US 2005.0002865A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2005/0002865 A1 Klaveness et al. (43) Pub. Date: Jan. 6, 2005

(54) DIAGNOSTIC/THERAPEUTICAGENTS continuation of application No. 08/959,206, filed on Oct. 28, 1997, now Pat. No. 6,331,289. (75) Inventors: Jo Klaveness, Oslo (NO); Pal Rongved, Oslo (NO); Anders Hogset, (60) Provisional application No. 60/049,263, filed on Jun. Oslo (NO); Helge Tolleshaug, Oslo 7, 1997. Provisional application No. 60/049.264, filed (NO); Alan Cuthbertson, Oslo (NO); on Jun. 6, 1997. Provisional application No. 60/049, Aslak Godal, Oslo (NO); Lars Hoff, 266, filed on Jun. 7, 1997. Oslo (NO); Geir Gogstad, Oslo (NO); Klaus Bryn, Oslo (NO); Anne (30) Foreign Application Priority Data Naevestad, Oslo (NO); Dagfinn Lovhaug, Oslo (NO); Halldis Oct. 28, 1996 (GB)...... 9622.366.4 Oct. 28, 1996 (GB)...... 96223698

Hellebust, Oslo (NO); Magne Solbakken, Oslo (NO) Feb. 4, 1997 (GB)...... 97O2.195.0 Apr. 24, 1997 (GB)...... 9708265.5 Correspondence Address: Jun. 6, 1997 (GB)...... 971. 1837.6 Li CAI Jun. 6, 1997 (GB)...... 971. 1839.2 Amersham Health, Inc. 101 Carnegie Center Publication Classification Princeton, NJ 08540-6231 (US) (51) Int. Cl...... A61K 49/00 (73) Assignee: Amersham Health AS, Oslo (NO) (52) U.S. Cl...... 424/9.52 (21) Appl. No.: 10/734,730 (57) ABSTRACT (22) Filed: Dec. 15, 2003 Targetable diagnostic and/or therapeutically active agents, e.g. ultrasound contrast agents, comprising a Suspension in Related U.S. Application Data an aqueous carrier liquid of a reporter comprising gas containing or gas-generating material, Said agent being (63) Continuation of application No. 09/925,715, filed on capable of forming at least two types of binding pairs with Aug. 10, 2001, now Pat. No. 6,680,047, which is a a target. US 2005/0002865 A1 Jan. 6, 2005

DIAGNOSTIC/THERAPEUTICAGENTS 0009. There is a limited body of prior art relating to targeted ultrasound contrast agents. Thus, for example, U.S. 0001. This invention relates to diagnostic and/or thera Pat No. 5,531,980 is directed to systems in which the peutically active agents, more particularly to diagnostic reporter comprises an aqueous Suspension of air or gas and/or therapeutically active agents incorporating moieties microbubbles stabilised by one or more film-forming Sur having affinity for sites and/or structures within the body so factants present at least partially in lamellar or laminar form, that diagnostic imaging and/or therapy of particular loca said Surfactant(s) being bound to one or more vectors tions within the body may be enhanced. Of particular comprising “bioactive species designed for Specific target interest are diagnostic agents for use in ultrasound imaging, ing purposes'. It is Stated that the microbubbles are not which are hereinafter referred to as targeted ultrasound directly encapsulated by Surfactant material but rather that contrast agents. this is incorporated in liquid-filled liposomes which Stabilise 0002. It is well known that ultrasonic imaging comprises the microbubbles. It will be appreciated that lamellar or a potentially valuable diagnostic tool, for example in Studies laminar Surfactant material Such as phospholipids present in of the vascular System, particularly in cardiography, and of such liposomes will inevitably be present in the form of one tissue microvasculature. A variety of contrast agents has or more lipid bilayers with the lipophilic tails “back-to been proposed to enhance the acoustic images So obtained, back” and the hydrophilic heads both inside and outside (see including Suspensions of Solid particles, emulsified liquid e.g. Schneider, M. on "Liposomes as drug carriers: 10 years droplets, gas bubbles and encapsulated gases or liquids. It is of research” in Drug targeting, Nyon, Switzerland, 3-5 Oct. generally accepted that low density contrast agents which 1984, Buri, P. and Gumma, A. (Ed), Elsevier, Amsterdam are easily compressible are particularly efficient in terms of 1984). the acoustic backScatter they generate, and considerable 0010 EP-A-0727225 describes targeted ultrasound con interest has therefore been shown in the preparation of trast agents in which the reporter comprises a chemical gas-containing and gas-generating Systems. having a Sufficient vapour pressure Such that a proportion of 0.003 Gas-containing contrast media are also known to it is a gas at the body temperature of the Subject. This be effective in magnetic resonance (MR) imaging, e.g. as chemical is associated with a Surfactant or albumin carrier susceptibility contrast agents which will act to reduce MR which includes a protein-, peptide- or carbohydrate-based Signal intensity. Oxygen-containing contrast media also rep cell adhesion molecule ligand as vector. The receptor moi resent potentially useful paramagnetic MR contrast agents. eties in Such contrast agents correspond to the phase shift colloid systems described in WO-A-9416739; it is now 0004 Furthermore, in the field of X-ray imaging it has recognised that administration of Such phase shift colloids been observed that gases Such as carbon dioxide may be may lead to generation of microbubbles which grow uncon used as negative oral contrast agents or intravascular con trollably, possibly to the extent where they cause potentially trast agents. dangerous embolisation of, for example, the myocardial 0005 The use of radioactive gases, e.g. radioactive iso vasculature and brain (see e.g. Schwarz, Advances in Echo topes of inert gases Such as Xenon, has also been proposed Contrast 1994(3)], pp. 48-49). in Scintigraphy, for example for blood pool imaging. 0011 WO-A-9320802 proposes that tissue-specific ultra 0006 Targeted ultrasound contrast agents may be Sonic image enhancement may be achieved using acousti regarded as comprising (i) a reporter moiety capable of cally reflective oligolamellar liposomes conjugated to tis interacting with ultrasound irradiation to generate a detect Sue-Specific ligands Such as antibodies, peptides, lectins etc. able signal; (ii) one or more vectors having affinity for The liposomes are deliberately chosen to be devoid of gas particular target Sites and/or Structures within the body, e.g. and So will not have the advantageous echogenic properties for specific cells or areas of pathology; and (iii) one or more of gas-based ultrasound contrast agents. Further references linkers connecting said reporter and vector(s), in the event to this technology, e.g. in targeting to fibrin, thrombi and that these are not directly joined. atherOSclerotic areas are found in publications by Alkanonyuksel, H. et al. in J. Pharm. Sci. (1996) 85(5), 0007. The molecules and/or structure to which the con 486-490, J. Am. Coll. Cardiol. (1996) 27(2) Suppl A, 298A; trast agent is intended to bind will hereinafter be referred to and Circulation, 68 Sci. Sessions, Anaheim 13-16 Nov. as the target. In order to obtain specific imaging of a Selected 1995. region/structure in the body the target must be present and available in this region/structure. Ideally it will be expressed 0012. There is also a number of publications concerning only in the region of interest, but usually will also be present ultrasound contrast agents which refer in passing to possible at other locations in the body, creating possible background use of monoclonal antibodies as vectors without giving problems. The target may either be a defined molecular Significant practical detail and/or to reporters comprising Species (i.e. a target molecule) or an unknown molecule or materials which may be taken up by the reticuloendothelial more complex structure (i.e. a target structure) which is System and thereby permit image enhancement of organs present in the area to be imaged, and is able to bind such as the liver-see, for example WO-A-9300933, WO Specifically or Selectively to a given vector molecule. A-94.01140, WO-A-9408.627, WO-A-9428874, U.S. Pat No. 5,088,499, U.S. Pat No. 5,348,016 and U.S. Pat No. 5,469, 0008. The vector is attached to the reporter moiety in 854. In general these prior art targeted contrast agents are order to bind these moieties to the region/structure to be intended to enhance contrast at Specific Sites in the body, for imaged. The Vector may bind Specifically to a chosen target, example tumour cells, by using one vector to bind Strongly or it may bind only Selectively, having affinty also for a to one target, in order to achieve concentration at the target limited number of other molecules/structures, again creating cells. In contrast to this principle of using one vector to bind possible background problems. with high affinity to one target, the present invention is based US 2005/0002865 A1 Jan. 6, 2005 in part on the finding that diagnostic and/or therapeutically tion is well Suited to imaging changes occurring in normal active agents with more favourable properties may be blood vessels which are situated in areas of tissue necrosis. obtained by use of multiple kinds of Vector-target interac tions (e.g. involving agents associated with a plurality of 0016. It will be appreciated that binding affinities are different vectors and/or with one or more vectors having dependent on numbers of interactions as well as their affinity for different targets on the same or different cell Strength. The density of vector molecules at the Surface of types). In this way, binding of gas-containing and gas the reporter units may therefore be Selected So as appropri generating diagnostic and/or therapeutic agents may, for ately to adjust the degree of interactions between particular example, be obtained by forming multiple binding pairs agents and targets. between one vector with Specificity for more than one 0017. The term multiple-specificity is also used to receptor or between more than one vector with affinity for describe an injectable carrier liquid, of gas-containing or one or more types of target, with either low or high affinities. gas-generating material composed of one or more vectors Such multiple binding of the vector-conjugated agent to one with a specificity for one or more cellular Surface receptors or more target molecules/structures may result in advanta while at the same time comprising a Second element with geous targeting properties, for example by enhancing target Specificity for a Substrate or receptor System binding to Specificity and/or by distinguishing interactions at a desired which induces a therapeutic response. Thus included within target area from background interactions with lower levels the Scope of the present invention are multiple-specific of molecules/structures Similar to target expressed elsewhere imaging agents comprising a targeting Vector, Such as the in the body. anti-fibrin antibody described by Lanza et al. (Circulation, 0013. It is well known to use one vector binding with (1996) 94 (12).pp 3334), annexin V atherosclerotic plaque high affinity to one target. The present invention, however, binding peptides such as YRALVDTLK, or any other vector is based on the finding that the desired binding of gas known to associate with fibrin clots, in combination with a containing and gas-generating diagnostic and/or therapeutic drug or enzyme with fibrinolytic activity Such as Streptoki agents may be obtained by forming multiple binding pairs nase, plasminogen activator (tPA), urokinase (uPA) or with low affinity between one type of vector and one type of prourokinase (ScuPA) resulting in a localised therapeutic target, or by forming multiple binding pairs between one or antithrombotic effect. This invention is also extended to more types of vectors and one or more types of target, with include Vectors with increased specificity for tumour cells in either low or high affinities. Thus multiple binding of the combination with vectors or drug molecules functioning as Vector conjugated agent to one or more target molecules/ chemotherapeutic agents capable of inhibiting tumour Structures may have advantageous targeting properties, for growth. example in enhancing target Specificity and/or in distin 0018. It is well known that many, if not all, target guishing interactions at a desired target area from back molecules are not expressed exclusively at target Sites, a ground interactions with lower levels of molecules/struc common Situation is that Such molecules are over-expressed tures similar to target expressed elsewhere in the body. by target cells or at a target Structure but are also expressed 0.014 Thus according to one aspect of the present inven at lower levels elsewhere in the body. The use of reporters tion there is provided a targetable diagnostic and/or thera carrying a multiplicity of vectors with relatively low affinity peutically active agent, e.g. an ultrasound contrast agent, for the target may be advantageous in this situation, Since the comprising a Suspension in an aqueous carrier liquid, e.g. an reporter will then tend to concentrate in regions of high injectable carrier liquid, of a reporter comprising gas-con target density which permit multiple (and therefore strong) taining or gas-generating material characterised in that Said binding to the reporter (e.g. a gas-containing agent incor agent is capable of forming at least two types of binding porating the Vectors folic acid and glutathione for multiple pairs, e.g. being conjugated to at least two vectors or to one Specific binding to folic acid receptors and glutathione-S- vector capable of binding to at least two binding Sites. trasferase receptorS respectively which are over-expressed as tumour cells). Areas of low target density, on the other 0.015. One advantageous embodiment of the invention is hand, will not provide sufficient interaction with such low based on the additional finding that limited adhesion to affinity vectors to bind the target. In such embodiments of targets is a highly useful property of diagnostic and/or the invention, low affinity vectors may be regarded as having therapeutically active agents, which property may be an association constant Kafor interaction with a target mol achieved using vectors giving temporary retention rather ecule or structure of less than 10 M', e.g. less than 107M", than fixed adhesion to a target. Thus Such agents, rather than preferably less than 10°M'. A further embodiment of this being fixedly retained at Specific Sites, may for example invention is thus based on the finding that the desired effectively exhibit a form of retarded flow along the vascular binding of gas-containing and gas-generating diagnostic endothelium by virtue of their transient interactions with and/or therapeutic agents may be obtained by forming endothelial cells. Such agents may thus become concen binding pairs with low affinity between more than one type trated on the walls of blood vessels, in the case of ultrasound of vector and one or more type of target. Multiple vectors contrast agents providing enhanced echogenicity thereof may therfore be used to increase Specificity, So that the relative to the bulk of the bloodstream, which is devoid of reporter will bind only to target cells or Structures expressing anatomical features. They therefore may permit enhanced imaging of the capillary System, including the microvascu a particular combination of target molecules. lature, and So may facilitate distinction between normal and 0019. It may also be useful to select a plurality of vectors inadequately perfused tissue, e.g. in the heart, and may also which bind to different parts, e.g. epitopes, of a target be useful in Visualising Structures Such as Kupffer cells, Structure in order to give increased binding Strength. This thrombi and atherosclerotic lesions or for visualising neo may be particularly advantageous when the target density is vascularized and inflamed tissue areas. The present inven low. US 2005/0002865 A1 Jan. 6, 2005

0020 Products comprising two or more vectors with 0025 The reporter may be in any convenient form, for different specificities, i.e. which bind to different target example being any appropriate gas-containing or gas-gen molecules on different cells, may advantageously be used as erating ultrasound contrast agent formulation. Representa "general purpose' agents for detection of a range of dis tive examples of such formulations include microbubbles of eases, e.g. different forms of cancer. Thus, for example, the gas stabilised (e.g. at least partially encapsulated) by a use of Such agents may enable detection of metastases, coalescence-resistant Surface membrane (for example gela which are often heterogeneous with respect to expression of tin, e.g. as described in WO-A-8002365), a filmogenic target molecules (i.e. antigens). protein (for example an albumin Such as human serum albumin, e.g. as described in U.S. Pat No. 4,718,433, U.S. 0021 Within the context of the present invention, the Pat No. 4,774,958, U.S. Pat No. 4,844,882, EP-A-0359246, reporter unit will usually remain attached to the vectors. In WO-A-9112823, WO-A-9205806, WO-A-9217213, WO-A- another type of targeting procedure, Sometimes called pre 9406477 or WO-A-95.01187), a polymer material (for targeting, the vector (often, a monoclonal antibody) is example a Synthetic biodegradable polymer as described in administered alone; Subsequently, the reporter is adminis EP-A-0398935, an elastic interfacial synthetic polymer tered, coupled to a moiety which is capable of Specifically membrane as described in EP-A-0458745, a microparticu binding the vector molecule (when the vector is an antibody, late biodegradable polyaldehyde as described in EP-A- the reporter may be coupled to an immunoglobulin-binding 0441468, a microparticulate N-dicarboxylic acid derivative molecule, Such as protein A or an anti-immunoglobulin of a polyamino acid-polycyclic imide as described in antibody). An advantage of this protocol is that time may be EP-A-0458079, or a biodegradable polymer as described in allowed for elimination of the vector molecules that do not WO-A-9317718 or WO-A-9607434), a non-polymeric and bind their targets, Substantially reducing the background non-polymerisable wall-forming material (for example as problems that are connected with the presence of an exceSS described in WO-A-9521631), or a surfactant (for example of reporter-vector conjugate. Within the context of the a polyoxyethylene-polyoxypropylene block copolymer Sur present invention, pre-targeting with one Specific vector factant Such as a Pluronic, a polymer Surfactant as described might be envisaged, followed by reporter units that are in WO-A-9506518, or a film-forming surfactant such as a coupled to another vector and a moiety which binds the first phospholipid, e.g. as described in WO-A-9211873, WO-A- VectOr. 9217212, WO-A-9222247, WO-A-9428780 or WO-A- 0022 Within the context of the present invention, in 9503835). Some cases and in particular for the assessment of blood 0026. Other useful gas-containing contrast agent formu perfusion rates in defined areas, for example in myocardium, lations include gas-containing Solid Systems, for example it is of interest to measure the rate at which ultrasound microparticles (especially aggregates of microparticles) hav contrast agents bound to the target are displaced or released ing gas contained there within or otherwise associated there from the target. This can be achieved in a controlled fashion with (for example being adsorbed on the surface thereof by Subsequent administration of a vector or other agent able and/or contained within Voids, cavities or pores therein, e.g. to displace or release the contrast agent from the target. as described in EP-A-0122624, EP-A-0123235, EP-A- 0023 Vectors useful in accordance with the invention 0365467, WO-A-92.21382, WO-A-9300930, WO-A- include ligands for cell adhesion proteins, as well as cell 9313802, WO-A-9313808 or WO-A-9313809). It will be adhesion proteins themselves where these have correspond appreciated that the echogenicity of Such microparticulate ing ligands on endothelial cell Surfaces. Examples of cell contrast agents may derive directly from the contained/ adhesion proteins include integrins, most of which bind the associated gas and/or from gas (e.g. microbubbles) liberated Arg-Gly-Asp (RGD) amino acid Sequence. If desired, the from the Solid material (e.g. upon dissolution of the micro vector may be targeted to Specific cell adhesion proteins particulate structure). expressed mainly on activated endothelial cells Such as are 0027. The disclosures of all of the above-described docu found at or close to Sites of inflammation or other patho ments relating to gas-containing contrast agent formulations logical responses. Other vectors which may be used include are incorporated herein by reference. proteins and peptides that bind to cell-Surface proteoglycans, which are complexes of proteins and Sulphated polysaccar 0028 Gas microbubbles and other gas-containing mate ides found on most cells, including endothelial cells. Such rials. Such as microparticles preferably have an initial aver proteoglycans contribute to the negative Surface charge of age size not exceeding 10 um (e.g. of 7 um or less) in order all nucleated cells from vertebrate animals; this charge may to permit their free passage through the pulmonary System also be exploited in accordance with the invention by using following administration, e.g. by intravenous injection. positively charged vectors, e.g. comprising cationic lipids, which will interact electrostatically with the endothelial 0029 Where phospholipid-containing compositions are employed in accordance with the invention, e.g. in the form Surface. of phospholipid-Stabilised gas microbubbles, representative 0024. A further aspect of the present invention is for examples of useful phospholipids include lecithins (i.e. example where a vector or vectorS is attached to the reporter phosphatidylcholines), for example natural lecithins Such as or included non-covalently into the reporter in a manner egg yolk lecithin or Soya bean lecithin and Synthetic or where the Said vector or vectorS is not readily exposed to the Semisynthetic lecithins Such as dimyristoylphosphatidylcho targets or receptors. Increased tissue specificity may there line, dipalmitoylphosphatidylcholine or distearoylphos fore be achieved by applying an additional process to expose phatidylcholine; phosphatidic acids, phosphatidylethanola the vectors, e.g. the agent is exposed after administration to mines, phosphatidylserines, phosphatidylglycerols, external ultrasound to change the diffusibility of the moieties phosphatidylinositols, cardiolipins, Sphingomyelins, fluori containing the vectors. nated analogues of any of the foregoing, mixtures of any of US 2005/0002865 A1 Jan. 6, 2005

the foregoing and mixtures with other lipids Such as cho ran, alginates, chitin, chitosan, hyaluronic acid or heparin; lesterol. The use of phospholipids predominantly (e.g. at and Sugar alcohols, including alditols Such as mannitol or least 75%) comprising molecules individually bearing net Sorbitol), inorganic Salts (e.g. Sodium chloride), organic Salts Overall charge, e.g. negative charge, for example as in (e.g. Sodium citrate, Sodium acetate or Sodium tartrate), naturally occurring (e.g. Soya bean or egg yolk derived), X-ray contrast agents (e.g. any of the commercially avail Semisynthetic (e.g. partially or fully hydrogenated) and able carboxylic acid and non-ionic amide contrast agents Synthetic phosphatidylserines, phosphatidylglycerols, phos typically containing at least one 2,4,6-triiodophenyl group phatidylinositols, phosphatidic acids and/or cardiolipins, having Substituents Such as carboxyl, carbamoyl, N-alkyl may be particularly advantageous. carbamoyl, N-hydroxyalkylcarbamoyl, acylamino, N-alky 0.030. Other exemplary lipids which may be used to lacylamino or acylaminomethyl at the 3- and/or 5-positions, prepare gas-containing contrast agents include fatty acids, as in metrizoic acid, diatrizoic acid, iothalamic acid, ioxaglic Stearic acid, palmitic acid, 2-n-hexadecylstearic acid, oleic acid, ioheXol, iopentol, iopamidol, iodixanol, iopromide, acid and other acid containing lipid structures. These lipid metrizamide, iodipamide, meglumine iodipamide, meglu Structures are considered particularly interesting when mine acetrizoate and meglumine diatrizoate), and polypep coupled by amide bond formation to amino acids containing tides and proteins (e.g. gelatin or albumin Such as human one or more amino groups. The resulting lipid modified Serum albumin). amino acids (e.g. dipalmitoyllysine, distearoyl-2,3-diamino propionic acid) are considered useful precursors for the 0034) Any biocompatible gas may be present in the attachment of functionalised spacer elements featuring cou reporter of contrast agents according to the invention, the pling Sites for conjugation of one or more vector molecules. term "gas” as used herein including any Substances (includ ing mixtures) Substantially or completely in gaseous (includ 0.031) A further extension of this invention relates to the ing vapour) form at the normal human body temperature of Synthesis of lipopeptide Structures comprising a lipid 37 C. The gas may thus, for example, comprise air; reporter attached to a linker portion (e.g. PEG, polyamino nitrogen; oxygen; carbon dioxide, hydrogen; an inert gas acid, alkylhalide etc) the said linker being Suitably func Such as helium, argon, Xenon or krypton, a Sulphur fluoride tionalised for coupling to one or more vector molecules. A Such as Sulphur hexafluoride, disulphur decafluoride or particular preference is the inclusion of a positively charged trifluoromethylsulphur pentafluoride, Selenium hexafluo linker element (e.g. two or more lysine residues) for anchor ride; an optionally halogenated Silane Such as methylsilane ing of the reporter element in the microbubble through or dimethylsilane; a low molecular weight hydrocarbon (e.g. electroStatic interaction with the negatively charged mem containing up to 7 carbon atoms), for example an alkane brane. Multiple-specific targeting is achievable by mixing Such as methane, ethane, a propane, a butane or a pentane, and doping of phospholipid gas-containing structures with a cycloalkane Such as cyclopropane, cyclobutane or cyclo one or more targeted lipopeptide Sequences. Multiple-Speci pentane, an alkene Such as ethylene, propene, propadiene or ficity can also be achieved by assembling more than one abutene, or an alkyne Such as acetylene or propyne; an ether vector on a branched lysine core structure Such as those Such as dimethyl ether; a ketone; an ester; a halogenated low described by Tam et al. (Proc. Natl. Acad. Sci. USA, 1989, molecular weight hydrocarbon (e.g. containing up to 7 86, 9084) or by incorporating multiple vectors in a linear carbon atoms); or a mixture of any of the foregoing. Advan Sequence. Multiple-specificity can also be achieved using tageously at least Some of the halogen atoms in halogenated lipopeptides or phospholipids comprising combinatorial gases are fluorine atoms; thus biocompatible halogenated libraries Synthesised by chemical Synthesis as described by hydrocarbon gases may, for example, be Selected from Lowe (Combinatorial Chemistry, Chemical Society bromochlorodifluoromethane, chlorodifluoromethane, Reviews, 1995, 309-317). dichlorodifluoromethane, bromotrifluoromethane, chlorotri 0032. Also within the scope of this invention are func fluoromethane, chloropentafluoroethane, dichlorotetrafluo tionalised microbubbles carrying one or more reactive roethane, chlorotrifluoroethylene, fluoroethylene, ethylfluo groups for non-Specific reaction with receptor molecules ride, 1,1-difluoroethane and perfluorocarbons, e.g. located on cell Surfaces. Microbubbles comprising a thiol perfluoroalkanes Such as perfluoromethane, perfluoroethane, moiety,for example, can bind to cell Surface receptors via perfluoropropanes, perfluorobutanes (e.g. perfluoro-n-bu disulphide exchange reactions. The reversible nature of this tane, optionally in admixture with other isomerS Such as covalent bond means that bubble flow can be controlled by perfluoro-iso-butane), perfluoropentanes, perfluorohexanes altering the redox environment. Similarly activated and perfluoroheptanes, perfluoroalkenes Such as perfluoro microbubbles of membranes comprising active esterS Such propene, perfluorobutenes-(e.g. perfluorobut-2-ene) and per as N-hydroxySuccinimide esters can be used to modify fluorobutadiene; perfluoroalkynes Such as perfluorobut-2- yne, and perfluorocycloalkanes Such S amino groups found on a multiplicity of cell Surface mol perfluorocyclobutane, perfluoromethylcyclobutane, perfluo ecules. rodimethylcyclobutanes, perfluorotrimethyl-cyclobutanes, 0.033 Representative examples of gas-containing micro perfluorocyclopentane, perfluoromethyl-cyclopentane, per particulate materials which may be useful in accordance fluorodimethylcyclopentanes, perfluorocyclohexane, per with the invention include carbohydrates (for example hex fluoromethylcyclohexane and perfluorocycloheptane. Other OSes Such as glucose, fructose or galactose; disaccharides halogenated gases include methyl chloride, fluorinated (e.g. Such as Sucrose, lactose or maltose; pentoses Such as arabi perfluorinated) ketones Such as perfluoroacetone and fluori nose, Xylose or ribose, Cl-, 3- and Y-cyclodextrins; polysac nated (e.g. perfluorinated) etherS Such as perfluorodiethyl charides Such as Starch, hydroxyethyl Starch, amylose, amy ether. The use of perfluorinated gases, for example Sulphur lopectin, glycogen, inulin, pulullan, dextran, carboxymethyl hexafluoride and perfluorocarbons Such as perfluoropro dextran, deXtran phosphate, ketodeXtran, aminoethyldext pane, perfluorobutanes and perfluoropentanes, may be par US 2005/0002865 A1 Jan. 6, 2005 ticularly advantageous in View of the recognised high Sta Traut, R. et al. in Biochemistry (1973) 12, 3266, which bility in the bloodstream of microbubbles containing such introduce a thiol group through conversion of an amino gaSeS. group, may be considered as Sulfhydryl reagents if linking occurs through the formation of disulphide bridges. Thus 0035. The reporter may be made by any convenient reagents which introduce reactive disulphide bonds into process, for example by making gas-containing or gas either the reporter or the vectors may be useful, Since linking generating formulations. Representative examples include may be brought about by disulphide exchange between the the preparation of a Suspension of gas microbubbles by vector and reporter; examples of Such reagents include contacting a Surfactant with gas and mixing them in the Ellman's reagent (DTNB), 4,4'-dithiodipyridine, methyl-3- presence of an aqueous carrier, as described in WO9115244; nitro-2-pyridyl disulphide and methyl-2-pyridyl disulphide or by atomising a Solution or dispersion of a wall-forming material in the presence of a gas in order to obtain hollow (described by Kimura, T. et al. in Analyt. Biochem. (1982) microcapsules, as described in EP 512693A1; preparation of 122, 271). Solid microSpheres by a double emulsion process, as 0039 Examples of reactive moieties capable of reaction described in U.S. Pat. No. 5,648,095; or a process for with amino groups include alkylating and acylating agents. forming hollow microcapsules by Spray-drying as described Representative alkylating agents include: in EP 68.1843A2; or preparing gas-filled liposomes by 0040 i) C-haloacetyl compounds, which show speci Shaking an aqueous Solution comprising a lipid in the ficity towards amino groups in the absence of reactive presence of a gas as described in U.S. Pat. No. 5,469,854. thiol groups and are of the type X-CHCO-(where 0.036 A Suitable process for attachment of the desired X=Cl, Br or I), e.g. as described by Wong, Y-H. H. in vector to the reporter comprises a Surface modification of the Biochemistry (1979) 24, 5337; preformed reporter with a Suitable linker employing reactive 0041) ii) N-maleimide derivatives, which may react groups on the Surface of both the reporter and vector. It may with amino groups either through a Michael type be particularly advantageous physically to mix the reporter reaction or through acylation by addition to the ring material with the vector-containing Substance at any Step of carbonyl group as described by Smyth, D. G. et al. in the process. Such a proceSS will result in incorporation or an J. Am. Chem. Soc. (1960) 82, 4600 and Biochem. J. attachment of the vector to the reporter. An optional proceSS (1964) 91, 589; Step may remove the excess of Vector not bound to the reporter by Washing the gas-containing particles following 0042) iii) aryl halides such as reactive nitrohaloaro Separation, by for example, floatation. A preferred aspect is matic compounds, the use of lipopeptide Structures incorporating functional 0043 iv) alkylhalides as described by McKenzie, J. A. groupS Such as thiol, maleimide biotin etc. which can be et al. in J. Protein Chem. (1988) 7, 581; premixed if desired with other reporter molecules before formation of gas-containing agents. The attachment of Vec 0044 v) aldehydes and ketones capable of Schiff's tor molecules may be carried out using the linker reagents base formation with amino groups, the adducts formed listed below. usually being Stabilised through reduction to give a Stable amine; 0037 Linking of a reporter unit to the desired vectors may be achieved by covalent or non-covalent means, usually 0045 vi) epoxide derivatives such as epichlorohydrin involving interaction with one or more functional groups and bisoxiranes,which may react with amino, Sulfhy located on the reporter and/or vectors. Examples of chemi dryl or phenolic hydroxyl groups, cally reactive functional groups which may be employed for 0046 vii) chlorine-containing derivatives of S-triaz this purpose include amino, hydroxyl, Sulfhydryl, carboxyl, ines, which are very reactive towards nucleophiles Such and carbonyl groups, as well as carbohydrate groups, vicinal as amino, Sufhydryl and hydroxy groups; diols, thioethers, 2-aminoalcohols, 2-aminothiols, guanidi nyl, imidazolyl and phenolic groups. 0047 viii) aziridines based on s-triazine compounds detailed above, e.g. as described by Ross, W. C.J. in 0.038 Covalent coupling of reporter and vectors may Adv. Cancer Res. (1954) 2, 1, which react with nucleo therefore be effected using linking agents containing reac philes Such as amino groups by ring opening, tive moieties capable of reaction with Such functional groups. Examples of reactive moieties capable of reaction 0048 ix) Squaric acid diethyl esters as described by with Sulfhydryl groups include C-haloacetyl compounds of Tietze, L. F. in Chem. Ber. (1991) 124, 1215; and the type X-CHCO- (where X=Br, Clor I), which show 0049 x) C-haloalkyl ethers, which are more reactive particular reactivity for Sulfhydryl groups but which can also alkylating agents than normal alkyl halides because of be used to modify imidazolyl, thioether, phenol and amino the activation caused by the ether oxygen atom, e.g. as groups as described by Gurd, F. R. N. in Methods Enzymol. described by Benneche, T. et al. in Eur. J. Med. Chem. (1967) 11,532. N-Maleimide derivatives are also considered (1993) 28, 463. Selective towards Sulfhydryl groups, but may additionally be useful in coupling to amino groupS under certain conditions. 0050 Representative amino-reactive acylating agents N-maleimides may be incorporated into linking Systems for include: reporter-vector conjugation as described by Kitagawa, T. et 0051) i) isocyanates and isothiocyanates, particularly al. in Chem. Pharm. Bull. (1981) 29, 1130 or used as aromatic derivatives, Which form stable urea and thio polymer crosslinkers for bubble stabilisation as described by urea derivatives respectively and have been used for Kovacic, P. et al. in J. Am. Chem. Soc. (1959) 81, 1887. protein crosslinking as described by Schick, A. F. et al. Reagents Such as 2-iminothiolane, e.g. as described by in J. Biol. Chem. (1961) 236, 2477; US 2005/0002865 A1 Jan. 6, 2005

0.052 ii) sulfonyl chlorides, which have been described 0063. Other potentially useful reactive moieties include by Herzig, D.J. et al. in Biopolymers (1964) 2,349 and vicinal diones Such as p-phenylenediglyoxal, which may be which may be useful for the introduction of a fluores used to react with guanidinyl groups, e.g. as described by cent reporter group into the linker; Wagner et al. in Nucleic acid Res. (1978) 5, 4065; and diazonium Salts, which may undergo electrophilic Substitu 0053) iii) Acid halides; tion reactions, e.g. as described by Ishizaka, K. and Ishizaka 0054) iv) Active esters such as nitrophenylesters or T. in J. Immunol. (1960) 85, 163. Bis-diazonium compounds N-hydroxysuccinimidyl esters; are readily prepared by treatment of aryl diamines with Sodium nitrite in acidic Solutions. It will be appreciated that 0055 v) acid anhydrides such as mixed, symmetrical functional groups in the reporter and/or vector may if or N-carboxyanhydrides; desired be converted to other functional groups prior to 0056 vi) other useful reagents for amide bond forma reaction, e.g. to confer additional reactivity or Selectivity. tion as described by Bodansky, M. et al. in Principles Examples of methods useful for this purpose include con of Peptide Synthesis (1984) Springer-Verlag, version of amines to carboxylic acids using reagents Such as dicarboxylic anhydrides, conversion of amines to thiols 0057 vii) acylazides, e.g. wherein the azide group is using reagents Such as N-acetylhomocysteine thiolactone, generated from a preformed hydrazide derivative using S-acetylmercaptoSuccinic anhydride, 2-iminothiolane or Sodium nitrite, e.g. as described by Wetz, K. et al. in thiol-containing Succinimidyl derivatives, conversion of thi Anal. Biochem. (1974) 58, 347; ols to carboxylic acids using reagents Such as a-haloacetates, 0.058 viii) azlactones attached to polymers such as conversion of thiols to amines using reagents Such as bis-acrylamide, e.g. as described by Rasmussen, J. K. ethylenimine or 2-bromoethylamine; conversion of carboxy lic acids to amines using reagents Such as carbodiimides in Reactive Polymers (1991) 16, 199; and followed by diamines; and conversion of alcohols to thiols 0059) ix) Imidoesters, which form stable amidines on using reagents Such as tosyl chloride followed by transes reaction with amino groups, e.g. as described by terification with thioacetate and hydrolysis to the thiol with Hunter, M. J. and Ludwig, M. L. in J. Am. Chem. Soc. Sodium acetate. (1962) 84, 3491. 0064 Vector-receptor coupling may also be effected 0060 Carbonyl groups such as aldehyde functions may using enzymes as Zero-length crosslinking agents; thus, for be reacted with weak protein bases at a pH such that example, transglutaminase, peroxidase and Xanthine oxidase nucleophilic protein Side-chain functions are protonated. have been used to produce crosslinked products. Reverse Weak bases include 1,2-aminothiols such as those found in proteolysis may also be used for crosslinking through amide N-terminal cysteine residues, which selectively form stable bond formation. 5-membered thiazolidine rings with aldehyde groups, e.g. as 0065. Non-covalent vector-receptor coupling may, for described by Ratner, S. et al. in J. Am. Chem. Soc. (1937) 59, example, be effected by electroStatic charge interactions e.g. 200. Other weak bases such as phenyl hydrazones may be between a polylysinyl-functionalised reporter and a poly used, e.g. as described by Heitzman, H. et al. in Proc. Natl. glutamyl-functionalised vector, through chelation in the Acad. Sci. USA (1974) 71, 3537. form of Stable metal complexes or through high affinity 0061 Aldehydes and ketones may also be reacted with binding interaction such as avidin/biotin binding. Polyl amines to form Schiff's bases, which may advantageously be ySine, coated non-covalently to the negatively charged Stabilised through reductive amination. Alkoxylamino moi membrane Surface can also increase non-specifically the eties readily react with ketones and aldehydes to produce affinity of a microbubble for a cell through charge interac stable alkoxamines, e.g. as described by Webb, R. et al. in tions. Bioconjugate Chem. (1990) 1, 96. 0066 Alternatively, vectors may be coupled to a protein 0062) Examples of reactive moieties capable of reaction or peptide Sequence known to bind phospholipids. In many with carboxyl groups include diaZO compounds Such as instances, a Single molecule of phospholipid may attach to diazoacetate esters and diazoacetamides, which react with a protein Such as a translocase, while other proteins may high Specificity to generate ester groups, e.g. as described by attach to Surfaces consisting mainly of phospholipid head Herriot R. M. in Adv. Protein Chem. (1947) 3, 169. Car groupS and So may be used to attach vectors to phospholipid boxylic acid modifying reagents Such as carbodiimides, microSpheres; one example of Such a protein is B2-glyco which react through O-acylurea formation followed by protein I (Chonn, A., Semple, S.C. and Cullis, P. R., Journal amide bond formation, may also usefully be employed; of Biological Chemistry (1995) 270, 25845-25849). Phos linking may be facilitated through addition of an amine or phatidylserine-binding proteins have been described, e.g. by may result in direct vector-receptor coupling. Useful water Igarashi, K. et al. in Journal of Biological Chemistry soluble carbodiimides include 1-cyclohexyl-3-(2-morpholi 270(49), 29075-29078. Annexins are a class of phospho nyl-4-ethyl)carbodiimide (CMC) and 1-ethyl-3-(3-dimethy lipid-binding proteins, many of which bind particularly laminopropyl)carbodiimide (EDC), e.g. as described by Zot, avidly to phosphatidyl-serine (reviewed in Raynal, P. and H. H. G. and Puett, D. in J. Biol. Chem. (1989) 264, 15552. B. Pollard. Annexins: the problem of assessing the biologi Other useful carboxylic acid modifying reagents include cal role for a gene family of multifunctional calcium- and isoxazolium derivatives Such as Woodwards reagent K, phospholipid-binding proteins”. Biochim. BiophyS. Acta chloroformates Such as p-nitrophenylchloroformate; carbo 1197: 63-93). A conjugate of a vector with such a phos nyldiimidazoles Such as 1,1'-carbonyldiimidazole; and phatidylserine-binding protein may therefore be used to N-carbalkoxydihydroquinolines such as N-(ethoxycarbo attach the vector to phosphatidylserine-encapsulated nyl)-2-ethoxy-1,2-dihydroquinoline. microbubbles. When the amino acid sequence of a binding US 2005/0002865 A1 Jan. 6, 2005 protein is known, the phospholipid-binding portion may be et al. in Am. J. Pathol. (1988) 130, 216) may crosslink Synthesised or isolated and used for conjugation with a antibody molecules and lead to formation of multi-bubble vector, thus avoiding the biological activity which may be croSS-linked assemblies of potentially increased echogenic located elsewhere in the molecule. ity. 0067. It is also possible to obtain molecules that bind 0071 So-called Zero-length linking agents, which induce specifically to the surface (or in the “membrane”) of micro direct covalent joining of two reactive chemical groups Spheres by direct Screening of molecular libraries for micro Sphere-binding molecules. For example, phage libraries dis without introducing additional linking material (e.g. as in playing Small peptides could be used for Such Selection. The amide bond formation induced using carbodiimides or enzy Selection may be made by Simply mixing the microSpheres matically) may, if desired, be used, as may agents Such as and the phage display library and eluting the phages binding biotin/avidin Systems which induce non-covalent reporter to the floating microSpheres. If desired, the Selection can be vector linking and agents which induce hydrophobic or done under “physiological conditions” (e.g. in blood) to electroStatic interactions. eliminate peptides which cross-react with blood compo 0072 Most commonly, however, the linking agent will nents. An advantage of this type of Selection procedure is that only binding molecules that do not destabilize the comprise two or more reactive moieties, e.g. as described microSpheres should be Selected, Since only binding mol above, connected by a Spacer element. The presence of Such ecules attached to intact floating microSpheres will rise to a Spacer permits bifunctional linkers to react with Specific the top. It may also be possible to introduce Some kind of functional groups within a molecule or between two differ “stress” during the Selection procedure (e.g. pressure) to ent molecules, resulting in a bond between these two com ensure that destabilizing binding moieties are not Selected. ponents and introducing extrinsic linker-derived material Furthermore the Selection could be done under Shear con into the reporter-vector conjugate. The reactive moieties in ditions e.g. by first letting the phages react with the micro a linking agent may be the same (homobifunctional agents) Spheres and then letting the microSpheres pass through a or different (heterobifunctional agents or, where several Surface coated with anti-phage antibodies under flow con dissimilar reactive moieties are present, heteromultifunc ditions. In this way it may be possible to select binders tional agents), providing a diversity of potential reagents which may resist shear conditions present in Vivo. Binding that may bring about covalent bonding between any chemi moieties identified in this way may be coupled (chemically cal Species, either intramolecularly or intermolecularly. via peptide synthesis, or at the DNA-level using recombi 0073. The nature of extrinsic material introduced by the nant vectors) to a vector molecule, constituting a general linking agent may have a critical bearing on the targeting tool for attaching any vector molecule to the microSpheres. ability and general stability of the ultimate product. Thus it 0068 Avector which comprises or is coupled to a peptide may be desirable to introduce labile linkages, e.g. containing or lipopeptide linker which contains a element capable of Spacer arms which are biodegradable or chemically Sensitive mediating membrane insertion may also be useful. One or which incorporate enzymatic cleavage Sites. Alternatively example is described by Leenhouts, J. M. et al. in Febs the Spacer may include polymeric components, e.g. to act as Letters (1995) 370(3), 189-192. Non-bioactive molecules Surfactants and enhance bubble Stability. The Spacer may consisting of known membrane insertion anchor/signal also contain reactive moieties, e.g. as described above to groups may also be used as Vectors for certain applications, enhance Surface crosslinking, or it may contain a tracer an example being the H1 hydrophobic Segment from the Na, element Such as a fluorescent probe, Spin label or radioactive K-ATPase O-subunit described by Xie, Y. and Morimoto, T. material. in J. Biol. Chem. (1995) 270(20), 11985-11991. The anchor 0074 Spacer elements may typically consist of aliphatic group may also be fatty acid(s) or cholesterol. chains which effectively Separate the reactive moieties of the 0069 Coupling may also be effected using avidin or linker by distances of between 5 and 30 A. They may also streptavidin, which have four high affinity binding sites for comprise macromolecular structures Such as poly(ethylene biotin. Avidin may therefore be used to conjugate vector to glycols). Such polymeric structures, hereinafter referred to reporter if both vector and reporter are biotinylated. as PEGS, are simple, neutral polyethers which have been Examples are described by Bayer, E. A. and Wilchek, M. in given much attention in biotechnical and biomedical appli Methods Biochem. Anal. (1980) 26, 1. This method may also cations (see e.g. Milton Harris, J. (ed) "Poly(ethylene glycol) be extended to include linking of reporter to reporter, a chemistry, biotechnical and biomedical applications” Ple proceSS which may encourage bubble association and con num Press, New York, 1992). PEGs are soluble in most Sequent potentially increased echogenicity. Solvents, including water, and are highly hydrated in aque ous environments, with two or three water molecules bound 0070. Non-covalent coupling may also utilise the bifunc to each ethylene glycol Segment; this has the effect of tional nature of bispecific immunoglobulins. These mol preventing adsorption either of other polymers or of proteins ecules can specifically bind two antigens, thus linking them. onto PEG-modified Surfaces. PEGs are known to be non For example, either bispecific IgG or chemically engineered toxic and not to harm active proteins or cells, whilst bispecific F(ab)2 fragments may be used as linking agents. covalently linked PEGs are known to be non-immunogenic Heterobifunctional bispecific antibodies have also been and non-antigenic. Furthermore, PEGS may readily be modi reported for linking two different antigens, e.g. as described fied and bound to other molecules with only little effect on by Bode, C. et al. in J. Biol. Chem. (1989) 264,944 and by their chemistry. Their advantageous Solubility and biological Staerz, U. D. et al. in Proc. Natl. Acad. Sci. USA (1986) 83, properties are apparent from the many possible uses of PEGS 1453. Similarly, any reporter and/or vector containing two or and copolymers thereof, including block copolymerS Such as more antigenic determinants (e.g. as described by Chen, Aa PEG-polyurethanes and PEG-polypropylenes. US 2005/0002865 A1 Jan. 6, 2005

