USOO6264,917B1 (12) United States Patent (10) Patent No.: US 6,264,917 B1 Klaveness et al. (45) Date of Patent: Jul. 24, 2001

(54) TARGETED ULTRASOUND CONTRAST 5,733,572 3/1998 Unger et al.. AGENTS 5,780,010 7/1998 Lanza et al. . 5,846,517 12/1998 Unger ...... 424/9.52 (75) Inventors: Jo Klaveness; Pál Rongved; Dagfinn 5,849,727 12/1998 Porter et al...... 514/156 Lovhaug, all of Oslo (NO) 5,910,300 6/1999 Tournier et al...... 424/9.34 FOREIGN PATENT DOCUMENTS (73) Assignee: Nycomed Imaging AS, Oslo (NO) 2 145 SOS 4/1994 (CA). (*) Notice: Subject to any disclaimer, the term of this 19 626 530 1/1998 (DE). patent is extended or adjusted under 35 O 727 225 8/1996 (EP). U.S.C. 154(b) by 0 days. WO91/15244 10/1991 (WO). WO 93/20802 10/1993 (WO). WO 94/07539 4/1994 (WO). (21) Appl. No.: 08/958,993 WO 94/28873 12/1994 (WO). WO 94/28874 12/1994 (WO). (22) Filed: Oct. 28, 1997 WO95/03356 2/1995 (WO). WO95/03357 2/1995 (WO). Related U.S. Application Data WO95/07072 3/1995 (WO). (60) Provisional application No. 60/049.264, filed on Jun. 7, WO95/15118 6/1995 (WO). 1997, provisional application No. 60/049,265, filed on Jun. WO 96/39149 12/1996 (WO). 7, 1997, and provisional application No. 60/049.268, filed WO 96/40277 12/1996 (WO). on Jun. 7, 1997. WO 96/40285 12/1996 (WO). (30) Foreign Application Priority Data WO 96/41647 12/1996 (WO). WO 97/23855 7/1997 (WO). Oct. 28, 1996 (GB) ...... 9622366 WO 97/33474 9/1997 (WO). Oct. 28, 1996 (GB) ...... 9622367 WO 97/41898 11/1997 (WO). Oct. 28, 1996 (GB) ...... 9622368 WO 98/OO172 1/1998 (WO). Jan. 15, 1997 (GB) 97OO699 WO 98/04293 2/1998 (WO). Apr. 24, 1997 (GB) 9708265 WO 98/19705 5/1998 (WO). Jun. 6, 1997 (GB) ...... 9711842 WO 98/20856 5/1998 (WO). Jun. 6, 1997 (GB) ...... 9711846 WO 98/42384 10/1998 (WO). (51) Int. Cl." ...... A61B 8/00; A61B 8/14 OTHER PUBLICATIONS (52) U.S. Cl...... 424/9.52; 600/458 U.S. application No. 08/640,464, Unger, filed May 1, 1996. (58) Field of Search ...... 424/9.52, 9.51, Medline database extract No. XP-002063692, 1997. 424/9.5, 450, 489; 530/300, 326, 327, 328, Biosis database extract No. XP-002063693, 1997. 329, 330; 600/441, 458 Medline database extract No. KP-00206411, 1997. (56) References Cited Muzykantov et al., J. Nuclear Medicine, 35(8): 1358–1365 (1994). U.S. PATENT DOCUMENTS Klibanov et al., Acta Radiologica, 38(Supp. 412): 113-120 4,927,916 5/1990 Matsueda et al. . ... 530/387 (1997). 5,013,556 * 5/1991 Woodle et al...... 424/450 5,154,924 10/1992 Friden ...... 424/85.91 * cited by examiner 5,198.424 3/1993 McEver ...... 514/13 Primary Examiner Michael G. Hartley 5,356,633 * 10/1994 Woodle et al. ... 424/450 5,498,421 * 3/1996 Grinstaff et al...... 424/450 (74) Attorney, Agent, or Firm-Bacon & Thomas 5,505,932 4/1996 Grinstaff et al...... 424/9.3 (57) ABSTRACT 5,534.241 7/1996 Torchillin et al. . 5,612,057 3/1997 Lanza et al. . Targetable diagnostic and/or therapeutically active agents, 5,632,986 5/1997 Tait et al.. e.g. ultrasound contrast agents, having reporters comprising 5,643,553 7/1997 Schneider et al. . gas-filled microbubbles stabilised by monolayers of film 5,650,156 7/1997 Grinstaff et al. . forming Surfactants, the reporter being coupled or linked to 5,656.211 8/1997 Unger et al.. at least one vector. 5,665,383 9/1997 Grinstaff et al. . 5,690.907 11/1997 Lanza et al.. 5,716,594 2/1998 Elmaleh et al. . 17 Claims, 2 Drawing Sheets U.S. Patent Jul. 24, 2001 Sheet 1 of 2 US 6,264,917 B1

256 Gm: 15.62 CW: 34.39 144-1023) 18430 (92.2/)

s U.S. Patent Jul. 24, 2001 Sheet 2 of 2 US 6,264,917 B1

2561 GGm; 13.84 C W: 28.66 117-1023) 18880 (94.4/)

M1 US 6,264,917 B1 1 2 TARGETED ULTRASOUND CONTRAST There is a limited body of prior art relating to targeted AGENTS ultrasound contrast agents. Thus, for example, U.S. Pat. No. 5,531,980 is directed to systems in which the reporter This application claims benefit under 35 U.S.C. 119(e) of comprises an aqueous Suspension of air or gas microbubbles provisional applications Serial No. 60/049,264 and 60/049, Stabilised by one or more film-forming Surfactants present at 265 both filed Jun. 7, 1997; and Ser. No. 60/049,268 filed least partially in lamellar or laminar form, said Surfactant(s) Jun. 7, 1997. being bound to one or more vectors comprising “bioactive This invention relates to diagnostic and/or therapeuti Species designed for Specific targeting purposes'. It is Stated cally active agents, more particularly to diagnostic and/or that the microbubbles are not directly encapsulated by Surfactant material but rather that this is incorporated in therapeutically active agents incorporating moieties which liquid-filled liposomes which stabilise the microbubbles. It interact with or have affinity for sites and/or structures will be appreciated that lamellar or laminar Surfactant mate within the body So that diagnostic imaging and/or therapy of rial Such as phospholipids present in Such liposomes will particular locations within the body may be enhanced. Of inevitably be present in the form of one or more lipid particular interest are diagnostic agents for use in ultrasound bilayers with the lipophilic tails “back-to-back” and the imaging, which are hereinafter referred to as targeted ultra 15 hydrophilic heads both inside and outside (see e.g. Sound contrast agents. Schneider, M. on "Liposomes as drug carriers: 10 years of It is well known that ultrasound imaging comprises a research” in Drug targeting, Nyon, Switzerland, Oct. 3-5, potentially valuable diagnostic tool, for example in Studies 1984, Buri, P. and Gumma, A. (Ed), Elsevier, Amsterdam of the vascular System, particularly in cardiography, and of 1984). tissue microvasculature. A variety of contrast agents has EP-A-0727225 describes targeted ultrasound contrast been proposed to enhance the acoustic images So obtained, agents in which the reporter comprises a chemical having a including Suspensions of Solid particles, emulsified liquid Sufficient vapour pressure Such that a proportion of it is a gas droplets, gas bubbles and encapsulated gases or liquids. It is at the body temperature of the subject. This chemical is generally accepted that low density contrast agents which asSociated with a Surfactant or albumin carrier which are easily compressible are particularly efficient in terms of 25 includes a protein-, peptide- or carbohydrate-based cell the acoustic backScatter they generate, and considerable adhesion molecule ligand as vector. The reporter moieties in interest has therefore been shown in the preparation of Such contrast agents correspond to the phase shift colloid gas-containing and gas-generating Systems. systems described in WO-A-9416739; it is now recognised Gas-containing contrast media are also known to be that administration of Such phase shift colloids may lead to effective in magnetic resonance (MR) imaging, e.g. as generation of microbubbles which grow uncontrollably, susceptibility contrast agents which will act to reduce MR possibly to the extent where they cause potentially danger Signal intensity. Oxygen-containing contrast media also rep ouS embolisation of, for example, the myocardial vascula resent potentially useful paramagnetic MR contrast agents. ture and brain (see e.g. Schwarz, Advances in Echo-Contrast Furthermore, in the field of X-ray imaging it has been 1994(3)], pp. 48–49). observed that gases Such as carbon dioxide may be used as 35 WO-A-9320802 proposes that tissue-specific ultrasonic negative oral contrast agents or intravascular contrast image enhancement may be achieved using acoustically agents. reflective oligolamellar liposomes conjugated to tissue The use of radioactive gases, e.g. radioactive isotopes of Specific ligands Such as antibodies, peptides, lectins etc. The inert gases Such as Xenon, has also been proposed in liposomes are deliberately chosen to be devoid of gas and So Scintigraphy, for example for blood pool imaging. 40 will not have the advantageous echogenic properties of Targeted ultrasound contrast agents may be regarded as gas-based ultrasound contrast agents. Further references to comprising (i) a reporter moiety capable of interacting with this technology, e.g. in targeting to fibrin, thrombi and ultrasound irradiation to generate a detectable signal; (ii) one atherosclerotic areas are found in publications by or more vectors having affinity for particular target Sites Alkanonyuksel, H. et al. in J. Pharm. Sci. (1996) 85(5), and/or structures within the body, e.g. for Specific cells or 45 486-490, J. Am. Coll. Cardiol. (1996)27(2) Suppl A, 298A; areas of pathology; and (iii) one or more linkers connecting and Circulation, 68 Sci. Sessions, Anaheim Nov. 13-16, said reporter and vector(s), in the event that these are not 1995. directly joined. There is also a number of publications concerning ultra The molecules and/or Structure to which the agent is Sound contrast agents which refer in passing to possible use intended to bind will hereinafter be referred to as the target. 