. 117-121. Springer. Khan, M., Duffy, B., Durel, C., Denancé, C., Kellerhals, M., Patocchi, A. and Gessler, C. (2007) Development of markers linked to the'Fiesta'7 major QTL for fire blight resistance and their application for marker-assisted selection. Genome / National Research Council Canada = Genome / Conseil national de recherches Canada 50, 568-577. Korban, S., Ries, S., Klopmeyer, M., Morrisey, J. and Hattermann, D. (1988) Genotypic responses of scab‐resistant apple cultivars/selections to two strains of Erwinia amylovora and the inheritance of resistance to fire blight. Annals of applied biology 113, 101-105. Krens, F.A., Schaart, J.G., van der Burgh, A.M., Tinnenbroek-Capel, I.E.M., Groenwold, R., Kodde, L.P., Broggini, G.A.L., Gessler, C. and Schouten, H.J. (2015) Cisgenic apple trees; development, characterization and performance. Frontiers in Plant Science 6. Kunz, S. (2006) Fire blight control in organic fruit growing-systematic investigation of the mode of action of potential control agents. Mitteilungen aus der biologischen Bundesanstalt für Land und Forstwirtschaft 408, 249. - 17 - General Introduction
Kunz, S. and Donat, C. (2013) Field Results for the Efficacy of Fire Blight Control Agents in the Last Fifteen Years in Germany. In: XIII International Workshop on Fire Blight pp. 101-106. Laurens, F. (1996) Review of the current apple breeding programmes in the world: objectives for scion cultivar improvement. In: Eucarpia Symposium on Fruit Breeding and Genetics 484 pp. 163-170. Le Roux, P.-M., Khan, M., Broggini, G., Duffy, B., Gessler, C. and Patocchi, A. (2010) Mapping of quantitative trait loci for fire blight resistance in the apple cultivars' Florina'and'Nova Easygro'. Genome / National Research Council Canada = Genome / Conseil national de recherches Canada 53, 710-722. Lespinasse, Y. (2007) Review of pome fruit breeding in Europe: which strategies for the near future? In: XII EUCARPIA Symposium on Fruit Breeding and Genetics 814 pp. 865-872. Lespinasse, Y. and Aldwinckle, H.S. (2000) Breeding for resistance to fire blight. In: Fire blight: the disease and its causative agent, Erwinia amylovora. (Vanneste, J. ed) pp. 253-273. CABI. Levine, A., Tenhaken, R., Dixon, R. and Lamb, C. (1994) H2O2 from the oxidative burst orchestrates the plant hypersensitive disease resistance response. Cell 79, 583-593. Lewis, S. and Goodman, R. (1965) Mode of penetration and movement of fire blight bacteria in apple leaf and stem tissue. Phytopath 55, 719-723. Lightner, G.W. and Steiner, P.W. (1992) Maryblyt™: A computer model for predicting of fire blight disease in apples and pears. Computers and electronics in agriculture 7, 249-260. Mackey, D., Belkhadir, Y., Alonso, J.M., Ecker, J.R. and Dangl, J.L. (2003) Arabidopsis RIN4 is a target of the type III virulence effector AvrRpt2 and modulates RPS2-mediated resistance. Cell 112, 379-389. Mackey, D., Holt, B.F., Wiig, A. and Dangl, J.L. (2002) RIN4 interacts with Pseudomonas syringae type III effector molecules and is required for RPM1-mediated resistance in Arabidopsis. Cell 108, 743-754. Malnoy, M., Martens, S., Norelli, J.L., Barny, M.-A., Sundin, G.W., Smits, T.H. and Duffy, B. (2012) Fire blight: applied genomic insights of the pathogen and host. Annual review of phytopathology 50, 475-494. McGhee, G.C. and Sundin, G.W. (2011) Evaluation of kasugamycin for fire blight management, effect on nontarget bacteria, and assessment of kasugamycin resistance potential in Erwinia amylovora. Phytopathology 101, 192-204. McManus, P. and Jones, A. (1994) Role of wind-driven rain, aerosols, and contaminated budwood in incidence and spatial pattern of fire blight in an apple nursery. Plant Dis 78, 1059-1066. McManus, P.S., Stockwell, V.O., Sundin, G.W. and Jones, A.L. (2002) Antibiotic use in plant agriculture. Annual Review of Phytopathology 40, 443-465. Mehdy, M.C. (1994) Active oxygen species in plant defense against pathogens. Plant physiology 105, 467. Milčevičová, R., Gosch, C., Halbwirth, H., Stich, K., Hanke, M.-V., Peil, A., Flachowsky, H., Rozhon, W., Jonak, C. and Oufir, M. (2010) Erwinia amylovora-induced defense mechanisms of two apple species that differ in susceptibility to fire blight. Plant Science 179, 60-67. Miller, P. (1929) Studies of fire blight of apple in Wisconsin. Journal of Agricultural Research 39, 579- 621. Moltmann, E. and Viehrig, M. (2007) Blossoms of infected pear trees may be sources of early inoculum for fire blight (Erwinia amylovora). In: XI International Workshop on Fire Blight 793 pp. 39-43.
- 18 - References
Morozova, O., Hirst, M. and Marra, M.A. (2009) Applications of new sequencing technologies for transcriptome analysis. Annual review of genomics and human genetics 10, 135-151. Ngugi, H., Lehman, B. and Madden, L. (2011) Multiple treatment meta-analysis of products evaluated for control of fire blight in the eastern United States. Phytopathology 101, 512-522. Norelli, J.L., Jones, A.L. and Aldwinckle, H.S. (2003) Fire blight management in the twenty-first century - Using new technologies that enhance host resistance in apple. Plant Dis 87, 756- 765. Parravicini, G., Gessler, C., Denance, C., Lasserre-Zuber, P., Vergne, E., Brisset, M.N., Patocchi, A., Durel, C.E. and Broggini, G.A.L. (2011) Identification of serine/threonine kinase and nucleotide-binding site-leucine-rich repeat (NBS-LRR) genes in the fire blight resistance quantitative trait locus of apple cultivar 'Evereste'. Mol Plant Pathol 12, 493-505. Paulin, J.-P. (1981) Overwintering of Erwinia amylovora: sources of inoculum in spring. Acta Horticulturae 117, 49-54.
Peace, C. and Norelli, J. (2009) Genomics approaches to crop improvement in the Rosaceae. In: Genetics and genomics of Rosaceae pp. 19-53. Springer. Peil, A., Garcia-Libreros, T., Richter, K., Trognitz, F.C., Trognitz, B., Hanke, M.V. and Flachowsky, H. (2007) Strong evidence for a fire blight resistance gene of Malus robusta located on linkage group 3. Plant Breeding 126, 470-475. Peil, A., Hanke, M.V., Flachowsky, H., Richter, K., Garcia-Libreros, T., Celton, J.M., Gardiner, S., Horner, M. and Bus, V. (2008) Confirmation of the fire blight QTL of Malus × robusta 5 on linkage group 3. Acta Hortic 793, 297-303. Peil, A., Kellerhals, M., Höfer, M. and Flachowsky, H. (2011) Apple breeding—from the origin to genetic engineering. Fruit Veg Cereal Sci Biotechnol 5, 118-138. Peil, A., Wöhner, T., Hanke, M.-V., Flachowsky, H., Richter, K., Wensing, A., Emeriewen, O., Malnoy, M., LeRoux, P.-M. and Patocchi, A. (2013) Comparative mapping of fire blight resistance in Malus. In: XIII International Workshop on Fire Blight 1056 pp. 47-51. Phipps, J.B., Robertson, K.R., Rohrer, J.R. and Smith, P.G. (1991) Origins and evolution of subfam. Maloideae (Rosaceae). Systematic Botany, 303-332. Plantwise Knowledge Bank [Internet]. (06.12.2015) Available from: http://www.plantwise.org/KnowledgeBank/Map/GLOBAL/Erwinia_amylovora/. Porrini, C., Sabatini, A.G., Carpana, E., Alexandrova, M., Medrzycki, P., Bortolotti, L., Bazzi, C., Ghini, S. and Girotti, S. (2002) Studi sul ruolo delle api nella disseminazione del batterio Erwinia amilovora e come bioindicatori della presenza del fitopatogeno nell’ambiente. In: Proceeding of the XIX Italian National Congress of Entomology pp. 1309-1318. Psallidas, P.G. and Tsiantos, J. (2000) Chemical control of fire blight. In: Fire blight: the disease and its causative agent, Erwinia amylovora (Vanneste, J. ed) pp. 199-234. Rose, D.H., McColloch, L.P. and Fisher, D. (1951) Market diseases of fruits and vegetables: apples, pears, quinces:US Department of Agriculture. Rosen, H.R. (1929) life history of the fire blight pathogen, Bacillus amylovorus, as related to the means of over wintering and dissemination. Rosen, H.R. (1936) Mode of penetration and of progressive invasion of fire-blight bacteria into apple and pear blossoms. Science 8, 26. Rosen, H.R. (1938) Life span and morphology of fire blight bacteria as influenced by relative humidity, temperature, and nutrition. Journal of Agricultural Research:US Government Printing Office.
- 19 - General Introduction
Sabatini, A., Alexandrova, M., Carpana, E., Medrzycki, P., Bortolotti, L., Ghini, S., Girotti, S., Porrini, C., Bazzi, C. and Baroni, F. (2006) Relationships between Apis mellifera and Erwinia amylovora: bioindication, bacterium dispersal and quarantine procedures. Acta Horticulturae 704, 155. Sansavini, S., Donati, F., Costa, F. and Tartarini, S. (2004) Advances in apple breeding for enhanced fruit quality and resistance to biotic stresses: new varieties for the European market. Journal of fruit and ornamental plant research 12. Schouten, H.J., Krens, F.A. and Jacobsen, E. (2006) Cisgenic plants are similar to traditionally bred plants - International regulations for genetically modified organisms should be altered to exempt cisgenesis. Embo Rep 7, 750-753. Schwessinger, B. and Zipfel, C. (2008) News from the frontline: recent insights into PAMP-triggered immunity in plants. Current opinion in plant biology 11, 389-395. Scofield, S.R., Tobias, C.M., Rathjen, J.P., Chang, J.H., Lavelle, D.T., Michelmore, R.W. and Staskawicz, B.J. (1996) Molecular basis of gene-for-gene specificity in bacterial speck disease of tomato. Science 274, 2063-2065. Service, N.P.P. (1970) Fire blight eradicated in The Netherlands. Plant Protection Bulletin 18, 123. Shao, F., Merritt, P.M., Bao, Z., Innes, R.W. and Dixon, J.E. (2002) A Yersinia effector and a Pseudomonas avirulence protein define a family of cysteine proteases functioning in bacterial pathogenesis. Cell 109, 575-588. Smith, M.W. (1971) National apple register of the United Kingdom. Steiner, P.W. (2001) Problems in managing fire blight in high density orchards on M-9 and M-26 rootstocks. College of Agriculture and Natural Resources, University of West Virgina. WEB site: http://www. cafcs. wvu. edu/kearneysville/articles/SteinerHort1. html. Stewart, V.B. (1913) The importance of the tarnished plant bug in the dissemination of fire blight in nursery stock. Phytopathology 3, 422. Stockwell, V.O. and Duffy, B. (2012) Use of antibiotics in plant agriculture. Rev Sci Tech Oie 31, 199- 210. Tang, X., Frederick, R.D., Zhou, J., Halterman, D.A., Jia, Y. and Martin, G.B. (1996) Initiation of plant disease resistance by physical interaction of AvrPto and Pto kinase. Science 274, 2060-2063. Thomas, H.E. and Ark, P.A. (1934) Fire blight of pears and related plants. University of California Agricultural Experiment Station Bulletin 586, Berkeley, California. Thomma, B.P., Nürnberger, T. and Joosten, M.H. (2011) Of PAMPs and effectors: the blurred PTI-ETI dichotomy. The plant cell 23, 4-15. Thomson, S. and Gouk, S. (1998) Transient populations of Erwinia amylovora on leaves in orchards and nurseries. In: VIII International Workshop on Fire Blight 489 pp. 515-520. Thomson, S.V. (2000) Epidemiology of Fire Blight. In: Fire Blight: the disease and its causative agent, Erwinia amylovora (Vanneste, J. ed) pp. 9-37. Turchek, W.W. (2004) Apple Diseases and their Management:Springer. Uyeda, E. (1903) On the Causal Bacteria of Fire Bight of apple. Dai-Nippon Nokai-ho 260, 1-3. Van der Biezen, E. and Jones, J. (1998a) Plant disease-resistance proteins and the gene-for-gene concept. Trends in biochemical sciences 23, 454. van der Biezen, E.A. and Jones, J.D. (1998b) The NB-ARC domain: a novel signalling motif shared by plant resistance gene products and regulators of cell death in animals. Current Biology 8, R226-R228. van der Hoorn, R.A. and Kamoun, S. (2008) From guard to decoy: a new model for perception of plant pathogen effectors. The Plant Cell 20, 2009-2017.
- 20 - References
Van der Zwet, T. (1995) Present worldwide distribution of fire blight. In: VII International Workshop on Fire Blight 411 pp. 7-8. Van Der Zwet, T. and Beer, S.V. (1995) Fire blight: its nature, prevention, and control, 2nd edn. United States Department of Agriculture Bulletin 631. Van Der Zwet, T. and Keil, H.L. (1979) Fire Blight: A Bacterial Disease of Rosaceous Plants. United States Department Agriculture Handbook 510,:US Government Printing Office. Van der Zwet, T., Orolaza-Halbrendt, N. and Zeller, W. (2012) Fire blight: history, biology, and management:APS Press/American Phytopathological Society. Vanblaere, T., Szankowski, I., Schaart, J., Schouten, H., Flachowsky, H., Broggini, G.A. and Gessler, C. (2011) The development of a cisgenic apple plant. Journal of biotechnology 154, 304-311. Vanneste, J.L. (2000) Fire blight: the disease and its causative agent, Erwinia amylovora:CABI. Vanneste, J.L. and Eden-Green, S. (2000) Migration of Erwinia amylovora in host plant tissues. In: Fire blight: the disease and its causative agent, Erwinia amylovora (Vanneste, J. ed) pp. 73-83. CABI. Velasco, R., Zharkikh, A., Affourtit, J., Dhingra, A., Cestaro, A., Kalyanaraman, A., Fontana, P., Bhatnagar, S.K., Troggio, M., Pruss, D., Salvi, S., Pindo, M., Baldi, P., Castelletti, S., Cavaiuolo, M., Coppola, G., Costa, F., Cova, V., Dal Ri, A., Goremykin, V., Komjanc, M., Longhi, S., Magnago, P., Malacarne, G., Malnoy, M., Micheletti, D., Moretto, M., Perazzolli, M., Si- Ammour, A., Vezzulli, S., Zini, E., Eldredge, G., Fitzgerald, L.M., Gutin, N., Lanchbury, J., Macalma, T., Mitchell, J.T., Reid, J., Wardell, B., Kodira, C., Chen, Z., Desany, B., Niazi, F., Palmer, M., Koepke, T., Jiwan, D., Schaeffer, S., Krishnan, V., Wu, C., Chu, V.T., King, S.T., Vick, J., Tao, Q., Mraz, A., Stormo, A., Stormo, K., Bogden, R., Ederle, D., Stella, A., Vecchietti, A., Kater, M.M., Masiero, S., Lasserre, P., Lespinasse, Y., Allan, A.C., Bus, V., Chagne, D., Crowhurst, R.N., Gleave, A.P., Lavezzo, E., Fawcett, J.A., Proost, S., Rouze, P., Sterck, L., Toppo, S., Lazzari, B., Hellens, R.P., Durel, C.E., Gutin, A., Bumgarner, R.E., Gardiner, S.E., Skolnick, M., Egholm, M., Van de Peer, Y., Salamini, F. and Viola, R. (2010) The genome of the domesticated apple (Malus × domestica Borkh.). Nat Genet 42, 833. Vogt, I., Wöhner, T., Richter, K., Flachowsky, H., Sundin, G.W., Wensing, A., Savory, E.A., Geider, K., Day, B. and Hanke, M.V. (2013) Gene‐for‐gene relationship in the host–pathogen system Malus× robusta 5–Erwinia amylovora. New Phytologist 197, 1262-1275. Wang, Z., Gerstein, M. and Snyder, M. (2009) RNA-Seq: a revolutionary tool for transcriptomics. Nature Reviews Genetics 10, 57-63. Way, R., Aldwinckle, H., Lamb, R., Rejman, A., Sansavini, S., Shen, T., Watkins, R., Westwood, M. and Yoshida, Y. (1991) Apples (Malus). Genetic Resources of Temperate Fruit and Nut Crops 290, 3-46. Weißhaupt, S., Köhl, L., Kunz, S., Hinze, M., Ernst, M., Schmid, A. and Voegele, R.T. (2015) Alternative Inoculum Sources for Fire Blight: the Potential Role of Fruit Mummies and Non‐Host Plants. Plant Pathology. Wöhner, T.W., Flachowsky, H., Richter, K., Garcia-Libreros, T., Trognitz, F., Hanke, M.-V. and Peil, A. (2014) QTL mapping of fire blight resistance in Malus× robusta 5 after inoculation with different strains of Erwinia amylovora. Mol Breeding 34, 217-230. Zeller, W. (2006) Status of biocontrol methods against fire blight. Phytopathol. Pol 39, 71-78. Zipfel, C. (2009) Early molecular events in PAMP-triggered immunity. Current opinion in plant biology 12, 414-420. Zohary, D. (2004) Unconscious selection and the evolution of domesticated plants. Economic Botany 58, 5-10. - 21 - Proof of functionality of FB_MR5
Chapter 1)
Proof of functionality of FB_MR5
This chapter is an extract from the results generated by T. D. Kost as contribution to the manuscript entitled "Engineering fire blight resistance into the apple cultivar ‘Gala’ using the FB_MR5 CC‐NBS‐ LRR resistance gene of Malus × robusta 5", by Giovanni A. L. Broggini et al. published in Plant Biotechnology Journal, accepted on 24 January 2014.
Contribution to manuscript published as:
Broggini, G. A. L., Wöhner, T.*, Fahrentrapp, J.*, Kost, T. D.*, Flachowsky, H., Peil, A., Hanke, M.-V., Richter, K., Patocchi, A. and Gessler, C. (2014), Engineering fire blight resistance into the apple cultivar ‘Gala’ using the FB_MR5 CC-NBS-LRR resistance gene of Malus × robusta 5. Plant Biotechnol J, 12: 728–733. doi:10.1111/pbi.12177
*Authors who contributed equally to this work
- 22 - Chapter 1)
Abstract Recently, 21 transgenic lines of the highly fire blight susceptible cultivar ‘Gala Galaxy’ have been complemented by genetic engineering with FB_MR5, a promising candidate resistance gene against this devastating disease. FB_MR5 has been isolated from the crab apple accession Malus ×robusta 5, which is robust to fire blight. The effects triggered through FB_MR5, either regulated by the constitutive CaMV 35S promoter and the ocs terminator or by its native promotor and terminator are fully unknown and should be tested in a phenotyping experiment. In this chapter, three (1400, 1402 and 1408) of five lines that were later further characterized in collaboration with the Julius-Kühn Institute, were tested in a randomized-blind study experiment, under artificial fire blight inoculation in the greenhouse. During weekly monitoring it was found that this single gene led to increased resistance to fire blight in all three transgenic lines compared to untransformed ‘Gala Galaxy’ wild type plants that underwent in parallel the same in vitro procedure and micrografting. The levels of necrosis 28 days post inoculation in the transgenic lines ranged from 4.0 ± 1.5 % percentage necrotic lesion length (PLL) to 4.6 ± 6.4 % PLL, which was significantly less than in the ‘Gala Galaxy’ wild-type plants, where 68.1 ± 35 % PLL were identified. FB_MR5 under control of either native regulatory sequences or strong constitutive transgenic regulatory sequences (CaMV 35S promoter) successfully increased the level of resistance. After 39 days the experiment was terminated as all ‘Gala Galaxy’ control plants were completely necrotic while the transgenic plant showed almost no necrosis. This experiment underlines that a single gene from the same genetic pool as for classical apple breeding induces fire blight resistance. Being a cisgene, FB_MR5 could be used to develop cisgenic fire blight resistant variants of normally highly fire blight susceptible cultivars. Such an approach could sidestep the drawback of linkage drag, and lead to fire blight resistant versions of already accepted cultivars by consumers and breeders.
- 23 - Proof of functionality of FB_MR5
Introduction Fire blight is a destructive plant disease that can destroy whole pear and apple orchards within one season, and is triggered by the Gram negative enterobacterium Erwinia amylovora (Burill) Winslow et al. (1920). As most popular apple cultivars are susceptible to fire blight (Flachowsky et al., 2009; Norelli et al., 2003) and with a yearly global production of 81 million tons of apples produced per year (FAO 2013) this disease can lead to huge economic losses. The economic importance of fire blight became clear in several countries in years of high incidence and was summarized by Bonn and Van der Zwet (Bonn and van der Zwet, 2000). They summarized the drastic consequences of fire blight all over the world including huge losses of over 68 million US$ in north-west USA in 1998 or costs of over 10 million NZ$ in the Hawke’s Bay region in New Zealand (Vanneste, 2000). In Europe, for instance in Switzerland, losses of 9 million US$ arose between 1997 and 2000 and in 2007, a year with drastic infestation, costs of 54 million US$ incurred (Hasler et al., 2001). The efficacy of control measures to fight this threatening disease depends highly on the right time point of application, in particular if copper compounds, biocontrol agents (Johnson and Stockwell, 1998) or antibiotics are sprayed. The number of effective approaches to manage this disease in commercial orchards, in which mainly highly susceptible cultivars are produced, is limited to intense pruning (Norelli et al., 2003), and antibiotic application (McManus et al., 2002), albeit some promising results have been obtained with novel compounds (Kunz, 2006) as in particular LMA (Freid et al., 2013).
However, an important strategy to manage this disease is to replace the susceptible apple cultivars with resistant ones. For the successful deployment of this strategy, there is first a need for identification of resistance sources which are mostly found in wild Malus accessions. Then breeders must introgress by conventional crosses this resistance in novel cultivar that should meet consumers’, producers’ and retailers’ expectations in term of fruit quality, productivity and storability. Being apple heterozygous and self-incompatible, and with a juvenility varying between 4-12 years, this process results painstakingly and the success of this approach is not yet predictable. A fast solution to improve an established susceptible cultivar could be the use of genetic engineering to transfer resistance genes to it. So far, two resistance genes against apple scab have been cloned, while for fire blight resistance to date only candidate resistance genes have been proposed in ‘Evereste’ (Parravicini et al., 2011), Malus fusca (Emeriewen et al., 2014) and in M. ×robusta 5, with the latter resulting in a single candidate. The resistance is inherited by a major QTL located on linkage group 3 of M. ×robusta 5 (Peil et al., 2007). This QTL has been confirmed in the progeny of crosses with M. ×robusta 5 using inoculation with different strains of E. amylovora (Peil et al., 2007; Peil et al., 2008; Gardiner et al., 2012). Albeit this QTL explains up to 80 % of the phenotypical variation (Peil et al., 2007; Peil et al., 2008) the detailed genetics underlying this resistance are still under discussion. Whilst presence of one single major QTL was predicted by Peil et al. (2007), multiple genes underlying this QTL on linkage group 3 were assumed by Gardiner et al. (2012). Recently the putative fire blight resistance gene FB_MR5 was detected by positional cloning on linkage group 3 within the QTL region between the SSR marker Ch03e03 and Fem18 (Fahrentrapp et al., 2013). Among the genes encoded in the genetic window a single gene showing homologies to known resistance genes was identified and called FB_MR5. It was predicted that FB_MR5 encodes for a protein belonging to the CC-NBS-LRR protein family, one of the largest resistance protein classes (McHale et al., 2006), consisting of a protein showing a coiled-coil domain, a nucleotide binding site domain and a leucine-rich repeat, assumed to have a sensing function (Belkhadir et al., 2004). This class, to which also a candidate resistance gene MdE-EaN for fire blight resistance of ‘Evereste’ belongs (Parravicini et al., 2011), consists of cytoplasmic proteins, similar to the closely related TIR-NBS-LRR class, to which the resistance gene Rvi15 belongs. - 24 - Chapter 1)
During the cloning of the two available scab resistance genes Rvi6 and Rvi15, complementation assays showed that the amendment of the candidate resistance gene to a susceptible cultivar incite in the transformed line a scab resistance (Belfanti et al., 2004; Szankowski et al., 2009; Schouten et al., 2014), either under control of a strong promoter like CaMV 35S, or under native promoter sequences. Similarly, Fahrentrapp (2012) transformed the fire blight susceptible cultivar ‘Gala Galaxy’ with the candidate resistance gene FB_MR5 under the control of CaMV 35S or 2 kb native 5’-UTR using A. tumefaciens-mediated transformation with vectors 390p95N and 392p9N35S. Transformed plants could be regenerated and 21 genotypes from both transformations could be grafted (Fahrentrapp, 2012), but no inoculation assay was performed to verify the functionality of FB_MR5. In this chapter, we present the results of the fire blight inoculation of three out of five lines that served to confirm the functionality of FB_MR5 (Broggini et al., 2014).
- 25 -
Proof of functionality of FB_MR5
Experimental Procedures Artificial fire blight inoculation Three transgenic lines (1400, 1402 and 1408), originating from transformations performed by Fahrentrapp (2012) with plasmid 390p95N::FB_MR5 (leading to lines 1400 and 1408 with FB_MR5 flanked by its native regulators elements) or 392p9N35S::FB_MR5 (resulting in line 1402 with FB_MR5 controlled by CaMV 35 S promoter and ocs terminator), were two-bud scion grafted on M9T337 rootstocks and used for artificial fire blight inoculations. Only shoots that reached at least 13 cm at the start of the experiment were inoculated.
The phenotypical evaluation after scissors inoculation with E. amylovora strain EA222_JKI was performed as described by Flachowsky et al. (2008). EA222_JKI is the original strain used for the identification of the strong QTL that was the starting point of the positional cloning of FB_MR5 (Peil et al., 2007). Actively growing shoots of transgenic lines and untransformed ‘Gala Galaxy’ lines that had undergone the same treatment (in vitro conditions and micrografting) were transversally bisected with scissors previously dipped in a bacteria suspension buffer with 109 cfu / ml (figure 1a and b).
Figure 1) Artificial inoculation with E. amylovora strain EA222_JKI a) Scissors dipped in bacteria suspension with 109 cfu / ml followed by b) Transversal bisecting of the youngest, completely unfolded leaf.
Plants were visually monitored for severity of infection and shoot length at 0, 7, 14, 21 and 28 days post inoculation and lesion length was scored (with ruler accuracy of ± 0.5 cm). The plants were further tracked until day 39 when all ‘Gala Galaxy’ wild-type plants were completely necrotic. For statistical comparison between transgenic lines and the control line, percent lesion length (PLL) was calculated with the formula: 100 * ((shoot length necrotized) / (total shoot length)). For progression of the disease the total shoot length, measured at the corresponding time point was used while for the PLL calculation in the boxplot the necrotized tissue was divided by the total shoot length corresponding to the shoot length at the start of the experiment.
Measures to avoid bias To avoid bias as best as possible, the whole inoculation and visual monitoring was performed in a blind experimental design. Therefore all plants were labelled with a random number instead of their - 26 -
Chapter 1) genotype name. Those numbers were generated using the sample function in software R (R Core Team, 2012) and each number was linked to a random position in the rack.
Statistical analysis Statistical analysis was performed using software JMP® 10.0 (SAS Institute Inc., Cary, USA) on Windows 7. As data did not follow normal distribution, the nonparametric Steel-Dwass test was used for multiple comparisons of the data with α = 0.05. Outliers were defined for single values if they differed more than 1.5 interquartile ranges (IQR) from the corresponding group median.
- 27 - Proof of functionality of FB_MR5
Results A total of 20 plants of ‘Gala Galaxy’ from in vitro culture, four plants from line 1400, 15 plants of the line 1402 and 18 plants of the line 1408 were used for fire blight inoculation with a suspension of E. amylovora strain EA222_JKI at 109 cfu/ml. Only one shoot per plant was maintained and the two youngest leaves were inoculated by bisection with scissors (figure 1). Only a single Malus ×robusta 5 plant could be inoculated as a fire blight resistant control and no shoot necrosis was observed at any moment (supplementary table 1). Four days following inoculation the first symptoms were visible in the susceptible control plants as necrosis along the midvein with the formation of ooze on the leaf petiole (figure 2a). In the susceptible control ‘Gala Galaxy’ plants then the necrosis reached the stem and rapidly propagated in the green tissues, resulting in the fire blight characteristic “shepherd crook“ recorded already 14 days post inoculation (figure 2b).
Figure 2) Progression of fire blight symptoms after inoculation of the susceptible apple cultivar ‘Gala Galaxy’ with E. amylovora a) 4 days post inoculation dpi necrosis reaches the stem and the typical fire blight accompanying formation of orange ooze is visible on the petiole b) 14 dpi necrosis proceeds to the lower part of the stem. On the shoot tip the characteristic formation of a “shepherd crook” is apparent. No symptoms were visible directly after inoculation 0 (dpi) as shown in figure 1b).
The progression of the disease symptoms was recorded weekly after inoculation and is shown in figure 3. After the first week about 10 % of the shoot length of ‘Gala Galaxy’ showed a necrotic lesion, while line 1402 showed the highest value among the three transgenic lines with just 3 %. After the second week the disease progressed rapidly in ’Gala Galaxy’, reaching already 68 % while less than 4 % were necrotic in the transgenic lines. Then the symptom progression slowed down and in the third week 72 % PLL was recorded in ’Gala Galaxy’ and about 4 % in transgenic lines.
- 28 - Chapter 1)
100,00 95,00 90,00 85,00 80,00 75,00 70,00 65,00 60,00 55,00 50,00 45,00 40,00 35,00 30,00 Percentage necrotic% lesion in 25,00 20,00 15,00 10,00 5,00 0,00 1400 1402 1408 Gala
PLL1 PLL2 PLL3
Figure 3) Progression of disease symptoms recorded as percentage necrotic lesion length (PLL) or by picture 21 dpi. Top) Shoots of three transgenic lines (1400, 1402 and 1408) bearing FB_MR5 and the untransformed wild type ‘Gala Galaxy’ (Gala) were monitored 7 (blue), 14 (orange) and 21 (grey) days post inoculation with E. amylovora strain EA222_JKI. Bars represent standard deviations. Bottom) Fire blight symptoms on shoots of ‘Gala Galaxy’ lines transformed with FB_MR5 under its native regulatory elements namely 1400 and 1408, ‘Gala Galaxy’ transformed with FB_MR5 under constitutive CaMV 35S promoter (1402) and non-transformed ‘Gala Galaxy’ (Gala). Pictures were taken 21 days post scissors inoculation with 109 cfu / ml E. amylovora of strain EA222_JKI.
- 29 - Proof of functionality of FB_MR5
Four weeks post inoculation the PLL was similar, showing 73 % in ’Gala Galaxy’ and about 4 % in the transgenic lines (supplementary table 2). At 28 dpi the differences in susceptibility to fire blight between plants of the ‘Gala Galaxy’ line and the transgenic lines were the most obvious (figure 4).
Figure 4) Boxplot representing fire blight symptoms expressed in percent lesion length (PLL) on shoots of ‘Gala Galaxy’ and three transgenic ‘Gala Galaxy’ lines (1400, 1402 and 1408) that bear FB_MR5. Data was collected 28 days after scissors inoculation with 109 cfu/ml buffer suspension of E. amylovora strain EA222_JKI. Lines 1400 and 1408 contain FB_MR5 driven by its native regulatory elements whereas line 1402 contains FB_MR5 under the constitutive CaMV 35 S promoter and ocs- terminator. The number of tested plants is indicated in brackets. Each box delimits values from the first to the third quartile of the dataset. The horizontal line in each box represents the median of the data. Whiskers are drawn for obtained values that differ least from respective group median ± 1.5 IQR. Outliers are represented as empty circles. Letters A and B indicate statistically significant difference found between groups by nonparametric Steel-Dwass test with α = 0.05. PLL was calculated in comparison to shoot length at the beginning of the experiment.
Statistical comparisons of the groups with the results collected 28 dpi showed that all transgenic lines differed significantly from the untransformed ‘Gala Galaxy’ line (figure 4) independent of the regulatory elements by which FB_MR5 was regulated. Between the different transgenic lines no statistically significant differences could be observed. The average PLL (necrosis compared to initial shoot length) of the untransformed ‘Gala Galaxy’ line was about 68.1 % ± 35.0 % and in the transformed lines differed between 4.0 % ± 1.5 % and 4.60 % ± 6.4 % (figure 4). One plant of line 1408 showed a PLL of 29.5 % which indicated a much higher PLL than all other plants (average 3.1 % ± 1.3 %) of the same line and was identified as an outlier (figure 4 and supplementary table 3). However, the differences stayed significant (p-value < 10-3) as indicated in figure 4, regardless of whether the outlier in 1408 was included in the analysis or not.
- 30 -
Chapter 1)
The inoculated plants were then left in the greenhouse cabin, and 39 dpi the ‘Gala Galaxy’ control plants were fully necrotic while the transgenic plants showed almost no necrosis (figure 5). The experiment was stopped after this observation.
Figure 5) Fire blight symptoms on representative shoots of non-transformed ‘Gala Galaxy’ (Gala), crab apple Malus ×robusta 5 (Mr5) and three transformed ‘Gala Galaxy’ lines (1400, 1402 and 1408) containing the FB_MR5 fire blight resistance gene 39 days post scissors inoculation with 109 cfu / ml E. amylovora strain EA222_JKI.
- 31 - Proof of functionality of FB_MR5
Discussion This study aimed at testing previously developed transgenic ‘Gala Galaxy’ lines (Fahrentrapp, 2012) that bear the fire blight resistance candidate gene FB_MR5 in their genome due to genetic engineering. Three of these (lines 1400, 1402 and 1408) were artificially inoculated with E. amylovora strain EA222_JKI and confirmed that FB_MR5 is strongly involved in fire blight resistance.
Previously Gardiner et al. (2012) predicted two QTL’s to be present on linkage group 3 in Malus ×robusta 5, and Wöhner et al. (2014) discovered four minor QTL’s (explaining 6 to 14 % of phenotypical variation ) on linkage groups 5, 7, 11 and 14. However, our study revealed that no further genes other than FB_MR5 were necessary to reduce fire blight susceptibility of ‘Gala Galaxy’ from about 70 % PLL to 5 % PLL in all tested transgenic lines.
The handling of this experiment in a blind-design with additional randomized position of the plants needed much more effort than if no such measures to limit bias had been taken. Before the experiment it was not clear that the differences in susceptibility to fire blight between ‘Gala Galaxy’ and the transgenic ‘Gala Galaxy’ would be so drastic. However, albeit a reduction of bias was ensured, in prospective experiments this blind design and the process of sophisticated randomizing could be simplified to save time as shown in a repetition of the experiment, where this was done and similar results were obtained (Broggini et al. 2014). It can be assumed that bias triggered by light or water access was negligible compared to the strong effects mediated by the pathogen.
Progression of necrosis increased during the first two weeks (figure 3). For this reason we would not recommend drawing a conclusion considering fire blight resistance by data obtained from monitoring during the first 14 days. This observation is in accordance to the work of Calenge et al. (2005), where a strong increase of necrosis occurred between 7 days and 14 days post scissors inoculation with 107 cfu / ml. The plants investigated in our study showed a similar severity of disease from 14 to 28 days post inoculation (figures 3 and 4). In previous studies at 28 days post artificial fire blight shoot inoculation by scissors, the disease progress was considered to be ceased (Kleinhempel et al., 1984). According to the protocol of Kleinhempel et al. (1984), shoots were inoculated with 109 cfu/ml of E. amylovora and PLL was recorded after 28 days in several studies as for instance performed by Peil et al., (2007) or by Vogt et al., (2013). In accordance to the results in those studies we would suggest the time point 28 dpi for monitoring to spot differences in fire blight susceptibility.
In this study only one strain EA222_JKI was used for inoculation as the same strain has been used for the identification of the strong QTL on linkage group 3 (Peil et al., 2007). It would be recommendable to confirm the plants’ resistance to further E. amylovora strains. The three reported transgenic lines (1400, 1402 and 1408) and two further lines were inoculated with Ea1189 in an independent experiment at Julius-Kühn Institute (Quedlinburg, Germany). Significant differences were obtained between each of the three transgenic lines (1400, 1402 and 1408) when compared to ‘Gala Galaxy’ control plants (Broggini et al., 2014).
The number of investigated replicates per line showed a big variation (between four and 18 plants per genotype). This is due to differences in shoot growth at the start of the experiment. In the case of line 1400, only four plants reached the minimal shoot length of 13 cm at the start of the experiment. Variability in growth occurs and could not be predicted a priori. In particular, wild type plants of Malus ×robusta 5 grew very slowly and only one (supplementary table 1) out of twelve reached 13 cm. Due to the number of replicates (n = twelve, 15 or 18 in control group, under CaM 35S promotor or under
- 32 -
Chapter 1) native promotor, respectively) statistical analysis should reveal differences between the groups (figure 4). In a second fire blight inoculation experiment seven to 20 biological replicates were used per genotype (Broggini et al., 2014).
In our study no differences in fire blight resistance were detected between plants of the line 1402, carrying FB_MR5 under the constitutive CaMV 35S promoter (n = 15) and 1408, carrying FB_MR5 under regulation of the native 1995 bp upstream promoter region of Malus ×robusta 5 (n = 18) were found (figure 4). In the second experiment at Julius-Kühn Institute with the previously mentioned lines 1402 and 1408 and three additional transgenic lines significant differences were observed between lines carrying the two different constructs. This was observed when an increased number of seven to 40 plants per line and inoculation with another E. amylovora strain (Ea1189) was performed. In this experiment line 1402 regulated by the CaMV 35S promoter (and a second one) showed an intermediate fire blight susceptibility, which was weaker than in plants of cultivar ‘Gala Galaxy’ but higher than in the lines with FB_MR5 under the native regulatory elements (Broggini et al., 2014). In the same experiment, all three lines regulated by the native promoter showed necrosis of between 0 and 4 % PLL. It was presumed that those differences could be explained by a semi-qualitative nature of the FB_MR5 resistance and that an unfavorable physiological state of the plants could result in some susceptible plants (Broggini et al., 2014). Another explanation was that a shortened form of FB_MR5 may have been inserted in vector 392p9N35S because of an incorrect prediction of the start or stop codon. Although such complications in the correct prediction of introns on M. × domestica had been reported previously by (Fahrentrapp et al., 2013), in our experiments we observed no such phenotypical differences between the tested plants under control of the two different regulatory elements of FB_MR5 (figures 3 and 4). However, one single transgenic plant (under native promotor) of line 1408 showed increased necrosis, while all other plants of this line showed fire blight resistance.
Further experiments performed with line 1408 (and a second one) indicated that the mechanism which leads to this fire blight resistance can be broken by an E. amylovora strain called ZYRKD3_1. This mutant strain carries a deletion (named ∆avrRpt2EA) of the effector avrRpt2EA (a homolog to the effector avrRpt2 from Pseudomonas syringae) and did break the resistance. This supports the hypothesis that FB_MR5 in the transgenic lines and in Malus ×robusta 5 interacts with avrRpt2EA in a similar gene-for-gene relationship as RPS2 from A. thaliana and AvrRpt2 from P. syringae as presumed by Vogt et al., 2013.
Summed up, our study confirmed that the single gene FB_MR5 confers fire blight resistance to the highly fire blight susceptible apple cultivar ‘Gala Galaxy’. FB_MR5 has recently been of interest (Peil et al., 2009; Peil et al., 2011) and will stay of high importance in classical apple and rootstock breeding in the future. Especially for the approach to create a cisgenic apple (chapter 2), the fire blight resistance gene FB_MR5 is very promising.
- 33 - Proof of functionality of FB_MR5
Conclusion This study confirmed that FB_MR5, isolated from the Malus wild accession Malus ×robusta 5, is a functional fire blight resistance gene. Shoots of three transgenic lines, bearing FB_MR5 (due to genetic engineering), were inoculated with Erwinia amylovora in the greenhouse and compared with ‘Gala Galaxy’ control plants that underwent a similar treatment. Albeit the genetic background of the transgenic plants (‘Gala Galaxy’ genome) was highly susceptible to fire blight, the additionally inserted gene FB_MR5 increased their fire blight resistance. The transgenic plants showed necrosis below 5 % PLL while the ‘Gala Galaxy’ control plants showed PLL above 70 % three to four weeks after inoculation. No significant differences in necrosis were observed between plants where FB_MR5 was regulated by a constitutive CaMV 35S promoter or by 2 kb native regulatory elements of the crab apple Malus ×robusta 5. Being isolated from the same genetic pool as used for conventional breeding and being functional under native regulatory elements, FB_MR5 fulfills the conditions to be used to develop a cisgenic plant. Such a cisgenic approach with FB_MR5 could enable the transmission of fire blight resistance into popular apple cultivars (chapter 2) through bystepping of linkage drag and could potentially minimize the use of antibiotics.
- 34 -
Chapter 1)
Acknowledgment We are grateful for the financial support by the Swiss National Science Foundation (SNF) DACH 310030L_1308911, the Deutsche Forschungsgemeinschaft (DFG) AOBJ577770 and by the Swiss Federal Office of Agriculture, Project ZUEFOS and ZUEFOSII. We also want to thank R. Blapp (Agroscope), J. Schneider (ETH), U. Hille, I. Hiller and I Polster (all from JKI) for their technical support and E. Chevreau from INRA Angers for providing in vitro ‘Gala’ plants.
- 35 - References
References Belfanti, E., Silfverberg-Dilworth, E., Tartarini, S., Patocchi, A., Barbieri, M., Zhu, J., Vinatzer, B.A., Gianfranceschi, L., Gessler, C. and Sansavini, S. (2004) The HcrVf2 gene from a wild apple confers scab resistance to a transgenic cultivated variety. P Natl Acad Sci USA 101, 886-890. Belkhadir, Y., Subramaniam, R. and Dangl, J.L. (2004) Plant disease resistance protein signaling: NBS– LRR proteins and their partners. Current opinion in plant biology 7, 391-399. Bonn, W.G. and van der Zwet, T. (2000) Distribution and economic importance of fire blight. In: Fire blight: the disease and its causative agent, Erwinia amylovora (Vanneste, J.L. ed) pp. 37-53. CABI. Broggini, G.A.L., Wöhner, T., Fahrentrapp, J., Kost, T.D., Flachowsky, H., Peil, A., Hanke, M.V., Richter, K., Patocchi, A. and Gessler, C. (2014) Engineering fire blight resistance into the apple cultivar 'Gala' using the FB_MR5 CC-NBS-LRR resistance gene of Malus × robusta 5. Plant Biotechnol J 12, 728-733. Calenge, F., Drouet, D., Denancé, C., Van de Weg, W., Brisset, M.-N., Paulin, J.-P. and Durel, C.-E. (2005) Identification of a major QTL together with several minor additive or epistatic QTLs for resistance to fire blight in apple in two related progenies. Theoretical and Applied Genetics 111, 128-135. Emeriewen, O., Richter, K., Kilian, A., Zini, E., Hanke, M.-V., Malnoy, M. and Peil, A. (2014) Identification of a major quantitative trait locus for resistance to fire blight in the wild apple species Malus fusca. Mol Breeding 34, 407-419. Fahrentrapp, J. (2012) Fire blight resistance of Malus × robusta 5. pp. 85-85. Eidgenössische Technische Hochschule ETH Zurich. Fahrentrapp, J., Broggini, G.A., Kellerhals, M., Peil, A., Richter, K., Zini, E. and Gessler, C. (2013) A candidate gene for fire blight resistance in Malus× robusta 5 is coding for a CC–NBS–LRR. Tree genetics & genomes 9, 237-251. Flachowsky, H., Hanke, M.V., Peil, A., Strauss, S.H. and Fladung, M. (2009) A review on transgenic approaches to accelerate breeding of woody plants. Plant Breeding 128, 217-226. Flachowsky, H., Richter, K., Kim, W.S., Geider, K. and Hanke, M.V. (2008) Transgenic expression of a viral EPS‐depolymerase is potentially useful to induce fire blight resistance in apple. Annals of Applied Biology 153, 345-355. Freid, A., Harzer, U., Scheer, C. (2013) LMA-A new product for fire blight control. Obstbau 4 234-237 Gardiner, S.E., Norelli, J.L., de Silva, N., Fazio, G., Peil, A., Malnoy, M., Horner, M., Bowatte, D., Carlisle, C., Wiedow, C., Wan, Y.Z., Bassett, C.L., Baldo, A.M., Celton, J.M., Richter, K., Aldwinckle, H.S. and Bus, V.G.M. (2012) Putative resistance gene markers associated with quantitative trait loci for fire blight resistance in Malus 'Robusta 5' accessions. Bmc Genet 13. Hasler, T., Schaerer, H., Holliger, E., Vogelsanger, J., Vignutelli, A. and Schoch, B. (2001) Fire blight situation in Switzerland. In: IX International Workshop on Fire Blight pp. 73-79. Johnson, K. and Stockwell, V. (1998) Management of fire blight: a case study in microbial ecology. Annual review of phytopathology 36, 227-248. Kleinhempel, H., Kegler, H., Ficke, W. and Schaefer, H. (1984) Methods of testing apples for resistance to fire blight. Acta Hortic 151, 261-265. Kunz, S. (2006) Fire blight control in organic fruit growing-systematic investigation of the mode of action of potential control agents. Mitteilungen aus der biologischen Bundesanstalt für Land und Forstwirtschaft 408, 249.
- 36 - References
McHale, L., Tan, X., Koehl, P. and Michelmore, R.W. (2006) Plant NBS-LRR proteins: adaptable guards. Genome Biol 7, 212. McManus, P.S., Stockwell, V.O., Sundin, G.W. and Jones, A.L. (2002) Antibiotic use in plant agriculture. Annual Review of Phytopathology 40, 443-465. Norelli, J.L., Jones, A.L. and Aldwinckle, H.S. (2003) Fire blight management in the twenty-first century - Using new technologies that enhance host resistance in apple. Plant Dis 87, 756- 765. Parravicini, G., Gessler, C., Denance, C., Lasserre-Zuber, P., Vergne, E., Brisset, M.N., Patocchi, A., Durel, C.E. and Broggini, G.A.L. (2011) Identification of serine/threonine kinase and nucleotide-binding site-leucine-rich repeat (NBS-LRR) genes in the fire blight resistance quantitative trait locus of apple cultivar 'Evereste'. Mol Plant Pathol 12, 493-505. Peil, A., Bus, V., Geider, K., Richter, K., Flachowsky, H. and Hanke, M. (2009) Improvement of fire blight resistance in apple and pear. Int J Plant Breed 3, 1-27. Peil, A., Garcia-Libreros, T., Richter, K., Trognitz, F.C., Trognitz, B., Hanke, M.V. and Flachowsky, H. (2007) Strong evidence for a fire blight resistance gene of Malus robusta located on linkage group 3. Plant Breeding 126, 470-475. Peil, A., Hanke, M.V., Flachowsky, H., Richter, K., Garcia-Libreros, T., Celton, J.M., Gardiner, S., Horner, M. and Bus, V. (2008) Confirmation of the fire blight QTL of Malus × robusta 5 on linkage group 3. Acta Hortic 793, 297-303. Peil, A., Kellerhals, M., Höfer, M. and Flachowsky, H. (2011) Apple breeding—from the origin to genetic engineering. Fruit Veg Cereal Sci Biotechnol 5, 118-138. Schouten, H.J., Brinkhuis, J., van der Burgh, A., Schaart, J.G., Groenwold, R., Broggini, G.A. and Gessler, C. (2014) Cloning and functional characterization of the Rvi15 (Vr2) gene for apple scab resistance. Tree Genetics & Genomes 10, 251-260. Szankowski, I., Waidmann, S., Degenhardt, J., Patocchi, A., Paris, R., Silfverberg-Dilworth, E., Broggini, G. and Gessler, C. (2009) Highly scab-resistant transgenic apple lines achieved by introgression of HcrVf2 controlled by different native promoter lengths. Tree Genetics & Genomes 5, 349-358. R Core Team. (2012) R: A language and environment for statistical computing. R Foundation for Statistical Computing, Vienna, Austria, 2012. ISBN 3-900051-07-0. Vanneste, J.L. (2000) Fire blight: the disease and its causative agent, Erwinia amylovora:CABI. Vogt, I., Wöhner, T., Richter, K., Flachowsky, H., Sundin, G.W., Wensing, A., Savory, E.A., Geider, K., Day, B. and Hanke, M.V. (2013) Gene‐for‐gene relationship in the host–pathogen system Malus× robusta 5–Erwinia amylovora. New Phytologist 197, 1262-1275. Winslow, C.-E., Broadhurst, J., Buchanan, R., Krumwiede Jr, C., Rogers, L. and Smith, G. (1920) The families and genera of the bacteria: final report of the committee of the Society of American Bacteriologists on characterization and classification of bacterial types. Journal of Bacteriology 5, 191. Wöhner, T.W., Flachowsky, H., Richter, K., Garcia-Libreros, T., Trognitz, F., Hanke, M.-V. and Peil, A. (2014) QTL mapping of fire blight resistance in Malus× robusta 5 after inoculation with different strains of Erwinia amylovora. Mol Breeding 34, 217-230.