0075. Appropriate molecular weights for PEG spacers of Such enzymes. They may therefore advantageously be used in accordance with the invention may, for example, be linked to therapeutic agents to permit slow release thereof. between 120 Daltons and 20 kDaltons. 0083) PolyN-(2-hydroxyethyl)methacrylamides C 0.076 The major mechanism for uptake of particles by the potentially useful spacer materials by Virtue of their low cells of the reticuloendothelial system (RES) is opsonisation degree of interaction with cells and tissues (see e.g. Volfová, by plasma proteins in blood; these mark foreign particles I., Ríhová, B. and V. R. and Vetvicka, P. in J. Bioact. Comp. which are then taken up by the RES. The biological prop Polymers (1992) 7, 175-190). Work on a similar polymer erties of PEG spacer elements used in accordance with the consisting mainly of the closely related 2-hydroxypropyl invention may serve to increase contrast agent circulation derivative showed that it was endocytosed by the mono time in a similar manner to that observed for PEGylated nuclear phagocyte System only to a rather low extent (see liposomes (see e.g. Klibanov, A. L. et al. in FEBS Letters Goddard, P., Williamson, I., Bron, J., Hutchkinson, L. E., (1990) 268, 235-237 and Blume, G. and Cevc, G. in Bio Nicholls, J. and Petrak, K. in J. Bioct. Compat. Polym. chim. Biophys. Acta (1990) 1029, 91-97). (1991) 6, 4-24. ). 0.077 Other potentially useful protein modifications 0084. Other potentially useful poymeric spacer materials which can be made to Vectors include partial or complete include: deglycosidation by neuraminidase, endoglycosydases or 0085) i) copolymers of methyl methacrylate with periodate, Since deglycosidation often results in less uptake methacrylic acid; these may be erodible (see Lee, P.I. by liver, Spleen, macrophages etc., whereas neo-glycosyla in Pharm. Res. (1993) 10, 980) and the carboxylate tion of proteins often results in increased uptake by the liver Substituents may cause a higher degree of Swelling than and macrophages); preparation of truncated forms by pro with neutral polymers, teolytic cleavage, leading to reduced size and Shorter half life in circulation; and cationisation, e.g. as described by 0086) ii) block copolymers of polymethacrylates with Kumagi et al. in J. Biol. Chem. (1987) 262, 15214-15219; biodegradable polyesters (see e.g. San Roman, J. and Triguero et al. in Proc. Natl. Acad. Sci. USA (1989) 86, Guillen-Garcia, P. in Biomaterials (1991) 12,236-241); 4761-4765; Pardridge et al. in J. Pharmacol. Exp. Therap. 0087 iii) cyanoacrylates, i.e. polymers of esters of (1989) 251, 821-826 and Pardridge and Boado, Febs Lett. 2-cyanoacrylic acid-these are biodegradable and have (1991) 288, 30-32. been used in the form of nanoparticles for Selective 0078 Increased coupling efficiency to areas of interest drug delivery (see Forestier, F., Gerrier, P., Chaumard, may also be achieved using antibodies bound to the termini C., Quero, A. M., Couvreur, P. and Labarre, C. in J. of PEG spacers (see e.g. Maruyama, K. et al. in Biochim. Antimicrob. Chemoter. (1992) 30, 173-179); Biophys. Acta (1995) 1234, 74-80 and Hansen, C. B. et al. 0088 iv) polyvinyl alcohols, which are water-soluble in Biochim. Biophys. Acta (1995) 1239, 133-144). and generally regarded as biocompatible (see e.g. 0079. In some instances it is considered advantageous to Langer, R. in J. Control. Release (1991) 16, 53–60); include a PEG component as a Stabiliser in conjunction with 0089 v) copolymers of vinyl methyl ether with maleic a vector or vectors or directly to the reporter in the same anhydride, which have been stated to be bioerodible molecule where the PEG does not serve as a Spacer. (see Finne, U., Hannus, M. and Urtti, A. in Int. J. 0080. Other representative spacer elements include struc Pharm. (1992) 78. 237-241); tural-type polysaccharides Such as polygalacturonic acid, 0090 vi) polyvinylpyrrolidones, e.g. with molecular glycosaminoglycans, heparinoids, cellulose and marine weight less than about 25,000, which are rapidly fil polysaccharides Such as alginates, chitosans and carrageen tered by the kidneys (see Hespe, W., Meier, A. M. and ans, Storage-type polysaccharides Such as Starch, glycogen, Blankwater, Y. M. in Arzeim-Forsch/Drug Res. (1977) dextran and aminodextrans, polyamino acids and methyl and 27, 1158-1162); ethyl esters thereof, as in homo- and co-polymers of lysine, 0091 vii) polymers and copolymers of short-chain glutamic acid and aspartic acid; and polypeptides, oligo aliphatic hydroxyacids Such as glycolic, lactic, butyric, nucleotides and oligosaccharides, which may or may not Valeric and caproic acids (see e.g. Carli, F. in Chim. Ind. contain enzyme cleavage Sites. (Milan) (1993) 75,494-9), including copolymers which 0081. In general, spacer elements may contain cleavable incorporate aromatic hydroxyacids in order to increase groupS Such as vicinal glycol, azo, Sulfone, ester, thioester or their degradation rate (see Imasaki, K., Yoshida, M., disulphide groups. Spacers containing biodegradable meth Fukuzaki, H., Asano, M., Kumakura, M., Mashimo, T., ylene diester or diamide groups of formula Yamanaka, H. and Nagai.T. in Int. J. Pharm. (1992) 81, 31-38); 0092 viii) polyesters consisting of alternating units of 0082 where X and Z are selected from -O-, -S-, and -NR- (where R is hydrogen or an organic group); ethylene glycol and terephthalic acid, e.g. Dacron, each Y is a carbonyl, thiocarbonyl, Sulphonyl, phosphoryl or which are non-degradable but highly biocompatible; Similar acid-forming group: m and n are each Zero or 1; and 0093) ix) block copolymers comprising biodegradable R" and Rare each hydrogen, an organic group or a group Segments of aliphatic hydroxyacid polymers (see e.g. -X.Y.(Z)-, or together form a divalent organic group Younes, H., Nataf, P. R., Cohn, D., Appelbaum, Y. J., may also be useful; as discussed in, for example, WO-A- Pizov, G. and Uretzky, G. in Biomater. Artif Cells Artif 9217436 Such groups are readily biodegraded in the pres Organs (1988) 16, 705-719), for instance in conjunc ence of esterases, e.g. in Vivo, but are stable in the absence tion with polyurethanes (see Kobayashi, H., Hyon, S. US 2005/0002865 A1 Jan. 6, 2005

H. and Ikada, Y. in “Water-curable and biodegradable prepolymers' J. Biomed. Mater. Res. (1991) 25, -continued 1481-1494); Linking agent Reactivity 1 Reactivity 2 Comments 0094 x) polyurethanes, which are known to be well ASIB(1) -SH photoreactive iod inable tolerated in implants, and which may be combined with ASBA(1) -COOH photoreactive iod inable flexible “Soft” segments, e.g. comprising poly(tetra EDC -NH. -COOH Zero-length methylene glycol), poly(propylene glycol) or poly(eth lin ylene glycol)) and aromatic "hard” segments, e.g. com GMBS -NH. -S prising 4,4'-methylenebis(phenylene isocyanate) (See Sulfo-GMBS -NH -S Wa er-soluble HSAB -NH. photoreactive e.g. Ratner, B. D., Johnston, A. B. and Lenk, T.J. in J. Sulfo-HSAB -NH. photoreactive Wa er-soluble Biomed. Mater. Res: Applied Biomaterials (1987) 21, MBS -NH. -S H 59-90; Sa Da Costa, V. et al. in J. Coll. Interface Sci. Sulfo-MBS -NH. -S H Wa er-soluble MCH carbohydrate -S H (1981) 80, 445-452 and Affrossman, S. et al. in Clinical MPBH carbohydrate -S H Materials (1991) 8, 25-31); NHS-ASA(1) -NH O OCaC ive Sulfo-NHS -NH. O OCaC ive 0.095 xi) poly(1,4-dioxan-2-ones), which may be ASA(1) regarded as biodegradable esters in View of their Sulfo-NHS-LC -NH. O OCaC ive hydrolysable ester linkages (see e.g. Song, C. X., Cui, ASA(1) X. M. and Schindler, A. in Med. Biol. Eng. Comput. PDPH carbohydrate -S H (1993) 31, S147-150), and which may include gly PNP-DTP -NH. O OCaC ive collide units to improve their absorbability (see SADP -NH O OCaC ive disulphid Bezwada, R. S., Shalaby, S. W. and Newman, H. D. J. in Agricultural and Synthetic polymers. Biodegradabil Sulfo-SADP -NH. O OCaC ive er-soluble ity and utilization (1990) (ed Glass, J. E. and Swift, G.), disulphid 167-174-ACS symposium Series, #433, Washington SAED -NH. O OCaC ive disulphid D.C., U.S.A.-American Chemical Society); SAND -NH. O OCaC ive 0096 xii) polyanhydrides such as copolymers of seba cic acid (octanedioic acid) with bis(4-carboxy-phenox SANPAH -NH. O O'CaC ive y)propane, which have been shown in rabbit studies Sulfo-SANPAH -NH O OCaC ive (see Brem, H., Kader, A., Epstein, J. I., Tamargo, R. J., O OCaC ive Domb, A., Langer, R. and Leong, K.W. in Sel. Cancer SASD(1) -NH. Ther. (1989) 5, 55-65) and rat studies (see Tamargo, R. J., Epstein, J. I., Reinhard, C. S., Chasin, M. and Brem, SAB -S H H. in J. Biomed. Mater. Res. (1989) 23, 253-266) to be sulfo-SIAB -S H Wa C-SO uble useful for controlled release of drugs in the brain SMCC -S H without evident toxic effects; Sulfo-SMCC -S H Wa C-SO uble SMPB -S H 0097 xiii) biodegradable polymers containing ortho Sulfo-SMPB -S H Wa C-SO uble ester groups, which have been employed for controlled SMPT -S H release in vivo (see Maa, Y. F. and Heller, J. in J. Sulfo-LC-SMPT -S H Wa C-SO uble Control. Release (1990) 14, 21-28); and SPDP -S H sulfo-SPDP -S H Wa C-SO uble 0098 xiv) polyphosphazenes, which are inorganic Sulfo-LC-SPDP -S H Wa C-SO uble polymers consisting of alternate phosphorus and nitro sulfo-SAMCA(2) photoreactive gen atoms (see Crommen, J. H., Vandorpe, J. and Sulfo-SAPB photoreactive Wa C-SO uble Schacht, E. H. in J. Control. Release (1993) 24, 167 Notes: 180). (1) = iodinable; 0099. The following tables list linking agents and agents (2) = fluorescent for protein modification which may be useful in preparing targetable contrast agents in accordance with the invention. 0101 Homobifunctional Linking Agents 0100 Heterobifunctional Linking Agents

Linking agent Reactivity Comments Linking agent Reactivity 1 Reactivity 2 Comments O -NH. BMH -SH ABH carbohydrate photoreactive BASED (1) photoreactive iodinable disulphide linker ANB-NOS -NH photoreactive BSCOES -NH APDP(1) -SH photoreactive iodinable Sulfo-BSCOES -NH. water-soluble disulphide DFDNB -NH. linker DMA -NH. APG -NH photoreactive reacts DMP -NH selectively DMS -NH. with Arg at pH DPDPB -SH disulphide linker 7-8 DSG -NH. US 2005/0002865 A1 Jan. 6, 2005 10

dimensional imaging techniques Such as B-mode imaging -continued (for example using the time-varying amplitude of the signal envelope generated from the fundamental frequency of the Linking agent Reactivity Comments emitted ultrasound pulse, from Sub-harmonics or higher DSP -NH. disulphide linker harmonics thereof or from Sum or difference frequencies DSS -NH derived from the emitted pulse and Such harmonics, images DST -NH. generated from the fundamental frequency or the Second Sulfo-DST -NH. water-soluble DTBP -NH. disulphide linker harmonic thereof being preferred), colour Doppler imaging DTSSP -NH disulphide linker and Doppler amplitude imaging, and combinations of the EGS -NH. two latter with any of the modalities (techniques) above. Sulfo-EGS -NH. water-soluble Surprisingly, the Second harmonic Signals from the targeted SPBP -NH. monolayer microSpheres were found to be excellent when used in accordance with the present invention. To reduce the effects of movement, Successive images of tissueS Such as 0102 Biotinylation Agents the heart or kidney may be collected with the aid of suitable Synchronisation techniques (e.g. gating to the ECG or res piratory movement of the Subject). Measurement of changes Agent Reactivity Comments in resonance frequency or frequency absorption which accompany arrested or retarded microbubbles may also biotin-BMCC -SH biotin-DPPE* preparation of usefully be made to detect the contrast agent. biotinylated liposomes 0106 The present invention provides a tool for therapeu biotin-LC-DPPE* preparation of biotinylated liposomes tic drug delivery in combination with vector-mediated direc biotin-HPDP -SH disulphide linker tion of the product to the desired site. By “therapeutic' or biotin-hydrazide carbohydrate "drug is meant an agent having a beneficial effect on a biotin-LC-hydrazide carbohydrate Specific disease in a living human or non-human animal. iodoacetyl-LC-biotin -NH. NHS-iminobiotin -NH reduced affinity for Whilst combinations of drugs and ultrasound contrast agents avidin have been proposed in, for example, WO-A-9428873 and NHS-SS-biotin -NH. disulphide linker WO-A-9507072, these products lack vectors having affinity photoactivatable biotin nucleic for particular sites and thereby show comparitively poor acids Sulfo-NHS-biotin -NH. water-soluble Specific retention at desired siteS prior to or during drug Sulfo-NHS-LC-biotin -NH. release.

Notes: 0107 Therapeutic compounds used in accordance with DPPE = dipalmitoylphosphatidylethanolamine; the present invention may be encapsulated in the interior of LC = long chain the microbubbles or attached to or incorporated in the encapsulating walls. Thus, the therapeutic compound may 0103) Agents for Protein Modification be linked to a part of the wall, for example through covalent or ionic bonds, or may be physically mixed into the encap Sulating material, particularly if the drug has similar polarity or Solubility to the membrane material, So as to prevent it Agent Reactivity Function from leaking out of the product before it is intended to act Ellman's reagent -SH quantifies/detects/protects in the body. The release of the drug may be initiated merely DTT -S.S.- reduction by wetting contact with blood following administration or as 2-mercaptoethanol -S.S.- reduction a consequence of other internal or external influences, e.g. 2-mercaptylamine -S.S.- reduction dissolution processes catalyzed by enzymes or the use of of Traut's reagent -NH. introduces -SH SATA -NH. introduces protected -SH ultrasound. The destruction of gas-containing microparticles AMCA-NHS -NH. fluorescent labelling using external ultrasound is a well known phenomenon in AMCA-hydrazide carbohydrate fluorescent labelling respect of ultrasound contrast agents, e.g. as described in AMCA-HPDP -S.S.- fluorescent labelling WO-A-9325241; the rate of release may be varied depend SBF-chloride -S.S.- fluorescent detection of -SH N-ethylmaleimide -S.S.- blocks -SH ing on the type of therapeutic application, using a specific NHS-acetate -NH blocks and acetylates -NH amount of ultrasound energy from the transducer. citraconic anhydride -NH. reversibly blocks and introduces negative charges 0108. The therapeutic agent may be covalently linked to DTPA -NH. introduces chelator the encapsulating membrane Surface using a Suitable linking BNPS-skatole tryptophan cleaves tryptophan residue agent, e.g. as described herein. Thus, for example, one may Bolton-Hunter -NH. introduces iodinable group initially prepare a phospholipid or lipopeptide derivative to which the drug is bonded through a biodegradable or Selec tively cleavable linker followed by incorporation of the 0104 Linking agents used in accordance with the inven material into the microbubble. Alternatively lipidated drug tion will in general bring about linking of vector to reporter molecules which do not require processing to liberate an or reporter to reporter with Some degree of Specificity, and active drug are incorporated directly into the membrane. The may also be used to attach one or more therapeutically active active lipidated-drug can be released by increasing the agents. Strength of the ultrasound beam. 0105 Ultrasound imaging modalities which may be used 0109 Exemplary drug delivery systems suitable for use in accordance with the invention include two- and three in the present compositions include any known therapeutic US 2005/0002865 A1 Jan. 6, 2005

drugs or active analogues thereof containing thiol groups FVIIa, FVIIIA, FIXa, tissue factor, hepatins, hirudin, hiru which are coupled to thiol containing microbubbles under log, argatroban, DEGR-rEVIIa and annexin V; inhibitors of oxidative conditions yielding disulphide bridges. In combi fibrin formation and promoters of fibrionolysis such as t-PA, nation with a vector or vectors the drug/vector modified urokinase, Plamin, Streptokinase, rt-Plasminogen Activator microbubbles are allowed to accumulate in the target tissue. and rStaphylokinase, antiangiogenic factorS Such as Administration of a reducing agent Such as reduced glu medroxyprogesteron, pentosan polySulphate, Suramin, taxol, tathione then liberates the drug molecule from the targeted thalidomide, angiostatin, interferon-alpha, metalloprotein microbubble in the vicinity of the target cell increasing the ase inhibitors, platelet factor 4, Somatostatin, thromobospon local concentration of the drug and enhancing therapeutic din; circulatory drugs. Such as propranolol, metabolic poten effect. The product may also be prepared without the thera tiatorS Such as glutathione; antitubercularS Such as peutic if desired. The drug may then be coupled to or coated p-aminoSalicylic acid, isoniazid, capreomycin Sulfate, on the microbubbles prior to use. Thus, for example, a cycloSexine, ethambutol, ethionamide, pyrazinamide, therapeutic could be added to a Suspension of microbubbles rifampin or Streptomycin Sulphate, antivirals Such as acy in aqueous media and Shaken in order to attach or adhere the clovir, amantadine, azidothymidine, ribavirin or Vidarabine; therapeutic to the microbubbles. blood vessel dilating agents Such as diltiazem, nifedipine, Verapamil, erythritol tetranitrate, isosorbide dinitrate, nitro 0110. Other drug delivery systems include vector modi glycerin or pentaerythritol tetranitrate; antibiotics Such as fied phospholipid membranes doped with lipopeptide Struc dapSone, chloramphenicol, neomycin, cefaclor, cefadroxil, tures comprising a poly-L-lysine or poly-D-lysine chain in cephalexin, cephradine, erythromycin, clindamycin, linco combination with a targeting vector. Applied to gene mycin, amoxicillin, amplicillin, bacampicillin, carbenicillin, therapy/antisense technologies with particular emphasis on dicloxacillin, cyclacillin, picloxacillin, hetacillin, methicil receptor-mediated drug delivery the microbubble carrier is lin, nafcillin, penicillin, polymyxin or tetracycline, antiin condensed with DNA or RNA via elecrostatic interaction flammatories Such as diflunisal, ibuprofen, indomethacin, with the polycation. This method has the advantage that the meclefenamate, mefenamic acid, naproxen, phenylbuta vector or vectors used for targeted delivery are not directly Zone, piroXicam, tolmetin, aspirin or Salicylates, antiproto attached to the polysine carrier moiety. The polylysine chain Zoans Such as chloroquine, metronidazole, quinine or meglu is also anchored more tightly in the microbubble membrane mine antimonate; antirheumatics Such as penicillamine; due to the presence of the lipid chains. The use of ultrasound narcoticS Such as paregoric, opiates Such as codeine, mor to increase the effectiveness of delivery is also considered phine or opium; cardiac glycosides Such as deslaneside, useful. digitoxin, digoxin, digitalin or digitalis; neuromuscular 0111 Alternatively free polylysine chains are firstly blockerS Such as atracurium meSylate, gallamine triethio modified with drug or vector molecules then condensed onto dide, hexafluorenium bromide, metocurine iodide, pancuro the negative Surface of targeted microbubbles. nium bromide, Succinylcholine chloride, tubocurarine chlo ride or vecuronium bromide, Sedatives Such as amobarbital, 0112 Representative and non-limiting examples of drugs amobarbital Sodium, apropbarbital, butabarbital Sodium, useful in accordance with the invention include antineoplas chloral hydrate, ethchlorVynol, ethinamate, flurazepam tic agents Such as Vincristine, vinblastine, Vindesline, buSul hydrochloride, glutethimide, methotrimeprazine hydrochlo fan, chlorambucil, Spiroplatin, cisplatin, carboplatin, meth ride, methyprylon, midazolam hydrochloride, paraldehyde, otrexate, adriamycin, mitomycin, bleomycin, cytosine pentobarbital, Secobarbital Sodium, talbutal, temazepam or arabinoside, arabinosyladenine, mercaptopurine, mitotane, triazolam, local anaesthetics Such as bupivacaine, chlorop procarbazine, dactinomycin (antinomycin D), daunorubicin, rocaine, etidocaine, lidocaine, mepivacaine, procaine or doxorubicin hydrochloride, taxol, plicamycin, aminoglute tetracaine; general anaesthetics Such as droperidol, etomi thimide, estramustine, flutamide, leuprolide, megestrol date, fentanyl citrate with droperidol, ketamine hydrochlo acetate, tamoxifen, testolactone, triloStane, amsacrine ride, methohexital Sodium or thiopental and pharmaceuti (m-AMSA), asparaginase (L-asparaginase), etoposide, cally acceptable Salts (e.g. acid addition salts. Such as the interferon a-2a and 2b, blood products Such as hematopor hydrochloride or hydrobromide or base Salts Such as Sodium, phyrins or derivatives of the foregoing, biological response calcium or magnesium Salts) or derivatives (e.g. acetates) modifierS Such as muramylpeptides, antifungal agents Such thereof. Other examples of therapeutics include genetic as ketoconazole, nyStatin, griseofulvin, flucytosine, micona material Such as nucleic acids, RNA, and DNA of natural or Zole or amphotericin B; hormones or hormone analogues synthetic origin, including recombinant RNA and DNA. Such as growth hormone, melanocyte Stimulating hormone, DNA encoding certain proteins may be used in the treatment estradiol, beclomethasone dipropionate, betamethasone, of many different types of diseases. For example, tumor cortisone acetate, dexamethasone, flunisolide, hydrocorti necrosis factor or interleukin-2 genes may be provided to Sone, methylprednisolone, paramethasone acetate, predniso treat advanced cancers, thymidine kinase genes may be lone, prednisone, triamcinolone or fludrocortisone acetate; provided to treat ovarian cancer or brain tumors, interleu Vitamins Such as cyanocobalamin or retinoids; enzymes Such kin-2 genes may be provided to treat neuroblastoma, malig as alkaline phosphatase or manganese Superoxide dismu nant melanoma or kidney cancer; and interleukin-4 genes tase, antiallergic agents Such as amelexanoX, inhibitors of may be provided to treat cancer. tissue factor Such as monoclonal antibodies and Fab frag ments thereof, Synthetic peptides, nonpeptides and com 0113 Lipophilic derivatives of drugs linked to the pounds downregulating tissue factor expression; inhibitors microbubble wall through hydrophobic interactions may of platelets such as, GPIa, GPIb and GPIb-IIIa, ADP exhibit therapeutic effects as part of the microbubble or after receptors, thrombin receptors, Von Willebrand factor, proS release from the microbubble, e.g. by use of ultrasound. If taglandins, aspirin, ticlopidin, clopigogrel and reopro; the drug does not possess the desired physical properties, a inhibitors of coagulation protein targets Such as: FIIa FVa, lipophilic group may be introduced for anchoring the drug to US 2005/0002865 A1 Jan. 6, 2005 the membrane. Preferably the lipophilic group should be blood vessels. Even if the target antigens are found on many introduced in a way that does not influence the in vivo cell types, the microSpheres will attach exclusively to endot potency of the molecule, or the lipophilic group may be helial cells. cleaved releasing the active drug. Lipophilic groupS may be 0117 So-called prodrugs may also be used in agents introduced by various chemical means depending on func according to the invention. Thus drugs may be derivatised to tional groups available in the drug molecule. Covalent alter their physicochemical properties and to adapt them for coupling may be effected using functional groups in the drug inclusion into the reporter; Such derivatised drugs may be molecule capable of reacting with appropriately functiona regarded as prodrugs and are usually inactive until cleavage lised lipophilic compounds. Examples of lipophilic moieties of the derivatising group regenerates the active form of the include branched and unbranched alkyl chains, cyclic com drug. pounds, aromatic residues and fused aromatic and non 0118. By targeting a gas-filled microbubble containing a aromatic cyclic Systems. In Some instances the lipophilic prodrug-activating enzyme to areas of pathology one may moiety will consist of a Suitably functionalised Steroid, like image targeting of the enzyme, making it possible to visua cholesterol and related compounds. Examples of functional lise when the micobubbles are targeted properly to the area groups particularly Suitable for derivatisation include of pathology and at the same time have disappeared from nucleophilic groups like amino, hydroxy and Sulfhydryl non-target areas. In this way one can determine the optimal groupS. Suitable processes for lipophilic derivatisation of time for injection of prodrug into individual patients. any drug containing a Sulfhydryl group, like captopril, may 0119) Another alternative is to incorporate the prodrug, include direct alkylation, e.g. reaction with an alkyl halide the prodrug-activating enzyme and the vector in the same under basic conditions and thiol ester formation by reaction microbubble in a system where the prodrug will only be with an activated carboxylic acid. Representative examples activated after Some external Stimulus. Such a Stimulus may, of derivatisation of any drug having carboxylic functions, for example, be a tumour-specific protease as described like atenolol and chlorambucil, include amide and ester formation by coupling of amines and alcohols, respectively, above, or bursting of the bubbles by external ultrasound after possesing requested physical properties. A preferred aspect the desired targeting has been achieved. is attachment of cholesterol to a therapeutic compound by 0120) Therapeutics may easily be delivered in accor forming a degradable ester bond. dance with the invention to diseased or necrotic areas including the heart and vasculature in general, and to the 0114) A preferred application of the present invention liver, Spleen and kidneys and other regions Such as the relates to angiogenesis, which is the formation of new blood lymph System, body cavities or gastrointestinal System. vessels by branching from existing vessels. The primary 0121 Products according to the present invention may be Stimulus for this proceSS may be inadequate Supply of used for targeted therapeutic delivery either in Vivo or in nutrients and oxygen (hypoxia) to cells in a tissue. The cells Vitro. In the latter context the products may be useful in in may respond by Secreting angiogenetic factors, of which Vitro Systems. Such as kits for diagnosis of different diseases there are many; one example is vascular endothelial growth or characterisation of different components in blood or tissue factor. These factors initiate the Secretion of proteolytic Samples. Similar techniques to those used to attach certain enzymes which break down the proteins of the basement blood components or cells to polymer particles(e.g. mono membrane, as well as inhibitors which limit the action of disperse magnetic particles) in vitro to separate them from a these potentially harmful enzymes. The combined effect of Sample may be used in the present invention, using the low loSS of attachment and Signals from the receptorS for angio density of the reporter units in agents of the present inven genetic factorS is to cause the endothelial cells to move, tion to effect Separation of the gas-containing material by multiply, and rearrange themselves, and finally to Synthetise floatation and repeated Washing. a basement membrane around the new vessels. 0.122 Vectors which may be usefully employed in gen 0115 Tumors must initiate angiogenesis when they reach erating multiple-Specific targetable contrast agents accord millimeter Size in order to keep up their rate of growth. AS ing to the invention include the following: angiogenesis is accompanied by characteristic changes in the endothelial cells and their environment, this process is a 0123 i) Antibodies, which can be used as vectors for promising target for therapeutic intervention. The transfor a very wide range of targets, and which have advanta mations accompanying angiogenesis are also very promis geous properties Such as very high Specificity, high ing for diagnosis, a preferred example being malignant affinity (if desired), the possiblity of modifying affinity disease, but the concept also shows great promise in inflam according to need etc. Whether or not antibodies will be mation and a variety of inflammation-related diseases. These bioactive will depend on the Specific vector/target factors are also involved in re-vascularisation of infarcted combination. Both conventional and genetically engi parts of the myocardium, which occurs if a Stenosis is neered antibodies may be employed, the latter permit released within a short time. ting engineering of antibodies to particular needs, e.g. as regards affinity and Specificity. The use of human 0116. A number of known receptors/targets associated antibodies may be preferred to avoid possible immune with angiogenesis are given in Subsequent tables. Using the reactions against the vector molecule. A further useful targeting principles described in the present disclosure, class of antibodies comprises So-called bispecific anti angiogenesis mav be detected by the majority of the imaging bodies, i.e. antibodies having Specificity for two dif modalities in use in medicine. Contrast-enhanced ultrasound ferent target molecules in one antibody molecule. Such may possess additional advantages, the contrast medium antibodies may, for example, be useful in promoting being microSpheres which are restricted to the interior of formation of bubble clusters and may also be used for US 2005/0002865 A1 Jan. 6, 2005 13

various therapeutic purposes, e.g. for carrying toxic 0128 vi) Various small molecules, including bioactive moieties to the target. Various aspects of bispecific compounds known to bind to biological receptors of antibodies are described by McGuinness, B. T. et al. in Various kinds. Such vectors or their targets may be used Nat. Biotechnol. (1996) 14, 1149-1154; by George, A. to generate non-bioactive compounds binding to the J. et al. in J. Immunol. (1994) 152, 1802-1811; by Same targets. Bonardi et al. in Cancer Res. (1993) 53, 3015-3021; 0129 vii) Vector molecules may be selected from and by French, R. R. et al. in Cancer Res. (1991) 51, combinatorial libraries without necessarily knowing 2353-2361. the exact molecular target, by functionally selecting (in 0124 ii) Cell adhesion molecules, their receptors, vitro, ex vivo or in vivo) for molecules binding to the cytokines, growth factors, peptide hormones and pieces region/structure to be imaged. thereof. Such vectors rely on normal biological protein protein interactions with target molecule receptors, and 0130 viii) Various small molecules, including bioac So in many cases will generate a biological response on tive compounds known to bind to biological receptors binding with the targets and thus be bioactive; this may of various kinds. Such vectors or their targets may be be a relatively insignificant concern with vectors which used for generate non-bioactive compounds binding to target proteoglycans. the same targets. 0125 iii) Non-peptide agonists/antagonists or non-bio 0131 ix) Proteins or peptides which bind to glu active binders of receptors for cell adhesion molecules, cosamino-glycan Side chains e.g. haparan Sulphate, cytokines, growth factors and peptide hormones. This including glucosoaminoglycan-binding portions of category may include non-bioactive vectors which will larger molecules, Since binding to Such glucoSoami be neither agonists nor antagonist but which may noglycans Side chains does not result in a biological nonetheless exhibit valuable targeting ability. response. Proteoglycans are not found on red blood cells, thus eliminating undesirable adsorption to these 0126 iv) Oligonucleotides and modified oligonucle cells. otides which bind DNA or RNA through Watson-Crick or other types of base-pairing. DNA is usually only 0.132. Other peptide vectors and lipopeptides thereof of present in extracellular space as a consequence of cell particular interest for targeted ultrasound imaging are listed damage, So that Such oligonucleotides, which will below: Atherosclerotic plaque binding peptides Such as usually be non-bioactive, may be useful in, for YRALVDTLK, YAKFRETILEDTRDRMY and example, targeting of necrotic regions, which are asso RALVDTEFKVKQEAGAK; Thrombus binding peptides ciated with many different pathological conditions. such as NDGDFEEIPEEYLO and GPRG; Platelet binding Oligonucleotides may also be designed to bind to peptides such as PLYKKIIKKLLES; and cholecystokinin, specific DNA- or RNA-binding proteins, for example C.-melanocyte-stimulating hormone, heat Stable enterotoxin transcription factors which are very often highly over 1, vasoactive intestinal peptide, Synthetic alpha-M2 peptide expressed or activated in tumour cells or in activated from the third heavy chain complementarity-determining immune or endothelial cells. Combinatorial libraries region and analogues thereof for tumor targeting. may be used to Select oligonucleotides which bind Specifically to possible target molecules (from proteins 0133. The following tables identify various receptors to caffeine) and which therefore may be employed as which may be targeted by particular types of vectors and vectors for targeting. consequent areas of use for targetable ultrasound contrast 0127 v) DNA-binding drugs may behave similarly to agents according to the invention which contain Such vec oligonuclotides, but may exhibit biological acitvity torS. and/or toxic effects if taken up by cells. 0134) Protein and Peptide Vectors-Antibodies

Vector ype Receptor Comments/areas of use Ref antibodies CD34 ar diseases in general, (general) vessel wall (e.g myocardium), activated ium, immune cells antibodies ICAM-1 ar diseases i (general) WeSSC myocardium), ac ium, i antibodies ICAM-2 ar diseases (general) WeSSCI Wa myocardium), ac ium, immune cells antibodies ICAM-3 ar diseases in general, (general) vessel wall (e.g myocardium), activated helium, immune cells antibodies E-selectin ar diseases in general, (general) normal vessel wall (e.g myocardium), activated endothelium, immune cells US 2005/0002865 A1 Jan. 6, 2005 14

-continued Vector type Receptor Comments/areas of use Ref antibodies P-selectin vascular diseases in general, (general) normal vessel wall (e.g myocardium), activated endothelium, immune cells antibodies PECAM vascular diseases in general, (general) normal vessel wall (e.g myocardium), activated endothelium, immune cells antibodies Integrins, vascular diseases in general, (general) e.g. VLA-1, normal vessel wall (e.g VLA-2, VLA-3, myocardium), activated VLA-4, VLA-5, endothelium, immune cells VLA-6, fc., f1Cls, f1Clv, LFA-1, Mac-1, CD41a, etc. antibodies GlyCAM Vessel wall in lymph nodes (general) (quite specific for lymph nodes) antibodies MadCam 1 Vessel wall in lymph nodes (general) (quite specific for lymph nodes) antibodies fibrin Thrombi (general) antibodies Tissue Activated endothelium, (general) Factor tumours antibodies Myosin Necrosis, myocardial (general) infaction antibodies CEA Tumours (general) (carcinoembryonal antigen) antibodies Mucins Tumours (general) antibodies Multiple Tumours (general) drug resistance protein antibodies Prostate Prostate cancer (general) specific antigen antibodies Cathepsin Tumours (proteases of various (general) B kinds are often more or less specifically overexpressed in a variety of tumours - Cathepsin B is such a protease) antibodies Transferrin Tumors, (general) receptor vessel wall MOAb 9.2.27 Tumours Antigen upregulated on cell growth VAP-1 Adhesion molecule Band 3 Upregulated during phagocytic protein activity CD44 tumor cells B2- general microglobulin MHC class I general antibody integrin tumors, angiogenisis C Civ3 antibodies CD44 tumour cells al antibodies B2- general b microglobulin antibodies MHC class 1 general b a.) Heider, K. H., M. Sproll, S. Susani, E. Patzelt, P. Beaumier, E. Ostermann, H. Ahorn, and G. R. Adolf. 1996. “Characterization of a high-affinity monoclonal antibody specific for CD44v6 as candidate for immunotherapy of squamous cell carcinomas'. Cancer Immunology Immunotherapy 43: 245-253. b). I. Roitt, J. Brostoff, and D. Male. 1985. Immunology, London: Gower Medical Pub lishing, p. 4.7 c.) Stromblad, S., and D. A. Cheresh. 1996. "Integrins, angiogenesis and vascular cell survival. Chemistry & Biology 3: 881-885. US 2005/0002865 A1 Jan. 6, 2005 15

0135) Protein and Peptide Vectors–Cell Adhesion Mol ecules etc.