50 of monoclonal antibodies as vectors without giving Signifi In order to obtain specific imaging of or a therapeutic effect cant practical detail and/or to reporters comprising materials at a Selected region/structure in the body the target must be which may be taken up by the reticuloendothelial System present and available in this region/structure. Ideally it will and thereby permit image enhancement of organs Such as the be expressed only in the region of interest, but usually will liver-see, for example WO-A-9300933, WO-A-94.01140, also be present at other locations in the body, creating 55 WO-A-9408.627, WO-A-9428874, U.S. Pat. No. 5,088,499, possible background problems. The target may either be a U.S. Pat. No. 5,348,016 and U.S. Pat. No. 5,469,854. defined molecular species (i.e. a target molecule) or an The present invention is based on the finding that gas unknown molecule or more complex structure (i.e. a target filled microbubbles stabilised by monolayers of film Structure) which is present in the area to be imaged and/or forming Surfactant material are particularly useful reporters treated, and is able to bind Specifically or Selectively to a 60 in targeted diagnostic and/or therapeutic agents. Thus, for given vector molecule. example, the flexibility and deformability of such thin The vector is attached or linked to the reporter moiety in monolayer membranes Substantially enhances the echoge order to bind these moieties to the region/structure to be nicity of Such reporters relative to liposome Systems con imaged and/or treated. The vector may bind Specifically to a taining lipid bilayerS or multiples of Such bilayers. This may chosen target, or it may bind only Selectively, having affinty 65 permit the use of very low doses of the reporter material to also for a limited number of other molecules/structures, achieve high ultrasound contrast efficacy, with consequent again creating possible background problems. safety benefits. US 6,264,917 B1 3 4 Thus according to one aspect of the present invention FIG. 2: Flow cytometry data-comparison with negative there is provided a targetable diagnostic and/or therapeuti control bubbles (left curve). 98% of the bubbles were cally active agent, e.g. an ultrasound contrast agent, com calculated to be fluorescent. prising a Suspension in an aqueous carrier liquid, e.g. an Any biocompatible gas may be present in the reporter, the injectable carrier liquid, of a reporter comprising gas-filled term "gas' as used herein including any Substances microbubbles stabilised by monolayers of film-forming Sur (including mixtures) Substantially or completely in gaseous factant material, Said agent further comprising at least one (including vapour) form at the normal human body tem VectOr. perature of 37 C. The gas may thus, for example, comprise The term “monolayer” is used herein to denote that the air; nitrogen, OXygen; carbon dioxide, hydrogen; an inert gas amphiphilic Surfactant moieties form monolayer films or Such as helium, argon, Xenon or krypton, a Sulphur fluoride membranes Similar to So-called Langmuir-Blodgett films at Such as Sulphur hexafluoride, disulphur decafluoride or the gas-liquid interfaces, with the lipophilic parts of the trifluoromethylsulphur pentafluoride, Selenium hexafluo amphiphiles aligning towards the gas phase and the hydro ride; an optionally halogenated Silane Such as methylsilane philic parts interacting with the water phase. or dimethylsilane; a low molecular weight hydrocarbon (e.g. As indicated in WO-A-9729783, it is believed that elec 15 containing up to 7 carbon atoms), for example an alkane troStatic repulsion between charged phospholipid mem Such as methane, ethane, a propane, a butane or a pentane, branes encourages the formation of Stable and Stabilising a cycloalkane Such as cyclopropane, cyclobutane or monolayers at microbubble-carrier liquid interfaces. The cyclopentane, an alkene Such as ethylene, propene, propa flexibility and deformability of such thin membranes are diene or a butene, or an alkyne Such as acetylene or propyne; believed to enhance the echogenicity of products according an ether Such as dimethyl ether; a ketone; an ester, a to the invention disclosed therein relative to gas-filled lipo halogenated low molecular weight hydrocarbon (e.g. con Somes comprising one or more lipid bilayers. The amount of taining up to 7 carbon atoms); or a mixture of any of the phospholipid used to Stabilise Such microbubble-containing foregoing. Advantageously at least Some of the halogen aqueous Suspensions may be as low as that necessary for atoms in halogenated gases are fluorine atoms; thus biocom formation of Single monolayers of Surfactant around each 25 patible halogenated hydrocarbon gases may, for example, be gas microbubble, the resulting film-like Structure Stabilising Selected from bromo chloro difluorome thane, the microbubbles against collapse or coalescence. chlorodifluoromethane, dichlorodifluoromethane, Microbubbles with a liposome-like surfactant bilayer are bromotrifluoromethane, chlorotrifluoromethane, believed not to be obtained when such low phospholipid chloropentafluoroethane, dichlorote trafluoroethane, concentrations are used. chlorotrifluoroethylene, fluoroethylene, ethylfluoride, 1,1- One advantageous embodiment of the invention is based difluoroethane and perfluorocarbons, e.g. perfluoroalkanes on the additional finding that limited adhesion to targets is Such as perfluorome thane, perfluoroethane, a highly useful property of diagnostic and/or therapeutically perfluoropropanes, perfluorobutanes (e.g. perfluoro-n- active agents, which property may be achieved using vectors butane, optionally in admixture with other isomerS Such as giving temporary retention rather than fixed adhesion to a 35 perfluoro-iso-butane), perfluoropentanes, perfluorohexanes target. Thus Such agents, rather than being fixedly retained and perfluoroheptane S; perfluoroalkenes Such as at Specific Sites, may for example effectively exhibit a form perfluoropropene, perfluorobutenes (e.g. perfluorobut-2- of retarded flow along the vascular endothelium by virtue of ene) and perfluorobutadiene; perfluoroalkynes Such as their transient interactions with endothelial cells. Such perfluorobut-2-yne; and perfluorocycloalkanes Such as agents may thus become concentrated on the walls of blood 40 perfluorocyclobutane, perfluoromethylcyclobutane, vessels, in the case of ultrasound contrast agents providing perfluoro dimethylcyclobutane S, enhanced echogenicity thereof relative to the bulk of the perfluorotrimethylcyclobutanes, perfluorocyclopentane, bloodstream, which is devoid of anatomical features. They perfluoro methylcyclope ntane, therefore may permit enhanced imaging of the capillary perfluorodimethylcyclopentanes, perfluorocyclohexane, System, including the microvasculature, and So may facili 45 perfluoromethylcyclohexane and perfluorocycloheptane. tate distinction between normal and inadequately perfused Other halogenated gases include methyl chloride, fluori tissue, e.g. in the heart, and may also be useful in Visualising nated (e.g. perfluorinated) ketones Such as perfluoroacetone Structures Such as Kupffer cells, thrombi and atherosclerotic and fluorinated (e.g. perfluorinated) etherS Such as perfluo lesions or for visualising neo-vascularised and inflamed rodiethyl ether. The use of perfluorinated gases, for example tissue areas. The present invention is particularly Suited to 50 Sulphur hexafluoride and perfluorocarbons Such as imaging changes which occur in normal blood vessels perfluoropropane, perfluorobutanes and perfluoropentanes, Situated in areas of tissue necrosis. may be particularly advantageous in View of the recognised In a further embodiment of the present invention, one or high stability in the bloodstream of microbubbles containing more vectors may be attached to or included within the Such gases. reporter in a manner Such that the vectors are not readily 55 The gas may comprise a Substance Such as butane, exposed to the target or target receptors. Increased tissue cyclobutane, n-pentane, is opentane, neopentane, Specificity may therefore be achieved by applying an addi cyclopentane, perfluoropentane, perfluorocyclopentane, per tional process to expose the vectors, for example by expos fluorohexane or a mixture containing one or more Such gases ing the agent after administration to external ultrasound So which is liquid at handling or processing temperatures but as to modify the diffusibility of the moieties containing the 60 gaseous at body temperature, e.g. as described in the afore VectOrS. mentioned WO-A-9416739, since the film-forming surfac tant monolayers in reporter units according to the invention BRIEF DESCRIPTION OF THE FIGURES may Stabilise the resulting microbubbles against uncontrol FIG. 1: Flow cytometric comparison of negative control lable growth. microbubbles of DSPS (left curve) with bubbles conjugated 65 In principle, any appropriate film-forming Surfactant may with CD71 FITC-labelled anti-transferrin antibody (filled be employed to form the gas-encapsulating monolayers, curve, right) showing that 92% of the population fluoresce. including non-polymeric and non-polymerisable wall US 6,264,917 B1 S 6 forming Surfactant materials, e.g. as described in WO-A- Phosphatidylserines represent particularly preferred phos 9521631; polymer Surfactant material, e.g. as described in pholipids of use in agents according to the invention and WO-A-9506518; and phospholipids, e.g. as described in preferably constitute a Substantial part, e.g. at least 80% of WO-A-9211873, WO-A-9217212, WO-A-9222247, WO-A- the phospholipid content thereof, for example 85-92%. 