- 37 - Proof of functionality of FB_MR5
Supplementary Material Supplementary table 1) List of disease symptoms during the whole experiment. Plantnr: number used for randomizing, values in cm shoot: shoot length, E: necrosis-like symptoms on parts of the stem but not circling it completely, B: necrosis-like symptoms circling stem completely, nec: necrosis of the two individually inoculated leaves, n: (only necrosis at inoculation site on leaf), a: (leaf discarded), b: (necrotic symptoms reaching midvein of leaf), s: (necrotic symptoms on whole leaf and petiole), number: necrosis in cm, necvalue: 0.1 for s, 0.5 for b, 1.0 for a, 1.0 + measured stem necrosis in cm (according to Calenge et al., 2005), pll: (percent lesion legth),* necrotic tissue on leave + shoot necrosis / shoot length of corresponding time point + 1, necvalue: corresponding to shoot length at the same time point, pllw: (worst case scenario) necvalue + E + B of corresponding time point compared to shoot length at the same time point + 1, growth: growth since start of experiment, necvalueXdpiw: nec+E+B of a particular time point where X represents number of days post inoculation, infection: 1: plant reached 15 cm at start of experiment, 2: plant reached 15 cm at 7 days post first infection and was then inoculated.
nec plant shoot shoot nec value E7 B7 shoot nec necvalue E14 B14 line insert nr 0dpi 7dpi 7dpi 7dpi dpi dpi 14dpi 14dpi 14dpi dpi dpi MR5 MR5 104 14,5 14,5 n 0,1 0 0 14,5 n,a 0,1 0 0,9 Gala GalaD1 46 13 16,5 17,5 0 0 17,5 n 0 0 Gala GalaD1 6 17 18 2 3 0 0 18 10 11 0 0 Gala GalaD1 17 30,5 30,5 1 2 0 0 30 30 31 0 0 Gala GalaD1 21 27 28 2,5 3,5 0 0 28 27 28 0 0 Gala GalaD1 27 20 20,5 1,5 2,5 0 0 20,5 16 17 0 0 Gala GalaD1 34 37 38 2 3 0 0 38,5 36 37 0 0 Gala GalaD1 50 24,5 24,5 1,5 2,5 0 0 24,5 22 23 0 0 Gala GalaD1 53 19 19 b,s 1 0 0 20 13 14 0 0 Gala GalaD1 70 17 18,5 1 2 0 0 18 15,5 16,5 0 0 1408 T41G1 141 18,5 19 n 0,1 0 0 19,5 n,n 0,1 0 0 1408 T41G1 76 21 22,5 b,s 1 0 0 23,5 b,s 1 0,5 0 1408 T41G1 83 16,5 19,5 n 0,1 0 0 20 n 0,1 0 0 1408 T41G1 98 20 22 1 2 0 0 21 6 7 0 0 1408 T41G1 100 21,5 26 n 0,1 0 0 27 n 0,1 0 0 1408 T41G1 105 19 19,5 b,s 1 0 0 20,5 b,s 1 0 0 1408 T41G1 115 25,5 27 b,s 1 0 0 28 b,s 1 0 0 1408 T41G1 120 31 32,5 b,s 1 0 0 33 b,s 1 0 0 1408 T41G1 126 22 23 n 0,1 0 0 23,5 b 0,5 0 0 1408 T41G1 131 26,5 27,5 b,s 1 0 0 27 b,s 1 0 0 Gala GalaD2 133 26 26,5 bs 1 0 0 26 4,5 5,5 0,5 0 Gala GalaD2 74 29 32 2,5 3,5 0 0 31 11 12 0 0 Gala GalaD2 77 31,5 33,5 5 6 0 0 33,5 24 25 0 0 Gala GalaD2 78 23 23 b,s 1 0 0 23,5 2,5 3,5 0 0 Gala GalaD2 85 31,5 32,5 2 3 0 0 32,5 30,5 31,5 0 0 Gala GalaD2 93 31,5 32,5 2 3 0 0 32 30,5 31,5 0 0 Gala GalaD2 109 33 33,5 2,5 3,5 0 0 34 30 31 0 0 Gala GalaD2 118 26,5 28,5 3 4 0 0 28,5 27,5 28,5 0 0 Gala GalaD2 121 26 27,5 4 5 0 0 28 11 12 0 0
- 38 - Chapter 1)
nec plant shoot shoot nec value E7 B7 shoot nec necvalue E14 B14 line insert nr 0dpi 7dpi 7dpi 7dpi dpi dpi 14dpi 14dpi 14dpi dpi dpi Gala GalaD2 127 31,5 32 1 2 0 0 32 11 12 0 0 Gala GalaD2 138 33,5 34,5 2,5 3,5 0 0 35 20 21 0 0 Gala GalaD2 146 28,5 30 3,5 4,5 0 0 30,5 29 30 0 0 Evereste Evereste 9 16,5 17 n 0,1 0 0 17,5 n,n 0,1 0 0 Evereste Evereste 30 16 16,5 n 0,1 0 0 17 n,n 0,1 0 0 Evereste Evereste 7 20 21,5 n 0,1 0 0 22 n 0,1 0 0 Evereste Evereste 23 17 18 n 0,1 0 0 18 b 0,5 0 0 Evereste Evereste 25 21 22,5 n 0,1 0 0 23 n 0,1 0 0 Evereste Evereste 49 15 21 n 0,1 0 0 22 n 0,1 0 0 Evereste Evereste 57 21 23 n 0,1 0 0 23 n 0,1 0 0 Evereste Evereste 59 16,5 17 n 0,1 0 0 17 n 0,1 0 0 1408 T41F1 102 19 19 n 0,1 0 0 19 n,n 0,1 0 0 1408 T41F1 150 20 21,5 n 0,1 0 0 21,5 n,n 0,1 0 0 1408 T41F1 112 29 29 b 0,5 0 0 29 b,s 1 1 0 1408 T41F1 129 28 27,5 b,s 1 0 0 28,5 b,s 1 0 0 1408 T41F1 136 19,5 21,5 b 0,5 0 0 21 b,s 1 0 0 1408 T41F1 142 24 24,5 b,s 1 0 0 25 b,s 1 0 0 1408 T41F1 143 34 35,5 b,s 1 0 0 36,5 b,s 1 0 0 1408 T41F1 147 24,5 26 n 0,1 0 0 26,5 n 0,1 0 0 1402 T40C1 94 17,5 17 n 0,1 0 0 17 n,n 0,1 0 0 1402 T40C1 116 15 15 b 0,5 0 0 15 b,bs 1 0 0 1402 T40C1 84 22 23,5 b 0,5 0 0 23 b,s 1 0 0 1402 T40C1 91 15 18 b 0,5 0 0 18 b,s 1 0 0 1402 T40C1 128 28,5 31 n 0,1 0 0 30,5 b,s 1 2 0 1402 T40C1 139 25 25 1 2 0 0 25 b,s 1 0 0 1402 T40D1 101 16 16,5 b,s 1 0 0 16,5 b,bs 1 0,5 0 1402 T40D1 72 17,5 17,5 b 0,5 0 0 18 b 0,5 0 0 1402 T40D1 73 18,5 19,5 b,s 1 0 0 19,5 b,s 1 0 0 1402 T40D1 79 17,5 17,5 b,s 1 0 0 18 b,s 1 0 0 1402 T40D1 113 29 30 b,s 1 0 0 29,5 b,s 1 0 0 1402 T40D1 125 22 26,5 b,s 1 0 0 27,5 b,s 1 0 0 1402 T40D1 132 26,5 27,5 n 0,1 0 0 27 b,s 1 0 0 1402 T40D1 134 22,5 23 n 0,1 0 0 23 n 0,1 0 0 1402 T40D1 144 27,5 29,5 b,s 1 0 0 30 b,s 1 0 0 1400 T36C1 108 18,5 19 n 0,1 0 0 19 n,A 0,1 0 0,9 1400 T36C1 149 16 16,5 n 0,1 0 0 16,5 n,b 0,5 0 0 1400 T36C1 80 20,5 22 n 0,1 0 0 22 b 0,5 0 0 1400 T36C1 96 15 19,5 b 0,5 0 0 19,5 b 0,5 0 0
- 39 -
Proof of functionality of FB_MR5
shoot nec necvalue E21 B21 shoot nec necvalue E28 B28 line 21dpi 21dpi 21dpi dpi dpi 28dpi 28dpi 28dpi dpi dpi infection MR5 14,5 n,a 0,1 0 0,9 14,5 a,n 0,1 0 0,9 2 Gala 17,5 n 0,1 0 0 17,5 n,n 0,1 0 0 2 Gala 17,5 12 13 0 0 18 13 14 0 0 1 Gala 30 30 31 0 0 30 30 31 0 0 1 Gala 28 28 29 0 0 27,5 27,5 28,5 0 0 1 Gala 21 21 22 0 0 20,5 20,5 21,5 0 0 1 Gala 39 39 40 0 0 39 39 40 0 0 1 Gala 24,5 24,5 25,5 0 0 24,5 24,5 25,5 0 0 1 Gala 20 14,5 15,5 0 0 20 14,5 15,5 0 0 1 Gala 18,5 18,5 19,5 0 0 18,5 18,5 19,5 0 0 1 1408 19,5 n,n 0,1 0 0 19 b,n 0,5 0 0 2 1408 23,5 bs,bg 1 4 0 23,5 bs,bs 1 4 0 1 1408 20,5 n 0,1 0 0 20,5 n,b 0,5 0 0 1 1408 21 6 7 0 0 21 5,5 6,5 0 0 1 1408 26,5 n,n 0,1 0 0 27 b,n 0,5 0 0 1 1408 20 n,bs 1 0 0 20 b,A 0,5 0 0,5 1 1408 27 n,bs 1 0 0 27,5 n,bs 1 0 0 1 1408 32,5 Bs,Bso 1 0 0 32,5 bs,A 1 1 0 1 1408 23,5 bs,a 1 0 0 23,5 A,A 1 0 0 1 1408 27 n,bs 1 1 0 27,5 n,bs 1 0 0 1 Gala 26 4,5 5,5 0 0 26 5 6 0 0 2 Gala 31 11 12 0 0 31 11 12 0 0 1 Gala 34,5 26 27 0 0 34,5 34,5 35,5 0 0 1 Gala 23 2 3 0 0 23 2,5 3,5 0 0 1 Gala 32 30 31 0 0 32,5 32,5 33,5 0 0 1 Gala 33 32 33 0 0 33 32 33 0 0 1 Gala 34 31 32 0 0 34 32,5 33,5 0 0 1 Gala 28,5 27,5 28,5 0 0 28,5 27,5 28,5 0 0 1 Gala 28,5 11 12 0 0 28,5 11 12 0 0 1
- 40 -
Chapter 1)
shoot nec necvalue E21 B21 shoot nec necvalue E28 B28 line 21dpi 21dpi 21dpi dpi dpi 28dpi 28dpi 28dpi dpi dpi infection Gala 32 11,5 12,5 0 0 32 11 12 0 0 1 Gala 35 20 21 0 0 35,5 20 21 0 0 1 Gala 30 29 30 0 0 30 29 30 0 0 1 Evereste 17,5 n,n 0,1 0 0 17,5 n,n 0,1 0 0 2 Evereste 17 n,n 0,1 0 0 17 n,n 0,1 0 0 2 Evereste 22 n 0,1 0 0 22 n,n 0,1 0 0 1 Evereste 17,5 n,b 0,5 0 0 18 n,b 0,5 0 0 1 Evereste 23 n 0,1 0 0 23 n,b 0,5 0 0 1 Evereste 22 n 0,1 0 0 22 n,n 0,1 0 0 1 Evereste 23 n 0,1 0 0 23 n,n 0,1 0 0 1 Evereste 17 n,b 0,5 0 0 17 n,b 0,5 0 0 1 1408 19 n,n 0,1 0 0 19 n,n 0,1 0 0 2 1408 21,5 n,n 0,1 0 0 21,5 n,n 0,1 0 0 2 1408 29 bs,n 1 0 0 29,5 bs,n 1 0 0 1 1408 28,5 n,bs 1 0 0 28 n,bs 1 0 0 1 1408 22 b(g),bs 1 0 0 22,5 b,bs 0,5 0 0 1 1408 24,5 bs,bsa 1 1 0 24,5 bs,A 1 1 0 1 1408 37 bs,bs 1 0 0 36,5 bs,bs 1 0 0 1 1408 26 n,b 0,5 0 0 26 n,b 0,5 0 0 1 1402 17 n,n 0,1 0 0 17,5 n,n 0,1 0 0 2 1402 15 b,bs 1 0 0 15 b,b 0,5 0 0 2 1402 24 n,bs 1 0 0 23,5 b,A 0,5 0 0,5 1 1402 18,5 ag,b 0,5 1 0 18,5 A,b 0,5 1,5 0,5 1 1402 31 n,BS 1 4 0 31 n,bs 1 4 0 1 1402 25,5 bs,bs 1 1 0 25,5 bs,bs 1 0 0 1 1402 16,5 b,bs 1 0,5 0 16,5 n,bs 1 0 0 2 1402 18,5 b,b 0,5 0 0 18 b,A 0,5 0 0,5 1 1402 19,5 bs,b 1 2 0 19,5 bs,b 1 2 0 1 1402 18,5 bs,bs 0,5 0,5 0 19 bs,A 1 0 0 1 1402 29,5 b,bs 1 2 0 30 b,bs 1 5,5 0 1 1402 27,5 bso,bso 1 3 0 27,5 bs,bs 1 5 0 1 1402 27 a,a 0,1 0 0,9 27,5 A,A 1 0 0 1 1402 23,5 b,bg 0,5 0 0 23 b,bg 0,5 0 0 1 1402 30 bs,bs 1 0 0 30 bs,bs 1 3,5 0 1 1400 19 n,A 1 0 0 19 n,a 0,1 0 0,9 2 1400 16,5 n,b 0,5 0 0 17 n,b 0,5 0 0 2 1400 22,5 bs,n 1 0 0 22,5 A,n 0,1 3 0,9 1 1400 20 ng,a 0,1 0 0,9 20 n,a 0,1 2 0,9 1
- 41 -
Proof of functionality of FB_MR5
shoot nec necvalue E35 B35 line 35dpi 35dpi 35dpi dpi dpi pll0* pll7* pll14* pll21* pll28* MR5 0,65 0,65 0,65 0,65 0,65 Gala 0,71 0,00 0,00 0,54 0,54 Gala 18 12,5 13,5 0 0 0,56 15,79 57,89 70,27 73,68 Gala 29,5 29,5 30,5 0 0 0,32 6,35 100,00 100,00 100,00 Gala 28 28 29 0 0 0,36 12,07 96,55 100,00 100,00 Gala 20,5 20,5 21,5 0 0 0,48 11,63 79,07 100,00 100,00 Gala 38,5 38,5 39,5 0 0 0,26 7,69 93,67 100,00 100,00 Gala 25 25 26 0 0 0,39 9,80 90,20 100,00 100,00 Gala 20 15 16 0 0 0,50 5,00 66,67 73,81 73,81 Gala 18 18 19 0 0 0,56 10,26 86,84 100,00 100,00 1408 0,51 0,50 0,49 0,49 2,50 1408 23,5 bs,b 1 4,5 0 0,45 4,26 4,08 4,08 4,08 1408 20,5 b,n 0,5 0 0 0,57 0,49 0,48 0,47 2,33 1408 21 5,5 6,5 0 0 0,48 8,70 31,82 31,82 29,55 1408 27,5 b,b 0,5 0 0 0,44 0,37 0,36 0,36 1,79 1408 20,5 b,a 0,5 0 0 0,50 4,88 4,65 4,76 2,38 1408 27,5 bs,b 1 0 0 0,38 3,57 3,45 3,57 3,51 1408 32,5 a,bs 1 0 0 0,31 2,99 2,94 2,99 2,99 1408 23,5 a,a 1 0 0 0,43 0,42 2,04 4,08 4,08 1408 27,5 b,a 0,5 0 0,5 0,36 3,51 3,57 3,57 3,51 Gala 0,37 3,64 20,37 20,37 22,22 Gala 31 11,5 12,5 0 0 0,33 10,61 37,50 37,50 37,50 Gala 34 34 35 0 0 0,31 17,39 72,46 76,06 100,00 Gala 23 2 3 1 0 0,42 4,17 14,29 12,50 14,58 Gala 32,5 32,5 33,5 0 0 0,31 8,96 94,03 93,94 100,00 Gala 33 32 33 3 0 0,31 8,96 95,45 97,06 97,06 Gala 34,5 33,5 34,5 0 0 0,29 10,14 88,57 91,43 95,71 Gala 28,5 27,5 28,5 0 0 0,36 13,56 96,61 96,61 96,61 Gala 28 10,5 11,5 0 0 0,37 17,54 41,38 40,68 40,68
- 42 -
Chapter 1)
shoot nec necvalue E35 B35 line 35dpi 35dpi 35dpi dpi dpi pll0 pll7* pll14* pll21* pll28* Gala 32 11 12 0 0 0,31 6,06 36,36 37,88 36,36 Gala 35 20 21 0 0 0,29 9,86 58,33 58,33 57,53 Gala 30,5 29,5 30,5 0 0 0,34 14,52 95,24 96,77 96,77 Evereste 0,57 0,56 0,54 0,54 0,54 Evereste 0,59 0,57 0,56 0,56 0,56 Evereste 22 n,n 0,1 0 0 0,48 0,44 0,43 0,43 0,43 Evereste 18 n,b 0,5 0 0 0,56 0,53 2,63 2,70 2,63 Evereste 23 n,b 0,5 0 0 0,45 0,43 0,42 0,42 2,08 Evereste 22,5 n,b 0,5 0 0 0,63 0,45 0,43 0,43 0,43 Evereste 23 n,n 0,1 0 0 0,45 0,42 0,42 0,42 0,42 Evereste 17 b,b 0,5 0 0 0,57 0,56 0,56 2,78 2,78 1408 0,50 0,50 0,50 0,50 0,50 1408 0,48 0,44 0,44 0,44 0,44 1408 29 bs,b 1 0 0 0,33 1,67 3,33 3,33 3,28 1408 28,5 bs,b 1 0 0 0,34 3,51 3,39 3,39 3,45 1408 22,5 bs,b 1 0 0 0,49 2,22 4,55 4,35 2,13 1408 25 bs,a 1 1 0 0,40 3,92 3,85 3,92 3,92 1408 36 bs,bs 1 0 0 0,29 2,74 2,67 2,63 2,67 1408 26,5 n,b 0,5 0 0 0,39 0,37 0,36 1,85 1,85 1402 0 0,54 0,56 0,56 0,56 0,54 1402 0 0,63 3,13 6,25 6,25 3,13 1402 24 b,a 0,5 0 0,5 0,43 2,04 4,17 4,00 2,04 1402 18,5 b,a 0,5 0 0,5 0,63 2,63 5,26 2,56 2,56 1402 31 bs,b 1 4 0 0,34 0,31 3,17 3,13 3,13 1402 25,5 bs,bs 1 3 0 0,38 7,69 3,85 3,77 3,77 1402 0,59 5,71 5,71 5,71 5,71 1402 18 b,a 0,5 0 0,5 0,54 2,70 2,63 2,56 2,63 1402 20 b,bs 1 7 0 0,51 4,88 4,88 4,88 4,88 1402 19 bs,a 1 0 0 0,54 5,41 5,26 2,56 5,00 1402 30 bs,b 1 5,5 0 0,33 3,23 3,28 3,28 3,23 1402 27,5 bs,bs 1 7 0 0,43 3,64 3,51 3,51 3,51 1402 27 a,a 1 0 0 0,36 0,35 3,57 0,36 3,51 1402 23 b,b 0,5 0 0 0,43 0,42 0,42 2,04 2,08 1402 30,5 bs,bs 1 3,5 0 0,35 3,28 3,23 3,23 3,23 1400 0,51 0,50 0,50 5,00 0,50 1400 0,59 0,57 2,86 2,86 2,78 1400 22,5 b,a 0,5 4 0,5 0,47 0,43 2,17 4,26 0,43 1400 20 a,a 0,1 0 0,9 0,63 2,44 2,44 0,48 0,48
- 43 -
Proof of functionality of FB_MR5
pll0 pll7 pll14 pll21 pll28 necvalue necvalue necvalue necvalue necvalue line w w w w w growth line 0dpiw 7dpiw 14dpiw 21dpiw 28dpiw MR5 0,65 0,65 6,45 6,45 6,45 0 MR5 0,10 0,1 1 1 1 Gala 0,71 0,00 0,00 0,54 0,54 4,5 Gala 0,10 0 0 0,1 0,1 Gala 0,56 15,79 57,89 70,27 73,68 1 Gala 0,10 3 11 13 14 Gala 0,32 6,35 100,00 100,00 100,00 -0,5 Gala 0,10 2 31 31 31 Gala 0,36 12,07 96,55 100,00 100,00 0,5 Gala 0,10 3,5 28 29 28,5 Gala 0,48 11,63 79,07 100,00 100,00 0,5 Gala 0,10 2,5 17 22 21,5 Gala 0,26 7,69 93,67 100,00 100,00 2 Gala 0,10 3 37 40 40 Gala 0,39 9,80 90,20 100,00 100,00 0 Gala 0,10 2,5 23 25,5 25,5 Gala 0,50 5,00 66,67 73,81 73,81 1 Gala 0,10 1 14 15,5 15,5 Gala 0,56 10,26 86,84 100,00 100,00 1,5 Gala 0,10 2 16,5 19,5 19,5 1408 0,51 0,50 0,49 0,49 2,50 0,5 1408 0,10 0,1 0,1 0,1 0,5 1408 0,45 4,26 6,12 20,41 20,41 2,5 1408 0,10 1 1,5 5 5 1408 0,57 0,49 0,48 0,47 2,33 4 1408 0,10 0,1 0,1 0,1 0,5 1408 0,48 8,70 31,82 31,82 29,55 1 1408 0,10 2 7 7 6,5 1408 0,44 0,37 0,36 0,36 1,79 5,5 1408 0,10 0,1 0,1 0,1 0,5 1408 0,50 4,88 4,65 4,76 4,76 1 1408 0,10 1 1 1 1 1408 0,38 3,57 3,45 3,57 3,51 2 1408 0,10 1 1 1 1 1408 0,31 2,99 2,94 2,99 5,97 1,5 1408 0,10 1 1 1 2 1408 0,43 0,42 2,04 4,08 4,08 1,5 1408 0,10 0,1 0,5 1 1 1408 0,36 3,51 3,57 7,14 3,51 1 1408 0,10 1 1 2 1 Gala 0,37 3,64 22,22 20,37 22,22 0 Gala 0,10 1 6 5,5 6 Gala 0,33 10,61 37,50 37,50 37,50 2 Gala 0,10 3,5 12 12 12 Gala 0,31 17,39 72,46 76,06 100,00 3 Gala 0,10 6 25 27 35,5 Gala 0,42 4,17 14,29 12,50 14,58 0 Gala 0,10 1 3,5 3 3,5 Gala 0,31 8,96 94,03 93,94 100,00 1 Gala 0,10 3 31,5 31 33,5 Gala 0,31 8,96 95,45 97,06 97,06 1,5 Gala 0,10 3 31,5 33 33 Gala 0,29 10,14 88,57 91,43 95,71 1 Gala 0,10 3,5 31 32 33,5 Gala 0,36 13,56 96,61 96,61 96,61 2 Gala 0,10 4 28,5 28,5 28,5 Gala 0,37 17,54 41,38 40,68 40,68 2,5 Gala 0,10 5 12 12 12
- 44 -
Chapter 1)
pll0 pll7 pll14 pll21 pll28 necvalue necvalue necvalue necvalue necvalue line w w w w w growth line 0dpiw 7dpiw 14dpiw 21dpiw 28dpiw Gala 0,31 6,06 36,36 37,88 36,36 0,5 Gala 0,10 2 12 12,5 12 Gala 0,29 9,86 58,33 58,33 57,53 2 Gala 0,10 3,5 21 21 21 Gala 0,34 14,52 95,24 96,77 96,77 1,5 Gala 0,10 4,5 30 30 30 Evereste 0,57 0,56 0,54 0,54 0,54 1 Evereste 0,10 0,1 0,1 0,1 0,1 Evereste 0,59 0,57 0,56 0,56 0,56 1 Evereste 0,10 0,1 0,1 0,1 0,1 Evereste 0,48 0,44 0,43 0,43 0,43 2 Evereste 0,10 0,1 0,1 0,1 0,1 Evereste 0,56 0,53 2,63 2,70 2,63 1 Evereste 0,10 0,1 0,5 0,5 0,5 Evereste 0,45 0,43 0,42 0,42 2,08 2 Evereste 0,10 0,1 0,1 0,1 0,5 Evereste 0,63 0,45 0,43 0,43 0,43 7 Evereste 0,10 0,1 0,1 0,1 0,1 Evereste 0,45 0,42 0,42 0,42 0,42 2 Evereste 0,10 0,1 0,1 0,1 0,1 Evereste 0,57 0,56 0,56 2,78 2,78 0,5 Evereste 0,10 0,1 0,1 0,5 0,5 1408 0,50 0,50 0,50 0,50 0,50 0 1408 0,10 0,1 0,1 0,1 0,1 1408 0,48 0,44 0,44 0,44 0,44 1,5 1408 0,10 0,1 0,1 0,1 0,1 1408 0,33 1,67 6,67 3,33 3,28 0,5 1408 0,10 0,5 2 1 1 1408 0,34 3,51 3,39 3,39 3,45 0 1408 0,10 1 1 1 1 1408 0,49 2,22 4,55 4,35 2,13 3 1408 0,10 0,5 1 1 0,5 1408 0,40 3,92 3,85 7,84 7,84 0,5 1408 0,10 1 1 2 2 1408 0,29 2,74 2,67 2,63 2,67 2,5 1408 0,10 1 1 1 1 1408 0,39 0,37 0,36 1,85 1,85 1,5 1408 0,10 0,1 0,1 0,5 0,5 1402 0,54 0,56 0,56 0,56 0,54 0 1402 0,10 0,1 0,1 0,1 0,1 1402 0,63 3,13 6,25 6,25 3,13 0 1402 0,10 0,5 1 1 0,5 1402 0,43 2,04 4,17 4,00 4,08 1,5 1402 0,10 0,5 1 1 1 1402 0,63 2,63 5,26 7,69 12,82 3,5 1402 0,10 0,5 1 1,5 2,5 1402 0,34 0,31 9,52 15,63 15,63 2,5 1402 0,10 0,1 3 5 5 1402 0,38 7,69 3,85 7,55 3,77 0,5 1402 0,10 2 1 2 1 1402 0,59 5,71 8,57 8,57 5,71 0,5 1402 0,10 1 1,5 1,5 1 1402 0,54 2,70 2,63 2,56 5,26 0,5 1402 0,10 0,5 0,5 0,5 1 1402 0,51 4,88 4,88 14,63 14,63 1 1402 0,10 1 1 3 3 1402 0,54 5,41 5,26 5,13 5,00 1,5 1402 0,10 1 1 1 1 1402 0,33 3,23 3,28 9,84 20,97 1 1402 0,10 1 1 3 6,5 1402 0,43 3,64 3,51 14,04 21,05 5,5 1402 0,10 1 1 4 6 1402 0,36 0,35 3,57 3,57 3,51 1 1402 0,10 0,1 1 1 1 1402 0,43 0,42 0,42 2,04 2,08 0,5 1402 0,10 0,1 0,1 0,5 0,5 1402 0,35 3,28 3,23 3,23 14,52 2,5 1402 0,10 1 1 1 4,5 1400 0,51 0,50 5,00 5,00 5,00 0,5 1400 0,10 0,1 1 1 1 1400 0,59 0,57 2,86 2,86 2,78 1 1400 0,10 0,1 0,5 0,5 0,5 1400 0,47 0,43 2,17 4,26 17,02 2 1400 0,10 0,1 0,5 1 4 1400 0,63 2,44 2,44 4,76 14,29 5 1400 0,10 0,5 0,5 1 3
- 45 -
Proof of functionality of FB_MR5
Supplementary table 2) Average PLL 7, 14, 21 and 28 days post inoculation with E. amylovora. PLL is calculated in comparison to total shoot length at the day of measurement.
average average average average Line PLL 7 dpi PLL 14 dpi PLL 21 dpi PLL 28 dpi Gala 9,71 67,69 71,61 73,48 Transgenic 2,18 3,25 3,55 2,82 1400 0,99 1,99 3,15 1,04 1402 3,06 3,72 3,23 3,26 1408 2,5 4,05 4,26 4,16
- 46 -
Chapter 1)
Supplementary table 3) PLL values of individual plants at different time points. One outlier was spotted in the transgenic line 1408 (indicated in bold). For complete dataset see supplementary table 2.
line pll0 pll7 pll14 pll21 pll28 1400 0,51 0,50 0,50 5,00 0,50 1400 0,59 0,57 2,86 2,86 2,78 1400 0,47 0,43 2,17 4,26 0,43 1400 0,63 2,44 2,44 0,48 0,48 1402 0,54 0,56 0,56 0,56 0,54 1402 0,63 3,13 6,25 6,25 3,13 1402 0,43 2,04 4,17 4,00 2,04 1402 0,63 2,63 5,26 2,56 2,56 1402 0,34 0,31 3,17 3,13 3,13 1402 0,38 7,69 3,85 3,77 3,77 1402 0,59 5,71 5,71 5,71 5,71 1402 0,54 2,70 2,63 2,56 2,63 1402 0,51 4,88 4,88 4,88 4,88 1402 0,54 5,41 5,26 2,56 5,00 1402 0,33 3,23 3,28 3,28 3,23 1402 0,43 3,64 3,51 3,51 3,51 1402 0,36 0,35 3,57 0,36 3,51 1402 0,43 0,42 0,42 2,04 2,08 1402 0,35 3,28 3,23 3,23 3,23 1408 0,51 0,50 0,49 0,49 2,50 1408 0,45 4,26 4,08 4,08 4,08 1408 0,57 0,49 0,48 0,47 2,33 1408 0,48 8,70 31,82 31,82 29,55 1408 0,44 0,37 0,36 0,36 1,79 1408 0,50 4,88 4,65 4,76 2,38 1408 0,38 3,57 3,45 3,57 3,51 1408 0,31 2,99 2,94 2,99 2,99 1408 0,43 0,42 2,04 4,08 4,08 1408 0,36 3,51 3,57 3,57 3,51 1408 0,50 0,50 0,50 0,50 0,50 1408 0,48 0,44 0,44 0,44 0,44 1408 0,33 1,67 3,33 3,33 3,28 1408 0,34 3,51 3,39 3,39 3,45 1408 0,49 2,22 4,55 4,35 2,13 1408 0,40 3,92 3,85 3,92 3,92 1408 0,29 2,74 2,67 2,63 2,67 1408 0,39 0,37 0,36 1,85 1,85
- 47 -
Proof of functionality of FB_MR5 line pll0 pll7 pll14 pll21 pll28 Evereste1 0,57 0,56 0,54 0,54 0,54 Evereste1 0,59 0,57 0,56 0,56 0,56 Evereste1 0,48 0,44 0,43 0,43 0,43 Evereste1 0,56 0,53 2,63 2,70 2,63 Evereste1 0,45 0,43 0,42 0,42 2,08 Evereste1 0,63 0,45 0,43 0,43 0,43 Evereste1 0,45 0,42 0,42 0,42 0,42 Evereste1 0,57 0,56 0,56 2,78 2,78 Malus ×robusta 5 0,65 0,65 0,65 0,65 0,65 Gala 0,37 3,64 20,37 20,37 22,22 Gala 0,33 10,61 37,50 37,50 37,50 Gala 0,31 17,39 72,46 76,06 100,00 Gala 0,42 4,17 14,29 12,50 14,58 Gala 0,31 8,96 94,03 93,94 100,00 Gala 0,31 8,96 95,45 97,06 97,06 Gala 0,29 10,14 88,57 91,43 95,71 Gala 0,36 13,56 96,61 96,61 96,61 Gala 0,37 17,54 41,38 40,68 40,68 Gala 0,31 6,06 36,36 37,88 36,36 Gala 0,29 9,86 58,33 58,33 57,53 Gala 0,34 14,52 95,24 96,77 96,77 Gala1 0,71 0,00 0,00 0,54 0,54 Gala1 0,56 15,79 57,89 70,27 73,68 Gala1 0,32 6,35 100,00 100,00 100,00 Gala1 0,36 12,07 96,55 100,00 100,00 Gala1 0,48 11,63 79,07 100,00 100,00 Gala1 0,26 7,69 93,67 100,00 100,00 Gala1 0,39 9,80 90,20 100,00 100,00 Gala1 0,50 5,00 66,67 73,81 73,81 Gala1 0,56 10,26 86,84 100,00 100,00
- 48 -
Chapter 1)
- 49 - Development of the First Cisgenic Apple with Increased Resistance to Fire Blight
Chapter 2)
Development of the First Cisgenic Apple with Increased Resistance to Fire Blight
Published as:
Kost TD, Gessler C, Jänsch M, Flachowsky H, Patocchi A, Broggini GAL (2015) Development of the First Cisgenic Apple with Increased Resistance to Fire Blight. PLoS ONE 10(12): e0143980. doi:10.1371/journal.pone.0143980 (accepted 01.12.2015)
- 50 - Chapter 2)
Abstract The generation and selection of novel fire blight resistant apple genotypes would greatly improve the management of this devastating disease, caused by Erwinia amylovora. Such resistant genotypes are currently developed by conventional breeding, but novel breeding technologies including cisgenesis could be an alternative approach. A cisgenic apple line C44.4.146 was regenerated using the cisgene FB_MR5 from wild apple Malus ×robusta 5 (Mr5), and the previously established method involving A. tumefaciens-mediated transformation of the fire blight susceptible cultivar ‘Gala Galaxy’ using the binary vector p9-Dao-FLPi. The line C44.4.146 was shown to carry only the cisgene FB_MR5, controlled by its native regulatory sequences and no transgenic sequences were detected by PCR or Southern blot following heat induced recombinase-mediated elimination of the selectable markers. Although this line contains up to 452 bp of vector sequences, it still matches the original definition of cisgenesis. A single insertion of T-DNA into the genome of 'Gala Galaxy' in chromosome 16 was identified. The transcription level of FB_MR5 in line C44.4.146 was similar to the transcription level in classically bred descendants of Mr5. Three independent shoot inoculation experiments with a Mr5 avirulent strain of Erwinia amylovora were performed using scissors or syringe. Significantly lower disease symptoms were detected on shoots of the cisgenic line compared to those of untransformed 'Gala Galaxy'. Despite the fact that the pathogen can overcome this resistance by a single nucleotide mutation, this is, to our knowledge, the first prototype of a cisgenic apple with increased resistance to fire blight.
- 51 -
Development of the First Cisgenic Apple with Increased Resistance to Fire Blight
Introduction Apple is one of the most important fruit crops worldwide considering its production level of 80.8 million tons per year [1]. Apple production relies on a small number of commercial cultivars. Most of today’s successful cultivars such as 'Braeburn', 'Fuji', 'Gala', 'Golden Delicious', 'Jonagold' and 'Cripps Pink' are susceptible to fire blight [2, 3] and to other major plant diseases like apple scab. For a long time resistance to diseases was often neglected in many breeding programs as the main focus was on fruit quality combined with optimal agronomical properties [4] and only in the last decades of the previous century, did disease resistance begin to gain relevance [5-9]. This occurred with increasing awareness of the ecological and economical costs of disease management strategies relying on plant protective chemicals only. High levels of resistance to diseases are often found in wild Malus accessions, e.g. the Rvi6 (alias Vf) resistance gene from M. floribunda clone 821 conferring resistance to apple scab [10] caused by Venturia inaequalis, or the FB_MR5 of M. ×robusta 5 which confers resistance to fire blight [11] caused by Erwinia amylovora. When such resistances are introduced into a breeding program, at least 5 pseudo backcrosses are then necessary to remove the unwanted properties inherited from the wild ancestor (e.g. small fruits) together with the resistance. Considering that the juvenile phase of the domesticated apple lasts between three and twelve years (and linkage drag), the introduction of a resistance from a wild source takes between 20 to 50 years until a cultivar with fruit of marketable quality can be released [12]. The rapid advancement in gene cloning in apple and in genetic transformation methods allows the deployment of resistances by means of genetic modification [13]. In particular cisgenesis may be considered for the goal of adding a particular resistance gene to cultivars of commercial value [14]. Schouten et al. [14] defined a cisgenic plant as a plant that does not contain any transgenes and that has been genetically modified with one or more genes (containing introns and flanking regions such as native promoter and terminator regions in sense orientation), isolated from a crossable donor plant. The recent identification and cloning of several apple resistance genes like Rvi6 [15], Rvi15 [16, 17], Pl2 [18], FB_MR5 [19], as well as the development of methods to generate marker-free genetically modified apple plants [20-22] are the basic requirements for developing cisgenic apple lines. The first cisgenic apple lines with scab resistance were developed by Vanblaere et al. [23]. Würdig et al. [24] and Krens et al. [25] later developed further cisgenic apple lines with Rvi6.
The most problematic bacterial disease in apple orchards is fire blight, caused by the Gram-negative bacteria Erwinia amylovora (Burrill) Winslow et al. [26]. It causes severe losses in years of heavy epidemics, with economical costs reaching up to several million Euros per year in single European countries or US states [27-29]. The use of fire blight resistant cultivars is a tool that is currently not popular in the management of the disease. This is because the very few commercial cultivars showing high levels of resistance to the disease including ‘Rewena’ [30] and ‘Enterprise’ [31], do not fully meet retailers and consumers demand, because their level of fruit and tree quality is not comparable with the top world varieties. Good levels of fire blight resistance were found in individual accessions of different wild apple species like M. fusca [32], M. baccata [33], M. prunifolia [34], M. ×atrosanguinea [35], M. ×robusta var. persicifolia [36] and M. sieversii [37] as well as in ‘Evereste’ [38, 39], M. floribunda 821 [38] and Malus ×robusta 5 [11]. In the last decade the resistance of the crab apple genotype Malus ×robusta 5 has been studied in depth. Peil et al. [11] identified a major QTL on linkage group 3 of M. ×robusta 5. Later on, Fahrentrapp
- 52 -
Chapter 2) et al. [40] identified a candidate resistance gene in this region, which was designated as FB_MR5, and predicted to code for a CC-NBS-LRR resistance protein. The functionality of the FB_MR5 gene under its native promotor and terminator sequences and under the constitutive CaMV 35S promoter and ocs terminator, respectively, was demonstrated [19]. Vogt et al. [41] suggested that this resistance undergoes a gene-for-gene interaction, as a single amino acid substitution in the avrRpt2EA gene of E. amylovora, is sufficient to allow the pathogen to become virulent and to overcome this resistance. In the present study the generation of a cisgenic 'Gala Galaxy' line carrying the FB_MR5 gene showing increased resistance to fire blight is presented. In vitro shoot cultures of 'Gala Galaxy' were transformed with the novel binary transformation vector p9-Dao-FLPi [24], allowing the post- transformation heat induced flippase (Flp) based removal of the excisable cassette containing three transgenes (NptII, Flp and dao1). Although it was not possible to use the selectable marker dao1 to increase the number of regenerants of lines without transgenes, a cisgenic line C44.4.146 was identified. Being FB_MR5 controlled by its native promotor and terminator, this line matches the definition of cisgenic plants of Schouten et al. [14]. The level of fire blight resistance of this line was assessed by means of two different shoot inoculation methods and compared with untransformed 'Gala Galaxy' plants. Further characterization of this line involved the assessment of the number of T- DNA integrations, site of integration in the genome, and transcription level of the FB_MR5 gene in this line compared to conventionally bred genotypes carrying the FB_MR5 gene. To our knowledge, this is the first report of a cisgenic apple with increased resistance to fire blight.
- 53 -
Development of the First Cisgenic Apple with Increased Resistance to Fire Blight
Results Generation of the cisgenic line C44.4.146 From two Agrobacterium-mediated transformation experiments T44 and T45, with vector p9-Dao- FLPi-FB_MR5 (Fig 1), eleven and two transgenic lines were obtained, corresponding to transformation efficiencies (transformants per explants) of 13.8 % and 0.7 %, respectively. Integration of FB_MR5 (amplicon D, Fig 2) and NptII (amplicon B, Fig 2) was confirmed in all 13 lines and in two cases of T44, integration of backbone sequences was detected (S1 Fig). Those two lines were removed, as lines with backbone usually do not lead to cisgenic plants. Nine out of the eleven remaining transgenic lines (seven from T44 and two from T45) produced sufficient leaf material to be subjected to heat shock. About 3,200 explants were subjected to heat shock activation of the Flp recombinase. The negative D- amino acid / dao1 selection system proposed by Hättasch et al. [42] could not be applied, as it was recently found that the selective medium containing D-Ile hinders the regeneration [24]. On this account PCR was used to screen the obtained putative cisgenic regenerants. Four out of 447 regenerants contained FB_MR5 and were free of selection marker (S2 Fig). Because all four regenerants originated from calli from the same transgenic mother line T44.4, and assuming a consistent excision process, we consider them to be the same genotype. Nevertheless only one shoot of the four regenerants was designated as line C44.4.146 and used for micrografting on 'Golden Delicious' seedlings for further characterization. PCR confirmed the presence of FB_MR5 (amplicon D, Fig 3), absence of both transgenes NptII (amplicon B, Fig 3) and Flp (amplicon C, Fig 3) plus absence of backbone sequences beyond the left border in this line after micrografting (amplicon A, Fig 1).
- 54 -
Chapter 2)
Fig 1. Map of the p9-Dao-FLPi-FB_MR5 vector used for transformations. Apple exogenous genes (transgenes) are colored in red, cisgene FB_MR5 with native coding elements in green and vector backbone in grey. Left border (LB), flippase recognition target (FRT), neomycin phosphotransferase II (NptII), D-amino acid oxidase 1 (dao1), flippase (Flp) and right border (RB) are indicated. Primer positions are shown as green triangles outside the vector. Relative position of amplicons A, B, C and D for further analysis (Figs 2 and 3) are indicated. Amplification of A indicates the presence of sequences beyond the left border.
- 55 -
Development of the First Cisgenic Apple with Increased Resistance to Fire Blight
Fig 2. Schematic representation of insertion site before and after heat shock induction leading to cisgenic line C44.4.146. (legend on next page).
- 56 -
Chapter 2)
Fig 2. Schematic representation of insertion site before and after heat shock induction leading to cisgenic line C44.4.146. (legend on next page) Transgenes neomycin phosphotransferase II (NptII), D-amino acid oxidase 1 (dao1) and flippase (Flp) are shown in red, genomic DNA of 'Golden Delicious' in yellow, regulatory elements in orange and FB _MR5 and regulatory sequences in green. Vector sequences in the cisgenic line are colored black and flippase recognition target (FRT) and original border sites are indicated in purple. Circles with letters indicate the amplicons resulting by PCR with the corresponding primers. Amplification of B and C indicates presence of the excisable cassette, amplification of D the presence of the cisgene FB_MR5. Amplicon E flanks the insertion site. F and G amplify the junction T- and genomic DNA at LB, and RB, respectively. In the structure of the insert in C44.4.146 both restriction sites BsaI and XbaI, used for Southern blot analysis and iPCR, respectively, are indicated.
- 57 -
Development of the First Cisgenic Apple with Increased Resistance to Fire Blight
Fig 3. Results of PCR tests to verify the presence / absence of backbone, FB_MR5, NptII and Flp. DNA template used for PCR was always loaded in the following order: Transgenic motherline T44.4, cisgenic line C44.4.146, 'Gala Galaxy' in vitro (Gala), Malus ×robusta 5 (Mr5), negative control (water) and vector p9-Dao-FLPi-FB_MR5 (plasmid). Marker (M) is GeneRulerTM 1 kb DNA ladder (Thermo Fisher scientific Inc. ©, Waltham, USA). Location of the backbone amplicon A is shown in Fig 1. Positions of primers of amplicons B, C and D are shown in Figs 1 and 2.
Copy number of C44.4.146 Using Southern hybridization a single specific band was detected with an NptII probe in the transgenic motherline T44.4, indicating that originally one copy of the T-DNA had been inserted (Fig 4A). In C44.4.146 this band was not detected confirming excision of the excisable cassette (Fig 4A). As expected 'Gala Galaxy' showed no hybridization with this probe. Southern hybridization with an FB_MR5 probe allowed the identification of an unspecific band in 'Gala Galaxy', while C44.4.146 and T44.4 showed a single additional FB_MR5-specific band (Fig 4B).
- 58 -
Chapter 2)
Fig 4. Determination of copy number by Southern hybridization using a NptII (A) or FB_MR5 (B) specific probe. A) A single copy of NptII was detectable in the transgenic motherline (T44.4) and in the vector p9-Dao-FLPi-FB_MR5 (plasmid) when probed with an NptII specific digoxygenin (DIG)-labelled probe. B) Using the FB_MR5 probe an unspecific band was detected in 'Gala Galaxy' in vitro (Gala), line C44.4.146 and its motherline T44.4. An additional, FB_MR5 specific band was visible in T44.4, C44.4.146 and in p9-Dao-FLPi-FB_MR5.
Integration site of C44.4.146 The genomic region flanking the insertion site in line C44.4.146 was identified using iPCR. The sequence from the RB site showed highest level of sequence identity to a sequence of the 'Golden Delicious' contig MDC012271.181 located on chromosome 16. No gene was predicted at the insertion site. Furthermore, mapping the reads generated by Gusberti et al. [43] did not reveal any novel transcript at the insertion site. The closest gene was MDP0000141330 (coding for a transmembrane transporter) at about 600 bp. Primer pairs IS146-1163F/IS146-321R (amplicon F, Fig 5), and IS146-1391R/iPCR- RBout (amplicon G, Fig 5) were designed to characterize the insertion site in line C44.4.146 at left border (LB) and right border (RB), respectively (Fig 2). These primers can be used to discriminate between C44.4.146 or T44.4 lines and the not genetically modified ‘Gala Galaxy’. Using the primers IS146-1163F/IS146-1391R (amplicon E, Fig 2), which flank the insertion site, no large fragments (eight kb in C44.4.146 or 14 kb in T44.4) were amplified by standard PCR conditions but a small PCR product was amplified corresponding to the second allele of contig MDC012271.181 present in C44.4.146, T44.4 and presumably in both alleles of 'Gala Galaxy' (amplicon E, Fig 5). Sequencing of the F and G PCR products (Fig 2) from C44.4.146 covering the genomic T-DNA junctions (amplicons F and G, Fig 2) revealed that 22 base pairs (bps) of the RB sequence were trimmed away and only two bps of the RB were found in C44.4.146, while a total of 63 bps including the LB itself were trimmed away on the opposite T-DNA side (Fig 2). The T-DNA insertion led to the loss of 36 bps of apple genomic sequences (MDC012271.181, bps 1287-1322). In addition, in line C44.4.146, beside the endogenous sequences of FB_MR5 gene (4167 bps) flanked by 1995 bp native 5’-UTR and 1547 bp
- 59 -
Development of the First Cisgenic Apple with Increased Resistance to Fire Blight native 3’-UTR, 358 bps (including flippase recognition target (FRT)) and 94 bps of p9-Dao-FLPi vector derived apple exogenous sequences were found at LB side and RB side of the T-DNA, respectively.
Fig 5. Results of PCR test of amplicons spanning the insertion site. PCR was performed with DNA of cisgenic line C44.4.146, T44.4, ‘Gala Galaxy’ in vitro (Gala) and the resistance donor M ×robusta 5 (Mr5). Water was used as negative control. Amplicons F and G are specific to T44.4 and C44.4.146 and can be used for discrimination purposes of these lines from ‘Gala Galaxy’. Location of the amplicons and corresponding primers are shown in Fig 2. It is presumed that E amplifies in 'Gala Galaxy' two alleles while only one is amplified in T44.4 and C44.4.146 (Fig 2 and results) as the second amplicon, containing the inserted T-DNA sequence, is too large to be amplified.
Transcription level of FB_MR5 Transcription level of FB_MR5 was estimated and compared with two classically bred FB_MR5 accessions (ACW 22161 and ACW 22176). It was observed that the CT values of both target amplicons, EF1α and FB_MR5, differed largely, with CT values for EF1α in the range between 20 and 28, while for
FB_MR5 they were between 30 and 49, whereas only few samples showed CTFB_MR5 values above 40 (S3 Table). However we observed no significant difference between transcription ratio in line C44.4.146 and in accession ACW 22176 and only one replicate of ACW 22161 (I) differed significantly from one replicate of C44.4.146 (III, Fig 6). This replicate of ACW 22161 (I) also differed significantly from its own biological replicate (III, Fig 6). As a negative control the fire blight susceptible 'Gala Galaxy' was used. No amplification of the FB_MR5 probe (S3 Table).
- 60 -
Chapter 2)
Fig 6. Comparison of the FB_MR5 transcription level of C44.4.146 and two classically bred FB_MR5 lines (ACW 22161 and ACW 22176). Three biological replicates are shown (I, II and III). For each of them three to eight technical replicates were created. Different capital letters indicate statistically significant differences (Steel-Dwass test with α = 0.05).
Fire blight resistance of the cisgenic line C44.4.146 The cisgenic line C44.4.146 showed increased fire blight resistance compared to non-transformed 'Gala Galaxy' control plants in three independent inoculation experiments 21 days after inoculation with E. amylovora strain EA222_JKI in the greenhouse (Fig 7). In the first experiment the cisgenic line C44.4.146 showed significantly (Wilcoxon test p-value < 0.0001) less symptoms (11.4 % ± 17.7 % PLL) compared to 'Gala Galaxy' (69.3 % ± 12.1) three weeks after scissors inoculation. Four out of twelve inoculated shoots of C44.4.146 showed small necroses at the stem, while the other eight shoots showed necroses limited to the midvein of the inoculated leaves. In contrast, all 'Gala Galaxy' plants showed strong stem necroses (Fig 8). In a second inoculation experiment when shoots were directly injected with E. amylovora using a syringe, the cisgenic line C44.4.146 showed a mean PLL of 41.1 % ± 15.0 %, which resulted to be significantly different from the mean PLL of 'Gala Galaxy' showing 73.9 % ± 16.5 % (Wilcoxon test p-value < 0.0001, Fig 7). All plants of both genotypes except one plant of C44.4.146 showed necrosis expanding along the stem. In a third experiment both inoculation methods were compared simultaneously. 21 days after inoculation, all inoculated plants showed some necroses. The cisgenic C44.4.146 line showed 23.4 % ± 19.3 % PLL while 'Gala Galaxy' showed 87.9 % ± 7.2 % PLL after syringe inoculation (Fig 7). Similar results were observed for the cisgenic plants (21.1 % ± 16.6 %
- 61 -
Development of the First Cisgenic Apple with Increased Resistance to Fire Blight
PLL) and 'Gala Galaxy' (75.2 % ± 5.5 % PLL) when inoculated using scissors (Fig 7). Using the Steel Dwass test, we observed significant differences (p-value < 0.02) between the PLL of line C44.4.146 and 'Gala Galaxy', independent of the inoculation method used (experiment 3, Fig 7).
Fig 7. Boxplot showing fire blight severity between shoots of C44.4.146 and 'Gala Galaxy'. Both lines underwent in vitro culture and similar treatment. Disease severity is expressed in percentage of lesion length (PLL) of the shoot of cisgenic (C44.4.146) and 'Gala Galaxy' in vitro plants (Gala), 21 days after inoculation in three independent experiments. Number of inoculated plants is indicated (replicates). Inoculations were performed either using scissors or syringe method. Each small box delimits values between 25 % and 75 % of the group. Bold horizontal line represents median of group. Whiskers are drawn for obtained values that differ least from median ± 1.5 interquartile ranges. Different letters show statistically significant differences (Steel Dwass test with α = 0.05) between groups in all experiments. Outliers are shown as empty circles.
- 62 -
Chapter 2)
Fig 8. Results of fire blight inoculation on grafted apple line C44.4.146 (left) and 'Gala Galaxy' in vitro (right). Picture taken 20 days after scissors inoculation with EA222_JKI (Fig 7, experiment 1).
- 63 -
Development of the First Cisgenic Apple with Increased Resistance to Fire Blight
Discussion In the present study a cisgenic apple of the cultivar 'Gala Galaxy' with increased resistance to fire blight was developed. The susceptible cultivar 'Gala Galaxy' acquired fire blight resistance by insertion of the resistance gene FB_MR5 flanked by its 1995 bp native 5’-UTR and 1547 bp native 3’-UTR. The same regulatory sequences were shown to effectively regulate the function of FB_MR5 in transgenic lines developed by Broggini et al. [19]. Cisgenic transformation was achieved using a novel vector p9-Dao- FLPi [24] for Agrobacterium-mediated transformation allowing the post-transformation heat-induced Flp-based excision of the transgene cassette. As a negative selection marker to exclude cells in which recombination did not occur, the gene dao1, encoding D-aminooxidase 1 [42], is present in the excisable cassette of p9-Dao-FLPi. However, this negative selection marker could not be applied, as it has recently been shown that the use of D-Ile containing medium (to remove cells in which the recombination did not occur) completely hinders the formation of cisgenic shoots and moreover transgenic shoots survived for several months on it [24]. Therefore we decided to regenerate lines without application of the D-Ile / dao1 system, using a regeneration medium without D-Ile and selecting the regenerants by PCR. Thereby cisgenic regenerants can be identified as they result in no PCR product after amplification with primers for the selectable marker cassette, in contrast to transgenic regenerants. Chimeric cisgenic-transgenic plants should lead to amplification of NptII and Flp according to the detection limit of PCR. Despite the hindering circumstances, a cisgenic genotype was identified (Fig 3). Nevertheless, a transformation vector with an effective negative selection would have been of great help to increase the number of regenerating cisgenic genotypes. Substitution of dao1 in p9-Dao-FLPi with codA could result in a pMF1-alternative vector with functional negative selection. This strategy was also proposed by Würdig et al. [24]. An approach with an alternative selectable marker could be the use of the MdMYB10 gene [44] originating from the apple gene pool, leading to visually detectable, red colored calli, shoots and fruits [25]. Line C44.4.146 was regenerated and molecularly investigated. We consider C44.4.146 as a cisgenic line, as PCR revealed that C44.4.146 amplified FB_MR5 but no transgenic selection markers (Fig 3). Southern blot hybridization indicated a single T-DNA insertion in this genotype, as well as the absence of NptII in the final cisgenic line C44.4.146 (Fig 4). On this account we consider the cisgenic line C44.4.146 to carry a single T-DNA insertion. FB_MR5 transcription level analysis revealed that the transcription level in this line was not different from the transcription in the FB_MR5 accessions ACW 22161 and ACW 22176 (Fig 6). Cisgene insertion in C44.4.146 occurred as a single copy on chromosome 16 (Fig 4). Gene prediction on contig MDC012271.181 indicates that no apple endogenous gene has been disrupted by the T-DNA insertion in line C44.4.146. 85 bps of T-DNA ends were trimmed away (63 bps on LB side, 22 bps on RB side) and T-DNA insertion resulted in the deletion of 36 bps genomic sequences (Fig 2). Trimming of T-DNA ends was also observed in cisgenic apple developed by Vanblaere et al. [45]. The extent of foreign sequences resulting in the final product generated using p9-Dao-FLPi without this trimming is larger than using pMF1 (538 bps vs 140 bps, [20]). While designing novel vectors to generate cisgenic genotypes only foreign sequences shorter than 20 bps can be present in the final product [46] to match the EFSA definition of cisgenic crops used to formulate their safety assessment on cisgenesis [47]. However, a product matching this definition can hardly be achieved when using recombinase recognition sequences (of which one copy remains in the final cisgenic product) that are at least 34 bps long for the Flp / FRT system [48] in p9-Dao-FLPi and 58 bps long for the R / Rs system in pMF1 [20]). Three different inoculation experiments, using scissors and/or syringe shoot inoculation, showed consistently that line C44.4.146 is significantly more fire blight resistant than the wild type (Figs 7 and
- 64 -
Chapter 2)
8). The comparison of the results of experiments 1 and 2 seems to indicate that while inoculating using a syringe, more severe fire blight symptoms are induced in the cisgenic line. However, when C44.4.146 and ‘Gala Galaxy’ plants were inoculated with the two inoculation methods in the same experiment (experiment 3), this effect was no longer observed (Fig 7). Flower susceptibility is very important for controlling the fire blight disease, as most of the infections occur during flowering. Resistance of this cisgenic line upon inoculation of the flowers with the pathogen has still to be investigated. We discourage the single use of the introduced fire blight resistance gene FB_MR5 by conventional breeding or by cisgenesis for cultivation, as it is known that a single point mutation leading to amino acid substitution in the pathogen can result in a virulent strain [41]. FB_MR5 virulent strains of E. amylovora have already been identified in North America, while such strains have not yet been identified in Europe. The mutation rate of the codon 43 switch of rpsL gene from K to R altering the ribosomal protein S12 leading to streptomycin resistance in most of the strains of E. amylovora was estimated to 4 x 10-9 per bacterial generation [49]. If we assume the same mutation rate for the switch from C-Allele to the S-Allele of AvrRpt2EA (leading to FB_MR5 virulent strains) and we consider that E. amylovora populations ranging from 103 to 107 cfu have been detected on stigmas of flowers of different rosaceous hosts after natural infection [50, 51], it can be assumed that Mr5-virulent E. amylovora strains are already present in Europe and can rise very quickly once we start selecting for them (i. e. by planting FB_MR5 genotypes at commercial scale). Therefore it can be anticipated that if used alone, this resistance would not be durable. Whatever use (e.g. classical breeding, transgenesis or cisgenesis) is made of FB_MR5, this resistance must be further combined with other (vertical or horizontal) resistances as suggested by McDonald and Linde [52] and Emeriewen et al. [53].
- 65 -
Development of the First Cisgenic Apple with Increased Resistance to Fire Blight
Experimental procedures Generation of the cisgenic line C44.4.146 Binary vector p9-Dao-FLPi-FB_MR5 (Fig 1) was constructed by a DNA cloning company (DNA Cloning Service, Hamburg, Germany) and transformed into Agrobacterium tumefaciens strain GV3101pMP90RK. This vector was derived from P9 and was designed to carry on the T-DNA an excisable cassette flanked by FRT recombination sites. This excisable cassette contains the NptII kanamycin resistance selection gene for plant selection, the D-amino oxidase 1 gene (dao1), originally planned to be used as negative selection marker, and the Flp recombinase under control of a heat shock promoter [42]. The same vector carrying HcrVf2 was recently published by Würdig et al. [24]. Instead of HcrVf2 and its native regulatory elements, the FB_MR5 gene (4167 bps) flanked by its 1995 bps native 5’-UTR and 1547 bps native 3’-UTR was cloned, using the same primers and restrictions sites as described by Broggini et al. [19] for generating vector 390p95N-Mr5FB1.
Transgenic plants were regenerated by transforming in vitro explants of the cultivar 'Gala Galaxy' following the protocol as described by Szankowski et al. [54] and Vanblaere et al. [23]. Young leaves of the in vitro plants were cut in explants (a total of 80 in T44 and 300 in T45), co-cultured with the transformed agrobacteria carrying the vector p9-Dao-FLPi-FB_MR5 and regenerated on a medium containing ticarcilin and kanamycin to select for pure (agrobacteria-free), transformed, transgenic calli. Once the plants started to regenerate they were transferred to elongation medium [23] and propagated every four to six weeks. To test if the shoots were successfully transformed and thus to confirm integration of FB_MR5 and NptII, all 13 lines growing on selective medium containing kanamycin were investigated by PCR with the primer pairs FB_MR5q1 F/FB_MR5q1 R (amplicon D, Fig 2) for FB_MR5 and 167nptII-for/367nptII-rev (amplicon B, Fig 2) for NptII. In order to identify lines that contain backbone sequences beyond the left border, PCR using primer pair Bb_LB1/Bb_LB2 (Amplicon A, Fig 1) was performed.
As soon as sufficient differentiated shoots were available, about 3,200 explants of nine transgenic lines were subjected to heat shock in an incubator (four hours at 42 °C on regeneration medium without kanamycin) to activate excision of the trangenic cassette containing the selectable marker genes NptII, dao1 and the Flp recombinase gene as well. Following heat treatment explants were cultured on regeneration medium without kanamycin for two weeks in the dark. After this period, explants were put on non-selective elongation medium, like during the transformation procedure, and started to form calli. Elongating shoots were transferred to elongation medium as soon as shoots were detectable or cells started to differentiate. To detect the cisgenic regenerants, they were screened for absence of NptII and Flp and for presence of FB_MR5 by PCR using the method of Frey et al. [55]. For this purpose primers 167nptII-for/367nptII-rev [54], FlpF/FlpR [22] and FB_MR5q1 F/FB_MR5q1 R [56] were used (Table 1 and Fig 2).
- 66 -
Chapter 2)
Table 1. List of the primers used in this study. Primer name Sequence 5’-3’ Reference Amplicona
Bb_LB1 CGCAATAGTTGGCGAAGTAATCGC This study A
Bb_LB2 GGTGGAGCTTGCATGTTGGTTTC This study A
FB_MR5q1 F TTTATGGAGAGTGCTCCTTGC [56] D
FB_MR5q1 R AGCGAATCAAGGTTCTCTGG [56] D
FbMr5_SondeF TCACAACTAATCACAGCTGCA This study
FbMr5_SondeR AACATTATGATCCCACCCTACG This study
FlpF CATCGGAAGAAGCAGATAAGGG [22] C
FlpR TCAACTCCGTTAGGCCCTTCAT [22] C
iPCR-RBout ATCTCACGTCATCCATGCCC This study G
iPCR-RB-XbaI-closer TCGTAGCAAATTGAAGAGGTCT This study
IS146-1163F TCGTTTTCAGTTCGATATGAGCAAG This study E, F
IS146-1391R ACATGCATAATGGTGATGAGGG This study E, G
IS146-LB-321R GCTAGAGCCGATCGTGAAGT This study F
nptII_F ACAAGATGGATTGCACGCAGG [19]
nptII_R AACTCGTCAAGAAGGCGATAG [19]
167nptII-for CCACAGTCGATGAATCCAGA [54] B
367nptII-rev AGCACGTACTCGGATGGAAG [54] B aThe relative positions of the primers on the sequence of T44.4 are shown in Figs 1 and 2.
A shoot of C44.4.146 and non-transformed 'Gala Galaxy' control plants, which simultaneously experienced in vitro culturing were then micrografted on 'Golden Delicious' seedlings following the procedure described by Joshi [57] and acclimatized to greenhouse conditions. This latter genotype is described in this manuscript as “'Gala Galaxy' in vitro”. DNA of the micrografted C44.4.146 plant, its motherline T44.4, Malus ×robusta 5 and 'Gala Galaxy' in vitro, was retested by PCR for absence of sequences beyond the left border, presence of FB_MR5 and absence of the selectable marker genes NptII and Flp using the corresponding primers (Figs 2 and 3).
Fire blight resistance test of the cisgenic line C44.4.146 Between six and twenty plants of each genotype grafted on M9T337, were subjected to fire blight resistance tests with E. amylovora strain EA222_JKI in each of the three independent experiments performed. Only actively growing plants that reached at least a shoot length of 13.0 cm were considered. Two inoculation methods were used: scissor inoculations (experiments 1 and 3) were - 67 -
Development of the First Cisgenic Apple with Increased Resistance to Fire Blight performed as described by Peil et al. [11] and syringe inoculation (experiments 2 and 3) as described by Khan et al. [58]. In all three experiments (experiments 1-3) an E. amylovora suspension in phosphate buffered saline with an optical density (OD600) adjusted to about 1.0 (1.06, 0.99, 1.09, respectively), corresponding to about 109 cfu / ml, was used. The percentage of lesion length (PLL) was recorded 21 days post inoculation.
Copy number of C44.4.146 Southern hybridization was performed as described by Broggini et al. [19] with minor changes. DNA (10 µg) from each line and plasmid p9-Dao-FLPi-FB_MR5 was digested with 100 units BsaI (Thermo Fisher Scientific Inc. ©, Waltham, USA). Cleaved DNA was separated on a 0.8 % agarose gel and transferred onto a nylon membrane (Roche Diagnostics, Mannheim, Germany). A DIG-labelled NptII probe was amplified by PCR using primers (nptII_F/nptII_R) and an FB_MR5 specific probe using primers (FbMr5_SondeF / FbMr5_SondeR, Table 1). Hybridization with each of the probes was performed using the ECF-Random-Prime-Labeling and Detection Kit (Amersham Biosciences, Freiburg, Germany) according to the manufacturer’s manual.
Integration site of C44.4.146 Molecular characterization and iPCR for determination of insertion site was performed as described by Vanblaere et al. [45] with the following modifications: i) Backbone integration was assessed by PCR amplification (Fig 3) using primers Bb_LB1 and Bb_LB2 (Fig 1 and Table 1); ii) For iPCR, XbaI-digested DNA of cisgenic genotypes was subjected to ligase reaction and the primers iPCR-RB-XbaI-closer and iPCR-RBout (Table 1) were used to amplify by PCR the junction between T-DNA and genomic sequence at the right border (Fig 2). The resulting PCR product was then sequenced and BLAST analysis against the apple genome [59] was performed.