Vector type Receptor Comments/areas of use Ref L-selectin CD34 vascular diseases in MadCAM1 general, normal vessel wall GlyCam 1 (e.g. myocardium), activated endothelium, Lymph nodes Other selectins carbohydrate vascular diseases in ligands general, normal vessel wall (sialyl Lewis X) (e.g. myocardium), activated heparan sulfate endothelium RGD-peptides integrins angiogenisis PECAM PECAM, Endothelium, and other Cells in immune system Integrins, Laminin, Endothelium, e.g. VLA-1, VLA-2, collagen, Vessel wall VLA-3, VLA-4, fibronectin, etc. VLA-5, VLA-6, VCAM-1, f51C-7, 31Cls. thrombospondin, BCtv, LFA-1, Mac-1, vitronectin CD41a, etc. etc. Integrin Integrins, Cells in immune system receptors, e.g. VLA-1, vessel wall e.g. Laminin, VLA-2, VLA-3, etc. collagen, VLA-4, VLA-5, fibronectin, VLA-6, B.C., VCAM-1, f51Cls, f1Clv, thrombospondin, LFA-1, Mac-1, vitronectin CD41a, etc. etc. Nerve cell proteoglycans angiogenesis C adhesion N-CAM molecule (N-CAM) (homophilic) RGD-peptides integrins

0.136 Vectors Comprising Cytokines/Growth Factors/ Peptide Hormones and Fragments Thereof -continued Vector type Receptor Comments fareas of use Ref Vector type Receptor Comments/areas of use Ref Insulin like IGF-I receptor Tumours, growth factor I other growing tissues Epidermal growth EGF-receptor or Tumours Atrial ANF-receptors Kidney, factor related Natriuretic vessel wall receptors Factor Nerve growth NGF-receptor Tumours factor Vasopressin Vasopressin Kidney, Somatostatin ST-receptor Tumours receptor vessel wall Endothelin Endothelin- Vessel wall VEGF VEGF-receptor Endothelium, receptor regions of angiogenesis Interleukin-1 IL-1-receptor Inflammation, activated Fibroblast FGF-receptors, Endothelium cells of different kinds growth factors Proteoglycans Angiogenesis Interleukin-2 IL-2-receptor Inflammation, activated Schwann cell proteoglycans cells of different kinds growth factor specific Chemokines (ca. Chemokine Inflammation receptors 20 different receptors, cytokines partly proteoglycans sharing receptors) 0137 Miscellaneous Protein and Peptide Vectors Tumour necrosis TNF-receptors Inflammation factor Parathyroid PTH-receptors Bone diseases hormone Kidney diseases Bone BMP-receptors Bone Diseases Vector type Receptor Comments fareas of use Ref Morphogenetic Protein Streptavidin Kidney Kidney diseases Calcitonin CT-receptors Bone diseases Bacterial Fibronectin Vessel wall Colony Corresponding Endothelium fibronectin stimulating specific binding proteins factors (G-CSF, receptors, Fc-part of Fc-receptors Monocytes GM-CSF, M-CSF, proteoglycans antibodies macrophages IL-3) liver US 2005/0002865 A1 Jan. 6, 2005 16

-continued -continued Vector type Receptor Comments/areas of use Ref Vector type Receptor Comments fareas of use Ref Transferrin transferrin- Tumours non-peptide RGD- integrins Cells in immune system receptor vessel walls analogues vessel wall etc. Streptokinase? thrombi thrombi tissue plasminogen activator 0.139 Vectors Comprising Anti-angiogenic Factors Plasminogen, Fibrin Thrombi, plasmin tumours Mast cell proteoglycans proteinases Elastase proteoglycans Vector type Target Comments/areas of use Ref Leipolein proteoglycans Angiostatin EC of tumors plasminogen fragment K Coagulation proteoglycans cartilage-derived EC of tumors J inhibitor E. I B-Cyclodextrin tumors, C tly proteoglycans tetradecasulfate inflammation dismutase fumagillin and analogs A. E inflammation Hepatin cofactor proteoglycans Interferon-C. EC of tumors K Interferon-Y EC of tumors E Retinal survival O egg ycans interleukin-12 EC of tumors E factor specific linomide tumors, A. - receptors inflammation Heparin-binding proteoglycans medroxyprogesterone EC of tumors K brain mitogen specific metalloproteinase EC of tumors K receptors inhibitors Apollipoprotein, proteoglycans pentosan polysulfate EC of tumors K C.S. specific platelet factor 4 EC of tumors M apolipoprotein B receptors Somatostatin EC of tumors K (e.g., LDL Suramin EC of tumors K receptor) Taxol EC of tumors K Apollipoprotein E LDL receptor thalidomide EC of tumors K proteoglycans Thrombospondin EC of tumors K Adhesion- proteoglycans promoting proteins,e.g. Purpurin 0140 Vectors Comprising Angiogenic FactFactors Viral coat proteoglycans proteins, e.g. HIV. Herpes Microbial "Antigen 85” fibronectin, collagen, Comments/areas adhesins complex of fibrinogen, vitronectin, Vector type Targe of use Ref mycobacteria heparan sulfate B-amyloid proteoglycans f-amyloid accumulates in is past EC of tumors K precursor Alzheimer's disease SE O EC of tumors K Tenascin, heparan sulfate, Angiogenin EC of tumors K e.g. tenascin C integrins Angiotensin II EC of tumors K basement membrane tumors e.g., tenascin, M components collagen IV 0138 Vectors Comprising Non-peptide Agonists/An- basicgrowth fibroblast factor EC of tumors K tagonists of Cytokines/Growth Factors/Peptide Hormones/ Bradykinin EC of tumors K Cell Adhesion Molecules Calcitonin gene- EC of tumors K related peptide epidermal growth EC of tumors K factor Fibrin tumors K Vector type Receptor Comments/areas of use Ref Fibrinogen tumors K Heparin EC of tumors K Endothelin Endothelin Vessel wall histamine EC of tumors K antagonist receptor hyaluronic acid EC of tumors K Desmopressin Vasopressin Kidney or fragments (vasopressin receptor Vessel wall thereof analogue) Interleukin-1C. EC of tumors K Demoxytocin Oxytocin Reproductive organs, laminin, laminin EC of tumors K (Oxytocin Receptor Mammary glands, fragments analogue) Brain nicotinamide EC of tumors K Angiotensin II Angiotensin II Vessel wall platelet acti- EC of tumors K receptor receptors brain vating factor antagonists adrenal gland Platelet-derived EC of tumors K CV-11974, endothelial TCV-116 growth factor US 2005/0002865 A1 Jan. 6, 2005

-continued -continued

Comments/areas Comments/areas Vector type Target of use Ref Vector type Target of use Ref Tumor necrosis factor-C. EC of tumors K prostaglandins EC of tumors K vascular endo- EC of tumors K E1, E2 thelial growth spermine EC of tumors K factor/vascular spermine EC of tumors K permeability factor Substance P EC of tumors K vitronectin A. transforming EC of tumors K growth factor-C. transforming EC of tumors K 0141 Vector Molecules Other than Recognized Angio growth factor-f genetic Factors with Known Affinity for Receptors Associ ated with Angiogenesis

Vector type Target Comments/areas of use Ref angiopoietin umors, B inflammation C2-antiplasmin umors, inflammation combinatorial umors, for instance: compounds libraries, compounds inflammation that bind to basement from membrane after degradation endoglin umors, D inflammation endosialin umors, D inflammation endostatin collagen umors, M ragment inflammation Factor VII related umors, D antigen inflammation fibrinopeptides umors, ZC inflammation fibroblast growth umors, E actor, basic inflammation hepatocyte growth umors, I actor inflammation insulin-like growth umors, R actor inflammation interleukins umors, e.g.: IL-8 I inflammation eukemia inhibitory umors, A. actor inflammation metalloproteinase umors, e.g., batimastat E inhibitors inflammation Monoclonal antibodies umors, for instance: to inflammation angiogenetic factors or their receptors, or to components of the fibrinolytic system peptides, for instance umors, B, Q cyclic RGDFV inflammation placental growth factor umors, J inflammation placental umors, E proliferin-related inflammation protein plasminogen umors, M inflammation plasminogen activators umors, D inflammation plasminogen activator umors, U, V inhibitors inflammation platelet activating umors, inhibitors of angiogenesis A. actor antagonists inflammation platelet-derived growth umors, E actor inflammation US 2005/0002865 A1 Jan. 6, 2005

-continued Vector type Target Comments/areas of use Ref pleiotropin umors, ZA inflammation proliferin umors, E inflammation proliferin related umors, E protein inflammation selectins umors, e.g., E-selectin D inflammation SPARC umors, M inflammation snake venoms umors, O (RGD-containing) inflammation Tissue inhibitor of umors, eg, TIMP-2 U metalloproteinases inflammation thrombin umors, H inflammation thrombin-receptor-activating umors, H tetradecapeptide inflammation thymidine phosphorylase umors, D inflammation tumor growth factor umors, ZA inflammation

0.142 ReceptorS/Targets ASSociated with Angiogenesis -continued Vector type Target Comments fareas of use Ref Vector type Target Comments/areas of use Ref Jagged gene product umors, T biglycan umors, dermatan sulfate X allaO. inflammation proteoglycan Ly-6 tumors, a lymphocyte activation N CD34 umors, L inflammation protein inflammation matrix umors, D CD44 umors, F metalloproteinases inflammation inflammation MHC class II umors, collagen type I, IV, umors, A. allaO. VI, VIII inflammation Notch gene product tumors, T decorin umors, dermatan sulfate Y allaO. inflammation proteoglycan Osteopontin OS Z. dermatan sulfate umors, X PECAM tumors, alias CD31 P proteoglycans inflammation allaO. endothelin umors, G plasminogen activator tumors, ZC inflammation receptor allaO. endothelin receptors umors, G platelet-derived growth tumors, E inflammation factor receptors inflammation fibronectin OS P Selectins: E-, P- tumors, D FIk-1/KDR, Flt-4 umors, VEGF receptor D allaO. inflammation Sialyl Lewis-X umors, blood group antigen M FLT1 (fms-like umors, VEGF-A receptor O allaO. yrosine kinase) inflammation stress proteins: umors, molecular chaperones heparan sulfate umors, P glucose regulated, heat inflammation inflammation shock families and others hepatocyte growth umors, I syndecan tumors, T actor receptor (c-met) inflammation allaO. insulin-like growth umors, R thrombospondin tumors, M actorfmannose-6- inflammation allaO. phosphate receptor TIE receptors umors, tyrosine kinases with Ig- E integrins: Tumors, D, inflammation and EGF-Iike domains fs and fs, inflammation P tissue factor tumors, Z. integrin Cly?is, - - allaO. integrin Caf1, laminin receptor tissue inhibitor of umors, e.g., TIMP-2 U integrins C6, metalloproteinases inflammation integrins B1, transforming growth umors, E integrin C.2?1, factor receptor inflammation integrin Cly?is, urokinase-type umors, D integrin Cls subunit of the fibronectin plasminogen activator inflammation receptor receptor integrin Clvfs, Vascular cellular umors, D fibrin receptors. adhesion molecule inflammation Intercellular adhesion tumors, P (VCAM) molecule-1 and -2 inflammation Vascular endothelial umors, US 2005/0002865 A1 Jan. 6, 2005

-continued -continued

Vector type Target Comments/areas of use Ref Vector type Receptor Comments fareas of use Ref growth factor related inflammation protein oligos with As for As for unmodified oligos Vascular endothelial tumors, K terminal unmodified growth factor-A inflammation phosphorothioate oligos receptor 2'-fluoro oligos As for As for unmodified oligos von Willebrand factor- tumors, L unmodified related antigen inflammation oligos 2'-amino oligos As for As for unmodified oligos unmodified 0143 Oligonucleotide Vectors oligos DNA-binding As for Increased binding affinity drugs conjugated unmodified as compared to pure oligos Vector type Receptor Comments/areas of use Ref to oligos (for oligos Oligonucleotides DNA made Tumours examples, see complementary to available by Myocardial infarction below) repeated necrosis All other diseases that Peptide Nucleic As for Increased binding affinity Sequences, e.g. involves necrosis genes for Acids (PNAs, unmodified and stability compared to ribosomal RNA, oligonucleotidss oligos standard oligos. Alu-sequences with a peptide Oligonucleotides DNA made Tumours complementary to available by backbone) disease-specific necrosis in a mutations (e.g. region of the mutated relevant disease oncogenes). 0145 Nucleoside and Nucleotide Vectors Oligonucleotides DNA of infective Viral or bacterial complementary to agent infections DNA of infecting agent. Triple or As in above As in above examples Vector type Receptor Comments fareas of use Ref quadruple-helix examples forming Adenosine or Adenosine Vessel wall Oligonucleotides analogues receptors Heart Oligonucleotides DNA-binding Tumours ADP, UDP, UTP Various Many tissues, e.g. brain, with recognition protein, e.g. Activated endothelium and others nucleotide spinal cord, kidney, spleen sequence for transcription Activated immune cells receptors DNA-or RNA- factors (often binding proteins overexpressed/ activated in tumours Or 0146 Receptors Comprising DNA-binding Drugs activated endotheliumf immune cells Vector type Receptor Comments fareas of use Ref acridine DNA made Tumours, 0144) Modified Oligonucleotide Vectors derivatives available by Myocardial infarction and distamycin necrosis all other diseases involving netropsin necrosis or other processes actinomycin D liberating DNA from cells echinomycin Vector type Receptor Comments fareas of use Ref bleomycin etc. Phosphorothioate As for As for unmodified oligos oligos unmodified oligos 2'-O-methyl As for As for unmodified oligos 0147 Receptors Comprising Protease Substrates substituted unmodified oligos oligos circular oligos As for As for unmodified oligos unmodified Vector type Receptor Comments fareas of use Ref oligos oligos As for As for unmodified oligos Peptidic or non Cathepsin B Tumours, a variety of which containing unmodified peptidic may more or less specifically hairpin oligos substrates overexpress proteases of Structure to various kinds, e.g. decrease Cathepsin B degradation US 2005/0002865 A1 Jan. 6, 2005

0148 Receptors Comprising Protease Inhibitors

Vector type Receptor Comments/areas of use Ref Peptidic or non Cathepsin B Tumours, a variety of which peptidic may more or less specifically inhibitors overexpress proteases of e.g. N-acetyl various kinds, e.g. Leu-Leu Cathepsin B norleucinal bestatin Aminopeptidases Tumours, ((2S,3R)-3- e.g. on cell surfaces Amino-2-hydroxy 4-phenyl butanoyl-L- eucine hydrochloride) Pefabloc (4-(2- Serine proteases Tumours, aminoethyl)- vessel wall benzenesulfonyl etc. fluoride hydrochloride) Commercially Angiotensin Endothelial cells available converting inhibitors enzyme e.g. kaptopril enalapri ricionopril Low specificity Coagulation Vessel wall injury, non-peptidic factors tumours, compounds etc. Protease nexins proteoglycans (extracellular protease inhibitors) Antithrombin proteoglycans, Coagulation actors

0149 Vectors from Combinatorial Libraries

Vector type Receptor Comments/areas of use Ref Antibodies with Any of above Any diseased or normal Structure argets - or may structure of interest, e.g. determined be unknown when thrombi, tumours or walls of during make functional myocardial vessels generation selection of process vector binding O chosen diseased Structure Peptides with Any of above Any diseased or normal sequence argets - or may structure of interest, e.g. determined be unknown when thrombi, tumours or walls of during make functional myocardial vessels generation selection of process vector binding O chosen diseased Structure Oligonucleotides Any of above Any diseased or normal with sequence argets - or may structure of interest, e.g. determined be unknown when thrombi, tumours or walls of during make functional myocardial vessels generation selection of process vector binding O chosen diseased Structure US 2005/0002865 A1 Jan. 6, 2005 21

-continued Vector type Receptor Comments/areas of use Ref Modifications of Any of above Any diseased or normal oligos obtained argets - or may structure of interest, e.g. as above be unknown when thrombi, tumours or walls of make functional myocardial vessels selection of vector binding O chosen diseased Structure Other chemicals Any of above Any diseased or normal with structure argets - or may structure of interest, e.g. determined be unknown when thrombi, tumours or walls of during make functional myocardial vessels generation selection of process vector binding O chosen diseased Structure

0150 Carbohydrate Vectors -continued Vector type Receptor Comments fareas of use Ref Vector type Receptor Comments/areas of use Ref anti-histamines Histamine Vessel wall CO- macrophages general activation? receptors glycoproteins inflammation Acetyl-choline ACh-receptors oligosaccharides Asialo- liver receptor with terminal glycoprotein antagonists galactose receptor Verapamil Cat-channel Heart muscle Hyaluronan aggrecan (a blocker proteoglycan). nifedipin Cat-channel Heart muscle link proteins blocker cell-surface receptors: CD44 Amiloride Na'/H'-exchanger Blocks this exchanges in Mannose Blood brain barrier, kidney and is generally Brain tumours and other upregulated in cells diseases causing changes in stimulated by growth factors. Bacterial Blood brain barrier, Digitalis Na/K-ATP-ases myocardium glycopeptides Brain tumours and other glycosides peripheral vasculature, diseases causing changes in central nervous system BBB Thromboxaef Thromboxanef Vessel wall, Prostaglandin prostaglandin Endothelium receptor receptors 0151. Lipid Vectors antagonists or agonists Glutathione Glutathione Lung, receptors Brain Vector type Receptor Comments/areas of use Ref Leukotriene receptors LDL-like lipids LDL-receptor Atherosclerosis Biotin biotin transport protein on cell surface 0152 Small Molecule Vectors Folate olate transport Tumours protein on cell surface Riboflavin riboflavin Vector type Receptor Comments/areas of use Ref ransport protein on cell Adrenalin Corresponding surface receptors Methotrexate olate transport Betablockers Adrenergic beta- Myocardium for beta-1 protein on cell receptors blockers Alpha-blockers Adrenergic Vessel wall surface alpha-receptors chlorambucil general benzodiazepines ransport serotonin- Serotonin mechanisms analogues receptors US 2005/0002865 A1 Jan. 6, 2005 22

0153. References to the Preceding Tables tumor cells: A possible link between angiogenesis and 0154 A. Auerbach, W., and R. Auerbach. 1994. Ly-6E.1". Immunology Letters 54: 207-213. “Angiogenesis inhibition: a review’. Pharmac. Ther. 0169 O. Strawn, L. M., G. McMahon, H. App, R. 63: 265-311. Schreck, W. R. Kuchler, M. P. Longhi, T. H. Hui, C. Tang, A. Levitzki, A. Gazit, I. Chen, G. Keri, L. Orfi, 0155 B. Barinaga, M. 1997. “Designing Therapies W. Risau, I. Flamme, A. Ullirch, K. P. Hirth, and L. K. That Target Tumor Blood Vessels”. Science 275 (Janu Shawyer. 1996. “Flk-1 as a Target for Tumor Growth ary 24): 482-484. Inhibition. Cancer ReS. 56: 3340-3545. 0156 C. Folkman, J., P. B. Weisz, M. M. Joullie, W. W. Li, and W. R. Ewing. 1989. “Control of Angiogenesis 0170 P. Stromblad, S., and D. A. Cheresh. December With Synthetic Heparin Substitutes”. Science 243: 1996. “Cell adhesion and angiogenesis”. Trends in Cell 1490-1493. Biology 6 (12): 462-468. 0157 D. Fox, S. B., and A. L. Harris. 1997. “Markers 0171 Q. Stromblad, S., and D. A. Cheresh. November of tumor angiogenesis: Clinical applications in prog 1996. "Integrins, angiogenesis and vascular cell Sur nosis and anti-angiogenic therapy'. Investigational vival”. Chemistry & Biology 3 (11): 881-885. New Drugs 15 (1): 15-28. 0172 R. Volpert, O., D. Jackson, N. Bouck, and D. I. 0158 E. Gastl, G., T. Hermann, M. Steurer, J. Zmija, H. Linzer. September 1996. “The insulin-like growth E. Gunsilius, C. Unger, and A. Kraft. May 1997. factor II/mannose 6-phosphate receptor is required for "Angiogenesis as a target for tumor treatment'. Oncol proliferin-induced angiogenesis'. Endocrinology 137 ogy 54(3): 177-184. (9): 3871-3876. 0159 F. Griffioen, A. W., M. J. H. Coenen, C. A. 0173 S. Yoshida, O. M., T. Shono, H. Izumi, T. Ish Damen, S. M. M. Hellwig, D. H. J. Vanweering, W. ibashi, H. Suzuki, and M. Kuwano. 1997. “Involve Vooys, G. H. Bliham, and G. Groenewegen. 1 Aug. ment of Interleukin-8, Vascular Endothelial Growth 1997. “CD44 is involved in tumor angiogenesis; an Factor, and Basic Fibroblast Growth Factor in Tumor activation antigen on human endothelial cells”. Blood Necrosis Factor Alpha-Dependent Angiogenesis'. Mol. 90 (3): 1150-1159. Cell. Biol. 17: 4015-4023. 0174 T. Zimrin, A. B., M. S. Pepper, G. A. McMahon, 0160 G. Hlatky, L., P. Hahnfeldt, and C. N. Coleman. F. Nguyen, R. Montesano, and T. Maciag. 1996. “An 1996. "Vacular endothelial growth factor: environmen AntiSense Oligonucleotide to the Notch Ligand Jagged tal controls and effects in angiogenesis'. Brit. J. Cancer Enhances Fibroblast Growth Factor-induced Angiogen 74 (Suppl. XXVII): S151-S156. esis