9428780, WO-A-95.03835 or WO-A-9729783. Advanta While we do not wish to be bound by theoretical geously 75%, preferably substantially all, of the film considerations, it may be that ionic bridging between the forming Surfactant present in agents according to the carboxyl and amino groups of adjacent Serine moieties invention is incorporated into monolayers at the gas-liquid contributes to the stability of such reporter systems. Pre interfaces. ferred phosphatidylserines include Saturated (e.g. hydroge Representative examples of useful phospholipids include nated or synthetic) natural phosphatidylserine and Synthetic lecithins (i.e. phosphatidylcholines), for example natural distearoylphosphatidylserine, dipalmitoylphosphati lecithins Such as egg yolk lecithin or Soya bean lecithin and Synthetic or SemiSynthetic lecithin S. Such as dylserine and diarachidoylphosphatidylserine. dimyristoylphosphatidylcholine, dipalmitoylphosphatidyl Other potentially useful lipids include phosphatidyletha choline or distearoylphosphatidylcholine; phosphatidic nolamines optionally admixed with one or more lipids Such acids; phosphatidylethanolamines, phosphatidylserines, 15 as Stearic acid, palmitic acid, Stearylamine, palmitylamine, phosphatidylglycerols, phosphatidylinositols, cardiolipins, cholesterol, bisalkylglycerols, Sphingoglycolipids, Synthetic Sphingomyelins, fluorinated analogues of any of the fore lipids such as N,N-dimethyl-N-octade cyl-1- going, mixtures of any of the foregoing and mixtures with octadecanammonium chloride or bromide (DODAC, other lipids Such as cholesterol. DODAB), and/or maleic acid bisalkylesters. It has been found that the use of phospholipids predomi Additional exemplary lipids which may be used to pre nantly (e.g. at least 75%) comprising molecules individually pare gas-containing contrast agents include fatty acids, bearing net overall charge may be particularly Stearic acid, palmitic acid, 2-n-hexadecylstearic acid, oleic advantageous, especially when used as essentially the Sole acid and other acid-containing lipid structures. Such lipid amphiphilic component of the reporter, and may convey Structures may be coupled by amide bond formation to valuable benefits in terms of parameterS Such as product 25 stability and acoustic properties. Without wishing to be amino acids containing one or more amino groups; the bound by theoretical considerations, it is believed that resulting lipid-modified amino acids (e.g. dipalmitoyllysine electroStatic repulsion between charged phospholipid mem or distearoyl-2,3-diaminopropionic acid) may be useful pre branes may encourage the formation of Stable monolayers at cursors for the attachment of functionalised Spacer elements the gas-liquid interfaces, as noted above, the flexibility and having coupling sites for conjugation of one or more vector deformability of such thin membranes will enhance the molecules. echogenicity of reporters used in accordance with the inven Further useful Stabilisers include lipopeptides comprising tion relative to gas-filled liposomes comprising one or more a lipid attached to a peptide linker portion which is Suitably lipid bilayers. functionalised for coupling to one or more vector molecules. The use of charged phospholipids may also provide 35 A particular preference is the inclusion of a positively reporters with advantageous properties regarding, for charged peptide linker element (e.g. comprising two or more example, Stability, dispersibility and resistance to coales lysine residues) capable of anchoring through electrostatic cence without recourse to additives Such as further Surfac interaction with reporter microbubbles stabilised by nega tants and/or Viscosity enhancers, thereby ensuring that the tively charged phospholipid or other Surfactant membranes. number of components administered to the body of a Subject 40 Another embodiment of the invention comprises func upon injection of the contrast agents is kept to a minimum. tionalised microbubbles carrying one or more reactive Thus, for example, the charged Surfaces of the microbubbles groups for non-Specific reaction with receptor molecules may minimise or prevent their aggregation as a result of located on cell Surfaces. Microbubbles comprising a thiol electroStatic repulsion. moiety, for example, may bind to cell Surface receptors via Desirably at least 75%, preferably substantially all of 45 disulphide eXchange reactions. The reversible nature of Such phospholipid material used in reporters in agents of the reactions means that microbubble flow may be controlled by invention consists of molecules bearing a net Overall charge altering the redox environment. Similarly, functionalised under conditions of preparation and/or use, which charge microbubbles with membranes comprising activated esters may be positive or, more preferably, negative. Representa Such as N-hydroxySuccinimide esters may be used to react tive positively charged phospholipids include esters of phos 50 with amino groups found on a multiplicity of cell Surface phatidic acids Such as dipalmitoylphosphatidic acid or dis molecules. tearoylphosphatidic acid with aminoalcohols Such as Previously proposed microbubble-containing contrast hydroxyethylethylenediamine. Examples of negatively agents based on phospholipids, for example as described in charged phospholipids include naturally occurring (e.g. Soya WO-A-9409829, are typically prepared by contacting pow bean or egg yolk derived), Semisynthetic (e.g. partially or 55 dered Surfactant, e.g. freeze-dried preformed liposomes or fully hydrogenated) and Synthetic phosphatidylserines, freeze-dried or Spray-dried phospholipid Solutions, with air phosphatidylglycerols, phosphatidylinositols, phosphatidic or other gas and then with aqueous carrier, agitating to acids and cardiolipins. The fatty acyl groups of Such phos generate a microbubble Suspension which must then be pholipids will typically each contain about 14–22 carbon administered shortly after its preparation. Such processes, atoms, for example as in palmitoyland Stearoyl groups. LySo 60 however, Suffer the disadvantages that Substantial agitational forms of Such charged phospholipids are also useful in energy must be imparted to generate the required dispersion accordance with the invention, the term “lySo' denoting and that the size and size distribution of the microbubbles phospholipids containing only one fatty acyl group, this are dependent on the amount of energy applied and So preferably being ester-linked to the 1-position carbon atom cannot in practice be controlled. of the glyceryl moiety. Such lySo forms of charged phos 65 The reporters or agents according to the present invention, pholipids may advantageously be used in admixture with on the other hand, may advantageously be prepared by charged phospholipids containing two fatty acyl groups. generating a gas microbubble dispersion in an appropriate US 6,264,917 B1 7 8 Surfactant (e.g. phospholipid)-containing aqueous medium, carboxyl or amino which permit ready linking of Vectors, if which may if desired previously have been autoclaved or desired by way of linking units. It should be noted that other otherwise Sterilised, and then, preferably after washing functional groups may also be incorporated into Such Sys and/or size fractionation of the thus-formed microbubbles, tems by mixing a lipid containing a desired functional group Subjecting the dispersion to lyophilisation, e.g. in the pres with the film-forming Surfactant prior to microbubble gen ence of one or more cryoprotectants/lyoprotectants, to yield eration. a dried product which is readily reconstitutable in water/ aqueous Solutions to generate consistently reproducible It is generally unnecessary to incorporate additives Such microbubble dispersions. This process is described in as emulsifying agents and/or Viscosity enhancerS Such as are greater detail in WO-A-9729783, the contents of which are commonly employed in many existing contrast agent for incorporated herein by reference; the ability to remove mulations into agents of the invention. AS noted above, this bubbles of unwanted size and exceSS Surfactant material is of advantage in keeping to a minimum the number of render this process of Substantial advantage over processes components administered to the body of a Subject and Such as those described in the aforementioned WO-A- ensuring that the Viscosity of the agents is as low as possible. 