Primers IS146-1163F and IS146-1391R (amplicon E, Fig 5) that flank the insertion site were designed using the sequence of contig MDC012271.181 and used in combination with the primers IS146-LB- 321R (amplicon F, Fig 5) or iPCR-RBout (amplicon G, Fig 5) to characterize the T-DNA junctions in the cisgenic line C44.4.146 (Fig 2). Primer sequences are summarized in Table 1.
Transcription level of FB_MR5 Transcript levels of FB_MR5 in different genotypes were determined by RT-qPCR. A Taqman Probe with the sequence YYE-TGGCTTCCATTTCAAACGGATCACAGA-BHQ1 was designed to specifically detect FB_MR5 in combination with primers FB_MR5q1 F and FB_MR5q1 R [56]. As reference primers pairs EF1α and relative Taqman probe developed by Gusberti et al. [60] were used. RNA was extracted from three young unfolded leaves of different plants of genotypes C44.4.146, 'Gala Galaxy' in vitro, and the classically bred FB_MR5-carrying accessions ACW 22161 and ACW 22176, using Zymo QuickRNA extraction kit (Zymo Research Corporation, Irvine, USA). Extracted RNA was then subjected to a second DNAse treatment (DNAse Ambion® Life Technologies, Carlsbad, USA), after which first strand synthesis was performed using the Fermenta’s first strand minus H cDNA synthesis kit. cDNA was then diluted 1 / 10 and 5 µl were used for qPCR on ViiA Ruo qPCR device (Thermo Fisher scientific Inc. ©, Waltham, USA) in a total reaction volume of 20 µl using the Taqman Fast Universal Master Mix (Thermo Fisher Scientific Inc. ©, Waltham, USA). Each reaction had following primer / probe final concentration: EF1α primers at 600 nM, EF1α probe at 400 nM, FB_MR5q1 primers at 900 nM and FB_MR5q1 probe at 250 nM. The same reaction protocol was used to generate standard curves using both dilution series of DNA as well as cDNA from the cisgenic line C44.4.146. Relative expression ratio of FB_MR5 / EF1α was calculated according to Pfaffl [61]. For transcription level comparison we excluded three data points - 68 -
Chapter 2)
with CTFB_MR5 > 40 (two from ACW 22161 II) and one from ACW 22161 III)) as relative expression ratio in standard curves was no longer linear and standard deviation increased above a CTFB_MR5 value of 40.
Statistical analysis Statistical analysis was performed using software JMP® 10.0 and 11.0 (SAS Institute INC., Cary, NC) and R [62]. As datasets did not follow normal distribution nonparametric tests were used to compare groups. Transcription level data were compared using the Steel Dwass test. In fire blight inoculation experiments 1 and 2, the Wilcoxon test was performed and in experiment 3 all groups were compared using the Steel Dwass test. Additionally all groups in all three experiments were compared simultaneously using the Steel Dwass test with corrected p-values (Fig 7). One outlier in experiment 2 (C44.4.146 inoculated by syringe) and one in experiment 3 ('Gala Galaxy' inoculated by scissors) were removed from the dataset for the statistical analysis as they differed more than 1.5 interquartile ranges from the corresponding group median (Fig 7). All statistical analysis were performed with a significance level of α = 0.05.
- 69 -
Development of the First Cisgenic Apple with Increased Resistance to Fire Blight
Acknowledgements The authors wish to acknowledge the financial support by the Swiss Federal Office of Agriculture Project ZUEFOSII. We are grateful for the technical support of R. Blapp (Agroscope in Wädenswil), Ines Hiller (JKI Dresden) and J. Schneider (ETH Zurich) and we thank E. Chevreau from INRA Angers for providing the in vitro 'Gala Galaxy' plants.
- 70 -
References
References 1. Food and Agriculture Organization of the United Nations [Internet]. 2013. Available from: http://faostat3.fao.org/browse/rankings/commodities_by_regions/E. 2. Turchek WW. Apple Diseases and their Management. In: Naqvi SAMH, editor. Diseases of Fruits and Vegetables. Springer; 2004. pp. 35-35 3. Norelli JL, Jones AL, Aldwinckle HS. Fire blight management in the twenty-first century - Using new technologies that enhance host resistance in apple. Plant Dis. 2003;87(7):756-65. doi: 10.1094/Pdis.2003.87.7.756. 4. Cornille A, Giraud T, Smulders MJ, Roldán-Ruiz I, Gladieux P. The domestication and evolutionary ecology of apples. Trends Genet. 2014;30(2):57-65. 5. Janick J. The PRI apple breeding program. Hortscience. 2006;41(1):8-10. 6. Kellerhals M, Meyer M. Aims of the apple breeding programme at Wädenswil. Progress in Temperate Fruit Breeding: Springer; 1994. pp. 117-21. 7. Peil A, Kellerhals M, Höfer M, Flachowsky H. Apple breeding—from the origin to genetic engineering. Fruit Veg Cereal Sci Biotechnol. 2011;5:118-38. 8. Peil A, Bus V, Geider K, Richter K, Flachowsky H, Hanke M. Improvement of fire blight resistance in apple and pear. Int J Plant Breed. 2009;3(1):1-27. 9. Abdeen A, Miki B. The pleiotropic effects of the bar gene and glufosinate on the Arabidopsis transcriptome. Plant Biotechnol J. 2009;7(3):266-82. 10. Hough L, editor A survey of the scab resistance of the foliage on seedlings in selected apple progenies. Proc Amer Soc Hort Sci; 1944. 11. Peil A, Garcia-Libreros T, Richter K, Trognitz FC, Trognitz B, Hanke MV, et al. Strong evidence for a fire blight resistance gene of Malus robusta located on linkage group 3. Plant Breeding. 2007;126(5):470-5. doi: 10.1111/j.1439-0523.2007.01408.x. 12. Flachowsky H, Hanke MV, Peil A, Strauss SH, Fladung M. A review on transgenic approaches to accelerate breeding of woody plants. Plant Breeding. 2009;128(3):217-26. doi: 10.1111/j.1439- 0523.2008.01591.x. 13. Gessler C, Patocchi A. Recombinant DNA technology in apple. Adv Biochem Eng Biot. 2007;107:113-32. doi: 10.1007/10_2007_053. 14. Schouten HJ, Krens FA, Jacobsen E. Cisgenic plants are similar to traditionally bred plants - International regulations for genetically modified organisms should be altered to exempt cisgenesis. Embo Rep. 2006;7(8):750-3. doi: 10.1038/sj.embor.7400769. 15. Belfanti E, Silfverberg-Dilworth E, Tartarini S, Patocchi A, Barbieri M, Zhu J, et al. The HcrVf2 gene from a wild apple confers scab resistance to a transgenic cultivated variety. P Natl Acad Sci USA. 2004;101(3):886-90. doi: 10.1073/pnas.0304808101. 16. Galli P, Broggini GAL, Gessler C, Patocchi A. Phenotypic Characterization of the Rvi15 (Vr2) Apple Scab Resistance. J Plant Pathol. 2010;92(1):219-26. 17. Schouten HJ, Brinkhuis J, van der Burgh A, Schaart JG, Groenwold R, Broggini GA, et al. Cloning and functional characterization of the Rvi15 (Vr2) gene for apple scab resistance. Tree Genetics & Genomes. 2014;10(2):251-60. 18. Rikkerink HA, Hilario-Andrade EM, Dare AP, Gardiner SE, Yoon M, Bus VGM, inventors; Google Patents, assignee. Resistance gene and uses thereof. U.S. Patent Application 12/740,318. New Zealand. 2007.
- 71 - Development of the First Cisgenic Apple with Increased Resistance to Fire Blight
19. Broggini GAL, Wöhner T, Fahrentrapp J, Kost TD, Flachowsky H, Peil A, et al. Engineering fire blight resistance into the apple cultivar 'Gala' using the FB_MR5 CC-NBS-LRR resistance gene of Malus × robusta 5. Plant Biotechnol J. 2014;12(6):728-33. doi: 10.1111/Pbi.12177. 20. Schaart JG, Krens FA, Pelgrom KT, Mendes O, Rouwendal GJ. Effective production of marker- free transgenic strawberry plants using inducible site-specific recombination and a bifunctional selectable marker gene. Plant Biotechnol J. 2004;2(3):233-40. doi: 10.1111/j.1467- 7652.2004.00067.x. 21. Herzog K, Flachowsky H, Deising HB, Hanke M-V. Heat-shock-mediated elimination of the nptII marker gene in transgenic apple (Malus× domestica Borkh.). Gene. 2012;498(1):41-9. 22. Würdig J, Flachowsky H, Hanke MV. Studies on heat shock induction and transgene expression in order to optimize the Flp/FRT recombinase system in apple (Malus × domestica Borkh.). Plant Cell Tiss Org. 2013;115(3):457-67. doi: 10.1007/s11240-013-0376-1. 23. Vanblaere T, Szankowski I, Schaart J, Schouten H, Flachowsky H, Broggini GA, et al. The development of a cisgenic apple plant. Journal of biotechnology. 2011;154(4):304-11. 24. Würdig J, Flachowsky H, Saß A, Peil A, Hanke M-V. Improving resistance of different apple cultivars using the Rvi6 scab resistance gene in a cisgenic approach based on the Flp/FRT recombinase system. Mol Breeding. 2015;35(3):1-18. doi: 10.1007/s11032-015-0291-8. 25. Krens FA, Schaart JG, van der Burgh AM, Tinnenbroek-Capel IE, Groenwold R, Kodde LP, et al. Cisgenic apple trees; development, characterization, and performance. Frontiers in plant science. 2015;6. 26. Winslow C-E, Broadhurst J, Buchanan R, Krumwiede Jr C, Rogers L, Smith G. The families and genera of the bacteria: final report of the committee of the Society of American Bacteriologists on characterization and classification of bacterial types. Journal of Bacteriology. 1920;5(3):191. 27. Bonn WG, van der Zwet T. Distribution and economic importance of fire blight. In: Vanneste JL, editor. Fire blight: the disease and its causative agent, Erwinia amylovora: CABI; 2000. pp. 37- 53. 28. Hasler T, Schaerer H, Holliger E, Vogelsanger J, Vignutelli A, Schoch B, editors. Fire blight situation in Switzerland. IX International Workshop on Fire Blight. 2001;590:73-79. 29. Scheer C. Feuerbrandsituation im Bodenseeraum und Ergebnisse der Feuerbrandversuche. Obstbau. 2009;34(3):168. German 30. Richter K, Fischer C, editors. Stability of fire blight resistance in apple. Eucarpia symposium on Fruit Breeding and Genetics.1999;538:267-270.. 31. Kellerhals M, Schütz S, Baumgartner IO, Schaad J, Kost T, Broggini G, et al. Züchtung feuerbrandrobuster Apfelsorten. Agrarforschung Schweiz. 2014;10:414-21. German 32. Emeriewen O, Richter K, Kilian A, Zini E, Hanke M-V, Malnoy M, et al. Identification of a major quantitative trait locus for resistance to fire blight in the wild apple species Malus fusca. Mol Breeding. 2014;34(2):407-19. 33. Peil A, Wöhner T, Hanke M-V, Flachowsky H, Richter K, Wensing A, et al. Comparative mapping of fire blight resistance in Malus. XIII International Workshop on Fire Blight. 2013;1056:47-51. 34. Aldwinckle H, Gustafson H, Forsline P, editors. Evaluation of the core subset of the USDA apple germplasm collection for resistance to fire blight. VIII International Workshop on Fire Blight. 1998;489:269-272. 35. Aldwinckle H, Zwet T. Recent Progress in Breeding for Fireblight Resistance in Apples and Pears in North America1. EPPO Bulletin. 1979;9(1):27-34.
- 72 - References
36. Milčevičová R, Gosch C, Halbwirth H, Stich K, Hanke M-V, Peil A, et al. Erwinia amylovora- induced defense mechanisms of two apple species that differ in susceptibility to fire blight. Plant Science. 2010;179(1):60-7. 37. Fazio G, Aldwinckle H, Volk G, Richards C, Janisiewicz W, Forsline P. Progress in evaluating Malus sieversii for disease resistance and horticultural traits. XII Eucarpia Symposium on Fruit Breeding and Genetics. 2007;814:59-66 38. Durel CE, Denance C, Brisset MN. Two distinct major QTL for resistance to fire blight co-localize on linkage group 12 in apple genotypes 'Evereste' and Malus floribunda clone 821. Genome. 2009;52(2):139-47. doi: 10.1139/g08-111. 39. Parravicini G, Gessler C, Denance C, Lasserre-Zuber P, Vergne E, Brisset MN, et al. Identification of serine/threonine kinase and nucleotide-binding site-leucine-rich repeat (NBS-LRR) genes in the fire blight resistance quantitative trait locus of apple cultivar 'Evereste'. Mol Plant Pathol. 2011;12(5):493-505. doi: 10.1111/j.1364-3703.2010.00690.x. 40. Fahrentrapp J, Broggini GAL, Kellerhals M, Peil A, Richter K, Zini E, et al. A candidate gene for fire blight resistance in Malus × robusta 5 is coding for a CC-NBS-LRR. Tree Genetics & Genomes. 2013;9(1):237-51. doi: 10.1007/s11295-012-0550-3. 41. Vogt I, Wöhner T, Richter K, Flachowsky H, Sundin GW, Wensing A, et al. Gene‐for‐gene relationship in the host–pathogen system Malus× robusta 5–Erwinia amylovora. New Phytologist. 2013;197(4):1262-75. 42. Hättasch C, Flachowsky H, Hanke MV. Evaluation of an alternative D-amino acid/DAAO selection system for transformation in apple (Malus × domestica Borkh.). J Hortic Sci Biotech. 2009:188-94. 43. Gusberti M, Gessler C, Broggini GA. RNA-Seq analysis reveals candidate genes for ontogenic resistance in Malus-Venturia pathosystem. PLoS One. 2013;8(11):e78457. doi: 10.1371/journal.pone.0078457. 44. Espley RV, Hellens RP, Putterill J, Stevenson DE, Kutty‐Amma S, Allan AC. Red colouration in apple fruit is due to the activity of the MYB transcription factor, MdMYB10. The Plant Journal. 2007;49(3):414-27. 45. Vanblaere T, Flachowsky H, Gessler C, Broggini GA. Molecular characterization of cisgenic lines of apple 'Gala' carrying the Rvi6 scab resistance gene. Plant Biotechnol J. 2014;12(1):2-9. doi: 10.1111/pbi.12110. 46. Lusser M, Parisi C, Plan D, Rodríguez-Cerezo E. New plant breeding techniques. JRC Scientific and Technical Reports (European Comission, Joint Research Center). 2011. 47. EFSA Panel on Genetically Modified Organisms. Scientific opinion addressing the safety assessment of plant developed through cisgenesis and intragenesis. 2012. 48. Luo KM, Duan H, Zhao DG, Zheng XL, Deng W, Chen YQ, et al. 'GM-gene-deletor': fused loxP- FRT recognition sequences dramatically improve the efficiency of FLP or CRE recombinase on transgene excision from pollen and seed of tobacco plants. Plant Biotechnol J. 2007;5(2):263- 74. doi: 10.1111/j.1467-7652.2006.00237.x. 49. Jones AL, Schnabel EL. The development of streptomycin resistant strains of Erwinia amylovora. In: Vanneste JL, editor. Fire blight: the disease and its causative agent, Erwinia amylovora; 2000. pp. 235-51. 50. Manulis S, Zutra D, Kleitman F, Dror O, David I, Zilberstaine M, et al. Distribution of streptomycin-resistant strains of Erwinia amylovora in Israel and occurrence of blossom blight in the autumn. Phytoparasitica. 1998;26(3):223-30. doi: 10.1007/Bf02981437.
- 73 - Development of the First Cisgenic Apple with Increased Resistance to Fire Blight
51. Thomson SV. Epidemiology of Fire Blight. In: Vanneste J, editor. Fire Blight: the disease and its causative agent, Erwinia amylovora; 2000. pp. 9-37. 52. McDonald BA, Linde C. The population genetics of plant pathogens and breeding strategies for durable resistance. Euphytica. 2002;124(2):163-80. doi: 10.1023/A:1015678432355. 53. Emeriewen OF, Richter K, Hanke MV, Malnoy M, Peil A. The fire blight resistance QTL of Malus fusca (Mfu10) is affected but not broken down by the highly virulent Canadian Erwinia amylovora strain E2002A. Eur J Plant Pathol. 2015;141(3):631-5. doi: 10.1007/s10658-014- 0565-8. 54. Szankowski I, Waidmann S, Degenhardt J, Patocchi A, Paris R, Silfverberg-Dilworth E, et al. Highly scab-resistant transgenic apple lines achieved by introgression of HcrVf2 controlled by different native promoter lengths. Tree Genetics & Genomes. 2009;5(2):349-58. doi: 10.1007/s11295-008-0191-8. 55. Frey JE, Frey B, Sauer C, Kellerhals M. Efficient low-cost DNA extraction and multiplex fluorescent PCR method for marker-assisted selection in breeding. Plant Breeding. 2004;123(6):554-7. doi: 10.1111/j.1439-0523.2004.01033.x. 56. Fahrentrapp J. Fire blight resistance of Malus × robusta 5. PhD Thesis, Eidgenössische Technische Hochschule ETH Zurich. 2012. 57. Joshi SG. Towards durable resistance to apple scab using cisgenes. PhD Thesis, Wageningen University. 2010. 58. Khan MA, Duffy B, Gessler C, Patocchi A. QTL mapping of fire blight resistance in apple. Mol Breeding. 2006;17(4):299-306. doi: 10.1007/s11032-006-9000-y. 59. Velasco R, Zharkikh A, Affourtit J, Dhingra A, Cestaro A, Kalyanaraman A, et al. The genome of the domesticated apple (Malus × domestica Borkh.). Nat Genet. 2010;42(10):833. doi: 10.1038/Ng.654. 60. Gusberti M, Patocchi A, Gessler C, Broggini GAL. Quantification of Venturia inaequalis Growth in Malus × domestica with Quantitative Real-Time Polymerase Chain Reaction. Plant Dis. 2012;96(12):1791-7. doi: 10.1094/Pdis-12-11-1058-Re. 61. Pfaffl MW. A new mathematical model for relative quantification in real-time RT–PCR. Nucleic acids research. 2001;29(9):e45-e. 62. R Core Team. R: A language and environment for statistical computing. R Foundation for Statistical Computing, Vienna, Austria, 2012.
- 74 - Chapter 2)
Supporting Information
S1 Fig. PCR tests to verify absence of backbone. An amplicon after PCR with primer pair Vf2_backbone_LB_1 and Vf2_backbone_LB_2 (Table 1) was observed in the transgenic lines T44.3 and T44.10 indicating presence of integrated backbone sequences beyond the left border (amplicon A, Fig 1). T45.5 did not amplify FB_MR5 (data not shown) and was not further considered.
- 75 - Development of the First Cisgenic Apple with Increased Resistance to Fire Blight
S2 Fig. PCR tests to identify cisgenic lines. Amplicons after PCR with primer pair 167nptII-for / 367nptII- rev (Table 2) revealed most lines to be transgenic. Three cisgenic lines (239, 240 and 243 were identified and all three originated from the same transgenic motherline (T44.4) as C.44.4.146 (Fig 3).
- 76 - Chapter 2)
S3 Table. Overview of RT-qPCR results. Legend: Date when experiment was performed (date). Sample: ‘Gala Galaxy’ (Gala), Cisgenic line C44.4.146 (Cis), conventionally bred genotypes ACW 22161 (22161) and ACW 22176 (22176). Biological replicates are indicated (A, B or C). Target: Specific probe for Elongation Factor 1α (EF1) or FB_MR5 (Mr5). CT value: If no target was identified. “Undetermined” is indicated. a Transcription level ratios were calculated in comparison to the average CT value of CisA on 4th of May (21.209 for EF1 and 31.594 for Mr5) according to Pfaffl [61]. Gala plants showed no amplification with Mr5 (indicated in bold). *: Data was not included for Fig 6 according to experimental procedures.
Date Sample Target CT value
30.04.2015 22161a Mr5 32.14
30.04.2015 22161a Mr5 32.62
30.04.2015 22161a Mr5 32.74
30.04.2015 22161a EF1 22.75
30.04.2015 22161a Mr5 33.32
30.04.2015 22161a EF1 23.01
30.04.2015 22161a EF1 23.12
30.04.2015 22161a Mr5 34.28
30.04.2015 22161a EF1 24.23
30.04.2015 22161a EF1 24.25
30.04.2015 22161b Mr5 37.24
30.04.2015 22161b Mr5 44.88*
30.04.2015 22161b Mr5 Undetermined
30.04.2015 22161b Mr5 Undetermined
30.04.2015 22161b Mr5 Undetermined
30.04.2015 22161b EF1 26.77
30.04.2015 22161b EF1 26.79
30.04.2015 22161b EF1 26.94
30.04.2015 22161b EF1 27.63
30.04.2015 22161b EF1 27.66
30.04.2015 22161c Mr5 33.48
30.04.2015 22161c Mr5 33.60
30.04.2015 22161c EF1 23.08
30.04.2015 22161c EF1 23.08
30.04.2015 22161c EF1 23.23
30.04.2015 22161c Mr5 35.51
30.04.2015 22161c EF1 24.22
30.04.2015 22161c Mr5 36.89
30.04.2015 22161c EF1 24.49
30.04.2015 22161c Mr5 50.00*
30.04.2015 22176a Mr5 35.14
30.04.2015 22176a Mr5 35.92
30.04.2015 22176a Mr5 35.97
- 77 - Development of the First Cisgenic Apple with Increased Resistance to Fire Blight
Date Sample Target CT value
30.04.2015 22176a EF1 24.17
30.04.2015 22176a Mr5 36.39
30.04.2015 22176a EF1 24.33
30.04.2015 22176a EF1 24.35
30.04.2015 22176a Mr5 Undetermined
30.04.2015 22176a EF1 26.34
30.04.2015 22176a EF1 26.44
30.04.2015 22176b Mr5 32.64
30.04.2015 22176b Mr5 33.03
30.04.2015 22176b EF1 23.23
30.04.2015 22176b Mr5 34.03
30.04.2015 22176b EF1 23.33
30.04.2015 22176b EF1 23.42
30.04.2015 22176b Mr5 35.15
30.04.2015 22176b Mr5 36.99
30.04.2015 22176b EF1 25.07
30.04.2015 22176b EF1 25.18
30.04.2015 22176c Mr5 32.44
30.04.2015 22176c EF1 22.73
30.04.2015 22176c EF1 22.78
30.04.2015 22176c Mr5 33.69
30.04.2015 22176c Mr5 33.89
30.04.2015 22176c Mr5 33.91
30.04.2015 22176c EF1 23.25
30.04.2015 22176c EF1 24.61
30.04.2015 22176c EF1 24.68
30.04.2015 22176c Mr5 Undetermined
30.04.2015 CisA Mr5 30.73
30.04.2015 CisA Mr5 30.84
30.04.2015 CisA Mr5 31.79
30.04.2015 CisA EF1 20.69
30.04.2015 CisA EF1 20.78
30.04.2015 CisA EF1 20.80
30.04.2015 CisB Mr5 33.95
30.04.2015 CisB Mr5 33.97
30.04.2015 CisB EF1 23.46
30.04.2015 CisB EF1 23.59
30.04.2015 CisB EF1 23.71
30.04.2015 CisB Mr5 35.51
30.04.2015 CisC Mr5 32.93
30.04.2015 CisC Mr5 32.96
- 78 -
Chapter 2)
Date Sample Target CT value
30.04.2015 CisC EF1 22.45
30.04.2015 CisC EF1 22.55
30.04.2015 CisC EF1 22.61
30.04.2015 CisC Mr5 33.31
30.04.2015 CisC Mr5 33.70
30.04.2015 CisC Mr5 35.09
30.04.2015 CisC EF1 23.84
30.04.2015 CisC EF1 24.06
30.04.2015 GalaA EF1 20.46
30.04.2015 GalaA EF1 20.57
30.04.2015 GalaA EF1 20.60
30.04.2015 GalaA Mr5 Undetermined
30.04.2015 GalaA Mr5 Undetermined
30.04.2015 GalaA Mr5 Undetermined
04.05.2015 22161a Mr5 31.49
04.05.2015 22161a Mr5 32.57
04.05.2015 22161a Mr5 32.94
04.05.2015 22161a EF1 22.92
04.05.2015 22161a EF1 22.92
04.05.2015 22161a EF1 23.14
04.05.2015 22161b Mr5 35.28
04.05.2015 22161b Mr5 36.29
04.05.2015 22161b Mr5 40.85*
04.05.2015 22161b EF1 26.86
04.05.2015 22161b EF1 26.97
04.05.2015 22161b EF1 27.05
04.05.2015 22161c Mr5 33.26
04.05.2015 22161c Mr5 33.48
04.05.2015 22161c EF1 23.10
04.05.2015 22161c EF1 23.16
04.05.2015 22161c EF1 23.18
04.05.2015 22161c Mr5 34.56
04.05.2015 22176a Mr5 33.21
04.05.2015 22176a Mr5 33.88
04.05.2015 22176a Mr5 35.80
04.05.2015 22176a EF1 24.93
04.05.2015 22176a EF1 24.97
04.05.2015 22176a EF1 25.09
04.05.2015 22176b Mr5 32.74
04.05.2015 22176b Mr5 32.75
04.05.2015 22176b Mr5 34.22
- 79 -
Development of the First Cisgenic Apple with Increased Resistance to Fire Blight
Date Sample Target CT value
04.05.2015 22176b EF1 23.53
04.05.2015 22176b EF1 23.58
04.05.2015 22176b EF1 23.80
04.05.2015 22176c Mr5 33.26
04.05.2015 22176c EF1 22.86
04.05.2015 22176c EF1 22.88
04.05.2015 22176c Mr5 33.50
04.05.2015 22176c EF1 22.98
04.05.2015 22176c Mr5 33.55
04.05.2015 CisA Mr5 30.80 a
04.05.2015 CisA Mr5 31.15 a
04.05.2015 CisA Mr5 31.35 a
04.05.2015 CisA EF1 20.96 a
04.05.2015 CisA EF1 21.08 a
04.05.2015 CisA EF1 21.11 a
04.05.2015 CisB Mr5 32.76
04.05.2015 CisB Mr5 32.90
04.05.2015 CisB Mr5 33.03
04.05.2015 CisB EF1 23.83
04.05.2015 CisB EF1 23.93
04.05.2015 CisB EF1 23.97
04.05.2015 CisC Mr5 32.71
04.05.2015 CisC Mr5 32.84
04.05.2015 CisC EF1 22.30
04.05.2015 CisC EF1 22.40
04.05.2015 CisC EF1 22.74
04.05.2015 CisC Mr5 33.45
04.05.2015 GalaA EF1 20.52
04.05.2015 GalaA EF1 20.69
04.05.2015 GalaA EF1 20.86
04.05.2015 GalaA Mr5 Undetermined
04.05.2015 GalaA Mr5 Undetermined
04.05.2015 GalaA Mr5 Undetermined
04.05.2015 GalaB EF1 20.12
04.05.2015 GalaB EF1 20.23
04.05.2015 GalaB EF1 20.27
04.05.2015 GalaB Mr5 Undetermined
04.05.2015 GalaB Mr5 Undetermined
04.05.2015 GalaB Mr5 Undetermined
04.05.2015 GalaC EF1 20.31
04.05.2015 GalaC EF1 20.41
- 80 -
Chapter 2)
Date Sample Target CT value
04.05.2015 GalaC EF1 20.41
04.05.2015 GalaC Mr5 Undetermined
04.05.2015 GalaC Mr5 Undetermined
04.05.2015 GalaC Mr5 Undetermined
- 81 -
The development of further cisgenic, fire blight resistant apples
Annex to Chapter 2)
The development of further cisgenic, fire blight resistant apples
Annex
This annex consist of two different, unpublished sections:
1. Morphological observation performed on the line C44.4.146. (p. 83)
2. Development of further cisgenic apple lines carrying the FB_MR5 fire blight resistance gene. (p. 86)
- 82 - Annex to Chapter 2)
Morphological observation performed on the line C44.4.146. Introduction The investigation of the fire blight resistant line C44.4.146 revealed that this line shows a single insertion of FB_MR5, whose transcriptional level was comparable to the one of conventionally bred plant carrying FB_MR5. The functionality of the fire blight resistance was confirmed by fire blight inoculation assays. It is supposed that the amendment of a single gene to apple by mean of genetic engineering should not affect any of the other relevant properties of the transformed cultivar. In order to verify this, we followed the growth of line C44.4.146 in the greenhouse, and compared it to the growth of ‘Gala Galaxy’ from the nursery as well as from in vitro culture. Additional to these genotypes, the parents of ‘Gala’, ‘Golden Delicious’ and ‘Kidd’s Orange’ served as controls. Several morphological parameters as shoot length, internode distance and characteristics of leaves (length and width) were compared between the cisgenic line C44.4.146, ‘Gala’ plants, the parents of ‘Gala’ (‘Golden Delicious’ and ‘Kidd’s Orange’) and ‘Gala Galaxy’ plants that underwent an in vitro phase. This experiment should allow assessing if striking differences between the cisgenic line and the other investigated plants exist.
Experimental procedures Morphological parameter assessment For comparison of plant growth, budwood of the following genotypes was grafted on M9 rootstock: C44.4.146, 'Gala Galaxy' (budwood originating from a nursery) that underwent in vitro culturing, 'Gala Galaxy' and both parents of 'Gala': 'Kidds’s Orange' and 'Golden Delicious'. Following grafting on M9 rootstock plants were stored in cold (< 10 °C) until start of the experiment. The greenhouse cabin was set to 24 °C / 18 °C with 8 h darkness, and a relative humidity of 70 %. For nine weeks the length of the shoot from the grafting point to the shoot tip was measured weekly (Figure S1). Only shoots that reached the physiological stage BBCH31 and with a minimal length of 10 cm were considered. First recording occurred on 26th January (week 1) and the last one on 23rd March 2015 (week 9). Plants grew until all the youngest leaves, present on 23rd March (week 9), were fully expanded, and the internode distance, leaf width and leaf length were measured for each single plant on 16th April (week 12). The number of investigated plants is indicated (Figure S1) and number of leaves were 117, 129, 177, 125 and 191 for 'Gala Galaxy' from nursery, 'Kidds’s Orange', line C44.4.146, 'Golden Delicious' and 'Gala Galaxy' in vitro, respectively.
Statistical analysis The statistical analysis was accomplished using the software JMP® 10.0 and 11.0 (SAS Institute INC., Cary, NC). For identification of statistically significant differences between groups the nonparametric Steel Dwass test was used with α = 0.05.
Results Plants were allowed to start growing and placed in a greenhouse cabin on January 5th 2015. On January 26 th 2015 the first plants reached the minimal length of 10 cm (week 1), and since then shoot length and leaf number were recorded weekly. Statistically significant differences of shoot length were found between genotypes from week 3 to week 9 (Figure S1). 'Gala Galaxy' from in vitro was always significantly different from the 'Gala Galaxy' from nursery. Statistically significant differences among line C44.4.146, 'Gala Galaxy' in vitro and 'Gala Galaxy' from nursery were observed since week 4. At all time points C44.4.146 was not significantly different from 'Golden Delicious', and 'Kidd’s Orange' was not significantly different from 'Gala Galaxy' from nursery.
- 83 - Morphological observation performed on the line C44.4.146.
Figure S1) Average shoot length of C44.4.146 and control genotypes from week three to nine. Different letters indicate statistically significant differences between groups (Steel Dwass test with α = 0.05). Bars represent standard deviations.
At week 12, when all leaves present in week 9 were fully expanded, leaf width and length together with internode length was recorded for all plants. The results are displayed as boxplot in Figure S2 and differences were investigated statistically using Steel Dwass test with α = 0.05. Leaf length of leaves from line C44.4.146 differed significantly from leaf length of the two 'Gala Galaxy' genotypes, while leaf width and internode length did not (Figure S2). At the same time point there was no significant difference between C44.4.146 and 'Gala'’s parent 'Kidd’s Orange', independent if the morphological parameter leaf length or leaf width was chosen.
- 84 - Annex to Chapter 2)
Figure S2) Boxplot of leaf length (top), leaf width (middle) and internode length (bottom), after a growth period of 12 weeks. Plants are shown in the following order: 'Gala Galaxy' from nursery, 'Kidds’s Orange', cisgenic line C44.4.146, 'Golden Delicious' and 'Gala Galaxy' in vitro. The number of plants whose leaves were considered is shown in brackets. Different letters indicate statistically significant differences between groups using Steel Dwass test with α = 0.05. Outliers are horizontally randomly shifted from the center line of each boxplot and were included for statistical analysis.
- 85 - Development of further cisgenic apple lines carrying the FB_MR5 fire blight resistance gene
Development of further cisgenic apple lines carrying the FB_MR5 fire blight resistance gene Introduction The development of cisgenic line C44.4.146 is described in Chapter two. This line was generated using the binary vector P9.Dap.FLPi-FBMR5, whereas it was soon observed that the negative selection involving the gene D-amino-oxidase could not be applied correctly, as this selection system hindered the regeneration of shoots. The use of this vector led to the regeneration of only a single line, despite the transformation of several thousand explants, and is thus not effective, and moreover the vector has the disadvantage of leaving behind after recombination stretches of vector sequences (apple foreign) reaching up to 414 bp [24]. Therefore, there is urgent need of applying a different transformation vector, and the best choice is the pMF1 vector, previously used to generate the first cisgenic line resistant to apple scab. In addition to the use of pMF1, and aiming at a cisgenic line possibly having a more durable resistance, there is also need to combine the FB_MR5 gene in a more fire blight robust tolerant genotype, as it is know that a single mutation in the pathogen effector
AvrRpt2EA is sufficient to overcome the FB_MR5 resistance. Summing up, there is need for more cisgenic lines, enabling the investigation of cisgenic lines with different insertion sites, and possibly these lines should be on one hand cleaner (carrying as few foreign sequences as possible) and on the other hand more robust lines transformed with this gene, in order to approach a real product with durable resistance. In this annex we describe the generation of several cisgenic fireblight resistant ‘Gala Galaxy’ lines using the pMF1::FB_MR5 vector, the results of inoculation experiments of three cisgenic lines and moreover the description of the development of intermediate transgenic lines of the fireblight robust variety ‘Ladina’ carrying FB_MR5.
Experimental procedures Micropropagation of the apple variety ‘Ladina’ At end of January 2014 scions of variety ‘Ladina’ were used, involucral-leaves removed and buds were washed for two hours in autoclaved water (on shaker and three times replaced). Under sterile conditions the healthy, meristem tissue was cut on a petri dish using a scalpel and transferred in 1 ml MS medium (4.4 g MS, 30 g sorbitol, 0.1 g myo-inositol per liter medium without any hormones and adjusted pH to 5.7) containing Eppendorf tubes. After 7 days all contaminated tubes and tubes containing brownish tissue were removed. In steps of 7 days tissue was adjust to increased phytohormone concentrations (without hormones, 50 % and finally 2.6 µM NAA, 3.1 µM BAP and 22 µM TDZ) by putting on 0.8 % agar plates. On the final medium formation of calli was observed and shoots were put on fresh medium every two weeks until formation of shoots was observed. Two shoots, k1 and k3 were separated from different calli, put on elongation medium (4.4 g MS, 30 g sucrose, 0.1 g myo-inositol, 2.1 µM BAP, 0.5 µM NAA, 2.8 µM GA3 and 0.8 % agar per liter and adjusted to pH 5.7) without antibiotics and further propagated. A leaf of each shoot was tested for presence of bacterial contamination by observation of microbial growth on YEB media (10 g Bacto Peptone Nr 10 g Bacto yeast extract, 5 g NaCl and 12 g agar per liter) of a stamp of the abaxial and adaxial leaf surface as well as between transversally bisected leaf stripes. Only shoots that resulted in no growth on YEB media were used for transformation.
Transformations Transformation experiments were performed according to Vanblaere et al (2011). Summed up, freshly developed leaves were cut in stipes and shaked for 30 minutes (120 rpm) in MS media with competent A. tumefaciens cells of strain AgL0, carrying pMF1::FB_MR5. 10 to 30 explants were adaxially put on - 86 - Annex to Chapter 2) coculture media (4.4 g MS, 30 g sorbitol, 0.1 g myo-inositol, 2.6 µM NAA, 2.2 µM TDZ and 8 g agar per liter, adjusted to pH 5.7) and stored in the dark at 24 °C for 3 days. Afterwards explants were washed twice in autoclaved water for 15 min (200rpm) at 24 °C and finally washed in 300 mg/l ticarcillin containing MS medium. Explants were placed adaxially on regeneration medium plates with 25 mg / L kanamycin and incubated at 24 °C in the dark and for 16 days, afterwards they were kept at 24 °C with 16 h light (3.5 kLux) per day and transferred on fresh media (with 50 mg kanamycin / L) every two weeks. As soon as shoots regenerated they were removed from the callus and put on elongation medium containing kanamycin. Transformants were investigated by PCR to confirm presence of FB_MR5, regularly propagated and transferred on fresh medium every 6 to 8 weeks until enough material was available for excision of the transgenic cassette. Recombination driven cisgenization was performed as by Vanblaere et al (2011) by cutting young leaf stripes and putting them on regeneration medium containing additionally 1 µM of dexamethasone (DEX) to initiate the exclusion of the selection marker cassette. Two weeks later (storage in the dark), by adding 5-fluorocytosin (5-FC) to the regeneration medium transgenic cells, still carrying the negative selection marker CodA started to produce the phytotoxic product 5-fluorouracil (5-FU). As soon as first differentiation of cells occurred, they were transferred on elongation medium containing DEX and 5-FC until shoot development. Cisgenic lines were then micrografted according to Joshi et al. (2011) and cultivated in greenhouse cabins.
- 87 -
Development of further cisgenic apple lines carrying the FB_MR5 fire blight resistance gene
Results Six-hundred and fourteen 'Gala Galaxy' explants were used to perform transformation with the pMF1 vector. Out of these explants, 32 transgenic lines resulted from four transformations (Table S1), and 7 produced enough material to perform DEX-driven recombination of the excisable cassette, which resulted in 7 cisgenic lines (C47D, C47M, C49H, C49I, C51B, C53B, C53Q, see Table S2). Three cisgenic 'Gala Galaxy' lines were further investigated by PCR for presence of FB_MR5 and absence of backbone and negative selection markers by PCR (Figure S3). Those three lines were micrografted, and as soon as enough budwood was produced, up to 12 plants per genotypes were tested for fire blight resistance in the quarantine greenhouse of Agroscope in Wädenswil. Compared to 'Gala Galaxy' with an average PLL of 94.0 % all three lines pC47M1, pC49I3C and pC53B showed significantly increased resistance to fire blight in the greenhouse, with an average PLL of 0.8 %, 15.2 % and 13.3 %, respectively (Figure S4).
Table S1) Results of 'Gala Galaxy' transformations performed with pmf1::FB_MR5
Experiment Number Regenerated Transformation Backbone BB of transgenic efficiency (in %) explants lines detected* (in %)
T47 160 5 3.13 2 40.00
T49 127 4 3.15 0 0.00
T51 149 7 4.70 2 28.57
T53 178 16 8.99 3 18.75
All 'Gala Galaxy' 614 32 5.21 7 21.88 transformations
*Backbone (BB) was identified by PCR in lines T47A1, T47B2, T51C, T51H, T53F, T53P and T53T.
- 88 -
Annex to Chapter 2)
Table S2 Summary of 'Gala Galaxy' transformations performed with pmf1::FB_MR5
Transgenic Backbone phenotype putative cisgenic shoot line In Line detected in vitro dexed after Dexing micrografted cisgenic* greenhouse
T47.A1 (A,B,C,D) yes healthy yes yes yes no no T47.B2 yes healthy no ND no ND no T47.C1 no sick no ND no ND no T47.D1 no sick yes maybe no ND no T47.M1 no healthy yes yes yes yes T47M1 T49.A1 no healthy no ND no ND no T49.H1 no healthy no maybe no ND no T49.I3 no healthy yes yes yes yes T49I3 T49.M1 no healthy no ND no ND no T51.B no healthy no maybe no ND no T51.C yes healthy no ND no ND no T51.E no sick no ND no ND no T51.F no healthy no ND no ND no T51.G no sick no ND no ND no T51.H yes healthy no ND no ND no T51.I no sick no ND no ND no T53.B no healthy yes yes yes yes T53B T53.D no healthy no ND no ND no T53.F yes healthy no ND no ND no T53.G no healthy no ND no ND no T53.I no healthy no ND no ND no T53.J no healthy no ND no ND no T53.K no sick no ND no ND no T53.L no sick no ND no ND no T53.M no sick no ND no ND no T53.N no healthy no ND no ND no T53.O no healthy no ND no ND no T53.P yes healthy no ND no ND no T53.Q yes healthy no maybe no ND no T53.R no healthy no ND no ND no T53.S no sick no ND no ND no T53.T yes healthy no ND no ND no * tested by PCR for presence of FB_MR5, absence of CodA and absence of backbone. Maybe: inconsistent results in PCR. ND: not determined. Cisgenic lines are shown in bold.
- 89 -
Development of further cisgenic apple lines carrying the FB_MR5 fire blight resistance gene
Figure S3) Results after PCR with specific primers for backbone (IpcrCodA, pmfBB), selection marker CodA (CodAfor, CodArev) and FB_MR5 (FBMR5q1for, FBMR5q1rev). The transgenic motherlines T47M1, T49I3 and a not completely cisgenic line (pC53B B) showed presence of CodA and FB_MR5, and absence of backbone. The micrografted, putative cisgenic shoots pC53B A, pC47M1 (A and B) and pC49I3C (A and B) showed presence of FB_MR5 and absence of selection marker CodA.
Figure S4) Boxplot showing fire blight severity expressed in percentage of lesion length (PLL) of 'Gala Galaxy' wild type plants and shoots of three cisgenic lines (47M1, 49I3 and 53B) bearing FB_MR5 21 dpi after inoculation. Number of inoculated shoots were 12, 9, 10 and 9, respectively. Inoculations were performed by syringe. Each small box delimits values between 25 % and 75 % of the group. Horizontal line represents median of group. Median for 47M1 was 0 PLL. Whiskers are drawn for obtained values that differ least from median ± 1.5 interquartile ranges. Different letters indicate statistically significant differences (Steel Dwass test with α = 0.05) between groups.
- 90 -
Annex to Chapter 2)
As strains that overcome the resistance of FB_MR5 have been reported, for a durable resistance several resistances need to be pooled. To create a first plant with pyramided fire blight resistance we used the apple variety 'Ladina', which is fire blight robust and shows apple scab resistance probably mediated by a quantitative trait against fire blight and scab, and added FB_MR5 to this elite cultivar applying the same transformation protocol used for the genotype 'Gala Galaxy'. 557 explants in four independent transformations with the vector pmf1::FBMR5 led to 20 transgenic lines (Table S5). PCR was then used to investigate the presence of the cisgene FB_MR5 and the presence of backbone sequences. Five lines contained backbone (T48F1, T50E, T50L and T50P, Figure S5) and T48 (I2) (data not shown) and were excluded from any further step. Sufficient plant material for excision of the transgenic cassette was produced from eight lines (Table S6). From these lines, three lines (pC46D, pC50L and pC52B) were regenerated, whereas due to time restrictions, no further investigation of these lines could be performed to confirm absence of the excisable cassette (and therefore designated putative cisgenic pC). The further characterization of those lines will allow insights into effects of pyramiding of several resistances in apple.
Table S5) Results of 'Ladina' transformations performed with pmf1::FB_MR5
Experiment Number of Regenerated Transformation Backbone BB explants transgenic efficiency (in %) lines detected* (in %)
T46 60 1 1.67 0 0.00
T48 48 5 10.42 2 40.00
T50 244 9 3.69 3 33.33
T52 205 5 2.44 0 0.00
All 'Ladina' 557 20 3.59 5 25.00 transformations
* Backbone (BB) was identified by PCR in lines T48F1, T48(I2), T50E, T50L and T50P.
- 91 -
Development of further cisgenic apple lines carrying the FB_MR5 fire blight resistance gene
Table S6) Summary of 'Ladina' transformations performed with pmf1::FB_MR5
Transgenic Backbone phenotype putative cisgenic shoot line Line detected in vitro dexed after Dexing micrografted in greenhouse
T46D2 no healthy yes maybe no no T48B1 no healthy yes no no no T48C2 no healthy yes no no no T48.F1 yes healthy no ND no no T48H1 no healthy yes no no no T48.(I2) yes healthy no ND no no T50.C no healthy no ND no no T50.E yes healthy no ND no no T50.F no healthy no ND no no T50.I no sick no ND no no T50.J no sick no ND no no T50.K no healthy no ND no no T50L yes healthy yes maybea no no T50M no healthy yes no no no T50.P yes healthy no ND no no T52.A no healthy no ND no no T52B no healthy yes maybeb no no T52.C no healthy no ND no no T52.D no healthy no ND no no T52E yes healthy yes no no no
Legend: Maybe means that further investigations are needed. a Tested by PCR for presence of FB_MR5, presence of CodA and absence of backbone. b Tested by PCR for presence of FB_MR5, absence of CodA and absence of backbone ND: not determined. No cisgenic lines could be attained so far. All plants are still in the in vitro culture stage.
- 92 -
Annex to Chapter 2)
Figure S5) Investigation of transgenic in vitro lines of variety 'Ladina' by PCR. Amplification of FB_MR5 (FBMR5q1for, FBMR5q1rev), backbone (IPCRcodA, pmfBB) selection marker CodA (CodAfor, CodAref) and two amplicons if eukaryotic DNA was present (EF1alpha Seq2for, EF1alpha Seq2rev). Samples were loaded in the following order: T46D2, T48B1,T48C2, T48F1, T48H1, T50C, T50E, T50F, T50I, T50J, T50K, T50L, T50M, T50P, T52A, T52B, T52C, T52D, T52E, 'Gala Galaxy', buffer, Agrobacteria carrying pmf1::FB_MR5.
- 93 - Investigation of the fire blight resistance cascade triggered by FB_MR5 using RNASeq'
Chapter 3)
Investigation of the fire blight resistance cascade triggered by FB_MR5 using RNASeq in transgenic 'Gala Galaxy'
Manuscript to be submitted as:
Kost TD, Wöhner T, Gessler C, Flachowsky H, Patocchi A, Richter K, Broggini GAL (2016). Investigation of the fire blight resistance cascade triggered by FB_MR5 using RNASeq in transgenic 'Gala Galaxy'.
- 94 - Chapter 3)
Abstract In this manuscript we present an RNAseq experiment aiming at the identification of the transcriptional changes induced by the recognition of E. amylovora by the fire blight resistance gene product FB_MR5. For this purpose we compared the transcriptome of the susceptible cultivar 'Gala Galaxy' following inoculation, with the transcriptome of a, due to genetic engineering, fire blight resistant 'Gala Galaxy' line that carries the fire blight resistance gene FB_MR5 and the selectable marker gene nptII. This unique set up allowed to compare two identical genotypes differing only by two genes, avoiding the problems linked to the heterozygosity and large genetic distance arising when comparing two different cultivars. The whole transcriptome of leave stripes from three biological replicates of the transgenic and the wild-type line was compared 24 hours after inoculation with Erwinia amylovora using RNASeq. At this time point, 206 transcripts were differentially expressed between the two compared genotypes. 64 of those transcripts showed increased abundance in the transgenic plants while 142 were higher expressed in the wild-type plants. The most striking transcriptional differences in response to E. amylovora were observed in candidates highly transcribed in the transgenic plants that showed homologies to proteins involved in cell wall synthesis and biotic stress response while the most transcribed genes in the wild-type plants showed sequence homologies to proteins involved in photosynthesis. However, no clear transcriptional changes due to disease resistance triggered by FB_MR5 were observed. 22 previously recommended reference genes for apple were compared between the two genotypes after fire blight inoculation as well as between 'Gala Galaxy' that underwent either a biotic or an abiotic stress treatment. The generated reads allowed the de novo assembly of a 'Gala Galaxy' transcriptome with 77’543 transcripts.
- 95 - Investigation of the fire blight resistance cascade triggered by FB_MR5 using RNASeq
Introduction Understanding the mechanisms underlying plant resistance is important while developing durable strategies for deployment of resistances. Among the fruit crops, apple is the most important crop in European countries together with grape. Striving at sustainable production of apple, natural resistances need to be introgressed into cultivars to decrease the chemical inputs during the production season. Apple breeding is a labor-intense process, and it results in a novel genotype, i.e. a novel combination of agronomical and fruit properties. This is due to the self-incompatibility of this crop, which results in high heterozygosity. Comparison of resistant apple genotypes with susceptible ones (e.g. wild apple M ×robusta 5 vs. 'Gala Galaxy') to identify specific plant defense mechanisms, is therefore hampered by this high heterozygosity. A different situation if found while applying plant biotechnology to amend a susceptible cultivar with a single resistance gene. Broggini et al. (2014) reported recently the development of transgenic lines that carry the fire blight resistance gene FB_MR5, derived from the Malus wild accession M ×robusta 5. These transgenic lines were used to demonstrate the functionality of this, at that time candidate resistance gene, against the fire blight causal agent E. amylovora by complementation of the susceptible cultivar 'Gala Galaxy' (Broggini et al., 2014). Such plant material as the transgenic line T41D (used in this study), is of inestimable value while investigating the plant defense mechanisms induced by the resistance gene FB_MR5.
This study focuses on the FB_MR5-induced transcriptional defense response following fire blight pathogen recognition. FB_MR5 is a member of the NBS-LRR resistance gene family. It is assumed to undergo a gene-for-gene relationship with the avrRpt2EA effector of E. amylovora (Vogt et al., 2013), but the resistance mechanism remains at large unknown. The R-gene dependent defense response has been summarized by Dangl and Jones (2001). After recognition of a pathogen, plants avoid an infection and multiplication of the pathogen by a defense response consisting of several structural and/or chemical components. Those host responses can be classified as a passive response where formation of waxy cuticle or accumulation of antimicrobial compounds is performed in absence of a particular pathogen (Anderson, 1982; Jackson and Taylor, 1996; Osbourn, 1996) or as an active defense response based on transcriptional and metabolic changes triggered by recognition of a pathogen (Hutcheson, 1998). This active defense response to biotrophic pathogens consist of three levels. The first one involves the cells that are directly in contact with the pathogen and leads to lignification of cell walls, and induction of the hypersensitive response (HR) including the release of reactive oxygenic species (ROS) (Levine et al., 1994; Mehdy, 1994), changes in ion fluxes and phosphorylation of proteins leading to local cell death. The second response leads to a local resistance in cells close to the infection site by accumulation of phenylpropanoids (Dixon and Paiva, 1995; Dixon et al., 2002; Petkovšek et al., 2009; Schijlen et al., 2004; Slatnar et al., 2010), phytoalexins (Darvill and Albersheim, 1984), antioxidants (Lamb and Dixon, 1997; Mittler, 2002), phenolic compounds (Nicholson and Hammerschmidt, 1992), pathogenesis-related (PR) proteins (Ryals et al., 1996; Martin et al., 2003) and cell wall fortification (Schenk et al., 2000; Cheong et al., 2002). The third level consist of resistance in distal, uninfected plant tissue (Chisholm et al., 2006; Robert-Seilaniantz et al., 2007) and is triggered by PR proteins (Heyens et al., 2006) and salicylic acid accumulation and crosstalk with other phytohormones (Ryals et al., 1996; Hutcheson, 1998; Durrant and Dong, 2004; Bostock, 2005; Huot et al., 2014).
Modulation of the transcription of defense-related proteins were studied in particular in apple in response to fire blight by comparing different genotypes showing different levels of resistance/susceptibility to fire blight. In these studies several thousand differentially expressed genes
- 96 - Chapter 3) were found as summarized by Malnoy et al. (2012). Two of those studies contained Malus ×robusta 5- related genotypes (Baldo et al., 2010; Jensen et al., 2012).
Several studies of the pathosystem E. amylovora / Malus × domestica reported information about genes and proteins involved in fire blight resistance during the last 15 years. One of the first responses to pathogenesis of the hostplant is the release of ROS, a mixture of highly reactive and therefore toxic molecules with the ability to damage cell structures including DNA (Torres et al., 2006; Gill and Tuteja, 2010) to directly hinder multiplication of invading cells or to enable fortification of cell walls by cross linking of glycoproteins using such ROS. In apple it is known that an oxidative burst occurs, independent of the susceptibility of the cultivar after recognition of E. amylovora (Venisse et al., 2001; Venisse et al., 2002; Venisse et al., 2003; Norelli et al., 2009; Viljevac, 2009; Baldo et al., 2010; Khan et al., 2012; Iakimova et al., 2013; Markiewicz and Michalczuk, 2015).
In fire blight susceptible cultivars E. amylovora was shown to delay the phenylpropanoid pathway during infection and thereby avoiding the generation of secondary metabolites as phytoalexins, flavonoids and lignification (Venisse et al., 2002; Baldo et al., 2010; Milčevičová et al., 2010; Malnoy et al., 2012). Moreover in resistant cultivars an upregulation of genes or enzymes involved in this pathway has been reported (Jensen et al., 2012).
Beside genes related to the phenylpropanoid pathway, PR-genes are of potential interest. PR-genes are known to be involved in the activation of systemic acquired resistance (SAR) (Ryals et al., 1996; Golshani et al., 2015;). In apple PR-2 (β-1,3-glucanase), PR-5 (thaumatin-like), PR-8 (chitinase) and PR- 10 (ribonuclease-like) were reported to be released in susceptible cultivars (Bonasera et al., 2006; Heyens et al., 2006; Norelli et al., 2009; Mayer et al., 2011) and in susceptible and resistant cultivars (Venisse et al., 2002). As PR-2 overexpression was observed in an uninoculated leaf of an inoculated plant, it is an interesting protein which could be involved in systemic resistance in apple (Heyens et al., 2006). Moreover this protein was upregulated in the resistant cultivar 'Free Redstar' at 24 hours post E. amylovora inoculation while it was not in a susceptible cultivar (Markiewicz and Michalczuk, 2015). PR-proteins are able to induce SAR, in which several phytohormones are involved.
The methods to study changes in the transcriptome of apple after fire blight inoculation drastically evolved during the last decade. Initially cDNA AFLP and RFLP (Barionovi et al., 2006) and suppression subtractive cDNA assays (Norelli et al., 2009) were applied. Later, microarrays (Bonasera et al., 2006; Jensen et al., 2010; Sarowar et al., 2011; Soria-Guerra et al., 2011; Jensen et al., 2012) or EST microarrays (Gasic et al., 2009; Khan et al., 2012) were a common method to reveal transcriptional differences, while more recently due to the dropping costs and increasing measurement accuracy the powerful NGS technologies as RNASeq took over (Zhang et al., 2012; Gusberti et al., 2013; Bai et al., 2014).
In this study a de novo assembled transcriptome of 'Gala Galaxy' was generated and previously identified house-keeping genes for apple were compared in plants exposed to biotic (inoculated with E. amylovora) or abiotic stress (65 hours high humidity treatment). This RNASeq study aimed at the detection of the FB_MR5 specific transcriptional changes in the defense response by comparing the transcriptomes of the susceptible 'Gala Galaxy' and the transgenic 'Gala Galaxy' transformed with the resistance gene FB_MR5 (and nptII). Differences in gene transcription observed 24 hours after fire blight inoculation with scissors are presented.
- 97 - Investigation of the fire blight resistance cascade triggered by FB_MR5 using RNASeq
Results Library construction RNASeq libraries were generated from RNA extracted from three biological replicates each of following leaf samples: Half leaves (teared in parallel to the midvein) of 'Gala Galaxy' kept at 100 % humidity during 65 h and leaf stripes (transversally bisected) from 'Gala Galaxy' and the transgenic line T41D, 24 h post scissor inoculation with E. amylovora. A sequencing depth of six or four libraries per single Illumina lane was achieved for plant material undergoing the abiotic stress treatment or the biotic approach (E. amylovora inoculation), respectively. Following de-multiplexing and pairing, the number of raw reads per library ranged from about 59 to 98 Mio reads, with an average of 74 million reads (table 1).
Table 1) Summary of raw reads per sample. Biological replicates are indicated as A, B and C
Gala Galaxy Gala Galaxy Gala Galaxy Gala Galaxy Gala Galaxy Gala Galaxy Trans Trans Trans Sample high high high inoculated inoculated inoculated inoculated inoculated inoculated Total humidity (A) humidity (B) humidity (C) (A) (B) (C) (A) (B) (C) Raw 59'815'636 59'101'202 59'868'078 76'900'662 89'468'390 78'114'886 80'740'680 72'826'086 97'535'788 674'371'408 reads
De novo assembly A total of 674'371’408 paired reads obtained from the nine libraries were assembled into contigs, resulting in 77’543 contigs with an average length of 945 bp and a range between the minimal chosen length of 300 bp and 16’894 bp and in about 0.5 % of the nucleotides ambiguity was observed. The function of the different contigs was then assigned in silico using Mercator, and it was found that 66 % of the contigs showed no functional homology to known proteins (figure 1). The remaining 34 % were assigned to one of 35 functional bins (figure 1), the largest one being protein synthesis, representing 6.7 % of the de novo assembled contigs, followed by 5.0 % RNA, 3.6 % signaling and 2.6 % stress.