growth factor beta-1, platelet-derived endothelial cell ameZepine, ameZinium metilsulfate, amfenac, amfepen growth factor, placenta growth factor and pleiotrophin torex, amfetaminil, amflutizole, amfonelic acid, amicar in human primary breast cancer and its relation to balide, amicibone, amicloral, amicycline, amidantel, ami angiogenesis8. Cancer Res. 57,963-9. dapSone, amidephrine, amiflamine, amifloverine, amifloxacin, amifostine, amikacin, amikhelline, amiloride, 0181 ZB. Carmeliet, P., L. Moons, M. Dewerchin, N. aminacrane, amindocate, amineptine, aminobenzoic acid, Mackman, T. Luther, G. Breier, V. Ploplis, M. Muller, aminocaproic acid, aminoethyl nitrate, aminoglutethimide, A. Nagy, E. Plow, R. Gerard, T. Edgington, W. Risau, aminohippuric acid, aminometradine, aminopentamide, D. Collen. 1997. Ann, N.Y. Acad. Sci. 811, 191-206. aminophylline, aminopromazine, aminopterin, aminopyrine, 0182 ZC. Van Hinsbergh, P. Koolwijk, R. Haane aminoquinol, aminoquinuride, aminorex, aminoSalicyclic maijer. 1997. “Role of fibrin and plasminogen activa acid, aminothiadiazole, aminothiazole, amiodarone, amiper tors in repair-associated angiogenesis: in vitro Studies one, amipheaZole, amipizOne, amiprilose, amiquinsin, ami with human endothelial cells' EXS 79,391-411. Sometradine, amisulpride, amiterol, amithioZone, amitraz, amitriptyline, amitriptylinoxide, amiXetrine, amlexanox, 0183 Passe, T.J., D. A. Bluemke and S. S. Siegelman. amlodipine, amobarbital, amodiaquine, amogastrin, amol 1997. Radiology 203: 593-600. anone, amonofide, amoproxan, amopyroquin, amorolfine, 0184 Representative examples of drugs useful in accor amocanate, amoSulalol, amotriphene, amoxapine, amox dance with the invention include: abamectin, abundiazole, ecaine, amoxicillin, amoxydramine camsilate, amperozide, acaprazine, acabrose, acebrochol, aceburic acid, acebutolol, amphecloral, amphenidone, amphetamine, amphotalide, acecainide, acecarbromal, aceclidine, ac clof nac, acedap amphotericin B, amplicillin, ampiroXicam, amprolium, Sone, acediaSulfone, acedoben, acefluranol, acefurtiamine, ampyrimine, ampyZine, amduinate, amrinone, amsacrine, acefylline clofibrol, acefylline piperazine, aceglatone, ace amygdalin, amylene, amylmetacresol, amyl nitrite, anage glutamide, aceglutamide aluminium, acemetacin, acenocou Stone acetate, anagrelide, anaXirone, anazocine, anazolene, marol, aceperone, acepromazine, aceprometazine, acequino ancarolol, ancitabine, androStanediol, androstanol propi line, aceSulfame, acetaminophen, acetaminoSalol, onate, androstenetrione, androstenonol propionate, anethole, acetanilide, acetarSone, acetazolamide, acetergamine, ace anguidine, anidoxime, anilamate, anilleridine, aniline, anilo tiamine, acetiromate, acetohexamide, acetohydroxamic pam, anipamil, aniracetam, anirolac, anisacril, anisindione, acid, acetomeroctol, acetophenazine, acetorphine, acetoSul aniSopirol, anisoylbromacrylic acid, anitraZafen, anpirtoline, fone, acetrioZate, acetryptine, acetylcholine chloride, ace ansoxetine, antafenite, antazoline, antaZonite, anthelmycin, tylcolchinol, acetylcysteine, acetyldigitoxin, acetylleucine, anthiolimine, anthralin, anthramycin, antienite, antimony acetylsalicyclic acid, acevaltrate, aceXamic acid, acifran, potassium tartrate, antimony thioglycollate, antipyrine, acipimox, acitemate, acitretin, acivicin, aclantate, aclarubi antrafenine, apalcillin, apaZone, apicycline, apomorphine, cin, aclatonium napadisilate, acodazole, aconiazide, apoVincamine, apraclonidine, apramycin, aprindine, aconitine, acoxatrine, acridorex, acrihellin, acrisorcin, acriv aprobarbital, aprofene, aptazapine, aptocaine, arabinosylm astine, acrocinide, acronine, actinoquinol, actodigin, acyclo ercaptopurine, aranotin, arbaproStil, arbekacin, arclofenin, Vir, adafenoxate, adamexine, ademetionine, adenosine phoS arfendaZam, arginine, arginine glutamat, arildone, arnolol, phate, adibendan, adicillin, adimolol, adinazolam, aronixil, arotinolol, arpinocid, arpromidine, arsanilic acid, adiphenine, aditeren, aditoprim, adrafinil, adrenalone, aflo arSthinol, artemisinin, articaine, asaley, ascorbic acid, ascor qualone, afurolol, aganodine, ajmaline, aklomide, alacepril, byl palmitate, asocainol, aspartame, aspartic acid, asperlin, alafosfalin, alanine mustard, alanosine, alaproclate, alaza aspoxicillin, astemizole, atameStane, atenolol, atipamezole, nine triclofenate, albendazole, albendazole oxide, albuterol, atiproSin, atolide, atracurium besilate, atromepine, atropine, albutoin, alclofenac, alcometasone dipropionate, alcloxa, atropine oxide, auranofin, aurothoiglucose, aurothiogly alcuronium chloride, aldioxa, aldosterone, alepride, ale canide, avilamycin-A, avridine, aXamozide, azabon, azabu tamine, alexidine, alfacalcidol, alfadeX, alfadolone, perone, azacitodine, azaclorzine, azaconazole, azacosterol, alfaprostol, alfaxalone, alfentanil, alfuzosin, algestone azacyclonol, azaftoZine, azaguanidine, azaloxan, azametho acetonide, algestone acetophenide, alibendol, aliconazole, nium bromide, azamulin, azanator, azanidazole, azaperone, alifedrine, alliflurane, alimadol, alinidine, alipamide, alitame, aZapicyl, azaprocin, azaduinzole, azaribine, azarole, aZaser alizapride, allantoin, alletorphine, allobarbital, alloclamide, ine, azaspirium chloride, azastene, azastrptonigrin, azatod allocupreide, allomethadione, allopurinol, allylestrenol, ine, azathioprine, azauridine, azelastine, azepeXole, azepin allyl isothicyanate, allylprodine, allylthiourea, almadrate dole, azetepa, azidamfenicol, azidocillin, azimeXon, Sulfate, almasilate, almecillin, almestrone, alminoprofen, aZintamide, azipramine, azithromycin, azlocillin, azolimine, almitrine, almoxatone, alonacic, alonimid, aloxiStatin, aloZ aZOSemide, azotomycin, aztreonam, azumolene, bacampicil afone, alpertine, alphacetylmethadol, alphameprodine, lin, baclofen, bacmecillinam, balSalazide, bamaluzole, bam alphamethadol, alphaprodine, alpha-Vinylaziridinoethyl buterol, bamethan, bamifylline, bamipine, bamnidazole, acetate, alpidem, alpiropride, alprazolam, alprenolol, alproS baduiloprim, barbexaclone, barbital, barucainide, batilol, tadil, alreStatin, altanserin, altapizone, alteconazole, althiaz baZinaprine, becanthone, beclamide, beclobrate, beclom ide, altrenogest, altretamine, aluminium acetate, aluminium ethasone dipropionate, beclotiamine, befiperide, befunolol, clofibrate, aluminium Subacetate, alverine, amadinone befuraline, bekanamycin, belarizine, beloxamide, bemar acetate, amafolone, amanozine, amantadine, amantanium inone, bemegride, bemetizide, bemitradine, benactyzine, bromide, amantocillin, ambasilide, ambaZone, ambenonium benafentrine, benanSerin, benapry Zine, benaxibine, chloride, ambenoxan, ambroXol, ambruticin, ambucaine, benazepril, bencianol, bencisteine, benclonidine, bency ambucetamide, ambuphylline, ambuSide, ambutonium bro clane, bendamustine, bendaZac, bendaZol, benderizine, ben mide, amcinafal, amcinafide, amcinonide, amdinocillin, droflumethiazide, benethamide penicillin, benexate, benflo amdinocillin pivoxil, amebucort, amedalin, ametantrone, reX, benfoSformin, benfotiamine, benfurodil hemisuccinate, US 2005/0002865 A1 Jan. 6, 2005 24 benhepaZone, benidipine, benmoxin, benolizime, benorilate, bupranolol, buprenorphine, bupropion, buquineran, benorterone, benoxafos, benoxaprofen, benoXinate, benperi buquinolate, buquiterine, buramate, burodiline, buSpirone, dol, beinproperine, benrixate, benSalan, benSerazide, benSul buSulfan, butabarbital, butacaine, butacetin, butaclamol, dazic acid, bentazepam, bentemazole, bentiamine, bentipi butadiaZamide, butafosfan, butalamine, but albital, butam mine, bentiromide, benurestat, benzaldehyde, benzalkonium ben, butamirate, butamisole, butamoxane, butanediol cyclic chloride, benzaprinoxide, benzarone, benzbromarone, ben Sulfite, butanilicaine, butanixin, butanserin, butantrone, Zestrol, benzethidine, benzethonium chloride, benzetimide, butaperazine, butaprost, butaverine, butedronate, buterizine, benzilonium, bromide, benzindopyrine, benziodarone, ben butetamate, butethamine, buthiazide, butibufen, butidrine, Zmalecene, benznidazole, benzobarbital, benzocaine, ben butikacin, butilfenin, butinazocine, butinoline, butirosin, Zoclidine, benzoctamide, benzodepa, benzododecinium butixirate, butobendine, butoconazole, butocrolol, butocta chloride, benzoic acid, benzoin, benzonatate, benzopyrro mide, butofilolol, butonate, butopamine, butopiprine, buto nium bromide, benzoquinium chloride, benzotript, benzox prozine, butopyrammonium iodide, butorphanol, butoxam iquine, benzoxonium chloride, benzoyl peroxide, ben ine, butoxylate, butriptyline, butropium bromide, butylated Zoylpas, benzphetamine, benzpiperylon, benzpyrinium hydroxyanisole, butylated hydroxytoluene, butylparaben, bromide, benzauercin, benzcuinamide, benzthiazide, benz butynamine, buZepide metiodide, cabastine, cabergoline, tropine, benzydamine, benzylpenicillin, benzylsulfamide, cadralazine, cafaminol, cafedrine, caffeine, calcifediol, cal beperidium iodide, bephenium naphtoate, bepiastine, bepri citrol, calcium citrate, calcium dobesilate, calcium glubion dil, beraprost, berberine Sulfate, bermastine, bermoprofen, ate, calcium gluceptate, calcium gluconate, calcium glyc berythromycin, beSulpamide, beslunide, beta caroteine, beta erophosphate, calcium hypophosphite, calcium lactate, cetylmethadol, betahistine, betaine, betameprodine, calcium lactobionate, calcium levulinate, calcium mande betamethadol, betamethasone, betamethasone acetate, late, calcium pantothenate, calcium phosphate dibasic, cal betamethasone acibutate, betamethasone benzoate, cium phophate tribasic, calcium Saccharate, calcium Stear betamethasone dipropionate, betamethasone phosphate, ate, calusterone, camazepam, cambendazole, camiverine, betamethasone Valerate, betamicin, betaprodine, betaxolol, camoStast, camphotamide, camptothecin, camylofin, can betazole, bethanechol chloride, bethanidine, betiatide, bisol, cannabinol, canrenoic acid, canrenone, cantharidine, betoxycaine, bevantolol, bevonium metilsulfate, beZafibrate, capobenic acid, capreomycin, caproxamine, capsaicine, bezitramide, bialamicol, bibenzonium bromide, bibrocathol, captamine, captodiame, captopril, capuride, caracemide, bicifadine, biclodil, biclofibrate, biclotymol, bicozamycin, caramiphen, carazolol, carbachol, carbadox, carbaldrate, bidimazium iodine, bietamiverine, bietaserpine, bifemelane, carbamazepine, carbamide peroxide, carbantel lauryl sul bifepramide, bifluranol, bifonazole, binedaline, binfloxacin, fate, carbaril, carbarSone, carbaspirin calcium, carbaZeran, binfibrate, bioallethrin, bioresmethrin, biotin, bipenamol, carbazochrome, carbazachrome Salicylate, carbazachrome biperiden, biphenamine, biriperone, bisacodyl, bisantrene, Sulfonate, carbazocine, carbeniciltin, carbenicillin indanyl, bis(aziridinyl)butanediol, bisbendazole, bisbentiamine, bis carbencillin phenyl, carbenoXolone, carbenzide, carbestrol, fenaZone, bisfentidine, bismuth betanaphthol, bismuth-trig carbetapentane, carbidopa, carbimazole, carbinoxamine, lycollamate, bismuth Subgallate, bismuth SubSalicylate, carbiphene, carbocloral, carbocysteine, carbofenotion, car bisorbin, bisoprolol, bisorcic, bioxatin acetate, bispyrithione bol-fuSchin, carbomycin, carboplatin, carboprost, carbo magSulfeX, bithionol, bithionoloxide, bitipaZone, bitoterol, prost methyl, carboquone, carbromal, carbubarb, car bitoScantate, bleomycin, bluenSomycin, bofumustine, bolan burazepam, carbutamide, carbuterol, carcainium chloride, diol dipropionate, bolasterone, bolazine, boldenone unde carebastine, carfentanil, carfimate, carisoprodol, carmanta cylenate, bolenol, bolmantalate, bometolol, bopindolol, bor dine, carmetizide, carmofur, carmustine, carnidazole, car naprine, bornaprolol, bornelone, botiacrine, boxidine, nitine, carocainide, caroverine, caroXaZone, carperidine, brallobarbital, braZergoline, brefonalol, bremazocine, bre caperone, carphenazine, carpindolol, carpiramine, carpro quinar, bretylium tosylate, brindoXime, brivundine, brobac fen, carpronium chloride, carSalam, cartazolate, carteolol, tam, broclepride, brocresine, brocrinat, brodimoprim, bro carubicin, carumonam, carvedilol, carZenide, carZolamide, faromine, brofezil, brofoxine, brolaconazole, cathine, cathinone, cefaclor, cefadroxil, cefaloniumi, cefa brolamfetamine, bromacrylide, bromadoline, bromamid, loram, cefamandole, cefamandole naftate, cefaparole, cefa bromazepam, bromchlorenone, bromebric acid, bromergu trizine, cefazaflur, cefazedone, cefazolin, cefbuperaZone, ride, brometenamine, bromfenac, bromheXine, bromindione, cefcanel, cefcanel daloxate, cefedrolor, cefempidone, bromisoValum, bromociclen, bromocriptine, bromodiphen cefepime, cefetamet, cefetrizole, cefvitril, cefixime, cef hydramine, bromofenofoS, bromopride, bromoxandide, bro menoXime, cefimepidium chloride, cefimetazole, cefminox, mperidol, bromperidol decanoate, brompheniramine, bro cefodizime, cefonizid, cefoperaZone, ceforanide, cefo nopol, broparestrol, broperamole, bropirimine, taxime, cefotetan, cefotiam, cefoxazole, cefoxitin, cefpimi broquinaldol, broSotamide, broSuximide, brotianide, broti Zole, cefpiramide, cefpirome, cefpodoxime, cefpodoxime Zolam, brovanexine, brovincamine, broXaldine, broXaterol, proxetil, cefduinome, cefrotil, cefroXadine, cefSulodin, cef broxitalamic acid, broXuridine, broxyquinoline, bruceantin, Sumide, ceftazidime, cefteram, cefteZole, ceftiofur, cefti brucine, bucainide, bucetin, buciclovir, bucillamine, bucin olene, ceftioxide, ceftizOXime, ceftriaxone, cefuracetime, dolol, bucladesine, buclizine, buclosamide, bucloxic acid, cefuroxime, cefuraxime axetil, cefurZonam, celiprolol, bucolome, bucricaine, bucromarone, bucrylate, bucumolol, cephacetrile, cephalexin, cephaloglycin, cephaloridine, budeSonide, budipin, budotitane, budralazine, bufenadrine, cephalothin, cephapirin, cephradine, cetaben, cetamolol, bufeniode, bufetolol, bufeXamac, bufezolac, buflomedil, cetheXonium chloride, cetiedil, cetirizine, cetocycline, ceto bufogenin, buformin, bufrolin, bufuralol, bumadizone, heXazine, cetophenicol, cetotiamine, cetoxime, cetraxate, bumecaine, bumepidil, bumetanide, bumetrizole, bunaftine, chaulmosulfone, chendiol, chiniofon, chlophedianol, chlo bunamidine, bunamiodyl, bunaprolast, bunaZosin, buni racy Zine, chloral betaine, chloral hydrate, chloralose, trolol, bunolol, buparvaquone, bupicomide, bupivacaine, chlorambucil, chloramine, chloramphenicol, chlorampheni US 2005/0002865 A1 Jan. 6, 2005 25 col palmitate, chloramphenicol Succinate, chlorazanil, chlor clopimozide, clopipazan, clopirac, cloponone, cloprednol, benzoxamine, chlorbetamide, chlorcyclizine, chlordantoin, cloprostenol, cloprothiazole, cloquinate, cloquinozine, clo chlordiazepoxide, chlordimorine, chlorhexadol, chlorhexi racetadol, cloranolol, cloraZepate, clorethate, clorexolone, dine, chlorhexidine phosphanilate, chlorindanol, chlorison clorgiline, cloricromen, cloridarol, clorindanic acid, clorin damine chloride, chlormadinone acetate, chlormerodrin, dione, clormecaine, cloroperone, clorophene, cloroqualone, chlormeZanone, chlormidazole, chloronaphazine, chloroa clorotepine, clorprenaline, clorSulon, clortermine, cloSantel, Zodin, chlorobutanol, chlorocreSol, chlorodihydroxyandros closiramine, clostebol, clothiapine, clothixamide, clotiaz tenone, chloroethyl mesylate, 5-chloro-3'-fluoro-2'3-dideox epam, cloticasone propionate, clotioxone, clotrimazole, clo yuridine, chloroguanide, chlorophenothane, VOXamine, cloxacepride, cloxacillin, cloxacillin benzathine, chloroprednisone acetate, chloroprocaine, chloropyramine, cloxazolam, cloxestradiol, cloximate, cloxotestosterone, chloroquine, chloroSerpidine, chlorothen, chlorothiazide, cloxypendyl, cloxyquin, clozapine, cobamide, cocaine, chlorotriansene, chloroXine, chloroxylenol, chlorozotocin, cocarboxylase, codeine, codoxime, cofisatin, cogaZOcine, chlorphenesin, chlorphenesin carbamate, chlorpheniramine, colchicine, colestolone, colfenamate, colforasin, colterol, chlorphenoctium amSonate, chlorphenoxamine, chlorphen conessine, conorphone, copper gluconate, cormethasone termine, chlorproethazine, chlorproguanil, chlorpromazine, acetate, corticosterone, cortisone acetate, cortisu Zol, corti chlorpropamide, chlorprothixene, chlorquinaldol, chlortet Vazol, cortodoxone, cotarnine chloride, cotinine, cotrip racycline, chlorthalidone, chlorthenoxazine, chlorZoaX tyline, coumaphos, coumazoline, coumermycin, coumetarol, aZone, chloecalciferol, cholic acid, choline chloride, choline creatinolfosfate, crisinatol, croconazole, cromakalim, cromi glycerophosphate, chromocarb, chromonar, ciadox, trile, cromolyn, cropropamide, croSpoVidone, crotamiton, ciameXon, cianergoline, cianidol, cianopramine, ciapilome, crotetamide, crotoniazide, crufomate, cuprimyxin, cuproXo cicaprost, cicarperOne, ciclactate, ciclafrine, ciclaZindol, line, cyacetacide, cyamemazine, cyanocobalamine, cyclacil cicletanine, ciclomenol, ciclonicate, ciclonium bromide, lin, cyclandelate, cyclarbamate, cyclazocine, cyclazodone, ciclopiroX, ciclopramine, cicloprofen, cicloprolol, ciclosi cyclexanone, cyclindole, cycliramine, cyclizine, cyclobar domine, ciclotizolam, ciclotropium bromide, cicloxilic acid, bital, cyclobendazole, cyclobenzaprine, cyclobutoic acid, cicloxolone, cicortonide, cicrotic acid, cidoXepin, cifenline, cyclobutyrol, cyclofenil, cycloguanil, cloheximide, cyclo cifostodine, ciglitaZone, ciheptolane, ciladopa, cilastatine, leucine, cyclomenol, cyclomethicone, cyclomethycaine, cilaZapril, cilaZaprilat, cilobamine, cillofungin, ciloStamide, cyclopentamine, cyclopenthiazide, cyclopentolate, cyclo ciloStaZol, ciltoprazine, cimaterol, cimenoxin, cimepanol, penazine, cyclophosphamide, cyclopregnol, cyclopyrro cimetidine, cimetropium bromide, cimoxatone, cinchonine, nium bromide, cycloserine, cyclosporine, cyclothiazide, cinchophen, cinecromen, cinepaXadil, cinepaZet, cinepazic cyclovalone, cycotiamine, cycrimine, cyheptamid, cyhep acid, cinepazide, cinfenine, cinfenoac, cinflumide, cingestol, tropine, cynarine, cypenamine, cypothrin, cyprazepam, cinitapride, cinmetacin, cinnamaverine, cinnamedrine, cin cyprenophine, cyprodenate, cyproheptadine, cyprolidol, narizine, cinnarizine clofibrate, cinnofuradione, cincotra cyproduinate, cyproterone acetate, cyproximide, cystine, mide, cinodine, cinolazepam, cinoquidox, cinoaxin, cinox cytarabine, dacarbazine, dacemazine, dacisteine, dacinomy ate, cinoXolone, cinooxopazide, cinperene, cinprazole, cin, dacuronium bromide, dagapamil, dalbraminol, daleda cinpropazide, cinromide, cintaZone, cintriamide, cinperone, lin, daltroban, dametralast, damotepine, danazol, danitracen, ciprafamide, ciprafaZone, ciprefadol, ciprocinonide, ciprofi danosteine, danthron, dantrolene, dapiprazole, dapSone, brate, ciprofloxacin, cipropride, ciprocquaZone, ciprostene, daptomycin, darenzepine, darodipine, datelliptium chloride, ciramadol, cirazoline, cisapride, cisconazole, cismadinone, dunorubicin, daZadrol, dazepinil, dazidamine, dazmegrel, cisplatin, cistinexine, citalopram, citatepine, citenamide, cit dazolicine, dazopride, dazoquinast, dacoxiben, deanol ace enaZone, citicoline, citiolone, clamidoxic acid, clamox glumate, deanol acetaminobenzoate, deaZauridine, debOX yguin, clanfenur, clanobutin, clantifen, clarithromycin, cla amet, debrisoquin, decamethonium bromide, decimenide, Vulanic acid, claZolam, clazolimine, claZuril, clebopride, decitropine, declaben, declenperone, decloxizine, decomi clefamide, clemastine, clemeprol, clemizole, clenbuterol, nol, decoquinate, deditonium bromide, deferoxamine, clenpirin, cletoquine, clibucaine, clidafidine, clidanac, clidi deflazacort, defosfamide, dehydroacetic acid, dehydroemet num bromide, climaZolam, climbazole, climiqualine, clin ine, dehydro-7-methyltestosterone, delanterone, delapril, damycin, clindamycin palmitate, clindamycin phosphate, delergotrile, delfantrine, delmadinone acetate, delmetacin, clinofibrate, clinolamide, cliquinol, clioxanide, clipoxamine, delmopinol, delorazepam, deloxone, delprostenate, dem cliprofen, clobazam, clobenoside, clobenzepam, cloben brexine, demecarium bromide, demeclocycline, demecol Zorex, clobenztropine, clobetasol propionate, clobetaSone cine, demecycline, demegestone, demelverine, demexip butyrate, clobutinol, clobu Zarit, clocanfamide, cloca tiline, democonazole, demoXepam, denaverine, pramine, clociguanil, clocinizine, clocortolone acetate, clo denbufylline, denipride, denopamine, denpidaZone, denzi cortolone pivalate, clocoumarol, clodacaine, clodanolene, mol, deoxyspergualin, depramine, deprodone, deprostil, clodazon, clodoxopone, clodronic acid, clofazimine, clofe deptropine, derpanicate, desacetylcolchicine tartrate, desas namic acid, clofenamide, clofenciclan, clofenetamine, pidin, desiclovir, descinolone acetonide, deserpidine, clofenoxyde, clofenVinfos, clofeverine, clofeXamide, clof desipramine, deslanoside, desmethylcolchicine, desmeth eZone, clofibrate, clofibric acid, clofibride, clofilium phos ylmisonidazole, deSmethylmoramide, deSocriptine, phate, cloflucarban, clofoctol, cloforex, clofurac, clogestone deSogeStrel, desomorphine, desonide, desoximetasone, des acetate, cloguanamil, clomacran, clomegestone acetate, Oxycorticosterone acetate, desoxycorticosterone pivalate, clometacin, clometherone, clomethiazole, clometocillin, desoxypyridoxine, detajmium bit artrate, detanosal, deter clomifenoxide, clominorex, clomiphene, clomipramine, clo enol, detomidine, detorubicin, detrothronine, devapamil, mocycline, clomoxir, clonazepam, clonazoline, clonidine, dexamethasone, dexamethasone, acefurate, dexamethasone clonitaZene, clonitrate, clonixeril, clonixin, clopamide, clo acetate, dexamethasone dipropionate, dexamethasone phos penthixol, cloperastine, cloperidone, clopidogrel, clopidol, phate, dexamisole, dexbrompheniramine, dexchlorphe US 2005/0002865 A1 Jan. 6, 2005 26 niramine, dexclamol, dexetimide, deXetoZolin, dexfenflu Zole, docusate, doliracetam, domaZoline, domiodol, domi ramine, deximafen, dexindoprofen, dexivacaine, phen bromide, domipizone, domoprednate, domoxin, dom dexlofexidine, dexmedetomidine, deXOXadrol, deXpan peridone, don, donetidine, dopamantine, dopamine, thenol, deXpropranolol, deXproxibutene, deXecoverine, dex dopexamine, dopropidil, dogualast, dorastine, doreptide, tilidine, dextroamphetamine, dextrofemine, dextromethor doSergoside, dotarizine, dotefonium bromide, dothiepin, phan, dextromoramide, dextrorphan, dextrothyroXine, doxacurium chloride, doxaminol, doxapram, doxaprost, deZaguanine, dezocine, diacerein, diacetamate, diacetolol, doxazosin, doxefazepam, doxenitoin, doxepin, doxibetasol, diacetylmorphine, diamfenetide, diaminomethylphena doxifluridine, doxofylline, doxorubicin, doxpicomine, doxy Zinium chloride, diamocaine, diampromide, diamthazole, cycline, doxylamine, dramedilol, draquinolol, deaZidox, dianhydrogalactitol, diapamide, diarbarone, diathymoSul dribendazole, drindene, drobuline, drocinonide, droclid fone, diatrizoic acid, diaveridine, diazepam, diaziquone, inium bromide, drocode, drofenine, droloxifene, drometri diazoacetylglycine hydrazide, diazouracil, diaZOxide, Zole, dromoStanolone, dromoStanolone propionate, dronab dibekacin, dibemethine, dibenamine, dibenzepin, dibro inol, dropempine, droperidol, droprenilamine, dropropizine, impropamidine, dibromsalan, dibroSpidium chloride, drotaverine, drotebanol, droxacin, droXicainide, droxicam, dibucaine, dibuprol, dibupyrone, dibuSadol, dicarbine, droxidopa, droxypropine, dulofibrate, duloZafone, duometa dicarfen, dichlorallyl lawsone, dichlorisone acetate, dichlo cin, duoperone, dupracetam, durapatite, dyclonine, rmeZanone, dichlorofluorimethane, dichloromethotrexate, dydrogesterone, dymanthine, dyphylline, ebastine, elbroti dichlorophen, dichlorophenarsine, dichlorotetrafluoroet dine, ebSelen, ecastolol, echinomycin, echothiophate iodide, hane, dichloroxylenol, dichlorphenamide, dichlorVOS, dici ecipramidil, eclanamine, eclaZolast, econazole, ectylurea, ferron, dicirenone, diclaZuril, diclofenac, diclofensine, edelfosine, edetic acid, edetol, edifolone, edogestrone, diclofurime, diclometide, diclonixin, dicloxacillin, dicobalt edoxudine, edrophonicum chloride, efaroXan, efetozole, edetate, dicolinium iodide, dicreSulene, dicumarol, dicyclo eflornithine, efloxate, efrotomycin, elantrine, elanzepine, mine, didemnin, dideoxycytidine, didrovaltrate, dieldrin, elderfield's pyrimidine mustard, elfazepam, ellagic acid, dienestrol, dienogest, diethadione, diethazine, diethylpro elliptinium acetate, elmustine, elnadipine, eltenac, eltopra pion, diethylstilbestrol, diethylstilbestrol diphosphate, dieth Zine, elucaine, elziverine, embramine, embutramide, eme ylstilbestrol dipropionate, diethylthiambutene, diethyltolua pronium bromide, emetine, emiglitate, emilium tosylate, mide, dietifen, difebarbamate, difemerine, difemetorex, emopanil, emorfaZone, emylcamate, enalapril, enalaprilat, difenamizole, difencloxazine, difenoXimide, difenoxin, dife enbucrilate, encainide, enciprazine, enclomiphene, tarSone, difeterol, diflorasone diacetate, difloxacin, diflua encyprate, endomide, endralazine, endrySone, enefeXine, nine, diflucortolone, diflurcortolone pivalate, diflumidone, eneStebol, enfenamic acid, enflurane, eniclobrate, enilcona diflunisal, difluprednate, diftalone, digalloyl trioleate, digi Zole, eniloSpirone, enisoprost, enocitabine, enolicam, enoxa toxin, digoxin, dihexyverine, dihydralazine, dihydroaZacy cin, enoXamast, enoXimone, enoXolone, eniprazole, enipro tidine, dihydroergotamine, dihydrolenperone, dihydroStrep line, enprazepine, enprofylline, enpromate, enproStil, tomycin, dihydrotachysterol, dihydroxyfluoroprogestrone, enrofloxacin, entSufon Sodium, enviomycin, enviradene, diisopromine, diisopropanolamine, dilaZep, dilevalol, epalretat, epanolol, eperisone, ephedrine, epicainide, epicil dilimefone, diloxanide, diltiazem, dimabefylline, dimecam lin, epicriptine, epieStriol, epimestrol, epinastine, epineph ine, dimecolonium iodide, dimecrotic acid, dimefadane, rine, epinephryl borate, epipropidine, epirizole, epiroprim, dimefline, dimelazine, dimenorfan, dimenhydrinate, epirubicin, epithiazide, epitioStanol, epoprostenol, epoStane, dimenoxadol, dimeheptanol, dimepranol, dimepregnen, eprazinone, eproVafen, eproXindine, eproZinol, epsiprantel, dimeproZan, dimercaprol, dimeSna, dimeSone, dimetacrine, eptaloprost, eptazocine, equilin, erdosteine, ergocalciferol, dimetamfetamine, dimethadione, dimethaminostyrylquino ergoloid meSylates, ergonoVine, ergosterol, ergotamine, eri line, dimethazan, dimethindene, dimethiodal, dimethiso colol, erizepine, erocainide, erythrityl tetranitrate, erythro quin, dimethisterone, dimetholizine, dimethoxanate, dim mycin, erythromycin acistrate, erythromycin ethylSuccinate, ethylhydroxytestosterone, dimethylnorandrostadienone, erythromycin propionate, erythrosine, eSaprazole, escu dimethylnortestosterone, dimethylstilbestrol, dimethyl, dim lamine, eSeridine, esflurbiprofen, eSmolol, eSorubicin, esp ethylthiambutene, dimethyltubocurarinium chloride, roquin, estaZolam, estradiol, estradiol benzoate, estradiol dimetipirium bromide, dimetofrine, dimetridazole, dimina cypionate, estradiol dipropionate, estradiol enanthate, estra Zene, dimoxamine, dimoxaprost, dimoxyline, dimpylate, diol undecylate, estradiol Valerate, estramustine, estramus dinaline, dinaZafoge, diniprofylline, dinitolmide, dinoprost, tine phosphate, estrapronicate, estraZinol, estriol, estrofu dinoprostone, dinsed, dioSmin, dioxadillol, dioxadrol, diox rate, estrone, estrone hydrogen Sulfate, estropipate, amate, dioxaphetyl butyrate, dioxethedrin, dioxifiedrine, eSuprone, etabenzarone, etacepride, etafedrine, etafenone, dioxybenzone, dipenine bromide, diperodon, diphemanil etameStrol, etamiline, etamiphyllin, etamocycline, etanida methylsulfate, diphenadione, diphenan, diphenhydramine, Zole, etanterol, etaqualone, etasuline, etazepine, etazolate, diphendiol, diphenoxylate, diphenylpraline, diphoxazide, etebenecid, eterobarb, eterSalate, ethacridine, ethacrynic dipipanone, dipipoverine, dipliverin, diprafenone, diprenor acid, ethambutol, ethamivan, ethamsylate, ethanolamine phine, diprobutine, diprofene, diprogulic acid, diproleando oleate, ethaverine, ethchlorVynol, ethenZamide, ethazide, mycin, diprocqualone, diproteverine, diprotriozate, diproXa ethidium chloride, ethinamate, ethinyl estradiol, ethiofoS, dol, dipyridamole, dipyrithione, dipyrocetyl, dipyrone, ethionamide, ethsterone, ethoheptazine, ethomoxane, etho dirithromycin, disobutamide, disofenin, disogluSide, disopy nam, ethopropazine, ethoSuximide, ethotoin, ethoxazene, ramide, disoxaril, distigmine bromide, disulergine, disulfa ethoxazorutoSide, ethoXZolamide, ethyybenztropine, ethyl mide, disulfiram, disuprazole, ditazole, ditercalinium chlo biscoumacetate, ethyl carfluZepate, ethyl cartrizoate, ethyl ride, dithiazanine iodide, ditiocarb, ditiomustine, dibunate, ethyl dirazepate, ethylenediamine, ethyleStrenol, ditolamide, ditophal, divabuterol, dixanthogen, dizatrifone, ethylhydrocupreine, ethyl loflazepate, ethylmethylthiam dizocilpine, dobupride, dobutamine, docarpamine, docona butene, ethylmorphine, 9-ethyl-6-mercaptopurine, ethyl US 2005/0002865 A1 Jan. 6, 2005 27 nitrite, ethylnorepinephrine, ethylparaben, ethylphenace otracen, fluoxetine, fluoxymesterone, fluparoxan, flupen mide, ethylstibamine, ethynerone, ethynodiol diacetate, tiXol, fluperamide, fluperlapine, fluperolone acetate, ethypicone, etibendazole, eticlopride, eticyclidine, eti fluphenazine, fluphenazine enanthate, flupimazine, flupir docaine, etidronic acid, etifelmine, etifenin, etifoXine, etil tine, flupranone, fluprazine, fluprednidene, fluprednisolone, amfetamine, etillefrine, etillefrin pivalate, etintidine, etiochl fluprednisolone Valerate, fluprofen, flu profylline, flu.proqua anolone, etipirium iodide, etiproston, etiracetam, etiroXate, Zone, fluproStenol, fluguaZone, fluradoline, flurandrenoline, etisazole, etisomicin, etisulergine, etizolam, etocarlide, etoc flurantel, flurazepam, flurbiprofen, fluretofen, flurithromy rylene, etodolac, etodroXZine, etofamide, etofenamate, cin, flurocitabine, flurofamide, flurogestone acetate, etofenproX, etofibrate, etoformin, etofuradine, etofylline, flurothyl, fluroxene, flusoxolol, fluspiperone, fluspirilene, etoglucid, etolorex, etolotifen, etoloxamine, etomidate, eto flutamide, flutazolam, flutemazepam, flutiazin, fluticaSone midoline, etomoxir, etonitaZene, etoperidone, etoposide, propionate, flutizenol, flutonidine, flutoprazepam, flutroline, etoprindole, etoprine, etorphine, etoSalamide, etoxadrol, flutropium bromide, fluvoxamine, fluzinamide, fluZoperine, etoxeridine, etoZolin, etrabamine, etretinate, etryptamine, folescutol, folic acid, fomidacillin, fominoben, fomocaine, etymemazine, eucalyptol, eucatropine, eugenol, euprocin, fonazine, fopiirtoline, forfenimex, formebolone, formetorex, evandamine, Evans blue, exalamide, exametazine, formintrazole, formocortal, formoterol, fosarilate, foS exaprolol, exepanol, exifone, exiproben, fallintolol, falli azepam, foScarnet, foscolic acid, foSenazide, foSfocreatine, pamil, famiraprinium chloride, famotidine, famotine, fami fosfomycin, foSfonet, fosfosal, foSinapril, foSmenic acid, profaZone, fanetizole, fantridone, fazadinium bromide, faZ foSmidomycin, forpirate, fostedil, fostriecin, fotemustine, aribine, febantel, febarbamate, februpol, febuverine, fotreamine, frabuprofen, frentizole, fronepidil, froxiprost, feclemine, feclobu Zone, fedrilate, felbamate, felbinac, ftaxilide, ftivazide, florafur, ftormetazine, ftorpropazine, felipyrine, felodipine, femoxetine, fenabutene, fenacetinol, fubrogonium iodide, fuchsin, fumagillin, fumoXcillin, fupra fenaclon, fenadiazole, fenaptic acid, fenalamide, fenalcom Zole, furacrinic acid, furafylline, furalazine, furaltadone, ine, fenamifuril, penamole, fenaperone, fenbendazole, fen furaprofen, furazabol, furazolidone, furazolium chloride, bencillin, fenbufen, fenbutrazate, fencamfamine, fenci furbucillin, furcloprofen, furegrelate, furethidine, furfeno butirol, fencleXonium metilsulfate, fenclofen4c, fenclonine, reX, furidarone, furmethoxadone, furobufen, furodazole, fenclorac, fenlozic acid, fendiline, fendosal, feneritrol, furofenac, furomazine, furoSemide, furoStilbestrol, furSalan, fenestrel, fenethazine, fenethylline, fenetradil, fenflumizole, furSutiamine, furterene, furtrethonium iodide, fusidic acid, fenfluramine, fenfluthrin, fengabine, fenharmane, fenimide, fuZlocillin, gabapentin, gabeXate, gabOXadol, galantamine, feniodium chloride, femipentol, femirofibrate, fenisorex, fen gallamine triethodide, gallopamil, galosemide, galtifenin, metoZole, fenmetramide, fenobam, fenocinol, fenoctimine, gampexine, gamolenic acid, ganciclovir, ganglefene, gapi fenofibrate, fenoldopam, fenoprofen, fenoterol, fenoverine, comine, gapromidine, gefarnate, gemazocine, gemcadiol, fenoxazoline, fenoxedil, fenozolone, fenpentadiol, femper gemeprost, gemfibrozil, gentamicin, gentian Violet, gepe ate, fenipalone, fenipramide, feniprane, fenpiverinium bro frine, gepirone, geroquinol, gestaclone, gestadienol, mide, fenprinast, fenproporex, fenproStalene, fenguizone, gestodene, geston.orone caproate, gestrinone, giparmen, fenretinide, fenspiride, fentanyl, fentiazac, fenticlor, fenti gitaloXin, gitoformate, glafenine, glaziovine, gliamilide, gli conazole, fentonium bromide, fenyripol, fepentolic acid, bornuride, glibutimine, glicaramide, glicetanile, geroquinol, fepitrizol, fepradinol, feprazone, fepromide, feprosidinine, gestaclone, gestadienol, gestodene, geston.orone caproate, ferriclate calcium, ferrotrenine, ferrous fumarate, ferrous gestrinone, giparmen, gitaloxin, gitoformate, glafenine, gluconate, fetoxylate, feXicaine, feXinidazole, fezatione, glaziovine, gliamilide, glibornuride, glibutimine, glicara feZolamine, fiacitabine, fibracillin, filenadol, filipin, fifexide, mide, glicetanile, gliclazide, glicondamide, glidaZamide, flamenol, flavamine, flavodic acid, flavodil, flavone actic gliflumide, glimepiride, glipentide, glipizide, gliquidone, acid, flavoxate, flazalone, flecainide, flerobuterol, fleroxacin, glisamuride, glisindamide, glisolamide, glisoxepide, glox flesinoxan, flestolol, fletazepam, floctafenine, flomoxef, aZone, gloXimonam, glucame tacin, glucosamine, glucosul flopropione, florantyrone, flordipine, floredil, florfenicol, famide, glucosulfone, glucurolactone, glucuronamide, glu florifenine, floSequinan, flotrenizine, floverine, floxacillin, nicate, glutamic acid, glutaral, glutarimide, glutaurine, floxacrine, floxuridine, fluacizine, fluialamide, fluianisone, glutethimide, glyburide, glybuthiazol, glybuzole, glyceryl fluazacort, flubanilate, flubendazole, flubepride, flucabril, monoStearate, glycidyl methacrylate, glycine, glyclopyra flucetorex, flucindole, fluciprazine, flucloronide, flucona mide, glybiar.Sol, glycopyrrolate, glycyclamide, glyhexam Zole, flucrylate, flucytosine, fludalanine, fludarabine phos ide, glymidine, glyoctamide, glypinamide, glyprothiazol, phate, fludazonium chloride, fludiazepam, fluidorex, fluidox glySobuzole, gold thiomalate, gold Sodium thiosulfate, gra opone, fludrocortisone acetate, flufenamic acid, flufenisal, nisetron, griseofulvin, guabenXan, guacetisal, guafecainol, flufosal, flufylline, fluindarol, fluindione, flumazenil, flume guaiactamine, guaiapate, guaietolin, guaifenesin, guaimeSal, cinol, flumedroXone-17-acetate, flumequine, flumeridone, guaisteine, guaithylline, guamecycline, guanabenz, guana flumethasone, flumethasone pivalate, flumethiazide, flume cline, guanadrel, guanaZodine, guanazole, guanclofine, tramide, flumeXadol, flumeZapine, fluminorex, flumizole, guancydine, guanethidine, guanfacine, guanisoquin, guano flumoxonide, flunamine, flunarizine, flunidazole, clor, guanoctine, guanoXabenz, guanoxan, guanoxyfen, flunisolide, flunisolide acetate, flunitrazepan, fluniXin, fluno hadacidin, halazepam, halazone, halcinonide, halethazole, prost, flunoxaprofen, fluocinolone acetonide, fluocinonide, halocortolone, halofantrine, halofenate, halofuginone, flourcortin butyrate, fluocortolone, fluocortolone caproate, halometasone, halonamine, halopemide, halopenium chlo fluorescein, fluoresone, fluoroadenosine, 3-fluoroan ride, haloperidol, haloperidol decanoate, haloperidone droStanol, fluorodopane, fluorohydroxyandrosterone, fluo acetate, haloprogesterone, haloprogin, halothane, halox rometholone, fluorometholone acetate, fluorosalan, 6-fluo aZolam, haloxon, halquinols, hedaquinium chloride, hep rOteStoSterOne propionate, fluorouracil, ronicate, heptabarbital, heptaminol, heptaverine, heptola 9-fluoroXotestenololactone, 9-fluoroXotestololacetone, flu mide, hepZidine, hetacillin, hetaflur, heteronium bromide, US 2005/0002865 A1 Jan. 6, 2005 28 hexachlorophene, hexacyclonate, hexacy prone, hexadiline, iproxamine, iprozilamine, ipsalazide, ipsapirone, iquin hexadimethrine bromide, hexafluorenium bromide, hexam damine, irindalone, irloxacin, irolapride, irSogladine, isam ethonium bromide, hexamidine, hexapradol, hexaprofen, faZone, isamoltan, isamoxole, isaxonine, isbogrel, isepami hexapropymate, heXasonium iodide, heXacarbacholine bro cin, isoaminile, isobromindione, isobucaine, isobutamben, mide, hexedine, hexestrol, heXetidine, hexobarbital, heX isocarboxazid, isoconazole, isocromil, isoetharine, isof obendine, hexocyclium methylsulfate, hexoprenaline, heX eZolac, isoflupredone acetate, isoflurane, isoflurophate, iso opyrronium bromide, hexylcaine, hexylene glycol, leucine, isomazole, isomerol, isometamidium, isometha hexylresorcinol, histamine, histapyrrodine, homarylamine, done, isomethept ne, isomylamine, isoniazid, isonixin, homatropine, homatropine methylbromide, homidium bro isopraZone, isoprednidene, isoprofen, isoprofamide iodide, mide, homochlorcyclizine, homofenazine, homoharringto isopropicillin, isopropyl myristate, isopropyl palmitate, iso nine, homopipramol, homosalate, homotestosterone propi proterenol, isosorbide, isosorbide dinitrate, isosorbide onate, homprenorphine, hopantenic acid, hoquizil, mononitrate, isospalglumic acid, isosulfan blue, isoSulpride, hycanthone, hydracarbazine, hydralazine, hydrargaphen, isothipendyl, isotic, isotiquimide, isotretinoin, isoxaprolol, hydrobentizide, hydrochlorthiazide, hydrocodone, hydro isoXepac, isoxicam, iSOXSuprine, isradipine, itanOXOne, itazi cortamate, hydrocortisone, hydrocortisone aceponate, grel, itraconazole, itrocainide, ivermectin bib, ivoqualine, hydrocortisone acetate, hydrocortisone butyrate, hydrocor josamycin, kainic acid, kalafungin, kanamycin, kebuZone, tisone cypionate, hydrocortisone-phosphate, hydrocortisone keracyanin, ketamine, ketanserin, ketazocine, ketazolam, Succinate, hydrocortisone Valerate, hydroflumethiazide, kethoxal, ketipramine, ketobemidone, ketocaine, ketocainol, hydromadinone, hydromorphinol, hydromorphone, hydro ketoconazole, ketoprofen, ketorfanol, ketorolac, ketotifen, quinone, hydroxindasate, hydroxindasol, hydroxyOXocobal ketotrexate, khellin, khelloSide, kitasamycin, labetalol, laci amin, hydroxy amphetamine, hydroxychloroquine, dipine, lactalfate, lactose, lactulose, lamotrigine, lamtidine, hydroxydimethandrostadienone, hydroxydione Succinate, lanatoside, lapachol, lapinone, lapyrium chloride, la, hydroxymethylandrostanone, 10-hydroxynorehisterone, Salocid, laudexium methyl Sulfate, lauralkonium chloride, hydroxypethidine, hydroxyphenamate, hydroxyprocaine, laureth, laurixamine, laurocapram, lauroguadine, lauro hydroxyprogeSerone, hydroxyprogesterone caproate, linium acetate, lauryl isoquinolinium, lefetamine, lefluno hydroxypyridine tartrate, hydroxyStilbamidine, 7-hydrox mide, leiopyrrole, lemidoSul, lenampicillin, leniquinsin, len yteStololacetone, hydroxytestosterone propionate, hydrox perone, leptacline, lergotrile, letimide, letosteine, leucine, ytetracaine, hydroxytoluic acid, hydroxyurea, hydroxy Zine, leucinocaine, leucocianidol, leucovorin, levacecarnine, hymecromone, hyoscyamine, hypericin, ibacitabine, iba levallorphan, levamfetamine, levamisole, levdropropizine, floxacin, ibazocine, ibopamine, ibrotamide, ibudilast, levisoprenaline, levlofexidine, levobunolol, levocabastine, ibufenac, ibuprofen, ibuprofen piconol, ibuproxam, ibuterol, levocarnitine, levodopa, levofacetoperane, leVofenflu ibuverine, icazepam, icosipiramide, icotidine, idarubicin, ramine, levofuraltadone, leVoglutamide, levomenol, idaverine, idaZOXan, idebenone, idenast, idoxuridine, idral levomethadone, levomethadyl acetate, levomethorphan, fidine, idrocilamide, idiropranolol, ifenprodil, ifosfamide, levometiomeprazine, levomopranol, levomoramide, levo ifoxetine, ilmofoSine, iloprost, imafen, imanixil, imaZOdan, nantradol, levonordeprin, levonorgestrel, levophenacyl mor imcarbofoS, imeXon, imiclopazine, imidazole Salicylate, phan, levopropoxyphene, levopropylcillin, levopropyl imidazopyrazole, imidecyl iodine, imidocarb, imidoline, hexedrine, levoprotiline, levorin, levorphanol, imidurea, imiloxan, iminophendimide, imipenem, imi levothyroXine, leVOXadrol, leXofenac, libecillide, libenza pramine, imipraminoxide, imirestat, imolamine, imOXiterol, pril, lidamidine, lidocaine, lidofenin, lidoflazine, lifibrate, impacarzine, impromidine, improSulfan, imuracetam, ina