9409829 and in prior art such as WO-A-9608234 (where Since preparation of the agents typically involves a freeze bubbles are generated on Site prior to injection by Shaking a 15 drying Step as discussed above, it may however be advan Suspension of different phospholipids and Viscosity enhanc tageous to include a cryoprotectant/lyoprotectant or bulking erS Such as propylene glycol and glycerol). agent, for example an alcohol, e.g. an aliphatic alcohol Such The above-described process may be used to generate as t-butanol; a polyol Such as glycerol, a carbohydrate, e.g. reporter microbubbles with a very narrow size distribution, a Sugar Such as Sucrose, mannitol, trehalose or a e.g. Such that over 90% (e.g. at least 95%, preferably at least cyclodextrin, or a polysaccharide Such as dextran; or a 98%) of the microbubbles have volume mean diameter in polyglycol Such as polyethylene glycol. The use of physi the range 1-7 um and less than 5% (e.g. not more than 3%, ologically well-tolerated SugarS Such as Sucrose is preferred. preferably not more than 2%) of the microbubbles have Lyophilised dried products prepared as described above Volume mean diameter above 7 um. The Washing Step may are especially readily reconstitutable in water, requiring only be used to ensure that the reporter is substantially free of 25 minimal agitation Such as may, for example, be provided by unwanted components Such as exceSS lipids or Viscosity gentle hand-shaking for a few Seconds. The size of the enhancers. Agents containing reporters prepared in this way microbubbles So generated is consistently reproducible and may exhibit the following advantages over prior art contrast is independent of the amount of agitational energy applied, agent materials: in practice being determined by the size of the microbubbles Echogenicity per dose may be greatly enhanced since formed in the initial microbubble dispersion, Surprisingly Substantially all of the Surfactant material participate in this size parameter is Substantially maintained in the lyo stabilisation of the microbubbles as monolayers. In vivo philised and reconstituted product. Thus, Since the Size of the ultrasound tests in dogs have shown that ultrasound contrast microbubbles in the initial dispersion may readily be con agents prepared as above may produce an increase in trolled by process parameterS Such as the method, Speed and backScattered signal intensity from the myocardium of 15 35 duration of agitation, the final microbubble size may readily dB following intravenous injection of doses as low as 0.1 ul be controlled. microbubbles/kg body weight. The lyophilised dried products have also proved to be Safety in Vivo is improved for the same reasons, Since Storage Stable for at least Several months under ambient Such agents may, for example, be administered in doses Such 40 conditions. The microbubble dispersions generated upon that the amount of phospholipid injected is as low as 0.1-10 reconstitution in water are stable for at least 8 hours, tug/kg body weight, e.g. 1–5 ug/kg. The use of Such low permitting considerable flexibility as to when the dried levels of Surfactant may clearly be of Substantial advantage product is reconstituted prior to injection. in minimising possible toxic side effects. The high efficacy of these preferred reporters may make The high efficacy/dose ratio is also particularly advanta 45 it possible to use smaller bubbles than usual while still geous in targeting applications, Since it is generally under generating ultrasound contrast effects Significantly above the stood that rather low amounts of reporter will accumulate at minimum detection levels of current ultrasound imaging Sites of interest when using products comprising vectors equipment. Such Smaller bubbles have potential advantages having affinity for Such sites. These preferred reporters Such as reduced clogging of vessels, longer circulation according to the invention may therefore considerably 50 times, greater ability to reach targets, and lower accumula improve contrast at Sites of interest compared to known tion in lungs or other non-target organs, and their use and targetable ultrasound contrast agents. Their high efficacy agents containing them constitute further features of the may effectively make it possible to “See' Single invention. microbubbles using ultrasound, giving a Sensitivity close to It may also be possible to use such smaller bubbles to or potentially even higher than that of Scintigraphy, which 55 exploit the enhanced ultrasound contrast effects of bubble currently is probably the most useful technique in targeting, clusters. It is known from theory that the ultrasound contrast although the resolution in Scintigraphic pictures is not effect of a specific number of bubbles with total volume V impressive. in a dilute dispersion increaseS when the bubbles aggregate A particular advantage of phosphatidylserine-based to form a larger gas phase with the same total Volume V. It agents is their biocompatibility; thus no acute toxic effects 60 may therefore be possible to use small bubbles which give Such as changes in blood preSSure or heart rate have been Substantially no ultrasound contrast until they are clustered observed in animal tests on dogs injected with intravenous (as may occur in target areas in preference to non-target sites boluses of phosphatidylserine-based contrast agents pre having low densities of target molecules). Small bubbles pared as described above at doses of up to ten times a normal may also be designed to fuse, e.g. through interbubble imaging dose. 65 binding promoted by interaction with the target, So as to The use of charged phospholipids may also be of advan enhance contrast in target areas. Interbubble crosslinking tage in that they will contain functional groupS Such as and consequent clustering may also be effected if the US 6,264,917 B1 9 10 reporter, in addition to carrying a vector leading to retention ionic bonds, or may be physically mixed into the Stabilising at Specific Sites, has unreacted linker moieties capable of material, particularly if the drug has similar polarity or reaction with functional groups on other bubbles. Solubility to the membrane material, So as to prevent it from Within the context of the present invention, the reporter leaking out of the product before it is intended to act in the unit will usually remain attached to the vectors. However, in body. The release of the drug may be initiated merely by one type of targeting procedure, Sometimes called “pre wetting contact with blood following administration or as a targeting, the vector (often a monoclonal antibody) is consequence of other internal or external influences, e.g. administered alone; Subsequently the reporter is dissolution processes catalyzed by enzymes or the use of of administered, coupled to a moiety which is capable of ultrasound. The destruction of gas-containing microparticles Specifically binding the pre-targeting vector molecule (when using external ultrasound is a well known phenomenon in the pre-targeting vector is an antibody, the reporter may be respect of ultrasound contrast agents, e.g. as described in coupled to an immunoglobulin-binding molecule, Such as WO-A-9325241; the rate of drug release may be varied protein A or an anti-immunoglobulin antibody). The advan depending on the type of therapeutic application, using a tage of this protocol is that time may be allowed for Specific amount of ultrasound energy from the transducer. elimination of the vector molecules that do not bind their 15 The therapeutic may be covalently linked to the encap targets, Substantially reducing the background problems that Sulating membrane Surface using a Suitable linking agent, are connected with the presence of an excess of reporter e.g. as described herein. Thus, for example, one may initially vector conjugate. Within the context of the present prepare a phospholipid or lipopeptide derivative to which invention, pre-targeting with one Specific vector might be the drug is bonded through a biodegradable bond or linker, envisaged, followed by reporter units that are coupled to and then incorporate this derivative into the material used to another vector and a moiety which binds the first vector. prepare the reporter, as described above. Again in the context of the present invention, for example Representative therapeutics Suitable for use in the present in assessment of blood perfusion rates in targeted areas Such drug delivery compositions include any known therapeutic as the myocardium, it is of interest to measure the rate at drugs or active analogues thereof containing thiol groups which contrast agents bound to the target are displaced or 25 which may be coupled to thiol-containing microbubbles released therefrom. This may be achieved in a controlled under oxidative