- 98 - Chapter 3)
Figure 1) Homologies of de novo assembled transcripts to known proteins and pathways using binning of Mercator.
Mapping It was observed that over 11’000 of the generated transcripts could not be mapped (table 2) to the ‘Golden Delicious’ reference genome provided by Velasco et al. (2010). Over 2000 de novo transcripts showed an RPKM that was higher than 50 while over 56’000 had an RPKM lower than 1.
Table 2) Transcription of de novo reads mapped on totally 63’541 proteins of gene model v1.0.
RPKM Hits Hits in % < 0.1 20’440 32,2 < 1 36’341 57,2 < 2 42’491 66,9 > 2 21’050 33,1 > 10 8’194 12,9 > 50 2’223 3,5 = 0 11’094 17,5
The single reads libraries were mapped back to the de novo assembled contigs to assess transcriptional levels and statistical analysis allowed identification of differentially expressed transcripts. The transgene nptII matched to the contig Kost_et_al_70213 by BLAST hit. This contig was expressed in all transgenic (T41D) replicates A, B and C with RPKMs of 44.7, 106.7 and 44.6 while it was absent in all inoculated (RPKMs of 0.00, 0.00 and 0.03) or high humidity-treated (RPKM of 0.04, 0.04 and 0.00) 'Gala Galaxy' wild-type replicates, respectively. FB_MR5 was difficult to identify in the contigs, as several contigs matched partially but not completely (contigs 3346, 7897, 10389 and 12422). Those contigs showed RPKM values between two and 24 in the transgenic as well as in the wild-type plants. To avoid this problem the single reads libraries were mapped specifically on the coding sequences of nptII and FB_MR5 only. In fact, when an exact mapping (98 % similarity) of the reads from all 'Gala Galaxy' and transgenic 'Gala Galaxy' plants was performed on nptII and FB_MR5 as reference sequence, average RPKMs of 0 and 1’237’814 were obtained for nptII while RPKMs of 0 and 1151 were identified for FB_MR5, respectively (table 3). Reads isolated from one replicate of the E. amylovora inoculated plants did not map on FB_MR5 at all but clearly on nptII (table 3, trans A).
Table 3) Reads mapped on nptII or FB_MR5 grouped by biological replicates. Results are shown as RPKMs after mapping RNASeq reads on nptII or on FB_MR5 as reference under stringent conditions (length identity 80 % and similarity 98 %).
Gala (A) Gala (B) Gala (C) high high high Gala (A) Gala (B) Gala (C) Trans (A) Trans (B) Trans (C) Target humidity humidity humidity 24 hpi 24 hpi 24 hpi 24 hpi 24 hpi 24 hpi (RPKM) (RPKM) (RPKM) (RPKM) (RPKM) (RPKM) (RPKM) (RPKM) (RPKM) NptII 0 0 0 0 0 0 1’243’781 1’230’530 1’239’131
FB_MR5 0 0 0 0 0 0 0 2’557 897
House-keeping genes RNASeq reads were used to verify the stability of 22 proposed reference genes for apple leaf tissue (supplementary table 1). For this analysis those genes were numbered from 1 to 22 according to - 99 - Investigation of the fire blight resistance cascade triggered by FB_MR5 using RNASeq supplementary table 1.The RPKM values of the 22 reference genes were assessed for the nine generated libraries mapping on the original MDP coding sequences, and fold-change was calculated between humidity-treated and E. amylovora inoculated 'Gala Galaxy' (supplementary figure 1 left hand side) or between E. amylovora inoculated 'Gala Galaxy' and T41D (supplementary figure 1 right hand side). The recommended reference genes located differently on the two volcano plots, and three respectively four genes resulted showing p-values smaller than 0.1 in the two comparisons. Two genes resulted differentially expressed with a p-value smaller than 0.01 (genes 9 and 13). Fold-change of the different reference genes varied between 0.2 (gene 22, supplementary figure 1 left) and about 2 (gene 19, supplementary figure 1 right). Therefore RNASeq reads of the transgenic and the wild-type plants were used to calculate average transcription and standard deviation in all tested conditions, and reference genes were ordered according to the smallest standard deviation percentage per mean RKPM (supplementary table 1). The five house-keeping genes actin (MDP0000060858), two SAND family proteins (MDP0000088431 and MDP0000202305), Sec14 cytosolic factor (MDP0000160107) and a SAGA associated factor (MDP0000336547) showed high stability corresponding to the lowest standard deviation and fold-change (genes 1, 4, 5, 11 and 15 in supplementary figure 1). To spot new putative reference genes a list with 300 transcripts that showed a low standard deviation per average RPKM of biological triplicates was generated (supplementary table 2).
Differentially expressed transcripts between 'Gala Galaxy' and T41D plants 24 hour post inoculation with E. amylovora. A total of 206 differentially expressed transcripts were observed between the transgenic T41D and the 'Gala Galaxy' wild-type plants applying a false discovery rate (FDR) of 0.01 (supplementary table 3). The standard deviation in those 206 transcripts between biological replicates, ranged from 1 to 97 % of the average RPKM (supplementary table 4). 64 transcripts were significantly more abundant in the transgenic plants, and 46 of them could be functionally annotated. 142 genes were higher transcribed in the wild-type plants, and 105 of these could be functionally annotated. The most abundant transcripts in the transgenic plants were related to protein modification (27 %), transport (18 %), cell wall (10 %) and stress (10 %). While most highly represented transcripts in 'Gala Galaxy' were predicted of being related to photosynthesis (35 %) followed by the categories protein modification (11 %) and glycolysis (8 %). To verify statistically significantly enriched groups (p-values < 0.05) a hypergeometric test was performed. This analysis confirmed that there was an enrichment of these functions in the differentially expressed transcripts compared to the overall distribution of the functions in the whole data set (table 4).
The predicted function of the 151 annotated differentially expressed genes between T41D and 'Gala Galaxy' 24 hours post inoculation was visualized using Mapman. A general overview is shown in figure 2, and it was found that the number of transcripts (indicated in parentheses) related to photosynthesis (42), proteins (14) or glycolysis (9) were significantly more abundant in the 'Gala Galaxy' wild-type plants than in the transgenic plants (figure 2). The transcripts significantly more abundant in T41D (compared to the wild-type) were related to the BIN categories cell wall, stress, protein modification and transport with five, five, twelve and nine hits, respectively.
The 151 annotated and differentially transcribed transcripts were further assessed for their potential involvement in known plant defense mechanisms in response to biotic stress or in secondary metabolism and corresponding transcripts are shown in figure 3. Transcripts related to cell wall, a peroxidase, a MYB factor and a heat-shock protein resulted to be higher transcribed in T41D, while transcripts related to abscisic acid signaling and secondary metabolites resulted higher transcribed in
- 100 - Chapter 3)
'Gala Galaxy'. A mixed behavior was observed for genes involved in proteolysis and signaling. Looking in detail at the results, it was found that in T41D following transcripts were more abundant than in 'Gala Galaxy': Four transcripts with low transcript ratio (fold-change of 1.4, 3.0, 5.0 and 17.6) binned to cell wall synthesis or modification of cell wall and one assigned as pectin estherase (fold-change of 4.0); A DNAJ heat shock protein like transcript (fold-change of 2.5) and a PR-protein like transcript (fold-change of 2.8); a predicted peroxidase (fold-change of 8.1), two signalling involved transcripts, namely a receptor kinase and a 14-3-3 regulator factor (fold-change of 2 and 1.6, respectively); and a MYB-family transcription factor (fold-change of 8.8). The transcripts with higher transcription level in 'Gala Galaxy' were a cold shock protein (fold-change of 4.4) and seven transcripts assigned to the non- mevalonate pathway (fold-change of 1.8 and 2.7), to carotenoids (fold-change of 2.0), to flavonoids (fold-change of 2.1 and 3.1) and to abscisic acid synthesis (fold-change of 2.0 and 2.7) (supplementary table 7).
To spot striking transcripts a table was generated with clustered groups of transcripts with similar functions that have been previously reported to be related to fire blight resistance in apple or to a defese response against a biotic threat in a different host plant (table 5).
Beside the investigation of transcripts assigned to general biotic stress response pathway, a more general approach consisted in investigating the function of the top 20 differentially expressed transcripts that showed lowest, conservative (Bonferoni corrected) p-values (table 6). Eleven of those transcripts were more abundant in the 'Gala Galaxy' wild-type plants and binned to photsynthesis. While one transcript that was 18 times more abundant in the transgenic plants binned to the category cell wall modification.
- 101 - Investigation of the fire blight resistance cascade triggered by FB_MR5 using RNASeq in transgenic 'Gala Galaxy'
Table 4) Hypergeometrical test allowed identification of statistically significantly (p-value < 0.05) enriched (observed – expected > 0) or underrepresented (observed – expected < 0) transcripts. Categories containing photosynthesis (PS) are indicated in bold.
Full In Expected Observed Category set subset in subset - expected p-value PS.lightreaction.photosystem II.LHC-II 16 7 0 7 9.44E-15 PS.calvin cycle.GAP 4 4 0 4 4.84E-11 PS.lightreaction.photosystem I.LHC-I 12 5 0 5 9.83E-11 PS.calvin cycle.aldolase 15 4 0 4 6.45E-08 PS.lightreaction.photosystem II.PSII polypeptide subunits 35 4 0 4 2.37E-06 PS.calvin cycle.PRK 2 2 0 2 7.02E-06 TCA / org transformation.carbonic anhydrases 16 3 0 3 1.01E-05 PS.photorespiration.phosphoglycolate phosphatase 3 2 0 2 2.10E-05 protein.synthesis.elongation 69 4 0 4 3.65E-05 PS.calvin cycle.FBPase 4 2 0 2 4.20E-05 OPP.non-reductive PP.ribose 5-phosphate isomerase 4 2 0 2 4.20E-05 amino acid metabolism.degradation.serine-glycine-cysteine group.glycine 4 2 0 2 4.20E-05 glycolysis.cytosolic branch.non-phosphorylating glyceraldehyde 3-phosphate dehydrogenase (NPGAP-DH) 4 2 0 2 4.20E-05 PS.lightreaction.ATP synthase.gamma chain 5 2 0 2 6.99E-05 transport.peptides and oligopeptides 83 4 0 4 7.54E-05 secondary metabolism.isoprenoids.non-mevalonate pathway.DXS 8 2 0 2 1.95E-04 cell wall.modification 46 3 0 3 2.58E-04 N-metabolism.ammonia metabolism.glutamine synthetase 10 2 0 2 3.12E-04 misc.rhodanese 11 2 0 2 3.80E-04 transport.Major Intrinsic Proteins.PIP 11 2 0 2 3.80E-04 PS.lightreaction.photosystem I.PSI polypeptide subunits 12 2 0 2 4.55E-04 PS.calvin cycle.rubisco interacting 13 2 0 2 5.37E-04 major CHO metabolism.degradation.starch.starch cleavage.beta amylase 21 2 0 2 1.43E-03 protein.folding 102 3 0 3 2.61E-03 tetrapyrrole synthesis.magnesium-protoporphyrin IX monomethyl ester (oxidative) cyclase 1 1 0 1 2.66E-03
- 102 - Chapter 3)
Full In Expected Observed Category set subset in subset - expected p-value protein.targeting.mitochondria 37 2 0 2 4.40E-03 major CHO metabolism.synthesis.sucrose.FBPase 2 1 0 1 5.31E-03 PS.lightreaction.ATP synthase.delta chain 2 1 0 1 5.31E-03 PS.calvin cycle.RPE 2 1 0 1 5.31E-03 minor CHO metabolism.myo-inositol.InsP Synthases 2 1 0 1 5.31E-03 protein.targeting 3 1 0 1 7.95E-03 not assigned.no ontology.S RNA-binding domain-containing protein 3 1 0 1 7.95E-03 protein.synthesis.ribosomal protein.prokaryotic.unknown organellar.30S subunit.S1 3 1 0 1 7.95E-03 amino acid metabolism.synthesis.central amino acid metabolism.GABA.Glutamate decarboxylase 4 1 0 1 0.01 secondary metabolism.isoprenoids.carotenoids.phytoene synthase 4 1 0 1 0.01 amino acid metabolism.synthesis.serine-glycine-cysteine group.serine.phosphoglycerate dehydrogenase 5 1 0 1 0.01 transport.Major Intrinsic Proteins.TIP 5 1 0 1 0.01 tetrapyrrole synthesis.glu-tRNA reductase 5 1 0 1 0.01 secondary metabolism.flavonoids.flavonols.flavonol-3-O-rhamnosyltransferase 6 1 0 1 0.02 glycolysis.cytosolic branch.glyceraldehyde 3-phosphate dehydrogenase (GAP-DH) 6 1 0 1 0.02 hormone metabolism.abscisic acid.synthesis-degradation. synthesis.short chain alcohol dehydrogenmase (ABA2) 6 1 0 1 0.02 PS.calvin cycle.phosphoglycerate kinase 6 1 0 1 0.02 glycolysis.unclear/dually targeted.phosphoglycerate mutase 7 1 0 1 0.02 lipid metabolism.FA synthesis and FA elongation. Acetyl CoA Carboxylation.homomeric Enzyme 7 1 0 1 0.02 secondary metabolism.flavonoids.dihydroflavonols.dihydroflavonol 4-reductase 7 1 0 1 0.02 metal handling.acquisition 8 1 0 1 0.02 misc.other Ferredoxins and Rieske domain 8 1 0 1 0.02 PS.photorespiration.glycolate oxydase 8 1 0 1 0.02 TCA / org transformation.other organic acid transformatons.cyt MDH 9 1 0 1 0.02 cell wall.precursor synthesis.UDP-Glc dehydrogenase (UGD) 9 1 0 1 0.02 TCA / org transformation.TCA.pyruvate DH.E1 9 1 0 1 0.02
- 103 - Investigation of the fire blight resistance cascade triggered by FB_MR5 using RNASeq in transgenic 'Gala Galaxy'
Full In Expected Observed Category set subset in subset - expected p-value PS.lightreaction.NADH DH 9 1 0 1 0.02 misc.alcohol dehydrogenases 9 1 0 1 0.02 minor CHO metabolism.raffinose family.raffinose synthases.putative 9 1 0 1 0.02 cell.organisation.cytoskeleton.actin.Actin 10 1 0 1 0.03 transport.sugars 97 2 0 2 0.03 TCA / org transformation.other organic acid transformatons.atp-citrate lyase 11 1 0 1 0.03 Biodegradation of Xenobiotics.lactoylglutathione lyase 11 1 0 1 0.03 OPP.oxidative PP.6-phosphogluconate dehydrogenase 11 1 0 1 0.03 signalling.14-3-3 proteins 12 1 0 1 0.03 not assigned.no ontology 1651 9 4 5 0.03 RNA.regulation of transcription.CCAAT box binding factor family, HAP5 13 1 0 1 0.03 Biodegradation of Xenobiotics 14 1 0 1 0.04 transport.metal 120 2 0 2 0.04 PS.photorespiration.serine hydroxymethyltransferase 18 1 0 1 0.05 protein.synthesis.initiation 140 2 0 2 0.05 hormone metabolism.abscisic acid.induced-regulated-responsive-activated 21 1 0 1 0.05 hormone metabolism.gibberelin.synthesis-degradation 21 1 0 1 0.05 protein.postranslational modification 996 1 3 -2 0.93
- 104 - Chapter 3)
Figure 2) Mapman mapping of the differentially expressed transcripts (DETS) identified between T41D and 'Gala Galaxy' on the general function/pathway overview. DETS are represented as colored boxes, and green indicates that RPKMs in the fireblight resistant, transgenic plants were higher than in the susceptible wild-type plants. Red indicates a higher number of RPKMs in the 'Gala Galaxy' wild- type plants than in the transgenic plants. Strong color indicates big differences and fain color weak changes. DETS are grouped by involvement in pathways: 1: photosynthesis, 2: major CHO metabolism, 3: minor CHO metabolism, 4: glycolysis, 5: fermentation, 6: gluconeogenese/ glyoxylate cycle, 7: OPP, 8: TCA / org. transformation, 9: mitochondrial electron transport / ATP synthesis, 10: cell wall, 11: lipid metabolism, 12: N-metabolism, 13: amino acid metabolism, 14: S-assimilation, 15: metal handling, 16: secondary metabolism, 17: hormone metabolism, 18: Co-factor and vitamin metabolism, 19: tetrapyrrole synthesis, 20: stress, 21: redox, 22: polyamine metabolism, 23: nucleotide metabolism, 24: biodegradation of xenobiotics, 25: C1-metabolism, 26: misc, 27: RNA, 28: DNA, 29: protein, 30: signaling, 31: cell, 32: micro RNA, natural antisense etc, 33: development, 34: transport, 35: not assigned. Ratio shows weighted proportional RPKM of wild-type plants divided by weighted proportional RPKM of transgenic plants if bigger than one, else the obtained value with a negative prefix. The highest and lowest ten RPKM ratios were summarized in supplementary tables 5 and 6.
- 105 - Investigation of the fire blight resistance cascade triggered by FB_MR5 using RNASeq
Figure 3) Overview of homologies of differentially expressed transcripts binned to known biotic stress-involved proteins. Figure was generated using Mapman. For explanation of legend see figure 2. A list with the involved transcripts is shown in supplementary table 7.
- 106 - Chapter 3)
Table 5) Significantly different transcripts sorted by BIN pathways. Fold-change (fc) < 0 for higher transcripts in line T41D. Source: Similar transcripts reported.
Mapman involved in predicted function transcript fc Gala vs T41D source E. amylovora-related response biotic stress response BIN
26.1.2 ROS Detoxification peroxidase kost_et_al_contig_9822 -8,1 peroxidases or peroxiredoxin Hiraga 2001
10.1.4 cell wall fortification cell wall kost_et_al_contig_6084 -1,4
10.7 cell wall fortification cell wall kost_et_al_contig_134 -3 glucanase and chitinase Balasubramanian 2012
10.7 cell wall fortification cell wall kost_et_al_contig_603 -5 glucanase and chitinase Balasubramanian 2012
10.7 cell wall fortification cell wall kost_et_al_contig_49392 -17,6 glucanase and chitinase Balasubramanian 2012
Jensen et al. 2012 10.8.1 cell wall fortification cell wall kost_et_al_contig_15854 -4 Pectin esterase up in less sus cultivar Baldo et al. 2010 Jensen et al. 2012 20.2.1 transcription heat shock protein kost_et_al_contig_22134 -2,5 Hsp90 less susceptible some up some down Norelli et al. 2009
20.2.2 transcription cold shock protein kost_et_al_contig_13624 4,4
30.2.99 signalling receptor kinase kost_et_al_contig_10599 -1,9 Baldo et al. 2010 protein kinases up in resistant rootstock G41
30.5 signalling G-proteins kost_et_al_contig_1429 1,9
30.7 signalling 14-3-3 protein kost_et_al_contig_3950 -1,6
Jensen et al. 2012, 27.3.26 RNA regulation of transcription MYB-related kost_et_al_contig_225 -8,8 Hsp90 less susceptible some up some down Norelli et al. 2009
27.3.16 RNA regulation of transcription CCAAT kost_et_al_contig_2160 2
27.3.7 RNA regulation of transcription Constans-like kost_et_al_contig_6859 -1,9 Markiewicz et al. 2015 constans like genes down in res cultivar Free Redstar
27.3.99 RNA regulation of transcription unclassified kost_et_al_contig_280 1,5
27.3.99 RNA regulation of transcription unclassified kost_et_al_contig_485 -1,9
29.2.3 protein synthesis initiation eIF-4A kost_et_al_contig_1976 -1,7 Baldo et al. 2010 eIF4A upregulated in resistant rootstock G41
29.2.3 protein synthesis initiation eIF-4D kost_et_al_contig_6126 -1,4 " "
Jensen et al. 2012 29.2.4 protein synthesis elongation EF-1-alpha kost_et_al_contig_2062 -2,4 down regulation showed less susceptibility Norelli et al. 2009
29.2.4 protein synthesis elongation EF-1-alpha kost_et_al_contig_2664 -1,9 " "
Gluthatione S transferase 29.2.4 protein synthesis elongation EF-1-gamma kost_et_al_contig_11347 -1,7 Markiewicz et al. 2015 upregulated in sus and res cultivar
29.2.4 protein synthesis elongation EF-1-gamma kost_et_al_contig_14154 -1,7 " "
29.3.3 Protein targeting chloroplast kost_et_al_contig_12933 1,9
29.3.2 Protein targeting mitochondria kost_et_al_contig_8113 -2,3
29.3.2 Protein targeting mitochondria kost_et_al_contig_11872 -1,9
- 107 - Investigation of the fire blight resistance cascade triggered by FB_MR5 using RNASeq in transgenic 'Gala Galaxy'
Mapman biotic stress involved in predicted function transcript fc Gala vs T41D source E. amylovora -related response BIN response
Protein posttranslational 29.4 Arf GTPase kost_et_al_contig_974 -1,3 modification Protein posttranslational 29.4 Protein Phosphatase 2C kost_et_al_contig_19118 2,7 modification
Protein posttranslational 29.4.1 Serine/threonine-protein kinase kost_et_al_contig_12085 2,1 modification
delayed induction of FLS involved in flavonolsynthesis in 16.1.4.1 Secondary metabolism flavonoids kost_et_al_contig_15010 2 Venisse et al. 2002 susceptible cultivars
16.8.4.3 Secondary metabolism flavonols kost_et_al_contig_2103 2,1
16.8.3.1 Secondary metabolism dihydroflavonols kost_et_al_contig_2397 3,1
16.1.1.1 Secondary metabolism non-mevalonate pathway kost_et_al_contig_10630 2,7
16.1.1.1 Secondary metabolism non-mevalonate pathway kost_et_al_contig_16582 1,8
17.1.1.1.11 Hormone Metabolism Abscisic Acid kost_et_al_contig_20359 2
upregulated ATP-dependent zinc metallo 29.5 Proteolysis Protein Degradation kost_et_al_contig_9781 2,9 Markiewicz et al. 2015 protease in susceptible cultivar only
29.5 Proteolysis Protein Degradation kost_et_al_contig_15395 -2,6
29.5.4 Proteolysis Aspartate Protease kost_et_al_contig_548 2,8
29.5.11.20 Proteolysis Ubiquitin Proteasom kost_et_al_contig_6612 -1,5
Venisse et al. 2002 Heyenes et al. 2006, Bonasera et al. 2006, upregulation of PR-2, PR-5, PR8 and PR-10 20.1.7 Biotic stress PR-proteins kost_et_al_contig_22580 -2,8 Norelli et al. 200, genes in susceptible and resistant cultivars Mayer et al. 2011 Pontais et al. 2008 Imani et al. 2006, upregulation in resistant cultivar Idared 20.1 Biotic stress Bax inhibitor I kost_et_al_contig_1735 -1,8 Markiewicz et al. 2015 Wang et al. 2012 similar in carrot, wheat but unexpected results in barley Eichmann et al. 2010 Baldo et al. 2010 upregulation of LRR-like/kinase-like 20.1 Biotic stress NB-ARC domain kost_et_al_contig_2186 -2,4 Jensen et al. 2012 proteins in resistant cultivar Norelli et al. 2009 Metraux et al. 1989 20.1 Biotic stress Glycosyl Hydrolase kost_et_al_contig_37435 -3,1 some chitinases are more affine fore peptidoglycan Brunner et al. 1998
33.99 Cell development unspecified kost_et_al_contig_1419 2,6
33.99 Cell development unspecified kost_et_al_contig_3781 -4,2
33.99 Cell development unspecified kost_et_al_contig_5273 2
33.99 Cell development unspecified kost_et_al_contig_13211 -2
- 108 - Chapter 3)
Mapman biotic stress involved in predicted function transcript fc Gala vs T41D source E. amylovora -related response BIN response
Jensen et al. 2012 sugar transporter upregulated 34.2 Major facilitator superfamily protein sugar transport kost_et_al_contig_9326 2,3 Norelli et al. 2009 in less susceptible cultivar
34.2 Major facilitator superfamily protein sugar transport kost_et_al_contig_10264 -1,6
34.12 Major facilitator superfamily protein metal transport kost_et_al_contig_5333 2,1
34.12 Major facilitator superfamily protein metal transport kost_et_al_contig_8098 -4,8
Jensen et al. 201 Plasmamembrane intrinsic protein 34.13 Major facilitator superfamily protein peptide transport kost_et_al_contig_2002 -1,6 Norelli et al. 2009 upregulated in less susceptible cultivar
34.13 Major facilitator superfamily protein peptide transport kost_et_al_contig_3784 -7,7
34.13 Major facilitator superfamily protein peptide transport kost_et_al_contig_14661 -7,4
34.13 Major facilitator superfamily protein peptide transport kost_et_al_contig_20516 -8,1
34.19.1 Major facilitator superfamily protein plasma membrane intrinsic protein kost_et_al_contig_119 -1,6 Baldo et al. 2010 Aquaporin upregulated in resistant rootstock G41
Aquaporins involved in H2O2 34.19.1 Major facilitator superfamily protein aquaporin kost_et_al_contig_120 -1,4 Henzel et al. 2000 transport through membrane
34.19.2 Major facilitator superfamily protein waterchannel kost_et_al_contig_41033 -2,1
Norelli et al. 2009 1.X.X.X photosynthesis lightreaction or photorespiration 26 contigs 2 Baldo et al. 2010 Chlorophyll A-B binding protein involved in res Jensen et al. 2012 Sarowar et al. 2006, Heyens and Valcke 1.3.X photosynthesis calvin cycle 16 contigs 2 2006, downregulation of photosynthesis Huot et al. 2014 Norelli et al. 2009 Baldo et al. 2010
35.X not assigned unknown 53 4 to -22
ABA sensor-mediated 35.1 PYR/PYL/RCAR kost_et_al_contig_2613 -7,8 protein phosphatase Peroxidases, Balasubramanian et al. absent PR proteins Brisset et al. 2000 upregulated in less susceptible cultivar β-1-3-glucanases 2012
absent Transcription factors WRKY Baldo 2010 involved in regulation Fu and Dong, 2013
caspase-like protease, Iakimova et al. 2013, absent HR / Local Cell Death leading to local cell death Vacuolar Processing Enzyme Markiewicz et al. 2015
increased polyphenolics less susceptible in pear absent Secondary metabolism Polyphenolics Bernonville et al. 2011 Ryugo et al. 1990 but not in apple
- 109 - Investigation of the fire blight resistance cascade triggered by FB_MR5 using RNASeq in transgenic 'Gala Galaxy'
Table 6) List of top 20 candidates that showed smallest Bonferoni corrected p-values. Half of those candidate transcripts were assigned to photosynthesis and highly abundant in the wild-type plants (fold-change from 1.7 to 3.1). Further highly abundant transcripts in the wild-type plants were assigned to carbonic anhydrases (1.6 and 5), beta amylase (1.6), glutamine synthethase (2.0) or unassigned (1.7 and 2.6). Only two transcripts of those 20 were more abundant in the transgenic plants. One of them assigned to glyceraldehyde-3-phosphate dehydrogenase involved in glycolysis (-1.7) and the other encoding a plant natriuretic peptide involved in cell wall modification (-17.6).
Fold change p- Feature ID BIN Related to Hit Gala per value Trans amino acid metabolism. Kost_et_al_contig_106 1.7 13.2.5.2 degradation.serine-glycine- (p54260|gcst_soltu : 742.0) Aminomethyltransferase, mitochondrial precursor (EC 2.1.2.10) 0 cysteine group.glycine PS.lightreaction. Kost_et_al_contig_1110 3.1 1.1.1.1 (at5g01530 : 459.0) light harvesting complex photosystem II (LHCB4.1) 0 photosystem II.LHC-II Kost_et_al_contig_1157 2.6 35.2 not assigned.unknown (original description: no original description) 0 PS.lightreaction. (at3g54890 : 423.0) Encodes a component of the light harvesting complex associated with Kost_et_al_contig_1170 1.8 1.1.2.1 0 photosystem I.LHC-I photosystem I.; photosystem I light harvesting complex gene 1 (LHCA1) PS.lightreaction.photosystem II. (q40459|psbo_tobac : 578.0) Oxygen-evolving enhancer protein 1, Kost_et_al_contig_130 2.4 1.1.1.2 0 PSII polypeptide subunits chloroplast precursor (OEE1) Kost_et_al_contig_1527 2.7 1.3.6 PS.calvin cycle.aldolase (at4g26530 : 211.0) Aldolase superfamily protein 0 Kost_et_al_contig_1528 2.4 1.3.6 PS.calvin cycle.aldolase (at4g26530 : 165.0) Aldolase superfamily protein 0 (p12859|g3pb_pea : 676.0) Glyceraldehyde-3-phosphate Kost_et_al_contig_174 2.0 1.3.4 PS.calvin cycle.GAP 0 dehydrogenase B, chloroplast precursor (EC 1.2.1.13) PS.lightreaction.photosystem I. (at1g30380 : 172.0) Encodes subunit K of photosystem I reaction center. Kost_et_al_contig_1858 1.8 1.1.2.2 0 PSI polypeptide subunits photosystem I subunit K (PSAK) (at3g54890 : 402.0) Encodes a component of the light harvesting Kost_et_al_contig_2366 1.9 1.1.2.1 PS.lightreaction.photosystem I.LHC-I complex associated with photosystem I.; photosystem I 0 light harvesting complex gene 1 (LHCA1) N-metabolism.ammonia metabolism. (p15102|glna4_phavu : 711.0) Glutamine Kost_et_al_contig_356 2.0 12.2.2 0 glutamine synthetase synthetase leaf isozyme, chloroplast precursor (EC 6.3.1.2) Major CHO metabolism.degradation. Kost_et_al_contig_3670 1.6 2.2.2.1.2 (at4g17090 : 377.0) Encodes a beta-amylase targeted to the chloroplast 0 starch.starch cleavage.beta amylase TCA / org transformation. Kost_et_al_contig_456 5.1 8.3 (p17067|cahc_pea : 345.0) Carbonic anhydrase, chloroplast precursor (EC 4.2.1.1) 0 carbonic anhydrases
- 110 - Chapter 3)
Fold change p- Feature ID BIN Related to Hit Gala per value Trans (at4g10340 : 429.0) photosystem II encoding the light-harvesting chlorophyll Kost_et_al_contig_468 2.0 1.1.1.1 PS.lightreaction.photosystem II.LHC-II a/b binding protein CP26 of the antenna system of the photosynthetic 0 apparatus; light harvesting complex of photosystem II 5 (LHCB5)
Kost_et_al_contig_552 2.4 1.3.3 PS.calvin cycle.phosphoglycerate kinase (q42961|pgkh_tobac : 594.0) Phosphoglycerate kinase, chloroplast precursor (EC 2.7.2.3) 0
(at5g23060 : 347.0) Encodes a chloroplast-localized protein Kost_et_al_contig_617 1.7 35.2 not assigned.unknown 0 that modulates cytoplasmic Ca2+ concentration PS.lightreaction.photosystem II. Kost_et_al_contig_71 1.8 1.1.1.2 (at1g67740 : 124.0) PsbY precursor (psbY) mRNA. 0 PSII polypeptide subunits TCA / org transformation Kost_et_al_contig_881 5.0 8.3 (at3g01500 : 119.0) Encodes a putative beta-carbonic anhydrase betaCA1. 0 .carbonic anhydrases (loc_os09g29690.1 : 150.0) no description available & Kost_et_al_contig_49392 -17.6 10.7 cell wall.modification 2.4-13 (at4g30380 : 103.0) Encodes a Plant Natriuretic Peptide (PNP). glycolysis.cytosolic Kost_et_al_contig_2142 -1.7 4.1.8 branch.glyceraldehyde (at1g13440 : 566.0) glyceraldehyde-3-phosphate dehydrogenase C2 (GAPC2) 9.8-13 3-phosphate dehydrogenase (GAP-DH)
- 111 - Investigation of the fire blight resistance cascade triggered by FB_MR5 using RNASeq
Discussion This study aimed at the identification of transcriptional differences following E. amylovora inoculation between fire blight resistant transgenic plants carrying FB_MR5 and the untransformed susceptible wild-type cultivar 'Gala Galaxy'. RNASeq was used to reveal changes in the full transcriptomes of those two 'Gala Galaxy' genotypes, differing only in presence of the fire blight resistance gene FB_MR5 (and the selection marker nptII) and in the resulting recognition of the pathogen. In this RNASeq comparison 24 hours post inoculation with the pathogen, only transcriptional changes mediated by the FB_MR5 specific recognition should be visible.
The use of three biological replicates for each genotype in this study is mentionable as it allows to estimate the variability between samples. Our results indicate a high variability between the biological replicates as the standard deviation of the 206 differentially expressed transcripts differed from 1 to 97 % of the corresponding RRKM average (supplementary table 4). In a previous RNASeq experiment performed on cultivar 'Golden Delicious', where biological triplicates were likewise compared, a similarly high variability of the standard deviation, ranging from 1 to 98 % of average RPKM was observed in the top candidates of Gusberti et al. (2012). These observations confirm that more than three replicates are essential for reliable RNASeq results in apple leaves.
While assessing the transcripts to be used for RNASeq reads mapping, there were two options: either mapping on the MDP coding sequences released by Velasco et al. (2010) or Bai et al. (2014), or, due to the large number of library sequences of more than 674 million reads (table 1), to assemble a de novo 'Gala Galaxy' transcriptome. The transcriptome of Velasco et al. (2010) and Bai et al. (2014) is based on the genomic sequencing of 'Golden Delicious', one of the two parents of the cultivar 'Gala' used in this study. In the de novo transcriptome of 'Gala Galaxy' more transcripts were obtained (77’543 contigs) than in the so far known transcriptomes of 'Golden Delicious' (53’654) (Velasco et al., 2010) or (71’178) (Bai et al., 2014). The observation that 11’094 of the de novo generated transcripts did not map to the transcriptome (table 2) published by Velasco et al. (2010) could, similarly to what has been observed in grape, indicate the presence of a pan-genome (Morgante et al., 2007) in 'Gala Galaxy'. Studies on grape showed hints for the presence of variety specific (private) genes which were absent from the general (core) genome (Da Silva et al., 2013). Therefore those unmapped transcripts could represent new, cultivar specific transcripts obtained from 'Kidds Orange Red', the second parent of cultivar 'Gala'. The generation of a high number of reads from the 'Kidds Orange Red'’s transcriptome should allow to further determine this transcriptome and to confirm this assumption. Another explanation may be that for the transcriptome by Velasco et al. (2010) only open reading frames were considered while in the 'Gala Galaxy' de novo transcriptome in addition 5’ and 3’ untranslated regions have been included. The ratios of functional bins assigned from the de novo reads in the presented study (figure 1) are very similar to those obtained from predicted genes of Malus domestica v1.0 where in a similar analysis 6.0 % proteins, 4.4 % RNA, 3.1 % signaling and 2.1 % stress was obtained with a total of 21 % not assigned (data not shown).
It was confirmed that all transgenic lines carried nptII and FB_MR5 by mapping the reads of the individual libraries on the coding sequences for nptII and FB_MR5. The transcription level of this cisgene was very weak compared to the CaMV 35S regulated transgene nptII (table 3). However, we could not find an explanation for why in one transgenic replicate no reads mapped on FB_MR5, while over one million reads did map on nptII. FB_MR5 could not be clearly identified in the de novo assembled transcripts. This could be explained by the fact that 992 genes in 'Golden Delicious' also encode NBS containing R-genes (Velasco et al., 2010). The RNASeq data was used to assess the - 112 - Chapter 3) suitability of 22 reference genes of which ten have previously been reported as stably expressed in different apple tissue or particularly in apple leaves (Perini et al., 2014) and twelve that had been investigated by Bowen et al. (2014). 16 of those 22 reference genes showed library-size-adjusted standard deviations below 50 % of RPKMs (supplementary table 1). 300 transcripts that showed a very stable transcription level so that they could serve as putative reference genes have been identified in our study (supplementary table 2) and need further validation by qPCR under different stress conditions as for instance performed by Bowen et al. (2014).
Looking at the differentially expressed transcripts involved in common defense response to biotic stresses, no clear candidate response could be highlighted by assessing genes with higher abundance in the resistant transgenic line in comparison to the susceptible wild-type: Four transcripts involved in cell wall fortification were more abundant in the transgenic line (figures 2 and 3), and in agreement with previous experiments where an increase of abundance of a pectin esterase in less fire blight susceptible rootstocks (Jensen et al., 2012) and resistant cultivars (Baldo et al., 2010) was reported.
Among signaling-related proteins, we found a NB_ARC domain containing protein to be more abundant in the transgenic plants. Such a domain is present in FB_MR5 and other LRR containing proteins and the involvement of the identified proteins in FB_MR5 dependent signal transduction was demonstrated. LRR-like and kinase-like proteins have been upregulated in several studies in fire blight resistant cultivars (Norelli et al., 2009; Baldo et al., 2010; Jensen et al., 2012), however, due to the large number of similar proteins present in the apple genome (Velasco et al., 2010), this candidate may have arisen by chance. Three further transcripts encoding for a receptor kinase (A. thaliana histidine phosphotransferase protein (AHP)), a 14-3-3-like protein and a MYB transcription factor were identified as candidates being differentially transcribed (table 5). Such proteins were presumed to be involved in fire blight resistance (Norelli et al., 2009; Jensen et al., 2012) but were downregulated in a resistant cultivar (Markiewicz 2015).
In several studies pathogenesis-related (PR) protein encoding genes have been reported to be involved in fire blight resistance. For instance, PR-2, coding for a β-1,3 glucanase was detected at 24 hours post inoculation in the study of (Markiewicz and Michalczuk, 2015) and a peak for PR-5 proteins was reported after 48 hours by Venisse et al. (2002). However, in our study only one single PR gene-like transcript was higher transcribed in the transgenic 'Gala Galaxy' plants. This hit was binned to a dirigent-like disease resistance response protein, involved in lignan biosynthesis and secondary metabolism. In response to fire blight inoculation an increased amount of peroxidases and β-1,3 glucanases (Brisset et al., 2000), WRKY transcription factors (Baldo et al., 2010) or caspase-like proteases (Iakimova et al., 2013; Markiewicz and Michalczuk, 2015) have been observed. However, none of those transcripts was differentially expressed between the transcriptomes compared in our study.
In a previous study it was shown that E. amylovora delayed the induction of flavonol synthesis in a susceptible apple cultivar (Venisse et al., 2002). Therefore it was surprising that in our study more transcripts involved in secondary metabolism, possibly in flavonoid biosynthetic pathway, where detected in the susceptible plants compared to the transgenic fire blight resistant ones (supplementary table 7).
A transcript that was more abundant in the transgenic plants showed homologies to a cell-death suppressor called Bax inhibitor 1 (BI1). BI1 was shown to be integrated in the endoplasmatic reticulum and to regulate HR (Hückelhoven, 2004). Albeit unexpected, overexpression of such BI1 cell-death - 113 - Investigation of the fire blight resistance cascade triggered by FB_MR5 using RNASeq suppressors led to increased resistance against fungal pathogens in transgenic barley and wheat (Imani et al., 2006; Wang et al., 2012). In the fire blight resistant apple cultivar 'Free Redstar' an increased abundancy of transcripts (compared to cultivar 'Idared') showing similaritiy to BI1 led to the assumption that HR controlling genes are important for the fire blight resistance in this cultivar (Markiewicz and Michalczuk, 2015). However, those observations are unlikely to be relevant in the case of FB_MR5, as the cultivar 'Free Redstar' does not carry FB_MR5. Nonetheless as the effector
(AvrRpt2EA) recognized by FB_MR5 is an analog to AvrRpt (Zhao et al., 2006), and as AvrRpt2EA is able to cleave RIN4 (Vogt et al., 2013), FB_MR5 and AvrRpt2EA could have a similar function as RPS2 and AvrRpt2 (reviewed by Khan et al., 2016) from the Pseudomonas syringae pv. tomato / A. thaliana pathosystem. Therefore a presumption could be that recognition of AvrRpt2EA induces HR and leads to programmed cell death similarly as in A. thaliana (Mudgett and Staskawicz, 1999).
Considering differentially expressed transcripts that are not directly related to disease resistance, there was a positive fold-change in photosynthesis (PS) in the 'Gala Galaxy' wild-type plants (figure 2 and table 4). According to literature, a decrease of PS and PS-related genes has been reported after inoculation by E. amylovora in susceptible apple cultivars (Bonasera et al., 2006; Heyens and Valcke, 2006; Norelli et al., 2009; Baldo et al., 2010) and lower photosynthesis rates on different plant species were observed after contact with various pathogens (Bolton, 2009). As only the ratio between RPKMs of 'Gala Galaxy' wild-type compared to the transgenic plants was considered, an explanation could be, that PS is downregulated in both plant lines but decreased more strongly in the resistant T41D plants than in the susceptible wild-type. A comparison with uninoculated plants of both plant lines should solve this problem by allowing a basal level of photosynthesis to be defined and therefore calculation of up or downregulation. Another approach to confirm such changes would be the measurement of effective photosynthetic activity by chlorophyll fluorescence (Heyens and Valcke, 2006) or by investigation of the latter one in combination with gas exchange measurements (Greer, 2015).
When only transcripts identified in resistant genotypes that could potentially bear FB_MR5 due to their pedigree (e.g Malus ×robusta 5 derived rootstock G.41) were considered, the number of candidate transcripts was reduced to a handful of candidates. In our study contigs 119 and 120 (aquaporin-like), 225 (MYB-like) and contigs 1976 and 6126 (elongation initiation factors) were more abundant in the transgenic plants than in the wild-type (table 5). This is in accordance to the study of Baldo et al. (2010) where aquaporins were called putative disease resistance proteins in a resistant rootstock and in the same study a MYB-related transcription factor was assumed to be involved in resistance of G.41. The others candidates are elongation initiation factors eIF4 that were involved in fire blight susceptibility in the studies of Norelli et al. (2009) and Baldo et al. (2010). Moreover, a pectin esterase, a receptor kinase or/and LRR-like/kinase-like proteins (Baldo et al. 2010) may be involved. Several elongation factors showed higher fold-change in the resistant plants, but were reported in literature to show a downregulation in less susceptible plants (Norelli et al., 2009; Jensen et al., 2012) or an upregulation in both, susceptible and resistant cultivars (Markiewicz et al. 2015). Putative transcripts for two elongation initiation factors (eIF4A and eIF4D) showed a high fold-change in the transgenic plants (table 5). This is in accordance to the upregulation of an eIF4A in fire blight resistant roostock G.41 in the study of Baldo et al. (2010).
As several thousand transcripts have been compared, some false positives do occur in the differentially expressed transcripts. Filtering by predicted function and mapping of the remaining transcripts to known pathways can simplify the detection of candidates. However, it is hard to objectively compare those few filtered candidates without artificially uprating transcripts that belong to known defense - 114 - Chapter 3) pathways or have recently been reported as candidates involved in fire blight resistance in literature. Albeit RNASeq leads to an immense number of data and despite the use of biological triplicates and a similar genetic background between the investigated plants, it was not possible to identify a clear transcriptional defense response. A reason to explain this could be that during filtering for transcripts with known annotations (where a putative function can be assigned) the transcripts of interest were not annotated and were not taken into account (26 % unannotated transcripts). The filtering for top candidates based on artificial thresholds of FDR and/or fold-change can also exclude transcripts of interest. For the interpretation of such results it is important to always consider that natural variability can affect the data and that errors in binning or annotating can occur. In further experiments RNASeq on mRNA of untreated plants (at least three but ideally five biological replicates) should be investigated. This would allow on the one hand to clearly define the natural variability in untreated plants and on the other hand it would allow the calculation of up or downregulated transcripts in the data set presented in this manuscript. This knowledge would increase the power of the predictions based on our dataset.
In the present study, due to polyA-filtering, micro RNAs (miRNAs) have been excluded. Recently 206 microRNA (miRNAs) have been reported in apple (miRBase, Release 21). Changes in miRNAs could be involved in fire blight resistance as for instance some MYB genes are regulated by miRNAs (Dubos et al., 2010). In particular, three apple miRNAs were shown to interact with up to 81 different MYB proteins and their putative role as master-regulators was predicted (Xia et al., 2012). The involvement of miRNAs in disease resistance in apple has been postulated for fire blight by Kaja et al. (2015) as well as for Alternaria leave spot (Ma et al., 2014). To reveal further insights in the defense cascade triggered by FB_MR5, prospective experiments should also include investigation of miRNAs.
A protein in a differentially post-transcriptionally modified form or involved in a protein complex that is only functional in the presence of further proteins, could produce misleading results in RNASeq. The translation of several mRNAs can be inefficient and/or the degradation rate of the proteins is unknown and could differ between them. For those reasons RNASeq analysis of mRNA only allows the determination of an approximate level of translation into proteins (Gygi et al., 1999). Posttranslational modification, in particular phosphorylation, plays an essential role for transduction of extracellular stimuli (Zhang and Klessig, 2001), MAP kinase signalling (Asai et al., 2002) and HR (Ren et al., 2002). Therefore an alternative approach that allows identification of post translational modifications should be used to identify the defense response mediated by FB_MR5. More reliable information about effective presence and state of proteins is obtained using proteomics, where the determination of e.g. phosphorylated proteins is possible (Xing and Laroche, 2011). In prospective experiments, a snapshot of the metabolites generated by host proteins could be assembled and compared using metabolomics as reviewed by Shulaev et al. (2008) for various plants undergoing different stresses.
- 115 - Investigation of the fire blight resistance cascade triggered by FB_MR5 using RNASeq
Conclusion Despite the use of three biological replicates and an almost identical genetic background between the investigated genotypes, it was not possible to reveal a clear transcriptional defense-response triggered by recognition of the pathogen due to FB_MR5. The differences between the available transgenic FB_MR5 carrying and wild-type 'Gala Galaxy' plants need to be investigated in an independent transcriptomic approach with more biological replicates or by technologies where posttranscriptional changes and effective amounts of metabolites are detectable. Deciphering of the involved resistance mechanism triggered by FB_MR5 will stay of high interest as only understanding the interaction between host and pathogen will allow developing sustainable and durable disease management strategies.
- 116 - Chapter 3)
Experimental procedures Plant material Transgenic plants of line T41D also called M1404 of cultivar 'Gala Galaxy', that carry the fire blight resistance gene FB_MR5 linked with the transgenic marker gene nptII, flanked by its native regulatory elements (1995 bp upstream the start and 1547 bp downstream the stop codon) as described by Broggini et al. (2014), were used. Those plants as well as a control of 'Gala Galaxy' wild-type plants that underwent a similar in vitro treatment, were put on medium (final pH 5.8) containing per liter 2.3 g Murashige and Skoog (M0222), 20 g saccharose, 15 ml indole-3-butyric acid (20 mg / 100 ml) and 8 g agar to induce root formation. Then the in vitro plants were transferred into autoclaved soil in a closed chamber with increased rel. humidity, sprinkled with water and gradually acclimatized to greenhouse conditions (22-26° C, 70 rH, 16 h light and 8 h dark) for a total of 6 months. As the shoot growth of the two plant groups was asynchronous, all plants were once trimmed 40 days before the experiment was performed.
Fire blight inoculation and sample collection The two youngest (terminal), completely unfolded leaves of three different plants per genotype (three biological replicates) were inoculated by transversal bisection with scissors previously dipped into a 8 -1 -1 solution of about 1 x 10 cfu of E. amylovora strain EA222_JKI ml PBS buffer (1.21 g KH2PO4 l and 2.6 -1 g K2HPO4 l ). For sampling the method of Norelli et al. (2009) was used. Summed up, 24 hours (± 4 min) post inoculation, for each plant a leaf-slice of 4-6 mm width was cut in parallel to the initial cut and instantly frozen in liquid nitrogen. Moreover half a leave of three 'Gala Galaxy' plants was frozen (three individual biological replicates) after the plants had been kept for 65 hours in a chamber with increased air humidity (Gala high humidity treatment). All tissue samples (each about 1.3 g) were transported in Eppendorf tubes with two metal beads on dry ice and stored at minus 80° C until further processing.
RNA isolation For each of the nine biological replicates RNA and DNA was extracted individually and purified using SV Total RNA Isolation System (Promega Corporatiom, Madison, USA) according to manual including a heating step. Frozen tissue was disrupted using a Retsch MM200 Qiagen tissue lyser (60/S) for 40 s and subsequently diluted with with β-mercaptoethanol containing buffer. DNA was eliminated by DNase I treatment, RNA was washed and finally eluted in 100 µl nuclease-free water.
RNA Integrity number Bioanalyzer 2100 (Agilent) was used to calculate RIN (RNA integrity number) values and those ranged from 7.3 to 8.3.
Library preparation, sequencing and quality control At least 0.25 µg of RNA was used for library preparation. cDNA library was created using the commercial TrueSeq®RNA (Illumina, San Diego, USA) kit, including a PolyA purification step according to manufacturers protocol. Library construction, performed and sequencing was performed by the Functional Genomics Center Zurich (FGCZ, Zurich, Switzerland). The run was performed on a HiSeq 2000 (Illumina Inc., San Diego, USA) with 2 x 100 bp paired-end reads (25 % of a lane for each E. amylovora inoculated sample and 16 % of a lane for each high humidity sample) followed by quality control using fastqc and trimming of reads according to in house conditions.
- 117 - Investigation of the fire blight resistance cascade triggered by FB_MR5 using RNASeq
De novo assembly A de novo assembly with all reads was performed in CLC Genomics Workbench 8.0 (http://www.clcbio.com) with a minimal contig length of 300 bp and otherwise default options (including automatic word and bubble size) using a Bruijn graph-based algorithm to deal with the reads.
Quality control of plants The RPKM of transcripts coding for FB_MR5 and nptII were calculated by mapping the reads from plants inoculated with E. amylovora (separately for each replicate) on the two genes as reference with stringent parameters of length = 0.95 and similarity = 0.98 in CLC Genomics workbench.
Identification of differentially expressed genes Reads expression was calculated in reads per kilobase per million mapped reads (RPKM) according to Mortazavi et al. (2008) and differentially expressed transcripts were selected in CLC Genomics Workbench 8.0 using multiple-group comparison (based on beta-binomial distributed data and by sample total count weighted t-test statistic according to adjusted p-values by the method of Baggerly (2003)) with a false discovery rate (FDR Benjamini and Hochberg (1995)) smaller than 0.01 (1 false positive transcript in 100, as shown in supplementary table 3).
Functional homologies and binning to known pathways One fasta file with all de novo reads and one with the differentially expressed transcripts was compared with known sequences using several protein databases (TAIR, PPAP, CHLAMY, ORYZA, KOG, CDD, and IPR) and BLASTx (Altschul et al., 1997) to identify pathways using Mercator webtool (http://mapman.gabipd.org/web/guest/mercator) and MapMan (http://mapman.gabipd.org/web/guest/mapman) by Thimm et al. (2004).
List with top candidates A list of top candidates between the transgenic 'Gala Galaxy' and the wild-type plants (24 hours post inoculation) was generated considering only genes with the 20 smallest Bonferroni corrected p-values. Best BIN hits by Mercator were added (table 6).
Mapping of house-keeping genes After mapping of the RNASeq reads on the reference transcriptome of Velasco et al. (2010) 22 previously recommended house-keeping genes for apple (twelve from a study of Bowen et al. (2014) and ten recommended by Perini et al. (2014)) were investigated (supplementary table 1). Nucleotide sequences of those 22 predicted house-keeping genes were downloaded from (http://www.applegene.org/) and used as a BLAST analysis template to confirm if similar hits could be identified in the de novo assembled transcriptome too. Therefore the de novo transcripts of this study were BLASTn aligned with the reference genes and the transcripts with the best BLASTn hits were indicated with * if similarity was above 95 % (supplementary table 1). The average RPKM values of all 22 genes were corrected by the initial library size.
- 118 - Chapter 3)
Acknowledgment The authors acknowledge the financial support by the Swiss National Science Foundation project 31003A_149637. We are grateful for the technical support of R. Blapp (Agroscope in Wädenswil) and J. Schneider (ETH Zurich) and we thank Silvia Kobel, Stefan Zoller and Jean-Claude Walser of the Genomics Diversity Center for providing equipment and support, Catharine Aquino for (FGCZ, Zurich) for library preparation and performing the RNASeq run and Weihong Qi (FGCZ, Zurich) for basic bioinformatic analysis.
- 119 - References
References Altschul, S.F., Madden, T.L., Schäffer, A.A., Zhang, J., Zhang, Z., Miller, W. and Lipman, D.J. (1997) Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic acids research 25, 3389-3402. Anderson, A.J. (1982) Preformed resistance mechanisms. Phytopathogenic prokaryotes 2, 119-136. Asai, T., Tena, G., Plotnikova, J., Willmann, M.R., Chiu, W.-L., Gomez-Gomez, L., Boller, T., Ausubel, F.M. and Sheen, J. (2002) MAP kinase signalling cascade in Arabidopsis innate immunity. Nature 415, 977-983. Baggerly, K.A., Deng, L., Morris, J.S. and Aldaz, C.M. (2003) Differential expression in SAGE: accounting for normal between-library variation. Bioinformatics 19, 1477-1483. Bai, Y., Dougherty, L. and Xu, K. (2014) Towards an improved apple reference transcriptome using RNA-seq. Molecular Genetics and Genomics 289, 427-438. Balasubramanian, V., Vashisht, D., Cletus, J. and Sakthivel, N. (2012) Plant β-1, 3-glucanases: their biological functions and transgenic expression against phytopathogenic fungi. Biotechnology letters 34, 1983-1990. Baldo, A., Norelli, J.L., Farrell, R.E., Bassett, C.L., Aldwinckle, H.S. and Malnoy, M. (2010) Identification of genes differentially expressed during interaction of resistant and susceptible apple cultivars (Malus× domestica) with Erwinia amylovora. BMC plant biology 10, 1. Barionovi, D., Giorgi, S., Stoeger, A., Ruppitsch, W. and Scortichini, M. (2006) Characterization of Erwinia amylovora strains from different host plants using repetitive‐sequences PCR analysis, and restriction fragment length polymorphism and short‐sequence DNA repeats of plasmid pEA29. Journal of applied microbiology 100, 1084-1094. Benjamini, Y. and Hochberg, Y. (1995) Controlling the false discovery rate: a practical and powerful approach to multiple testing. Journal of the Royal Statistical Society. Series B (Methodological), 289-300. Bolton, M.D. (2009) Primary metabolism and plant defense-fuel for the fire. Molecular Plant-Microbe Interactions 22, 487-497. Bonasera, J., Meng, X., Beer, S., Owens, T. and Kim, W. (2006) Interaction of DspE/A, a pathogenicity/avirulence protein of Erwinia amylovora, with pre-ferredoxin from apple and its relationship to photosynthetic efficiency. Acta horticulturae 704, 473. Bostock, R.M. (2005) Signal crosstalk and induced resistance: straddling the line between cost and benefit. Annu. Rev. Phytopathol. 43, 545-580. Brisset, M.-N., Cesbron, S., Thomson, S.V. and Paulin, J.-P. (2000) Acibenzolar-S-methyl induces the accumulation of defense-related enzymes in apple and protects from fire blight. Eur J Plant Pathol 106, 529-536. Brisset, M., Faize, M., Heintz, C., Cesbron, S., Chartier, R., Tharaud, M. and Paulin, J. (2002) Induced Resistance to Erwinic amylovora in Apple and Pear. Acta Horticulturae, 335-338. Broggini, G.A.L., Wöhner, T., Fahrentrapp, J., Kost, T.D., Flachowsky, H., Peil, A., Hanke, M.V., Richter, K., Patocchi, A. and Gessler, C. (2014) Engineering fire blight resistance into the apple cultivar 'Gala' using the FB_MR5 CC-NBS-LRR resistance gene of Malus × robusta 5. Plant Biotechnol J 12, 728-733. Brunner, F., Stintzi, A., Fritig, B. and Legrand, M. (1998) Substrate specificities of tobacco chitinases. The Plant Journal 14, 225-234.