lilopristone, limaprost, lincomycin, lindane, linsidomine, perisone, indacrinone, indalpine, indanazoline, indanidine, liothyronine, liroldine, lisinopril, lisuride, lithium carbonate, indanorex, indapamide, indatraline, indacainide, indelox lithium citrate, litracen, lividomycin, lixazinone, lobeline, azine, indenolol, indicine-N-oxide, indigotindisulfonic acid, lobendazole, lobenzarit, lobuprofen, locicortone, lodax indobufen, indocate, indocyanine green, indolapril, indol aprine, lodace/arlodinixil, lodiperone, lodoxamide, lodoxa idan, indomethacin, indopanolol, indopine, indoprofen, mide ethyl, lofemizole, lofendazam, lofentanil, lofepramine, indoramin, indorenate, indoxole, indriline, inicarone, inoco lofexidine, loflucarban, lombazole, lomefloxacin, lometra terone, inosine, inosine dialdehyde, inositol niacinate, inp line, lomevactone, lomifylline, lomofungin, lomustine, lona roquone, intrazole, intriptyline, iobenzamic acid, iobutic palene, lonaprofen, lonazolac, lonidamine, loperamide, lop acid, iocarmic acid, iocetamic acid, iodamide, iodecimol, eramide oxide, lopirazepam, loprazolam, loprodiol, iodetryl, iodipamide, iodixanol, iodoalphionic acid, iodol, lorajmine, lorapride, loratadine, lorazepam, lorbamate, iodophthalein, iodoquinol, iodothiouracil, iodoxamic acid, lorcainide, lorcinadol, lorglumide, lormetazepam, lorta ioglicic acid, ioglucol, ioglucomide, ioglunide, ioglycamic lamine, lorZafone, losindole, loSulazine, lotifazole, lotrifen, acid, iogulamide, iohexol, iodlidonic acid, iolixanic acid, lotucaine, lovastatin, loxanast, loxapine, loxiglumide, loXo iomeglamic acid, iomeprol, iomorinic acid, iopamidol, profen, loxtidine, lozilurea, lucanthone, lucartamide, luci iopanoic acid, iopentol, iophendylate, iophenoxic acid, mycin, lufuradom, lupitidine, luprostiol, luxabendazole, ioprocemic acid, iopromide, iopronic acid, iopydol, iopy lyapolate Sodium, lycetamine, lydimycin, lymecycline, done, ioSarcol, ioSefamic acid, ioSeric acid, iosimide, ioSu lynestrenol, lySergide, lysine, mabuterol, maduramicin, lamide, ioSumetic acid, iotasul, iotetric acid, iothalamic acid, mafenide, mafoprazine, mafosfamide, magnesium citrate, iotranic acid, iotrizoic acid, iotrolan, iotroXic acid, iOverSol, magnesium, gluconate, magnesium Salicylate, malathion, ioXabrolic acid, iOXaglic acid, ioxitalamic acid, ioxotrizoic malethamer, malic acid, malotilate, manidipine, manganese acid, iOZomic acid, ipexidine, ipodic acid, ipragratine, ipra gluconate, mannitol, mannitol heXanitrate, mannomustine, midil, ipratropium bromide, iprazochrome, ipriflavone, mannoSulfan, manoZodil, maprotiline, maridomycin, marip iprindole, iprocinodine, iproclozide, iprocrolol, iprofenin, tiline, marOXepin, maytansine, maZaticol, mazindol, iproheptine, iproniazid, iproidazole, iproplatin, iprotiazem, maZipredone, mebanazine, mebendazole, mebenoside, US 2005/0002865 A1 Jan. 6, 2005 29 mebeverine, mebeZonium iodide, mebhydrolin, mebiquine, ylprednisolone hemisuccinate, methylprednisolone mebolazine, mebrofenin, mebutamate, mebutizide, phosphate, methylprednisolone Suleptanate, methyl Salicy mecamylamine, mecarbinate, mecetronium ethylsulfate, late, methylstreptonigrin, 4-methyltestosterone, 7-methylt mechlorethamine, meciadanol, mecinarone, meclizine, estosterone, 17-methyltestosterone, 7-methylteSosterone meclocycline, meclocycline Sulfosalicylate, meclofenamic propionate, methylthionosine, 16-methylthioprogestone, acid, meclofenoxate, meclonazepam, mecloqualone, meclo methylthiouracil, methynodiol diacetate, methyprylon, ralurea, meclorisone dibutyrate, mecloxamine, mecobal methySergide, metiamide, metiapine, metiaZinic acid, amin, mecrylate, mecysteine, medazepam, medaZomide, metibride, meticrane, metildigoxin, metindizate, metioprim, medetomidine, medibazine, medifoxamine, medorinone, metioXate, metipiroX, metipranolol, metiprenaline, medorubicin, medrogestone, medronic acid, medroxalol, metitepine, metizoline, metkephamid, metochalcone, meto medroxyprogestrone, medroxyprog Strone acetate, medry cinium iodide, metoclopramide, metocurine iodide, lamine, medrySone, mefeclorazine, mefenamic acid, mefeni metofenazate, metogest, metolaZone, metomidate, metopi dil, mefenidramium metilsulfate, mefenorex, mefeserpine, mazine, metopon, metoprine, metoprolol, metoquizine, mefeXamide, mefloquine, mefruside, megalomicin, mege metoSerpate, metoStilenol, metoxepin, metrafazoline, Strol acetate, meglitinide, megucycline, meglumine, meglu metralindole, metrazifone, metrenperone, metribolone, met tol, meladrazine, melarSonyl, melarSoprol, melengestrol rifonate, metrifudil, metrizamide, metrizoic acid, metronida acetate, meletimide, melinamide, melitracen, melizame, Zole, meturedepa, metyrapone, metyridine, metyrosine, meloxicam, melperone, melphalan, memantine, memotine, mevastatin, meXafylline, mexazolam, meXenone, mexilet menabitan, menadiol, menadiol diphosphate, menadiol dis ine, mexiprostil, mexoprofen, meXrenoate, meZacopride, ulfate, menadione, menadione Sodium bisulfite, menate meZepine, meZilamine, meZlocillin, mianserin, mibolerone, trenone, menbutone, menfegol, menglytate, menitrazepam, micinicate, miconazole, micronomicin, midaflur, midagli menoctone, menogaril, menthol, meobentine, meparfynol, Zole, midalcipran, midamaline, midazogrel, midazolam, mepazine, mepenZolate bromide, meperidine, mephenesin, midecamycin, midodrine, mifentidine, mifepristone, mifo mephenoxalone, mephentermine, mephenyton, mephobar bate, miglitol, mikamycin, millacemide, milemperone, mili bital, mepindolol, mepiprazole, mepiroXol, mepitioStane, pertine, miloxacin, milrinone, milverine, mimbane, mepivacaine, mepixanox, mepramidil, meprednisone, mep minaprine, minaxolone, mindolilol, mindoperone, minepen robamate, meproscillarin, meproxitol, meprylcaine, tate, minocromil, minocycline, minoxidil, mioflazine, mipi meptazinol, meguidox, meguinol, meguitazine, meralein, mazole, mirincamycin, miristalkonium chloride, miropro meralluride, merbarone, merbromin, mercaptamine, mer fen, mirosamicin, misonidazole, misoprostol, mitindomide, captomerin, mercaptopurine, mercuderamide, mercufenol mitobronitol, mitoclomine, mitoguaZone, mitolactol, mito chloride, mercumatilin, mercurobutol, mergocriptine, mycin, mitonafide, mitopodozide, mitocquidone, mitotane, merophan, merSalyl, mesabolone, meSalamine, meSecla mitotenamine, mitoxantrone, mitoZolomide, mivacurium Zone, meSna, mesocarb, meso-hexestrol, mesoridazine, chloride, mixidine, misoprostol, mitindomide, mitobronitol, mesipirenone, meStanolone, mesterolone, meStranol, meSu mitoclomine, mitoguaZone, mitolactol, mitomycin, mitona dipine, meSulergine, meSulfamide, meSulfen, meSuprine, fide, mitopodozide, mitocquidone, mitotane, mitotenamine, metabromsalan, metacetamol, metaclazepam, metaglycodol, mitoxantrone, mitoZolomide, mivacurium chloride, mixi metahexamide, metamelfalan, metamfaZone, metamfepra dine, mizoribine, mobecarb, mobenzoxamine, mocimycin, mone, metampicillin, metanixin, metapramine, metaproter mociprazine, moclobemide, moctamide, modafinil, moda enol, metaraminol, metaterol, metaxalone, metaZamide, line, mofebutaZone, mofloverine, mofoXime, molfarnate, metazide, metazocine, metbufen, meteneprost, metergoline, molinaZone, molindone, molracetam, molsidomine, metergotamine, metescufylline, meteSculletol, metethohep mometasone furoate, monalazone disodium, monensin, tazine, metformin, methacholine chloride, methacycline, monobenzone, monoethanolamine, monometacrine, mono methadone, methadyl acetate, methallenestril, methallibure, phosphothiamine, monothioglycerol, monoxerutin, montire methalthiazide, methamphetamine, methandriol, meth lin, moperone, mopidamol, mopidralazine, moprolol, androstenolone, methaniazide, methantheline bromide, moduizone, morantel, moraZone, morclofone, morforex, methaphenilene, methapyrilene, m thaqualone, metharbital, moricizine, morinamide, morniflumate, morocromen, methastyridone, methazolamide, methdilazine, meth morOXydine, morpheridine, morphine, morSuximide, mot enamine, methenolone acetate, methenolone enanthate, apizone, motrazepam, motretinide, moveltipril, moxadolen, metheptazine, methestrol, methetoin, methicillin, methima moxalactam, moxaprindine, moxastine, moxaverine, mox Zole, methiodal Sodium, methioguanine, methiomeprazine, azocine, moxestrol, moxicoumone, moxipraquine, moxisy methionine, methisaZone, methitural, methixene, methocar lyte, moxnidazole, moXonidine, mupirocin, murabutide, bamol, methohexital, methopholine, methoSerpidine, meth murocainid muZolimine, mycophenolic acid, my fadol, otrexate, methotrimeprazine, methoxamine, methoXSalen, myralact, myrophine, myrtecaine, nabaZenil, nabilone, nabi methoxyflurane, methoxyphedrine, methoxyphenamine, tan, naboctate, nabumetone, nadide, nadolol, nadoxolol, methoxypromazine, methScopolamine bromide, methSuxim naepaine, nafamoStat, nafazatrom, nafcaproic acid, nafcillin, ide, methylclothiazide, N-methyladrealone hcl, methyl alco nafenodone, nafenopin, nafetolol, nafimidone, nafiverine, hol, methylatropine nitrate, methylbenactyzium bromide, naflocort, nafomine, nafoxadol, nafoxidine, nafronyl, nafta methylbenzethonium, methylchromone, methyldesorphine, lofoS, naftaZone, naftifine, naftopidil, naftoxate, naftypra methyldihydromorphine, methyldopa, methyldopate, meth mide, nalbuphine, nalidixic acid, nalmefene, nalmeXOne, ylene blue, methylphedrine, methylergonovine, methylfor nalorphine, naltrexone, naminterol, namoxyrate, nanapro mamide, methyl nicotinate, 2-methyl-19-nortestosterone, cin, nandrolone cyclotate, nandrolone decanoate, nan 2-methyl-11-oxoprogestrone, methyl palmoxirate, meth drolone, phenpropionate, nanofin, nantradol, napacitadine, ylparaben, methylphendiate, methylprednisolone, methyl napamezole, naphazoline, naphthonone, naprodoxime, prednisolone aceponate, methylprednisolone acetate, meth naproxen, naproXol, naranol, narasin, natamycin, naX US 2005/0002865 A1 Jan. 6, 2005 30 agolide, naxaprostene, nealbarbital, nebidrazine, nebivolol, Oxaprotiline, Oxaprozin, oxarbazole, Oxatomide, oxazafone, nebracetam, nedocromil, nefazodone, neflumozide, nefo oxazepam, oxazidione, oxazolam, oxazorone, Oxcarba pam, neleZaprine, neoarSphenamine, neocinchophen, neo Zepine, Oxdralazine, OXeladin, Oxendolone, OXepinac, oxet mycin, neostigmine bromide, nequinate, neraminol, ner acillin, oxethazaine, Oxetorone, Oxfendazole, Oxfenicine, bacadol, neSapidil, neSOsteine, netilmicin, netobimin, OXibendazole, Oxibetaine, oxiconazole, oxidopamine, neutramycin, neXeridine, niacin, niacinamide, nialamide, oxidronic acid, oxifentorex, OXifungin, OXilorphan, oxi niaprazine, nibroxane, nicafenine, nicainoprol, nicametate, monam, OXindanac, OXiniacic acid, OXiperomide, oxirac nicarbazin, nicarpidine, nicergoline, niceritrol, niceverine, etam, OXiramide, oxisopred, OXisuran, OXitefonium bromide, niclofolan, niclosamide, nicoboxil, nicoclonate, nicocodine, oxitriptan, OXitriptyline, OXitropium bromide, OXmetidine, nicocortonide, nicodicodine, nicofibrate, nicofuranose, nico OXOdipine, Oxogestone phenpropionate, oxolamine, OXolinic furate, nicogrelate, nicomol, nicomorphine, nicopholine, acid, oxomemazine, OXonazine, oxophenarsine, Oxoprostol, nicorandil, nicothiaZone, nicotinyl alcohol, nicOXamat, nic oXpheneridine, Oxprenoate potassium, OXprenolol, OXtriph tiazem, nictindole, nodroxy Zone, nifedipine, nifenalol, ylline, oxybenzone, Oxybutynin, oxychlorosene, Oxycin nifenaZone, niflumic acid, nifluridide, nifuradene, nifurald chophen, oxyclozanide, Oxycodone, Oxydipentonium chlo eZone, nifuralide, nifuratel, nifuratrone, nifurdazil, knifure ride, Oxyfedrine, oxymesterone, oxymetazoline, thaZone, nifurfoline, nifurimide, nifurizone, nifurmazole, oxymetholone, Oxymorphone, oxypendyl, oxypertine, nifurmerone, nifuroquine, nifuroxazide, nifuroxime, nifurpi OxyphenbutaZone, oxyphenonium bromide, Oxypurinol, pone, nifurpirinol, nifurprazine, nifurcquinazole, nifurSemi Oxypyrronium bromide, Oxyquinoline, Oxyridazine, oxySo Zone, nifurSol, nifurthiazole, nifurtimox, nifurtoinol, nifur nium iodide, Oxytetracycline, Oxytiocin, OZagrel, Ozolinone, Vidine, nifurzide, niguldipine, nihydraZone, nikethamide, pacrinolol, pactamycin, padimate, pafenolol, palatrigine, nileprost, nilprazole, niludipine, nilutamide, nilvadipine, paldimycin, palmidrol, palmoxiric acid, pamabrom, pam nimaZone, nimeSulide, nimetazepam, nimidane, nimodipine, aquine, pamatolol, pamidronic acid, pancuronium bromide, nimorazole, nimustine, niometacin, niperotidine, nipradillol, panidazole, panomifene, patenicate, panthenol, pantothenic niprofaZone, niridazole, nisbuterol, nisobamate, nisoldipine, acid, panuramine, papaverine, papaveroline, parachlorophe nisoxetine, nisterime acetate, nitarSone, nitaZOXanide, nithia nol, paraflutizide, paraldehyde, paramethadione, parametha mide, nitracrine, nitrafudam, nitralamine, nitramisole, Sone acetate, paranyline, parapenzolate bromide, para nitraduaZone, nitrazepam, nitrefazole, nitrendipine, nitricho propamol, pararosaniline, pararosaniline embonate, line, nitrochlofene, nitrocycline, nitrodan, nitrofurantoin, paraXaZone, parbendazole, parconazole, pareptide, pare nitrofurazone, nitroglycerin, nitromersol, nitromide, thoxycaine, pargeverine, pargolol, pargyline, paridocaine, nitromifene, nitroScanate, nitroSulfathiazole, nitroXinil, parodilol, paromomycin, paroxetine, paroxypropione, nitroxoline, nivaZol, nivimeldone, nixylic acid, nizatidine, parSalmide, partricin, parvaquone, pasiniazid, paulomycin, nizofenone, noberastine, nocloprost, nocodazole, nofecain paXamate, paZelliptine, paZOxide, pcnu, pecilocin, pecocy ide, nogalamycin, nolinium bromide, nomegestrol, nomeli cline, pefloxacin, pelanSerin, pelretin, pelrinone, pemedolac, dine, nomifensine, nonabine, nonaperone, nonapyrimine, pemerid, pemoline, pempidine, penamecillin, penbutolol, nonoxynol-4, nonoxynol-9, noracy methadol, norbolethone, pendecamaine, penfluridol, penflutizide, pengitoxin, peni norbudrine, norcloStebol, norcodeine, nordazepam, norde cillamine, penicillin procaine, penicillin, penimepicycline, frin, nordinone, norepinephrine, norethandrolone, norethin penimocycline, penirolol, penmesterol, penoctonium bro drone, norethindrone acetate, norethynodrel, noreximide, mide, penprostene, pentabamate, pentacynium chloride, norfenefrine, norfloxacin, norfloxacin Succinil, norflurane, pentaerythritol tetranitrate, pentafluranol, pentagastrin, pent norgesterone, norgestimate, norgestomet, norgestrel, norg agestrone, pentalamide, pentamethonium bromide, pentam estrienone, norletimol, norlevorphanol, normethadone, ethylmelamine, pentamidine, pentamoxane, pentamustine, normethandrone, normorphine, norpipanone, nortestoster pentapiperide, pentapiperium methylsulfate, pentaduine, one propionate, nortetrazepam, nortriptyline, norvinister pentazocine, pentetate calcium triSodium, pentetic acid, one, noSantine, noScapine, noSiheptide, novobiocin, noXip penthienate bromide, penthrichloral, pentiapine maleate, tiline, noxytiolin, nuclomedone, nuclotixine, nulfenoXole, pentifylline, pentigetide, pentisomicin, pentisomide, pentizi nuVenzepine, nylestriol, nylidrin, nyStatin, obidoxime, Ocilt done, pentobarbital, pentolinium tartrate, pentomone, pen ide, ocrylate, octabenzone, octacaine, octafonium chloride, topril, pentorex, pentosan polysulfate Sodium, pentostatin, octamoxin, octamylamine, octanoic acid, octapinol, octast pentoxifylline, pentrinitrol, pentylenetrazole, peplomycin, ine, octaverine, octaZamide, octenidine, octenidine Saccha pepstatin, peraclopone, peradoxime, perafensine, peralo rin, Octicizer, Octimibate, octorylene, octodrine, octopamine, pride, peraquinsin, perastine, peratizole, perbufylline, per Octotiamine, Octoxynol-9, octriptyline, octrizole, ofloxacin, fluiamine, perflunafene, pergolide, perhexilene, periciazine, ofornine, oftasceine, Olaflur, olacquindox, oleanomycin, ole perimetazine, perindopril, perindoprilat, perisoxal, perlap timol, oleyl alcohol, olivomycin a, Olmidine, olpimedone, ine, permethrin, perphenazine, persilic acid, petrichloral, olsalazine, oltipraz, olvanil, omeprazole, omidoline, Omo peXantel, phanquone, phenacaine, phenacemide, phenacetin, conazole, omonasteine, Onapristone, ondansetron, Ontianil, phenact tropinium chloride, phenadoxone, phenaglycodol, opiniazide, opipramol, oraZamide, orbutopril, orconazole, phenamaZoline, phenampromide, phenarSone Sulfoxylate, orestrate, Ormetoprim, ornidazole, Ornipressin, ornithine, phenazocine, phenazopyridine, phencarbamide, phencyclid ornoprostil, orotic acid, orotirelin, orpanoxin, orphenadrine, ine, phendimetrazine, phenelZine, pheneridine, phenesterin, ortetamine, OSalmid, OSmadizone, otilonium bromide, otim penethicillin, phenformin, phenglutarimide, phenicarbazide, erate Sodium, Ouabain, Oxabolone cipionate, OXabrexine, phenindamine, phenindione, pheniprazine, pheniramine, Oxaceprol, oxacillin, oxadimedine, Oxaflozane, oxaflu phenisonone, phenmetrazine, phenobarbital, phenobutiodil, mazine, OXagrelate, Oxalinast, Oxaliplatin, OXamarin, OXam phenolphtalein, phenolsulfonphthalein, phenomorphan, etacin, oxamisole, Oxamniquine, Oxanamide, Oxandrolone, phenoperidine, phenothiazine, phenothrin, phenoxyben OXantel, oxapadol, oxapium iodide, Oxapropanium iodide, Zamine, phenoxypropazine, phenprobamate, phenprocou US 2005/0002865 A1 Jan. 6, 2005 mon, phenpromethamine, phensuXimide, phentermine, mide, procaine, procarbazine, procaterol, prochlorperazine, phentolamine, phenylalanine, phenyl aminoSalicylate, phe procinolol, procinonide, proclonol, procodazole, procyclid nylbutaZone, phenylrphrine, phenylethyl alcohol, phenylm ine, procymate, prodeconium bromide, prodilidine, ercuric acetate, phenylmercuric borate, phenylmercuric prodipine, prodblic acid, profadol, profeXalone, proflavine, chloride, phenylmercuric nitrate, phenylmethylbarbituric proflazepam, progabide, progesterone, proglumetacin, pro acid, phenylpropanolamine, phenylthilone, phenyltoloxam glumide, proheptazine, proligestone, proline, prolintane, ine, phenyramidol, phenytoin, phetharbital, pholcodine, prolonium iodide, promazine, promegestone, promestricne, pholedrine, phosphoramide mustard, phoxim, phthalofyne, promethazine, promolate, promoxolane, pronetalol, propac phthalysulfacetamide, phthalylsulfamethizole, phthalylsul etamol, propafenone, propamidine, propanidid, pro fathiazole, phySoStigmine, phytic acid, phytonadiol diphos panocaine, propantheline bromide, proparacaine, propatyl phate, phytonadione, pibecarb, pibenzimol, pibecarb, piben nitrate, propazolamide, propendiazole, propentofylline, pro Zimol, piberaline, picafibrate, picartamide, picenadol, penZolate, properidine, propetamide, propetandrol, propicil picilorex, piclonidine, piclopastine, picloxydine, picoben lin, propikacin, propinetidine, propiolactone, propiomazine, Zide, picodralazine, picolamine, piconol, picoperine, pico propipocaine, propiram, propisergide, propiverine, prazole, picotamide, picotrin diolamine, picumast, pidolic propizepine, propofol, propoXate, propoxycaine, pro acid, pifarnine, pilfenate, pifeXole, piflutiXole, pifoXime, poxyphene, propranolol, propyl docetrizoate, propylene gly piketoprofen, pildralazine, pilocarpine, pimoclone, pimefyl col, propylene glycol monoStearate, propyl gallate, propyl line, pimelautde, pimetacin, pimethixene, pimetime, pime hexedrine, propyliodone, propylparaben, propylthiouracil, tremide, piminodine, pimobendan, pimondiazole, pimozide, propyperone, propyphenaZone, propyromazine bromide, pinacidil, pinadoline, pinafide, pinaverium bromide, produaZone, produinolate, prorenoate potassium, proroXan, pinazepam, pincainide, pindolol, pinolcaine, pinoxepin, proscillaridin, prospidium chloride, prostalene, proSulpride, pioglitaZone, pipacycline, pipamazine, pipaperone, proSultiamine, proterguride, protheobromine, prothipendyl, pipazethate, pipebuZone, pipecuronium bromide, pipemidic prothixene, protiofate, protionamide, protirelin, protizinic acid, pipenZolate bromid pipequaline, piperacetazine, pip acid, protokylol, protoveratine, protriptyline, proxazole, eracillin, piperamide, piperazine, piperazinedione, piperi proXibarbal, proxibutene, proXicromil, proxifeZone, proXor dolate, piperilate, piperocaine, piperoxan, piperylone, pipo phan, proxyphylline, proZapine, pseudoephedrine, psilocy broman, pipoctanone, pipofeZine, pipOSulfan, pipotiazine bine, pumiteba, puromycin, pyrabrom, pyran copolymer, palmiate, pipOXizine, pipOXolan, pipradimadol, pipradol, pyrantel, pyrathiazine, pyrazinamide, pyrazofurin, pyricar pipramadol, pipratecol, piprinhydrinate, piprocurarium bate, pyridarone, pyridofylline, pyridostigmine bromide, iodide, piprofurol, piprozolin, piquindone, piquizil, pirac pyridoxine, pyrilamine, pyrimethamine, pyrimitate, pyrino etam, pirandamine, pirarubicin, piraxelate, piraZmonam, line, pyrithione Zinc, pyrithyldione, pyritidium bromide, piraZolac, pirbenicillin, pirbuterol, pirdonium bromide, pyritinol, pyronine, pyrophenindane, pyrovalerone, pyrox pirenoxine, piremperone, pirenzepine, pirepolol, piretanide, amine, pyrrobutamine, pyrrocaine, pyrroliphene, pyrrolni pirfenidone, piribedil, piridicillin, piridocaine, piridoxilate, trin, pyrvinium chloride, pytamine, quadazocine, quadrosi piridironic acid, pirifibrate, pirindazole, pirinixic acid, pirin lan, quatacaine, quazepam, quaZinone, quaZodine, iXil, piriprost, piriqualone, piriSudanol, piritramide, piritr quaZolast, quifenadine, quillifoline, quinacainol, quinacillin, exim, pirlimycin, pirlindole, pirmagrel, pirmenol, pirnabine, quinacrine, quinaldine blue, quinapril, quinaprilat, piroctone, pirogliride, piroheptine, pirolate, pirolazamide, quinaZOsin, quinbolone, quincarbate, quindecamine, quin piromidic acid, piroXantrone hcl, piroXicam, piroXicam cin donium bromide, quindoxin, quinestradol, quinestrol, namate, piroXicillin, piroXimone, pirozadil, pirprofen, quinethaZone, quinetolate, quineZamide, quinfamide, pirquinozol, pirralkonium bromide, pirtenidine, pitenodil, quingestanol acetate, quingestrpne, quindine, quinine, pitofenone, pituxate, pivampicillin, pivenfrine, pivopril, piv quinocide, quinpirole, quinterenol, quintiofoS, quinuclium oxazepam, pizotyline, plafibride, plaunotol, pleuromulin, bromide, quinupramine, quipazine, quisultazine, race fem plicamycin, podilfen, podophylloxOXin, poldine methylsul ine, racemethionine, racemethorphan, racemetirosine, raclo fate, polidocanol, ploymyxin, polythiazide, ponalrestat, pon pride, ractopamine, rafoxanide, ralitoline, raloxifene, ram fibrate, porfiromycin, poskine, potassium guaiacolsulfonate, ciclane, ramefenaZone, ramipril, ramiprilat, ramixotidine, potassium nitrazepate, potassium Sodium tartrate, potassium ramnodignin, ranimustine, ranimycin, ranitidine, ranolazine, Sorbate, potassium thiocyanate, practolol, prajmalium, prali rathyronine, raZinodil, raZobazam, razoxane, reboxetine, doXime chloride, pramipexole, pramiracetam, pramiverine, recainam, reclazepam, relomycin, remoxipride, renanolone, pramoxime, prampine, pranolium chloride, pranoprofen, rentiapril, repirinast, repromicin, reproterol, recimetol, res pranosal, prasterone, pravastatin, praXadine, prazepam, cinnamine, reserpine, resorantel, resorcinol, resorcinol prazepine, praZiquantel, praZitone, praZOcillin, praZOsin, monoacetate, retelliptine, retinol, revenast, ribavirin, ribo preclamol, prednazate, prednazoline, prednicarbate, predni flavin, riboflavin 5'-phosphate, riboprine, ribostamycin, mustine, prednisolamate, prednisolone, prednisolone ridazolol, ridiflone, rifabutin, rifamide, rifampin, rifamycin, acetate, prednisolone hemisuccinate, prednisolone phos rifapentine, rifaximin, rilapine, rilmazafone, rillmenidine, phate, prednisolone Steaglate, prednisolone tebutate, pred rilopiroX, riloZarone, rimantadine, rimazolium metilsulfate, nisone, prednival, pr dnylidene, prefenamate, pregnenolone, rimcazole, rimeXolone, rimiterol, rimoprogin, riodipine, rio pregnenolone Succinate, premazepam, prenalterol, prostil, ripazepam, risocaine, risperidone, ristianol, ristoce prenisteine, prenoverine, prenoXciazine, prenylamine, pre tin, ritanserin, ritiometan, ritodrine, ritropirronium bromide, tamazium iodide, pretiadil, pribecaine, pridefine, prideper ritroSulfan, robenidine, rocastine, rociverine, rodocaine, one, pridinol, prifelone, pri?inium bromide, prifuroline, rodorubicin, rofelodine, roflurante, rokitamycin, roletamide, prilocaine, primaperone, primaquine, primidolol, primidone, rolgamidine, rolicyclidine, rolicyprine, rolipram, rollitetra primycin, prinomide, pristinamycin, prizidilol, proadifen, cycline, rolodine, rolziracetam, romifenone, romifidine, probarbital, probenecid, probicromil, probucol, procaina ronactolol, ronidazole, ronifibrate, ronipamil, ronnel, ropi US 2005/0002865 A1 Jan. 6, 2005 32 toin, ropivacaine, ropizine, roquinimex, rosaprostol, rosa fapyridine, Sulfacquinoxaline, SulfarSphenamine, SulfaSala ramicin, rosaramicin butyrate, rosaramicin propionate, Zine, SulfaSomizole, SulfaSuccinamide, Sulfasymazine, Sul roSoxacin, rosterolone, rotamicillin, rotoxamine, rotraxate, fathiazole, Sulfathiourea, Sulfatolamide, Sulfatroxazole, roXarSone, roXatidine acetate, roXibolone, roXindole, Sulfatrozole, Sulfazamet, Sulfinalol, Sulfinpyrazone, Sulfiram, roXithromycin, roXolonium metilsulfate, roXoperonef Sulfisomidine, Sulfisoxazole, Sulfisoxazole, Sulfobromoph rufloxacin, rutamycin, rutin, ruvaZone, Sabeluzole, Saccha thalein, Sulfonethylmethane, Sulfonmethane, Sulfonterol, rin, Salacetamide, Salafibrate, Salantel, Salazodine, SalazOS Sulforidazine, Sulfoxone Sodium, Sullicrinat, Sulindac, Suli Sulfadimedine, SalazOSulfamide, SalazoSulfathiazole, Sale Satin, Sulisobenzone, Sulmarin, Sulmazole, Sulmepride, thamide, Salfluverine, Salicin, Salicyl alcohol, Salicylamide, Sulinidazole, Sulocarbilate, Suloctidil, Sulosemide, Salicylanilide, Salicylic acid, Salinazid, Salinomycin, Salme Sulotroban, Suloxifen, Sulpiride, Sulprosal, Sulprostone, Sul fanol, Salmeterol, Salmisteine, Salprotoside, Salsalate, Salver tamicillin, Sulthiame, Sultopride, Sultosilic acid, Sultropo ine, Sancycline, Sangivamycin, Saperconazole, Sarcolysin, nium, Sulverapride, Sumacetamol, Sumatriptan, Sumetizide, Sarmazenil, Sarmoxicillin, Sarpicillin, Saterinone, Satranida Sunagrel, Suncillin, Supidimide, Suproclone, Suprofen, Zole, SaVOXepin, Scarlet red, Scopafungin, Scopolamine, Suramin, Suricainide, Suriclone, Suxemerid, SuXethonium SeclaZone, Secnidazole, Secobarbital, Secoverine, Securinine, chloride, SuxibuZone, Symclosene, Symetine, Synephrine, Sedecamycin, Seganserin, Seglitide, Selegiline, Selenium Sul Syrisingopine, taclamine, tacrine, taglutimide, talampicillin, fide, Selprazine, Sematilide, Semustine, Sepazonium chloride, talastine, talbutal, taleranol, talinolol, talipexole, tallisomy Seperidol, Sequifenadine, Serfibrate, Sergolexole, Serine, Ser cin, talmetacin, talmetoprim, talniflumate, talopram, talos metacin, Serotonin, Sertaconazole, Sertraline, Setastine, Set alate, taloximine, talsupram, taltrimide, tameridone, tameti aZindol, Setiptiline, Setoperone, Sevitropium mesilate, SeVof cillin, tametraline, tamitinol, tamoxipen, tampramine, lurane, Sevopramide, Siagoside, Sibutramine, Siccanin, tandamine, taprostene, tartaric acid, tasuldine, taurocholic Silandrone, Silibinin, Silicristin, Silidianin, Silver Sulfadiaz acid, taurolidine, tauromustine, tauroSelcholic acid, taurul ine, Simetride, Simfibrate, SimtraZene, Simvastatin, Sinefun tam, taxol, taZadolene, taZanolast, tazaburate, taZeprofen, gin, Sintropium bromide, Sisomicin, Sitalidone, Sitofibrate, taZifylline, taZiprinone, tazolol, tebatizole, tebuduine, sitogluSide, Sodium benzoate, Sodium dibunate, Sodium teclothiazide, teclozan, tedisamil, tefazoline, tefenperate, ethasulfate, Sodium formaldehyde Sulfoxylate, Sodium gen tefludazine, teflurane, teflutiXol, tegafur, telenzepine, tema tisate, Sodium gualenate, Sodium nitrite, Sodium nitroprus floxacin, temarotene, temazepam, temefoS, temelastine, Side, Sodium oxybate, Sodium phenylacetate, Sodium pico temocillin, temodox, temozolomide, temurtide, tenamfe fosfate, sodium picosulfate, sodium propionate, sodium tamine, tenilapine, teniloxazine, tenilsetam, teniposide, Stibocaptate, Sodium Stibogluconate, Sodium tetradecyl Sul tenocyclidine, tenonitrozole, tenoxicam, tenylidone, teop fate, Sodium thiosulfate, Sofalcone, Solasulfone, Solpecainol, ranitol, teoprolol, tepirindole, tepoxalin, teraZosin, terbin Solypertine, Somantadine, Sopitazine, Sopromidine, Soqui afine, terbucromil, terbufibrol, terbuficin, terbuprol, terbuta nolol, Sorbic acid, Sorbinicate, Sorbinil, Sorbitan monolau line, terciprazine, terconazole, terfenadine, terfluranol, rate, Sorbitan monooleate, Sorbitan monopalmitate, Sorbitan terguride, terizidone, ternidazole, terodiline, terofenamate, monoStearate, Sorbitan trioleate, Sorbitan tristearate, Sorbi teroxalene, teroxirone, terpin hydrate, tertatolol, teSicam, tol, Sorndipine, Sotalol, Soterenol, Spaglumic acid, Sparfosic tesimide, testolactone, testosterone, testosterone cypionate, acid, SparSomycin, Sparteine, Spectinomycin, Spiclamine, testosterone enanthate, testosterone ketolaurate, testosterone Spiclomazine, Spiperone, Spiradoline, Spiramide, Spiramy phenylacetate, testosterone propionate, tetrabarbital, tetra cin, Spirapril, Spiraprilat, Spirendolol, Spirgetine, Spirilene, benazine, tetracaine, tetrachloroethylene, tetracycline, tetra Spirofylline, Spirogermanium, Spiromustine, Spironolactone, donium bromide, tetraethylammonium chloride, tetrahydro Spiroplatin, Spirorenone, Spirotriazine, SpiroXasone, SpiroX Zoline, tetramethrin, tetramisole, tetrandrine, tetrantoin, atrine, SpiroXepin, Spizofurone, Stallimycin, Stanolone, Stan tetrazepam, tetriprofen, tetronasin 5930, tetroquinone, Zolol, Stearic acid, Stearyl alcohol, Stearylsulfamide, Steffi tetroXoprim, tetrydamine, texacromil, thalicarpine, thalido mycin, Stenbolone acetate, Stepronin, Stercuronium iodide, mide, thebacon, thebaine, thenalidine, thenium closylate, Stevaladil, Stibamine glucoside, Stibophen, Stilbamidine, Stil thenyldiamine, theobromine, theodrenaline, theofibrate, bazium iodide, Stilonium iodide, Stirimazole, Stiripentol, theophylline, thiabendazole, thiacetarSamide, thialbarbital, Stirocainide, Stirifos, Streptomycin, StreptonicOZid, Streptoni thiambutosine, thiamine, thiamiprine, thiamphenicol, thia grin, Streptovarycin, Streptozocin, Strinoline, Strychnine, mylal, thiaZeSim, thiazinamium chloride, thiazolsulforie, Styramate, Subathizone, Subendazole, Succimer, Succinyl thiethyperazine, thihexinol methylbromide, thimerfonate, choline chloride, Succinylsulfathiazole, Succisulfone, thimerosal, thiocarbanidin, thiocarZolamide, thiocolchio Suclofenide, Sucralfate, Sucrose octaacetate, SudeXanox, Side, thiofuradene, thioguanine, thioguanine alpha-deoxyri Sudoxicam, Sufentanil, Sufosfamide, Sufotidine, Sulazepam, boside, thioguanine beta-deoxyriboside, thioguanosine, Sulbactam, Sulbactam pivoxil, Sulbenicillin, Sulbenox, Sul thiohexamide, thioinosine, thiopental, thiopropazate, thio bentine, Sulbutiamine, Sulclamide, Sulconazole, Sulfabenz, properazine, thioridazine, thiosalan, thiotepa, thiotetrabar Sulfabenzamide, Sulfacarbamide, Sulfacecole, Sulfaceta bital, thiothixene, thiouracil, thiphenamil, thiphencillin, mide, Sulfachlorpyridazine, Sulfachrysoidine, Sulfaclomide, thiram, thonzonium bromide, thonZylamine, thozalinone, Sulfaclorazole, Sulfaclozine, Sulfacytine, Sulfadiazine, Sul threonine, thymidine, thymol, thymol iodide, thymopentin, fadicramide, Sulfadimethoxine, Sulfadoxine, Sulfaethidole, thyromedan, thyropropic acid, tiacrilast, tiadenol, tiafibrate, Sulfaguandide, Sulfaguanole, Sulfalene, Sulfaloxic acid, tiamenidine, tiametonium iodide, tiamulin, tianafac, tianep SulfamaZone, Sulfamerazine, Sulfameter, Sulfamethazine, tine, tiapamil, tiapirinol, tiapride, tiaprofenic acid, tiaprost, Sulfamethizole, Sulfamethoxazole, Sulfamethoxypyridazine, tiaramide, tiazofurin, tiaZuril, tibalosin, tibenalast Sodium, Sulfamethoxypyridazine acetyl, Sulfametomidine, Sulfame tibenzate, tibeZonium iodide, tibolone, tibric acid, tibrofan, trole, Sulfamonomethoxine, Sulfamoxole, Sulfanil amide, tic-mustard, ticabesone propionate, ticarbodine, ticarcillin, Sulfanitran, Sulfaperin, Sulfaphenazole, Sulfaproxyline, Sul ticarcillin creSyl, ticlatone, ticlopidine, ticrynafen, tidiacic, US 2005/0002865 A1 Jan. 6, 2005 33 tiemoium iodide, tienocarbine, tienopramine, tienoXolol, trizoxime, trocimine, troclosene potassium, trofosfamide, tifemoxone, tiflamizole, tiflorex, tifluadom, tiflucarbine, troleandomycin, trolnitrate, tromantadine, tromethamine, tiformin, tifurac, tigemonam, tigestol, tigloidine, tilbro tropabazate, tropanserin, tropapride, tropatepine, tropen quinol, tiletamine, tilidine, tiliquinol, tilisolol, tilmicosin, Ziline bromide, tropicamide, tropigline, tropiprine, tropod tilomisole, tillorone, tilozepine, tilsuprost, timefurone, tim ifene, trospectomycin, troSpium chloride, troXerutin, troXip egadine, timelotem, timepidium bromide, timiperone, ide, troXolamide, troXonium tosilate, troxypyrrolium timobesone acetate, timofibrate, timolol, timonacic, timo tosilate, troxypyrrolium tosilate, truXicurium iodide, truxi prazole, tinabinol, tinazoline, tinidazole, tinisulpride, picurium iodide, tryparsamide, tryptophan, tryptophane tinofedrine, tinoridine, tiocarlide, tioclomarol, tioconazole, mustard, tuaminoheptane, tubercidine, tubocurarine chlo tioctilate, tiodaZosin, tiodonium chloride, tiomergine, ride, tubulozole, tuclazepam, tulobutrol, tuVatidine, tybam tiomesterone, tioperidone, tiopinac, tiopronin, tiopropamine, ate, tylocrebin, tylosin, tyramine, tyropanic acid, tyrosine, ubenimex, ubidecarenone, ubisindine, ufenamate, ufipra tioSpirone, tiotidine, tioxacin, tioXamast, tioxaprofen, tioxi Zole, uldazepam, ulobetaSol, undecoylium chloride, unde dazole, tioxolone, tipentosin, tipepidine, tipetropium bro cyclenic acid, uracil mustard, urapidil, urea, uredepa, ure mide, tipindole, tipredane, tiprenolol, tiprinast, tipropidil, dofoS, urefibrate, urethane, uridine, urSodeoxycholic acid, tiproStanide, tiprotimod, tiquinamide, tiquizium bromide, urSucholic acid, Vadocaine, Valconazole, Valdetamide, Val tiratricol, tiropramide, tisocromide, tisopurine, tisoquone, dipromide, Valine, Valnoctamide, Valofane, Valperinol, Val tivandizole, tiXadil, tiXanox, tiXocortol pivalate, tizabrin, proate pivoxil, Valproic acid, Valpromide, Valtrate, Vanco tianidine, tizolemide, tizoprolic acid, tobramycin, tobuterol, mycin hcl, Vaneprim, Vanillin, Vanitolide, Vanyldisulfamide, tocainide, tocamphyl, tocofenoxate, tocofibrate, tocopher Vapi.prost, vecuronium bromide, Velnacrine maleate, Ven Solan, todralazine, tofenacin, tofetridine, tofisoline, tofiso lafaxine, Veradoline, Veralipride, Verapamil, Verazide, Ver pam, tolamolol, tolaZamide, tolazoline, tolboxane, tolbuta ilopam, Verofylline, Vesnarinone, Vetrabutine, Vidarabine, mide, tolciclate, toldimfoS, tolfamide, tolfenamic acid, Vidarabine phophate, vigabatrin, Viloxazine, Viminol, Vin tolgabide, tolimidone, tolindate, toliodium chloride, tolip barbital, vinblastine, Vinburnine, Vincamine, Vincanol, Vin rolol, tolmeSoxide, tolmetin, tolnaftate, tolnapersine, cantril, VincofoS, Vinconate, Vincristine, Vindrburnol, Vin tolnidamine, toloconium metilsulfate, tolonidine, tolonium desine, Vindepidine, Vinformide, Vinglycinate, Vinorelbine, chloride, toloxatone, toloxychlorinol, tolpadol, tolpentam Vinpocetine, Vinpoline, Vinrosidine, Vintiamol, Vintriptol, ide, tolperisone, toliprazole, tolpronine, tolpropamine, Vinylbital, Vinylether, Vinzolidine, Viomycin, Viprostol, tolpyrramide, tolduinzole, toirestat, toltraZuril, tolufazepam, Vicqualine, Vicquidil, Virginiamycin factors, ViroXime, Visna tolycaine, tomelukast, tomoglumide, tomoxetine, tomox dine, Visnafylline, Vitamine, volazocine, warfarin, Xamot iprole, tonazocine, topiramate, toprilidine, tonazocine, topi erol, Xanoxic acid, Xanthinol niacinate, Xanthiol, Xantifi ramate, toprilidine, topterone, toguizine, toraSemide, toe brate, Xantocillin, Xenalipin, Xenazoic acid, Xenbucin, bafylline, toremifene, toSifen, toSufloxacin, toSulur, Xenipentone, Xenthiorate, Xenygloxal, Xenyhexenic acid, toyocamycin, toyomycin, traboxepine, tracazolate, tral Xeny tropium bromide, Xibenolol, Xibornol, Xilobam, Ximo onide, tramadol, tramaZoline, trandolapril, tranexamic acid, profen, Xinidamine, Xinomiline, Xipamide, Xipranolol, Xor tranilast, transcainide, trantelinium bromide, tranylcyprom phanol, Xylamidine, Xylazine, Xylocoumarol, Xylometazo ine, trapencaine, trapidil, traXanox, trazilitine, traZium eSi line, Xyloxemine, yohimbic acid, Zabicipril, Zacopride, late, traZOdone, traZolopride, trebenzomine, trecadrine, tre Zafuleptine, Zaltidine, Zapizolam, Zaprinast, Zardaverine, loxinate, trenbolone acetate, trengestone, trenizine, Zenazocine meSylate, Zepastine, Zeranol, Zetidoline, Zidapa troSulfan, trepibutone, trepipam, trepirium iodide, treptil mide, Zidometacin, Zidovudine, Zilantel, Zimeldine, Zimido amine, trequensin, trestolone acetate, trethinium tosilate, ben, Zinc acetate, Zinc phenolsulfonate, Zinc undecylenate, trethocanoic acid, tretinoin, tretoquinol, triacetin, triafungin, Zindotrine, Zindoxifene, Zinoconazole, Zinterol, ZinviroXime, triamcinolone, triamcinolone acetonide, triamcinolone Zipeprol, Zocainone, Zofenopril, Zoficonazole, Zolamine, acetonide-phosphate, triamcinolone benetonide, triamcino Zolazepam, Zolenzepine, Zolertine, Zolimidine, Zoliprofen, lone diacetate, triamcinolone furetonide, triamcinolone Zoloperone, Zolpidem, Zomebazam, Zomepirac, Zometapine, hexacetonide, triampyZine, triamterene, triaZinate, triazi Zonisamide, Zopiclone, Zorubicin, Zotepine, ZOxazolamine, quone, triazolam, tribendilol, tribenoside, tribromoethanol, Zuclomiphene, Zuclophenthixol, Zylofuramine. tribromsalan, tribuZone, triacetamide, trichlormethiazide, trichlormethine, trichloroacetic acid, trichloroethylene, tric 0185. The following non-limitative examples serve to ribine phosphate, triclabendazole, triclacetamol, triclazate, illustrate the concept of multiple receptor Specificity. Other triclobisonicum chloride, triclocarban, triclodaZol, tri combinations of Vectors, Spacers and reporters and conju clofenol, piperazine, triclofoS, triclofylline, triclonide, tri gation technologies leading to multiple vector incorporation closan, tricyclamol chloride, tridiheXethyl chloride, trien are also considered relevant to this invention. Confirmation tine, triethylenemelamine, triethylenephosphoramide, of the microparticulate nature of products is performed using trifenagrel, trifeZolac, triflocin, triflubazam, triflumidate, tri microscopy as described in WO-A-9607434. Ultrasonic fluomeprazine, trifluoperazine, trifluperidol, triflupro transmission measurements may be made using a broadband mazine, trifluridine, triflusal, trigeVolol, trihexyphenidyl, transducer to indicate Suspensions of products giving an triletide, triloStane, trimaZoSin, trimebutine, trimecaine, tri increased Sound beam attenuation compared to a Standard. medoxime bromide, trimeperidine, trimeprazine, trimetazi Flow dytometric analysis of products can be used to confirm dine, trimethadione, trimethamide, trimethaphan camsylate, attachment of antibodies thereto. The ability of targeted trimethidinium methoSulfate, trimethobenzamide, trimetho agents to bind Specifically to cells expressing a target may be prim, trimetozine, trimetrexate, trimeXiline, trimipramine, Studied by microScopy and/or using a flow chamber con trimoprostil, trimoxamine, trioxifene, trioxSalen, tripamide, taining immobilised cells, for example employing a popu triparanol, tripelennamine, tripotassium dicitratobismuthate, lation of cells expressing the target Structure and a further triprolidine, tritioZine, tritoqualine, trityl cysteine, trixolane, population of cells not expressing the target. Radioactive, US 2005/0002865 A1 Jan. 6, 2005 34 fluorescent or enzyme-labelled Streptavidin/avidin may be 0190. Purification by preparative HPLC (Vydac used to analyse biotin attachment. 218TP1022 column) of a 40 mg aliquot of crude material was carried out using a gradient of 70 to 100% B over 40 EXAMPLE 1. min (A=0.1% TFA/water and B=MeOH) at a flow rate of 9 Preparation and Biological Evaluation of mL/min. After lyophilization 16 mg of pure material was Multiple-specific Gas-containing Microbubbles of obtained (Analytical HPLC; Gradient, 70-100% B where DSPS Doped with a Lipopeptide Consisting of a B=MeOH, A=0.01% TFA/water: column-vydac 218TP54: Heparin Sulphate Binding Peptide (KRKR) and a Detection-UV 260 and fluorescence, Exso, Emaso prod Fibronectin Peptide (WOPPRARI) uct retention time=19.44 min). Further product character 0186 This example is directed at the preparation of ization was carried out using MALDI mass spectrometry; targeted microbubbles comprising multiple peptidic vectors expected, M+H at 2198, found, at 2199. arranged in a linear Sequence. 0191 b) Preparation of Gas-containing Microbubbles of 0187 a) Synthesis of a Lipopeptide Consisting of a DSPS Doped with a Multiple-specific Lipopeptide Con Heparin Sulphate Binding Peptide (KRKR) and Fibronectin sisting of a Heparin Sulphate Binding Peptide (KRKR) and Peptide (WOPPRARI). Fibronectin Peptide (WOPPRARI).