conditions yielding disulphide groups. In manner by administration of an additional vector and/or combination with a vector or vectorS Such drug/vector other Substance able to displace or release the contrast agent modified microbubbles may be allowed to accumulate in from its target. target tissue; administration of a reducing agent Such as Ultrasound imaging modalities which may be used in reduced glutathione may then liberate the drug molecule accordance with the invention include two- and three from the targeted microbubble in the vicinity of the target dimensional imaging techniques Such as B-mode imaging cell, increasing the local concentration of the drug and (for example using the time-varying amplitude of the signal enhancing its therapeutic effect. Alternatively the composi envelope generated from the fundamental frequency of the tion may initially be prepared without the therapeutic, which emitted ultrasound pulse, from Sub-harmonics or higher 35 may then be coupled to or coated on the microbubbles harmonics thereof or from Sum or difference frequencies immediately prior to use; thus, for example, a therapeutic derived from the emitted pulse and Such harmonics, images may be added to a Suspension of microbubbles in aqueous generated from the fundamental frequency or the Second media and Shaken in order to attach or adhere the therapeutic harmonic thereof being preferred), colour Doppler imaging to the microbubbles. and Doppler amplitude imaging, and combinations of the 40 Other drug delivery systems include vector-modified two latter with any of the above modalities. Surprisingly phospholipid membranes doped with lipopeptide Structures excellent Second harmonic Signals have been obtained from comprising a poly-L-lysine or poly-D-lysine chain in com targeted monolayer-Stabilised microSpheres in accordance bination with a targeting vector. Applied to gene therapy/ with the present invention. To reduce the effects of antisense technologies with particular emphasis on receptor movement, Successive images of tissueS Such as the heart or 45 mediated drug delivery, the microbubble carrier is kidney may be collected with the aid of suitable synchro condensed with DNA or RNA via elecrostatic interaction nisation techniques (e.g. gating to the ECG or respiratory with the cationic polylysine. This method has the advantage movement of the Subject). Measurement of changes in that the vector or vectors used for targeted delivery are not resonance frequency or frequency absorption which accom directly attached to the polylysine carrier moiety. The polyl pany arrested or retarded microbubbles may also usefully be 50 ySine chain is also anchored more tightly in the microbubble made to detect the contrast agent. membrane due to the presence of the lipid chains. The use The present invention provides a tool for therapeutic drug of ultrasound to increase the effectiveness of delivery is also delivery in combination with vector-mediated direction of considered useful. the product to the desired site. By “therapeutic' or “drug” is 55 Alternatively free polylysine chains are firstly modified meant an agent having a beneficial effect on a specific with drug or vector molecules then condensed onto the disease in a living human or non-human animal. Whilst negative Surface of targeted microbubbles. combinations of drugs and ultrasound contrast agents have Representative and non-limiting examples of drugs useful been proposed in, for example, WO-A-9428873 and WO-A- in accordance with the invention include antineoplastic 9507072, these products lack vectors having affinity for 60 agents Such as Vincristine, vinblastine, Vindesline, buSulfan, particular sites and thereby show comparitively poor Specific chlorambucil, Spiroplatin, cisplatin, carboplatin, retention at desired SiteS prior to or during drug release. methotrexate, adriamycin, mitomycin, bleomycin, cytosine Therapeutic compounds used in accordance with the arabinoside, arabinosyladenine, mercaptopurine, mitotane, present invention may be encapsulated in the interior of the procarbazine, dactinomycin (antinomycin D), daunorubicin, microbubbles or attached to or incorporated in the Stabilising 65 doxorubic in hydrochloride, taxol, plicamycin, membranes. Thus, the therapeutic compound may be linked aminoglutethimide, estramustine, flutamide, leu prolide, to a part of the membrane, for example through covalent or megestrol acetate, tamoxifen, teStolactone, triloStane, amsa US 6,264,917 B1 11 12 crine (m-AMSA), asparaginase (L-asparaginase), etoposide, such as the hydrochloride or hydrobromide or base salts interferon a-2a and 2b, blood products Such as hematopor Such as Sodium, calcium or magnesium salts) or derivatives phyrins or derivatives of the foregoing, biological response (e.g. acetates) thereof. Other examples of therapeutics modifierS Such as muramylpeptides, antifungal agents Such include genetic material Such as nucleic acids, RNA, and as ketoconazole, nyStatin, griseofulvin, flucytosine, micona DNA of natural or Synthetic origin, including recombinant Zole or amphotericin B; hormones or hormone analogues RNA and DNA. DNA encoding certain proteins may be used Such as growth hormone, melanocyte Stimulating hormone, in the treatment of many different types of diseases. For estradiol, beclomethasone dipropionate, betamethasone, example, tumor necrosis factor or interleukin-2 genes may cortis one acetate, de Xame thaSone, flu niSolide, be provided to treat advanced cancers, thymidine kinase hydrocortisone, methylprednisolone, paramethasone genes may be provided to treat Ovarian cancer or brain acetate, prednisolone, prednisone, triamcinolone or fluidro tumors, interleukin-2 genes may be provided to treat cortisone acetate; Vitamins Such as cyanocobalamin or ret neuroblastoma, malignant melanoma or kidney cancer; and inoids, enzymes Such as alkaline phosphatase or manganese interleukin-4 genes may be provided to treat cancer. Superoxide dismutase; antiallergic agents Such as amelex Lipophilic derivatives of drugs linked to the microbubble anox, inhibitors of tissue factor Such as monoclonal anti 15 membrane through hydrophobic interactions may exhibit bodies and Fab fragments thereof, Synthetic peptides, non therapeutic effects as part of the microbubble or after release peptides and compounds downregulating tissue factor from the microbubble, e.g. by use of ultrasound. If the drug expression; inhibitors of platelets such as GPIa, GPIb and does not possess the desired physical properties, a lipophilic GPIb-IIIa, ADP receptors, thrombin receptors, von Will group may be introduced for anchoring the drug to the ebrand factor, prostaglandins, aspirin, ticlopidin, clopigogrel membrane. Preferably the lipophilic group should be intro and reopro; inhibitors of coagulation protein targets Such as duced in a way that does not influence the in Vivo potency FIIa, FVa, FVIIa, FVIIIA, FIXa, FXa, tissue factor, heparins, of the molecule, or the lipophilic group may be cleaved hirudin, hirulog, argatroban, DEGR-rFVIIa and annexin V: releasing the active drug. Lipophilic groups may be intro inhibitors of fibrin formation and promoters of fibrinolysis duced by various chemical means depending on functional Such as t-PA, urokinase, Plasmin, Streptokinase, 25 groups available in the drug molecule. Covalent coupling rt-Plasminogen Activator and rStaphylokinase; antiangio may be effected using functional groups in the drug mol genic factorS Such as medroxyprogesteron, pentosan ecule capable of reacting with appropriately functionalised poly Sulphate, Suramin, taxol, thalidomide, angiostatin, lipophilic compounds. Examples of lipophilic moieties interferon-alpha, metalloproteinase inhibitors, platelet factor include branched and unbranched alkyl chains, cyclic 4, Somatostatin, thromobospondin; circulatory drugs. Such as compounds, aromatic residues and fused aromatic and non propranolol, metabolic potentiatorS Such as glutathione; aromatic cyclic Systems. In Some instances the lipophilic antitubercularS Such as p-aminoSalicylic acid, isoniazid, moiety will consist of a Suitably functionalised Steroid, Such capreomycin Sulfate, cycloSexine, ethambutol, ethionamide, as cholesterol or a related compound. Examples of func pyrazinamide, rifampin or Streptomycin Sulphate; antivirals tional groups particularly Suitable for derivatisation include Such as acyclovir, amantadine, azidothymidine, ribavirin or 35 nucleophilic groups like amino, hydroxy and Sulfhydryl Vidarabine; blood vessel dilating agents Such as diltiazem, groupS. Suitable processes for lipophilic derivatisation of nifedipine, Verapamil, erythritol tetranitrate, isosorbide any drug containing a Sulfhydryl group, Such as captopril, dinitrate, nitroglycerin or pentaerythritol tetranitrate; antibi may include direct alkylation, e.g. reaction with an alkyl otics Such as dapSone, chloramphenicol, neomycin, cefaclor, halide under basic conditions and thiol ester formation by