- 120 - References
Cheong, Y.H., Chang, H.-S., Gupta, R., Wang, X., Zhu, T. and Luan, S. (2002) Transcriptional profiling reveals novel interactions between wounding, pathogen, abiotic stress, and hormonal responses in Arabidopsis. Plant Physiology 129, 661-677. Chisholm, S.T., Coaker, G., Day, B. and Staskawicz, B.J. (2006) Host-microbe interactions: shaping the evolution of the plant immune response. Cell 124, 803-814. Da Silva, C., Zamperin, G., Ferrarini, A., Minio, A., Dal Molin, A., Venturini, L., Buson, G., Tononi, P., Avanzato, C. and Zago, E. (2013) The high polyphenol content of grapevine cultivar tannat berries is conferred primarily by genes that are not shared with the reference genome. The Plant Cell 25, 4777-4788. Dangl, J.L. and Jones, J.D. (2001) Plant pathogens and integrated defence responses to infection. nature 411, 826-833. Darvill, A.G. and Albersheim, P. (1984) Phytoalexins and their elicitors-a defense against microbial infection in plants. Annual Review of Plant Physiology 35, 243-275. de Bernonville, T.D., Gaucher, M., Guyot, S., Durel, C.-E., Dat, J.F. and Brisset, M.-N. (2011) The constitutive phenolic composition of two Malus× domestica genotypes is not responsible for their contrasted susceptibilities to fire blight. Environmental and Experimental Botany 74, 65- 73. Dixon, R.A., Achnine, L., Kota, P., Liu, C.J., Reddy, M. and Wang, L. (2002) The phenylpropanoid pathway and plant defence—a genomics perspective. Mol Plant Pathol 3, 371-390. Dixon, R.A. and Paiva, N.L. (1995) Stress-induced phenylpropanoid metabolism. The plant cell 7, 1085. Dubos, C., Stracke, R., Grotewold, E., Weisshaar, B., Martin, C. and Lepiniec, L. (2010) MYB transcription factors in Arabidopsis. Trends in plant science 15, 573-581. Durrant, W. and Dong, X. (2004) Systemic acquired resistance. Annu. Rev. Phytopathol. 42, 185-209. Eichmann, R., Bischof, M., Weis, C., Shaw, J., Lacomme, C., Schweizer, P., Duchkov, D., Hensel, G., Kumlehn, J. and Hückelhoven, R. (2010) BAX INHIBITOR-1 is required for full susceptibility of barley to powdery mildew. Molecular Plant-Microbe Interactions 23, 1217-1227. Fu, Z.Q. and Dong, X. (2013) Systemic acquired resistance: turning local infection into global defense. Annual review of plant biology 64, 839-863. Gasic, K., Han, Y., Kertbundit, S., Shulaev, V., Iezzoni, A.F., Stover, E.W., Bell, R.L., Wisniewski, M.E. and Korban, S.S. (2009) Characteristics and transferability of new apple EST-derived SSRs to other Rosaceae species. Mol Breeding 23, 397-411. Gill, S.S. and Tuteja, N. (2010) Reactive oxygen species and antioxidant machinery in abiotic stress tolerance in crop plants. Plant Physiology and Biochemistry 48, 909-930. Golshani, F., Fakheri, B.A., Behshad, E. and Vashvaei, R.M. (2015) PRs proteins and their Mechanism in Plants. In: Biological Forum p. 477. Research Trend. Greer, D.H. (2015) Temperature-dependent responses of the photosynthetic and chlorophyll fluorescence attributes of apple (Malus domestica) leaves during a sustained high temperature event. Plant Physiology and Biochemistry 97, 139-146. Gusberti, M., Gessler, C. and Broggini, G.A. (2013) RNA-Seq analysis reveals candidate genes for ontogenic resistance in Malus-Venturia pathosystem. PLoS One 8, e78457. Gusberti, M., Patocchi, A., Gessler, C. and Broggini, G.A.L. (2012) Quantification of Venturia inaequalis Growth in Malus × domestica with Quantitative Real-Time Polymerase Chain Reaction. Plant Dis 96, 1791-1797. Gygi, S.P., Rochon, Y., Franza, B.R. and Aebersold, R. (1999) Correlation between protein and mRNA abundance in yeast. Molecular and cellular biology 19, 1720-1730. - 121 - Investigation of the fire blight resistance cascade triggered by FB_MR5
Henzler, T. and Steudle, E. (2000) Transport and metabolic degradation of hydrogen peroxide in Chara corallina: model calculations and measurements with the pressure probe suggest transport of H2O2 across water channels. Journal of Experimental Botany 51, 2053-2066. Heyens, K. and Valcke, R. (2006) Flourescence Imaging of the Infection Pattern of Apple Leaves with Erwinia amylovora. Acta horticulturae 704, 69. Heyens, K., Valcke, R., Dumont, D., Robben, J. and Noben, J. (2006) Differential expression of proteins in apple following inoculation with Erwinia amylovora. Acta horticulturae 704, 489. Hiraga, S., Sasaki, K., Ito, H., Ohashi, Y. and Matsui, H. (2001) A large family of class III plant peroxidases. Plant and Cell Physiology 42, 462-468. Hückelhoven, R. (2004) BAX Inhibitor-1, an ancient cell death suppressor in animals and plants with prokaryotic relatives. Apoptosis 9, 299-307. Huot, B., Yao, J., Montgomery, B.L. and He, S.Y. (2014) Growth–defense tradeoffs in plants: a balancing act to optimize fitness. Molecular plant 7, 1267-1287. Hutcheson, S.W. (1998) Current concepts of active defense in plants. Annual review of phytopathology 36, 59-90. Iakimova, E.T., Sobiczewski, P., Michalczuk, L., Węgrzynowicz-Lesiak, E., Mikiciński, A. and Woltering, E.J. (2013) Morphological and biochemical characterization of Erwinia amylovora-induced hypersensitive cell death in apple leaves. Plant Physiology and Biochemistry 63, 292-305. Imani, J., Baltruschat, H., Stein, E., Jia, G., Vogelsberg, J., Kogel, K.H. and Huckelhoven, R. (2006) Expression of barley BAX Inhibitor-1 in carrots confers resistance to Botrytis cinerea. Mol Plant Pathol 7, 279-284. Jackson, A.O. and Taylor, C.B. (1996) Plant-microbe interactions: life and death at the interface. The Plant Cell 8, 1651. Jensen, P.J., Halbrendt, N., Fazio, G., Makalowska, I., Altman, N., Praul, C., Maximova, S.N., Ngugi, H.K., Crassweller, R.M. and Travis, J.W. (2012) Rootstock-regulated gene expression patterns associated with fire blight resistance in apple. BMC genomics 13, 9. Jensen, P.J., Makalowska, I., Altman, N., Fazio, G., Praul, C., Maximova, S.N., Crassweller, R.M., Travis, J.W. and McNellis, T.W. (2010) Rootstock-regulated gene expression patterns in apple tree scions. Tree Genetics & Genomes 6, 57-72. Kaja, E., Szcześniak, M.W., Jensen, P.J., Axtell, M.J., McNellis, T. and Makałowska, I. (2015) Identification of apple miRNAs and their potential role in fire blight resistance. Tree Genetics & Genomes 11, 1-11. Khan, M., Subramaniam, R. and Desveaux, D. (2016) Of guards, decoys, baits and traps: pathogen perception in plants by type III effector sensors. Current Opinion in Microbiology 29, 49-55. Khan, M.A., Zhao, Y.F. and Korban, S.S. (2012) Molecular mechanisms of pathogenesis and resistance to the bacterial pathogen Erwinia amylovora, causal agent of fire blight disease in Rosaceae. Plant Molecular Biology Reporter 30, 247-260. Lamb, C. and Dixon, R.A. (1997) The oxidative burst in plant disease resistance. Annual review of plant biology 48, 251-275. Levine, A., Tenhaken, R., Dixon, R. and Lamb, C. (1994) H 2 O 2 from the oxidative burst orchestrates the plant hypersensitive disease resistance response. Cell 79, 583-593. Ma, C., Lu, Y., Bai, S., Zhang, W., Duan, X., Meng, D., Wang, Z., Wang, A., Zhou, Z. and Li, T. (2014) Cloning and Characterization of miRNAs and Their Targets, Including a Novel miRNA-Targeted NBS–LRR Protein Class Gene in Apple (Golden Delicious). Molecular plant 7, 218-230.
- 122 - References
Malnoy, M., Martens, S., Norelli, J.L., Barny, M.-A., Sundin, G.W., Smits, T.H. and Duffy, B. (2012) Fire blight: applied genomic insights of the pathogen and host. Annual review of phytopathology 50, 475-494. Markiewicz, M. and Michalczuk, L. (2015) Molecular response of resistant and susceptible apple genotypes to Erwinia amylovora infection. Eur J Plant Pathol, 1-12. Martin, G.B., Bogdanove, A.J. and Sessa, G. (2003) Understanding the functions of plant disease resistance proteins. Annual review of plant biology 54, 23-61. Mayer, M., Oberhuber, C., Loncaric, I., Heissenberger, B., Keck, M., Scheiner, O. and Hoffmann- Sommergruber, K. (2011) Fireblight (Erwinia amylovora) affects Mal d 1-related allergenicity in apple. Eur J Plant Pathol 131, 1-7. Mehdy, M.C. (1994) Active oxygen species in plant defense against pathogens. Plant physiology 105, 467. Milčevičová, R., Gosch, C., Halbwirth, H., Stich, K., Hanke, M.-V., Peil, A., Flachowsky, H., Rozhon, W., Jonak, C. and Oufir, M. (2010) Erwinia amylovora-induced defense mechanisms of two apple species that differ in susceptibility to fire blight. Plant Science 179, 60-67. miRBase database, Release 21 [Internet]. (14.06.2014). Available from: http://www.mirbase.org. Mittler, R. (2002) Oxidative stress, antioxidants and stress tolerance. Trends in plant science 7, 405- 410. Morgante, M., De Paoli, E. and Radovic, S. (2007) Transposable elements and the plant pan-genomes. Current opinion in plant biology 10, 149-155. Mortazavi, A., Williams, B.A., McCue, K., Schaeffer, L. and Wold, B. (2008) Mapping and quantifying mammalian transcriptomes by RNA-Seq. Nature methods 5, 621-628. Mudgett, M.B. and Staskawicz, B.J. (1999) Characterization of the Pseudomonas syringae pv. tomato AvrRpt2 protein: demonstration of secretion and processing during bacterial pathogenesis. Molecular microbiology 32, 927-941. Nicholson, R.L. and Hammerschmidt, R. (1992) Phenolic compounds and their role in disease resistance. Annual review of phytopathology 30, 369-389. Norelli, J.L., Farrell Jr, R.E., Bassett, C.L., Baldo, A.M., Lalli, D.A., Aldwinckle, H.S. and Wisniewski, M.E. (2009) Rapid transcriptional response of apple to fire blight disease revealed by cDNA suppression subtractive hybridization analysis. Tree Genetics & Genomes 5, 27-40. Osbourn, A.E. (1996) Preformed antimicrobial compounds and plant defense against fungal attack. The plant cell 8, 1821. Petkovšek, M.M., Štampar, F. and Veberič, R. (2009) Accumulation of phenolic compounds in apple in response to infection by the scab pathogen, Venturia inaequalis. Physiological and Molecular Plant Pathology 74, 60-67. Pontais, I., Treutter, D., Paulin, J.P. and Brisset, M.N. (2008) Erwinia amylovora modifies phenolic profiles of susceptible and resistant apple through its type III secretion system. Physiologia plantarum 132, 262-271. Ren, D., Yang, H. and Zhang, S. (2002) Cell death mediated by MAPK is associated with hydrogen peroxide production in Arabidopsis. Journal of Biological Chemistry 277, 559-565. Robert-Seilaniantz, A., Navarro, L., Bari, R. and Jones, J.D. (2007) Pathological hormone imbalances. Current opinion in plant biology 10, 372-379. Ryals, J.A., Neuenschwander, U.H., Willits, M.G., Molina, A., Steiner, H.-Y. and Hunt, M.D. (1996) Systemic acquired resistance. The plant cell 8, 1809. Ryugo, K., Okuse, I. and Fujii, Y. (1989) Correlation between fire blight resistance and phenolic levels in pears. In: V International Workshop on Fire Blight 273 pp. 335-338. - 123 - Investigation of the fire blight resistance cascade triggered by FB_MR5 using RNASeq
Sarowar, S., Zhao, Y., Soria-Guerra, R.E., Ali, S., Zheng, D., Wang, D. and Korban, S.S. (2011) Expression profiles of differentially regulated genes during the early stages of apple flower infection with Erwinia amylovora. Journal of experimental botany 62, 4851-4861. Schenk, P.M., Kazan, K., Wilson, I., Anderson, J.P., Richmond, T., Somerville, S.C. and Manners, J.M. (2000) Coordinated plant defense responses in Arabidopsis revealed by microarray analysis. Proceedings of the National Academy of Sciences 97, 11655-11660. Schijlen, E.G., De Vos, C.R., van Tunen, A.J. and Bovy, A.G. (2004) Modification of flavonoid biosynthesis in crop plants. Phytochemistry 65, 2631-2648. Shulaev, V., Cortes, D., Miller, G. and Mittler, R. (2008) Metabolomics for plant stress response. Physiologia Plantarum 132, 199-208. Slatnar, A., Mikulic Petkovsek, M., Halbwirth, H., Stampar, F., Stich, K. and Veberic, R. (2010) Enzyme activity of the phenylpropanoid pathway as a response to apple scab infection. Annals of Applied Biology 156, 449-456. Soria-Guerra, R.E., Rosales-Mendoza, S., Gasic, K., Wisniewski, M.E., Band, M. and Korban, S.S. (2011) Gene expression is highly regulated in early developing fruit of apple. Plant Molecular Biology Reporter 29, 885-897. Thimm, O., Bläsing, O., Gibon, Y., Nagel, A., Meyer, S., Krüger, P., Selbig, J., Müller, L.A., Rhee, S.Y. and Stitt, M. (2004) mapman: a user‐driven tool to display genomics data sets onto diagrams of metabolic pathways and other biological processes. The Plant Journal 37, 914-939. Torres, M.A., Jones, J.D. and Dangl, J.L. (2006) Reactive oxygen species signaling in response to pathogens. Plant physiology 141, 373-378. Velasco, R., Zharkikh, A., Affourtit, J., Dhingra, A., Cestaro, A., Kalyanaraman, A., Fontana, P., Bhatnagar, S.K., Troggio, M., Pruss, D., Salvi, S., Pindo, M., Baldi, P., Castelletti, S., Cavaiuolo, M., Coppola, G., Costa, F., Cova, V., Dal Ri, A., Goremykin, V., Komjanc, M., Longhi, S., Magnago, P., Malacarne, G., Malnoy, M., Micheletti, D., Moretto, M., Perazzolli, M., Si- Ammour, A., Vezzulli, S., Zini, E., Eldredge, G., Fitzgerald, L.M., Gutin, N., Lanchbury, J., Macalma, T., Mitchell, J.T., Reid, J., Wardell, B., Kodira, C., Chen, Z., Desany, B., Niazi, F., Palmer, M., Koepke, T., Jiwan, D., Schaeffer, S., Krishnan, V., Wu, C., Chu, V.T., King, S.T., Vick, J., Tao, Q., Mraz, A., Stormo, A., Stormo, K., Bogden, R., Ederle, D., Stella, A., Vecchietti, A., Kater, M.M., Masiero, S., Lasserre, P., Lespinasse, Y., Allan, A.C., Bus, V., Chagne, D., Crowhurst, R.N., Gleave, A.P., Lavezzo, E., Fawcett, J.A., Proost, S., Rouze, P., Sterck, L., Toppo, S., Lazzari, B., Hellens, R.P., Durel, C.E., Gutin, A., Bumgarner, R.E., Gardiner, S.E., Skolnick, M., Egholm, M., Van de Peer, Y., Salamini, F. and Viola, R. (2010) The genome of the domesticated apple (Malus × domestica Borkh.). Nat Genet 42, 833. Venisse, J.-S., Barny, M.-A., Paulin, J.-P. and Brisset, M.-N. (2003) Involvement of three pathogenicity factors of Erwinia amylovora in the oxidative stress associated with compatible interaction in pear. FEBS letters 537, 198-202. Venisse, J.-S., Gullner, G. and Brisset, M.-N. (2001) Evidence for the involvement of an oxidative stress in the initiation of infection of pear by Erwinia amylovora. Plant Physiology 125, 2164- 2172. Venisse, J.-S., Malnoy, M., Faize, M., Paulin, J.-P. and Brisset, M.-N. (2002) Modulation of defense responses of Malus spp. during compatible and incompatible interactions with Erwinia amylovora. Molecular Plant-Microbe Interactions 15, 1204-1212. Viljevac, M.D., Krunoslav; Štolfa, Ivna; Đermić, Edyta; Cvjetković, Bogdan; Sudar, Rezica; Kovačević, Josip; Cesar, Vera; Lepeduš, Hrvoje; Jurković, Zorica (2009) Biochemical basis of apple leaf resistance to Erwinia amylovora infection. Food Technology and Biotechnology 47, 281-287. - 124 - References
Vogt, I., Wöhner, T., Richter, K., Flachowsky, H., Sundin, G.W., Wensing, A., Savory, E.A., Geider, K., Day, B. and Hanke, M.V. (2013) Gene‐for‐gene relationship in the host–pathogen system Malus× robusta 5–Erwinia amylovora. New Phytologist 197, 1262-1275. Wang, X., Tang, C., Huang, X., Li, F., Chen, X., Zhang, G., Sun, Y., Han, D. and Kang, Z. (2012) Wheat BAX inhibitor-1 contributes to wheat resistance to Puccinia striiformis. Journal of experimental botany. Xia, R., Zhu, H., An, Y., Beers, E.P. and Liu, Z. (2012) Apple miRNAs and tasiRNAs with novel regulatory networks. Genome Biol 13, R47. Xing, T. and Laroche, A. (2011) Revealing plant defense signaling: getting more sophisticated with phosphoproteomics. Plant signaling & behavior 6, 1469-1474. Zhang, S. and Klessig, D.F. (2001) MAPK cascades in plant defense signaling. Trends in plant science 6, 520-527. Zhang, Y., Zhu, J. and Dai, H. (2012) Characterization of transcriptional differences between columnar and standard apple trees using RNA-Seq. Plant Molecular Biology Reporter 30, 957-965. Zhao, Y., He, S.-Y. and Sundin, G.W. (2006) The Erwinia amylovora avrRpt2EA gene contributes to virulence on pear and AvrRpt2EA is recognized by Arabidopsis RPS2 when expressed in Pseudomonas syringae. Molecular plant-microbe interactions 19, 644-654.
- 125 - Investigation of the fire blight resistance cascade triggered by FB_MR5 using RNASeq
Supporting Information for chapter 3 Index of content
Supplementary tables Supplementary table 1 (p. 127)
Supplementary table 2 (p. 128)
Supplementary table 3 (p. 136)
Supplementary table 4 (p. 158)
Supplementary table 5 (p. 164)
Supplementary table 6 (p. 165)
Supplementary table 7 (p. 166)
Supplementary figures
Supplementary figure 1 (p. 170)
- 126 - Chapter 3)
Supplementary table 1) Transcripts of recommended house-keeping genes. A high expression (RPKM) and a low standard deviation (SD) were used as indicators for stable house-keeping genes). 1 indicates RPKM values corrected by the initial library size. * indicates similarity between MDP and contig > 95 %.
mean SD in best Predicted Nr in sup Reference gene SD Source RPKM1 % BLAST hit MDP figure 1
Espley et al. (2007) 1 Actin 196.01 41.25 21.05 Kost_et_al_contig_1189 MDP0000912745 * Bowen et al. (2014) Phytochrome protein phosphatase 3 (FYPP3) 2.94 0.74 25.16 Kost_et_al_contig_11674 MDP0000060858 * Bowen et al. (2014) 2 Type 1 membrane protein like (TMP 1) 15.24 4.15 27.21 Kost_et_al_contig_4704 MDP0000241680 * Perini et al. (2014) 3 Protein of unknown function SAND family (SAND) 1.18 0.33 28.17 Kost_et_al_contig_470 MDP0000088431 Perini et al. (2014) 4 Sec14 cytosolic factor (PI/PC TR) 10.14 3.25 32.02 Kost_et_al_contig_11595 MDP0000160107 * Bowen et al. (2014) 5 26S proteosome subunit 14 3.11 1.03 33.02 Kost_et_al_contig_12678 MDP0000127619 Bowen et al. (2014) 6 Casein kinase II subunit beta-4 (CKB4) 3.15 1.14 36.16 Kost_et_al_contig_3743 MDP0000095375 * Bowen et al. (2014) 7 Transcription factor WD40-like repeat domain (WD40) 0.74 0.27 36.26 Kost_et_al_contig_21899 MDP0000230683 * Perini et al. (2014) 8 Actin 11 15.13 5.49 36.26 Kost_et_al_contig_1129 MDP0000921834 * Perini et al. (2014) 9 Malate dehydrogenase (MDH) 43.20 16.07 37.20 Kost_et_al_contig_1878 MDP0000197620 * Perini et al. (2014) 10 Protein of unknown function SAND family (SAND) 1.77 0.71 40.08 Kost_et_al_contig_471 MDP0000202305 Perini et al. (2014) 11 Protein of unknown function SAND family (SAND) 0.35 0.15 41.82 Kost_et_al_contig_471 MDP0000185470 Perini et al. (2014) 12 Malate dehydrogenase (MDH) 145.00 67.84 46.79 Kost_et_al_contig_1878 MDP0000170418 * Perini et al. (2014) 13 14 Glycerol-3-phosphate acyl transferase 1.31 0.61 46.83 Kost_et_al_contig_7533 MDP0000326399 Bowen et al. (2014) 15 SAGA associated factor 2.26 1.07 47.22 Kost_et_al_contig_7179 MDP0000336547 Bowen et al. (2014) Bulley et al. (2009) 16 Protein Phosphatase (PP2a) 11.93 5.71 47.87 Kost_et_al_contig_5539 MDP0000280952 Bowen et al. (2014) 17 Vacuolar sorting-associated protein 1.13 0.58 51.56 Kost_et_al_contig_20094 MDP0000342757 Bowen et al. (2014) 18 Clathrin assembly protein 1.94 1.22 63.02 Kost_et_al_contig_12542 MDP0000209890 Bowen et al. (2014) 19 Somatic embryogenesis receptor kinase 6.02 3.88 64.42 Kost_et_al_contig_2348 MDP0000324175 * Bowen et al. (2014) Formate-tetrahydrofolate ligase (THFS) 5.08 3.87 76.14 Kost_et_al_contig_1384 MDP0000182376 * Perini et al. (2014) 20 Formate-tetrahydrofolate ligase (THFS) 4.76 3.64 76.54 Kost_et_al_contig_1384 MDP0000622972 * Perini et al. (2014) 21 22 StaR-related lipid tranfer protein (LTL1) 0.58 0.72 125.16 Kost_et_al_contig_277 MDP0000173025 Bowen et al. (2014)
- 127 - Investigation of the fire blight resistance cascade triggered by FB_MR5 using RNASeq
Supplementary table 2) List of transcripts that could be used as putative reference genes. Standard deviation of three biological replicates (SD), reads per kilobase of transcript per million mapped reads (RPKM), 'Gala Galaxy' (G), after high humidity treatment (hum), transgenic line T41D (T), inoculated by E. amylovora (erw).
total mean Ghum %SD Terw %SD Gerw %SD of % SD per Ghum Terw - Gerw - per mean per mean per mean Feature ID mean RPKM Means Means Means RPKM RPKM RPKM Kost_et_al_contig_17511 1,83 15,6 26,0 23,2 1,1 2,8 1,7 Kost_et_al_contig_1951 2,41 19,9 25,6 20,2 3,7 2,6 0,9 Kost_et_al_contig_6612 3,51 67,1 110,5 71,9 5,7 3,1 1,7 Kost_et_al_contig_1600 3,59 34,5 35,7 20,0 4,5 4,8 1,5 Kost_et_al_contig_6137 3,63 10,6 7,5 8,8 3,1 4,9 2,9 Kost_et_al_contig_617 3,90 312,9 173,7 282,3 4,4 4,6 2,7 Kost_et_al_contig_16723 3,90 23,2 14,2 13,7 5,3 6,0 0,4 Kost_et_al_contig_8212 4,06 50,6 45,2 47,7 1,9 6,9 3,3 Kost_et_al_contig_11197 4,14 12,9 25,8 24,6 6,6 2,0 3,8 Kost_et_al_contig_17198 4,23 10,8 25,6 16,8 0,8 9,8 2,1 Kost_et_al_contig_11294 4,28 25,6 34,3 26,6 5,4 3,5 3,9 Kost_et_al_contig_15086 4,33 2,9 2,2 3,3 2,5 4,0 6,5 Kost_et_al_contig_13029 4,43 41,8 51,1 50,9 7,5 2,8 3,0 Kost_et_al_contig_3659 4,58 24,0 42,0 35,0 4,3 4,2 5,2 Kost_et_al_contig_19711 4,67 9,1 13,4 12,2 1,5 5,1 7,4 Kost_et_al_contig_356 4,67 845,5 287,6 535,1 6,3 5,6 2,1 Kost_et_al_contig_3636 4,69 15,9 18,3 15,9 4,0 4,2 5,8 Kost_et_al_contig_20352 4,70 8,4 7,1 5,4 9,3 2,7 2,1 Kost_et_al_contig_13205 4,70 7,6 4,4 7,2 2,1 4,9 7,1 Kost_et_al_contig_1838 4,71 21,1 18,9 23,5 5,0 2,8 6,3 Kost_et_al_contig_13824 4,75 16,2 21,7 18,2 2,7 3,5 8,1 Kost_et_al_contig_2286 4,77 61,3 66,7 59,7 5,8 4,0 4,6 Kost_et_al_contig_15400 4,79 14,2 16,5 14,6 3,8 3,3 7,3 Kost_et_al_contig_1591 4,94 45,0 53,2 56,0 5,2 5,7 3,9 Kost_et_al_contig_38928 5,04 3,9 4,8 5,6 5,6 6,1 3,4 Kost_et_al_contig_4934 5,11 189,0 154,8 198,7 4,2 4,8 6,3 Kost_et_al_contig_6097 5,11 35,7 13,3 22,5 2,4 10,0 2,9 Kost_et_al_contig_10609 5,15 21,7 37,9 30,6 5,9 5,7 3,8 Kost_et_al_contig_4549 5,15 31,5 53,3 49,0 2,3 10,4 2,7 Kost_et_al_contig_12934 5,17 35,0 36,7 39,0 2,7 7,5 5,3 Kost_et_al_contig_15344 5,19 7,1 12,7 10,3 2,9 10,0 2,7 Kost_et_al_contig_91 5,21 57,2 98,8 76,1 7,0 4,6 4,0 Kost_et_al_contig_10769 5,28 37,4 38,4 37,1 1,8 8,5 5,5 Kost_et_al_contig_5356 5,30 14,4 15,6 13,7 5,0 2,6 8,3 Kost_et_al_contig_3863 5,35 35,9 23,0 36,8 4,0 6,3 5,7 Kost_et_al_contig_481 5,38 165,6 240,5 241,2 9,5 4,6 2,1 Kost_et_al_contig_19643 5,41 12,0 10,9 11,9 2,4 2,0 11,8 Kost_et_al_contig_38345 5,44 0,7 1,4 1,7 2,9 9,3 4,1
- 128 - Chapter 3)
total mean Ghum %SD Terw %SD Gerw %SD of % SD per Ghum Terw - Gerw - per mean per mean per mean Feature ID mean RPKM Means Means Means RPKM RPKM RPKM Kost_et_al_contig_2401 5,44 68,2 48,6 67,6 7,3 4,5 4,5 Kost_et_al_contig_3652 5,46 21,2 24,3 26,6 3,2 9,8 3,4 Kost_et_al_contig_20539 5,55 21,2 28,7 30,3 7,7 6,8 2,1 Kost_et_al_contig_16396 5,55 38,9 53,5 39,8 5,2 8,5 2,9 Kost_et_al_contig_7421 5,56 36,2 19,4 20,4 4,9 7,2 4,6 Kost_et_al_contig_12658 5,61 17,3 25,2 23,1 9,0 4,3 3,5 Kost_et_al_contig_12 5,63 63,6 82,8 58,0 4,6 4,1 8,2 Kost_et_al_contig_3816 5,69 24,6 23,6 19,3 7,5 3,0 6,6 Kost_et_al_contig_3258 5,69 28,5 11,8 15,9 4,2 10,1 2,8 Kost_et_al_contig_8539 5,71 72,5 94,3 83,9 1,6 5,2 10,3 Kost_et_al_contig_1156 5,71 675,8 467,8 584,5 7,5 5,0 4,6 Kost_et_al_contig_974 5,72 196,1 266,3 191,9 2,4 6,6 8,2 Kost_et_al_contig_10810 5,72 26,5 52,6 40,8 3,6 3,3 10,2 Kost_et_al_contig_724 5,74 20,0 19,2 23,9 6,8 7,7 2,7 Kost_et_al_contig_755 5,75 176,8 139,1 170,3 2,8 4,1 10,3 Kost_et_al_contig_16171 5,77 6,1 7,8 6,6 4,3 9,0 4,0 Kost_et_al_contig_3137 5,78 45,0 32,0 39,8 6,3 4,8 6,2 Kost_et_al_contig_4845 5,79 14,1 16,4 15,6 2,0 3,7 11,6 Kost_et_al_contig_11035 5,80 16,8 25,5 18,0 8,8 2,7 6,0 Kost_et_al_contig_13243 5,83 28,4 31,5 20,1 4,9 6,6 6,0 Kost_et_al_contig_8306 5,83 38,5 14,5 14,5 10,3 4,9 2,3 Kost_et_al_contig_9921 5,84 25,3 29,2 22,5 5,8 2,4 9,2 Kost_et_al_contig_5820 5,87 15,2 28,9 18,8 3,5 10,1 4,0 Kost_et_al_contig_2285 5,87 53,2 46,6 44,7 2,1 10,8 4,6 Kost_et_al_contig_4403 5,89 20,5 19,9 25,8 1,1 8,6 8,0 Kost_et_al_contig_9113 5,91 8,0 14,8 10,9 1,4 3,4 13,0 Kost_et_al_contig_2443 5,93 66,4 26,1 44,5 1,7 9,8 6,3 Kost_et_al_contig_15972 5,93 23,6 22,8 19,6 5,7 3,2 8,9 Kost_et_al_contig_26312 5,95 11,0 19,7 20,8 2,5 7,7 7,6 Kost_et_al_contig_4805 5,95 24,3 27,3 21,0 4,1 7,4 6,4 Kost_et_al_contig_22730 5,96 12,6 12,8 11,3 4,0 5,3 8,6 Kost_et_al_contig_5914 5,96 43,0 51,7 44,7 3,8 5,0 9,1 Kost_et_al_contig_2839 5,99 49,8 52,4 50,4 8,6 3,5 5,8 Kost_et_al_contig_9155 6,02 10,5 17,7 12,0 4,4 9,3 4,3 Kost_et_al_contig_47253 6,03 1,5 1,3 1,4 8,4 8,1 1,6 Kost_et_al_contig_13165 6,07 14,4 9,3 15,5 5,2 5,5 7,5 Kost_et_al_contig_1930 6,08 6,8 12,8 10,5 3,5 4,6 10,2 Kost_et_al_contig_16281 6,10 33,9 25,6 31,0 1,3 10,6 6,4 Kost_et_al_contig_27792 6,10 17,0 19,3 14,5 4,4 6,3 7,6 Kost_et_al_contig_20935 6,11 13,5 14,3 11,0 5,1 2,9 10,4 Kost_et_al_contig_16191 6,12 11,5 9,9 6,1 5,7 3,3 9,4 Kost_et_al_contig_36512 6,13 3,1 5,6 5,5 8,6 4,5 5,3 Kost_et_al_contig_9505 6,14 47,2 48,7 46,7 10,0 1,1 7,3 - 129 - Investigation of the fire blight resistance cascade triggered by FB_MR5 using RNASeq
total mean Ghum %SD Terw %SD Gerw %SD of % SD per Ghum Terw - Gerw - per mean per mean per mean Feature ID mean RPKM Means Means Means RPKM RPKM RPKM Kost_et_al_contig_6907 6,14 15,1 22,6 22,7 9,8 4,9 3,7 Kost_et_al_contig_3692 6,17 31,9 42,7 30,9 7,5 7,0 3,9 Kost_et_al_contig_12633 6,17 17,1 39,1 41,4 4,6 4,6 9,4 Kost_et_al_contig_14991 6,17 25,1 26,2 23,2 3,8 13,8 1,0 Kost_et_al_contig_3282 6,21 10,5 9,9 9,6 6,0 7,1 5,5 Kost_et_al_contig_4697 6,22 86,6 83,2 97,5 10,9 4,4 3,3 Kost_et_al_contig_28419 6,22 8,7 12,0 9,9 11,2 5,2 2,2 Kost_et_al_contig_8922 6,26 27,1 42,5 32,7 10,7 5,0 3,0 Kost_et_al_contig_179 6,26 69,1 188,3 144,5 4,0 8,3 6,5 Kost_et_al_contig_7830 6,26 15,9 18,2 17,8 0,8 2,8 15,2 Kost_et_al_contig_23793 6,26 27,1 30,4 32,1 1,0 2,6 15,2 Kost_et_al_contig_4135 6,27 9,1 9,9 8,1 6,9 2,1 9,8 Kost_et_al_contig_16395 6,27 17,2 18,0 18,9 3,8 7,1 7,9 Kost_et_al_contig_3584 6,29 6,0 4,7 5,3 3,9 8,9 6,0 Kost_et_al_contig_20279 6,30 3,4 3,9 3,2 3,1 8,6 7,1 Kost_et_al_contig_10852 6,32 29,5 9,3 15,2 4,4 8,1 6,5 Kost_et_al_contig_1390 6,33 20,1 29,9 24,8 2,9 15,8 0,3 Kost_et_al_contig_27457 6,34 1,8 1,3 1,6 2,5 11,7 4,8 Kost_et_al_contig_2459 6,36 25,4 33,3 28,9 2,7 10,3 6,1 Kost_et_al_contig_31201 6,38 2,0 3,5 2,6 12,4 5,8 1,0 Kost_et_al_contig_10964 6,40 23,7 35,0 23,1 5,6 10,2 3,4 Kost_et_al_contig_2719 6,40 553,2 536,3 651,6 8,0 3,5 7,7 Kost_et_al_contig_1391 6,45 7,3 10,0 8,7 6,3 7,3 5,7 Kost_et_al_contig_14129 6,49 3,8 4,8 3,8 4,8 8,9 5,8 Kost_et_al_contig_9616 6,55 76,5 92,6 66,0 4,6 8,6 6,4 Kost_et_al_contig_6240 6,55 44,1 51,7 42,5 12,1 6,2 1,3 Kost_et_al_contig_6969 6,57 6,0 5,4 6,2 8,2 4,5 7,0 Kost_et_al_contig_7831 6,58 12,9 34,5 20,8 6,0 5,7 7,9 Kost_et_al_contig_18940 6,58 15,6 15,7 14,4 4,1 2,9 12,8 Kost_et_al_contig_13848 6,59 3,1 3,2 3,2 2,8 13,3 3,6 Kost_et_al_contig_11101 6,61 5,9 3,4 4,9 6,1 2,0 11,7 Kost_et_al_contig_3418 6,61 18,3 4,9 3,3 7,4 8,6 3,9 Kost_et_al_contig_5410 6,62 8,8 8,9 6,9 4,9 6,6 8,3 Kost_et_al_contig_174 6,62 1268,1 506,9 942,0 10,1 5,5 4,3 Kost_et_al_contig_32126 6,63 3,3 5,3 4,3 8,8 1,4 9,7 Kost_et_al_contig_2113 6,65 78,7 47,9 43,8 5,1 6,5 8,4 Kost_et_al_contig_12891 6,65 9,5 7,1 6,5 6,5 8,2 5,2 Kost_et_al_contig_11334 6,65 38,5 46,9 32,0 6,8 4,2 9,0 Kost_et_al_contig_1650 6,67 13,3 20,7 19,8 11,9 6,4 1,8 Kost_et_al_contig_120 6,69 455,8 986,0 675,4 3,2 9,5 7,4 Kost_et_al_contig_24807 6,69 16,4 25,4 21,9 1,9 9,5 8,7 Kost_et_al_contig_8036 6,72 37,2 52,9 61,2 10,9 2,0 7,2 Kost_et_al_contig_8598 6,72 8,6 11,7 10,2 7,8 6,3 6,0 - 130 - Chapter 3)
total mean Ghum %SD Terw %SD Gerw %SD of % SD per Ghum Terw - Gerw - per mean per mean per mean Feature ID mean RPKM Means Means Means RPKM RPKM RPKM Kost_et_al_contig_13309 6,72 8,9 9,7 8,8 5,9 10,0 4,3 Kost_et_al_contig_1520 6,73 65,9 38,0 43,6 7,3 9,1 3,8 Kost_et_al_contig_8092 6,75 80,9 104,5 80,4 3,9 12,1 4,2 Kost_et_al_contig_19105 6,75 8,6 16,8 10,1 1,5 11,7 7,1 Kost_et_al_contig_1533 6,77 39,8 36,3 28,6 8,1 6,5 5,7 Kost_et_al_contig_4903 6,78 39,5 24,2 38,0 9,8 4,4 6,1 Kost_et_al_contig_9262 6,79 53,0 45,5 52,7 2,1 13,7 4,6 Kost_et_al_contig_3823 6,79 34,9 22,9 20,4 0,7 13,3 6,4 Kost_et_al_contig_3690 6,82 34,1 27,1 27,7 2,7 16,1 1,7 Kost_et_al_contig_1001 6,82 17,8 28,3 24,2 3,3 11,9 5,3 Kost_et_al_contig_5141 6,83 9,0 14,2 9,9 4,8 4,4 11,3 Kost_et_al_contig_5861 6,84 12,0 16,1 11,1 5,5 3,2 11,7 Kost_et_al_contig_18172 6,84 4,0 4,8 5,3 1,2 7,9 11,4 Kost_et_al_contig_22201 6,85 12,4 11,8 9,0 2,6 12,5 5,4 Kost_et_al_contig_28712 6,85 7,4 10,5 9,8 1,2 10,0 9,3 Kost_et_al_contig_14353 6,85 47,0 52,6 66,5 10,6 8,9 1,1 Kost_et_al_contig_27541 6,87 5,1 11,4 7,5 3,2 9,1 8,3 Kost_et_al_contig_3643 6,87 26,6 24,1 38,4 4,7 7,1 8,8 Kost_et_al_contig_13449 6,88 31,8 78,1 55,3 6,3 11,2 3,1 Kost_et_al_contig_16125 6,88 31,5 49,7 37,4 1,4 4,4 14,9 Kost_et_al_contig_2977 6,88 47,1 55,4 46,6 12,6 6,3 1,8 Kost_et_al_contig_5944 6,90 63,1 62,2 51,3 1,4 9,3 10,0 Kost_et_al_contig_22239 6,93 13,2 10,3 9,3 2,2 5,6 13,0 Kost_et_al_contig_24540 6,95 4,9 5,3 7,0 4,1 7,2 9,5 Kost_et_al_contig_9459 6,95 12,7 17,4 19,3 11,3 7,9 1,7 Kost_et_al_contig_2261 6,96 14,6 26,9 23,4 3,5 4,6 12,8 Kost_et_al_contig_24808 6,97 10,3 18,5 15,3 4,5 10,5 5,9 Kost_et_al_contig_7964 6,97 6,4 3,9 4,6 4,8 8,1 8,0 Kost_et_al_contig_4001 6,98 68,7 50,2 67,4 0,2 14,0 6,8 Kost_et_al_contig_7358 6,98 50,8 66,0 40,1 2,9 15,9 2,1 Kost_et_al_contig_4817 6,99 75,2 71,3 78,5 2,3 7,2 11,5 Kost_et_al_contig_14443 6,99 9,2 14,4 11,5 2,8 12,6 5,5 Kost_et_al_contig_420 6,99 148,0 244,8 177,5 4,3 12,3 4,4 Kost_et_al_contig_10849 7,00 87,1 133,6 101,3 5,3 10,6 5,1 Kost_et_al_contig_14903 7,02 44,4 46,0 40,9 10,0 7,9 3,1 Kost_et_al_contig_689 7,02 113,0 80,0 90,4 3,9 4,3 12,8 Kost_et_al_contig_9271 7,02 14,6 30,4 20,7 2,6 14,7 3,8 Kost_et_al_contig_37763 7,03 1,7 2,9 2,2 11,2 5,2 4,6 Kost_et_al_contig_7370 7,03 24,3 12,1 17,8 8,3 3,7 9,1 Kost_et_al_contig_1859 7,05 56,8 125,2 92,5 6,4 7,7 7,0 Kost_et_al_contig_22108 7,10 7,6 7,0 8,0 8,1 8,7 4,5 Kost_et_al_contig_26334 7,10 9,7 8,7 9,5 10,1 0,6 10,6 Kost_et_al_contig_60644 7,12 0,2 0,1 0,1 2,9 9,5 9,0 - 131 - Investigation of the fire blight resistance cascade triggered by FB_MR5 using RNASeq
total mean Ghum %SD Terw %SD Gerw %SD of % SD per Ghum Terw - Gerw - per mean per mean per mean Feature ID mean RPKM Means Means Means RPKM RPKM RPKM Kost_et_al_contig_65131 7,12 0,1 0,1 0,1 2,9 9,5 9,0 Kost_et_al_contig_18527 7,13 3,6 4,0 4,7 4,2 4,6 12,6 Kost_et_al_contig_1589 7,13 16,7 21,6 27,7 5,8 4,3 11,3 Kost_et_al_contig_13670 7,14 28,8 34,5 29,6 7,7 7,7 6,0 Kost_et_al_contig_8335 7,14 46,3 39,1 36,0 7,4 13,5 0,6 Kost_et_al_contig_24896 7,15 6,5 2,1 2,0 4,3 15,2 1,9 Kost_et_al_contig_2992 7,15 23,6 32,3 33,6 10,2 2,9 8,4 Kost_et_al_contig_11023 7,15 5,7 11,0 6,3 2,0 12,2 7,2 Kost_et_al_contig_11290 7,17 7,3 7,5 6,4 4,3 13,1 4,1 Kost_et_al_contig_10400 7,18 47,4 41,9 42,9 14,2 2,6 4,7 Kost_et_al_contig_15175 7,19 18,8 13,9 17,0 1,7 6,8 13,1 Kost_et_al_contig_12657 7,19 37,6 59,4 45,9 9,0 7,4 5,2 Kost_et_al_contig_19280 7,23 10,6 9,9 9,5 3,5 12,6 5,6 Kost_et_al_contig_6126 7,23 116,2 187,7 123,0 15,5 2,0 4,2 Kost_et_al_contig_14569 7,24 25,7 37,4 27,1 6,1 6,1 9,4 Kost_et_al_contig_11588 7,24 9,7 19,2 13,4 8,7 7,3 5,7 Kost_et_al_contig_10986 7,24 54,8 90,6 73,5 1,0 5,5 15,3 Kost_et_al_contig_3735 7,25 2,3 1,2 1,1 6,0 5,8 9,9 Kost_et_al_contig_387 7,25 221,0 174,4 227,3 8,2 9,4 4,2 Kost_et_al_contig_6266 7,26 10,0 15,6 12,7 5,0 8,7 8,1 Kost_et_al_contig_26522 7,26 3,1 3,7 3,0 1,5 4,0 16,3 Kost_et_al_contig_6296 7,27 103,5 115,3 150,4 12,2 4,9 4,7 Kost_et_al_contig_876 7,28 34,5 22,8 26,3 6,0 7,4 8,5 Kost_et_al_contig_7108 7,28 64,2 50,6 64,6 8,4 6,4 7,0 Kost_et_al_contig_3139 7,30 79,4 153,9 100,2 5,6 4,8 11,4 Kost_et_al_contig_4642 7,30 186,2 71,2 62,7 10,2 2,2 9,5 Kost_et_al_contig_9074 7,32 14,5 14,6 13,0 4,0 9,7 8,2 Kost_et_al_contig_30376 7,32 4,8 4,2 4,8 8,9 6,2 6,9 Kost_et_al_contig_5354 7,33 69,8 69,5 64,8 4,7 13,5 3,8 Kost_et_al_contig_24105 7,35 9,1 14,5 12,6 5,7 10,9 5,5 Kost_et_al_contig_13903 7,35 39,3 71,7 60,4 5,0 7,7 9,4 Kost_et_al_contig_5829 7,37 89,5 143,2 100,3 8,4 11,6 2,1 Kost_et_al_contig_30466 7,39 4,5 2,8 3,3 7,6 4,0 10,6 Kost_et_al_contig_3679 7,39 15,5 14,6 18,0 4,3 5,7 12,2 Kost_et_al_contig_21530 7,40 12,6 19,4 13,4 7,9 6,1 8,2 Kost_et_al_contig_2200 7,40 18,1 25,6 24,8 2,2 12,5 7,6 Kost_et_al_contig_6783 7,40 13,5 22,5 18,7 6,0 13,4 2,9 Kost_et_al_contig_15763 7,41 8,4 15,6 8,6 4,1 7,3 10,9 Kost_et_al_contig_11675 7,41 46,8 73,2 48,7 8,6 10,7 2,9 Kost_et_al_contig_10416 7,43 15,1 28,8 26,3 2,1 11,9 8,4 Kost_et_al_contig_16124 7,43 10,9 19,7 15,5 5,6 12,1 4,6 Kost_et_al_contig_14682 7,44 20,4 33,3 27,6 5,5 5,1 11,7 Kost_et_al_contig_15417 7,45 30,9 27,9 38,6 7,6 13,8 0,9 - 132 - Chapter 3)
total mean Ghum %SD Terw %SD Gerw %SD of % SD per Ghum Terw - Gerw - per mean per mean per mean Feature ID mean RPKM Means Means Means RPKM RPKM RPKM Kost_et_al_contig_11950 7,46 10,8 12,5 10,1 5,1 13,7 3,6 Kost_et_al_contig_10818 7,47 29,2 41,0 35,2 7,6 5,5 9,2 Kost_et_al_contig_5256 7,48 17,7 24,5 18,9 3,1 16,0 3,3 Kost_et_al_contig_2142 7,50 153,8 848,2 464,1 9,9 9,9 2,8 Kost_et_al_contig_16173 7,51 14,6 14,0 11,7 2,9 9,0 10,6 Kost_et_al_contig_23974 7,52 7,9 8,6 9,0 11,6 9,1 1,9 Kost_et_al_contig_2086 7,53 52,4 78,2 62,4 5,4 7,6 9,6 Kost_et_al_contig_25242 7,53 4,7 7,8 6,4 2,7 14,1 5,8 Kost_et_al_contig_16502 7,53 6,1 6,7 5,9 2,0 15,7 4,9 Kost_et_al_contig_4363 7,54 35,6 22,6 20,5 6,8 13,0 2,8 Kost_et_al_contig_25390 7,55 8,1 8,0 9,0 9,4 12,0 1,2 Kost_et_al_contig_2950 7,56 5,3 4,3 5,2 5,5 7,3 9,8 Kost_et_al_contig_4674 7,58 14,5 15,4 23,2 9,0 6,0 7,8 Kost_et_al_contig_16722 7,58 14,8 10,4 10,9 11,5 4,4 6,9 Kost_et_al_contig_15819 7,59 13,9 23,1 22,7 4,4 12,6 5,8 Kost_et_al_contig_18309 7,60 4,5 4,4 4,8 3,6 4,3 14,9 Kost_et_al_contig_17035 7,60 23,8 16,4 15,4 13,4 0,8 8,6 Kost_et_al_contig_4994 7,60 6,1 7,5 7,7 1,7 2,7 18,3 Kost_et_al_contig_14278 7,61 2,0 4,9 3,2 2,2 17,7 3,0 Kost_et_al_contig_4816 7,61 64,4 132,9 93,5 11,4 2,4 9,0 Kost_et_al_contig_28977 7,62 13,8 4,2 3,7 7,0 6,4 9,5 Kost_et_al_contig_201 7,62 35,4 38,0 29,5 2,0 3,1 17,8 Kost_et_al_contig_17661 7,62 8,7 10,3 8,9 10,7 0,7 11,5 Kost_et_al_contig_421 7,63 25,7 24,8 19,7 12,3 9,0 1,5 Kost_et_al_contig_15127 7,64 44,1 31,6 31,7 5,0 15,1 2,9 Kost_et_al_contig_7725 7,65 10,8 7,7 6,6 10,3 5,5 7,2 Kost_et_al_contig_22074 7,65 13,7 17,9 17,0 3,6 9,5 9,9 Kost_et_al_contig_44012 7,65 0,3 0,4 0,6 5,7 6,2 11,1 Kost_et_al_contig_23227 7,65 22,5 43,9 38,3 8,5 3,3 11,2 Kost_et_al_contig_23867 7,66 10,8 7,2 6,3 3,5 4,5 15,0 Kost_et_al_contig_4933 7,68 36,2 30,1 39,8 1,1 6,0 15,9 Kost_et_al_contig_26852 7,69 3,6 3,9 4,1 3,3 6,4 13,4 Kost_et_al_contig_21136 7,70 24,5 50,8 38,2 6,1 11,1 6,0 Kost_et_al_contig_17968 7,71 8,2 12,0 10,0 6,1 12,6 4,4 Kost_et_al_contig_3916 7,72 12,6 16,1 12,1 10,1 10,5 2,5 Kost_et_al_contig_1532 7,73 86,9 109,0 110,2 15,3 4,9 3,0 Kost_et_al_contig_5390 7,73 100,6 115,3 99,5 5,8 10,6 6,7 Kost_et_al_contig_19477 7,73 17,9 15,8 13,5 8,2 3,3 11,8 Kost_et_al_contig_27403 7,76 12,5 17,9 17,4 5,0 12,9 5,4 Kost_et_al_contig_3456 7,77 14,2 12,3 12,5 7,9 12,4 3,1 Kost_et_al_contig_13628 7,77 29,2 32,7 36,4 2,3 4,0 17,0 Kost_et_al_contig_15302 7,77 10,2 12,7 12,1 11,8 5,7 5,8 Kost_et_al_contig_16127 7,77 35,0 24,2 24,4 9,7 1,3 12,3 - 133 - Investigation of the fire blight resistance cascade triggered by FB_MR5 using RNASeq
total mean Ghum %SD Terw %SD Gerw %SD of % SD per Ghum Terw - Gerw - per mean per mean per mean Feature ID mean RPKM Means Means Means RPKM RPKM RPKM Kost_et_al_contig_11298 7,77 54,2 45,3 56,8 4,1 15,4 3,8 Kost_et_al_contig_13562 7,79 13,1 20,2 23,4 5,2 10,2 8,0 Kost_et_al_contig_11277 7,79 15,9 10,6 8,6 8,7 3,8 10,9 Kost_et_al_contig_2971 7,79 18,7 18,4 13,1 6,3 6,4 10,7 Kost_et_al_contig_5108 7,80 23,7 11,2 11,1 6,7 10,6 6,0 Kost_et_al_contig_8263 7,81 72,8 78,0 64,5 5,1 12,4 6,0 Kost_et_al_contig_21728 7,81 4,6 17,7 15,5 9,5 10,9 3,0 Kost_et_al_contig_16995 7,81 1,2 1,9 1,6 1,7 7,4 14,4 Kost_et_al_contig_4554 7,83 54,7 44,5 57,0 7,1 5,3 11,1 Kost_et_al_contig_8188 7,83 36,9 28,7 42,0 10,2 11,1 2,2 Kost_et_al_contig_14359 7,84 2,4 2,4 2,7 9,5 4,0 10,1 Kost_et_al_contig_9917 7,84 17,9 22,7 14,3 10,5 5,4 7,6 Kost_et_al_contig_7775 7,85 62,2 67,1 82,2 13,9 6,1 3,6 Kost_et_al_contig_32874 7,87 3,4 5,6 5,0 10,6 10,6 2,5 Kost_et_al_contig_15012 7,87 48,5 58,7 48,4 11,5 6,0 6,1 Kost_et_al_contig_294 7,87 69,4 90,4 69,5 2,9 17,9 2,7 Kost_et_al_contig_5400 7,87 3,0 13,1 12,8 1,7 4,4 17,5 Kost_et_al_contig_13941 7,89 10,1 7,4 7,7 4,1 0,5 19,1 Kost_et_al_contig_527 7,89 24,9 23,4 23,4 2,4 17,8 3,5 Kost_et_al_contig_547 7,89 39,4 19,2 17,9 5,6 11,8 6,2 Kost_et_al_contig_7904 7,89 60,8 76,8 62,9 3,5 14,3 6,0 Kost_et_al_contig_19005 7,89 11,7 12,0 16,2 5,7 9,6 8,3 Kost_et_al_contig_3753 7,90 9,9 26,6 18,5 7,9 12,6 3,1 Kost_et_al_contig_6877 7,90 23,6 24,1 18,8 3,3 8,0 12,4 Kost_et_al_contig_20540 7,90 21,2 24,6 24,6 6,5 12,7 4,5 Kost_et_al_contig_9256 7,91 165,7 226,8 163,9 4,1 10,3 9,3 Kost_et_al_contig_11766 7,92 18,3 29,4 20,5 4,3 8,9 10,6 Kost_et_al_contig_29722 7,92 1,8 1,0 1,3 6,9 11,0 5,9 Kost_et_al_contig_18273 7,95 23,2 32,4 23,4 3,3 5,3 15,2 Kost_et_al_contig_7824 7,95 35,5 44,0 34,8 5,1 5,4 13,3 Kost_et_al_contig_2171 7,95 63,2 39,9 57,9 5,0 18,5 0,4 Kost_et_al_contig_16967 7,96 15,3 27,9 19,0 9,8 5,8 8,3 Kost_et_al_contig_16948 7,96 14,7 14,9 15,7 1,3 4,3 18,4 Kost_et_al_contig_16966 7,98 24,4 39,4 32,6 8,0 6,8 9,1 Kost_et_al_contig_35955 7,99 4,2 7,8 7,1 9,8 5,4 8,7 Kost_et_al_contig_26914 7,99 11,7 9,4 11,6 1,7 20,7 1,6 Kost_et_al_contig_6846 8,00 37,9 45,7 28,9 5,6 15,9 2,5 Kost_et_al_contig_895 8,01 36,2 30,5 42,5 7,0 14,3 2,7 Kost_et_al_contig_9972 8,01 20,1 24,3 24,5 10,2 7,2 6,6 Kost_et_al_contig_10892 8,02 39,5 29,4 27,4 8,8 11,7 3,6 Kost_et_al_contig_22051 8,02 31,7 48,8 36,7 11,0 5,2 7,8 Kost_et_al_contig_13017 8,02 12,0 16,4 15,6 3,3 11,6 9,2 Kost_et_al_contig_988 8,03 10,5 12,2 10,8 4,0 1,4 18,7 - 134 - Chapter 3)
total mean Ghum %SD Terw %SD Gerw %SD of % SD per Ghum Terw - Gerw - per mean per mean per mean Feature ID mean RPKM Means Means Means RPKM RPKM RPKM Kost_et_al_contig_5355 8,04 4,9 4,7 4,4 4,8 7,4 11,9 Kost_et_al_contig_22696 8,05 11,8 18,8 16,3 10,6 8,1 5,5 Kost_et_al_contig_3387 8,05 42,5 31,9 33,4 5,7 17,0 1,5 Kost_et_al_contig_12392 8,06 29,7 24,2 24,5 4,3 7,0 12,9
- 135 - Investigation of the fire blight resistance cascade triggered by FB_MR5 using RNASeq in transgenic 'Gala Galaxy'
Supplementary table 3) Summary of all 206 differentially expressed transcripts (with FDR < 0.01) part 1 of 3. Baggerly’s weighted fold-change (Bag wfc), transgenic line T41D (T), inoculated by E. amylovora (erw), 'Gala Galaxy' (G), after high humidity treatment (hum), biological replicates (A, B and C), reads per kilobase of transcript per million mapped reads (RPKM).