O ~~~~ NH N NH2 NH

O O O

--~~~~ N N N1 H H H O O

HN HN HNN NH2 NH O NH2

O O O O H H N N N N H 1. OH O O O O O e NH

NH NH

HN1. NH2 HN 1. NH2

0188 The lipopeptide was synthesised on a ABI 433A 0.192 DSPS (Avanti, 4.5 mg) and lipopeptide from a) (0.5 automatic peptide Synthesiser Starting with Fmoc-Ile-Wang mg) were weighed into each of 2 Vials and 0.8 mL of a resin (Novabiochem) on a 0.1 mmol scale using 1 mmol Solution of 1.4% propylene glycol/2.4% glycerol was added amino acid cartridges. All amino acids and palmitic acid to each vial. The mixture was warmed to 80 C. for 5 were preactivated using HBTU before coupling. minutes (vials Shaken during warming). The samples were 0189 The simultaneous removal of peptide from the cooled to room temperature and the head Space flushed with resin and Side-chain protecting groups was carried out in perfluorobutane gas. The Vials were Shaken in a cap mixer TFA containing 5% phenol, 5% EDT, 5% anisole and 5% for 45 s and the microbubbles rolled overnight. Bubbles HO for 2 hours giving a crude product yield of 150 mg. were washed Several times with deionised water and analy US 2005/0002865 A1 Jan. 6, 2005 35 sed by Coulter counter (Size: 1-3 micron (87%), 3-5 micron 0204.) A net volume of 2 mL of microbubbles from b) (11.5%)) and acoustic attenuation (frequency max att.: 3.5 were injected as a rapid intravenous bolus. 3 Seconds later, MHz). The microbubbles were stable at 120 mm Hg. the imaged right ventricle was seen to contain contrast material, another 3 Seconds later, the left ventricle was also 0193 MALDI mass spectral analysis was used to confirm filled, and a transient attenuation Shadow that obscured the incorporation into DSPS microbubbles as follows; ca. 0.05 view of the posterior parts of the left ventricle was observed. 0.1 mL of microbubble suspension was transferred to a clean A Substantial increase in brightness of the myocardium was vial and 0.05-0.1 mL methanol added. The suspension was Sonicated for 30s and the solution analysed by MALDIMS. Seen, also in the portions of the heart distal to the left Positive mode gave M+H at 2200, expected for lipopeptide, ventricle when the attenuation shadow Subsided. 2198. 0205 After passage of the inital bolus, the ultrasound Scanner was Set to continuous, high frame rate high output 0194 c) In Vitro Study of Gas-containing Microbubbles power imaging, a procedure known to cause destruction of of DSPS Doped with a Multiple-specific Lipopeptide Con utrasound contrast agent bubbles in the imaged tissue sisting of a Heparin Sulphate Binding Peptide (KRKR) and regions. After a few Seconds, the Scanner was adjusted back Fibronectin Peptide (WOPPRARI): Binding to Endothelial to its initial Setting. The myocardium was then darker, and Cells Under Flow Conditions closer to the baseline value. Moving the imaged slice to a 0195 The human endothelial cell line ECV 304, derived new position resulted in re-appearance of contrast effects, from a normal umbilical cord (ATCC CRL-1998) was moving the slice back to the initial position again resulted in cultured in 260 mL Nunc culture flasks (chutney 153732) in a tissue brightneSS again close to baseline. RPMI 1640 medium (BioWhittaker) to which L-Glutamine 0206 Case 2) Comparative 200 mM, Penicillin/Streptomycin (10.000 U/mL and 10.000 mcg/mL) and 10% Fetal Bovine Serum (Hyclone Lot no. 0207 Anet volume of 2 mL microbubbles prepared in an identical manner to b) above with the exception that no AFE 5183) were added. lipopeptide was included in the preparation was injected, 0196) The cells were subcultured with a split ratio of 1:5 using the same imaging procedure as above. The myocardial to 1:7 when reaching confluence. echo enhancement was far less intense and of Shorter duration than observed in case 1. At the completion of the 0197) Cover-glasses, 22mm in diameter (BDH, Cat no. left Ventricular attenuation phase, there was also almost 406/0189/40) were sterilised and placed on the bottom of 12 complete loss of myocardial contrast effects, and a myocar well culture plates (Costar) before cells in 0.5 mL complete dial echo increases in the posterior part of the left ventricle medium with Serum was added on top. as in case 1 was not observed. 0198 When the cells reached confluence the coverslips were placed in a custom made flow-chamber. The chamber EXAMPLE 2 consists of a groove carved into a glass plate upon which the cover Slip with cells was placed with the cells facing the Multiple-specific Gas-containing Microbubbles of groove forming a flow channel. DSPS Doped with RGDC-Mal-PEG-DSPE and a Lipopeptide Consisting of a Heparin Sulphate 0199 Ultrasound microbubbles from section b) were passed from a reservoir held at 37 degree Celsius through the Binding Peptide (KRKR) and Fibronectin Peptide flow chamber and back to the reservoir using a peristaltic (WOPPRARI) pump. The flow rate was adjusted to Simulate physiological 0208. This example is directed at the preparation of relevant shear rates. The flow chamber was placed under a targeted microbubbles comprising multiple peptidic vectors. microScope and the interaction between the microSpheres and cells viewed directly. A camera mounted on the micro 0209 a) Synthesis of 3-Maleimidopropionylamido Scope was connected to a colour Video printer and a monitor. PEGoo-acyl Distearoyl Phosphatidylethanolamine (PE PEG-MAL) 0200. A gradual accumulation of the microbubbles on the cells took place which was dependent on the flow rate. By 0210. A mixture of distearoyl phosphatidyl ethanolamine increasing the flow rate the cells Started to become detached (DSPE), (37.40 mg, 0.005 mmol), N-hydroxysuccinimido from the coverslip, the microbubbles were still bound to the PEGooo-maleimide, NHS-PEG-MAL, (100 mg, 0.25 cells. Control bubbles not carrying the vector did not adhere mmol) and triethylamine (35ul, 0.25 mmol) in a solution of to the endothelial cells and disappeared from the cells under chloroform/methanol (3:1) was stirred at room temperature minimal flow conditions. for 24 hours. After evaporation of the solvents under reduced preSSure, the residue was purified by flash chromatography 0201 d) In Vivo Experiment in Dog (chloroform/methanol, 8:2). The product was obtained as a white wax,92 mg (66%) and structure was verified by NMR 0202) Case 1) and maldi-MS. 0203 A 22 kg mongrel dog was anaesthetized with pentobarbital and mechanically ventilated. The chest was 0211 b) Synthesis of RGDC opened by a midline Sternotomy, the anterior pericardium 0212. The RGDC peptide was synthesised on a ABI 433A was removed, and a 30 mm gelled Silicone rubber Spacer automated peptide Synthesiser (0.25 mmol Scale, Fmoc was inserted between the heart and a P5-3 transducer of an Cys(Trt)-Wang resin, (Novabiochem). All amino acids were ATL HDI-3000 ultrasound Scanner. The Scanner was set for activated using HBTU. The crude peptide was removed intermittent Short axis imaging once in each end-Systole by from the resin and Simultaneously deprotected in TFA con delayed EGC triggering. taining 5% EDT, 5% phenol and 5% water. Following US 2005/0002865 A1 Jan. 6, 2005 36 evaporation of the excess cleavage Solution the peptide was temperature for 1 h. ExceSS reagent was separated from the precipitated and triturated Several times with diethyl ether modified protein on a NAP-5 column (Pharmacia). before air drying. The crude peptide was purified by pre 0222 c) Conjuaation of Thiolated Anti-CD62 and Anti parative hplc and fractions containing pure product com ICAM-1 Antibodies to Gas-containing Microbubbles bined and freeze dried. Final characterisation was performed using analytical hplc and MALDI MS. Encapsulated with DSPS and DSPE-PEG-MAL 0223 0.5 mL of the mixed thiolated antibody preparation 0213 c) Preparation of Multiple-specific Gas-filled from b) was added to an aliquot of microbubbles from a) and Microbubbles Encapsulated by Phosphatidylserine and the conjugation reaction allowed to proceed for 30 min on a Doped with RGDC-Mal-PEGoo-DSPE and a Lipopep roller table. Following centrifugation at 2000 rpm for 5 min tide Comprising a Heparin Sulphate Binding Peptide the infranatant was removed. The microbubbles were (KRKR) and Fibronectin Peptide (WOPPRARI). washed a further three times with water. 0214 DSPS (Avanti, 5.0 mg), lipopeptide (0.5 mg) from 0224. The PEG spacer length may also be varied to example 1 a) and PE-PEG-MAL (0.5 mg) from section a) include longer e.g. PEGoo and PEG sooo or shorter e.g. was weighed into a clean vial and 1.0 mL of a Solution of PEG or PEGso chains. Addition of a third antibody such 1.4% propylene glycol/2.4% glycerol added. The mixture as thiolated-anti-CD34 is also envisaged. EXAMPLE 4 was Sonicated for 3-5 mins, warmed to 80 C. for 5 minutes Targeted Multiple-specific Gas-containing then filtered through a 4.5 micron filter. The mixture was Microbubbles of DSPS Coated Non-covalently with cooled to room temperature and the head Space flushed with Polylysine and a Fusion Peptide Comprising a PS perfluorobutane gas. The Vials were Shaken in a cap mixer Binding Component and a Fibronectin Peptide for 45s and the microbubbles centrifuged at 1000 rpm for Sequence 3 minutes. The infranatant was exchanged with 1 mL of PBS containing 1 mg of the peptide RGDC and the pH adjusted NHF.N.F.R.L.K.A.G.O.K.I.R.F.G.G.G.G.W.O.P.P.R.- to 8. The conjugation reaction was allowed to proceed for 2 A.I.OH. h. The bubbles were washed in PBS then with water until all 0225 a) Synthesis of PS Binding/Fibronectin Fragment unreacted RGDC had been removed from the infranatant as Fusion Peptide observed by MALDI-MS. The microbubbles were further analysed by Coulter counter (98% between 1 and 7 micron). 0226. The peptide was synthesised on an ABI 433A 0215 d) In Vitro Binding Assay. automatic peptide Synthesiser Starting with Fmoc-Ile-Wang 0216) The binding of microbubbles to endothelial cells resin (Novabiochem) on a 0.1 mmol scale using 1 mmol was carried out under flow conditions using the in vitro amino acid cartridges. All amino acids were preactivated assay described in example 1. c). A gradual accumulation of using HBTU before coupling. the microbubbles on the cells took place which was depen 0227. The simultaneous removal of peptide from the dant on the flow rate. Control bubbles not carrying the resin and Side-chain protecting groups was carried out in vectors did not adhere to the endothelial cells detaching TFA containing 5% phenol, 5% EDT and 5% HO for 2 from the cells under minimal flow conditions. EXAMPLE 3 hours giving a crude product yield of 302 mg. Purification by preparative HPLC (Vydac 218TP1022 column) of a 25 Preparation of Multiple-Specific Gas-containing mg aliquot of crude material was carried out using a gradient Microbubbles Encapsulated with DSPS and Thi of 20 to 40% B over 40 min (A=0.1% TFA/water and olated Anti-CD62-Mal-PEG-PE and Thiolated B=0.1% TFA/acetonitrile) at a flow rate of 9 mL/min. After anti-ICAM-1-Mal-PEGooo-PE lyophilization 10 mg of pure material was obtained (Ana lytical HPLC; Gradient, 20 to 50% B where B=0.1% TFA/ 0217. This example is directed at the preparation of acetonitrile, A=0.01% TFA/water: column-vydac microbubbles comprising multiple antibody vectors for tar 218TP54: Detection-UV 214 and 260 nm product reten geted ultrasound. tion time=12.4 min). Further product characterization was 0218 a) Preparation of Gas-containing Microbubbles carried out using MALDI mass spectrometry; expected, Encapsulated with DSPS and PE-PEoco-MAL M+H at 2856, found, at 2866. 0219 DSPS (Avanti, 4.5 mg) and PE-PEG-Maleim 0228 b) Preparation of Microbubbles of DSPS Coated ide from example 2 a) (0.5 mg) were weighed into a clean Non-covalently with Polylysine and the PS Binding/Fi vial and 1 mL of a solution of 1.4% propylene glycol/2.4% bronectin Fragment Fusion Peptide glycerol added. The mixture was warmed to 80° C. for 5 NHFN.F.R.L.K.A.G.O.K.I.R.F.G.G.G.G.W.O.P.P.R.A.I.- minutes then filtered through a 4.5 micron filter. The sample OH. was cooled to room temperature and the head Space flushed 0229 DSPS (5 mg, Avanti) was weighed into a clean vial with perfluorobutane gas. The Vials were shaken in a cap along with poly-L-lysine (Sigma, 0.2 mg) and peptide from mixer for 45s and the microbubbles washed three times with a) above (0.2 mg). To the vial was added 1.0 mL of a solution distilled water. of 1.4% propylene glycol/2.4% glycerol. The mixture was warmed to 80 C. for 5 minutes. The sample was cooled to 0220 b) Thiolation of Anti-CD62 and Anti-ICAM-1 room temperature and the head Space flushed with perfluo Antibodies robutane gas. The Vials were Shaken in a cap mixer for 45 S 0221) To 0.3 mg each of anti-CD62 and anti-ICAM-1 and the microbubbles centrifuged at 1000 rpm for 3 minutes. antibodies dissolved in PBS buffer (pH 7, 0.5 mL) was 0230. Following extensive washing with water, PBS and added Traut's reagent and the Solutions Stirred at room water the final Solution was examined for polylysine and US 2005/0002865 A1 Jan. 6, 2005 37 peptide content using MALDI MS. No polypeptide material a crude product yield of 75 mg. Purification by preparative was observed in the final wash Solution. HPLC (Vydac 218TP1022 column) of a 20 mg aliquot of 0231 Acetonitrile (0.5 mL) was then added and the crude material was carried out using a gradient of 30 to 80% microbubbles destroyed by Sonication. Analysis of the B over 40 min (A=0.1% TFA/water and B=0.1% TFA/ resulting solution for polylysine and PS-binding/fibronectin acetonitrile) and a flow rate of 9 mL/min. After lyophiliza fusion peptide was then carried out using MALDI MS. The tion of the pure fractions 2 mg of pure material was obtained results were as follows: (Analytical HPLC; Gradient, 30-80% B where B=0.1% TFA/acetonitrile, A=0.01% TFA/water: column-Vydac 218TP54: Detection-UV 214 nm product retention time= 12.6 min). Further product characterization was carried out MALDI expected MALDI found using MALDI mass spectrometry; expected, M+H at 1077, found, 1077. Poly-L-lysine 786,914, 1042, 1170 790,919, 1048, 1177 0239 c) Synthesis of Biotinyl-fibrin-anti-polymerant DSPS-binding peptide 2856 2866 Peptide (Biotin-GPRPPERHOS.NH) 0240 This peptide was synthesised and purified using 0232 The spacer element contained within the PS bind similar protocols to those described in section b) above. The ing/Fibronectin fusion peptide (-GGG-) can also be replaced pure product was characterised by hplc and MALDI MS. with other spacers Such as PEG or polyalanine (-AAA-). It is also envisaged that a form of pre-targeting may be 0241 d) Preparation of Multiple-specific Gas-filled employed, whereby the DSPS binding/Fibronectin fragment Microbubbles Encapsulated with Phosphatidylserine and fusion peptide is firstly allowed to associate with cells via Biotin-PEGoo-B-Alanine Cholesterol the fibronectin peptide binding. This is followed by admin istration of PS microbubbles which then bind to the PS 0242 DSPS (Avanti, 4.5 mg) and biotin-PEGoo-B-Ala binding peptide. nine cholesterol from Section a) (0.5 mg) were weighed into a vial and 0.8 mL of a solution of 1.4% propylene glycol/ 2.4% glycerol added. The mixture was warmed to 80 C. for EXAMPLE 5 5 minutes (vials shaken during warming). The sample was Multiple-specific Gas-containing Microbubbles cooled to room temperature and the head Space flushed with Encapsulated with Phosphatidylserine and Biotin perfluorobutane gas. The Vial was shaken in a cap mixer for PEGoo-alanyl-cholesterol and Functionalised with 45s and the microbubbles rolled overnight. Streptavidin/biotinyl-endothelin-1 Peptide (Biotin 0243 The microbubble suspension was washed several D-Trp-Leu-Asp-Ile-Ile-Trp.OH) and Biotinyl-fibrin times with deionised water and analysed by Coulter counter anti-polymerant Peptide (Biotin-GPRPPERHO and acoustic attenuation. S.NH) 0244 e) Conjugation with Fluorescein Labelled Strepta 0233. This example is directed at the preparation of vidin and Biotinylated Peptides from Section b) and c). targeted ultrasound microbubbles whereby streptavidin is used as a linker between biotinylated reporter(s) and vec 0245) To the microbubble preparation from d) was added tor(s). fluorescein conjugated Streptavidin (0.2 mg) dissolved in PBS (1 mL). The bubbles were placed on a roller table for 0234 a) Synthesis of Biotin-PEGoo-B-Alanine Choles 3 hat room temperature. Following extensive Washing with terol water and analysis by fluorescence microScopy the 0235. To a solution of cholesteryl-B-alanine hydrochlo microbubbles were incubated in 1 mL of PBS containing ride (15 mg, 0.03 mmol) in 3 mL chloroform/wet methanol biotinyl-Endothelin-1 peptide (0.5 mg) and biotinyl-Fibrin (2.6:1), was added triethylamine (42 mL, 0.30 mmol). The anti-polymerant peptide (0.5 mg) from Sections b) and c) mixture was Stired for 10 minutes at room temperature and respectively for 2 h. Extensive washing of the microbubbles a solution of biotin-PEGoo-NHS (100 mg, 0.03 mmol) in was performed to remove unconjugated peptide. 1,4-dioxan (1 mL) was added dropwise. After stirring at room temperature for 3 h, the mixture was evaporated to EXAMPLE 6 dryneSS and the residue purified by flash chromatography to give white crystals, yield; 102 mg (89%). The structure was Multiple-specific Gas-filled Microbubbles Encapsu verified by MALDI-MS and NMR. lated with Phosphatidylserine and a Biotinylated Lipopeptide Used to Prepare a Streptavidin Sand 0236 b) Synthesis of Biotinylated Endothelin-1 Peptide wich with a Mixture of Biotinyl-endothelin-1 Pep (Biotin-D-Trp-Leu-Asp-Ile-Ile-Trp.OH) tide (Biotin-D-Trp-Leu-Asp-Ile-Ile-Trp.OH) and 0237) The peptide was synthesised on a ABI 433A auto Biotinyl-fibrin-anti-polymerant Peptide (Biotin matic peptide Synthesiser starting with Fmoc-Trp(Boc)- GPRPPERHOS.NH) Wang resin (Novabiochem) on a 0.1 mmol scale using 1 mmol amino acid cartridges. All amino acids were preacti 0246) a) Synthesis of Lipopeptide Dipalmitoyl-lysinyl vated using HBTU before coupling. tryptophanyl-lysinyl-lysinyl-lysinyl(biotinyl)-glycine 0238. The simultaneous removal of peptide from the 0247 The lipopeptide was synthesised on a ABI 433A resin and Side-chain protecting groups was carried out in automatic peptide Synthesiser Starting with Fmoc-Gly-Wang TFA containing 5% anisole and 5% HO for 2 hours giving resin (Novabiochem) on a 0.1 mmol scale using 1 mmol US 2005/0002865 A1 Jan. 6, 2005 38 amino acid cartridges. All amino acids and palmitic acid Seconds. After centrifugation the infranatant was removed were preactivated using HBTU before coupling. and the microbubbles formed washed extensively with 0248. The simultaneous removal of peptide from the Water. resin and Side-chain protecting groups was carried out in 0256 b) Conjugation of Gas-filled Microbubbles Encap TFA containing 5% phenol, 5% EDT, 5% anisole and 5% sulated with Phosphatidylserine and Biotin-DPPE with HO for 2 hours giving a crude product yield of 150 mg. Streptavidin and a Mixture of Biotinyl-endothelin-1 (Biotin Purification by preparative HPLC (Vydac 218TP1022 col D-Trp-Leu-Asp-Ile-Ile-Trp.OH) and Biotinyl-Fibrin-anti umn) of a 40 mg aliquot of crude material was carred out polymerant Peptide (Biotin-GPRPPERHOS.NH) using a gradient of 70 to 100% B over 40 min (A=0.1% 0257) The procedure detailed in example 5 section e) was TFA/water and B=MeOH) at a flow rate of 9 mL/min. After followed. lyophilization 14 mg of pure material (Analytical HPLC; Gradient, 70-100% B where B=MeOH, A=0.01% TFA/ EXAMPLE 8 water: column-vydac 218TP54: Detection 13 UV 260 and fluorescence, Ex280, Em350 product retention time=22 Multiple-specific Gas-filled Microbubbles min). Further product characterization was carried out using Encapsulated with Phosphatidylserine, MALDI mass spectrometry; expected, M+H at 1478, found, Streptavidin-Succ-PEG-DSPE and a Mixture of 1471. Biotinylated Human Endothelium IgG Antibody 0249 b) Preparation of Gas-containing Microbubbles of and Biotinylated Transferrin DSPS Doped with the Biotinylated Lipopeptide Sequence 0258 a) Synthesis of Succ-PEGo-DSPE from Section a) 0259 NH-PEGo-DSPE is carboxylated using suc 0250 DSPS (Avanti, 4.5 mg) and lipopeptide from a) (0.5 cinic anhydride, e.g. by a similar method to that described by mg) were weighed into each of 2 Vials and 0.8 mL of a Nayar, R. and Schroit, A. J. in Biochemistry (1985) 24, Solution of 1.4% propylene glycol/2.4% glycerol was added 5967-71. to each vial. The mixture was warmed to 80 C. for 5 minutes (vials Shaken during warming). The samples were 0260 b) Preparation of Gas-filled Microbubbles Encap cooled to room temperature and the head Space flushed with sulated with Phosphatidylserine and Succ-PEGo-DSPE perfluorobutane gas. The Vials were Shaken in a cap mixer 0261) To a mixture (5 mg) of phosphatidylserine (90-99.9 for 45s and the microbubbles formed rolled overnight. The mol %) and Succ-PEGo-DSPE (10-0.1 mol%) is added microbubbles were washed several times with deionised 5% propyleneglycol-glycerol in water (1 mL). The disper water and analysed by Coulter counter and acoustic attenu sion is heated to not more than 80 C. for 5 minutes and then ation. cooled to ambient temperature. The dispersion (0.8 mL) is transferred to a vial (1 mL) and the head space is flushed 0251 MALDI mass spectral analysis was used to confirm with perfluorobutane. The Vial is Shaken in a cap-mixer for incorporation into DSPS microbubbles as described in 45 Seconds, whereafter the Sample is put on a roller table. example 1 b). After centrifugation the infranatant is exchanged with water 0252 c) Preparation of Multiple-specific Gas-filled and the Washing is repeated. Microbubbles Encapsulated with Phosphatidylserine and a Biotinylated Lipopeptide and Functionalised with Strepta 0262 c) Coupling of Streptavidin to Gas-filled vidin/biotinyl-endothelin-1 Peptide (Biotin-D-Trp-Leu Microbubbles Encapsulated with Phosphatidylserine and Asp-Ile-Ile-Trp.OH)/biotinyl-fibrin-anti-polymerant Peptide Succ-PEGo-DSPE (Biotin-GPRPPERHOS.NH) 0263 Streptavidin is covalently bound to Succ-PEGoo DSPE in the membrane by standard coupling methods using 0253) The microbubble preparation from b) above was a water-Soluble carbodiimide. The Sample is placed on a treated in an analogous manner to that described in example roller table during the reaction. After centrifugation the 5 Section e). infranatant is exchanged with water and the Washing is repeated. The functionality of the attached Streptavidin is EXAMPLE 7 analysed by binding, e.g. to fluorescently labeled biotin, biotinylated antibodies (detected with a fluorescently Multiple-specific Gas-filled Microbubbles Encapsu labeled secondary antibody) or biotinylated and fluores lated with Phosphatidylserine and Biotin-DPPE cence- or radioactively-labeled oligonucleotides. Analysis is Used to Prepare a Streptavidin Sandwich with a performed by fluorescence microscopy or Scintillation Mixture of Biotinyl-endothelin-1 Peptide (Biotin-D- counting. Trp-Leu-Asp-Ile-Ile-Trp.OH) and Biotinyl-fibrin anti-polymerant Peptide (Biotin-GPRPPERHO 0264 d) Preparation of Multiple-specific Gas-filled Microbubbles Encapsulated with Phosphatidylserine and S.NH) Streptavidin-Succ-PEGo-DSPE Non-covalently Func 0254) a) Preparation of Biotin Containing Microbubbles. tionalised with Biotinylated Human Transferrin and Human 0255 To a mixture of phosphatidylserine (5 mg, Avanti) Endothelium IgG Antibody and biotin-DPPE (0.6 mg, Pierce) in a clean vial was added 0265 Microbubbles from section c) are incubated in a 5% propyleneglycol-glycerol in water (1 mL). The disper Solution containing human transferrin and human endothe sion was heated to 80 C. for 5 minutes and then cooled to lium IgG antibody biotinylated using the method described ambient temperature. The head Space was then flushed with by Bayer et al., Meth. Enzymol., 62,308. The vector-coated perfluorobutane and the vial Shaken in a cap-mixer for 45 microbubbles are washed as described above. US 2005/0002865 A1 Jan. 6, 2005 39

EXAMPLE 9 0277 b) Modification of Fibronectin/Transferrin. 0278 Fibronectin (0.5 mg) and transferrin (1.3 mg) were Multiple-specific Gas-filled Microbubbles mixed in PBS and a solution containing NHS-fluorescin in Encapsulated with DMSO added. The mixture was stirred at room temperature Phosphatidylserine/streptavidin-Succ-PEG-DSPE for 1 hour then the protein purified on a Superdex 200 and the Oligonucleotides column. The fluorescein-labelled protein mixture in phos Biotin-GAAAGGTAGTGGGGTCGTGTGCCGG phate buffer pH 7.5 was freeze dried. and biotin-GGCGCTGATGATGTTGTTGATTCTT 0279 c) Microbubble Modification. 0266 a) Synthesis of Succ-PEGaoo-Dsp. 0280 The freeze-dried product from b) was re-dissolved in 0.5 mL water and to the fluorescein labelled fibronectin/ 0267 Described in example 8 a) transferrin mixture was added 0.1 mmol of the crosslinker SDBP (Pierce). The solution was incubated on ice for 2 0268 b) Preparation of Gas-filled Microbubbles Encap hours, charged on a NAP-5 column and eluted with PBS. To sulated with Phosphatidylserine and Succ-PEGo-DSPE this was added 1 mL of the microbubble suspension from a) and incubation allowed to proceed for 2 hat room tempera 0269. Described in example 8b). ture on a roller table. Unreacted material was removed by 0270 c) Coupling of Streptavidin to Gas-filled allowing the microbubbles to float then replacing the buffer Microbubbles Encapsulated with Phosphatidylserine and with water, this process was repeated 3 times. Succ-PEG,00-DSPE EXAMPLE 11 0271) Described in example 8 c). Preparation of Multiple-specific Hollow Polymer 0272 d) Preparation of Gas-filled Microbubbles Encap Particles Incorporating Avidin in the Polymer Wall sulated with Phosphatidylserine/streptavidin-Succ-PEG Conjugated with the Oligonucleotide DSPE and the Oligonucleotides Biotin-GAAAGG Biotin-GGCGCTGATGATGTTGTTGATTCTT and TAGTGGGGTCGTGTGCCGG and Biotin the Endothelin-1 Peptide GGCGCTGATGATGTTGTTGATTCTT Biotin-D-Trp-Leu-Asp-Ile-Ile-Trp.OH 0273 Microbubbles from section c) are incubated in a 0281. This example is directed at the preparation of solution containing a mixture of biotin-GAAAGG polymeric ultrasound contrast agents comprising multiple TAGTGGGGTCGTGTGCCGG and biotin-GGCGCTGAT vectors attached to non-Surfactant for targeting/therapeutic GATGTTGTTGATTCTT. The oligonucleotide-coated applications. microbubbles are washed as described above. Binding of the oligonucleotide to the bubbles is detected e.g. by using 0282) a) Preparation of Polymer Particles Incorporating fluorescent-labeled oligonucleotides for attachment to the Avidin in the Polymer Wall bubbles, or by hybridising the attached oligonucleotide to a 0283 Hollow polymer particles of P73 (as described in labeled (fluorescence or radioactivity) complementary oli patent WO 96/07434) containing avidin were prepared by a gonucleotide. The functionality of the oligonucleotide-car process involving the freeze-drying of an oil-in-water emul rying microbubbles is analysed, e.g. by hybridising the Sion using the following procedure: An oil Solution was bubbles with immobilized DNA-containing sequences prepared by dissolving 0.25 g of the biodegradable polymer complementary to the attached oligonucleotide. P73 poly(ethylidene bis(16-hydroxyhexadecanoate)co(adi 0274) Other useful examples include an oligonucleotide pic acid) in 5 mL of camphene at 60° C. To 0.2 mL of the complementary to ribosomal DNA (of which there are many oil Solution was added 2 mg avidin. An aqueous Solution was copies perhaploid genome) and an oligonucleotide comple then prepared by dissolving 0.4 g of the polymer, a-(16 mentary to an oncogene (e.g. ras of which there is one copy hexadecanoyloxyhexadecanoyl)-W-methoxypolyoxyethyl per haploid genome) are used. ene ester, in 20 mL of water at 60° C. The oil solution (0.2 mL) was then mixed with of the aqueous solution (0.8 mL) EXAMPLE 10 in a vibromixer (Capmix) for 15 S to form the oil-in-water emulsion. The emulsion was frozen in dry ice and methanol then dried at a pressure of 200 mTorr for 24 h to remove Multiple-specific Gas-filled Microbubbles exceSS Solvent. The powder was reconstituted as a Suspen Encapsulated with Phosphatidylserine and sion of hollow particles by addition of 1.0 mL water. The Phosphatidylethanolamine Covalently resulting ultrasound contrast agent was confirmed by Functionalised with the Fibronectin and Transferrin microScopy observation, Coulter Size distribution, acoustic Proteins attenuation and resistance to external pressure. 0275 a) Microbubbles Preparation. 0284 b) Synthesis of Biotin-D-Trp-Leu-Asp-Ile-Ile-Tr p.OH 0276 DSPS (Avanti, 4.5 mg) and DSPE (Avanti, 1.0 mg) were weighed into a clean vial and 1 mL of a Solution of 0285) Described in example 5b). 1.4% propylene glycol/2.4% glycerol added. The mixture 0286 c) Conjugation of Polymer Particles Incorporating was warmed to 80° C. for 5 minutes then filtered through a Avidin. 4.5 micron filter. The Sample was cooled to room tempera ture and the head Space flushed with perfluorobutane gas. 0287. The particles from a) were centrifuged and the The vial was shaken in a cap mixer for 45 s and the Supernatant replaced with 1 mL of PBS buffer pH 7.5 microbubbles washed two times with distilled water then containing 0.2 mg of biotin-GGCGCTGATGATGTTGT resuspended in 0.1 M sodium borate buffer pH 9. TGATTCTT and 0.2 mg of biotin-D-Trp-Leu-Asp-Ile-Ile US 2005/0002865 A1 Jan. 6, 2005 40

Trp.OH from b) above. After incubation for 24 h the 0290. In order to determine the presence of microsphere particles were washed extensively with PBS and water. asSociated biotin, Streptavidin conjugated to horseradish peroxidase (strep-HRP) was added to both suspensions and EXAMPLE 12 the tubes were rotated for 1 hour to allow for reaction. The microSpheres were then washed three times, resuspended in Functionalisation of Gas-filled Albumin 100 mM citrate-phosphate buffer (pH 5) containing 0.1 Microspheres (GAM) with Biotin for mg/mL phenylenediamine dihydrochloride and 0.01% Multiple-specific Targeting hydrogen peroxide, and rotated for 10 minutes. Develop 0288 a) Preparation of Biotinylated Albumin Micro ment of a yellow-green colour was indicative of the presence Spheres of enzyme. The following results were obtained: 0289. A homogeneous suspension of GAM (6x10 par ticles/mL) in 5 mg/mL albumin was used, with all manipu lations being carried out at room temperature. Two 10 mL Sample Colour development aliquots were centrifuged (170xg, 5 minutes) to promote Biotinylated spheres + strp-HRP 2+ floatation of the microSpheres and 8 mL of the underlying Control spheres + strp-HRP -- infranatant was removed by careful Suction and replaced by This confirms that GAM were biotinylated. an equal volume of air-Saturated phosphate buffered Saline, the preparations being rotated for 15-20 minutes to resus pend the microSpheres. This procedure was repeated twice, 0291 b) Multiple-specific Gas-containing Microparticles whereafter only negligible amounts of free non-micro 0292. The biotinylated microspheres are then used to Sphere-associated albumin were assumed to remain. 50 ul of prepare multiple-specific targeting products in an analogous NHS-biotin (10 mM in dimethylsulphoxide) was added to one of the aliquots (final concentration 50 uM); the other manner to those exemplified in examples 5), 6) and 7). (control) aliquot received 50 ul of dimethylsulphoxide. The EXAMPLE 13 tubes containing the Samples were rotated for 1 hour where after 20 ul portions of 50% aqueous glutaraldehyde were Multiple-specific Gas-containing Microbubbles of added to each tube to crosslink the microSpheres. After DSPS Functionalised with Heparin Sulphate rotation for another hour the tubes were positioned vertically Binding Peptide/Fibronectin Peptide/RGD Peptide overnight to allow floatation of the microspheres. The next and Fluorescein. day, the Suspensions were washed twice with phosphate 0293 a) Synthesis of a Lipopeptide Containing the RGD buffered Saline containing 1 mg/mL human Serum albumin Sequence and a Fluorescein Reporter Group: Dipalmitoyl (PBS/HSA) and were resuspended in PBS/HSA after the last Lys-Lys-Lys-Lys Acetyl-Arg-Gly-Asp-LyS(Fluorescein) centrifugation. Gly.OH

O

- HN O

N -- O lsO H

NH2

COOH

OH US 2005/0002865 A1 Jan. 6, 2005 41

-continued

H N ~~~~~~~ O

--~~~~ O

0294 The lipopeptide was synthesised as described in vial. The mixture was warmed to 80°C. for 5 minutes (vials example 1) using commercially available amino acids and Shaken during warming). The samples were cooled to room polymers. The lipopeptide was cleaved from the resin in temperature and the head Space flushed with perfluorobutane TFA containing 5% water, 5% phenol, 5% EDT for 2 h. gas. The Vials were Shaken in a cap mixer for 45 S and the Following evaporation in vacuo the crude product was microbubbles formed rolled overnight. The microbubbles precipitated and triturated with diethyl ether. Purification by were washed Several times with deionised water and analy preparative HPLC (Vydac 218TP1022 column) of a 40 mg sed by MALDI mass spectrometry as described in example aliquot of crude material was carried out using a gradient of 1 b). The microbubbles following analysis by microscopy 60 to 100% B over 40 min (A=0.1%TFA/water and B=0.1% were Seen to consist of a range of sizes between 1 and 5 TFA/acetonitrile) at a flow rate of 9 mL/min. After lyo micron. Furthermore the microbubbles were fluorescent. philization 10 mg of pure material (Analytical HPLC; Gra dient, 60-100% B where B=0.1% TFA/acetonitrile), EXAMPLE 1.4 A=0.01% TFA/water: column-vydac 218TP54: Detec tion-UV 260 product retention time=20-22 min). Further Multiple-specific Gas Containing Microbubbles of product characterization was carried out using MALDI maSS DSPS Covalently Modified with CD71 spectrometry; expected, M+H at 1922, found, at 1920. FITC-labelled Anti-transferrin Receptor Antibody 0295 b) Synthesis of a Lipopeptide Containing a Heparin and Doped with a Lipopeptide with Affinity for Sulphate Binding Sequence and a Fibronectin Peptide Endothelial Cells 0296 Synthesis and purification described in example 1 0299. This example is directed at the preparation of a). multiple vector targeted ultrasound agents. 0297 c) Preparation of Multiple-specific Gas-containing 0300 a) Synthesis of an Endothelial Cell Binding Microbubbles of DSPS Functionalised with a Heparin Sul Lipopeptide: 2-n-hexadecylstearyl-Lys-Leu-Ala-Leu-Lys phate Binding Peptide a Fibronectin Peptide Acetyl-RGD Leu-Ala-Leu-Lys-Ala-Leu-Lys-Ala-Ala-Leu-Lys-Leu-Ala Peptide and Fluorescein. NH. 0298 DSPS (Avanti, 4 mg) and lipopeptide from a) (0.5 0301 The lipopeptide shown below was synthesised on a mg, 0.2 mmol) and lipopeptide from b) (0.5 mg) were ABI 433A automatic peptide synthesiser starting with a Rink weighed into each of 2 vials and 0.8 mL of a solution of amide resin on a 0.1 mmol Scale using 1 mmol amino acid 1.4% propylene glycol/2.4% glycerol was added to each cartridges.

| O | O | N N N

O H O H O

-NN US 2005/0002865 A1 Jan. 6, 2005 42

-continued HS-H

O | O | O H O | O N-s, sus, --- N s- NS h O h O h O H O h O

1N 1N

0302 All amino acids and 2-m-hexadecylstearic acid gas. The Vials were Shaken in a cap mixer for 45 S and the were preactivated using HBTU before coupling. The simul microbubbles washed three times with distilled water. taneous removal of peptide from the resin and Side-chain protecting groups was carried out in TFA containing 5% 0305 c) Thiolation of FITC-labelled Anti-transferrin EDT, and 5% HO for 2 hours giving a crude product yield Receptor Antibody. of 150 mg. Purification by preparative HPLC (Vydac 218TP1022 column) of a 40 mg aliquot of crude material 0306 FITC labelled CD71 anti-transferrin receptor Ab was carried out using a gradient of 90 to 100% B over 50 (100 mg/mL, Becton Dickinson), 0.7 mL, in PBS was min (A=0.1% TFA/water and B=MeOH) at a flow rate of 9 modified with Traut's reagent (0.9 mg, Pierce) at room mL/min. After lyophilization 10 mg of pure material was temperature for 1 h. ExceSS reagent was separated from obtained (Analytical HPLC; Gradient, 90-100% B where modified protein on a NAP-5 column (Pharmacia). B=MeOH, A=0.01% TFA/water: column-vydac 218TP54: Detection-UV 214 nm product retention time=23 min). 0307 d) Conjugation of Thiolated FITC-labelled Anti Further product characterization was carried out using transferrin Receptor Antibody to Gas-containing MALDI mass spectrometry; expected, M+H at 2369, found, Microbubbles of DSPS Doped with an Endothelial Cell at 2373. Binding Lipopeptide and DSPE-PEG-MAL 0303 b) Preparation of Gas-containing Microbubbles of 0308) A 0.5 mL aliquot of the protein fraction (2 mL in DSPS Doped with a Endothelial Cell Binding Lipopeptide total) from c) above was added to the microbubbles from b) and PE-PEGooo-MAL and the conjugation reaction allowed to proceed for 10 min 0304 DSPS (Avanti, 4.5 mg) and lipopeptide from a) (0.5 on a roller table. Following centrifugation at 1000 rpm for mg) along with PE-PEGooo-Maleimide from example 2 3 min the protein Solution was removed and the conjugation (0.5 mg) were weighed into a clean vial and 1 mL of a repeated a further two times with 1 mL and 0.5 mL aliquots solution of 1.4% propylene glycol/2.4% glycerol added. The of protein solution respectively. The bubbles were then mixture was warmed to 80° C. for 5 minutes then filtered washed four times in distilled water and a Sample analysed through a 4.5 micron filter. The Sample was cooled to room for the presence of antibody by flow cytometry and micros temperature and the head Space flushed with perfluorobutane copy. A fluorescent population of >92% was observed. US 2005/0002865 A1 Jan. 6, 2005 43

lor (se Y 144-tosteo (22)

US 2005/0002865 A1 Jan. 6, 2005 45

0309 Incorporation into the microbubbles of lipopeptide 0314 b) Preparation of Gas-containing Microbubbles of was confirmed by MALDI mass spectrometry as described DSPS Doped with a Thiol Containing Lipid Structure: in example 1 b). 0315 DSPS (Avanti, 4.5 mg) and the lipid structure from EXAMPLE 1.5 a) above (0.5 mg) were weighed into a clean vial and 0.8 mL of a Solution containing 1.4% propylene glycol/2.4% glyc Preparation of Multiple-sepecific Transferrin/Avidin erol in water added. The mixture was warmed to 80 C. for Coated Gas-filled Microbubbles for Targeted 5 minutes (vials Shaken during warming) and filtered while Ultrasound Imaging still hot through a 40 micron filter. The samples were cooled to room temperature and the head Space flushed with per 0310. This example is directed to the preparation of fluorobutane gas. The Vials were Shaken in a cap mixer for microbubbles containing multiple protein vectors for tar 45s and the microbubbles placed on roller table overnight. geted ultrasound/therapy. Bubbles were washed several times with deionised water 0311) a) Synthesis of a Thiol Functionalised Lipid Mol and analysed for thiol group incorporation using Ellmans ecule: Dipalmitoyl-Lys-Lys-Lys-Aca-CyS.OH Reagent.