cefadroxil, cephalexin, cephradine, erythromycin, 40 reaction with an activated carboxylic acid. Representative clindamycin, lincomycin, amoxicillin, amplicillin, examples of derivatisation of any drug having carboxylic bacampicillin, carbenicillin, dicloxacillin, cyclacillin, functions, for example atenolol or chlorambucil, include picloxacillin, hetacillin, methicillin, nafcillin, penicillin, amide and ester formation by coupling respectively with polymyxin or tetracycline; antiinflammatories Such as amines and alcohols possessing appropriate physical prop diflunisal, ibuprofen, indomethacin, meclefenamate, mefe 45 erties. A preferred embodiment comprises attachment of namic acid, naproxen, phenylbutaZone, piroXicam, tolmetin, cholesterol to a therapeutic compound by forming a degrad aspirin or Salicylates, antiprotozoans Such as chloroquine, able ester bond. metronidazole, quinine or meglumine antimonate; antirheu A preferred application of the present invention relates to matics Such as penicillamine, narcoticS Such as paregoric; angiogenesis, which is the formation of new blood vessels opiates Such as codeine, morphine or opium; cardiac glyco 50 by branching from existing vessels. The primary Stimulus SideS Such as deslaneside, digitoxin, digoxin, digitalin or for this proceSS may be inadequate Supply of nutrients and digitalis; neuromuscular blockerS Such as atracurium oxygen (hypoxia) to cells in a tissue. The cells may respond meSylate, gallamine triethiodide, hexafluorenium bromide, by Secreting angiogenetic factors, of which there are many; metocurine iodide, pancuronium bromide, Succinylcholine one example is vascular endothelial growth factor. These chloride, tubocurarine chloride or vecuronium bromide; 55 factors initiate the Secretion of proteolytic enzymes which Sedatives Such as amobarbital, amobarbital Sodium, break down the proteins of the basement membrane, as well apropbarbital, butabarbital Sodium, chloral hydrate, as inhibitors which limit the action of these potentially ethchlorVynol, ethinamate, flurazepam hydrochloride, harmful enzymes. The combined effect of loss of attachment glute thimide, methotrime praZine hydrochloride, and Signals from the receptors for angiogenetic factors is to methy prylon, midazolam hydrochloride, paraldehyde, 60 cause the endothelial cells to move, multiply, and rearrange pentobarbital, Secobarbital Sodium, talbutal, temazepam or themselves, and finally to Synthesise a basement membrane triazolam, local anaesthetics Such as bupivacaine, around the new vessels. chloroprocaine, etidocaine, lidocaine, mepivacaine, Tumors must initiate angiogenesis when they reach mil procaine or tetracaine; general anaesthetics Such as limeter size in order to keep up their rate of growth. AS droperidol, etomidate, fentanyl citrate with droperidol, ket 65 angiogenesis is accompanied by characteristic changes in amine hydrochloride, methohexital Sodium or thiopental and the endothelial cells and their environment, this process is a pharmaceutically acceptable Salts (e.g. acid addition salts promising target for therapeutic intervention. The transfor US 6,264,917 B1 13 14 mations accompanying angiogenesis are also very promis capable of reaction with Such functional groups. Examples ing for diagnosis, a preferred example being malignant of reactive moieties capable of reaction with sulfhydryl disease, but the concept also shows great promise in inflam groups include C.-haloacetyl compounds of the type mation and a variety of inflammation-related diseases. These X-CHCO-(where X=Br, Clor I), which show particular factors are also involved in re-vascularisation of infarcted reactivity for sulfhydryl groups but which can also be used parts of the myocardium, which occurs if a Stenosis is to modify imidazolyl, thioether, phenol and amino groups as released within a short time. described by Gurd, F. R. N. in Methods Enzymol. (1967) 11, A number of known receptorS/targets associated with 532. N-Maleimide derivatives are also considered selective angiogenesis are given in Subsequent tables. Using the towards Sulfhydryl groups, but may additionally be useful in targeting principles described in the present disclosure, coupling to amino groups under certain conditions. angiogenesis mav be detected by the majority of the imaging N-maleimides may be incorporated into linking Systems for modalities in use in medicine. Contrast-enhanced ultrasound reporter-vector conjugation as described by Kitagawa, T. et may possess additional advantages, the contrast medium al. in Chem. Pharm. Bull. (1981) 29, 1130 or used as being microSpheres which are restricted to the interior of polymer crosslinkers for bubble stabilisation as described by blood vessels. Even if the target antigens are found on many 15 Kovacic, P. et al. in J. Am. Chem. Soc. (1959) 81, 1887. cell types, the microSpheres will attach exclusively to endot Reagents Such as 2-iminothiolane, e.g. as described by helial cells. Traut, R. et al. in Biochemistry (1973) 12, 3266, which So-called prodrugs may also be used in agents according introduce a thiol group through conversion of an amino to the invention. Thus drugs may be derivatised to alter their group, may be considered as Sulfhydryl reagents if linking physicochemical properties and to adapt them for inclusion occurs through the formation of disulphide bridges. Thus into the reporter, Such derivatised drugs may be regarded as reagents which introduce reactive disulphide bonds into prodrugs and are usually inactive until cleavage of the either the reporter or the vector may be useful, Since linking derivatising group regenerates the active form of the drug. may be brought about by disulphide exchange between the By targeting gas-filled microbubbles containing a vector and reporter; examples of Such reagents include prodrug-activating enzyme to areas of pathology, one may 25 Ellman's reagent (DTNB), 4,4'-dithiodipyridine, methyl-3- image targeting the enzyme, making it possible to visualise nitro-2-pyridyl disulphide and methyl-2-pyridyl disulphide when the microbubbles are targeted properly to the area of (described by Kimura, T. et al. in Analyt. Biochem. (1982) pathology and at the same time have disappeared from 122, 271). non-target areas. In this way one can determine the optimal Examples of reactive moieties capable of reaction with time for injection of prodrug into individual patients. amino groups include alkylating and acylating agents. Rep Another alternative is to incorporate the prodrug, resentative alkylating agents include: prodrug-activating enzyme and vector in the same i) C-haloacetyl compounds, which show specificity microbubbles in a system where the prodrug will only be towards amino groups in the absence of reactive thiol activated after Some external Stimulus. Such a Stimulus may, groups and are of the type X-CHCO-(where X=Cl, for example, be a tumour-specific protease as described 35 Br or I), e.g. as described by Wong, Y-H. H. in above, or bursting of the microbubbles by external ultra Biochemistry (1979) 24, 5337; Sound after the desired targeting has been achieved. ii) N-maleimide derivatives, which may react with amino Therapeutics may easily be delivered in accordance with groups either through a Michael type reaction or the invention to diseased or necrotic areas, for example in 40 through acylation by addition to the ring carbonyl the heart, general vasculature, and to the liver, Spleen, group as described by Smyth, D. G. et al. in J. Am. kidneys and other regions Such as the lymph System, body Chem. Soc. (1960) 82,4600 and Biochem.J. (1964) 91, cavities or gastrointestinal System. 589; Products according to the present invention may be used iii) aryl halides Such as reactive nitrohaloaromatic com for targeted therapeutic delivery either in vivo or in vitro. In 45 pounds, the latter context the products may be useful in in Vitro iv) alkyl halides as described by McKenzie, J. A. et al. in Systems. Such as kits for diagnosis of different diseases or J. Protein Chem. (1988) 7, 581; characterisation of different components in blood or tissue v) aldehydes and ketones capable of Schiff's base forma Samples. Similar techniques to those used to attach certain tion with amino groups, the adducts formed usually blood components or cells to polymer particles (e.g. mono 50 disperse magnetic particles) in vitro to separate them from a being Stabilised through reduction to give a Stable Sample may be used in the present invention, using the low amine; density of the reporter units in agents of the present inven Vi) epoxide derivatives Such as epichlorohydrin and bisoxiranes,which may react with amino, Sulfhydryl or tion to effect Separation of the gas-containing material by phenolic hydroxyl groups, flotation and repeated washing. 