Bag Bag wfc Bag wfc wfc Terw Gerw Gerw Ghum Terw Gerw vs vs vs Ghum(A) Ghum(B) Ghum(C) Means Terw(A) Terw(B) Terw(C) Means Gerw(A) Gerw(B) Gerw(C) Means Feature ID BIN Ghum Ghum Terw RPKM RPKM RPKM RPKM RPKM RPKM RPKM RPKM RPKM RPKM RPKM RPKM Kost_et_al_contig_10778 1.1.1.1 -2.38 -1.11 2.15 41.46 46.22 49.95 45.88 18.92 20.02 23.46 20.80 41.05 39.90 44.86 41.94 Kost_et_al_contig_1109 1.1.1.1 -2.32 -1.02 2.28 1'227.31 1'280.47 1'066.50 1'191.43 487.42 689.54 475.07 550.67 1'306.60 982.76 1'269.43 1'186.26 Kost_et_al_contig_1110 1.1.1.1 -2.82 1.11 3.12 340.35 373.00 300.12 337.82 136.68 120.71 129.88 129.09 414.55 329.94 396.36 380.28 Kost_et_al_contig_3310 1.1.1.1 -1.14 2.34 2.67 140.87 249.09 180.43 190.13 221.65 85.88 234.48 180.67 496.79 462.94 399.05 452.93 Kost_et_al_contig_4147 1.1.1.1 -1.35 1.95 2.64 374.43 451.60 207.79 344.61 282.56 188.00 362.06 277.54 658.21 599.44 788.03 681.89 Kost_et_al_contig_468 1.1.1.1 -1.41 1.38 1.95 997.05 1'127.68 845.78 990.17 763.23 754.49 751.78 756.50 1'485.91 1'511.71 1'193.18 1'396.93 Kost_et_al_contig_901 1.1.1.1 1.20 2.51 2.09 392.04 512.66 450.59 451.76 694.80 300.00 771.32 588.70 1'216.83 1'078.80 1'165.69 1'153.77 Kost_et_al_contig_130 1.1.1.2 -2.97 -1.26 2.36 2'376.29 2'313.37 2'834.43 2'508.03 981.84 962.21 764.11 902.72 2'222.93 2'127.39 1'736.86 2'029.06 Kost_et_al_contig_15 1.1.1.2 -2.25 -1.24 1.81 1'357.07 1'431.88 1'477.53 1'422.16 653.53 718.77 673.68 681.99 1'367.99 1'143.95 997.08 1'169.67 Kost_et_al_contig_16 1.1.1.2 -2.17 -1.21 1.79 748.11 876.83 784.42 803.12 355.19 359.99 485.39 400.19 777.57 666.65 582.34 675.52 Kost_et_al_contig_71 1.1.1.2 -2.83 -1.54 1.84 518.92 535.21 366.45 473.53 184.95 165.75 190.32 180.34 290.68 339.68 308.13 312.83 Kost_et_al_contig_1170 1.1.2.1 -1.34 1.37 1.85 413.92 436.79 252.58 367.76 267.44 300.74 317.51 295.23 504.55 485.95 548.06 512.85 Kost_et_al_contig_1232 1.1.2.1 -2.00 1.08 2.17 690.49 819.30 572.64 694.15 350.41 408.68 362.39 373.83 809.80 666.49 815.59 763.96 Kost_et_al_contig_1392 1.1.2.1 -1.21 1.76 2.12 902.53 949.70 731.80 861.34 782.60 663.78 864.32 770.23 1'454.00 1'380.35 1'762.61 1'532.32 Kost_et_al_contig_1636 1.1.2.1 -1.13 1.74 1.97 642.66 709.23 470.77 607.55 603.70 531.85 596.85 577.47 1'043.95 1'004.44 1'158.96 1'069.12 Kost_et_al_contig_2366 1.1.2.1 -1.39 1.39 1.94 528.42 571.97 407.55 502.65 352.70 415.77 397.75 388.74 733.94 675.79 725.63 711.79 Kost_et_al_contig_1592 1.1.2.2 -1.57 1.09 1.72 540.21 556.17 394.92 497.10 320.61 353.75 348.34 340.90 565.60 486.87 600.64 551.03 Kost_et_al_contig_1858 1.1.2.2 -2.91 -1.58 1.84 1'970.86 2'124.24 1'783.44 1'959.51 593.47 743.38 849.20 728.68 1'227.22 1'287.29 1'268.85 1'261.12 Kost_et_al_contig_1156 1.1.4.4 -1.56 -1.18 1.32 722.85 682.32 622.26 675.81 442.60 488.93 471.73 467.75 578.52 614.18 560.94 584.55 Kost_et_al_contig_4955 1.1.4.4 -2.47 -1.28 1.92 461.20 494.11 446.23 467.18 206.57 248.69 151.22 202.16 399.88 404.49 309.28 371.22 Kost_et_al_contig_326 1.1.4.7 -2.22 -1.41 1.57 615.94 602.68 489.38 569.33 271.43 237.93 322.94 277.43 394.51 419.41 416.14 410.02 Kost_et_al_contig_8081 1.1.6 -2.09 -1.00 2.09 53.21 59.94 68.87 60.67 30.64 24.89 38.20 31.24 58.16 58.04 67.34 61.18
- 136 - Chapter 3)
Bag Bag wfc Bag wfc wfc Terw Gerw Gerw Ghum Terw Gerw vs vs vs Ghum(A) Ghum(B) Ghum(C) Means Terw(A) Terw(B) Terw(C) Means Gerw(A) Gerw(B) Gerw(C) Means Feature ID BIN Ghum Ghum Terw RPKM RPKM RPKM RPKM RPKM RPKM RPKM RPKM RPKM RPKM RPKM RPKM Kost_et_al_contig_1079 1.2.1 -1.45 1.16 1.68 313.02 353.90 310.26 325.73 231.03 187.05 313.43 243.84 372.09 405.10 378.40 385.20 Kost_et_al_contig_1080 1.2.1 -1.36 1.37 1.87 166.92 197.57 201.90 188.80 139.90 114.71 196.47 150.36 234.08 294.47 262.16 263.57 Kost_et_al_contig_601 1.2.2 -2.84 -1.57 1.81 289.89 273.43 243.05 268.79 85.21 107.28 113.61 102.03 166.52 166.22 188.04 173.59 Kost_et_al_contig_454 1.2.5 -2.34 -1.42 1.65 544.24 561.93 525.61 543.93 220.94 309.81 215.72 248.82 397.19 388.72 385.42 390.45 Kost_et_al_contig_387 1.3.11 -1.36 1.01 1.38 213.13 208.17 241.69 221.00 157.48 190.21 175.46 174.38 220.42 223.35 238.06 227.28 Kost_et_al_contig_1300 1.3.12 -1.83 -1.16 1.58 524.80 555.91 456.45 512.39 260.99 275.05 372.04 302.69 449.88 484.12 416.97 450.32 Kost_et_al_contig_455 1.3.12 -1.57 -1.03 1.51 1'078.01 1'032.20 839.16 983.12 572.03 653.92 811.87 679.27 886.16 1'065.92 944.24 965.44 Kost_et_al_contig_400 1.3.13 -2.33 -1.30 1.79 959.81 1'025.15 1'717.50 1'234.15 557.80 586.85 563.70 569.45 1'100.47 1'039.30 760.45 966.74 Kost_et_al_contig_622 1.3.13 -1.54 1.03 1.58 2'667.09 2'763.58 3'110.02 2'846.90 2'103.55 1'813.94 2'066.14 1'994.54 3'235.57 3'345.34 2'388.79 2'989.90 Kost_et_al_contig_552 1.3.3 -2.88 -1.20 2.41 951.77 1'088.86 1'140.95 1'060.53 462.15 365.47 357.34 394.99 935.19 961.33 812.76 903.09 Kost_et_al_contig_174 1.3.4 -2.70 -1.37 1.97 1'223.56 1'411.89 1'168.74 1'268.06 505.56 479.78 535.32 506.89 923.11 988.61 914.33 942.02 Kost_et_al_contig_2936 1.3.4 -1.79 1.08 1.94 89.60 103.54 89.92 94.35 56.85 50.12 63.42 56.80 122.46 104.68 85.79 104.31 Kost_et_al_contig_661 1.3.4 -1.42 1.16 1.64 1'115.79 1'211.02 1'091.30 1'139.37 951.54 640.36 1'010.27 867.39 1'430.34 1'380.50 1'214.53 1'341.79 Kost_et_al_contig_662 1.3.4 -2.14 -1.21 1.77 1'191.04 1'310.35 1'083.60 1'195.00 657.30 485.62 667.30 603.41 1'096.40 970.83 953.66 1'006.96 Kost_et_al_contig_1375 1.3.6 -5.41 -2.24 2.42 1'179.43 1'089.78 1'063.16 1'110.79 185.98 256.24 221.38 221.20 484.58 465.10 558.58 502.75 Kost_et_al_contig_1527 1.3.6 -4.61 -1.68 2.75 206.53 204.15 162.74 191.14 40.36 43.76 50.32 44.82 105.66 117.85 123.16 115.56 Kost_et_al_contig_1528 1.3.6 -4.45 -1.89 2.35 291.23 278.97 193.21 254.47 51.55 65.19 68.48 61.74 123.11 139.82 146.10 136.34 Kost_et_al_contig_4433 1.3.6 -4.09 -1.61 2.54 105.02 116.70 86.38 102.70 26.10 25.32 29.85 27.09 55.85 66.49 70.95 64.43 Kost_et_al_contig_2546 1.3.7 -1.55 1.24 1.91 324.15 376.69 366.11 355.65 243.90 173.47 329.86 249.08 473.64 461.47 405.78 446.96 Kost_et_al_contig_2547 1.3.7 -1.91 1.02 1.96 275.52 306.22 264.71 282.15 143.20 104.80 235.58 161.19 282.84 314.51 283.91 293.75 Kost_et_al_contig_6084 10.1.4 1.93 1.43 -1.35 129.43 112.00 97.66 113.03 212.01 246.52 244.80 234.44 171.65 169.95 150.43 164.01 Kost_et_al_contig_134 10.7 -1.69 -5.04 -2.98 1'152.66 639.60 734.21 842.16 417.05 633.91 556.01 535.66 89.39 177.04 234.87 167.10 Kost_et_al_contig_49392 10.7 40.45 2.30 -17.56 0.46 1.09 1.23 0.92 31.67 46.57 42.70 40.31 2.26 3.23 1.10 2.20 Kost_et_al_contig_603 10.7 -6.54 -32.55 -4.98 397.54 372.99 238.27 336.27 54.79 56.97 54.66 55.48 16.75 4.08 10.73 10.52 Kost_et_al_contig_15854 10.8.1 1.44 -2.77 -3.98 19.78 14.83 14.69 16.43 28.52 24.03 23.54 25.36 6.33 6.84 5.02 6.06
- 137 - Investigation of the fire blight resistance cascade triggered by FB_MR5 using RNASeq in transgenic 'Gala Galaxy'
Bag Bag wfc Bag wfc wfc Terw Gerw Gerw Ghum Terw Gerw vs vs vs Ghum(A) Ghum(B) Ghum(C) Means Terw(A) Terw(B) Terw(C) Means Gerw(A) Gerw(B) Gerw(C) Means Feature ID BIN Ghum Ghum Terw RPKM RPKM RPKM RPKM RPKM RPKM RPKM RPKM RPKM RPKM RPKM RPKM Kost_et_al_contig_3055 11.1.1.1 -1.38 1.24 1.72 101.24 120.86 59.21 93.77 73.57 74.05 72.63 73.42 116.39 129.79 110.71 118.96 Kost_et_al_contig_143 12.2.2 -2.17 -1.03 2.10 652.05 687.98 689.02 676.35 362.24 235.55 416.24 338.01 646.08 717.24 633.33 665.55 Kost_et_al_contig_356 12.2.2 -3.17 -1.61 1.97 792.46 845.71 898.34 845.51 269.00 298.60 295.29 287.63 522.13 540.89 542.31 535.11 Kost_et_al_contig_1193 13.1.1.1.1 -1.63 1.70 2.77 35.23 58.69 51.27 48.40 41.50 15.98 38.72 32.07 94.56 85.12 71.56 83.75 Kost_et_al_contig_10035 13.1.5.1.1 -1.13 2.87 3.25 9.07 7.96 6.48 7.84 9.74 2.51 10.19 7.48 27.27 23.43 18.21 22.97 Kost_et_al_contig_106 13.2.5.2 -2.23 -1.28 1.75 606.35 688.28 524.19 606.27 303.79 267.92 307.78 293.17 456.91 504.93 490.33 484.06 Kost_et_al_contig_32 13.2.5.2 -2.55 -1.47 1.74 252.69 281.97 222.39 252.35 106.46 93.26 120.00 106.57 174.14 183.85 165.70 174.56 Kost_et_al_contig_1553 15.1 -6.12 -2.72 2.25 89.68 89.63 101.42 93.58 20.41 14.95 13.67 16.34 34.46 42.55 28.05 35.02 Kost_et_al_contig_10630 16.1.1.1 -1.22 2.21 2.69 8.12 11.34 11.71 10.39 10.87 7.83 8.81 9.17 29.48 20.59 20.14 23.40 Kost_et_al_contig_16582 16.1.1.1 1.10 1.95 1.77 40.22 53.07 44.58 45.96 59.44 54.07 48.76 54.09 109.25 84.29 80.10 91.22 Kost_et_al_contig_15010 16.1.4.1 -1.55 1.29 2.01 42.22 39.45 49.89 43.85 28.52 29.45 33.30 30.42 68.06 54.50 50.40 57.65 Kost_et_al_contig_2397 16.8.3.1 1.03 3.20 3.09 107.72 119.16 75.35 100.74 116.95 52.45 172.24 113.88 279.10 402.78 301.58 327.82 Kost_et_al_contig_2103 16.8.4.3 -1.04 1.99 2.06 19.94 27.42 15.97 21.11 24.85 17.86 23.17 21.96 44.89 49.38 34.31 42.86 Kost_et_al_contig_20359 17.1.1.1.11 -3.19 -1.63 1.95 63.10 68.50 71.98 67.86 16.36 26.65 25.83 22.94 40.76 38.03 47.34 42.05 Kost_et_al_contig_19118 17.1.3 -1.51 1.80 2.72 20.37 26.22 31.67 26.08 22.14 16.70 16.49 18.44 55.46 42.85 44.86 47.72 Kost_et_al_contig_11404 17.6.1 2.16 -1.19 -2.58 10.93 9.08 10.34 10.12 18.28 27.54 24.94 23.59 8.65 9.75 7.51 8.64 Kost_et_al_contig_597 19.12 -2.29 -1.33 1.72 893.93 956.44 785.85 878.74 448.03 356.89 435.10 413.34 760.54 725.97 538.17 674.89 Kost_et_al_contig_6416 19.2 1.05 1.82 1.73 100.80 135.85 38.01 91.55 117.64 94.16 99.98 103.93 187.57 187.00 136.52 170.36 Kost_et_al_contig_403 2.1.1.3 -2.67 -1.28 2.09 347.12 362.45 335.68 348.42 127.58 91.69 207.11 142.13 269.67 289.55 271.12 276.78 Kost_et_al_contig_3670 2.2.2.1.2 2.13 3.41 1.60 115.20 132.90 63.69 103.93 224.89 224.69 268.36 239.31 334.95 362.87 381.40 359.74 Kost_et_al_contig_4897 2.2.2.1.2 -1.29 1.72 2.22 46.23 45.39 33.61 41.74 40.52 37.44 25.92 34.63 80.22 68.46 70.08 72.92 Kost_et_al_contig_1735 20.1 2.21 1.26 -1.76 42.15 34.42 60.51 45.70 104.62 117.83 103.07 108.51 53.17 53.01 68.34 58.17 Kost_et_al_contig_2186 20.1 -1.82 -4.40 -2.42 55.97 55.18 60.09 57.08 34.21 38.75 27.70 33.55 10.42 14.32 14.56 13.10 Kost_et_al_contig_37435 20.1 48.58 15.53 -3.13 1.86 0.82 4.03 2.24 125.26 126.68 97.06 116.33 30.57 32.40 42.06 35.01 Kost_et_al_contig_22580 20.1.7 -1.68 -4.65 -2.77 156.24 109.17 70.21 111.87 65.22 66.90 83.88 72.00 14.68 28.11 30.14 24.31
- 138 - Chapter 3)
Bag Bag wfc Bag wfc wfc Terw Gerw Gerw Ghum Terw Gerw vs vs vs Ghum(A) Ghum(B) Ghum(C) Means Terw(A) Terw(B) Terw(C) Means Gerw(A) Gerw(B) Gerw(C) Means Feature ID BIN Ghum Ghum Terw RPKM RPKM RPKM RPKM RPKM RPKM RPKM RPKM RPKM RPKM RPKM RPKM Kost_et_al_contig_22134 20.2.1 1.72 -1.45 -2.48 11.13 8.12 31.69 16.98 34.33 29.91 29.18 31.14 13.54 8.88 13.13 11.85 Kost_et_al_contig_13624 20.2.2 -13.93 -3.17 4.40 57.06 47.24 35.90 46.73 4.32 2.01 4.58 3.63 14.06 16.69 14.26 15.00 Kost_et_al_contig_3221 24 -16.41 -3.38 4.86 98.95 93.09 119.38 103.81 13.21 2.16 4.82 6.73 38.39 34.56 21.17 31.37 Kost_et_al_contig_467 24.2 -1.77 -1.04 1.70 76.79 81.11 67.61 75.17 45.82 48.73 42.37 45.64 79.92 79.11 62.20 73.74 Kost_et_al_contig_43848 26.10 74.12 18.61 -3.98 0.27 0.28 0.27 0.27 21.58 26.94 17.21 21.91 5.48 6.81 3.42 5.24 Kost_et_al_contig_12431 26.11 -1.26 1.51 1.90 32.61 36.50 33.54 34.22 33.49 23.04 31.59 29.38 51.78 52.38 53.85 52.67 Kost_et_al_contig_9822 26.12 7.08 -1.15 -8.12 2.41 1.77 1.73 1.97 13.48 19.70 11.86 15.01 1.07 2.00 2.12 1.73 Kost_et_al_contig_52332 26.16 118.17 37.20 -3.18 0.26 0.35 0.59 0.40 55.23 51.84 44.98 50.69 20.03 12.78 12.66 15.15 Kost_et_al_contig_23483 26.21 9.74 22.95 2.35 2.05 3.91 0.48 2.14 19.62 18.23 30.02 22.62 47.72 43.47 58.11 49.77 Kost_et_al_contig_30208 26.22 -1.80 2.50 4.51 4.64 6.77 9.36 6.92 4.64 0.64 7.26 4.18 21.33 15.76 15.81 17.64 Kost_et_al_contig_1028 26.23 -1.63 1.07 1.75 131.35 164.60 130.19 142.04 75.32 93.14 114.58 94.35 151.85 147.26 164.07 154.39 Kost_et_al_contig_5823 26.23 -1.65 1.43 2.36 33.50 46.54 35.62 38.55 25.45 18.79 31.25 25.16 58.55 59.04 50.81 56.13 Kost_et_al_contig_6281 26.30 -2.67 -1.33 2.01 209.32 218.81 159.62 195.91 92.15 87.01 55.80 78.32 166.32 166.82 119.30 150.81 Kost_et_al_contig_615 26.7 -3.01 -1.51 1.99 166.08 197.26 158.46 173.93 61.96 67.52 56.57 62.01 129.82 108.16 112.97 116.98 Kost_et_al_contig_670 27.2 -3.01 -1.23 2.44 175.13 219.65 185.06 193.28 72.86 55.28 79.92 69.35 179.08 175.92 125.73 160.24 Kost_et_al_contig_2160 27.3.16 -1.75 1.12 1.96 32.24 36.08 28.59 32.30 22.69 15.89 20.96 19.85 38.47 38.25 33.88 36.87 Kost_et_al_contig_225 27.3.26 -4.63 -40.66 -8.78 5'099.63 2'605.07 457.80 2'720.83 515.34 530.85 875.90 640.70 21.40 109.81 72.03 67.75 Kost_et_al_contig_6859 27.3.7 4.42 2.34 -1.89 38.55 40.90 25.77 35.07 140.62 179.09 182.47 167.39 67.31 85.20 97.08 83.20 Kost_et_al_contig_280 27.3.99 -2.30 -1.49 1.54 216.15 172.36 194.34 194.28 89.60 97.27 85.46 90.78 147.96 120.97 128.87 132.60 Kost_et_al_contig_485 27.3.99 -1.52 -2.95 -1.94 68.44 84.74 149.85 101.01 71.95 59.13 83.91 71.66 28.33 40.31 35.29 34.64 Kost_et_al_contig_1844 28.1 -2.65 -1.61 1.65 297.15 242.61 240.78 260.18 106.48 123.13 85.82 105.14 182.58 155.73 155.25 164.52 Kost_et_al_contig_4898 28.1 -1.40 1.11 1.56 74.85 82.54 63.48 73.62 53.17 62.73 53.73 56.55 78.81 95.20 76.07 83.36 Kost_et_al_contig_11 28.99 1.82 1.20 -1.51 55.56 49.62 47.18 50.79 105.29 86.65 106.43 99.46 66.63 69.21 50.89 62.24 Kost_et_al_contig_4080 29.2.1.1.3.1.1 -1.33 1.31 1.73 127.08 135.21 128.88 130.39 106.93 77.79 134.76 106.50 186.19 170.92 162.62 173.24 Kost_et_al_contig_1976 29.2.3 1.81 1.09 -1.66 91.97 77.68 78.81 82.82 170.33 143.06 171.52 161.64 98.40 100.55 76.84 91.93
- 139 - Investigation of the fire blight resistance cascade triggered by FB_MR5 using RNASeq in transgenic 'Gala Galaxy'
Bag Bag wfc Bag wfc wfc Terw Gerw Gerw Ghum Terw Gerw vs vs vs Ghum(A) Ghum(B) Ghum(C) Means Terw(A) Terw(B) Terw(C) Means Gerw(A) Gerw(B) Gerw(C) Means Feature ID BIN Ghum Ghum Terw RPKM RPKM RPKM RPKM RPKM RPKM RPKM RPKM RPKM RPKM RPKM RPKM Kost_et_al_contig_6126 29.2.3 1.50 1.04 -1.44 134.84 114.95 98.84 116.21 190.77 183.62 188.75 187.72 125.46 126.56 117.07 123.03 Kost_et_al_contig_11347 29.2.4 1.91 1.10 -1.73 50.86 47.24 52.19 50.10 106.41 85.39 117.56 103.12 59.28 65.29 44.22 56.26 Kost_et_al_contig_14154 29.2.4 1.52 -1.10 -1.67 51.69 46.93 52.88 50.50 77.97 78.81 91.97 82.92 50.47 53.60 36.37 46.81 Kost_et_al_contig_2062 29.2.4 3.75 1.58 -2.38 71.79 54.18 62.59 62.85 243.38 217.71 302.01 254.37 118.06 98.98 85.67 100.90 Kost_et_al_contig_2664 29.2.4 2.40 1.24 -1.93 227.63 182.76 188.82 199.74 477.51 460.14 617.98 518.54 274.95 271.26 212.28 252.83 Kost_et_al_contig_6296 29.3 1.03 1.43 1.38 105.88 114.68 89.81 103.46 109.53 120.81 115.44 115.26 150.81 157.27 143.07 150.38 Kost_et_al_contig_11872 29.3.2 2.99 1.60 -1.87 25.90 22.57 23.92 24.13 65.34 75.81 92.75 77.97 43.30 38.29 36.21 39.27 Kost_et_al_contig_8113 29.3.2 2.95 1.30 -2.26 23.44 19.69 20.12 21.08 60.82 64.43 76.01 67.09 34.55 28.98 20.38 27.97 Kost_et_al_contig_12933 29.3.3 -1.66 1.13 1.88 73.74 77.60 69.76 73.70 45.61 57.74 39.80 47.72 82.50 82.64 89.75 84.97 Kost_et_al_contig_974 29.3.4.99 1.26 -1.04 -1.31 201.42 194.36 192.52 196.10 259.07 253.66 286.22 266.32 208.25 190.49 176.85 191.86 Kost_et_al_contig_12085 29.4 2.85 6.02 2.11 16.84 15.06 14.18 15.36 46.90 42.54 52.10 47.18 99.76 86.46 95.23 93.82 Kost_et_al_contig_15395 29.5 1.83 -1.44 -2.64 28.62 23.48 38.60 30.23 62.77 62.52 52.48 59.26 19.55 28.22 16.25 21.34 Kost_et_al_contig_9781 29.5 -1.77 1.65 2.91 14.40 16.37 19.41 16.73 12.39 8.90 9.14 10.14 27.97 26.20 29.58 27.92 Kost_et_al_contig_6612 29.5.11.20 1.53 1.05 -1.45 64.60 65.23 71.50 67.11 111.06 106.79 113.66 110.51 72.28 72.92 70.56 71.92 Kost_et_al_contig_548 29.5.4 -3.90 -1.39 2.81 71.85 70.43 114.28 85.52 28.76 16.12 25.85 23.58 69.89 55.41 62.34 62.55 Kost_et_al_contig_1655 29.6 -5.81 -1.46 3.99 33.92 58.21 65.75 52.63 9.72 2.83 17.20 9.92 45.77 31.52 33.02 36.77 Kost_et_al_contig_1656 29.6 -4.75 -1.86 2.56 79.30 87.36 97.86 88.18 16.72 19.12 24.43 20.09 51.15 46.15 47.40 48.24 Kost_et_al_contig_2016 29.6 -4.29 -1.81 2.37 337.65 378.51 308.30 341.48 93.31 44.41 122.12 86.61 189.12 190.54 195.70 191.79 Kost_et_al_contig_3288 29.7 2.39 1.16 -2.06 16.01 14.24 16.47 15.58 43.70 37.10 39.25 40.02 18.56 22.73 13.78 18.35 Kost_et_al_contig_11424 29.8 1.20 1.62 1.35 118.41 134.87 40.75 98.01 127.12 118.25 137.20 127.52 156.95 152.18 175.25 161.46 Kost_et_al_contig_7815 3.1.2.2 -4.44 -1.50 2.95 35.25 48.95 36.04 40.08 12.49 8.44 8.00 9.65 27.80 32.73 20.91 27.15 Kost_et_al_contig_7071 3.4.3 2.57 3.83 1.49 30.04 30.97 22.74 27.92 76.72 85.78 68.13 76.88 107.46 117.43 101.69 108.86 Kost_et_al_contig_10599 30.2.99 2.12 1.09 -1.95 19.10 17.85 14.14 17.03 33.37 45.59 37.78 38.91 16.38 23.86 16.59 18.94 Kost_et_al_contig_1429 30.5 -2.12 -1.11 1.91 120.06 147.88 135.40 134.45 73.82 51.41 79.86 68.36 137.57 122.65 108.67 122.96 Kost_et_al_contig_3950 30.7 1.61 1.02 -1.57 230.31 193.23 206.37 209.97 308.29 402.25 383.72 364.75 212.23 207.90 233.09 217.74
- 140 - Chapter 3)
Bag Bag wfc Bag wfc wfc Terw Gerw Gerw Ghum Terw Gerw vs vs vs Ghum(A) Ghum(B) Ghum(C) Means Terw(A) Terw(B) Terw(C) Means Gerw(A) Gerw(B) Gerw(C) Means Feature ID BIN Ghum Ghum Terw RPKM RPKM RPKM RPKM RPKM RPKM RPKM RPKM RPKM RPKM RPKM RPKM Kost_et_al_contig_263 31.1 -1.83 1.11 2.03 70.61 78.44 84.86 77.97 37.54 56.49 43.42 45.82 94.13 87.31 82.78 88.07 Kost_et_al_contig_2385 31.1.1.1.1 1.80 1.12 -1.60 219.00 192.53 225.48 212.34 450.13 369.93 412.40 410.82 270.11 263.06 197.39 243.52 Kost_et_al_contig_13242 31.4 1.84 -1.31 -2.41 24.55 22.77 28.48 25.27 44.58 59.18 46.28 50.01 19.20 22.66 17.14 19.67 Kost_et_al_contig_13211 33.99 3.92 1.92 -2.04 9.24 5.87 9.92 8.34 35.49 40.17 29.18 34.95 16.24 19.55 13.29 16.36 Kost_et_al_contig_1419 33.99 -4.70 -1.79 2.62 82.34 83.40 78.64 81.46 19.42 25.03 11.06 18.50 57.16 44.24 37.39 46.27 Kost_et_al_contig_3781 33.99 4.04 -1.03 -4.17 11.30 7.30 6.66 8.42 36.54 25.74 48.10 36.80 5.65 11.97 7.25 8.29 Kost_et_al_contig_5273 33.99 -2.24 -1.10 2.03 73.35 85.70 83.22 80.76 40.05 31.52 44.77 38.78 89.59 70.22 63.90 74.57 Kost_et_al_contig_5333 34.12 -1.69 1.21 2.05 26.73 28.77 31.84 29.11 18.02 21.00 16.19 18.40 38.72 36.32 32.64 35.89 Kost_et_al_contig_8098 34.12 11.42 2.39 -4.78 3.46 2.03 4.89 3.46 45.70 37.32 44.31 42.44 9.66 9.05 6.57 8.43 Kost_et_al_contig_14661 34.13 -1.61 -11.94 -7.43 21.11 21.51 32.54 25.05 17.35 17.30 15.73 16.79 1.35 3.38 1.69 2.14 Kost_et_al_contig_2002 34.13 2.43 1.48 -1.64 51.46 56.21 59.57 55.74 154.69 153.89 126.86 145.15 96.16 76.84 78.65 83.89 Kost_et_al_contig_20516 34.13 -1.28 -10.33 -8.07 20.93 20.30 24.92 22.05 19.84 19.36 16.11 18.44 2.41 2.18 1.93 2.17 Kost_et_al_contig_3784 34.13 -1.63 -12.48 -7.66 22.84 20.95 35.58 26.46 18.78 19.93 13.19 17.30 1.89 2.80 1.79 2.16 Kost_et_al_contig_119 34.19.1 1.77 1.13 -1.57 372.57 316.77 344.67 344.67 598.11 719.47 652.59 656.72 387.77 365.94 426.39 393.37 Kost_et_al_contig_120 34.19.1 2.01 1.46 -1.37 455.85 441.29 470.27 455.80 947.03 918.24 1'092.85 986.04 681.92 622.50 721.80 675.41 Kost_et_al_contig_41033 34.19.2 187.07 87.57 -2.14 1.44 2.99 1.41 1.95 340.38 351.87 495.04 395.76 157.82 148.71 210.88 172.47 Kost_et_al_contig_10264 34.2 1.55 -1.06 -1.64 34.44 39.53 48.49 40.82 63.39 74.31 66.34 68.01 35.32 44.85 37.26 39.14 Kost_et_al_contig_9326 34.2 -1.92 1.20 2.29 35.30 41.33 52.60 43.08 27.09 23.57 21.59 24.08 58.10 52.85 46.64 52.53 Kost_et_al_contig_13554 35.1 11.24 3.37 -3.34 2.22 2.55 3.21 2.66 27.86 38.38 29.97 32.07 10.42 7.31 9.50 9.08 Kost_et_al_contig_14502 35.1 -2.18 1.05 2.28 26.79 31.82 29.70 29.43 15.99 14.52 12.82 14.45 34.13 29.87 29.99 31.33 Kost_et_al_contig_17933 35.1 -1.03 2.33 2.41 12.11 12.94 9.95 11.67 12.00 8.48 16.11 12.20 23.91 28.23 30.43 27.52 Kost_et_al_contig_2310 35.1 -2.87 -22.41 -7.81 73.76 73.60 86.03 77.80 19.37 38.69 29.60 29.22 2.53 5.58 2.54 3.55 Kost_et_al_contig_2613 35.1 -1.50 1.26 1.89 170.59 212.54 120.73 167.96 139.26 83.19 139.89 120.78 196.09 232.76 214.67 214.51 Kost_et_al_contig_4462 35.1 -1.17 2.03 2.37 33.31 38.28 50.33 40.64 40.28 30.18 41.80 37.42 92.05 92.81 66.79 83.89 Kost_et_al_contig_4463 35.1 -1.64 -1.02 1.60 159.11 164.72 200.02 174.62 102.06 126.61 115.87 114.85 188.25 179.36 155.04 174.22
- 141 - Investigation of the fire blight resistance cascade triggered by FB_MR5 using RNASeq in transgenic 'Gala Galaxy'
Bag Bag wfc Bag wfc wfc Terw Gerw Gerw Ghum Terw Gerw vs vs vs Ghum(A) Ghum(B) Ghum(C) Means Terw(A) Terw(B) Terw(C) Means Gerw(A) Gerw(B) Gerw(C) Means Feature ID BIN Ghum Ghum Terw RPKM RPKM RPKM RPKM RPKM RPKM RPKM RPKM RPKM RPKM RPKM RPKM Kost_et_al_contig_555 35.1 -2.25 -1.16 1.94 119.38 156.14 131.59 135.70 68.74 56.64 69.73 65.03 133.46 132.95 92.45 119.62 Kost_et_al_contig_5750 35.1 -1.90 1.25 2.38 70.07 88.91 51.99 70.32 56.11 26.34 36.68 39.71 99.36 99.28 70.62 89.75 Kost_et_al_contig_1357 35.1.14 -2.00 -1.09 1.83 89.29 102.19 99.19 96.89 50.48 45.12 61.09 52.23 97.23 89.14 84.72 90.36 Kost_et_al_contig_9581 35.1.41 1.80 -1.16 -2.09 36.94 30.20 38.27 35.14 57.91 81.95 63.84 67.90 31.97 28.87 31.39 30.74 Kost_et_al_contig_10985 35.2 -1.71 1.65 2.82 13.59 15.83 12.86 14.09 11.73 4.02 11.01 8.92 20.74 26.28 23.88 23.63 Kost_et_al_contig_1157 35.2 -1.43 1.79 2.56 476.58 437.87 877.93 597.46 522.70 332.31 490.20 448.40 1'131.16 1'010.85 1'102.46 1'081.49 Kost_et_al_contig_11610 35.2 -2.33 1.04 2.43 29.94 38.05 41.44 36.48 16.09 17.22 17.21 16.84 43.95 35.40 36.49 38.61 Kost_et_al_contig_11703 35.2 -1.64 1.09 1.80 55.08 63.83 71.90 63.60 44.16 42.90 37.31 41.46 72.35 78.98 61.11 70.81 Kost_et_al_contig_1254 35.2 -2.28 -1.34 1.70 404.45 427.86 375.84 402.72 195.34 141.23 237.94 191.50 295.90 344.54 279.98 306.80 Kost_et_al_contig_1256 35.2 -1.34 1.31 1.76 50.31 57.85 47.65 51.94 41.70 37.03 46.52 41.75 70.65 80.50 56.66 69.27 Kost_et_al_contig_1456 35.2 -1.91 -1.14 1.67 369.26 291.72 335.52 332.17 191.32 134.76 239.84 188.64 311.76 298.56 274.82 295.05 Kost_et_al_contig_1466 35.2 -4.60 -1.68 2.73 155.72 183.81 189.84 176.46 44.57 33.88 45.75 41.40 123.48 115.98 82.11 107.19 Kost_et_al_contig_16237 35.2 4.46 -1.49 -6.66 13.66 16.09 4.67 11.47 48.21 44.96 73.61 55.59 4.29 6.82 12.10 7.74 Kost_et_al_contig_1630 35.2 -1.75 -1.21 1.45 741.55 771.52 655.57 722.88 407.44 384.86 546.43 446.24 580.39 622.76 623.47 608.87 Kost_et_al_contig_18868 35.2 -1.37 1.48 2.03 21.15 26.53 19.69 22.46 20.55 12.84 19.66 17.68 33.17 31.85 36.29 33.77 Kost_et_al_contig_20893 35.2 -5.48 -1.33 4.12 19.09 22.97 17.56 19.87 4.23 2.05 5.57 3.95 13.62 20.28 11.72 15.21 Kost_et_al_contig_2229 35.2 1.52 -1.56 -2.36 23.59 23.68 30.26 25.84 35.06 47.12 44.70 42.29 17.55 16.23 16.84 16.88 Kost_et_al_contig_2545 35.2 -5.32 -1.72 3.09 27.83 33.94 31.89 31.22 7.41 4.15 7.45 6.34 17.54 19.93 17.75 18.40 Kost_et_al_contig_255 35.2 -9.52 -4.95 1.92 2'271.58 1'655.39 306.74 1'411.24 131.56 153.91 196.91 160.79 256.90 311.87 300.51 289.76 Kost_et_al_contig_2696 35.2 -1.13 -1.66 -1.46 215.88 185.75 237.57 213.07 211.16 200.37 196.90 202.81 111.00 136.06 143.64 130.23 Kost_et_al_contig_2712 35.2 1.41 -1.35 -1.90 53.66 45.28 62.21 53.72 66.12 83.31 95.01 81.48 35.62 36.67 48.65 40.31 Kost_et_al_contig_28 35.2 -1.66 -1.10 1.51 537.68 572.89 517.21 542.59 350.88 303.11 406.74 353.58 475.25 529.26 499.04 501.19 Kost_et_al_contig_28253 35.2 13.20 -2.20 -29.07 0.27 0.28 1.34 0.63 8.69 12.29 5.68 8.89 0.22 0.56 0.10 0.29 Kost_et_al_contig_28671 35.2 -2.23 -1.10 2.03 49.65 45.09 53.33 49.36 16.02 28.36 27.10 23.83 47.93 37.66 50.48 45.36 Kost_et_al_contig_3139 35.2 1.80 1.24 -1.45 77.45 76.22 84.53 79.40 160.42 145.80 155.45 153.89 112.21 98.87 89.43 100.17
- 142 - Chapter 3)
Bag Bag wfc Bag wfc wfc Terw Gerw Gerw Ghum Terw Gerw vs vs vs Ghum(A) Ghum(B) Ghum(C) Means Terw(A) Terw(B) Terw(C) Means Gerw(A) Gerw(B) Gerw(C) Means Feature ID BIN Ghum Ghum Terw RPKM RPKM RPKM RPKM RPKM RPKM RPKM RPKM RPKM RPKM RPKM RPKM Kost_et_al_contig_3169 35.2 1.06 1.82 1.71 96.61 84.55 117.02 99.39 102.17 104.77 135.58 114.17 183.51 201.24 166.75 183.83 Kost_et_al_contig_35645 35.2 13.29 2.60 -5.11 2.24 1.36 3.64 2.41 35.86 29.53 38.05 34.48 6.63 6.67 5.79 6.37 Kost_et_al_contig_3615 35.2 1.26 -1.55 -1.95 53.49 40.76 47.83 47.36 57.39 75.03 60.45 64.29 32.34 26.26 34.29 30.96 Kost_et_al_contig_40992 35.2 67.21 1.50 -44.81 0.14 0.15 0.07 0.12 10.08 7.42 8.41 8.63 0.23 0.24 0.08 0.19 Kost_et_al_contig_4131 35.2 -1.78 -1.04 1.72 105.77 114.04 165.81 128.54 90.65 54.55 87.85 77.68 132.82 124.28 120.94 126.01 Kost_et_al_contig_4274 35.2 -1.86 -1.09 1.70 63.43 73.11 71.56 69.37 35.57 44.40 40.26 40.08 68.29 70.73 54.44 64.49 Kost_et_al_contig_4318 35.2 -1.20 1.20 1.44 92.42 104.20 71.87 89.50 78.02 72.02 91.49 80.51 113.54 106.57 107.88 109.33 Kost_et_al_contig_4431 35.2 -1.27 1.46 1.84 29.82 42.25 44.27 38.78 33.72 35.09 29.74 32.85 60.68 59.75 52.10 57.51 Kost_et_al_contig_4439 35.2 -3.13 -1.45 2.15 55.42 71.38 64.23 63.67 21.64 15.20 29.28 22.04 46.99 43.95 42.69 44.54 Kost_et_al_contig_4781 35.2 -3.65 -1.34 2.72 31.42 36.07 29.24 32.25 11.09 8.70 8.63 9.48 26.56 27.79 19.37 24.57 Kost_et_al_contig_5001 35.2 -1.47 -2.71 -1.85 172.76 167.20 224.73 188.23 134.97 138.80 141.16 138.31 57.09 86.62 67.52 70.41 Kost_et_al_contig_59360 35.2 139.28 50.39 -2.76 0.00 0.05 0.35 0.13 17.90 24.85 16.47 19.74 7.63 5.72 6.96 6.77 Kost_et_al_contig_617 35.2 -1.94 -1.13 1.72 297.82 315.69 325.07 312.86 171.49 167.13 182.61 173.75 288.19 285.06 273.80 282.35 Kost_et_al_contig_6781 35.2 -1.86 1.15 2.13 24.38 29.36 31.12 28.29 17.04 15.48 16.61 16.38 31.43 38.32 29.28 33.01 Kost_et_al_contig_6913 35.2 -3.10 -1.27 2.45 57.65 71.57 56.23 61.82 19.27 20.25 25.14 21.55 48.40 49.69 51.00 49.70 Kost_et_al_contig_7149 35.2 -2.18 -1.24 1.75 140.70 144.56 141.35 142.20 77.42 76.65 55.72 69.93 135.39 110.44 103.74 116.52 Kost_et_al_contig_7520 35.2 -1.84 1.65 3.03 21.09 30.32 32.41 27.94 21.41 7.60 20.25 16.42 49.80 44.64 45.99 46.81 Kost_et_al_contig_7911 35.2 -1.03 -1.90 -1.85 36.85 34.64 54.96 42.15 46.81 47.99 36.16 43.65 19.82 23.00 24.35 22.39 Kost_et_al_contig_7986 35.2 -2.55 -11.90 -4.66 55.64 113.08 83.94 84.22 29.70 37.39 39.96 35.68 6.10 8.95 6.58 7.21 Kost_et_al_contig_8072 35.2 -3.82 -1.96 1.95 78.97 93.81 65.99 79.59 26.19 16.44 24.73 22.45 37.05 48.57 38.40 41.34 Kost_et_al_contig_817 35.2 2.21 4.04 1.83 103.69 80.94 90.68 91.77 213.19 240.79 199.63 217.87 422.76 332.09 374.43 376.43 Kost_et_al_contig_2142 4.1.8 5.12 2.97 -1.72 156.75 137.40 167.33 153.83 751.66 894.45 898.44 848.18 468.92 473.82 449.41 464.05 Kost_et_al_contig_2719 4.1.9 -1.11 1.16 1.29 569.47 587.16 502.99 553.21 540.33 552.43 516.02 536.26 636.49 707.71 610.63 651.61 Kost_et_al_contig_735 4.1.9 -1.34 1.12 1.50 333.76 357.59 303.21 331.52 282.90 227.72 292.03 267.55 357.27 413.99 362.66 377.97 Kost_et_al_contig_1147 4.3.12 -2.34 -1.13 2.08 52.55 62.68 53.98 56.41 25.06 30.70 21.54 25.76 56.94 51.02 45.23 51.06
- 143 - Investigation of the fire blight resistance cascade triggered by FB_MR5 using RNASeq in transgenic 'Gala Galaxy'
Bag Bag wfc Bag wfc wfc Terw Gerw Gerw Ghum Terw Gerw vs vs vs Ghum(A) Ghum(B) Ghum(C) Means Terw(A) Terw(B) Terw(C) Means Gerw(A) Gerw(B) Gerw(C) Means Feature ID BIN Ghum Ghum Terw RPKM RPKM RPKM RPKM RPKM RPKM RPKM RPKM RPKM RPKM RPKM RPKM Kost_et_al_contig_4934 7.1.3 -1.32 1.03 1.36 181.79 187.60 197.62 189.00 147.74 153.92 162.60 154.76 203.03 208.43 184.69 198.72 Kost_et_al_contig_1503 7.2.4 -1.56 1.08 1.68 146.61 138.86 129.50 138.32 103.64 71.55 112.57 95.92 145.69 160.01 148.37 151.35 Kost_et_al_contig_1504 7.2.4 -1.57 1.20 1.89 169.21 198.11 188.88 185.40 138.59 80.84 163.59 127.67 227.67 227.71 223.16 226.18 Kost_et_al_contig_5055 8.1.1.1 3.22 2.06 -1.56 33.11 33.76 27.65 31.51 109.88 109.95 108.35 109.40 69.17 74.54 54.58 66.10 Kost_et_al_contig_2470 8.2.11 -1.27 1.26 1.60 271.10 292.05 218.73 260.63 225.25 212.79 227.02 221.69 310.95 382.81 312.38 335.38 Kost_et_al_contig_16962 8.2.9 4.47 2.29 -1.96 21.43 16.93 13.45 17.27 81.82 77.47 90.66 83.32 39.97 43.39 37.15 40.17 Kost_et_al_contig_199 8.3 -3.48 -1.29 2.69 851.79 1'031.91 959.22 947.64 379.77 108.66 399.13 295.85 883.09 701.76 659.06 747.97 Kost_et_al_contig_456 8.3 -12.78 -2.50 5.10 4'069.53 4'948.76 5'421.97 4'813.42 491.66 93.76 649.66 411.69 2'161.90 1'892.37 1'811.96 1'955.41 Kost_et_al_contig_881 8.3 -9.66 -1.95 4.95 346.99 433.59 438.72 406.43 50.36 10.61 77.49 46.15 238.45 202.77 194.76 212.00
- 144 - Chapter 3)
Supplementary table 3) Summary of all 206 differentially expressed transcripts (with FDR < 0.01) part 2 of 3. Baggerly’s p-value (Bag pvalue), transgenic line T41D (T), inoculated by E. amylovora (erw), 'Gala Galaxy' (G), after high humidity treatment (hum), reads per kilobase of transcript per million mapped reads (RPKM). False discovery rate (FDR). Bonferroni corrected p-value (bonf).