O --~~~~ NH NH2

O O H H --~~~~ N N N N-1N1 S-1 H H O O

NH2 SH O

Nulls N OH H O

0312 The lipid structure shown above was synthesised 0316 c) Modification of Transferrin and Avidin with on a ABI 433A automatic peptide Synthesiser Starting with Fluorescein-NHS and Sulpho-SMPB. Fmoc-Cys(Trt)-Wang resin (Novabiochem) on a 0.25 mmol Scale using 1 mmol amino acid cartridges. All amino acids 0317 To a mixture of 2 mg of transferrin (Holo, human, and palmitic acid were preactivated using HBTU coupling Alpha Therapeutic Corp) and 2 mg of avidin (Sigma) in PBS chemistry. (1 mL) was added 0.5 mL DMSO solution containing 1 mg 0313 The simultaneous removal of peptide from the Sulpho-SMPB (Pierce) and 0.5 mg Fluorescein-NHS resin and deprotection of Side-chain protecting groups was (Pierce). The mixture was stirred for 45 minutes at room carried out in TFA containing 5% EDT, and 5% HO for 2 temperature then passed through a SephadeX 200 column hours giving a crude product yield of 250 mg. Purification using PBS as eluent. The protein fraction was collected and by preparative HPLC (Vydac 218TP1022 column) of a 40 stored at 4 C. prior to use. mg aliquot of crude material was carried out using a gradient of 90 to 100% B over 50 min (A=0.1% TFA/water and 0318 d) Microbubble Conjugation with Modified Trans B=MeOH) at a flow rate of 9 mL/min. After lyophilization ferrin/Avidin. 24 mg of pure material was obtained (Analytical HPLC; Gradient, 70-100% B where B=0.1% TFA/acetonitrile, 0319. To the thiol containing microbubbles from b) was A=0.01% TFA/water: column-vydac 218TP54: Detec added 1 mL of the modified transferrin/avidin protein solu tion-UV 214 nm-product retention time=23 min). Further tion c). After adjusting the pH of the solution to 9 the product characterization was carried out using MALDI maSS conjugation reaction was allowed to proceed for 2 hat room spectrometry; expected, M+H at 1096, found, at 1099. temperature. Following extensive Washing with deionised US 2005/0002865 A1 Jan. 6, 2005 46 water the microbubbles were analysed by Coulter counter EXAMPLE 1.7 (81% between 1 and 7 micron) and fluorescence microscopy (highly fluorescent microbubbles were observed). Multiple-specific Gas-containing Microbubbles of EXAMPLE 16 DSPS Comprising a Lipopeptide for Endothelial Cell Targeting and a Captopril Containing Molecule Preparation of Functionalised Gas-filled Microbubbles for Targeted Ultrasound Imaging 0322 This example is directed to the preparation of 0320 This example is directed to the preparation of ultrasound agents for combined targeting and therapeutic microbubbles having a reactive group on the Surface for applications. non-specific targeting, principally utilising disulphide eXchange reactions to effect binding to a multiplicity of 0323 a) Synthesis of a Lipopeptide Functionalised with cellular targets. Captopril:

O

~s. H NH2

O O H ~~~~ N N N N H H O O

NH2 O

NH2

O O OH

HN s N O

0321 DSPS (Avanti, 5.0 mg) and the thiol containing 0324. The structure shown above was synthesised using lipid structure from example 15 a)(1.0 mg) were weighed a manual nitrogen bubbler apparatus Starting with Fmoc into a clean vial and 0.8 mL of a Solution containing 1.4% protected Rink Amide MBHA resin (Novabiochem) on a 0.125 mmol Scale. All amino acids were purchased from propylene glycol/2.4% glycerol in water added. The mixture Novabiochem and palmitic acid from Fluka. Coupling was was warmed to 80° C. for 5 minutes (vials shaken during carried out using standard TBTU/HOBt/DIEA protocols. warming) and filtered while still hot through a 40 micron Bromoacetic acid was coupled through the Side-chain of LyS filter. The Samples were cooled to room temperature and the as a Symmetrical anhydride using DIC preactivation. Cap head Space flushed with perfluorobutane gas. The Vials were topril (Sigma) dissolved in DMF was introduced on the Shaken in a cap mixer for 45 S and the microbubbles placed Solid-phase using DBU as base. on roller table overnight. Bubbles were washed several 0325 Simultaneous removal of the peptide from the resin times with deionised water and analysed for thiol group and deprotection of Side-chain protecting groups was carried incorporation using Ellmans Reagent. out in TFA containing 5% EDT, 5% water and 5% ethyl US 2005/0002865 A1 Jan. 6, 2005 47 methyl Sulphide for 2 h. An aliquot of 10 mg of the crude mg aliquot of crude material was carried out using a gradient material was purified by preparative liquid chromatography of 70 to 100% B over 40 min (A=0.1% (Vydac 218TP1022 column) using a gradient of 70 to 100% B over 60 min (A=0.1% TFA/water and B=0.1% 0330 TFA/water and B=MeOH) at a flow rate of 9 mL/min. After lyophilization 20 mg of pure material was 0326 TFA/acetonitrile) at a flow rate of 10 mL/min. After lyophilization a yield of 2 mg of pure material was obtained obtained (Analytical HPLC; Gradient, 70-100% B where (analytical HPLC: gradient 70-100% B over 20 min, B=MeOH, A=0.01% TFA/water: column-vydac 218TP54: A=0.1% TFA/water and B=0.1% TFA/acetonitrile; flow rate Detection-UV 214 and 260 nm product retention time= 1 mL/min; column Vydac 218TP54, detection UV 214 nm, 16 min). Further product characterization was carried out retention time 26 min). Further characterisation was carried using MALDI mass spectrometry; expected, M+H at 2050, out using MALDI mass spectrometry, giving M--H at 1265 found, at 2055. as expected. 0331 c) Preparation of Gas-containing Microbubbles of 0327 b) Synthesis of a Lipopeptide with Affinity for DSPS Comprising a Lipopeptide for Endothelial Cell Tar Endothelial Cells: Dipalmitoyl-Lys-Lys-Lys-Aca-Ile-Arg geting and a Captopril Containing Molecule for Drug Deliv Arg-Val-Ala-Arg-Pro-Pro-Leu-NH ery

O --~~~~ NH NH2

O O H H --~~~~ N N N N-1N1-1 H H O O

NH2 HN NH

O NH2 O O O O N H H H H N N N O N N N N H H H N O O O O l l HN NH HN NH

0328. The lipopeptide was synthesised on a ABI 433A 0332 DSPS (Avanti, 4.5 mg), product from a) (0.5 mg) automatic peptide Synthesiser Starting with Rink amide resin and product from b) (0.5 mg) were weighed into a vial and (Novabiochem) on a 0.1 mmol Scale using 1 mmol amino 1.0 mL of a solution of 1.4% propylene glycol/2.4% glycerol acid cartridges. All amino acids and palmitic acid were preactivated using HBTU before coupling. was added to each vial. The mixture was warmed to 80 C. for 5 minutes (vials shaken during warming). The samples 0329. The simultaneous removal of peptide from the resin and Side-chain protecting groups was carried out in were cooled to room temperature and the head Space flushed TFA containing 5% phenol, 5% EDT and 5% HO for 2 with perfluorobutane gas. The Vials were firstly shaken in a hours giving a crude product yield of 160 mg. Purification cap mixer for 45s then rolled for 1 h followed by extensive by preparative HPLC (Vydac 218TP1022 column) of a 35 washing with deionised water. No detectable levels of start US 2005/0002865 A1 Jan. 6, 2005 48 ing material were found in the final wash Solution as 0338) Described in example 14a). evidenced by MALDI MS. 0339 b)-Preparation of Multiple-specific Gas-contain 0333 MALDI mass spectral analysis was used to confirm ing Microbubbles. incorporation of the products from Section a) and b) into the 0340 DSPS (Avanti, 5.0 mg), lipopeptide from a)(0.3 microbubbles as described in example 1 b). mg)and polymixin B Sulphate (Sigma, 0.5 mg) were weighed into a clean vial and 1.0 mL of a solution of 1.4% 0334 d) In Vitro Study of Gas-containing Microbubbles propylene glycol/2.4% glycerol added. The mixture was of DSPS Comprising a Lipopepitcle for Endothelial Cell Sonicated for 3-5 mins, warmed to 80° C. for 5 minutes then Targeting and a Captopril Containing Molecule for Thera filtered through a 4.5 micron filter. The mixture was cooled peutic Applications. to room temperature and the head Space flushed with per fluorobutane gas. The Vial was Shaken in a cap mixer for 45 0335 The in vitro assay described in example 1 c) was S and the microbubbles centrifuged at 1000 rpm for 3 used to examine cell binding under flow conditions. A minutes. The microbubbles were washed in water until no gradual accumulation of the microbubbles on the cells took polymixin B Sulphate or lipopeptide could be detected in the place which was dependant on the flow rate. By increasing infranatant by MALDI-MS. Microscopy showed that the the flow rate the cells started to become detached from the size distribution of the bubble population was between 1-8 coverslip, the microbubbles were still bound to the cells. micron as desired. Control bubbles not carrying the vector did not adhere to the endothelial cells and disappeared from the cells under mini 0341) To the washed bubbles (ca. 0.2 mL) was added mal flow conditions. methanol (0.5 mL) and the mixture placed in a sonic bath for 2 min. The resulting clear Solution, following analysis by MALDI-MS, was found to contain both lipopeptide and EXAMPLE 1.8 polymixin B Sulphate (expected 1203, found 1207). Preparation of Multiple-Specific Gas-containing EXAMPLE 1.9 Microbubbles of DSPS Loaded with a Lipopeptide Comprising a Helical Peptide with Affinity for Cell Preparation of Multiple-Specific Gas-containing Membranes and the Peptide Antibiotic Polymixin B Microbubbles of DSPS Doped with a Lipopeptide Sulphate Comprising a IL-1 Receptor Binding Sequence and Modified with a Branched Structure Containing the 0336. This example is directed at the preparation of Drug Methotrexate targeted microbubbles comprising multiple peptidic vectors 0342. This example is directed at the preparation of having a combined targeting and a therapeutic application. targeted microbubbles comprising multiple vectors for tar 0337 a) Synthesis of a Lipopeptide Comprising a Helical geted/therapeutic/drug release applications. Peptide with Affinity for Cell Membranes:hexadecylstearyl 0343 a) Synthesis of a Lipopeptide Comprising an Inter Lys-Leu-Ala-Leu-Lys-Leu-Ala-Leu-Lys-Ala-Leu-Lys-Ala leukin-1 Receptor Binding Peptide: Dipalmitoyl-Lys-Gly Ala-Leu-Lys-Leu-Ala-NH. Asp-Trp-Asp-Gln-Phe-Gly-Leu-Trp-Ara-Gly-Ala-Ala.OH US 2005/0002865 A1 Jan. 6, 2005 49

-continued

H i- Y N-H NH

| O | O | O | O | O -N N Nulls, ---, Nulls, sus,

2 NN H H-N O

H

0344) The lipopeptide was synthesised on a ABI 433A using a gradient of 90 to 100% B over 40 min (A=0.1% automatic peptide Synthesiser Starting with Fmoc-Ala-Wang TFA/water and B=MeOH) at a flow rate of 9 mL/min. After resin (Novabiochem) on a 0.1 mmol scale using 1 mmol lyophilization 4 mg of pure material was obtained (Analyti amino acid cartridges. All amino acids and palmitic acid cal HPLC; Gradient, 90-100% B over 20 min where were preactivated using HBTU before coupling. B=MeOH, A=0.01% TFA/water: column-vydac 218TP54: 0345 The simultaneous removal of lipopeptide from the Detection-UV 214 nm; product retention time=23 min). resin and Side-chain protecting groups was carried out in Further product characterization was carried out using TFA containing 5% H0, 5% anisole, 5% phenol and 5% MALDI mass spectrometry; expected, M+H at 2083, found, EDT for 2 hours giving a crude product yield of 150 mg. at 2088. Purification by preparative HPLC (Vydac 218TP1022 col 0346 b) Synthesis of a Branched Methotrexate Core umn) of a 30 mg aliquot of crude material was carried out Structure Containing a Thiol Moiety.

HN N N rS COOH NN 4 N O H H H NH Nulls N N N H N O O COOH HN N N COOH O

N 2 N H OClu COOH N1SNH O N O N HN O E N H O Nshi O N O COOH US 2005/0002865 A1 Jan. 6, 2005 50

0347 The methotrexate structure was synthesised on a EXAMPLE 2.0 ABI 433A automatic peptide synthesiser starting with Fmoc Cys(Trt) Tentagel resin on a 0.1 mmol scale. The simulta Preparation of Microbubbles Coated with neous removal of product from the resin and deprotection of Poly-L-lysine Complexed to Fluorescein Labeled protecting groups was carried out in TFA containing 5% DNA Fragments from Plasmid pBR322 EDT and 5% HO for 2 hours giving a crude product yield of 160 mg. Purification by preparative HPLC (Vydac 0353. This example is directed to the preparation of 218TP1022 column) of a 30 mg aliquot of crude material microbubbles for gene therapy/anti-Sense applications. It is was carried out using a gradient of 10 to 30% B over 40 min envisaged that Specific targeting may be achieved by further (A=0.1% TFA/water and B=0.1% TFA/acetonitrile) and a doping of microbubble membranes with vector modified flow rate of 9 mL/min. After lyophilization of the pure lipid structures as described in example 1. fractions 9 mg of pure material was obtained (Analytical 0354) a) Preparation of DSPS Gas-containing HPLC; Gradient, 5-50% B where B=0.1% TFA/acetonitrile, Microbubbles A=0.01% TFA/water: column-vydac 218TP54: Detec 0355 DSPS (Avanti, 4.5 mg) was weighed into a clean tion-UV 214 nm product retention time=9.5 min). Fur vial. 1.0 mL of a solution of 1.4% propylene glycol/2.4% ther product characterization was carried out using MALDI glycerol was added and the mixture Sonicated for 2 min then mass spectrometry; expected, M+H at 1523, found, 1523. warmed to 80° C. for 5 minutes. Immediately following 0348 c)-Preparation of Multiple-specific Gas-contain warming the Solution was filtered through a 4 micron filter. ing Microbubbles. The Sample was cooled to room temperature and the head Space flushed with perfluorobutane gas. The Vial was shaken in a cap mixer for 45 S. Bubbles were then washed once with 0349 DSPS (Avanti, 4.5 mg.) and thiol containing deionised water and the infranatant discarded. The lipopeptide from example 15 a) (0.5 mg) and lipopeptide microbubbles were then resuspended in 0.5 mL water. from a) (0.2 mg) above were weighed into a clean vial and 0356) b) Preparation of Poly-L-lysine/DNA Complex and 1.0 mL of a solution of 1.4% propylene glycol/2.4% glycerol Loading of DSPS Microbubbles added. The mixture was Sonicated for 3-5 mins, warmed to 0357 To 1 mg of poly-L-lysine (70-150 kD) in a clean 80 C. for 5 minutes then filtered through a 4.5 micron filter. vial was added 0.1 mL of a fluorescein labeled digest of The mixture was cooled to room temperature and the head plasmid pBR322 (Biorad) dissolved in TE buffer (10 mM Space flushed with perfluorobutane gas. The Vials were tris-HCl, pH 8). The solution was made up to a total of 0.6 shaken in a cap mixer for 45 s and the microbubbles mL by addition of water and the pH adjusted to 8. centrifuged at 1000 rpm for 3 minutes following which the 0358 Complexation was allowed to proceed for 1 h then infranatant was discarded. 0.05 mL of the polylysine-DNA solution was added to the 0350 d) Conjugation of Methotrexate Branched Struc microbubble suspension from a) above. After. 1 h micros ture to Thiolated Microbubbles. copy was used to show that the bubbles were fluorescent confirming the presence of DNA.

0351) The methotrexate structure from b) above (0.5 mg) EXAMPLE 21 was dissolved in PBS pH 8.0. The solution was then added Preparation of Multiple-specific Gas-filled to the thiol containing bubbles from c) and disulphide bond Microbubbles Containing a Branched Core Peptide formation allowed to proceed for 16 h. Following extensive Comprising a Dabsylated-atherosclerotic Plaque washing with PBS and water the bubbles were analysed by Binding Sequence and RGDS microscopy and MALDI MS. 0359. This example is directed to the preparation of 0352. It is also considered relevant that the disulphide microbubbles having a thiol group on the Surface for modi bond linking the methotrexate structure to the microbubble fication with thiol containing vectors for targeting/drug may be reduced in Vivo liberating the free drug molecule. delivery and drug release. This in combination with a tumour specific vector is a drug 0360 a) Synthesis of the Branched Peptide Dabsyl-Tyr delivery System. A physiologically relevant reducing agent Arg-Ala-Leu-Val-Asp-Thr-leu-Lys-LyS (NH2-Arg-Gly Such as glutathione may be used to bring about drug release. Asp-Ser)-Gly-Cys.OH US 2005/0002865 A1 Jan. 6, 2005 51

O O O

N N N1 H H E H

-NH NH2

O O O H H H N N N N N OH H E H O )- O E l O Yoh NH

HO O

N N H H O YCOOH O 1sNH

0361 The peptide was synthesised on a ABI 433A auto carried out using MALDI mass spectrometry; expected, matic peptide Synthesiser starting with Fmoc-Cys(Trt)- M+H at 2070, found, at 2073. Tentagel resin on a 0.1 mmol Scale using 1 mmolamino acid 0363 b) Preparation of Thiol Containing Gas-filled cartridges. All amino acids were preactivated using HBTU Microbubbles. before coupling. 0362. The simultaneous removal of peptide from the 0364. As described in example 15 a) and b). resin and Side-chain protecting groups was carried out in 0365 c) Oxidative Coupling of Thiolated Microbubbles TFA containing 5% phenol, 5% EDT and 5% HO for 2 with Multiple-specific Peptide Via Disulphide Bond Forma hours giving a crude product yield of 160 mg. Purification tion. by preparative HPLC (Vydac 218TP1022 column) of a 30 0366) The infranatant from the microbubbles from b) mg aliquot of crude material was carried out using a gradient above was discarded and replaced with a Solution of dabsyl of 10 to 60% B over 40 min (where A=0.1%TFA/water and peptide from a) (1 mg) in 0.7 mL dil. ammonia Solution (pH B=acetonitrile) at a flow rate of 9 mL/min. After lyophiliza 8). To this was added 0.2 mL of a stock solution containing tion 2.5 mg of pure material was obtained (Analytical 6 mg of potassiumferricyanate dissolved in 2 mL of water. HPLC; Gradient, 10-50% B over 20 min where B=0.1% The vial was placed on a roller table and-thiol oxidation TFA/acetonitrile and A=0.01% TFA/water: column-Vydac allowed to proceed for 2 h. The bubbles were then washed 218TP54: Detection-UV 214 and 435 nm product reten extensively with water until the infranatant was free of the tion time=21 min). Further product characterization was dabsyl-peptide as evidenced by hplc and MALDI MS. US 2005/0002865 A1 Jan. 6, 2005 52

0367 Detection of microbubble bound peptide was car 0377) e) Acoustic Characterisation and Microscopy of the ried out by reduction of the disulphide bond using the water Product Souble reducing agent tris-(2-carboxyethyl)-phosphine. Fol 0378 Confirmation of the microparticulate nature of the lowing reduction the infranatant was found to contain free product is performed using light microscopy as described in dabsyl-peptide as evidenced by hplc and MALDI MS. WO-A-9607434. Ultrasonic transmission measurements 0368 Other physiological relevant reducing agents such using a 3.5 MHz broadband transducer indicate that a as reduced glutathione are also considered useful for initi particle Suspension of <2 mg/mL gives a Sound beam ating release. attenuation of at least 5 dB/cm. 0379 f) Multiple-specific Microparticles EXAMPLE 22 0380 The biotinylated microspheres are then used to Gas-containing Microparticles Comprising Polymer prepare multiple-specific targeting products Similar to those from Ethylidene Bis(16-hydroxyhexadecanoate) and exemplified in examples 5), 6) and 7). Adipoyl Chloride and Biotin-amidocaproate-Ala EXAMPLE 23 Covalently Attached to the Polymer Preparation of Multiple-Specific Gas-containing 0369 a) Synthesis of Z-Ala-polymer (3-O-(carbobenzy Microbubbles Encapsulated with DSPS and Biotin loxy-L-alanyl)-polymer) PEGoo-acyl-phosphatidylethanolamine and Func tionalised with Streptavidin, Oligonucleotide 0370. The polymer is prepared from ethylidene bis(16 Biotin-GAAAGGTAGTGGGGTCGTGTGCCGG hydroxyhexadecanoate) and adipoyl chloride as described in and Biotinylated Fibrin-anti-polymerant Peptide WO-A-9607434, and a polymer fraction with molecular weight 10000 is purified using gel permeation chromatog (Biotin-GPRPPERHOS.NH) raphy (GPC). 10 g of the material (corresponding to 1 mmol s a) Synthesis of Biotin-PEGaoo-acvl-phosphatidyl OH groups), Z-alanine (5 mmol) and dimethylaminopyri thanolamine dine (4 mmol) are dissolved in dry dimethylformamide/ 0382. A mixture of dipalmitoyl phosphatidyl ethanola tetrahydrofuran and dicyclohexylcarbodiimide is then mine, (21.00 mg, 0.03 mmol), biotin-PEG-CO-NHS, (100 added. The reaction mixture is stirred at ambient tempera mg, 0.03 mmol) and triethylamine (42 ul, 0.30 mmol) in a ture overnight. Dicyclohexylurea is filtered off and the solution of chloroform/methanol (3:1) was stirred at room Solvent is removed using rotary evaporation. The product is temperature for 2 hours. After evaporation of the Solvents purified by chromatography, fractions containing the title under reduced pressure, the residue was flash chromato compound are combined and the Solvent is removed using graphed (methylene chloride/methanol/water, 40:8:1). The rotary evaporation. The Structure of the product is confirmed product was obtained as a yellow gum, 112 mg (94%) and by NMR. structure verified by NMR and MALDI-MS. 0371 b) Synthesis of Ala-polymer (3-O-(L-alanyl)-poly 0383 b) Binding of Fluorescein-conjugated Streptavidin mer) to Gas Filled Microbubbles 0372 Z-Ala-polymer (0.1 mmol) is stirred in toluene/ 0384 Gas-containing microbubbles were prepared by tetrahydrofuran and glacial acetic acid (15% of the total mixing DSPS and biotin-PEG-acyl-phosphatidyl etha Volume) and hydrogenated in the presence of 5% palladium nolamine as described in example 5 a). on charcoal for 2 hours. The reaction mixture is filtered and 0385) The microbubble suspension was divided into 0.2 concentrated in vacuo. mL aliquots and fluorescein conjugated Streptavidin added 0373 c) Synthesis of Biotinamidocaproate-Ala-polymer as shown in the table below. The samples were incubated on a roller table for 15 or 30 minutes at ambient temperature 0374. A solution of Biotinamidocaproate N-hydroxysuc before removal of excess protein by washing in PBS. cinimide ester in tetrahydrofuran is added to HN-Ala polymer dissolved in a mixture of tetrahydrofuran and 0386 Results: dimethylformamide and 0.1 M Sodium phosphate buffer having a pH of 7.5. The reaction mixture is heated to 30° C. and stirred vigorously; the reaction is followed by TLC to Added Particle completion. The Solvent is evaporated and the crude product Streptavidin Incubation 26 Fluo- median is used without further purification. Aliquot (ug/200: 1 time (amb. rescent diameter O. sample) temp.) particles (microns) 0375 d) Gas-containing Particles Comprising Biotin amidocaproate-Ala-polymer and PEG 10000 Methyl Ether 1. O 2.O 2 O 12 16-hexadecanoyloxyhexadecanoate (foam) 3 O.2 30 min 7.8 3.9 0376) 10 mL of a 5% w/w solution of biotin-amidoca (3 x 10 mmol) proate-Ala-polymer in (-)-camphene maintained at 60° C. is 4 2 30 min 26.2 4.2 added to 30 mL of an 1% w/w aqueous solution of PEG (3 x 10 mmol) 10000 methyl ether 16-hexadecanoyloxyhexadecanoate 5 1O 15 min 30.5 la (1.5 x 107 mmol) (prepared as described in WO-A-9607434) at the same 6 2O 30 min 97.9 5.2 temperature. The mixture is emulsified using a rotor Stator (3 x 107 mmol) mixer (Ultra Turax(R) T25) at a slow speed for several 7 40 15 min 96.7 5.1 minutes, and thereafter is frozen in a dry ice/methanol bath (6 x 107 mmol) and lyophilized for 48 hours, giving the title product as a (6 x 107 mmol) white powder. US 2005/0002865 A1 Jan. 6, 2005 53

EXAMPLE 24 -continued

Added Particle Streptavidin Incubation 26 Fluo- median Preparation of Microbubbles Encapsulated with Aliquot (ug/200: 1 time (amb. rescent diameter DSPS and Functionalised with a Thrombi-targeting O. sample) temp.) particles (microns) Lipopeptide and the Thrombolytic Enzyme Tissue 8 DSPS 2O 15 min O6 3.7 Plasminogen Activator control (3 x 107 mmol) 0391 This example is directed at the preparation of 0387. The samples were analysed by flow cytometry and thrombus targeted US agents comprising a therapeutic thro Coulter Counter. The results are Summarized in the table molytic agent. above. 0388 c) Conjugation of Streptavin Coated Microbubbles with the Oligonucleotide Biotin-GAAAGG 0392 a) Synthesis of a Lipopeptide with Affinity for TAGTGGGGTCGTGTGCCGG and Biotinylated Fibrin Thrombi (Diplannitoyl-Lys-Asn-Gly-Asp-Phe-Glu-Glu-Ile anti-polymerant Peptide Biotin-GPRPPERHOS Pro-Glu-Glu-Tyr-Leu-Gln-NH).

O

COOH COOH O O O H H --~~~~ N Rul N Null N H E H H O YCOOH O O COOH

COOH

O O O H H N Null N Null NH2 E H H COOH N O O COOH COOH

OH

0389. The particles from aliquot no. 6 above were cen 0393. The lipopeptide was synthesised on a ABI 433 A trifuged and the Supernatant replaced with 1 mL of PBS automatic peptide Synthesiser Starting with Rink amide resin buffer pH 7.5 containing 0.2 mg of biotin-GAAAGG (Novabiochem) on a 0.1 mmol scale using 1 mmol amino TAGTGGGGTCGTGTGCCGG and 0.2 mg of biotin acid cartridges. All amino acids and palmitic acid were GPRPPERHQS (example 5 c). After incubation for 24 h the preactivated using HBTU before coupling. particles were washed extensively with PBS and water. 0394. The simultaneous removal of peptide from the 0390. It is envisaged that other biotinylated vectors or resin and Side-chain protecting groups was carried out in therapeutic agents may be conjugated to Streptavidin or TFA containing 5% phenol, 5% EDT, 5% anisole and 5% avidin coated microbubbles using this procedure. HO for 2 h giving a crude product yield of 80 mg. US 2005/0002865 A1 Jan. 6, 2005 54

Purification by preparative HPLC (Vydac 218TP1022 col pyridine (121ul, 1.5 mmol) was stirred at 85°C. for 2 h. The umn) of a 20 mg aliquot of the crude material was carried reaction mixture was cooled, and exceSS epichlorohydrin out. After lyophilization 6 mg of pure material was obtained. was distilled off (rotavapor). The residue was taken up in The product was characterized by MALDI mass spectrom ethyl acetate, washed with brine and dried (Na2SO). The etry and analytical HPLC. Solution was filtered and concentrated. The dark residue was 0395 b) Modification of Tissue Plasminogen Activator chromatographed (silica, hexane/ethyl acetate 7:3) to give with Sulpho-SMPB. 2.25 g (34%) of a colourless oil. "H (300 MHz) and 'C 0396 A solution of 0.1 mL of ammonium carbonate NMR (75 MHz) spectra were in accordance with the struc buffer containing 0.1 mg oft-PA (Sigma) was made up to 0.2 ture. mL by the addition of water. To this solution was added 0.4 mg of Sulpho-SMPB (Pierce) dissolved in 0.05 mL DMSO. 0405 ii) Synthesis of methyl 4-2-hydroxy-3-(1-meth The protein Solution was left Standing at room temperature ylethyl)amino-propoxyphenylacetate for 45 min then purification carried out on a Superdex 200 column. The product was eluted in PBS and the modified protein fraction collected. 0406 A mixture of methyl 4-(2,3-epoxy)propoxyphe 0397) c) Preparation of Microbubbles Encapsulated with nylacetate (2.00 g, 9.00 mmol), isopropylamine (23 ml, 0.27 DSPS/thrombi-binding Lipopeptide and Thiol Containing mol) and water (1.35 ml, 74.7 mmol) was stirred at room Lipoeptide and Conjugation to Modified Tissue Plasmino temperature overnight. The reaction mixture was concen gen Activator. trated (rotavapor) and the oily residue was dissolved in 0398 DSPS (Avanti, 5.0 mg) was weighed into a clean vial along with 0.5 mg of the lipopeptide from a) and 0.5 mg chloroform and dried (NaSO). Filtration and concentration of the thiol containing lipopeptide from example 15 a). To gave quantitative yield of a yellow oil that was used in the this was added 1.0 mL of a solution of 1.4% propylene next Step without further purification. The Structure was glycol/2.4% glycerol and the mixture Sonicated for 2 min verified by H and 'C NMR analysis. then warmed to 80 C. for 5 minutes. Immediately following warming the Solution was filtered through a 4 micron filter. 0407 iii) Synthesis of 4-2-hydroxy-3-(1-methylethy The Sample was cooled to room temperature and the head l)amino-propoxyphenylacetic acid hydrochloride Space flushed with perfluorobutane gas. The Vials were shaken in a cap mixer for 45s and the microbubbles washed 0408. A solution of methyl 4-2-hydroxy-3-(1-methyl 2 times with deionised water. The infranatant was discarded and replaced with a 1 mL aliquot of the protein Solution from ethyl)amino-propoxyphenylacetate (563 mg, 2.00 mmol) b) above. The conjugation reaction was allowed to proceed in 6 M hydrochloric acid (15 ml) was heated at 100° C. for for 1 h. The bubbles were centrifuged and infranatant 4 h. The reaction mixture was concentrated (rotavapor) and exchanged with a further 1 mL of protein solution. The the residue was taken up in water and lyophilised. H and incubation Step was repeated until all protein Solution was 'C NMR spectra were in accordance with the strucure and used up. The microbubbles were then washed extensively MALDI mass spectrometry gave a M+H at 268 as expected. with water and analysed by Coulter counter. The microbubbles were tested in the flow chamber assay 04.09 iv) Synthesis of N-Boc-4-2-hydroxy-3-(1-meth described in example 1 c). Microbubbles modified with ylethyl)amino-propoxyphenylacetic acid protein were found to bind in higher numbers than those comprising either lipopeptide/DSPS or DSPS alone. 0399. It is envisaged that the targeting/therapeutic/ultra 0410 A solution of the 4-2-hydroxy-3-(1-methylethy Sound activities of these microbubbles be evaluated in l)amino-propoxyphenylacetic acid hydrochloride (2.0 models of in vitro and in vivo thrombogenisis. mmol) in water (2 ml) was added to a Solution of Sodium EXAMPLE 25 bicarbonate (0.60 g, 7.2 mmol) in water/dioxane (2:1, 15 Multiple-specific PFB Gas-filled Microbubbles ml). A solution of di-tert-butyl dicarbonate (0.48 g, 2.2 Encapsulated with DSPS and a Lipopeptide mmol) in dioxane (5 ml) was added. Progress of the reaction Comprising a Heparin Sulphate Binding Peptide was monitored by TLC analysis (silica, CHCl/MeOH/ (KRKR) and a Fibronectin Peptide (WOPPRARI) for Targeting and a Lipopeptide Containing AcOH 85:10:5), and portions of di-tert-butyl dicarbonate Atenolol for Therapeutic Applications were added until conversion was complete. 04.00 a) Synthesis of a Lipopeptide Consisting of a Heparin Sulphate Binding Peptide (KRKR) and a Fibronec 0411 The reaction mixture was poured onto water satu tin Peptide (WOPPRARI) rated with potassium hydrogensulphate and organic material 0401 Synthesis and purification described in example 1 was extracted into ethyl acetate. The organic phase was a). washed with water and brine, dried (NaSO) and filtered to 0402 b) Synthesis of a Protected Atenolol Derivative give 0.6 g of crude material. The product was purified by Suitable for Solid Phase Coupling chromatography (silica, CHCl/MeOH/AcOH 85:10:5). The 04.03 i) Synthesis of methyl 4-(2,3-epoxy)propoxyphe Solution was concentrated and the residue was taken up in nylacetate glacial acetic acid and lyophilised. Yield 415 mg (56%), 0404 A mixture of methyl 4-hydroxyphenylacetate (4.98 white solid. The structure was confirmed by H and 'C g, 0.03 mol), epichlorohydrin (23.5 ml, 0.30 mol) and NMR analysis. US 2005/0002865 A1 Jan. 6, 2005 55