55 Coupling of a reporter unit to a desired vector (and/or Vii) chlorine-containing derivatives of S-triazines, which therapeutic drug) may be achieved by covalent or non are very reactive towards nucleophiles Such as amino, covalent means, usually involving interaction with one or Sufhydryl and hydroxy groups, more functional groups located on the reporter and/or vector viii) aziridines based on S-triazine compounds detailed and/or any intervening linker group/spacer element. 60 above, e.g. as described by Ross, W. C. J. in Adv. Examples of chemically reactive functional groups which Cancer Res. (1954) 2, 1, which react with nucleophiles may be employed for this purpose include amino, hydroxyl, Such as amino groups by ring opening; Sulfhydryl, carboxyl, and carbonyl groups, as well as car ix) Squaric acid diethyl esters as described by Tietze, L. F. bohydrate groups, vicinal diols, thioethers, 2-aminoalcohols, in Chem. Ber. (1991) 124, 1215; and 2-aminothiols, guanidinyl, imidazolyl and phenolic groups. 65 X) C.-haloalkyl ethers, which are more reactive alkylating Covalent coupling of reporter and vector may therefore be agents than normal alkyl halides because of the acti effected using linking agents containing reactive moities Vation caused by the ether oxygen atom, e.g. as US 6,264,917 B1 15 16 described by Benneche, T. et al. in Eur: J. Med. Chem. N-carb alkoxydihydro quinolines such S (1993) 28,463. N-(ethoxycarbonyl)-2-ethoxy-1,2-dihydroquinoline. Representative amino-reactive acylating agents include: Other potentially useful reactive moieties include Vicinal i) isocyanates and isothiocyanates, particularly aromatic diones Such as p-phenylenediglyoxal, which may be used to derivatives, Which form stable urea and thiourea react with guanidinyl groups, e.g. as described by Wagner et derivatives respectively and have been used for protein al. in Nucleic acid Res. (1978) 5,4065; and diazonium salts, crosslinking as described by Schick, A. F. et al. in J. which may undergo electrophilic Substitution reactions, e.g. Biol. Chem. (1961) 236, 2477; as described by Ishizaka, K. and Ishizaka T. in J. Immunol. ii) sulfonyl chlorides, which have been described by (1960) 85, 163. Bis-diazonium compounds are readily pre Herzig, D. J. et al. in Biopolymers (1964) 2, 349 and pared by treatment of aryl diamines with Sodium nitrite in which may be useful for the introduction of a fluores acidic Solutions. It will be appreciated that functional groups cent reporter group into the linker; in the reporter and/or vector may if desired be converted to iii) Acid halides; other functional groups prior to reaction, e.g. to confer iv) Active esters such as nitrophenyle Sters or additional reactivity or Selectivity. Examples of methods 15 useful for this purpose include conversion of amines to N-hydroxysuccinimidyl esters; carboxylic acids using reagents Such as dicarboxylic anhy V) acid anhydrides Such as mixed, symmetrical or drides, conversion of amines to thiols using reagents Such as N-carboxyanhydrides; N-acetylhomoc y Steine thiol act one, Vi) other useful reagents for amide bond formation as S-acetylmercaptoSuccinic anhydride, 2-liminothiolane or described by Bodansky, M. et al. in Principles of thiol-containing Succinimidyl derivatives, conversion of thi Peptide Synthesis (1984) Springer-Verlag; ols to carboxylic acids using reagents Such as vii) acylazides, e.g. wherein the azide group is generated C-haloacetates, conversion of thiols to amines using from a preformed hydrazide derivative using Sodium reagents Such as ethylenimine or 2-bromoethylamine; con nitrite, e.g. as described by Wetz, K. et al. in Anal. version of carboxylic acids to amines using reagents Such as Biochem. (1974) 58, 347; 25 carbodiimides followed by diamines; and conversion of viii) azlactones attached to polymerS Such as bis alcohols to thiols using reagents Such as tosyl chloride acrylamide, e.g. as described by Rasmussen, J. K. in followed by transesterification with thioacetate and hydroly Reactive Polymers (1991) 16, 199; and sis to the thiol with Sodium acetate. iX) Imidoesters, which form stable amidines on reaction Vector-reporter coupling may also be effected using with amino groups, e.g. as described by Hunter, M. J. enzymes as Zero-length linking agents; thus, for example, and Ludwig, M. L. in J. Am. Chem. Soc. (1962) 84, transglutaminase, peroxidase and Xanthine oxidase may be 3491. used to produce linked products. Reverse proteolysis may Carbonyl groups Such as aldehyde functions may be also be used for linking through amide bond formation. reacted with weak protein bases at a pH Such that nucleo Non-covalent vector-reporter coupling may, for example, philic protein Side-chain functions are protonated. Weak 35 be effected by electroStatic charge interactions e.g. between bases include 1,2-aminothiols Such as those found in a polylysinyl-functionalised reporter and a polyglutamyl N-terminal cysteine residues, which selectively form stable functionalised vector, through chelation in the form of Stable 5-membered thiazolidine rings with aldehyde groups, e.g. as metal complexes or through high affinity binding interaction described by Ratner, S. et al. in J. Am. Chem. Soc. (1937) 59, Such as avidin/biotin binding. Polylysine, coated non 200. Other weak bases such as phenyl hydrazones may be 40 covalently to a negatively charged membrane Surface may used, e.g. as described by Heitzman, H. et al. in Proc. Natl. also increase non-specifically the affinity of a microbubble Acad. Sci. USA (1974) 71, 3537. for a cell through charge interactions. Aldehydes and ketones may also be reacted with amines Alternatively, a vector may be coupled to a protein known to form Schiff's bases, which may advantageously be Sta to bind phospholipids. In many instances, a Single molecule bilised through reductive amination. Alkoxylamino moieties 45 of phospholipid may attach to a protein Such as a readily react with ketones and aldehydes to produce Stable translocase, while other proteins may attach to Surfaces alkoxamines, e.g. as described by Webb, R. et al. in Bio consisting mainly of phospholipid head groupS and So may conjugate Chem. (1990) 1, 96. be used to attach vectors to phospholipid microSpheres, one Examples of reactive moieties capable of reaction with example of Such a protein is f2-glycoprotein I (Chonn, A., carboxyl groups include diazo compounds Such as diaZoac 50 Semple, S. C. and Cullis, P. R., Journal of Biological etate esters and diazoacetamides, which react with high Chemistry (1995) 270, 25845–25849). Phosphatidylserine Specificity to generate ester groups, e.g. as described by binding proteins have been described, e.g. by Igarashi, K. et Herriot R. M. in Adv. Protein Chem. (1947) 3, 169. Car al. in Journal of Biological Chemistry 270(49), boxylic acid modifying reagents Such as carbodiimides, 29075-29078; a conjugate of a vector with such a which react through O-acylurea formation followed by 55 phosphatidylserine-binding protein may therefore be used to amide bond formation, may also usefully be employed; attach the vector to phosphatidylserine-encapsulated linking may be facilitated through addition of an amine or microbubbles. When the amino acid sequence of a binding may result in direct vector-receptor coupling. Useful water protein is known, the phospholipid-binding portion may be soluble carbodiimides include 1-cyclohexyl-3-(2- Synthesised or isolated and used for conjugation with a morpholinyl-4-ethyl)carbodiimide (CMC) and 1-ethyl-3-(3- 60 vector, thus avoiding the biological activity which may be dimethylaminopropyl)carbodiimide (EDC), e.g. as located elsewhere in the molecule. described by Zot, H. G. and Puett, D. in J. Biol. Chem. It is also possible to obtain molecules that bind Specifi (1989) 264, 15552. Other useful carboxylic acid modifying cally to the surface (or in the “membrane”) of microspheres reagents include isoxazolium derivatives Such as Wood by direct Screening of molecular libraries for microSphere wards reagent K, chloro for mate S. Such as 65 binding molecules. For example, phage libraries displaying p-nitrophenylchloroformate; carbonyldiimidazoles Such as Small peptides may be used for Such Selection. The Selection 1, 1'- carbonyl diimidazole; and may be made by Simply mixing the microSpheres and the US 6,264,917 B1 17 18 phage display library and eluting the phages binding to the So-called Zero-length linking agents, which induce direct floating microSpheres. If desired, the Selection may be done covalent joining of two reactive chemical groups without under “physiological conditions” (e.g. in blood) to eliminate introducing additional linking material (e.g. as in amide peptides which cross-react with blood components. An bond formation induced using carbodiimides or advantage of this type of Selection procedure is that only enzymatically) may, if desired, be used in accordance with binding molecules that do not destabilise the microSpheres the invention, as may agentS Such as biotin/avidin Systems should be Selected, Since only binding molecules attached to which induce non-covalent reporter-vector linking and intact floating microSpheres