Bag Bag Bag Bag Bag Bag Bag Bag Bag pvalue FDR bonf pvalue FDR bonf pvalue FDR bonf Terw vs Terw vs Terw vs Gerw vs Gerw vs Gerw vs Gerw vs Gerw vs Gerw vs Feature ID Ghum Ghum Ghum Ghum Ghum Ghum Terw Terw Terw Kost_et_al_contig_10778 7.86E-9 1.03E-6 6.09E-4 0.41 1.00 1.00 5.25E-7 3.77E-4 0.04 Kost_et_al_contig_1109 2.34E-11 4.83E-9 1.81E-6 0.87 1.00 1.00 1.82E-6 1.08E-3 0.14 Kost_et_al_contig_1110 1.06E-20 6.45E-18 8.19E-16 0.32 1.00 1.00 0.00 0.00 0.00 Kost_et_al_contig_3310 0.66 1.00 1.00 2.02E-11 4.32E-9 1.57E-6 2.70E-9 3.23E-6 2.10E-4 Kost_et_al_contig_4147 0.29 1.00 1.00 1.83E-3 0.04 1.00 1.07E-6 6.87E-4 0.08 Kost_et_al_contig_468 1.03E-3 0.02 1.00 4.73E-4 0.01 1.00 0.00 0.00 0.00 Kost_et_al_contig_901 0.50 1.00 1.00 0.00 0.00 0.00 4.71E-6 2.37E-3 0.37 Kost_et_al_contig_130 4.65E-21 2.89E-18 3.61E-16 3.64E-3 0.07 1.00 0.00 0.00 0.00 Kost_et_al_contig_15 4.83E-101 6.80E-98 3.74E-96 1.28E-3 0.03 1.00 1.10E-10 1.95E-7 8.56E-6 Kost_et_al_contig_16 6.68E-18 3.34E-15 5.18E-13 0.02 0.21 1.00 2.69E-9 3.23E-6 2.08E-4 Kost_et_al_contig_71 4.76E-8 5.17E-6 3.69E-3 3.65E-3 0.07 1.00 0.00 0.00 0.00 Kost_et_al_contig_1170 0.12 0.72 1.00 0.02 0.28 1.00 0.00 0.00 0.00 Kost_et_al_contig_1232 7.86E-6 4.59E-4 0.61 0.54 1.00 1.00 2.95E-10 4.98E-7 2.29E-5 Kost_et_al_contig_1392 0.07 0.51 1.00 2.63E-4 8.66E-3 1.00 2.38E-6 1.36E-3 0.18 Kost_et_al_contig_1636 0.34 1.00 1.00 3.01E-5 1.43E-3 1.00 4.07E-11 7.88E-8 3.15E-6 Kost_et_al_contig_2366 8.34E-3 0.12 1.00 2.52E-4 8.37E-3 1.00 0.00 0.00 0.00 Kost_et_al_contig_1592 8.35E-4 0.02 1.00 0.51 1.00 1.00 1.09E-6 6.91E-4 0.08 Kost_et_al_contig_1858 1.60E-26 1.32E-23 1.24E-21 7.83E-11 1.49E-8 6.08E-6 0.00 0.00 0.00 Kost_et_al_contig_1156 1.15E-13 3.42E-11 8.95E-9 2.45E-3 0.05 1.00 4.66E-15 1.64E-11 3.62E-10 Kost_et_al_contig_4955 3.38E-16 1.43E-13 2.62E-11 1.20E-4 4.56E-3 1.00 4.17E-6 2.18E-3 0.32 Kost_et_al_contig_326 6.12E-12 1.36E-9 4.74E-7 1.34E-4 5.01E-3 1.00 1.89E-12 4.20E-9 1.47E-7 Kost_et_al_contig_8081 1.54E-8 1.87E-6 1.20E-3 0.97 1.00 1.00 1.32E-8 1.33E-5 1.02E-3 Kost_et_al_contig_1079 1.39E-3 0.03 1.00 4.75E-3 0.09 1.00 2.68E-7 1.99E-4 0.02 Kost_et_al_contig_1080 0.02 0.22 1.00 8.38E-4 0.02 1.00 2.65E-6 1.48E-3 0.21 Kost_et_al_contig_601 1.14E-28 1.01E-25 8.85E-24 1.03E-9 1.61E-7 8.00E-5 4.06E-14 1.26E-10 3.15E-9 Kost_et_al_contig_454 4.35E-19 2.38E-16 3.37E-14 5.95E-20 2.98E-17 4.62E-15 8.79E-6 4.11E-3 0.68 Kost_et_al_contig_387 1.77E-6 1.29E-4 0.14 0.85 1.00 1.00 3.21E-8 3.00E-5 2.49E-3 Kost_et_al_contig_1300 3.67E-9 5.12E-7 2.85E-4 0.04 0.41 1.00 1.59E-9 2.15E-6 1.24E-4 Kost_et_al_contig_455 6.46E-5 2.71E-3 1.00 0.72 1.00 1.00 6.58E-6 3.15E-3 0.51 Kost_et_al_contig_400 2.94E-3 0.06 1.00 0.25 1.00 1.00 8.93E-8 7.45E-5 6.92E-3 Kost_et_al_contig_622 1.11E-10 2.02E-8 8.57E-6 0.75 1.00 1.00 4.93E-6 2.45E-3 0.38 Kost_et_al_contig_552 7.88E-24 5.82E-21 6.11E-19 5.54E-3 0.10 1.00 0.00 0.00 0.00 Kost_et_al_contig_174 1.30E-22 9.14E-20 1.01E-17 3.31E-5 1.55E-3 1.00 0.00 0.00 0.00 Kost_et_al_contig_2936 1.48E-9 2.23E-7 1.15E-4 0.45 1.00 1.00 2.36E-7 1.79E-4 0.02 Kost_et_al_contig_661 1.41E-3 0.03 1.00 1.09E-3 0.03 1.00 5.83E-7 4.15E-4 0.05 Kost_et_al_contig_662 4.69E-13 1.25E-10 3.64E-8 8.73E-3 0.14 1.00 5.32E-13 1.29E-9 4.13E-8 Kost_et_al_contig_1375 6.05E-111 8.69E-108 4.69E-106 2.28E-28 1.56E-25 1.76E-23 5.95E-10 9.04E-7 4.61E-5 Kost_et_al_contig_1527 5.71E-23 4.14E-20 4.42E-18 1.34E-6 1.00E-4 0.10 0.00 0.00 0.00 - 145 - Investigation of the fire blight resistance cascade triggered by FB_MR5 using RNASeq
Bag Bag Bag Bag Bag Bag Bag Bag Bag pvalue FDR bonf pvalue FDR bonf pvalue FDR bonf Terw vs Terw vs Terw vs Gerw vs Gerw vs Gerw vs Gerw vs Gerw vs Gerw vs Feature ID Ghum Ghum Ghum Ghum Ghum Ghum Terw Terw Terw Kost_et_al_contig_1528 6.18E-10 9.86E-8 4.79E-5 2.02E-4 7.03E-3 1.00 0.00 0.00 0.00 Kost_et_al_contig_4433 5.05E-16 2.07E-13 3.92E-11 1.34E-4 5.02E-3 1.00 5.07E-13 1.27E-9 3.93E-8 Kost_et_al_contig_2546 1.25E-3 0.03 1.00 1.04E-4 4.07E-3 1.00 3.63E-8 3.31E-5 2.82E-3 Kost_et_al_contig_2547 6.18E-5 2.61E-3 1.00 0.67 1.00 1.00 1.26E-5 5.45E-3 0.97 Kost_et_al_contig_6084 0.00 0.00 0.00 4.40E-5 1.96E-3 1.00 2.54E-7 1.91E-4 0.02 Kost_et_al_contig_134 0.04 0.36 1.00 3.44E-5 1.60E-3 1.00 1.00E-5 4.59E-3 0.78 Kost_et_al_contig_49392 0.00 0.00 0.00 0.23 1.00 1.00 3.06E-18 1.25E-14 2.38E-13 Kost_et_al_contig_603 1.81E-8 2.16E-6 1.40E-3 1.15E-10 2.14E-8 8.92E-6 9.78E-15 3.30E-11 7.59E-10 Kost_et_al_contig_15854 0.04 0.38 1.00 1.19E-4 4.53E-3 1.00 5.59E-9 6.19E-6 4.33E-4 Kost_et_al_contig_3055 0.18 0.89 1.00 0.24 1.00 1.00 2.35E-10 4.04E-7 1.82E-5 Kost_et_al_contig_143 5.42E-15 1.94E-12 4.20E-10 0.35 1.00 1.00 7.69E-13 1.81E-9 5.96E-8 Kost_et_al_contig_356 2.31E-78 3.15E-75 1.79E-73 4.63E-23 2.62E-20 3.59E-18 0.00 0.00 0.00 Kost_et_al_contig_1193 0.07 0.51 1.00 1.93E-4 6.78E-3 1.00 2.27E-8 2.20E-5 1.76E-3 Kost_et_al_contig_10035 0.74 1.00 1.00 3.77E-6 2.50E-4 0.29 1.12E-5 4.98E-3 0.87 Kost_et_al_contig_106 7.65E-11 1.47E-8 5.93E-6 0.01 0.17 1.00 0.00 0.00 0.00 Kost_et_al_contig_32 1.51E-15 5.87E-13 1.17E-10 4.23E-5 1.91E-3 1.00 4.97E-14 1.48E-10 3.86E-9 Kost_et_al_contig_1553 5.20E-39 6.20E-36 4.03E-34 2.95E-18 1.40E-15 2.29E-13 1.57E-5 6.60E-3 1.00 Kost_et_al_contig_10630 0.46 1.00 1.00 2.30E-4 7.80E-3 1.00 1.18E-5 5.21E-3 0.92 Kost_et_al_contig_16582 0.42 1.00 1.00 6.23E-7 5.09E-5 0.05 7.98E-6 3.80E-3 0.62 Kost_et_al_contig_15010 1.22E-3 0.03 1.00 0.04 0.38 1.00 4.15E-7 3.04E-4 0.03 Kost_et_al_contig_2397 0.91 1.00 1.00 5.03E-9 6.82E-7 3.90E-4 2.02E-6 1.17E-3 0.16 Kost_et_al_contig_2103 0.86 1.00 1.00 7.69E-5 3.13E-3 1.00 5.61E-6 2.74E-3 0.44 Kost_et_al_contig_20359 8.33E-17 3.85E-14 6.46E-12 1.25E-5 6.95E-4 0.97 1.65E-5 6.82E-3 1.00 Kost_et_al_contig_19118 0.03 0.27 1.00 4.36E-5 1.95E-3 1.00 6.68E-11 1.23E-7 5.18E-6 Kost_et_al_contig_11404 2.20E-4 7.33E-3 1.00 0.51 1.00 1.00 1.45E-5 6.14E-3 1.00 Kost_et_al_contig_597 1.74E-16 7.60E-14 1.35E-11 3.13E-3 0.06 1.00 1.10E-6 6.91E-4 0.09 Kost_et_al_contig_6416 0.87 1.00 1.00 0.02 0.24 1.00 2.40E-6 1.36E-3 0.19 Kost_et_al_contig_403 8.72E-14 2.61E-11 6.76E-9 9.62E-8 9.85E-6 7.46E-3 8.45E-7 5.70E-4 0.07 Kost_et_al_contig_3670 4.84E-7 4.15E-5 0.04 0.00 0.00 0.00 0.00 0.00 0.00 Kost_et_al_contig_4897 0.13 0.74 1.00 2.31E-6 1.64E-4 0.18 3.73E-9 4.31E-6 2.89E-4 Kost_et_al_contig_1735 3.61E-9 5.05E-7 2.80E-4 0.22 1.00 1.00 5.04E-8 4.39E-5 3.91E-3 Kost_et_al_contig_2186 1.58E-6 1.17E-4 0.12 5.75E-20 2.90E-17 4.46E-15 7.52E-7 5.16E-4 0.06 Kost_et_al_contig_37435 0.00 0.00 0.00 0.00 0.00 0.00 4.00E-10 6.33E-7 3.10E-5 Kost_et_al_contig_22580 0.08 0.54 1.00 5.53E-4 0.02 1.00 1.39E-9 1.92E-6 1.07E-4 Kost_et_al_contig_22134 0.13 0.74 1.00 0.49 1.00 1.00 1.23E-6 7.58E-4 0.10 Kost_et_al_contig_13624 3.46E-12 8.17E-10 2.68E-7 9.80E-7 7.60E-5 0.08 2.53E-6 1.42E-3 0.20 Kost_et_al_contig_3221 3.11E-31 2.96E-28 2.41E-26 6.02E-16 2.39E-13 4.67E-11 1.78E-5 7.22E-3 1.00 Kost_et_al_contig_467 1.22E-7 1.19E-5 9.45E-3 0.70 1.00 1.00 1.67E-6 1.01E-3 0.13 Kost_et_al_contig_43848 4.00E-15 1.46E-12 3.10E-10 2.93E-4 9.44E-3 1.00 9.10E-8 7.50E-5 7.05E-3 Kost_et_al_contig_12431 0.12 0.72 1.00 9.84E-4 0.03 1.00 1.15E-6 7.15E-4 0.09 Kost_et_al_contig_9822 3.83E-7 3.34E-5 0.03 0.82 1.00 1.00 1.68E-7 1.32E-4 0.01 Kost_et_al_contig_52332 0.00 0.00 0.00 7.57E-10 1.22E-7 5.87E-5 3.95E-13 1.02E-9 3.07E-8
- 146 - Chapter 3)
Bag Bag Bag Bag Bag Bag Bag Bag Bag pvalue FDR bonf pvalue FDR bonf pvalue FDR bonf Terw vs Terw vs Terw vs Gerw vs Gerw vs Gerw vs Gerw vs Gerw vs Gerw vs Feature ID Ghum Ghum Ghum Ghum Ghum Ghum Terw Terw Terw Kost_et_al_contig_23483 1.24E-8 1.55E-6 9.62E-4 0.00 0.00 0.00 2.56E-8 2.45E-5 1.99E-3 Kost_et_al_contig_30208 0.18 0.90 1.00 2.37E-4 7.99E-3 1.00 4.56E-6 2.32E-3 0.35 Kost_et_al_contig_1028 1.83E-4 6.36E-3 1.00 0.46 1.00 1.00 5.58E-9 6.19E-6 4.33E-4 Kost_et_al_contig_5823 3.03E-3 0.06 1.00 4.96E-3 0.09 1.00 1.62E-9 2.15E-6 1.25E-4 Kost_et_al_contig_6281 6.76E-8 7.08E-6 5.24E-3 0.03 0.37 1.00 2.30E-5 8.98E-3 1.00 Kost_et_al_contig_615 1.42E-18 7.39E-16 1.10E-13 2.36E-5 1.18E-3 1.00 1.51E-14 4.88E-11 1.17E-9 Kost_et_al_contig_670 6.50E-17 3.02E-14 5.04E-12 0.07 0.56 1.00 6.35E-10 9.47E-7 4.93E-5 Kost_et_al_contig_2160 6.17E-4 0.02 1.00 0.41 1.00 1.00 2.21E-5 8.80E-3 1.00 Kost_et_al_contig_225 0.11 0.69 1.00 0.05 0.45 1.00 8.07E-9 8.58E-6 6.26E-4 Kost_et_al_contig_6859 0.00 0.00 0.00 3.14E-5 1.49E-3 1.00 8.83E-7 5.88E-4 0.07 Kost_et_al_contig_280 1.46E-16 6.42E-14 1.13E-11 5.18E-6 3.26E-4 0.40 6.92E-8 5.90E-5 5.37E-3 Kost_et_al_contig_485 0.17 0.87 1.00 6.79E-3 0.11 1.00 1.39E-6 8.50E-4 0.11 Kost_et_al_contig_1844 1.45E-13 4.23E-11 1.12E-8 6.07E-7 4.99E-5 0.05 6.28E-6 3.02E-3 0.49 Kost_et_al_contig_4898 2.40E-3 0.05 1.00 0.28 1.00 1.00 1.03E-5 4.69E-3 0.80 Kost_et_al_contig_11 7.37E-10 1.16E-7 5.71E-5 0.11 0.78 1.00 2.24E-5 8.84E-3 1.00 Kost_et_al_contig_4080 0.03 0.29 1.00 6.25E-5 2.64E-3 1.00 1.71E-6 1.02E-3 0.13 Kost_et_al_contig_1976 2.26E-14 7.32E-12 1.76E-9 0.37 1.00 1.00 3.92E-10 6.33E-7 3.04E-5 Kost_et_al_contig_6126 6.11E-6 3.71E-4 0.47 0.70 1.00 1.00 3.70E-8 3.34E-5 2.87E-3 Kost_et_al_contig_11347 1.27E-7 1.24E-5 9.84E-3 0.45 1.00 1.00 1.62E-5 6.73E-3 1.00 Kost_et_al_contig_14154 3.56E-5 1.65E-3 1.00 0.47 1.00 1.00 5.35E-6 2.63E-3 0.41 Kost_et_al_contig_2062 0.00 0.00 0.00 1.03E-4 4.03E-3 1.00 8.36E-13 1.91E-9 6.48E-8 Kost_et_al_contig_2664 8.88E-16 3.53E-13 6.89E-11 0.02 0.23 1.00 5.72E-11 1.08E-7 4.44E-6 Kost_et_al_contig_6296 0.71 1.00 1.00 1.42E-5 7.78E-4 1.00 5.88E-6 2.85E-3 0.46 Kost_et_al_contig_11872 2.09E-12 5.09E-10 1.62E-7 1.49E-3 0.03 1.00 2.72E-6 1.50E-3 0.21 Kost_et_al_contig_8113 1.11E-15 4.35E-13 8.61E-11 0.17 0.99 1.00 1.86E-9 2.37E-6 1.44E-4 Kost_et_al_contig_12933 6.33E-5 2.67E-3 1.00 0.17 1.00 1.00 1.94E-7 1.49E-4 0.02 Kost_et_al_contig_974 1.87E-5 9.65E-4 1.00 0.50 1.00 1.00 6.29E-7 4.44E-4 0.05 Kost_et_al_contig_12085 5.10E-11 9.94E-9 3.95E-6 0.00 0.00 0.00 1.80E-13 4.99E-10 1.40E-8 Kost_et_al_contig_15395 2.89E-5 1.40E-3 1.00 0.09 0.70 1.00 9.24E-11 1.67E-7 7.16E-6 Kost_et_al_contig_9781 0.01 0.17 1.00 4.54E-3 0.08 1.00 1.60E-7 1.28E-4 0.01 Kost_et_al_contig_6612 1.44E-6 1.07E-4 0.11 0.59 1.00 1.00 1.74E-5 7.10E-3 1.00 Kost_et_al_contig_548 1.09E-5 6.05E-4 0.85 0.11 0.76 1.00 3.45E-12 7.43E-9 2.68E-7 Kost_et_al_contig_1655 2.03E-5 1.03E-3 1.00 0.11 0.79 1.00 8.87E-7 5.88E-4 0.07 Kost_et_al_contig_1656 7.95E-32 7.90E-29 6.16E-27 1.22E-9 1.89E-7 9.50E-5 3.96E-10 6.33E-7 3.07E-5 Kost_et_al_contig_2016 2.55E-19 1.43E-16 1.98E-14 4.53E-11 9.19E-9 3.51E-6 1.67E-7 1.32E-4 0.01 Kost_et_al_contig_3288 1.10E-7 1.09E-5 8.54E-3 0.46 1.00 1.00 4.68E-6 2.37E-3 0.36 Kost_et_al_contig_11424 0.50 1.00 1.00 0.04 0.43 1.00 1.22E-5 5.35E-3 0.95 Kost_et_al_contig_7815 1.13E-10 2.06E-8 8.75E-6 0.02 0.21 1.00 1.00E-6 6.54E-4 0.08 Kost_et_al_contig_7071 5.33E-15 1.91E-12 4.13E-10 0.00 0.00 0.00 3.02E-6 1.64E-3 0.23 Kost_et_al_contig_10599 3.05E-6 2.08E-4 0.24 0.65 1.00 1.00 2.29E-5 8.97E-3 1.00 Kost_et_al_contig_1429 1.02E-10 1.89E-8 7.92E-6 0.21 1.00 1.00 1.27E-8 1.29E-5 9.83E-4 Kost_et_al_contig_3950 1.90E-6 1.37E-4 0.15 0.71 1.00 1.00 2.39E-6 1.36E-3 0.19
- 147 - Investigation of the fire blight resistance cascade triggered by FB_MR5 using RNASeq
Bag Bag Bag Bag Bag Bag Bag Bag Bag pvalue FDR bonf pvalue FDR bonf pvalue FDR bonf Terw vs Terw vs Terw vs Gerw vs Gerw vs Gerw vs Gerw vs Gerw vs Gerw vs Feature ID Ghum Ghum Ghum Ghum Ghum Ghum Terw Terw Terw Kost_et_al_contig_263 1.78E-6 1.29E-4 0.14 0.24 1.00 1.00 6.01E-9 6.54E-6 4.66E-4 Kost_et_al_contig_2385 2.62E-10 4.56E-8 2.03E-5 0.19 1.00 1.00 2.72E-6 1.50E-3 0.21 Kost_et_al_contig_13242 3.39E-5 1.59E-3 1.00 0.12 0.82 1.00 3.12E-8 2.95E-5 2.42E-3 Kost_et_al_contig_13211 1.05E-11 2.26E-9 8.14E-7 6.68E-3 0.11 1.00 2.10E-5 8.49E-3 1.00 Kost_et_al_contig_1419 2.23E-22 1.55E-19 1.73E-17 8.06E-7 6.43E-5 0.06 1.74E-5 7.10E-3 1.00 Kost_et_al_contig_3781 5.00E-6 3.14E-4 0.39 0.91 1.00 1.00 4.83E-6 2.41E-3 0.37 Kost_et_al_contig_5273 4.57E-13 1.23E-10 3.55E-8 0.37 1.00 1.00 6.55E-7 4.57E-4 0.05 Kost_et_al_contig_5333 2.05E-3 0.04 1.00 0.18 1.00 1.00 1.06E-5 4.82E-3 0.82 Kost_et_al_contig_8098 0.00 0.00 0.00 0.01 0.20 1.00 6.41E-16 2.37E-12 4.97E-11 Kost_et_al_contig_14661 0.03 0.28 1.00 1.38E-9 2.10E-7 1.07E-4 9.13E-9 9.57E-6 7.08E-4 Kost_et_al_contig_2002 3.21E-11 6.44E-9 2.49E-6 1.19E-4 4.53E-3 1.00 2.19E-5 8.80E-3 1.00 Kost_et_al_contig_20516 0.18 0.89 1.00 2.29E-12 5.59E-10 1.78E-7 7.16E-10 1.05E-6 5.55E-5 Kost_et_al_contig_3784 0.04 0.38 1.00 1.18E-7 1.17E-5 9.17E-3 3.16E-9 3.71E-6 2.45E-4 Kost_et_al_contig_119 2.30E-11 4.77E-9 1.79E-6 0.16 0.98 1.00 1.14E-6 7.12E-4 0.09 Kost_et_al_contig_120 0.00 0.00 0.00 5.60E-6 3.49E-4 0.43 3.07E-6 1.65E-3 0.24 Kost_et_al_contig_41033 0.00 0.00 0.00 4.86E-12 1.14E-9 3.77E-7 3.50E-6 1.86E-3 0.27 Kost_et_al_contig_10264 1.87E-4 6.46E-3 1.00 0.67 1.00 1.00 1.26E-5 5.45E-3 0.98 Kost_et_al_contig_9326 2.73E-4 8.69E-3 1.00 0.19 1.00 1.00 2.60E-9 3.20E-6 2.01E-4 Kost_et_al_contig_13554 0.00 0.00 0.00 1.27E-3 0.03 1.00 1.90E-9 2.37E-6 1.47E-4 Kost_et_al_contig_14502 1.94E-5 9.91E-4 1.00 0.76 1.00 1.00 4.40E-6 2.26E-3 0.34 Kost_et_al_contig_17933 0.89 1.00 1.00 1.36E-5 7.49E-4 1.00 8.65E-6 4.07E-3 0.67 Kost_et_al_contig_2310 4.21E-12 9.58E-10 3.27E-7 2.98E-46 2.36E-43 2.31E-41 9.85E-6 4.55E-3 0.76 Kost_et_al_contig_2613 0.08 0.56 1.00 0.13 0.87 1.00 9.60E-8 7.84E-5 7.45E-3 Kost_et_al_contig_4462 0.32 1.00 1.00 1.87E-6 1.35E-4 0.14 1.63E-9 2.15E-6 1.27E-4 Kost_et_al_contig_4463 6.34E-7 5.22E-5 0.05 0.82 1.00 1.00 3.98E-11 7.88E-8 3.08E-6 Kost_et_al_contig_555 3.81E-10 6.33E-8 2.96E-5 0.24 1.00 1.00 1.68E-6 1.01E-3 0.13 Kost_et_al_contig_5750 0.02 0.20 1.00 0.20 1.00 1.00 1.51E-5 6.36E-3 1.00 Kost_et_al_contig_1357 2.85E-12 6.84E-10 2.21E-7 0.30 1.00 1.00 1.72E-9 2.22E-6 1.33E-4 Kost_et_al_contig_9581 3.76E-4 0.01 1.00 0.29 1.00 1.00 2.25E-5 8.84E-3 1.00 Kost_et_al_contig_10985 0.06 0.49 1.00 8.77E-3 0.14 1.00 2.51E-5 9.65E-3 1.00 Kost_et_al_contig_1157 0.22 0.99 1.00 7.09E-4 0.02 1.00 0.00 0.00 0.00 Kost_et_al_contig_11610 4.24E-7 3.67E-5 0.03 0.77 1.00 1.00 7.77E-8 6.55E-5 6.03E-3 Kost_et_al_contig_11703 2.71E-5 1.33E-3 1.00 0.39 1.00 1.00 1.74E-7 1.35E-4 0.01 Kost_et_al_contig_1254 1.30E-16 5.84E-14 1.01E-11 6.83E-6 4.12E-4 0.53 4.23E-6 2.20E-3 0.33 Kost_et_al_contig_1256 0.01 0.18 1.00 0.03 0.32 1.00 2.43E-5 9.38E-3 1.00 Kost_et_al_contig_1456 9.95E-7 7.80E-5 0.08 0.08 0.62 1.00 8.05E-6 3.80E-3 0.62 Kost_et_al_contig_1466 8.92E-36 9.75E-33 6.92E-31 1.38E-6 1.03E-4 0.11 1.35E-9 1.90E-6 1.05E-4 Kost_et_al_contig_16237 4.62E-7 3.97E-5 0.04 0.37 1.00 1.00 5.49E-9 6.19E-6 4.26E-4 Kost_et_al_contig_1630 9.38E-10 1.46E-7 7.28E-5 2.01E-3 0.04 1.00 3.83E-7 2.83E-4 0.03 Kost_et_al_contig_18868 0.09 0.59 1.00 0.01 0.16 1.00 2.21E-5 8.80E-3 1.00 Kost_et_al_contig_20893 5.22E-9 7.08E-7 4.05E-4 0.17 0.98 1.00 2.64E-5 9.96E-3 1.00 Kost_et_al_contig_2229 3.26E-3 0.06 1.00 0.01 0.19 1.00 6.64E-8 5.72E-5 5.15E-3
- 148 - Chapter 3)
Bag Bag Bag Bag Bag Bag Bag Bag Bag pvalue FDR bonf pvalue FDR bonf pvalue FDR bonf Terw vs Terw vs Terw vs Gerw vs Gerw vs Gerw vs Gerw vs Gerw vs Gerw vs Feature ID Ghum Ghum Ghum Ghum Ghum Ghum Terw Terw Terw Kost_et_al_contig_2545 4.03E-13 1.11E-10 3.13E-8 1.17E-3 0.03 1.00 1.08E-5 4.89E-3 0.84 Kost_et_al_contig_255 0.03 0.30 1.00 0.05 0.49 1.00 1.87E-8 1.84E-5 1.45E-3 Kost_et_al_contig_2696 0.13 0.74 1.00 5.71E-6 3.54E-4 0.44 2.64E-5 9.96E-3 1.00 Kost_et_al_contig_2712 7.99E-3 0.12 1.00 0.04 0.37 1.00 9.33E-6 4.33E-3 0.72 Kost_et_al_contig_28 2.88E-15 1.07E-12 2.24E-10 0.02 0.28 1.00 1.12E-11 2.35E-8 8.69E-7 Kost_et_al_contig_28253 3.98E-5 1.81E-3 1.00 0.54 1.00 1.00 1.26E-5 5.45E-3 0.98 Kost_et_al_contig_28671 3.66E-7 3.21E-5 0.03 0.42 1.00 1.00 1.15E-5 5.08E-3 0.89 Kost_et_al_contig_3139 4.49E-14 1.41E-11 3.48E-9 0.01 0.18 1.00 4.30E-7 3.11E-4 0.03 Kost_et_al_contig_3169 0.60 1.00 1.00 1.79E-11 3.85E-9 1.38E-6 2.21E-11 4.51E-8 1.71E-6 Kost_et_al_contig_35645 0.00 0.00 0.00 0.02 0.28 1.00 1.00E-13 2.88E-10 7.77E-9 Kost_et_al_contig_3615 0.05 0.44 1.00 9.76E-4 0.03 1.00 9.64E-7 6.34E-4 0.07 Kost_et_al_contig_40992 5.95E-7 4.97E-5 0.05 0.85 1.00 1.00 7.99E-7 5.44E-4 0.06 Kost_et_al_contig_4131 7.43E-3 0.11 1.00 0.81 1.00 1.00 2.35E-5 9.12E-3 1.00 Kost_et_al_contig_4274 4.71E-8 5.14E-6 3.65E-3 0.37 1.00 1.00 4.38E-6 2.26E-3 0.34 Kost_et_al_contig_4318 0.17 0.87 1.00 0.12 0.81 1.00 1.61E-5 6.72E-3 1.00 Kost_et_al_contig_4431 0.14 0.78 1.00 4.56E-3 0.08 1.00 1.02E-6 6.60E-4 0.08 Kost_et_al_contig_4439 5.41E-14 1.67E-11 4.19E-9 8.40E-4 0.02 1.00 5.00E-6 2.47E-3 0.39 Kost_et_al_contig_4781 1.73E-10 3.08E-8 1.34E-5 0.06 0.51 1.00 3.14E-6 1.68E-3 0.24 Kost_et_al_contig_5001 1.37E-3 0.03 1.00 1.01E-9 1.58E-7 7.85E-5 1.64E-8 1.63E-5 1.27E-3 Kost_et_al_contig_59360 1.82E-14 5.98E-12 1.41E-9 1.17E-5 6.58E-4 0.91 2.65E-5 9.96E-3 1.00 Kost_et_al_contig_617 2.54E-34 2.66E-31 1.97E-29 0.01 0.17 1.00 0.00 0.00 0.00 Kost_et_al_contig_6781 4.97E-4 0.01 1.00 0.36 1.00 1.00 1.10E-5 4.91E-3 0.85 Kost_et_al_contig_6913 3.78E-14 1.19E-11 2.93E-9 0.04 0.42 1.00 8.25E-10 1.18E-6 6.39E-5 Kost_et_al_contig_7149 1.92E-13 5.53E-11 1.49E-8 8.99E-3 0.14 1.00 1.33E-5 5.69E-3 1.00 Kost_et_al_contig_7520 0.02 0.20 1.00 4.99E-4 0.01 1.00 3.95E-8 3.52E-5 3.06E-3 Kost_et_al_contig_7911 0.86 1.00 1.00 3.49E-3 0.07 1.00 2.57E-5 9.83E-3 1.00 Kost_et_al_contig_7986 2.92E-3 0.06 1.00 5.58E-6 3.48E-4 0.43 2.47E-13 6.60E-10 1.91E-8 Kost_et_al_contig_8072 1.90E-11 3.99E-9 1.48E-6 1.78E-5 9.43E-4 1.00 1.40E-5 5.96E-3 1.00 Kost_et_al_contig_817 3.71E-12 8.69E-10 2.87E-7 0.00 0.00 0.00 1.15E-8 1.19E-5 8.91E-4 Kost_et_al_contig_2142 0.00 0.00 0.00 0.00 0.00 0.00 1.26E-17 4.90E-14 9.80E-13 Kost_et_al_contig_2719 0.07 0.50 1.00 0.01 0.18 1.00 6.08E-9 6.54E-6 4.71E-4 Kost_et_al_contig_735 3.99E-4 0.01 1.00 0.08 0.64 1.00 4.74E-8 4.18E-5 3.67E-3 Kost_et_al_contig_1147 2.55E-10 4.45E-8 1.98E-5 0.29 1.00 1.00 9.76E-8 7.88E-5 7.57E-3 Kost_et_al_contig_4934 1.18E-5 6.50E-4 0.92 0.57 1.00 1.00 6.74E-7 4.67E-4 0.05 Kost_et_al_contig_1503 7.27E-5 3.00E-3 1.00 0.28 1.00 1.00 1.90E-6 1.11E-3 0.15 Kost_et_al_contig_1504 2.46E-3 0.05 1.00 2.23E-3 0.05 1.00 2.79E-6 1.52E-3 0.22 Kost_et_al_contig_5055 0.00 0.00 0.00 6.04E-8 6.47E-6 4.69E-3 1.89E-6 1.11E-3 0.15 Kost_et_al_contig_2470 0.02 0.25 1.00 0.03 0.31 1.00 3.27E-8 3.02E-5 2.54E-3 Kost_et_al_contig_16962 0.00 0.00 0.00 2.82E-7 2.55E-5 0.02 4.83E-10 7.49E-7 3.75E-5 Kost_et_al_contig_199 2.47E-11 5.06E-9 1.91E-6 5.26E-3 0.09 1.00 3.91E-6 2.06E-3 0.30 Kost_et_al_contig_456 2.20E-26 1.79E-23 1.70E-21 3.46E-13 9.58E-11 2.68E-8 0.00 0.00 0.00 Kost_et_al_contig_881 4.32E-26 3.46E-23 3.35E-21 5.31E-10 8.74E-8 4.12E-5 0.00 0.00 0.00
- 149 - Investigation of the fire blight resistance cascade triggered by FB_MR5 using RNASeq in transgenic 'Gala Galaxy'
Supplementary table 3) Summary of all 206 differentially expressed transcripts (with FDR < 0.01) part 3 of 3. Binning by Mapman (BIN) and annotation according to Mercator Blast hits (Annotation description) are indicated.
Feature ID BIN Annotation description Kost_et_al_contig_10778 1.1.1.1 (at1g76570 : 499.0) Chlorophyll A-B binding family protein; FUNCTIONS IN: chlorophyll binding; INVOLVED IN: response to blue light Kost_et_al_contig_1109 1.1.1.1 (at3g08940 : 446.0) Lhcb4.2 protein (Lhcb4.2, protein involved in the light harvesting complex of photosystem II; light harvesting complex Kost_et_al_contig_1110 1.1.1.1 (at5g01530 : 459.0) light harvesting complex photosystem II (LHCB4.1); FUNCTIONS IN: chlorophyll binding; INVOLVED IN: response to blue light Kost_et_al_contig_3310 1.1.1.1 (p27518|cb21_goshi : 473.0) Chlorophyll a-b binding protein 151, chloroplast precursor (LHCII type II CAB-151) (LHCP) - Gossypium hirsutum Kost_et_al_contig_4147 1.1.1.1 (p36494|cb4_spiol : 427.0) Chlorophyll a-b binding protein CP24, chloroplast precursor - Spinacia oleracea (Spinach) & (at1g15820 : 424.0) Lhcb6 protein Kost_et_al_contig_468 1.1.1.1 (at4g10340 : 429.0) photosystem II encoding the light-harvesting chlorophyll a/b binding protein CP26 of the antenna system of the photosynthetic apparatus Kost_et_al_contig_901 1.1.1.1 (at5g54270 : 488.0) Lhcb3 protein is a component of the main light harvesting chlorophyll a/b-protein complex of Photosystem II (LHC II) Kost_et_al_contig_130 1.1.1.2 (q40459|psbo_tobac : 578.0) Oxygen-evolving enhancer protein 1, chloroplast precursor (OEE1) (33 kDa subunit of oxygen evolving system of photosystem Kost_et_al_contig_15 1.1.1.2 (q9slq8|psbp_cucsa : 393.0) Oxygen-evolving enhancer protein 2, chloroplast precursor (OEE2) (23 kDa subunit of oxygen evolving system of photosystem Kost_et_al_contig_16 1.1.1.2 (q7dm39|psbp1_tobac : 361.0) Oxygen-evolving enhancer protein 2-1, chloroplast precursor (OEE2) (23 kDa subunit of oxygen evolving system Kost_et_al_contig_71 1.1.1.2 (at1g67740 : 124.0) PsbY precursor (psbY) mRNA. This single nuclear gene is imported into the chloroplasts Kost_et_al_contig_1170 1.1.2.1 (at3g54890 : 423.0) Encodes a component of the light harvesting complex associated with photosystem I.; photosystem I light harvesting complex gene 1 Kost_et_al_contig_1232 1.1.2.1 (p13869|cb12_pethy : 473.0) Chlorophyll a-b binding protein, chloroplast precursor (LHCI type II CAB) - Petunia hybrida (Petunia) Kost_et_al_contig_1392 1.1.2.1 (at3g47470 : 384.0) Encodes a chlorophyll a/b-binding protein that is more similar to the PSI Cab proteins than the PSII cab proteins Kost_et_al_contig_1636 1.1.2.1 (at1g61520 : 443.0) PSI type III chlorophyll a/b-binding protein (Lhca3*1); photosystem I light harvesting complex gene 3 (LHCA3) Kost_et_al_contig_2366 1.1.2.1 (at3g54890 : 402.0) Encodes a component of the light harvesting complex associated with photosystem I.; photosystem I light harvesting complex gene 1 Kost_et_al_contig_1592 1.1.2.2 (p12355|psaf_spiol : 243.0) Photosystem I reaction center subunit III, chloroplast precursor (Light-harvesting complex I 17 kDa protein) (PSI-F) Kost_et_al_contig_1858 1.1.2.2 (at1g30380 : 172.0) Encodes subunit K of photosystem I reaction center.; photosystem I subunit K (PSAK); FUNCTIONS IN: molecular_function unknown Kost_et_al_contig_1156 1.1.4.4 (p29790|atpg_tobac : 587.0) ATP synthase gamma chain, chloroplast precursor (EC 3.6.3.14) - Nicotiana tabacum (Common tobacco) Kost_et_al_contig_4955 1.1.4.4 (p29790|atpg_tobac : 351.0) ATP synthase gamma chain, chloroplast precursor (EC 3.6.3.14) - Nicotiana tabacum (Common tobacco) Kost_et_al_contig_326 1.1.4.7 (p32980|atpd_tobac : 233.0) ATP synthase delta chain, chloroplast precursor (EC 3.6.3.14) - Nicotiana tabacum (Common tobacco) Kost_et_al_contig_8081 1.1.6 (loc_os01g66000.1 : 293.0) no description available & (at5g58260 : 289.0) Encodes subunit NDH-N of NAD(P)H:plastoquinone dehydrogenase complex Kost_et_al_contig_1079 1.2.1 (loc_os04g41340.1 : 496.0) no description available & (at5g36700 : 495.0) 2-phosphoglycolate phosphatase 1 (PGLP1) Kost_et_al_contig_1080 1.2.1 (at5g36700 : 501.0) 2-phosphoglycolate phosphatase 1 (PGLP1); FUNCTIONS IN: phosphoglycolate phosphatase activity Kost_et_al_contig_601 1.2.2 (at3g14420 : 191.0) Aldolase-type TIM barrel family protein; FUNCTIONS IN: glycolate oxidase activity
- 150 - Chapter 3)
Feature ID BIN Annotation description Kost_et_al_contig_454 1.2.5 (p50433|glym_soltu : 885.0) Serine hydroxymethyltransferase, mitochondrial precursor (EC 2.1.2.1) (Serine methylase) (Glycine hydroxymethyltransferase Kost_et_al_contig_387 1.3.11 (at5g61410 : 300.0) Arabidopsis thaliana ribulose-5-phosphate-3-epimerase mRNA; D-ribulose-5-phosphate-3-epimerase (RPE) Kost_et_al_contig_1300 1.3.12 (p26302|kppr_wheat : 660.0) Phosphoribulokinase, chloroplast precursor (EC 2.7.1.19) (Phosphopentokinase) (PRKase) (PRK) - Triticum aestivum (Wheat) Kost_et_al_contig_455 1.3.12 (p27774|kppr_mescr : 637.0) Phosphoribulokinase, chloroplast precursor (EC 2.7.1.19) (Phosphopentokinase) (PRKase) (PRK) - Mesembryanthemum crystallin Kost_et_al_contig_400 1.3.13 (p10871|rca_spiol : 367.0) Ribulose bisphosphate carboxylase/oxygenase activase, chloroplast precursor (RuBisCO activase) (RA) - Spinacia oleracea Kost_et_al_contig_622 1.3.13 (q40073|rcaa_horvu : 406.0) Ribulose bisphosphate carboxylase/oxygenase activase A, chloroplast precursor (RuBisCO activase A) (RA A) - Hordeum vulgare Kost_et_al_contig_552 1.3.3 (q42961|pgkh_tobac : 594.0) Phosphoglycerate kinase, chloroplast precursor (EC 2.7.2.3) - Nicotiana tabacum (Common tobacco) Kost_et_al_contig_174 1.3.4 (p12859|g3pb_pea : 676.0) Glyceraldehyde-3-phosphate dehydrogenase B, chloroplast precursor (EC 1.2.1.13) Kost_et_al_contig_2936 1.3.4 (at3g26650 : 148.0) Encodes one of the two subunits forming the photosynthetic glyceraldehyde-3-phosphate dehydrogenase (GAPDH) Kost_et_al_contig_661 1.3.4 (at3g26650 : 547.0) Encodes one of the two subunits forming the photosynthetic glyceraldehyde-3-phosphate dehydrogenase (GAPDH) Kost_et_al_contig_662 1.3.4 (at1g12900 : 545.0) glyceraldehyde 3-phosphate dehydrogenase A subunit 2 (GAPA-2); FUNCTIONS IN: NAD or NADH binding Kost_et_al_contig_1375 1.3.6 (p46256|alf1_pea : 473.0) Fructose-bisphosphate aldolase, cytoplasmic isozyme 1 (EC 4.1.2.13) - Pisum sativum (Garden pea) Kost_et_al_contig_1527 1.3.6 (at4g26530 : 211.0) Aldolase superfamily protein; FUNCTIONS IN: fructose-bisphosphate aldolase activity; INVOLVED IN: glycolysis, metabolic process Kost_et_al_contig_1528 1.3.6 (at4g26530 : 165.0) Aldolase superfamily protein; FUNCTIONS IN: fructose-bisphosphate aldolase activity; INVOLVED IN: glycolysis, metabolic process Kost_et_al_contig_4433 1.3.6 (at4g26530 : 275.0) Aldolase superfamily protein; FUNCTIONS IN: fructose-bisphosphate aldolase activity; INVOLVED IN: glycolysis, metabolic process Kost_et_al_contig_2546 1.3.7 (q42796|f16p1_soybn : 423.0) Fructose-1,6-bisphosphatase, chloroplast precursor (EC 3.1.3.11) (D-fructose-1,6-bisphosphate 1-phosphohydrolase) Kost_et_al_contig_2547 1.3.7 (q42796|f16p1_soybn : 420.0) Fructose-1,6-bisphosphatase, chloroplast precursor (EC 3.1.3.11) (D-fructose-1,6-bisphosphate 1-phosphohydrolase) Kost_et_al_contig_6084 10.1.4 (q96558|ugdh_soybn : 331.0) UDP-glucose 6-dehydrogenase (EC 1.1.1.22) (UDP-Glc dehydrogenase) (UDP-GlcDH) (UDPGDH) - Glycine max (Soybean) Kost_et_al_contig_134 10.7 (at5g65730 : 484.0) xyloglucan endotransglucosylase/hydrolase 6 (XTH6); FUNCTIONS IN: hydrolase activity, acting on glycosyl bonds, hydrolase activity Kost_et_al_contig_49392 10.7 (loc_os09g29690.1 : 150.0) no description available & (at4g30380 : 103.0) Encodes a Plant Natriuretic Peptide (PNP) Kost_et_al_contig_603 10.7 (p35694|bru1_soybn : 473.0) Brassinosteroid-regulated protein BRU1 precursor - Glycine max (Soybean) Kost_et_al_contig_15854 10.8.1 (q43062|pme_prupe : 882.0) Pectinesterase PPE8B precursor (EC 3.1.1.11) (Pectin methylesterase) (PE) - Prunus persica (Peach) Kost_et_al_contig_3055 11.1.1.1 (at1g36160 : 127.0) Encodes acetyl-CoA carboxylase. Mutant displays uncoordinated cell divisions which are enhanced by cytokinins. Kost_et_al_contig_143 12.2.2 (p15102|glna4_phavu : 726.0) Glutamine synthetase leaf isozyme, chloroplast precursor (EC 6.3.1.2) (Isozyme delta) (Glutamate--ammonia ligase) Kost_et_al_contig_356 12.2.2 (p15102|glna4_phavu : 711.0) Glutamine synthetase leaf isozyme, chloroplast precursor (EC 6.3.1.2) (Isozyme delta) (Glutamate--ammonia ligase) Kost_et_al_contig_1193 13.1.1.1.1 (at2g02010 : 632.0) glutamate decarboxylase 4 (GAD4); FUNCTIONS IN: calmodulin binding; INVOLVED IN: carboxylic acid metabolic process Kost_et_al_contig_10035 13.1.5.1.1 (at1g17745 : 678.0) encodes a 3-Phosphoglycerate dehydrogenase; D-3-phosphoglycerate dehydrogenase
- 151 - Investigation of the fire blight resistance cascade triggered by FB_MR5 using RNASeq in transgenic 'Gala Galaxy'
Feature ID BIN Annotation description Kost_et_al_contig_106 13.2.5.2 (p54260|gcst_soltu : 742.0) Aminomethyltransferase, mitochondrial precursor (EC 2.1.2.10) (Glycine cleavage system T protein) (GCVT) - Solanum tuberosum Kost_et_al_contig_32 13.2.5.2 (at1g11860 : 337.0) Glycine cleavage T-protein family; FUNCTIONS IN: aminomethyltransferase activity; EXPRESSED IN: 23 plant structures Kost_et_al_contig_1553 15.1 (at5g49740 : 209.0) Encodes a chloroplast ferric chelate reductase. Shows differential splicing and has three different mRNA products Kost_et_al_contig_10630 16.1.1.1 (o78328|dxs_capan : 930.0) Probable 1-deoxy-D-xylulose-5-phosphate synthase, chloroplast precursor (EC 2.2.1.7) (1-deoxyxylulose-5-phosphate synthase) Kost_et_al_contig_16582 16.1.1.1 (o78328|dxs_capan : 517.0) Probable 1-deoxy-D-xylulose-5-phosphate synthase, chloroplast precursor (EC 2.2.1.7) (1-deoxyxylulose-5-phosphate synthase) Kost_et_al_contig_15010 16.1.4.1 (p37272|psy_capan : 601.0) Phytoene synthase, chloroplast precursor (EC 2.5.1.-) - Capsicum annuum (Bell pepper) & (at5g17230 : 589.0) Encodes phytoen Kost_et_al_contig_2397 16.8.3.1 (p51110|dfra_vitvi : 380.0) Dihydroflavonol-4-reductase (EC 1.1.1.219) (DFR) (Dihydrokaempferol 4-reductase) - Vitis vinifera (Grape) Kost_et_al_contig_2103 16.8.4.3 (at5g17050 : 283.0) The At5g17050 encodes a anthocyanidin 3-O-glucosyltransferase which specifically glucosylates the 3-position of the flavonoid C-ring Kost_et_al_contig_20359 17.1.1.1.11 (at1g52340 : 107.0) Encodes a cytosolic short-chain dehydrogenase/reductase involved in the conversion of xanthoxin to ABA-aldehyde during ABA biosynthesis Kost_et_al_contig_19118 17.1.3 (at3g11410 : 373.0) Encodes protein phosphatase 2C. Negative regulator of ABA signalling. Expressed in seeds during germination Kost_et_al_contig_11404 17.6.1 (at1g52800 : 149.0) 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein; FUNCTIONS IN: oxidoreductase activity Kost_et_al_contig_597 19.12 (q6sjv8|crd1_goshi : 666.0) Magnesium-protoporphyrin IX monomethyl ester [oxidative] cyclase, chloroplast precursor (EC 1.14.13.81) Kost_et_al_contig_6416 19.2 (p93111|hem11_cucsa : 396.0) Glutamyl-tRNA reductase 1, chloroplast precursor (EC 1.2.1.70) (GluTR) - Cucumis sativus (Cucumber) Kost_et_al_contig_403 2.1.1.3 (p14766|f16p2_spiol : 621.0) Fructose-1,6-bisphosphatase, cytosolic (EC 3.1.3.11) (D-fructose-1,6-bisphosphate 1-phosphohydrolase) (FBPase) Kost_et_al_contig_3670 2.2.2.1.2 (at4g17090 : 377.0) Encodes a beta-amylase targeted to the chloroplast. Transgenic BMY8 RNAi lines fail to accumulate maltose during cold shock Kost_et_al_contig_4897 2.2.2.1.2 (at3g23920 : 727.0) Encodes a chloroplast beta-amylase. Is necessary for leaf starch breakdown in the absence of BAM3.; beta-amylase 1 (BAM1) Kost_et_al_contig_1735 20.1 (at5g47120 : 340.0) Encodes BI-1, a homolog of mammalian Bax inhibitor 1. Functions as an attenuator of biotic and abiotic types of cell death Kost_et_al_contig_2186 20.1 (loc_os08g12740.2 : 322.0) no description available & (at3g14470 : 258.0) NB-ARC domain-containing disease resistance protein Kost_et_al_contig_37435 20.1 (at4g19810 : 261.0) Glycosyl hydrolase family protein with chitinase insertion domain; FUNCTIONS IN: cation binding, chitinase activity Kost_et_al_contig_22580 20.1.7 (p13240|dr206_pea : 220.0) Disease resistance response protein 206 - Pisum sativum (Garden pea) & (at4g23690 : 182.0) Disease resistance-responsive Kost_et_al_contig_22134 20.2.1 (at3g08910 : 85.9) DNAJ heat shock family protein; FUNCTIONS IN: unfolded protein binding, heat shock protein binding; INVOLVED IN: protein folding Kost_et_al_contig_13624 20.2.2 (loc_os02g02870.1 : 107.0) no description available & (p27484|grp2_nicsy : 101.0) Glycine-rich protein 2 - Nicotiana sylvestris (Wood tobacco) Kost_et_al_contig_3221 24 (at3g53950 : 790.0) glyoxal oxidase-related protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown Kost_et_al_contig_467 24.2 (at1g67280 : 208.0) Glyoxalase/Bleomycin resistance protein/Dioxygenase superfamily protein; FUNCTIONS IN: lactoylglutathione lyase activity Kost_et_al_contig_43848 26.10 (at3g25180 : 116.0) member of CYP82G; cytochrome P450, family 82, subfamily G, polypeptide 1 (CYP82G1); FUNCTIONS IN: electron carrier activity Kost_et_al_contig_12431 26.11 (at5g24760 : 619.0) GroES-like zinc-binding dehydrogenase family protein; FUNCTIONS IN: oxidoreductase activity, zinc ion binding Kost_et_al_contig_9822 26.12 (at5g06720 : 442.0) peroxidase 2 (PA2); FUNCTIONS IN: peroxidase activity, heme binding; INVOLVED IN: oxidation reduction, response to oxidative stress
- 152 - Chapter 3)
Feature ID BIN Annotation description Kost_et_al_contig_52332 26.16 (at4g04960 : 240.0) Concanavalin A-like lectin protein kinase family protein; FUNCTIONS IN: kinase activity; INVOLVED IN: protein amino acid phosphorylation Kost_et_al_contig_23483 26.21 (at2g37870 : 100.0) Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein; FUNCTIONS IN: lipid binding Kost_et_al_contig_30208 26.22 (at5g50130 : 203.0) NAD(P)-binding Rossmann-fold superfamily protein; FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity Kost_et_al_contig_1028 26.23 (at2g42220 : 301.0) Rhodanese/Cell cycle control phosphatase superfamily protein; FUNCTIONS IN: molecular_function unknown Kost_et_al_contig_5823 26.23 (loc_os09g36040.1 : 130.0) no description available & (at4g27700 : 126.0) Rhodanese/Cell cycle control phosphatase superfamily protein Kost_et_al_contig_6281 26.30 (loc_os11g13850.3 : 290.0) no description available & (at1g71500 : 288.0) Rieske (2Fe-2S) domain-containing protein Kost_et_al_contig_615 26.7 (at1g23740 : 478.0) Oxidoreductase, zinc-binding dehydrogenase family protein; FUNCTIONS IN: oxidoreductase activity, zinc ion binding Kost_et_al_contig_670 27.2 (at3g46780 : 490.0) plastid transcriptionally active 16 (PTAC16); FUNCTIONS IN: binding, catalytic activity; INVOLVED IN: metabolic process Kost_et_al_contig_2160 27.3.16 (at3g48590 : 246.0) Encodes a protein with similarity to a subunit of the CCAAT promoter motif binding complex of yeast Kost_et_al_contig_225 27.3.26 (at2g21650 : 114.0) RSM1 is a member of a small sub-family of single MYB transcription factors Kost_et_al_contig_6859 27.3.7 (at1g06040 : 197.0) Encodes salt tolerance protein (STO) which confers salt tolerance to yeast cells Kost_et_al_contig_280 27.3.99 (at3g18490 : 573.0) Eukaryotic aspartyl protease family protein; FUNCTIONS IN: aspartic-type endopeptidase activity; INVOLVED IN: proteolysis Kost_et_al_contig_485 27.3.99 (at3g17980 : 243.0) Calcium-dependent lipid-binding (CaLB domain) family protein; CONTAINS InterPro DOMAIN/s: C2 membrane targeting protein Kost_et_al_contig_1844 28.1 (at2g47450 : 394.0) A component of the chloroplast signal recognition particle pathway that is involved in LHCP targeting Kost_et_al_contig_4898 28.1 (at2g03390 : 383.0) uvrB/uvrC motif-containing protein; FUNCTIONS IN: DNA binding, nuclease activity; INVOLVED IN: nucleotide-excision repair Kost_et_al_contig_11 28.99 (at2g01970 : 664.0) Endomembrane protein 70 protein family; INVOLVED IN: transport; LOCATED IN: integral to membrane, Golgi apparatus, plasma membrane Kost_et_al_contig_4080 29.2.1.1.3.1.1 (p29344|rr1_spiol : 642.0) 30S ribosomal protein S1, chloroplast precursor (CS1) - Spinacia oleracea (Spinach) & (at5g30510 : 609.0) ribosomal protein Kost_et_al_contig_1976 29.2.3 (q40465|if411_tobac : 780.0) Eukaryotic initiation factor 4A-11 (EC 3.6.1.-) (ATP-dependent RNA helicase eIF4A-11) (eIF-4A-11) - Nicotiana tabacum Kost_et_al_contig_6126 29.2.3 (p24922|if5a2_nicpl : 313.0) Eukaryotic translation initiation factor 5A-2 (eIF-5A-2) (eIF-4D) - Nicotiana plumbaginifolia (Leadwort-leaved tobacco) Kost_et_al_contig_11347 29.2.4 (q5z627|ef1g3_orysa : 267.0) Elongation factor 1-gamma 3 (EF-1-gamma 3) (eEF-1B gamma 3) - Oryza sativa (Rice) & (loc_os06g37440.1 : 267.0) no description Kost_et_al_contig_14154 29.2.4 (q5z627|ef1g3_orysa : 253.0) Elongation factor 1-gamma 3 (EF-1-gamma 3) (eEF-1B gamma 3) - Oryza sativa (Rice) & (loc_os06g37440.1 : 253.0) no description Kost_et_al_contig_2062 29.2.4 (o64937|ef1a_orysa : 806.0) Elongation factor 1-alpha (EF-1-alpha) - Oryza sativa (Rice) & (loc_os03g08060.2 : 806.0) no description Kost_et_al_contig_2664 29.2.4 (p43643|ef1a_tobac : 331.0) Elongation factor 1-alpha (EF-1-alpha) (Vitronectin-like adhesion protein 1) (PVN1) - Nicotiana tabacum (Common tobacco) Kost_et_al_contig_6296 29.3 (at2g20890 : 307.0) Chloroplast-localized Thylakoid formation1 gene product involved in vesicle-mediated formation of thylakoid membranes Kost_et_al_contig_11872 29.3.2 (p92792|tom20_soltu : 264.0) Mitochondrial import receptor subunit TOM20 (Translocase of outer membrane 20 kDa subunit) - Solanum tuberosum (Potato) Kost_et_al_contig_8113 29.3.2 (p92792|tom20_soltu : 273.0) Mitochondrial import receptor subunit TOM20 (Translocase of outer membrane 20 kDa subunit) - Solanum tuberosum (Potato) Kost_et_al_contig_12933 29.3.3 (at2g01110 : 389.0) mutant is Albino and pale green; Chloroplast Protein Translocation (tatC). Core subunit of the chloroplast Tat translocase
- 153 - Investigation of the fire blight resistance cascade triggered by FB_MR5 using RNASeq in transgenic 'Gala Galaxy'
Feature ID BIN Annotation description Kost_et_al_contig_974 29.3.4.99 (loc_os05g41060.1 : 365.0) no description available & (p51823|arf2_orysa : 363.0) ADP-ribosylation factor 2 - Oryza sativa (Rice) Kost_et_al_contig_12085 29.4 (q75v63|sapk3_orysa : 196.0) Serine/threonine-protein kinase SAPK3 (EC 2.7.11.1) (Osmotic stress/abscisic acid-activated protein kinase 3) Kost_et_al_contig_15395 29.5 (at5g22860 : 485.0) Serine carboxypeptidase S28 family protein; FUNCTIONS IN: serine-type peptidase activity, peptidase activity Kost_et_al_contig_9781 29.5 (at5g05740 : 324.0) S2P-like putative metalloprotease, also contain transmembrane helices near their C-termini Kost_et_al_contig_6612 29.5.11.20 (loc_os04g36700.1 : 626.0) no description available & (at1g29150 : 601.0) specifically interacts with FUS6/COP11 via the C-terminal domain of FUS6/COP11 Kost_et_al_contig_548 29.5.4 (p42211|asprx_orysa : 587.0) Aspartic proteinase precursor (EC 3.4.23.-) - Oryza sativa (Rice) & (loc_os05g04630.6 : 587.0) no description available Kost_et_al_contig_1655 29.6 (at1g18170 : 282.0) FKBP-like peptidyl-prolyl cis-trans isomerase family protein; FUNCTIONS IN: FK506 binding Kost_et_al_contig_1656 29.6 (at1g18170 : 131.0) FKBP-like peptidyl-prolyl cis-trans isomerase family protein; FUNCTIONS IN: FK506 binding Kost_et_al_contig_2016 29.6 (at4g39710 : 283.0) FK506-binding protein 16-2 (FKBP16-2); FUNCTIONS IN: FK506 binding, peptidyl-prolyl cis-trans isomerase activity Kost_et_al_contig_3288 29.7 (at2g01720 : 619.0) Ribophorin I; FUNCTIONS IN: oligosaccharyl transferase activity, dolichyl-diphosphooligosaccharide-protein glycotransferase activity Kost_et_al_contig_11424 29.8 (loc_os08g06530.1 : 84.7) no description available & (at5g17170 : 82.4) enhancer of sos3-1 (ENH1); FUNCTIONS IN: metal ion binding Kost_et_al_contig_7815 3.1.2.2 (loc_os04g40520.1 : 176.0) no description available & (at3g57520 : 160.0) seed imbibition 2 (SIP2); CONTAINS InterPro DOMAIN/s: Glycoside hydrolase Kost_et_al_contig_7071 3.4.3 (q9lw96|ino1_tobac : 954.0) Inositol-3-phosphate synthase (EC 5.5.1.4) (Myo-inositol-1-phosphate synthase) (MI-1-P synthase) (IPS) - Nicotiana tabacum Kost_et_al_contig_10599 30.2.99 (at3g21510 : 180.0) Encodes AHP1, one of the six Arabidopsis thaliana histidine phosphotransfer proteins (AHPs) Kost_et_al_contig_1429 30.5 (at3g63130 : 667.0) Encodes a RAN GTPase activating protein involved in nuclear import, cell plate formation and mitotic spindle formation.; RAN GTPase Kost_et_al_contig_3950 30.7 (q96450|1433a_soybn : 464.0) 14-3-3-like protein A (SGF14A) - Glycine max (Soybean) & (at5g38480 : 454.0) general regulatory factor, a 14-3-3 gene Kost_et_al_contig_263 31.1 (at5g19940 : 134.0) Plastid-lipid associated protein PAP / fibrillin family protein; FUNCTIONS IN: structural molecule activity Kost_et_al_contig_2385 31.1.1.1.1 (at5g09810 : 750.0) Member of Actin gene family.Mutants are defective in germination and root growth.; actin 7 (ACT7); FUNCTIONS IN: protein binding Kost_et_al_contig_13242 31.4 (loc_os12g10560.1 : 286.0) no description available & (at1g47830 : 274.0) SNARE-like superfamily protein; FUNCTIONS IN: protein transporter activity Kost_et_al_contig_13211 33.99 (loc_os08g42010.1 : 643.0) no description available & (at5g14120 : 623.0) Major facilitator superfamily protein; LOCATED IN: plasma membrane, vacuole Kost_et_al_contig_1419 33.99 (at4g24220 : 513.0) encodes a novel protein containing mammalian death domain involved in programmed cell death Kost_et_al_contig_3781 33.99 (loc_os01g36070.1 : 113.0) no description available & (at3g14770 : 105.0) Nodulin MtN3 family protein; FUNCTIONS IN: molecular_function unknown Kost_et_al_contig_5273 33.99 (at5g49930 : 1150.0) embryo defective 1441 (emb1441); FUNCTIONS IN: zinc ion binding, nucleic acid binding Kost_et_al_contig_5333 34.12 (at5g26820 : 683.0) Mutations in MAR1 confer resistance, while MAR1 overexpression causes hypersensitivity to multiple aminoglycoside antibiotics Kost_et_al_contig_8098 34.12 (at2g13620 : 191.0) member of Putative Na+/H+ antiporter family; cation/hydrogen exchanger 15 (CHX15); FUNCTIONS IN: monovalent cation:hydrogen antiporter Kost_et_al_contig_14661 34.13 (at2g40460 : 193.0) Major facilitator superfamily protein; FUNCTIONS IN: transporter activity; INVOLVED IN: oligopeptide transport, response to nematodes Kost_et_al_contig_2002 34.13 (at1g68570 : 885.0) Major facilitator superfamily protein; FUNCTIONS IN: transporter activity; INVOLVED IN: oligopeptide transport; LOCATED IN: membrane
- 154 - Chapter 3)
Feature ID BIN Annotation description Kost_et_al_contig_20516 34.13 (at2g40460 : 222.0) Major facilitator superfamily protein; FUNCTIONS IN: transporter activity; INVOLVED IN: oligopeptide transport, response to nematodes Kost_et_al_contig_3784 34.13 (at2g40460 : 463.0) Major facilitator superfamily protein; FUNCTIONS IN: transporter activity; INVOLVED IN: oligopeptide transport, response to nematodes Kost_et_al_contig_119 34.19.1 (at4g00430 : 505.0) a member of the plasma membrane intrinsic protein subfamily PIP1.; TRANSMEMBRANE PROTEIN C (TMP-C); FUNCTIONS IN: water channel Kost_et_al_contig_120 34.19.1 (q6eu94|pip11_orysa : 147.0) Aquaporin PIP1.1 (Plasma membrane intrinsic protein 1a) (PIP1a) (OsPIP1.1) (Water channel protein RWC1) (RWC-1) - Oryza sativa Kost_et_al_contig_41033 34.19.2 (at4g01470 : 417.0) Encodes AtTIP1;3, functions as water and urea channels in pollen.; tonoplast intrinsic protein 1;3 (TIP1;3) Kost_et_al_contig_10264 34.2 (at2g20780 : 629.0) Major facilitator superfamily protein; FUNCTIONS IN: carbohydrate transmembrane transporter activity, sugar:hydrogen symporter Kost_et_al_contig_9326 34.2 (at5g59250 : 611.0) Major facilitator superfamily protein; FUNCTIONS IN: carbohydrate transmembrane transporter activity, sugar:hydrogen symporter Kost_et_al_contig_13554 35.1 (at2g36290 : 287.0) alpha/beta-Hydrolases superfamily protein; FUNCTIONS IN: hydrolase activity; INVOLVED IN: biological_process unknown Kost_et_al_contig_14502 35.1 (at5g52030 : 169.0) TraB family protein; CONTAINS InterPro DOMAIN/s: Pheromone shutdown-related, TraB (InterPro:IPR002816); BEST Arabidopsis thaliana Kost_et_al_contig_17933 35.1 (at2g36290 : 147.0) alpha/beta-Hydrolases superfamily protein; FUNCTIONS IN: hydrolase activity; INVOLVED IN: biological_process unknown Kost_et_al_contig_2310 35.1 (at2g38310 : 255.0) Encodes a member of the PYR (pyrabactin resistance )/PYL(PYR1-like)/RCAR (regulatory components of ABA receptor) family proteins Kost_et_al_contig_2613 35.1 (at1g32080 : 570.0) membrane protein, putative; LOCATED IN: chloroplast, chloroplast inner membrane, membrane, chloroplast envelope Kost_et_al_contig_4462 35.1 (at1g54780 : 106.0) Encodes a thylakoid lumen protein regulating photosystem II repair cycle.; TLP18.3; FUNCTIONS IN: molecular_function unknown Kost_et_al_contig_4463 35.1 (at1g54780 : 263.0) Encodes a thylakoid lumen protein regulating photosystem II repair cycle.; TLP18.3; FUNCTIONS IN: molecular_function unknown Kost_et_al_contig_555 35.1 (at4g35250 : 572.0) NAD(P)-binding Rossmann-fold superfamily protein; FUNCTIONS IN: binding, catalytic activity; INVOLVED IN: metabolic process Kost_et_al_contig_5750 35.1 (at2g39570 : 528.0) ACT domain-containing protein; FUNCTIONS IN: amino acid binding; INVOLVED IN: metabolic process Kost_et_al_contig_1357 35.1.14 (at3g23700 : 429.0) Nucleic acid-binding proteins superfamily; FUNCTIONS IN: RNA binding; INVOLVED IN: response to cold Kost_et_al_contig_9581 35.1.41 (loc_os03g03180.1 : 355.0) no description available & (at1g63830 : 345.0) PLAC8 family protein; LOCATED IN: membrane Kost_et_al_contig_10985 35.2 no hits & (original description: no original description) Kost_et_al_contig_1157 35.2 (original description: no original description) Kost_et_al_contig_11610 35.2 (at2g39080 : 389.0) NAD(P)-binding Rossmann-fold superfamily protein; LOCATED IN: chloroplast stroma, chloroplast; EXPRESSED IN: 23 plant structures Kost_et_al_contig_11703 35.2 (at3g01680 : 88.6) CONTAINS InterPro DOMAIN/s: Mediator complex subunit Med28 (InterPro:IPR021640); BEST Arabidopsis thaliana protein match is: unknown Kost_et_al_contig_1254 35.2 (at1g09340 : 535.0) Encodes CHLOROPLAST RNA BINDING (CRB), a putative RNA-binding protein. CRB is important for the proper functioning of the chloroplast Kost_et_al_contig_1256 35.2 (at2g03420 : 80.1) unknown protein Kost_et_al_contig_1456 35.2 no hits & (original description: no original description) Kost_et_al_contig_1466 35.2 (at1g15980 : 309.0) encodes a novel subunit of the chloroplast NAD(P)H dehydrogenase complex, involved in cyclic electron flow around photosystem I Kost_et_al_contig_16237 35.2 no hits & (original description: no original description)
- 155 - Investigation of the fire blight resistance cascade triggered by FB_MR5 using RNASeq in transgenic 'Gala Galaxy'
Feature ID BIN Annotation description Kost_et_al_contig_1630 35.2 (at4g01150 : 167.0) unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown Kost_et_al_contig_18868 35.2 (loc_os02g03720.1 : 154.0) no description available & (at5g17670 : 151.0) alpha/beta-Hydrolases superfamily protein; FUNCTIONS IN: hydrolase activity Kost_et_al_contig_20893 35.2 no hits & (original description: no original description) Kost_et_al_contig_2229 35.2 no hits & (original description: no original description) Kost_et_al_contig_2545 35.2 (at1g62520 : 142.0) unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G12450.1) Kost_et_al_contig_255 35.2 (original description: no original description) Kost_et_al_contig_2696 35.2 (at1g29050 : 533.0) Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) Kost_et_al_contig_2712 35.2 (at1g69760 : 81.6) unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G26920.1) Kost_et_al_contig_28 35.2 (at1g09340 : 476.0) Encodes CHLOROPLAST RNA BINDING (CRB), a putative RNA-binding protein. CRB is important for the proper functioning of the chloroplast Kost_et_al_contig_28253 35.2 no hits & (original description: no original description) Kost_et_al_contig_28671 35.2 no hits & (original description: no original description) Kost_et_al_contig_3139 35.2 (at5g35160 : 1156.0) Endomembrane protein 70 protein family; CONTAINS InterPro DOMAIN/s: Nonaspanin (TM9SF) (InterPro:IPR004240); BEST Arabidopsis thaliana Kost_et_al_contig_3169 35.2 (at5g03880 : 369.0) Thioredoxin family protein; FUNCTIONS IN: electron carrier activity; INVOLVED IN: cell redox homeostasis; LOCATED IN: chloroplast Kost_et_al_contig_35645 35.2 no hits & (original description: no original description) Kost_et_al_contig_3615 35.2 (at1g52140 : 116.0) unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G16330.1) Kost_et_al_contig_40992 35.2 no hits & (original description: no original description) Kost_et_al_contig_4131 35.2 (at2g12400 : 504.0) unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown Kost_et_al_contig_4274 35.2 (at2g21385 : 395.0) unknown protein. & (loc_os09g36130.1 : 387.0) no description available & (chl4|525478 : 122.0) no description available Kost_et_al_contig_4318 35.2 (at1g22850 : 305.0) SNARE associated Golgi protein family; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast Kost_et_al_contig_4431 35.2 no hits & (original description: no original description) Kost_et_al_contig_4439 35.2 (at1g72640 : 240.0) NAD(P)-binding Rossmann-fold superfamily protein; FUNCTIONS IN: binding, catalytic activity; INVOLVED IN: metabolic process Kost_et_al_contig_4781 35.2 no hits & (original description: no original description) Kost_et_al_contig_5001 35.2 (at2g42570 : 508.0) Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) Kost_et_al_contig_59360 35.2 no hits & (original description: no original description) Kost_et_al_contig_617 35.2 (at5g23060 : 347.0) Encodes a chloroplast-localized protein that modulates cytoplasmic Ca2+ concentration and is crucial for proper stomatal regulation Kost_et_al_contig_6781 35.2 (at5g16810 : 419.0) Protein kinase superfamily protein; FUNCTIONS IN: protein kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation Kost_et_al_contig_6913 35.2 (at5g48790 : 234.0) FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast
- 156 - Chapter 3)
Feature ID BIN Annotation description Kost_et_al_contig_7149 35.2 (at1g74730 : 151.0) Protein of unknown function (DUF1118); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown Kost_et_al_contig_7520 35.2 (at1g64355 : 132.0) unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast Kost_et_al_contig_7911 35.2 (at1g57680 : 343.0) FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system Kost_et_al_contig_7986 35.2 no hits & (original description: no original description) Kost_et_al_contig_8072 35.2 (at1g31300 : 408.0) TRAM, LAG1 and CLN8 (TLC) lipid-sensing domain containing protein; FUNCTIONS IN: molecular_function unknown Kost_et_al_contig_817 35.2 no hits & (original description: no original description) Kost_et_al_contig_2142 4.1.8 (at1g13440 : 566.0) glyceraldehyde-3-phosphate dehydrogenase C2 (GAPC2); FUNCTIONS IN: copper ion binding Kost_et_al_contig_2719 4.1.9 (p93338|gapn_nicpl : 308.0) NADP-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.9) Kost_et_al_contig_735 4.1.9 (p93338|gapn_nicpl : 447.0) NADP-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.9) Kost_et_al_contig_1147 4.3.12 (at5g22620 : 572.0) phosphoglycerate/bisphosphoglycerate mutase family protein; FUNCTIONS IN: catalytic activity; INVOLVED IN: metabolic process Kost_et_al_contig_4934 7.1.3 (at3g25530 : 407.0) Encodes gamma-hydroxybutyrate dehydrogenase (AtGHBDH). Contains a NADP-binding domain Kost_et_al_contig_1503 7.2.4 (at3g04790 : 379.0) Ribose 5-phosphate isomerase, type A protein; FUNCTIONS IN: ribose-5-phosphate isomerase activity; INVOLVED IN: defense response Kost_et_al_contig_1504 7.2.4 (at3g04790 : 375.0) Ribose 5-phosphate isomerase, type A protein; FUNCTIONS IN: ribose-5-phosphate isomerase activity; INVOLVED IN: defense response Kost_et_al_contig_5055 8.1.1.1 (loc_os08g42410.1 : 637.0) no description available & (at5g50850 : 611.0) MACCI-BOU (MAB1); FUNCTIONS IN: pyruvate dehydrogenase (acetyl-transferring) Kost_et_al_contig_2470 8.2.11 (at3g06650 : 1112.0) One of the two genes encoding subunit B of the trimeric enzyme ATP Citrate lyase; ATP-citrate lyase B-1 (ACLB-1) Kost_et_al_contig_16962 8.2.9 (loc_os08g33720.1 : 572.0) no description available & (at3g47520 : 556.0) Encodes a protein with NAD-dependent malate dehydrogenase activity Kost_et_al_contig_199 8.3 (p17067|cahc_pea : 339.0) Carbonic anhydrase, chloroplast precursor (EC 4.2.1.1) (Carbonate dehydratase) Kost_et_al_contig_456 8.3 (p17067|cahc_pea : 345.0) Carbonic anhydrase, chloroplast precursor (EC 4.2.1.1) (Carbonate dehydratase) Kost_et_al_contig_881 8.3 (at3g01500 : 119.0) Encodes a putative beta-carbonic anhydrase betaCA1. Together with betaCA4 (At1g70410) regulates CO2-controlled stomatal movements
- 157 - Investigation of the fire blight resistance cascade triggered by FB_MR5 using RNASeq
Supplementary table 4) 206 differentially expressed transcripts sorted by % standard deviation per mean RPKM. Standard deviation of three biological replicates (SD), reads per kilobase of transcript per million mapped reads (RPKM), 'Gala Galaxy' (G), after high humidity treatment (hum), transgenic line T41D (T), inoculated by E. amylovora (erw). * For one contig no transcripts were detected (RPKM = 0) in one replicate and therefore SD could not be calculated).