0412 c) Synthesis of a Lipopeptide Functionalised with Atenolol

O

~s, H NH2

O O O H H N N N N NH2 H H O O

NH2 ins O O ~~ 1. OH

0413. The structure shown above was synthesised on a with perfluorobutane gas and the vial was shaken in a cap manual nitrogen bubbler Starting with Fmoc protected Rink mixer for 45s followed by extensive washing with deionised Amide MBHA resin (Novabiochem) on a 0.125 mmol scale, Water. using amino acids from Novabiochem, palmitic acid from 0417. Incorporation of atenolol containing lipopeptide Fluka and the compound from a). Coupling was carried out into the bubbles was confirmed by MALDI-MS as described using standard TBTU/HOBt/DIEA protocols. in example 1 b). 0414. Simultaneous removal of the peptide from the resin 0418 e) In Vitro Study of Multiple-specific Gas-filled and deprotection of Side-chain protecting groups was carried Microbubbles. out in TFA containing 5% EDT and 5% water for 2 h. Crude material was precipitated from ether and purified by pre 0419. In vitro analysis of the microbubble suspension parative liquid chromatography (Vydac 218TP1022 column) was carried out as described in example 1 c). A gradual using a gradient of 70 to 100% B over 60 min (A=0.1% accumulation of the microbubbles on the cells took place TFA/water and B=0.1% TFA/acetonitrile) at a flow rate of which was dependent on the flow rate. By increasing the 10 ml/min. After lyophilisation a yield of 38 mg of pure flow rate the cells started to become detached from the material was obtained (analytical HPLC: gradient 70-100% coverslip, the microbubbles were still bound to the cells. B over 20 min, A=0.1% TFA/water and B=0.1% TFA/ Control bubbles not carrying the vector did not adhere to the acetonitrile, flow rate 1 ml/min, column Vydac 218TP54, endothelial cells and disappeared from the cells under mini detection UV 214 nm, retention time 25 min). Further mal flow conditions. characterisation was carried out using MALDI maSS Spec trometry (ACH matrix), giving M+H at 1258, expected EXAMPLE 26 1257. PFB Gas-filled Microbubbles of DSPS Containing 0415 d) Preparation of Gas-filled Microbubbles of DSPS a Cholesterol Ester of Chlorambucil for Diagnostic Comprising a Lipopeptide CoSisting of a Heparin Sulphate and Therapeutic Applications Binding Peptide (KRKR) and a Fibronectin Peptide (WOP PRARI) and a Lipopeptide Containing Atenolol 0420. This example is directed at non-specific modifica tion of a multiplicity of cell receptorS on endothelial cells. 0416 A Solution of 1.4% propylene glycol/2.4% glycerol (1.0 ml) was added to a mixture of DSPS (Avanti, 5.0 mg), 0421 a) Synthesis of Cholesterol 4-4-bis(2-chloroethy product from a) (0.5 mg) and product from c) (0.5 mg) in a l)aminol-phenylbutanoate vial. The mixture was Sonicated for 5 min and then heated 0422 DIC (170 ul, 1.10 mmol) was added to a solution at 80° C. for 5 min (vial was shaken during warming). The of chlorambucil (Sigma, 669 mg, 2.20 mmol) in dry dichlo Solution was filtered and cooled. Head Space was flushed romethane (15 ml). The mixture was stirred at room tem US 2005/0002865 A1 Jan. 6, 2005 56 perature for 0.5 h and added to a solution of cholesterol mixture was Sonicated for 5 min and then warmed to 80 C. (Aldrich, 387 mg, 1.00 mmol) and DMAP (122 mg, 1.00 for 5 min (vial was shaken during warming). The Solution mmol) in dichloromethane (10 ml). The reaction mixture was filtered and cooled. Head space was flushed with was stirred overnight and then poured onto 5% sodium perfluorobutane gas and the Vial was shaken in a cap mixer bicarbonate. The phases were separated and the organic for 45 s followed by extensive washing with deionised phase was washed with brine and dried (MgSO). The water. Incorporation of atenolol containing lipopeptide and Solution was filtered and concentrated and the product was chlorabucil analogue into the bubble membrane was con purified by column chromatography (Silica, chloroform) to firmed by MALDI-MS as described in example 1 c). give 560 mg (83%) yield of colouless oil. The product was characterised by MALDI mass spectrometry, giving M--H at 0434 e) In Vitro Study of Multiple-specific PFB Gas 674 as expected. Further characterisation was carried out containing Microbubbles of DSPS Comprising a Lipopep using H (500 MHz) and 'C (125 MHz) NMR analysis, tide Containing Atenolol and a Cholesterol Derivative of giving spectra in accordance with the Structure. Chlorambucil for Diagnostic and Therapeutic Applications 0423 b) Preparation of Gas-containing Microbubbles of 0435 The in vitro assay described in example 1 c) was DSPS Comprising a Cholesteryl Ester of Chlorambucil for used to assess cellular binding under flow conditions. A Diagnostic and/or Therapeutic Applications gradual accumulation of the microbubbles on the cells took place which was dependant on the flow rate. By increasing 0424. A solution of 1.4% propylene glycol/2.4% glycerol the flow rate the cells started to become detached from the (1.0 ml) was added to a mixture of DSPS (Avanti, 4.5 mg) coverslip, the microbubbles were still bound to the cells. and product from a) (0.5 mg) in a vial. The mixture was Control bubbles not carrying the vector did not adhere to the Sonicated for 5 min and then heated at 80°C. for 5 min (vial endothelial cells and disappeared from the cells under mini was shaken during warming) and cooled. Head space was mal flow conditions. flushed with perfluorobutane gas and the Vial was Shaken in a cap mixer for 45 s followed by extensive washing with deionised water. MALDI mass spectrometry showed no EXAMPLE 28 detectable level of compound from a) in the final wash Solution. Incorporation of chlorambucil cholesteryl ester Multiple-specific Gas-filled Microbubbles of DSPS into the bubbles was confirmed by MALDI-MS as follows: Comprising a Lipopeptide Containing Atenolol for ca 50 ul of microbubbles were transferred to a clean vial Cell Targeting and a Lipophilic Thiol Ester of containing ca 100 ul of 90% methanol. The mixture was Captopril for Therapeutic Use Sonicated for 30s and analysed by MALDI-MS, giving a 0436 a) Synthesis of a Protected Atenolol Derivative M+H peak at 668 corresponding to structure from a). Suitable for Solid Phase Coupling 0425. In combination with a tumour specific vector these 0437 AS described in example 25 section b). microbubbles are considered useful as targeted drug delivery agents. 0438 b) Synthesis of a Lipopeptide Functionalised with Atenolol EXAMPLE 27 0439 As described in example 25 section c). Multiple-specific Gas-filled Microbubbles of DSPS 0440 c) Synthesis of Cholanic Acid Thiol Ester of Cap Comprising a Lipopeptide Containing Atenolol and topril a Cholesterol Derivative of Chlorambucil for Diagnostic and Therapeutic Applications 0441. A mixture of 5-f-cholanic acid (Sigma, 361 mg, 1.00 mmol) and DIC (77 ul, 0.50 mmol) in dichloromethane 0426 a) Synthesis of a Protected Atenolol Derivative (5 ml) was stirred for 10 min and then added to a solution Suitable for Solid Phase Coupling of captopril (Sigma, 130 mg, 0.600 mmol) and DBU (180 ul, 1.20 mmol) in dichloromethane (10 ml). The reaction mix 0427 As described in example 25 section b). ture was stirred overnight and then poured onto dilute 0428 b) Synthesis of a Lipopeptide Functionalised with hydrochloric acid. Chloroform (30 ml) was added. The Atenolol phases were separated and the organic phase was washed with water and brine and dried (MgSO). After filtration and 0429. As described in example 25 section c). concentration the crude material was chromatographed (silica, chloroform/methanol/acetic acid 95:4:1). The prod 0430 c) Synthesis of Cholesteryl 4-4-bis(2-chloroethy uct was lyophilised from a acetonitrile/water/ethanol mix l)aminophenylbutanoate ture. Yield 137 mg (49%) of off-white solid. The structure 0431 AS described in example 25 section d). was verified by H (500 MHz) and 'C (125 MHz) NMR Spectroscopy. Further characterisation was carried out using 0432) d) Preparation of Microbubbles of DSPS Compris MALDI mass spectrometry, giving a M--Na peak in positive ing a Lipopeptide Containing Atenolol and a Cholesteryl mode at m/z 584. Ester of Chloambucil 0442 d) Preparation of Gas-filled Microbubbles of DSPS 0433) A solution of 1.4% propylene glycol/2.4% glycerol Comprising a Lipopeptide Containing Atenolol for Cell (1.0 ml) was added to a mixture of DSPS (Avanti, 5.0 mg), Targeting and a Lipophilic Thiol Ester of Captopril for product from b) (0.5 mg) and c) (0.5 mg) and in a vial. The Therapeutic Use. US 2005/0002865 A1 Jan. 6, 2005 57

0443 A Solution of 1.4% propylene glycol/2.4% glycerol B-alaninate hydrochloride. The structure was confirmed by (1.0 ml) was added to a mixture of DSPS (Avanti, 5.0 mg) 1H NMR (500 MHz) analysis and by MALDI mass spec and product from b) (0.5 mg) and c) (0.5 mg) in a vial. The trometry, giving a M+Na peak at 482, expected 481. mixture was Sonicated for 5 min and then heated at 80 C. for 5 min (vial was shaken during warming) and cooled. 0450 c) Biotin-PEGoo-B-Ala-Cholesterol Head Space was flushed with perfluorobutane gas and the 0451) To a solution of cholesteryl B-alaninate hydrochlo vial was shaken in a cap mixer for 45 s followed by ride (15 mg, 0.03 mmol) in chloroform/wet methanol (2.6:1, extensive washing with deionised water. MALDI mass 3 ml) was added triethylamine (42 ul, 0.30 mmol). The Spectrometry showed no detectable level of compound from mixture was stirred for 10 minutes at room temperature and b) and c) in the final wash Solution. Incorporation of a solution of biotin-PEG3400-NHS (100 mg, 0.03 mmol) in compounds from b) and from c) into the bubbles was 1,4-dioxane (1 ml) was added dropwise. After stirring at confirmed by MALDI-MS as follows. Ca. 50 ul of room temperature for 3 hours, the mixture was evapourated microbubbles were transferred to a clean vial containing ca to dryneSS and the residue purified by flash chromatography 100 ul of 90% methanol. The mixture was Sonicated for 30 to give white crystals, yield; 102 mg (89%). The structure s and analysed by MALDI-MS (ACH-matrix)...giving peaks was verified by MALDI-MS and by NMR analysis. according to structures from b) and c), respectively. 0452 d) Synthesis of Cholesterol 4-4-bis(2-chloroethy 0444 e) In Vitro Study of Gas-containing Microbubbles l)aminophenylbutanoate from d) 0453) DIC (170 ul, 1.10 mmol) was added to a solution 04:45 The in vitro assay described in example 1 c) was of chlorambucil (Sigma, 669 mg, 2.20 mmol) in dry dichlo used to assess cellular binding under flow conditions. A romethane (15 ml). The mixture was stirred at room tem gradual accumulation of the microbubbles on the cells took perature for 0.5 h and added to a solution of cholesterol place which was dependent on the flow rate. By increasing (Aldrich, 387 mg, 1.00 mmol) and DMAP (122 mg, 1.00 the flow rate the cells started to become detached from the mmol) in dichloromethane (10 ml). The reaction mixture coverslip, the microbubbles were still bound to the cells. was stirred overnight then poured into a solution of 5% Control bubbles not carrying the vector did not adhere to the Sodium bicarbonate. The organic phase was washed with endothelial cells and disappeared from the cells under mini brine and dried over MgSO. The solution was filtered and mal flow conditions. concentrated and the product was purified by column chro matography (silica, chloroform) to give 560 mg (83%) yield EXAMPLE 29 of colouless oil. The product was characterised by MALDI mass spectrometry, giving M-H at 674 as expected. Further Gas-filled Microbubbles of Phosphatidylserine characterisation was carried out using H (500 MHz) and Comprising Biotinamide-PEG-B-Ala-Cholesterol 'C (125 MHz) NMR analysis, giving spectra in accordance and a Cholesteryl Ester of Chlorambucil for with the structure. Diagnostic and Therapeutic Applications 0454) e) Preparation of Gas-filled Microbubbles 0446) a) Synthesis of Cholesterol N-Boc-f-alaninate 0455 Asolution of 1.4% propylene glycol/2.4% glycerol 0447 DIC (510 ul) was added to a solution of Boc-B- (1.0 ml) was added to a mixture of DSPS (Avanti, 5 mg) and Ala-OH (1.25 g, 6.60 mmol) in dichloromethane (15 ml) product from c) (0.5 mg) and d) (0.5 mg) in a vial. The under an inert atmosphere. The reaction mixture was Stirred mixture was Sonicated for 5 min and then heated at 80 C. for 30 min and then transferred to a flask containing a for 5 min (vial was Shaken during warming) and cooled. solution of cholesterol (1.16 g, 3.00 mmol) and DMAP (367 Head Space was flushed with perfluorobutane gas and the mg, 3.00 mmol) in dichloromethane (15 ml). The reaction vial was shaken in a cap mixer for 45 s followed by mixture was stirred for 2 h and then mixed with an aqueous extensive washing with deionised water. MALDI mass Solution of potassium hydrogensulphate. The phases were Spectrometry showed no detectable level of compound from Separated and the aqueous phase extracted with chloroform. c and d) in the final wash Solution. The combined organic phases were washed with aqueous potassium hydrogensulphate and water and dried over 0456 Incorporation of compounds from c) and d) into the MgSO. After filtration and evaporation the crude product bubbles was confirmed by MALDI-MS as described in was chromatographed (silica, chloroform/methanol 99:1) to example 1 b). give 1.63 g (97%) of white solid. The structure was con firmed by H NMR (500 MHz). EXAMPLE 30 0448 b) Synthesis of Cholesterol B-alaninate Hydrochlo Gas-filled Microbubbles of DSPS Comprising a ride Lipopeptide Containing Chlorambucil for Diagnostic and Therapeutic Applications 0449 A solution of compound from a) (279 mg, 0.500 mmol) in 1 M hydrochloric acid in 1,4-dioxan (5 ml) was 0457. This example is directed at the preparation of Stirred at room temperature for 4 h. The reaction mixture was functionalised microbubbles with non-specific affinity for a concentrated to give a quantitative yield of cholesteryl multiplicity of cell Surface molecules. US 2005/0002865 A1 Jan. 6, 2005 58

0458) a) Synthesis of a Lipopeptide Containing Chloram bucil

O

~s, H NH2

O O O H N N N NH2 H H O O

NH2 HN r O

1\-1 C

Cl

0459. The structure shown above was synthesised on a and product from a) (0.5 mg) in a vial. The mixture was manual nitrogen bubbler Starting with Fmoc protected Rink Sonicated for 5 min and then heated at 80°C. for 5 min (vial Amide MBHA resin (Novabiochem) on a 0.125 mmol scale. was shaken during warming) and cooled. Head space was Standard amino acids were purchased from Novabiochem flushed with perfluorobutane gas and the Vial was Shaken in and palmitic acid from Fluka. Coupling was carried out using standard TBTU/HOBt/DIEA protocol. Chlorambucil a cap mixer for 45 s followed by extensive washing with (Sigma) was coupled through the Side-chain of Lys as a deionised water. MALDI mass spectrometry showed no Symmetrical anhydride using DIC preactivation. detectable level of compound from a) in the final wash Solution. 0460 Simultaneous removal of the peptide from the resin and deprotection of Side-chain protecting groups was carried 0464) Incorporation of chlorambucil containing lipopep out in TFA containing 5% EDT, 5% water and 5% ethyl tide into the bubbles was confirmed by MALDI-MS as methyl Sulphide for 2 h. An aliqout of 10 mg of the crude follows. Ca 50 ul of microbubbles were transferred to a material was purified by preparative liquid chromatography clean vial containing ca 100 ul of 90% methanol. The (Vydac 218TP1022 column) using a gradient of 70 to 100% mixture was sonicated for 30s and analysed by MALDI-MS B over 60 min (A=0.1% TFA/water and B 0.1% TFA/ (ACH-matrix), giving a M+H peak at 1300, expected at acetonitrile) at a flow rate of 10 ml/min. After lyophilisation 1294-and a M+Na peak at 1324, expected 1317. a yield of 30 mg of pure material was obtained (analytical HPLC: gradient 70-100% B over 20 min, A=0.1% TFA/ 0465 c) In Vitro Study of Gas-containing Microbubbles water and B=0.1% of DSPS Doped with a Lipopeptide Containing Chloram bucil for Diagnostic and Therapeutic Applications 0461 TFA/acetonitrile; flow rate 1 ml/min; column Vydac 218TP54; detection UV 214 nm; retention time 26.5 0466. The microbubbles were evaluated using the in vitro min). Further characterisation was carried out using MALDI flow assay described in example 1 c). A gradual accumula mass spectrometry, giving M+H at 1295, expected 1294. tion of the microbubbles on the cells took place which was 0462 b) Preparation of Gas-filled Microbubbles Com dependant on the flow rate. By increasing the flow rate the prising a Lipopeptide Containing Chlorambucil for Diag cells Started to become detached from the coverslip, the nostic and Therapeutic Applications microbubbles were still bound to the cells. Control bubbles not carrying the vector did not adhere to the endothelial cells 0463 A Solution of 1.4% propylene glycol/2.4% glycerol and disappeared from the cells under minimal flow condi (1.0 ml) was added to a mixture of DSPS (Avanti, 4.5 mg) tions. US 2005/0002865 A1 Jan. 6, 2005 59

EXAMPLE 31 0476. The human endothelial cell line ECV 304, derived Gas-filled Microbubbles of DSPS Comprising a from a normal umbilical cord (ATCC CRL-1998) was Lipopeptide Containing Atenolol and a Lipophilic cultures in Nunc culture flasks (chutney 153732) in RPMI Derivative of Captopril for Diagnostic and 1640 medium (Bio Whitaker) to which L-Glutamine 200 Therapeutic Applications mM, Penicillin/Streptomycin (10.000 U/ml and 10.00 mcg/ ml) and 10% Fetal Calf Serum (Hyclone Lot no AFE 5183) 0467 a) Synthesis of a Protected Atenolol Derivative were added. The cells were subcultured following trypsina Suitable for Solid Phase Coupling tion with a split ratio of 1:5 to 1:7 when reaching confluence. 0468. As described in example 25) b) 2 mill. cells from trypsinated confluent cultures were added 0469 b) Synthesis of N-(S)-3-hexadecylthio-2-methyl to a set of 5 centrifuge tubes followed by either control propionylproline microbubbles of DSPS, microbubbles from example 1 or microbubbles of DSPS doped with the endothelial cell 0470 DIEA (188 ul, 1.10 mmol) was added to a solution binding lipopeptide from example 14a) at a concentration of of 1-iodohexadecane (176 mg, 0.500 mmol), captopril (120 2, 4, 6, 8 or 10 mill bubbles per tube. The cells at the bottom mg, 0.550 mmol) and DBU (165ul, 1.10 mmol) in tetrahy of the tubes after centrifugation at 400 g for 5 minutes were drofuran (5 ml). The mixture was heated at 70° C. for 2 hand counted by Coulter counter. It was found that binding of four then concentrated. The residue was poured onto water or more microbubbles to a cell brought about floatation. Saturated with potassium hydrogensulphate and organic Furthermore all cells were floated by the endothelial cell material was extracted into chloroform. The organic phase binding lipopeptide bubbles while around 50% were floated was washed with water and dried (MgSO). The product with microbubbles from example 1). purified by chromatography (silica, CHCl/MeOH/AcOH 85:10:5) and lyophilised to give 105 mg (48%) of white EXAMPLE 33 solid material. The structure was verified by 1H (500 MHz) and 13C (125 MHz) analysis and further characterised by MALDI maSS spectrometry, giving M-H in negative mode Gene Transfer by PFB Gas-filled Microbubbles at m/z 440 as expected. 0477 This example is directed at the preparation of 0471 c) Preparation of Gas-filled Microbubbles of DSPS targeted microbubbles for gene transfer. Comprising a Lipopeptide Containing Atenolol and a Lipo 0478 a) Preparation of DSPS Lipopeptide Bubbles/PFB philic Derivative of Captopril for Diagnostic and Therapeu Gas Coated with Polyl-L-lysine tic Applications 0479. DSPS (4.5 mg) and lipopeptide from 17b) (0.5 mg) 0472. A solution of 1.4% propylene glycol/2.4% glycerol were weighed in two 2-ml vials. To each vial, 0.8 ml (1.0 ml) was added to a mixture of DSPS (Avanti, 4.5 mg), propyleneglycol/glycerol (4%) in water was added. The product from b) (0.5 mg) and c) in a vial. The mixture was Solution was heated at 80 C. for 5 minutes and shaken. The Sonicated for 5 min and then heated at 800 C. for 5 min (vial was shaken during warming) and cooled. Head space was Solution was then cooled to ambient temperature and the flushed with perfluorobutane gas and the Vial was Shaken in headspace flushed with perfluorobutane. The vials were a cap mixer for 45 s followed by extensive washing with Shaken on a Capmix (Espe Capmix, 4450 oscillations/min) deionised water. MALDI mass spectrometry showed no for 45 seconds and put on a roller table for 5 minutes. The detectable level of compound from b)or c) in the final wash content of the Vials were mixed and the Sample washed by Solution. Incorporation of compound b) and c) containing centrifugation at 2000 rpm for 5 minutes. The infranatant lipopeptide into the bubbles was confirmed by MALDI-MS was removed and the same volume of distilled water added. as described in example 1 b). The Washing procedure was repeated once. 0473 d) In Vitro Study of Gas-containing Microbubbles 0480 poly-L-lysine HBr (Sigma, 20.6 mg) was dissolved of DSPS Comprising a Lipopeptide Containing Atenolol and in 2 mL water then an aliquot (0.4 mL) made up to 2 mL a Lipophilic Derivative of Captopril for Diagnostic and water. To 1.2 mL of the diluted poly-L-lysine solution was Therapeutic Applications added 0.12 mL of the DSPS-lipopeptide bubble suspension. Following incubation exceSS polylysine was removed by 0474. The microbubbles were evaluated using the in vitro extensive Washing with water. flow assay described in example 1 c). A gradual accumula tion of the microbubbles on the cells took place which was 0481 b) Transfection of Cells dependant on the flow rate. By increasing the flow rate the 0482 Endothelial cells (ECV 304) were cultured in 6 cells Started to become detached from the coverslip, the well plates to a uniform Subconfluent layer. A transfection microbubbles were still bound to the cells. Control bubbles mixture consisting of 5 ug DNA (an Enhanced Green not carrying the vector did not adhere to the endothelial cells Fluorescent Protein vector from CLONTECH) and 50 ul of and disappeared from the cells under minimal flow condi microbubble suspension from a) in RPMI medium at a final tions. volume of 250 ul was prepared. The mixture was left EXAMPLE 32 Standing for 15 min at room temperature then 1 mL of Floatation of Endothelial Cells by DSPS complete RPMI medium added. The medium was removed Microbubbles Comprising a Multiple-specific from the cell culture dish, and the DNA-microbubble mix Lipopeptide that Binds to the Endothelial Cells ture added to the cells. 0475. This example was carried out to show that the 0483 The cells were incubated in a cell culture incubator invention could also be used for cell Separation. (37° C). US 2005/0002865 A1 Jan. 6, 2005 60

0484) c) Ultrasonic Treatment medium containing DNA-microbubbles was then removed 0485. After 15 minutes incubation, selected wells were by aspiration, and 2 ml complete RPMI medium was added. exposed to continious wave ultrasound of 1 MHz, 0.5 The cells were incubated for 40-70 hours before examina W/cm', for 30 seconds. tion. Most of the medium was then removed, and the cells 0486 d) Incubation and Examination were examined by fluorescence microscopy. The results 0487. The cells were further incubated in the cell culture were compared to the results from control experiments were incubator (37 ° C) for approximately 4% hours. The DNA or DNA-polylysine were added to the cells.

SEQUENCE LISTING

<160> NUMBER OF SEQ ID NOS: 20 <210> SEQ ID NO 1 <211& LENGTH: 4 &212> TYPE PRT <213> ORGANISM: Artificial Sequence &22O > FEATURE <223> OTHER INFORMATION: Description of Artificial Sequence: Heparin sulphate binding peptide

<400 SEQUENCE: 1 Lys Arg Lys Arg 1

<210> SEQ ID NO 2 &2 11s LENGTH 8 &212> TYPE PRT <213> ORGANISM: Artificial Sequence &22O > FEATURE <223> OTHER INFORMATION: Description of Artificial Sequence: Fibronectin peptide

<400 SEQUENCE: 2 Trp Glin Pro Pro Arg Ala Arg Ile 1 5

<210> SEQ ID NO 3 &2 11s LENGTH 13 &212> TYPE PRT <213> ORGANISM: Artificial Sequence &22O > FEATURE <223> OTHER INFORMATION: Description of Artificial Sequence: Lipopeptide consisting of heparin sulphate binding peptide and fibronectin peptide &22O > FEATURE <221 NAME/KEY: MODRES <222> LOCATION: (1) . . (1) <223> OTHER INFORMATION: Dipalmitoyl-lysine

<400 SEQUENCE: 3 Lys Lys Arg Lys Arg Trp Glin Pro Pro Arg Ala Arg Ile 1 5 10

<210> SEQ ID NO 4 <211& LENGTH: 4 &212> TYPE PRT <213> ORGANISM: Artificial Sequence &22O > FEATURE <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic RGDC sequence

<400 SEQUENCE: 4 Arg Gly Asp Cys 1 US 2005/0002865 A1 Jan. 6, 2005 61

-continued

<210 SEQ ID NO 5 <211& LENGTH 24 &212> TYPE PRT <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic fusion peptide comprising a PS binding component and a fibronectin peptide sequence

<400 SEQUENCE: 5 Phe Asn. Phe Arg Lieu Lys Ala Gly Glin Lys Ile Arg Phe Gly Gly Gly 1 5 10 15 Gly Trp Gln Pro Pro Arg Ala Ile 2O

<210> SEQ ID NO 6 &2 11s LENGTH 6 &212> TYPE PRT <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: Description of Artificial Sequence: Biotinylated endothelin-1 peptide &220s FEATURE <221 NAME/KEY: MODRES <222> LOCATION: (1) . . (1) <223> OTHER INFORMATION: Biotin-D-Trp <400> SEQUENCE: 6 Trp Lieu. Asp Ile Ile Trp 1 5

<210 SEQ ID NO 7 &2 11s LENGTH 10 &212> TYPE PRT <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: Description of Artificial Sequence: Biotinylated fibrin-antipolymerant peptide &220s FEATURE <221 NAME/KEY: MODRES <222> LOCATION: (1) . . (1) <223> OTHER INFORMATION: Biotin-Gly &220s FEATURE <221 NAME/KEY: MODRES <222> LOCATION: (10) . . (10) &223> OTHER INFORMATION AMIDATION

<400 SEQUENCE: 7 Gly Pro Arg Pro Pro Glu Arg His Glin Ser 1 5 10

<210 SEQ ID NO 8 &2 11s LENGTH 6 &212> TYPE PRT <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: Description of Artificial Sequence: Lipopeptide &220s FEATURE <221 NAME/KEY: MODRES <222> LOCATION: (5) . . (5) <223> OTHER INFORMATION: Biotinylated-lys &220s FEATURE <221 NAME/KEY: MODRES <222> LOCATION: (1) . . (1) <223> OTHER INFORMATION: Dipalmitoyl-lysine <400 SEQUENCE: 8 US 2005/0002865 A1 Jan. 6, 2005 62

-continued

Lys Trp Llys Lys Lys Gly 1 5

SEQ ID NO 9 LENGTH 25 TYPE DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Description of Artificial Sequence: Biotinylated synthetic oligonucleotide FEATURE: NAME/KEY: misc feature LOCATION: (1) . . (1) OTHER INFORMATION: Biotinylated <400 SEQUENCE: 9 gaaagg tagt ggggtogtgt gcc.gg

SEQ ID NO 10 LENGTH 25 TYPE DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Description of Artificial Sequence: Biotinylated synthetic oligonucleotide FEATURE: NAME/KEY: misc feature LOCATION: (1) . . (1) OTHER INFORMATION: Biotinylated <400 SEQUENCE: 10 ggcgct gatg atgttgttga ttctt

SEQ ID NO 11 LENGTH 5 TYPE PRT ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Description of Artificial Sequence: Lipopeptide containing the RGD sequence and a fluorescein reporter group FEATURE: NAME/KEY: MODRES LOCATION: (1) . . (1) OTHER INFORMATION: Dipalmitoyl-lys FEATURE: NAME/KEY: MODRES LOCATION: (4) ... (4) OTHER INFORMATION: Acetyl-RGD-K-fluorescein side chain

<400 SEQUENCE: 11 Lys Lys Lys Lys Gly 1 5

SEQ ID NO 12 LENGTH 18 TYPE PRT ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Description of Artificial Sequence: Synthetic endothelial cell binding lipopeptide FEATURE: NAME/KEY: MODRES LOCATION: (1) . . (1) OTHER INFORMATION: 2-n-hexadecyl stearyl-lysine FEATURE: NAME/KEY: MODRES LOCATION: (18) . . (18) OTHER INFORMATION AMIDATION US 2005/0002865 A1 Jan. 6, 2005 63

-continued

SEQUENCE: 12 Lys Lieu Ala Lieu Lys Lieu Ala Lieu Lys Ala Lieu Lys Ala Ala Lieu Lys 1 5 10 15

Leu Ala

<210> SEQ ID NO 13 &2 11s LENGTH 5 &212> TYPE PRT <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: Description of Artificial Sequence: Thiol functionalised lipid molecule &220s FEATURE <221 NAME/KEY: MODRES <222> LOCATION: (1) . . (1) <223> OTHER INFORMATION: Dipalmitoyl-lysine &220s FEATURE <221 NAME/KEY: MISC FEATURE <222> LOCATION: (4) ... (4) <223> OTHER INFORMATION: Acp <400 SEQUENCE: 13 Lys Lys Lys Xala Cys 1 5

SEQ ID NO 14 ENGTH 4 TYPE PRT ORGANISM: Artificial Sequence FEATURE OTHER INFORMATION: Description of Artificial Sequence: Synthetic lipopeptide functionalised with captopril FEATURE NAME/KEY: MODRES LOCATION: (1) . . (1) OTHER INFORMATION: Dipalmitoyl-lysine FEATURE NAME/KEY: MODRES LOCATION: (4) . . (4) OTHER INFORMATION AMIDATION FEATURE NAME/KEY: MODRES LOCATION: (4) . . (4) OTHER INFORMATION: Amide-linked via side chain to captopril <400 SEQUENCE: 14 Lys Lys Lys Lys 1

SEQ ID NO 15 ENGTH 13 TYPE PRT ORGANISM: Artificial Sequence FEATURE OTHER INFORMATION: Description of Artificial Sequence: Synthetic lipopeptide functionalised with captopril FEATURE NAME/KEY: MODRES LOCATION: (1) . . (1) OTHER INFORMATION: Dipalmitoyl-lysine FEATURE NAME/KEY: MODRES LOCATION: (4) . . (4) OTHER INFORMATION: Acp FEATURE NAME/KEY: MISC FEATURE LOCATION: (4) . . (4) OTHER INFORMATION: Acp US 2005/0002865 A1 Jan. 6, 2005 64

-continued

&220s FEATURE <221 NAME/KEY: MODRES <222> LOCATION: (13) . . (13) &223> OTHER INFORMATION AMIDATION

<400 SEQUENCE: 15 Lys Lys Lys Xala Ile Arg Arg Val Ala Arg Pro Pro Leu 1 5 10

<210> SEQ ID NO 16 <211& LENGTH: 14 &212> TYPE PRT <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: Description of Artificial Sequence: Lipopeptide comprising an interleukin 1 receptor binding peptide &220s FEATURE <221 NAME/KEY: MODRES <222> LOCATION: (1) . . (1) <223> OTHER INFORMATION: Dipalmitoyl-lysine <400 SEQUENCE: 16 Lys Gly Asp Trp Asp Glin Phe Gly Lieu Trp Arg Gly Ala Ala 1 5 10

<210 SEQ ID NO 17 <211& LENGTH: 12 &212> TYPE PRT <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: Description of Artificial Sequence: Core peptide comprising dabsylated-atherosclerotic plaque binding sequence and RGDS &220s FEATURE <221 NAME/KEY: MODRES <222> LOCATION: (1) . . (1) <223> OTHER INFORMATION: Dabsylated-tyrosine &220s FEATURE <221 NAME/KEY: MODRES <222> LOCATION: (10) . . (10) <223> OTHER INFORMATION: Arg-Gly-Asp-Ser chain liked via NH2 group of lysine

<400 SEQUENCE: 17 Tyr Arg Ala Lieu Val Asp Thr Lieu Lys Lys Gly Cys 1 5 10

<210> SEQ ID NO 18 &2 11s LENGTH 15 &212> TYPE PRT <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: Description of Artificial Sequence: Lipopeptide with an affinity for thrombi &220s FEATURE <221 NAME/KEY: MOD RES <222> LOCATION: (1) . . (1) <223> OTHER INFORMATION: Dipalmitoyl-lysine &220s FEATURE <221 NAME/KEY: MODRES <222> LOCATION: (15) . . (15) &223> OTHER INFORMATION AMIDATION

<400 SEQUENCE: 18 Lys Asn Asp Gly Asp Phe Glu Glu Ile Pro Glu Glu Tyr Lieu Glin 1 5 10 15

<210 SEQ ID NO 19 US 2005/0002865 A1 Jan. 6, 2005

-continued

<211& LENGTH 4 &212> TYPE PRT <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: Description of Artificial Sequence: Lipopeptide functionalised with atenolol &220s FEATURE <221 NAME/KEY: MOD RES <222> LOCATION: (1) . . (1) <223> OTHER INFORMATION: Dipalmitoyl-lysine &220s FEATURE <221 NAME/KEY: MODRES <222> LOCATION: (4) ... (4) &223> OTHER INFORMATION AMIDATION &220s FEATURE <221 NAME/KEY: MODRES <222> LOCATION: (4) ... (4) <223> OTHER INFORMATION: Lysine with side chain linked via amide bond to atenolol

<400 SEQUENCE: 19 Lys Lys Lys Lys 1

<210> SEQ ID NO 20 <211& LENGTH 4 &212> TYPE PRT <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: Description of Artificial Sequence: Lipopeptide containing chlorambucil &220s FEATURE <221 NAME/KEY: MOD RES <222> LOCATION: (1) . . (1) <223> OTHER INFORMATION: Dipalmitoyl-lysine &220s FEATURE <221 NAME/KEY: MODRES <222> LOCATION: (4) ... (4) <223> OTHER INFORMATION: Lysine with side chain linked via amide bond chlorambucil &220s FEATURE <221 NAME/KEY: MODRES <222> LOCATION: (4) ... (4) &223> OTHER INFORMATION AMIDATION

<400 SEQUENCE: 20 Lys Lys Lys Lys 1

1. A targetable diagnostic and/or therapeutically active membrane, a filmogenic protein, a polymer material, a agent comprising a Suspension in an aqueous carrier liquid non-polymeric and non-polymerisable wall-forming mate of a reporter comprising gas-containing or gas-generating rial or a Surfactant. material, Said agent being capable of forming at least two 6. An agent as claimed in claim 5 wherein Said Surfactant types of binding pairs with a target. comprises at least one phospholipid. 2. An agent as claimed in claim 1 wherein the gas 7. An agent as claimed in claim 6 wherein at least 750 of comprises air, nitrogen, oxygen, carbon dioxide, hydrogen, the Said Surfactant material comprises phospholipid mol an inert gas, a Sulphur fluoride, Selenium, hexafluoride, a ecules individually bearing net overall charge. low molecular weight hydrocarbon, a ketone, an ester, a 8. An agent as claimed in claim 7 wherein at least 750 of halogenated low molecular weight hydrocarbon or a mixture the film-forming Surfactant material comprises one or more of any of the foregoing. phospholipids Selected from phosphatidylserines, phosphati 3. An agent as claimed in claim 2 wherein the gas dylglycerols, phosphatidylinositols, phosphatidic acids and comprises a perfluorinated ketone, perfluorinated ether or cardiolipins. perfluorocarbon. 9. An agent as claimed in claim 8 wherein at least 800 of 4. An agent as claimed in claim 2 wherein the gas Said phospholipids comprise phosphatidylserines. comprises Sulphur hexafluoride or a perfluoropropane, per 10. An agent as claimed in claim 1 wherein Said gas fluorobutane or perfluoropentane. containing or gas-generating material is conjugated to at 5. An agent as claimed in claim 1 comprising gas least two vectors or to one vector capable of binding to at microbubbles Stabilised by a coalescence resistant Surface least two binding Sites. US 2005/0002865 A1 Jan. 6, 2005 66

11. An agent as claimed in claim 1 wherein Said gas 25. A combined formulation as claimed in claim 24 containing or gas-generating material is conjugated to one or wherein Said pre-targeting vector comprises a monoclonal more targeting vectors having Specificity for one or more antibody. cellular Surface receptors and further comprises moieties 26. A combined formulation comprising: capable of binding to a receptor System So as to induce a therapeutic response. i) a first administrable composition comprising an agent 12. An agent as claimed in claim 1 wherein the vector or an agent as claimed in claim 1, and vectors are Selected from antibodies, cell adhesion mol ii) a Second administrable composition comprising a ecules, cell adhesion molecule receptors, cytokines, growth Substance capable of displacing or releasing Said agent factors, peptide hormones and pieces thereof; non-bioactive from its target. binders of receptors for cell adhesion molecules, cytokines, 27. A combined formulation comprising: growth factors and peptide hormones, oligonucleotides and modified oligonucleotides, DNA-binding drugs, protease i) a first administrable composition comprising an agent Substrates/inhibitors, molecules generated from combinato as claimed in claim 22, and rial libraries, Small bioactive molecules, and proteins and ii) a Second administrable composition comprising a peptides which bind to cell-Surface proteoglycans. reducing agent capable of reductively cleaving the 13. An agent as claimed in claim 1 wherein the vector or disulphide groups coupling or linking the therapeutic vectors have affinity for targets at a level Such that the agent compound and reporter in the agent of Said first admin interacts with but does not fixedly bind to Said targets. istrable composition. 14. An agent as claimed in claim 13 wherein the Vector or 28. A process for the preparation of a targetable diagnostic vectors are Selected from ligands for cell adhesion proteins and/or therapeutically active agent as defined in claim 1 and cell adhesion proteins which have corresponding ligands which comprises coupling or linking at least one vector to a on endothelial cell Surfaces. reporter comprising gas-containing or gas-generating mate 15. An agent as claimed in claim 1 wherein the vector or rial: Such that Said agent is capable of forming at least two vectors are sited Such that they are not readily exposed to the types of binding pairs with a target. target. 29. A proceSS as claimed in claim 28 wherein a therapeutic 16. An agent as claimed in claim 1 wherein the vector or compound is also combined with the reporter. vectors are coupled or linked to the reporter by means of 30. (canceled). avidin-biotin and/or Streptavidin-biotin interactions. 31. A method of generating enhanced images of a human 17. An agent as claimed in claim 1 wherein the vector or or non-human animal body which comprises administering vectors may be covalently or non-covalently coupled or to said body an agent as claimed in claim 1 and generating linked to the reporter. an ultrasound, magnetic resonance, X-ray, radiographic or 18. An agent as claimed in claim 1 wherein the vector is light image of at least a part of Said body. coupled or linked to the reporter by means of electroStatic 32. A method as claimed in claim 31 which comprises the charge interaction. Steps: 19. An agent as claimed in claim 1 which further contains moieties which are radioactive or are effective as X-ray i) administering to said body a pre-targeting vector having contrast agents, light imaging probes or Spin labels. affinity for a Selected target; and thereafter 20. An agent as claimed in claim 1 further comprising a ii) administering an agent, Said agent comprising a vector therapeutic compound. having affinity for Said pre-targeting vector. 21. An agent as claimed in claim 20 wherein Said thera 33. A method as claimed in claim 32 wherein said peutic compound is an antineoplastic agent, blood product, pre-targeting vector comprises a monoclonal antibody. biological response modifier, antifungal agent, hormone or 34. A method as claimed in claim 31 which comprises the hormone analogue, Vitamin, enzyme, antiallergic agent, tis Steps: Sue factor inhibitor, platelet inhibitor, coagulation protein target inhibitor, fibrin formation inhibitor, fibrinolysis pro i) administering to said body an agent; and thereafter moter, antiangiogenic, circulatory drug, metabolic potentia ii) administering a Substance capable of displacing or tor, antitubercular, antiviral, Vasodilator, antibiotic, antiin releasing Said agent from its target. flammatory, antiprotozoan, antirheumatic, narcotic, opiate, 35. A method as claimed in claim 31 wherein said agent cardiac glycoside, neuromuscular blocker, Sedative, local further comprises a therapeutic compound. anaesthetic, general anaesthetic or genetic material. 36. A method as claimed in claim 35 wherein said 22. An agent as claimed in claim 20 wherein Said thera therapeutic compound is covalently coupled or linked to the peutic compound is covalently coupled or linked to the reporter through disulphide groups, and a composition com reporter through disulphide groups. prising a reducing agent capable of reductively cleaving Said 23. An agent as claimed in claim 20 wherein a lipophilic disulphide groups is Subsequently administered. or lipophilically-derivatised therapeutic compound is linked 37. A method for in vitro investigation of targeting by an to the reporter through hydrophobic interactions. agent as defined in claim 1 wherein cells expressing a target 24. A combined formulation comprising: are fixedly positioned in a flow chamber, a Suspension of Said agent in a carrier liquid is passed through Said chamber, i) a first administrable composition comprising a pre and binding of Said agent to Said cells is examined. targeting vector having affinity for a Selected target; and 38. A method as claimed in claim 37 wherein the flow rate ii) a Second administrable composition comprising an of carrier liquid is controlled to Simulate shear rates encoun agent as claimed in any of the preceding claims, Said tered in vivo. agent comprising a vector having affinity for Said pre-targeting Vector.