Ghum %SD Terw %SD Gerw %SD total mean per per per of % SD Ghum Terw Gerw Feature ID mean RPKM mean RPKM mean RPKM per mean RPKM Mean RPKM Mean RPKM Mean RPKM Kost_et_al_contig_7149 1,45 17,61 14,31 11,12 142,20 69,93 116,52 Kost_et_al_contig_974 2,40 6,55 8,21 5,72 196,10 266,32 191,86 Kost_et_al_contig_43848 2,87 22,25 32,62 19,25 0,27 21,91 5,24 Kost_et_al_contig_1419 3,06 38,00 21,70 20,92 81,46 18,50 46,27 Kost_et_al_contig_143 3,11 27,44 6,79 12,45 676,35 338,01 665,55 Kost_et_al_contig_120 3,18 9,49 7,40 6,69 455,80 986,04 675,41 Kost_et_al_contig_4080 3,28 26,75 6,90 12,31 130,39 106,50 173,24 Kost_et_al_contig_454 3,34 21,25 1,56 8,72 543,93 248,82 390,45 Kost_et_al_contig_403 3,85 41,56 4,00 16,47 348,42 142,13 276,78 Kost_et_al_contig_4934 4,24 4,82 6,26 5,11 189,00 154,76 198,72 Kost_et_al_contig_15 4,28 4,90 15,97 8,38 1422,16 681,99 1169,67 Kost_et_al_contig_617 4,43 4,59 2,68 3,90 312,86 173,75 282,35 Kost_et_al_contig_2186 4,62 16,56 17,75 12,98 57,08 33,55 13,10 Kost_et_al_contig_11347 5,12 15,84 19,29 13,42 50,10 103,12 56,26 Kost_et_al_contig_28 5,19 14,67 5,40 8,42 542,59 353,58 501,19 Kost_et_al_contig_4955 5,24 24,18 14,46 14,63 467,18 202,16 371,22 Kost_et_al_contig_12933 5,32 19,18 4,88 9,79 73,70 47,72 84,97 Kost_et_al_contig_1375 5,48 15,88 9,81 10,39 1110,79 221,20 502,75 Kost_et_al_contig_661 5,55 22,92 8,42 12,30 1139,37 867,39 1341,79 Kost_et_al_contig_3139 5,65 4,83 11,43 7,30 79,40 153,89 100,17 Kost_et_al_contig_6612 5,69 3,14 1,70 3,51 67,11 110,51 71,92 Kost_et_al_contig_12431 5,94 18,95 2,02 8,97 34,22 29,38 52,67 Kost_et_al_contig_1503 6,19 22,49 5,03 11,24 138,32 95,92 151,35 Kost_et_al_contig_14154 6,23 9,47 19,61 11,77 50,50 82,92 46,81 Kost_et_al_contig_356 6,26 5,64 2,10 4,67 845,51 287,63 535,11 Kost_et_al_contig_1254 6,47 25,31 10,96 14,25 402,72 191,50 306,80 Kost_et_al_contig_20359 6,59 24,93 11,39 14,30 67,86 22,94 42,05 Kost_et_al_contig_11872 6,96 17,75 9,28 11,33 24,13 77,97 39,27 Kost_et_al_contig_1357 6,97 15,56 7,02 9,85 96,89 52,23 90,36 Kost_et_al_contig_1553 7,26 21,91 20,75 16,64 93,58 16,34 35,02 Kost_et_al_contig_2002 7,32 10,91 12,72 10,32 55,74 145,15 83,89 Kost_et_al_contig_1156 7,49 5,01 4,64 5,71 675,81 467,75 584,55 Kost_et_al_contig_4274 7,49 11,02 13,62 10,71 69,37 40,08 64,49 Kost_et_al_contig_1079 7,50 26,31 4,55 12,79 325,73 243,84 385,20 Kost_et_al_contig_3288 7,55 8,42 24,42 13,46 15,58 40,02 18,35
- 158 - Chapter 3)
Ghum %SD Terw %SD Gerw %SD total mean per per per of % SD Ghum Terw Gerw Feature ID mean RPKM mean RPKM mean RPKM per mean RPKM Mean RPKM Mean RPKM Mean RPKM Kost_et_al_contig_2547 7,63 41,70 6,12 18,49 282,15 161,19 293,75 Kost_et_al_contig_2546 7,81 31,45 8,09 15,78 355,65 249,08 446,96 Kost_et_al_contig_1504 7,96 33,24 1,16 14,12 185,40 127,67 226,18 Kost_et_al_contig_2719 8,02 3,46 7,72 6,40 553,21 536,26 651,61 Kost_et_al_contig_5273 8,09 17,32 17,95 14,45 80,76 38,78 74,57 Kost_et_al_contig_119 8,10 9,26 7,78 8,38 344,67 656,72 393,37 Kost_et_al_contig_622 8,18 7,90 17,51 11,20 2846,90 1994,54 2989,90 Kost_et_al_contig_387 8,19 9,40 4,16 7,25 221,00 174,38 227,28 Kost_et_al_contig_2385 8,22 9,77 16,47 11,49 212,34 410,82 243,52 Kost_et_al_contig_735 8,22 13,01 8,28 9,84 331,52 267,55 377,97 Kost_et_al_contig_16 8,26 18,45 14,50 13,74 803,12 400,19 675,52 Kost_et_al_contig_1630 8,33 19,61 4,05 10,66 722,88 446,24 608,87 Kost_et_al_contig_28671 8,37 28,49 14,96 17,27 49,36 23,83 45,36 Kost_et_al_contig_2936 8,44 11,71 17,58 12,58 94,35 56,80 104,31 Kost_et_al_contig_11 8,49 11,17 15,93 11,86 50,79 99,46 62,24 Kost_et_al_contig_14502 8,58 10,99 7,75 9,11 29,43 14,45 31,33 Kost_et_al_contig_1858 8,71 17,63 2,44 9,59 1959,51 728,68 1261,12 Kost_et_al_contig_12085 8,80 10,15 7,21 8,72 15,36 47,18 93,82 Kost_et_al_contig_5333 8,84 13,18 8,53 10,18 29,11 18,40 35,89 Kost_et_al_contig_601 8,84 14,61 7,21 10,22 268,79 102,03 173,59 Kost_et_al_contig_3950 8,95 13,64 6,18 9,59 209,97 364,75 217,74 Kost_et_al_contig_263 9,15 21,17 6,49 12,27 77,97 45,82 88,07 Kost_et_al_contig_2310 9,17 33,08 49,64 30,63 77,80 29,22 3,55 Kost_et_al_contig_467 9,17 6,97 13,57 9,90 75,17 45,64 73,74 Kost_et_al_contig_552 9,21 14,76 8,78 10,92 1060,53 394,99 903,09 Kost_et_al_contig_10778 9,28 11,37 6,20 8,95 45,88 20,80 41,94 Kost_et_al_contig_1109 9,35 21,87 14,94 15,39 1191,43 550,67 1186,26 Kost_et_al_contig_11404 9,37 20,25 12,97 14,20 10,12 23,59 8,64 Kost_et_al_contig_662 9,49 16,92 7,74 11,39 1195,00 603,41 1006,96 Kost_et_al_contig_199 9,56 54,89 15,90 26,79 947,64 295,85 747,97 Kost_et_al_contig_1976 9,59 9,96 14,26 11,27 82,82 161,64 91,93 Kost_et_al_contig_1147 9,72 17,93 11,46 13,04 56,41 25,76 51,06 Kost_et_al_contig_8113 9,74 11,83 25,54 15,70 21,08 67,09 27,97 Kost_et_al_contig_597 9,82 11,93 17,73 13,16 878,74 413,34 674,89 Kost_et_al_contig_2142 9,87 9,86 2,78 7,50 153,83 848,18 464,05 Kost_et_al_contig_1300 9,93 19,98 7,46 12,45 512,39 302,69 450,32 Kost_et_al_contig_2545 9,97 29,83 7,19 15,66 31,22 6,34 18,40 Kost_et_al_contig_174 10,06 5,48 4,31 6,62 1268,06 506,89 942,02 Kost_et_al_contig_1080 10,10 27,85 11,47 16,47 188,80 150,36 263,57 Kost_et_al_contig_1256 10,19 11,37 17,29 12,95 51,94 41,75 69,27 Kost_et_al_contig_1466 10,32 15,80 20,56 15,56 176,46 41,40 107,19 Kost_et_al_contig_2016 10,33 45,36 1,81 19,16 341,48 86,61 191,79
- 159 - Investigation of the fire blight resistance cascade triggered by FB_MR5 using RNASeq
Ghum %SD Terw %SD Gerw %SD total mean per per per of % SD Ghum Terw Gerw Feature ID mean RPKM mean RPKM mean RPKM per mean RPKM Mean RPKM Mean RPKM Mean RPKM Kost_et_al_contig_1429 10,37 21,93 11,75 14,68 134,45 68,36 122,96 Kost_et_al_contig_1656 10,55 19,64 5,39 11,86 88,18 20,09 48,24 Kost_et_al_contig_5055 10,65 0,83 15,63 9,03 31,51 109,40 66,10 Kost_et_al_contig_1110 10,81 6,21 11,71 9,58 337,82 129,09 380,28 Kost_et_al_contig_4781 10,82 14,78 18,51 14,71 32,25 9,48 24,57 Kost_et_al_contig_10985 10,98 47,71 11,76 23,48 14,09 8,92 23,63 Kost_et_al_contig_280 11,27 6,60 10,46 9,45 194,28 90,78 132,60 Kost_et_al_contig_130 11,34 13,34 12,69 12,46 2508,03 902,72 2029,06 Kost_et_al_contig_20516 11,36 11,00 11,21 11,19 22,05 18,44 2,17 Kost_et_al_contig_13242 11,57 15,97 14,16 13,90 25,27 50,01 19,67 Kost_et_al_contig_2160 11,60 17,79 7,03 12,14 32,30 19,85 36,87 Kost_et_al_contig_1456 11,71 27,88 6,34 15,31 332,17 188,64 295,05 Kost_et_al_contig_32 11,80 12,55 5,20 9,85 252,35 106,57 174,56 Kost_et_al_contig_615 11,82 8,83 9,72 10,12 173,93 62,01 116,98 Kost_et_al_contig_670 12,09 18,30 18,68 16,36 193,28 69,35 160,24 Kost_et_al_contig_6296 12,19 4,89 4,73 7,27 103,46 115,26 150,38 Kost_et_al_contig_2664 12,19 16,69 13,91 14,26 199,74 518,54 252,83 Kost_et_al_contig_2696 12,22 3,67 13,12 9,67 213,07 202,81 130,23 Kost_et_al_contig_326 12,22 15,43 3,30 10,32 569,33 277,43 410,02 Kost_et_al_contig_9581 12,31 18,45 5,35 12,04 35,14 67,90 30,74 Kost_et_al_contig_1844 12,31 17,78 9,51 13,20 260,18 105,14 164,52 Kost_et_al_contig_15010 12,34 8,33 16,03 12,23 43,85 30,42 57,65 Kost_et_al_contig_6781 12,36 4,91 14,31 10,53 28,29 16,38 33,01 Kost_et_al_contig_817 12,44 9,63 12,05 11,37 91,77 217,87 376,43 Kost_et_al_contig_4439 12,55 31,98 4,97 16,50 63,67 22,04 44,54 Kost_et_al_contig_881 12,68 72,87 10,97 32,18 406,43 46,15 212,00 Kost_et_al_contig_4463 12,70 10,72 9,87 11,10 174,62 114,85 174,22 Kost_et_al_contig_1527 12,88 11,29 7,76 10,65 191,14 44,82 115,56 Kost_et_al_contig_455 12,89 17,95 9,50 13,45 983,12 679,27 965,44 Kost_et_al_contig_8081 12,94 21,36 8,72 14,34 60,67 31,24 61,18 Kost_et_al_contig_4898 13,03 9,49 12,41 11,64 73,62 56,55 83,36 Kost_et_al_contig_11703 13,23 8,79 12,76 11,59 63,60 41,46 70,81 Kost_et_al_contig_17933 13,25 31,32 12,04 18,87 11,67 12,20 27,52 Kost_et_al_contig_3221 13,30 85,70 28,82 42,61 103,81 6,73 31,37 Kost_et_al_contig_1392 13,31 13,09 13,24 13,21 861,34 770,23 1532,32 Kost_et_al_contig_901 13,35 42,97 6,05 20,79 451,76 588,70 1153,77 Kost_et_al_contig_3615 13,46 14,66 13,54 13,89 47,36 64,29 30,96 Kost_et_al_contig_106 13,53 7,49 5,09 8,70 606,27 293,17 484,06 Kost_et_al_contig_6913 13,72 14,58 2,62 10,30 61,82 21,55 49,70 Kost_et_al_contig_1028 13,76 20,84 5,63 13,41 142,04 94,35 154,39 Kost_et_al_contig_555 13,80 11,21 19,67 14,89 135,70 65,03 119,62 Kost_et_al_contig_2062 14,01 16,99 16,14 15,71 62,85 254,37 100,90
- 160 - Chapter 3)
Ghum %SD Terw %SD Gerw %SD total mean per per per of % SD Ghum Terw Gerw Feature ID mean RPKM mean RPKM mean RPKM per mean RPKM Mean RPKM Mean RPKM Mean RPKM Kost_et_al_contig_20893 14,03 44,95 29,56 29,51 19,87 3,95 15,21 Kost_et_al_contig_6084 14,07 8,30 7,19 9,85 113,03 234,44 164,01 Kost_et_al_contig_16582 14,21 9,87 17,28 13,79 45,96 54,09 91,22 Kost_et_al_contig_468 14,25 0,79 12,67 9,23 990,17 756,50 1396,93 Kost_et_al_contig_456 14,26 69,58 9,37 31,07 4813,42 411,69 1955,41 Kost_et_al_contig_2470 14,49 3,50 12,25 10,08 260,63 221,69 335,38 Kost_et_al_contig_2229 14,81 15,09 3,92 11,27 25,84 42,29 16,88 Kost_et_al_contig_4433 14,89 8,92 12,04 11,95 102,70 27,09 64,43 Kost_et_al_contig_9781 15,06 19,21 6,07 13,45 16,73 10,14 27,92 Kost_et_al_contig_10599 15,16 15,90 22,50 17,85 17,03 38,91 18,94 Kost_et_al_contig_6126 15,52 1,96 4,22 7,23 116,21 187,72 123,03 Kost_et_al_contig_2712 15,76 17,83 17,96 17,19 53,72 81,48 40,31 Kost_et_al_contig_18868 16,03 23,87 6,74 15,55 22,46 17,68 33,77 Kost_et_al_contig_7071 16,14 11,48 7,32 11,65 27,92 76,88 108,86 Kost_et_al_contig_11610 16,20 3,85 12,06 10,71 36,48 16,84 38,61 Kost_et_al_contig_6281 16,23 25,12 18,10 19,81 195,91 78,32 150,81 Kost_et_al_contig_3169 16,52 16,28 9,38 14,06 99,39 114,17 183,83 Kost_et_al_contig_10035 16,53 57,59 19,81 31,31 7,84 7,48 22,97 Kost_et_al_contig_5001 16,86 2,26 21,27 13,46 188,23 138,31 70,41 Kost_et_al_contig_4897 16,90 22,24 8,74 15,96 41,74 34,63 72,92 Kost_et_al_contig_2366 16,95 8,36 4,42 9,91 502,65 388,74 711,79 Kost_et_al_contig_10264 17,42 8,30 12,87 12,86 40,82 68,01 39,14 Kost_et_al_contig_8072 17,49 23,44 15,23 18,72 79,59 22,45 41,34 Kost_et_al_contig_15854 17,64 10,83 15,47 14,65 16,43 25,36 6,06 Kost_et_al_contig_1232 17,77 8,23 11,06 12,35 694,15 373,83 763,96 Kost_et_al_contig_1592 17,87 5,22 10,57 11,22 497,10 340,90 551,03 Kost_et_al_contig_5823 18,15 24,78 8,23 17,05 38,55 25,16 56,13 Kost_et_al_contig_4318 18,28 12,39 3,39 11,35 89,50 80,51 109,33 Kost_et_al_contig_13554 18,84 17,35 17,59 17,93 2,66 32,07 9,08 Kost_et_al_contig_10630 19,00 16,94 22,50 19,48 10,39 9,17 23,40 Kost_et_al_contig_7815 19,19 25,63 21,87 22,23 40,08 9,65 27,15 Kost_et_al_contig_9822 19,26 27,58 33,23 26,69 1,97 15,01 1,73 Kost_et_al_contig_71 19,66 7,16 7,94 11,59 473,53 180,34 312,83 Kost_et_al_contig_4431 20,18 8,46 8,18 12,28 38,78 32,85 57,51 Kost_et_al_contig_1636 20,25 6,87 7,51 11,54 607,55 577,47 1069,12 Kost_et_al_contig_9326 20,39 11,58 10,92 14,30 43,08 24,08 52,53 Kost_et_al_contig_1528 20,99 14,54 8,72 14,75 254,47 61,74 136,34 Kost_et_al_contig_4462 21,54 16,87 17,65 18,69 40,64 37,42 83,89 Kost_et_al_contig_7520 21,56 46,66 5,71 24,64 27,94 16,42 46,81 Kost_et_al_contig_19118 21,67 17,35 14,20 17,74 26,08 18,44 47,72 Kost_et_al_contig_2397 22,56 52,65 20,10 31,77 100,74 113,88 327,82 Kost_et_al_contig_13624 22,66 38,98 9,77 23,80 46,73 3,63 15,00
- 161 - Investigation of the fire blight resistance cascade triggered by FB_MR5 using RNASeq
Ghum %SD Terw %SD Gerw %SD total mean per per per of % SD Ghum Terw Gerw Feature ID mean RPKM mean RPKM mean RPKM per mean RPKM Mean RPKM Mean RPKM Mean RPKM Kost_et_al_contig_16962 23,19 8,07 7,78 13,01 17,27 83,32 40,17 Kost_et_al_contig_6859 23,21 13,89 18,01 18,37 35,07 167,39 83,20 Kost_et_al_contig_1193 24,77 43,67 13,80 27,41 48,40 32,07 83,75 Kost_et_al_contig_4131 25,32 25,86 4,86 18,68 128,54 77,68 126,01 Kost_et_al_contig_15395 25,44 9,91 28,97 21,44 30,23 59,26 21,34 Kost_et_al_contig_603 25,50 2,34 60,21 29,35 336,27 55,48 10,52 Kost_et_al_contig_14661 25,89 5,47 50,74 27,37 25,05 16,79 2,14 Kost_et_al_contig_13211 26,02 15,78 19,16 20,32 8,34 34,95 16,36 Kost_et_al_contig_5750 26,26 38,06 18,46 27,59 70,32 39,71 89,75 Kost_et_al_contig_7911 26,45 14,93 10,39 17,26 42,15 43,65 22,39 Kost_et_al_contig_1170 27,30 8,63 6,22 14,05 367,76 295,23 512,85 Kost_et_al_contig_2613 27,36 26,95 8,55 20,95 167,96 120,78 214,51 Kost_et_al_contig_2103 27,54 16,63 18,06 20,74 21,11 21,96 42,86 Kost_et_al_contig_3310 28,80 45,58 10,96 28,44 190,13 180,67 452,93 Kost_et_al_contig_548 29,13 28,07 11,58 22,93 85,52 23,58 62,55 Kost_et_al_contig_1735 29,32 7,48 15,13 17,31 45,70 108,51 58,17 Kost_et_al_contig_3781 29,87 30,39 39,62 33,29 8,42 36,80 8,29 Kost_et_al_contig_3784 30,08 20,83 25,83 25,58 26,46 17,30 2,16 Kost_et_al_contig_1655 31,60 72,45 21,29 41,78 52,63 9,92 36,77 Kost_et_al_contig_134 32,42 20,51 43,83 32,25 842,16 535,66 167,10 Kost_et_al_contig_3055 33,59 0,98 8,24 14,27 93,77 73,42 118,96 Kost_et_al_contig_400 34,02 2,70 18,75 18,49 1234,15 569,45 966,74 Kost_et_al_contig_7986 34,10 14,96 21,15 23,41 84,22 35,68 7,21 Kost_et_al_contig_30208 34,13 79,67 18,14 43,98 6,92 4,18 17,64 Kost_et_al_contig_3670 34,59 10,51 6,50 17,20 103,93 239,31 359,74 Kost_et_al_contig_40992 35,95 15,60 48,90 33,49 0,12 8,63 0,19 Kost_et_al_contig_4147 36,16 31,40 14,15 27,24 344,61 277,54 681,89 Kost_et_al_contig_22580 38,51 14,34 34,57 29,14 111,87 72,00 24,31 Kost_et_al_contig_1157 40,78 22,71 5,81 23,10 597,46 448,40 1081,49 Kost_et_al_contig_8098 41,29 10,59 19,46 23,78 3,46 42,44 8,43 Kost_et_al_contig_485 42,65 17,29 17,37 25,77 101,01 71,66 34,64 Kost_et_al_contig_52332 42,73 10,31 27,84 26,96 0,40 50,69 15,15 Kost_et_al_contig_49392 44,60 19,17 48,67 37,48 0,92 40,31 2,20 Kost_et_al_contig_41033 46,50 21,77 19,47 29,25 1,95 395,76 172,47 Kost_et_al_contig_35645 47,60 12,84 7,88 22,77 2,41 34,48 6,37 Kost_et_al_contig_11424 51,29 7,43 7,54 22,09 98,01 127,52 161,46 Kost_et_al_contig_16237 52,45 28,21 51,48 44,05 11,47 55,59 7,74 Kost_et_al_contig_6416 54,15 11,76 17,20 27,70 91,55 103,93 170,36 Kost_et_al_contig_255 71,21 20,66 10,01 33,96 1411,24 160,79 289,76 Kost_et_al_contig_37435 73,23 14,36 17,63 35,07 2,24 116,33 35,01 Kost_et_al_contig_22134 75,55 8,94 21,74 35,41 16,98 31,14 11,85 Kost_et_al_contig_23483 80,06 28,47 15,13 41,22 2,14 22,62 49,77
- 162 - Chapter 3)
Ghum %SD Terw %SD Gerw %SD total mean per per per of % SD Ghum Terw Gerw Feature ID mean RPKM mean RPKM mean RPKM per mean RPKM Mean RPKM Mean RPKM Mean RPKM Kost_et_al_contig_225 85,38 31,81 65,47 60,89 2720,83 640,70 67,75 Kost_et_al_contig_28253 97,43 37,28 79,97 71,56 0,63 8,89 0,29 Kost_et_al_contig_59360 N.A.* 22,72 14,38 N.A. * 0,13 19,74 6,77
- 163 - Investigation of the fire blight resistance cascade triggered by FB_MR5 using RNASeq in transgenic 'Gala Galaxy'
Supplementary table 5) Top 10 highest ratio of RPKM between wild-type (G) and transgenic (T) plants 24 h after inoculation with E. amylovora (erw).
ratio Gerw transcript Category P-value Pathway Annotation description vs Terw Kost_et_al_contig_456 8.3 5.10 0.00 TCA / org transformation.carbonic anhydrases (p17067|cahc_pea : 345.0) Carbonic anhydrase, chloroplast precursor Kost_et_al_contig_881 8.3 4.95 0.00 TCA / org transformation.carbonic anhydrases (at3g01500 : 119.0) Encodes a putative beta-carbonic anhydrase betaCA1. Kost_et_al_contig_3221 24 4.86 1.78E-5 biodegradation of xenobiotics (at3g53950 : 790.0) glyoxal oxidase-related protein Kost_et_al_contig_30208 26.22 4.51 4.56E-6 misc.short chain dehydrogenase/reductase (SDR) (at5g50130 : 203.0) NAD(P)-binding Rossmann-fold superfamily protein (loc_os02g02870.1 : 107.0) no description available & (p27484|grp2_nicsy : 101.0) Glycine-rich protein 2 & Kost_et_al_contig_13624 20.2.2 4.40 2.53E-6 stress.abiotic.cold (chl4|523223 : 94.0) no description available & (at2g17870 : 89.4) Encodes cold shock domain protein 3 (CSP3) Kost_et_al_contig_20893 35.2 4.12 2.64E-5 not assigned.unknown no hits & (original description: no original description) Kost_et_al_contig_1655 29.6 3.99 8.87E-7 protein.folding (at1g18170 : 282.0) FKBP-like peptidyl-prolyl cis-trans isomerase family protein amino acid metabolism.synthesis. Kost_et_al_contig_10035 13.1.5.1.1 3.25 1.12E-5 serine-glycine-cysteine group. (at1g17745 : 678.0) encodes a 3-Phosphoglycerate dehydrogenase serine.phosphoglycerate dehydrogenase Kost_et_al_contig_1110 1.1.1.1 3.12 0.00 PS.lightreaction.photosystem II.LHC-II (at5g01530 : 459.0) light harvesting complex photosystem II (LHCB4.1) secondary metabolism.flavonoids. (p51110|dfra_vitvi : 380.0) Dihydroflavonol-4-reductase (EC 1.1.1.219) Kost_et_al_contig_2397 16.8.3.1 3.09 2.02E-6 dihydroflavonols.dihydroflavonol 4-reductase (DFR) (Dihydrokaempferol 4-reductase)
- 164 - Chapter 3)
Supplementary table 6) Top 10 lowest ratio of RPKM between wild-type (G) and transgenic (T) plants 24 h after inoculation with E. amylovora (erw).
ratio Gerw transcript Category P-value Pathway Annotation description vs Terw Kost_et_al_contig_40992 35.2 -44.81 7.99E-7 not assigned.unknown no hits & (original description: no original description) Kost_et_al_contig_28253 35.2 -29.07 1.26E-5 not assigned.unknown no hits & (original description: no original description) (loc_os09g29690.1 : 150.0) no description available Kost_et_al_contig_49392 10.7 -17.56 3.06E-18 cell wall.modification & (at4g30380 : 103.0) Encodes a Plant Natriuretic Peptide (PNP) RNA.regulation of transcription. (at2g21650 : 114.0) RSM1 is a member of a small Kost_et_al_contig_225 27.3.26 -8.78 8.07E-9 MYB-related transcription factor family sub-family of single MYB transcription factors. Kost_et_al_contig_9822 26.12 -8.12 1.68E-7 misc.peroxidases (at5g06720 : 442.0) peroxidase 2 (PA2) Kost_et_al_contig_20516 34.13 -8.07 7.16E-10 transport.peptides and oligopeptides (at2g40460 : 222.0) Major facilitator superfamily protein (at2g38310 : 255.0) Encodes a member of the PYR Kost_et_al_contig_2310 35.1 -7.81 9.85E-6 not assigned.no ontology (pyrabactin resistance)/PYL(PYR1-like)/RCAR Kost_et_al_contig_3784 34.13 -7.66 3.16E-9 transport.peptides and oligopeptides (at2g40460 : 463.0) Major facilitator superfamily protein Kost_et_al_contig_14661 34.13 -7.43 9.13E-9 transport.peptides and oligopeptides (at2g40460 : 193.0) Major facilitator superfamily protein Kost_et_al_contig_16237 35.2 -6.66 5.49E-9 not assigned.unknown no hits & (original description: no original description)
- 165 - Investigation of the fire blight resistance cascade triggered by FB_MR5 using RNASeq in transgenic 'Gala Galaxy'
Supplementary table 7) Identified transcripts related to biotic stress and secondary metabolism. Baggerly’s weighted fold-change (wfc). 'Gala Galaxy' (G) compared to transgenic line T41D (T) 24 hours post inoculation with E. amylvora (erw).
wfc Feature ID Gerw vs Pathway Annotation description Terw (at1g52340 : 107.0) Encodes a cytosolic short-chain hormone metabolism.abscisic acid.synthesis-degradation. Kost_et_al_contig_20359 1.95 dehydrogenase/reductase involved in the conversion of xanthoxin to ABA-aldehyde during synthesis.short chain alcohol dehydrogenmase (ABA2) ABA biosynthesis. hormone metabolism.abscisic acid.induced-regulated- Kost_et_al_contig_19118 2.72 (at3g11410 : 373.0) Encodes protein phosphatase 2C. Negative regulator of ABA signalling responsive-activated cell wall.precursor synthesis.UDP-Glc dehydrogenase Kost_et_al_contig_6084 -1.35 (q96558|ugdh_soybn : 331.0) UDP-glucose 6-dehydrogenase (EC 1.1.1.22) (UGD) Kost_et_al_contig_134 -2.98 cell wall.modification (at5g65730 : 484.0) xyloglucan endotransglucosylase/hydrolase 6 (XTH6) (loc_os09g29690.1 : 150.0) no description available & (at4g30380 : 103.0) Encodes a Plant Kost_et_al_contig_49392 -17.56 cell wall.modification Natriuretic Peptide (PNP) (p35694|bru1_soybn : 473.0) Brassinosteroid-regulated protein BRU1 precursor – Glycine Kost_et_al_contig_603 -4.98 cell wall.modification max (Soybean) & (at4g14130 : 432.0) xyloglucan endotransglycosylase-related protein (XTR7); xyloglucan endotransglucosylase/hydrolase 15 (q43062|pme_prupe : 882.0) Pectinesterase PPE8B precursor (EC 3.1.1.11) Kost_et_al_contig_15854 -3.98 cell wall.pectin*esterases.PME (Pectin methylesterase) Kost_et_al_contig_15395 -2.64 protein.degradation (at5g22860 : 485.0) Serine carboxypeptidase S28 family protein; (at5g05740 : 324.0) S2P-like putative metalloprotease, also contain transmembrane helices Kost_et_al_contig_9781 2.91 protein.degradation near their C-termini and many of them, five of seven, contain a conserved zinc-binding motif HEXXH. Homolog of EGY1 (loc_os04g36700.1 : 626.0) no description available & (at1g29150 : 601.0) Kost_et_al_contig_6612 -1.45 protein.degradation.ubiquitin.proteasom specifically interacts with FUS6/COP11 via the C-terminal domain of FUS6/COP11 Kost_et_al_contig_548 2.81 protein.degradation.aspartate protease (p42211|asprx_orysa : 587.0) Aspartic proteinase precursor (EC 3.4.23.-) (p13240|dr206_pea : 220.0) Disease resistance response protein 206 - Pisum sativum (Garden pea) & (at4g23690 : 182.0) Disease resistance-responsive (dirigent-like protein) Kost_et_al_contig_22580 -2.77 stress.biotic.PR-proteins family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: lignan biosynthetic process, defense response (at3g08910 : 85.9) DNAJ heat shock family protein; Kost_et_al_contig_22134 -2.48 stress.abiotic.heat FUNCTIONS IN: unfolded protein binding, heat shock protein binding no description available & (p27484|grp2_nicsy : 101.0) Glycine-rich protein 2 - Nicotiana sylvestris (Wood tobacco) & Kost_et_al_contig_13624 4.40 stress.abiotic.cold (chl4|523223 : 94.0) no description available & (at2g17870 : 89.4) Encodes COLD SHOCK DOMAIN PROTEIN 3 (CSP3) (at5g06720 : 442.0) peroxidase 2 (PA2); FUNCTIONS IN: peroxidase activity, Kost_et_al_contig_9822 -8.12 misc.peroxidases response to oxidative stress;
- 166 - Chapter 3)
wfc Feature ID Gerw vs Pathway Annotation description Terw (at3g21510 : 180.0) Encodes AHP1, one of the six Arabidopsis thaliana histidine Kost_et_al_contig_10599 -1.95 signalling.receptor kinases.misc phosphotransfer proteins (AHPs). AHPs function as redundant positive regulators of cytokinin signaling. (at3g63130 : 667.0) Encodes a RAN GTPase activating protein involved in nuclear import, Kost_et_al_contig_1429 1.91 signalling.G-proteins cell plate formation and mitotic spindle formation (q96450|1433a_soybn : 464.0) 14-3-3-like protein A (SGF14A) - Glycine max (Soybean) & Kost_et_al_contig_3950 -1.57 signalling.14-3-3 proteins (at5g38480 : 454.0) general regulatory factor, a 14-3-3 gene RNA.regulation of transcription.MYB-related transcription Kost_et_al_contig_225 -8.78 (at2g21650 : 114.0) RSM1 is a member of a small sub-family of single MYB transcription factors factor family secondary metabolism.isoprenoids.non-mevalonate (o78328|dxs_capan : 517.0) Probable 1-deoxy-D-xylulose-5-phosphate synthase, Kost_et_al_contig_16582 1.77 pathway.DXS chloroplast precursor (EC 2.2.1.7) (1-deoxyxylulose-5-phosphate synthase) secondary metabolism.isoprenoids.non-mevalonate Kost_et_al_contig_10630 2.69 (o78328|dxs_capan : 930.0) same description as Kost_Et_al_contig_16582 pathway.DXS (at5g17050 : 283.0) The At5g17050 encodes a anthocyanidin 3-O-glucosyltransferase secondary metabolism.flavonoids.flavonols.flavonol-3-O- which specifically glucosylates the 3-position of the flavonoid C-ring. Anthocyanidins such as Kost_et_al_contig_2103 2.06 rhamnosyltransferase cyaniding and pelargonidin as well as flavonols such as kaempferol and quercetin are accepted substrates secondary (p51110|dfra_vitvi : 380.0) Dihydroflavonol-4-reductase (EC 1.1.1.219) (DFR) Kost_et_al_contig_2397 3.09 metabolism.flavonoids.dihydroflavonols.dihydroflavonol 4- (Dihydrokaempferol 4-reductase) - Vitis vinifera (Grape) reductase secondary metabolism.isoprenoids.carotenoids.phytoene Kost_et_al_contig_15010 2.01 (p37272|psy_capan : 601.0) Phytoene synthase, chloroplast precursor (EC 2.5.1.-) synthase wfc Gala Feature ID Pathway Annotation description vs Trans (at1g52340 : 107.0) Encodes a cytosolic short-chain hormone metabolism.abscisic acid.synthesis-degradation. Kost_et_al_contig_20359 1.95 dehydrogenase/reductase involved in the conversion of xanthoxin to ABA-aldehyde during synthesis.short chain alcohol dehydrogenmase (ABA2) ABA biosynthesis. hormone metabolism.abscisic acid.induced-regulated- Kost_et_al_contig_19118 2.72 (at3g11410 : 373.0) Encodes protein phosphatase 2C. Negative regulator of ABA signalling responsive-activated cell wall.precursor synthesis.UDP-Glc dehydrogenase Kost_et_al_contig_6084 -1.35 (q96558|ugdh_soybn : 331.0) UDP-glucose 6-dehydrogenase (EC 1.1.1.22) (UGD) Kost_et_al_contig_134 -2.98 cell wall.modification (at5g65730 : 484.0) xyloglucan endotransglucosylase/hydrolase 6 (XTH6) (loc_os09g29690.1 : 150.0) no description available & (at4g30380 : 103.0) Encodes a Plant Kost_et_al_contig_49392 -17.56 cell wall.modification Natriuretic Peptide (PNP) (p35694|bru1_soybn : 473.0) Brassinosteroid-regulated protein BRU1 precursor – Glycine Kost_et_al_contig_603 -4.98 cell wall.modification max (Soybean) & (at4g14130 : 432.0) xyloglucan endotransglycosylase-related protein (XTR7); xyloglucan endotransglucosylase/hydrolase 15
- 167 - Investigation of the fire blight resistance cascade triggered by FB_MR5 using RNASeq in transgenic 'Gala Galaxy'
wfc Feature ID Gerw vs Pathway Annotation description Terw (q43062|pme_prupe : 882.0) Pectinesterase PPE8B precursor (EC 3.1.1.11) Kost_et_al_contig_15854 -3.98 cell wall.pectin*esterases.PME (Pectin methylesterase) Kost_et_al_contig_15395 -2.64 protein.degradation (at5g22860 : 485.0) Serine carboxypeptidase S28 family protein; (at5g05740 : 324.0) S2P-like putative metalloprotease, also contain transmembrane helices Kost_et_al_contig_9781 2.91 protein.degradation near their C-termini and many of them, five of seven, contain a conserved zinc-binding motif HEXXH. Homolog of EGY1 (loc_os04g36700.1 : 626.0) no description available & (at1g29150 : 601.0) Kost_et_al_contig_6612 -1.45 protein.degradation.ubiquitin.proteasom specifically interacts with FUS6/COP11 via the C-terminal domain of FUS6/COP11 Kost_et_al_contig_548 2.81 protein.degradation.aspartate protease (p42211|asprx_orysa : 587.0) Aspartic proteinase precursor (EC 3.4.23.-) (p13240|dr206_pea : 220.0) Disease resistance response protein 206 - Pisum sativum (Garden pea) & (at4g23690 : 182.0) Disease resistance-responsive (dirigent-like protein) Kost_et_al_contig_22580 -2.77 stress.biotic.PR-proteins family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: lignan biosynthetic process, defense response (at3g08910 : 85.9) DNAJ heat shock family protein; Kost_et_al_contig_22134 -2.48 stress.abiotic.heat FUNCTIONS IN: unfolded protein binding, heat shock protein binding no description available & (p27484|grp2_nicsy : 101.0) Glycine-rich protein 2 - Nicotiana sylvestris (Wood tobacco) & Kost_et_al_contig_13624 4.40 stress.abiotic.cold (chl4|523223 : 94.0) no description available & (at2g17870 : 89.4) Encodes COLD SHOCK DOMAIN PROTEIN 3 (CSP3) (at5g06720 : 442.0) peroxidase 2 (PA2); FUNCTIONS IN: peroxidase activity, Kost_et_al_contig_9822 -8.12 misc.peroxidases response to oxidative stress; (at3g21510 : 180.0) Encodes AHP1, one of the six Arabidopsis thaliana histidine Kost_et_al_contig_10599 -1.95 signalling.receptor kinases.misc phosphotransfer proteins (AHPs). AHPs function as redundant positive regulators of cytokinin signaling. (at3g63130 : 667.0) Encodes a RAN GTPase activating protein involved in nuclear import, Kost_et_al_contig_1429 1.91 signalling.G-proteins cell plate formation and mitotic spindle formation (q96450|1433a_soybn : 464.0) 14-3-3-like protein A (SGF14A) - Glycine max (Soybean) & Kost_et_al_contig_3950 -1.57 signalling.14-3-3 proteins (at5g38480 : 454.0) general regulatory factor, a 14-3-3 gene RNA.regulation of transcription.MYB-related transcription Kost_et_al_contig_225 -8.78 (at2g21650 : 114.0) RSM1 is a member of a small sub-family of single MYB transcription factors factor family secondary metabolism.isoprenoids.non-mevalonate (o78328|dxs_capan : 517.0) Probable 1-deoxy-D-xylulose-5-phosphate synthase, Kost_et_al_contig_16582 1.77 pathway.DXS chloroplast precursor (EC 2.2.1.7) (1-deoxyxylulose-5-phosphate synthase) secondary metabolism.isoprenoids.non-mevalonate Kost_et_al_contig_10630 2.69 (o78328|dxs_capan : 930.0) same description as Kost_Et_al_contig_16582 pathway.DXS
secondary metabolism.flavonoids.flavonols.flavonol-3-O- (at5g17050 : 283.0) The At5g17050 encodes a anthocyanidin 3-O-glucosyltransferase Kost_et_al_contig_2103 2.06 rhamnosyltransferase which specifically glucosylates the 3-position of the flavonoid C-ring.
- 168 - Chapter 3)
wfc Feature ID Gerw vs Pathway Annotation description Terw secondary (p51110|dfra_vitvi : 380.0) Dihydroflavonol-4-reductase (EC 1.1.1.219) (DFR) Kost_et_al_contig_2397 3.09 metabolism.flavonoids.dihydroflavonols.dihydroflavonol 4- (Dihydrokaempferol 4-reductase) - Vitis vinifera (Grape) reductase secondary metabolism.isoprenoids.carotenoids.phytoene Kost_et_al_contig_15010 2.01 (p37272|psy_capan : 601.0) Phytoene synthase, chloroplast precursor (EC 2.5.1.-) synthase
- 169 - Investigation of the fire blight resistance cascade triggered by FB_MR5 using RNASeq in transgenic 'Gala Galaxy'
Supplementary figure 1) Relative position of the transcripts numbered 1 to 22 (from supplementary table 1) recommended as house-keeping genes for apple leave tissue between identically treated transgenic and wild-type 'Gala Galaxy' (left) or between wild-type 'Gala Galaxy' compared to transgenic plants T41D at 24 hours post E. amylovora inoculation (right).
- 170 - End of chapter 3)
- 171 - General conclusion and outlook
General conclusion and outlook
- 172 - General conclusion and outlook
General conclusion and outlook
Fire blight is a destructive disease with relevant damage in most apple and pear orchards worldwide. As the control measures of this disease are very limited and their efficacy depends highly on the correct time point of application, there is an urgent need for flanking current disease management strategies with fire blight resistant cultivars. Nowadays new breeding technologies could help developing high quality, fire blight resistant cultivars avoiding the hurdles posed by conventional breeding.
This thesis had three aims of which two have clearly been achieved: The first one was the confirmation of FB_MR5 being the first cloned, functional fire blight resistance gene (chapter 1). An inoculation experiment showed that FB_MR5 is working under native sequences, required for deployment of this gene by cisgenesis, and also under regulation by a strong promoter, as it led to increased fire blight resistance in a, normally highly fire blight susceptible cultivar. Aiming at the development of fire blight resistant, cisgenic plants, two different vector systems were used in combination with A. tumefaciens bacteria as a ferry to transfer FB_MR5 into the target genome. In a first transformation experiment the cisgenic line, C44.4.146 of cultivar 'Gala Galaxy', was developed and subsequently showed persistently an increased fire blight resistance in three independent experiments (chapter 2). In further transformations a different vector system was used and three more cisgenic lines of the cultivar 'Gala Galaxy' were developed, which all manifested increased resistance to fire blight in the greenhouse (annex to chapter 2). In chapter 3 it was aimed at deciphering the transcriptional mechanisms involved in fire blight resistance after recognition of the pathogen by FB_MR5. In this experiment, 206 differentially expressed transcripts were observed and transcripts involved in cell-wall fortification and biotic stress were more abundant in the transgenic, fire blight resistant (FB_MR5 carrying) line while a higher number of photosynthesis-related transcripts was observed in the fire blight susceptible 'Gala Galaxy' plants. However, it was not possible to identify a clear defense response.
There were several possible reasons, why this was the case. The abundancy of transcripts, as detectable in RNASeq experiments does not essentially show the effective abundancy of proteins present in the plant nor reveal the activity of the proteins. Resistance could be strongly regulated by post translational modification or micro RNAs which were not detectable by the applied Next Generation Sequencing technology or in the used study design, respectively. In addition, 26 % of the differentially expressed transcripts remained unannotated and were not considered. Nevertheless, this work confirmed that the natural variability between biological replicates differs a lot (1 to 97% of mean expression level) and indicated that the use of more than three biological replicates is inevitable to obtain reliable results in RNASeq experiments on apple. Prospective studies need to result from more replicates to prevent speculative conclusions. A further, independent experiment should confirm true positive candidates and allow filtering out false positive transcripts, just detected by chance.
Line C44.4.146, together with the other developed lines, which carry either FB_MR5, Rvi15 or Rvi6 could allow assessing if the cisgenic approach really sidesteps linkage drag and speeds up introgression of specific traits in apple compared to conventional breeding. In our investigation in greenhouse cabins, apart from increased fire blight resistance no striking phenotypical changes were observed when plants of the cisgenic line C44.4.146 were compared with conventionally bred plants (annex to chapter 2). Depending if no further striking differences (phenotypically, transcriptome or proteome) in the cisgenic plants compared to the wild-type and related cultivars are revealed under field conditions, cisgenesis may be accepted as new alternative, if public acceptance is present, to increase
- 173 - General conclusion and outlook the small number of efficient control strategies to fight fire blight. Recently an application form for a field trial with the cisgenic line C44.4.146 has been submitted to the Federal Office for the Environment (FOEN). This experiment may reveal if differences between the cisgenic line and conventional cultivars are found under field conditions. Albeit line C44.4.146 showed high fire blight resistance after scissors and syringe inoculation with E. amylovora, a crucial question to answer will be how susceptible the blossoms of the cisgenic line are to fire blight. This is an important information as blossom infection is the main infection way. This field trial will allow examining if fruits with similar properties (high quality) as in the control cultivar are developed, and if their storage properties are maintained.
Revealing of the cascade activated to obtain fire blight resistance in apple (as attempted in chapter 3) is useful for the scientific community to better understand plant-pathogen interactions and to attain sustainable control measures. As the apple customers and producers worldwide prefer a dozen of cultivars, which are all highly susceptible to fire blight, there is a relevant demand for new measures to maintain exactly those established cultivars. Cisgenesis with FB_MR5 and further R-genes is a promising tool, as it has the potential to lower the risk of high losses in such accepted cultivars. Cloning of further, apple-own R-genes in combination with the cisgenic approach could improve those preferred cultivars in a durable manner. Using biotechnology FB_MR5 and/or other resistances could be inserted into old cultivars (e.g of pear) and help to achieve fire blight resistance in such cultivars that are, due to their extreme susceptibility to fire blight, nowadays only grown by a few farmers.
The obtained cisgenic plants showed less susceptibility to fire blight in the greenhouse (13.4 % PLL) than the wild-type control plants (85.3 % PLL). However, C44.4.146, being a prototype of a cisgenic apple bearing FB_MR5 alone, would only lead to very limited, short-term advantages. As a single point mutation in the effector of the pathogen is enough to break the resistance mechanism of FB_MR5 and as such an event is likely to happen in apple orchard monocultures, we disadvise any commercial production of this cisgenic line. To achieve a durable resistance, allowing a long-term reduction in the number of chemical treatments (meaning less work, fuel and applications of antibiotics and chemicals), FB_MR5 needs to be stacked with further, independent resistances (R-genes or QTLs). As currently FB_MR5 is the only cloned fire blight resistance gene, it could be pyramided into an already robust variety so to achieve a possible “product” (similar as attempted in annex of chapter 2).
A useful approach to achieve efficient fire blight resistance management and to enhance the durability of FB_MR5 could be to stacking it with Mfu10, which has not yet been cloned, into Malus fusca (as vectors for such a transformation of FB_MR5 have already been developed). Mfu10 has recently been shown to endure strains that broke the resistance of FB_MR5. Host resistance by stacking of FB_MR5 and Mfu10 into cultivars that already show a high tolerance to fire blight or other important apple diseases as scab could be a powerful tool when aiming at durable resistance. Such a resistance cassette could be introgressed into the latest, fire blight tolerant cultivars, or to prominent cultivars improved with powdery mildew (PI1 and PI2) or apple scab resistance genes (HcrVf2 and Rvi15). A cultivar with several stacked R-genes could reduce the number of copper, fungicide and antibiotic applications and the consequent residues of those products on the fruits and in the environment, and reduce the development of antibiotic resistances. However, if several R-genes should be pooled into an already established cultivar, further research to increase the spectrum of resistances against E. amylovora is a prevailing topic.
In the future, biotechnology may speed up the confirmation of functionality of novel R-genes in transgenic or cisgenic plants, which could also be applied combined with conventional breeding. A
- 174 - General conclusion and outlook stacking of three independent R-genes would be a reasonable starting product for application. This was previously shown in a three-year study where potatoes carrying three stacked cisgenes stayed resistant during the whole experiment.
Cisgenesis as a control strategy against fire blight in Europe also depends on the legal status and on the public acceptance. Independent if this approach will be broadly accepted by the public or not and even if several R-genes will be pooled in a susceptible or even robust cultivar by novel breeding technologies or conventional breeding, the struggling coevolution, between E. amylovora and apple, driven by constant changes in recognition targets, will move on. As the pathosystem evolves in the course of time, continuous research will be needed on this topic. Like the wise philosopher Heraclitus of Ephesus once said: “The only thing that is constant is change” (Heraclitus of Ephesus 535-475 BC).
- 175 - Acknowledgments
Acknowledgments First of all I would like to express my gratitude to Dr. Giovanni Broggini for his outstanding supervision of this project including providing inspiring ideas, patience, scientific discussions and continuous support.
I gratefully acknowledge both Prof. Cesare Gessler, who made it possible to write this thesis at the ETH in his research group and Prof. Bruce McDonald, for taking over my supervision after Prof. Gessler’s retirement.
I would like to thank the co-examiner Dr. ir. Henk Schouten for the critical reading of this thesis.
I wish to acknowledge Dr. Andrea Patocchi for his scientific guidance, critical inputs and support in scientific writing, and his valuable advice in the publications.
Thank you to Dr. Markus Kellerhals (from Agroscope in Wädenswil) for his motivation and interest in this thesis during the ZUEFOS meetings.
The contributions of Jana Schneider, Dr. Michele Gusberti, Dr. Johannes Fahrentrapp (all from ETH Zurich), Rolf Blapp, Melanie Jänsch, Bea Schoch, Cosima Pelludat, Isabelle Baumgartner (all from Agroscope in Wädenswil), Dr. Thomas Wöhner, Dr. Henryk Flachowsky, Ines Hiller, Dr. Andreas Peil (all from JKI in Dresden-Pillnitz) and Dr. Klaus Richter (from JKI Quedlinburg) are gratefully acknowledged.
My special thanks goes to Marcello Zala, Dr. Ueli Merz, Dr. Monika Maurhofer, Ulrike Rosenberger, and Sandra Galfetti Weinreich, for their extraordinary support throughout my thesis.
I am grateful to David On (ETH Zurich) and Toni Zürcher (Agroscope in Wädenswil), for their great IT assistance and I thank Tania Torossi, Silvia Kobel, Dr. Stefan Zoller, Dr. Jean-Claude Walser, Dr. Aria Minder (all from GDC Zurich) Catharine Aquino and Weihong Qi (both from FGCZ Zurich), for their kind collaboration.
I would like to thank the whole Plant Pathology Group for the outstanding harmonic working atmosphere and particularly for all scientific inputs, cooking recipes, “Instifästs” and ski weekends.
I wish to acknowledge the collaboration of ETH Zurich and Agroscope in the frame work of the projects ZUEFOS I and ZUEFOS II (Züchtung feuerbrandrobuster Obstsorten) which made this PhD thesis possible and I am grateful for the financial support by the Swiss Federal Office for Agriculture (FOAG) and the SNF project 31003A_149637.
Last but not least I am very thankful to my parents, my brother and my wonderful girlfriend, for their support and their interest in my thesis.
- 176 - Curriculum Vitae
Curriculum Vitae Thomas Kost
Publications and international conferences:
Broggini, G.A.L., Wöhner, T., Fahrentrapp, J., Kost, T.D., Flachowsky, H., Peil, A., Hanke, M.V., Richter, K., Patocchi, A. and Gessler, C. (2014) Engineering fire blight resistance into the apple cultivar 'Gala' using the FB_MR5 CC-NBS-LRR resistance gene of Malus × robusta 5. Plant Biotechnol J 12, 728-733.
Kellerhals, M., Schütz, S., Baumgartner, I.O., Schaad, J., Kost, T., Broggini, G. and Patocchi, A. (2014) Züchtung feuerbrandrobuster Apfelsorten. Agrarforschung Schweiz 10, 414-421.
Kost, T., Stopnisek, N., Agnoli, K., Eberl, L. and Weisskopf, L. (2013) Oxalotrophy, a widespread trait of plant-associated Burkholderia species, is involved in successful root colonization of lupin and maize by Burkholderia phytofirmans. Frontiers in microbiology 4.
Kost, T.D., Gessler C., Jänsch M., Flachowsky H., Patocchi A., Broggini G.A.L. (2015) Development of the First Cisgenic Apple with Increased Resistance to Fire Blight. PLOS ONE 8. e0143980
Kost, T.D., Jänsch, M., Gessler, C., Flachowsky, H., Patocchi, A. and Broggini, G.A.L. (2015) Generation of a cisgenic apple line of cultivar Gala with increased fire blight resistance. EUCARPIA Fruit Breeding and Genetics Symposium (presentation: Acta Hort accepted for printing in January 2016)
Broggini, G.A.L., Kost T., Fahrentrapp, J., Patocchi, A., Wöhner, T., Flachowsky, H., Peil, A. Hanke M.- V. and Gessler C. (2014) FB-MR5 Is an Apple Gene Providing Resistance to Fire Blight. Acta Hort. (ISHS). 1056:273-276.
Kost, T., Broggini, G.A.L., Fahrentrapp, J., Patocchi, A., Wöhner, T., Flachowsky, H., Peil, A. Hanke M.V. and Gessler C. (2014) Resistance against fire blight of Gala transformed with a gene from Malus × robusta 5. XIII International Workshop on Fire Blight (poster).
- 177 -