will rise to the top. It may also be possible to introduce some kind of “stress” during the agents which induce hydrophobic or electrostatic interac Selection procedure (e.g. pressure) to ensure that destabilis tions. ing binding moieties are not Selected. Furthermore the Most commonly, however, the linking agent will com Selection may be done under shear conditions, for example prise two or more reactive moieties, e.g. as described above, by first letting the phages react with the microSpheres and connected by a Spacer element. The presence of Such a then letting the microSpheres pass through a Surface coated Spacer permits bifunctional linkers to react with Specific with anti-phage antibodies under flow conditions. In this functional groups within a molecule or between two differ way it may be possible to Select binders which may resist 15 ent molecules, resulting in a bond between these two com Shear conditions present in Vivo. Binding moieties identified ponents and introducing extrinsic linker-derived material in this way may be coupled (by chemical conjugation or via into the reporter-vector conjugate. The reactive moieties in peptide synthesis, or at the DNA-level for recombinant a linking agent may be the same (homobifunctional agents) vectors) to a vector molecule, constituting a general tool for or different (heterobifunctional agents or, where several attaching any vector molecule to the microSpheres. dissimilar reactive moieties are present, heteromultifunc A vector which comprises or is coupled to a peptide, tional agents), providing a diversity of potential reagents lipo-oligosaccharide or lipopeptide linker which contains a that may bring about covalent bonding between any chemi element capable of mediating membrane insertion may also cal Species, either intramolecularly or intermolecularly. be useful. One example is described by Leenhouts, J. M. et The nature of extrinsic material introduced by the linking al. in Febs Letters (1995) 370(3), 189-192. Non-bioactive 25 agent may have a critical bearing on the targeting ability and molecules consisting of known membrane insertion anchor/ general Stability of the ultimate product. Thus it may be Signal groupS may also be used as Vectors for certain desirable to introduce labile linkages, e.g. containing Spacer applications, an example being the H1 hydrophobic Segment arms which are biodegradable or chemically Sensitive or from the Na,K-ATPase C.-subunit described by Xie, Y. and which incorporate enzymatic cleavage Sites. Alternatively Morimoto, T. in J. Biol. Chem. (1995) 270(20), the Spacer may include polymeric components, e.g. to act as 11985–11991. The anchor group may also be fatty acid(s) or Surfactants and enhance bubble Stability. The Spacer may cholesterol. also contain reactive moieties, e.g. as described above to Coupling may also be effected using avidin or enhance Surface crosslinking, or it may contain a tracer streptavidin, which have four high affinity binding sites for element Such as a fluorescent probe, Spin label or radioactive biotin. Avidin may therefore be used to conjugate vector to 35 material. reporter if both vector and reporter are biotinylated. Contrast agents according to the present invention are Examples are described by Bayer, E. A. and Wilchek, M. in therefore useful in all imaging modalities Since contrast Methods Biochem. Anal. (1980) 26, 1. This method may also elements Such as X-ray contrast agents, light imaging be extended to include linking of reporter to reporter, a probes, Spin labels or radioactive units may readily be proceSS which may encourage bubble association and con 40 incorporated in or attached to the reporter units. Sequent potentially increased echogenicity. Alternatively, Spacer elements may typically consist of aliphatic chains avidin or Streptavidin may be attached directly to the Surface which effectively separate the reactive moieties of the linker of reporter microparticles. by distances of between 5 and 30 A. They may also comprise Non-covalent coupling may also utilise the bifunctional macromolecular structures such as PEGs, which have been nature of bispecific immunoglobulins. These molecules can 45 given much attention in biotechnical and biomedical appli Specifically bind two antigens, thus linking them. For cations (see e.g. Milton Harris, J. (ed) "Poly(ethylene glycol) example, either bispecific IgG or chemically engineered chemistry, biotechnical and biomedical applications” Ple bispecific F(ab)2 fragments may be used as linking agents. num Press, New York, 1992). PEGs are soluble in most Heterobifunctional bispecific antibodies have also been Solvents, including water, and are highly hydrated in aque reported for linking two different antigens, e.g. as described 50 ous environments, with two or three water molecules bound by Bode, C. et al. in J. Biol. Chem. (1989) 264,944 and by to each ethylene glycol Segment; this has the effect of Staerz, U. D. et al. in Proc. Natl. Acad. Sci. USA (1986) 83, preventing adsorption either of other polymers or of proteins 1453. Similarly, any reporter and/or vector containing two or onto PEG-modified Surfaces. PEGs are known to be non more antigenic determinants (e.g. as described by Chen, Aa toxic and not to harm active proteins or cells, whilst et al. in Am. J. Pathol. (1988) 130, 216) may be crosslinked 55 covalently linked PEGs are known to be non-immunogenic by antibody molecules and lead to formation of multi-bubble and non-antigenic. Furthermore, PEGS may readily be modi croSS-linked assemblies of potentially increased echogenic fied and bound to other molecules with only little effect on ity. their chemistry. Their advantageous Solubility and biological Linking agents used in accordance with the invention will properties are apparent from the many possible uses of PEGS in general bring about linking of Vector to reporter or 60 and copolymers thereof, including block copolymerS Such as reporter to reporter with Some degree of Specificity, and may PEG-polyurethanes and PEG-polypropylenes. also be used to attach one or more therapeutically active Appropriate molecular weights for PEG Spacers used in agents. accordance with the invention may, for example, be between In Some instances it is considered advantageous to include 120 Daltons and 20 kDaltons. a PEG component as a Stabiliser in conjunction with a vector 65 The major mechanism for uptake of particles by the cells or vectors or directly to the reporter in the same molecule of the reticuloendothelial system (RES) is opsonisation by where the PEG does not serve as a spacer. plasma proteins in blood; these mark foreign particles which US 6,264,917 B1 19 20 are then taken up by the RES. The biological properties of been used in the form of nanoparticles for Selective PEG spacer elements used in accordance with the invention drug delivery (see Forestier, F., Gerrier, P., Chaumard, may serve to increase contrast agent circulation time in a C., Quero, A. M., Couvreur, P. and Labarre, C. in J. similar manner to that observed for PEGylated liposomes Antimicrob. Chemoter. (1992) 30, 173–179); (see e.g. Klibanov, A. L. et al. in FEBS Letters (1990) 268, iv) polyvinyl alcohols, which are water-Soluble and gen 235-237 and Blume, G. and Cevc, G. in Biochim. BiophyS. erally regarded as biocompatible (see e.g. Langer, R. in Acta (1990) 1029, 91-97). Increased coupling efficiency to J. Control. Release (1991) 16, 53–60); areas of interest may also be achieved using antibodies v) copolymers of vinyl methyl ether with maleic bound to the termini of PEG spacers (see e.g. Maruyama, K. anhydride, which have been stated to be bioerodible et al. in Biochim. Biophys. Acta (1995) 1234, 74–80 and (see Finne, U., Hannus, M. and Urtti, A. in Int. J. Hansen, C. B. et al. in Biochim. Biophys. Acta (1995) 1239, Pharm. (1992) 78. 237–241); 133–144). Vi) polyvinylpyrrolidones, e.g. with molecular weight less In Some instances it is considered advantageous to include than about 25,000, which are rapidly filtered by the a PEG component as a Stabiliser in conjunction with a vector kidneys (see Hespe, W., Meier, A. M. and Blankwater, or vectors or directly to the reporter in the same molecule 15 Y. M. in Arzeim.-Forsch./Drug Res. (1977) 27, where the PEG does not serve as a spacer. Other representative Spacer elements include Structural 1158–1162); type polysaccharides Such as polygalacturonic acid, Vii) polymers and copolymers of short-chain aliphatic glycosaminoglycans, heparinoids, cellulose and marine hydroxyacids Such as glycolic, lactic, butyric, Valeric polysaccharides Such as alginates, chitosans and carrageen and caproic acids (see e.g. Carli, F. in Chim. Ind. ans, Storage-type polysaccharides Such as Starch, glycogen, (Milan) (1993) 75, 494-9), including copolymers dextran and aminodextrans, polyamino acids and methyl and which incorporate aromatic hydroxyacids in order to ethyl esters thereof, as in homo- and co-polymers of lysine, increase their degradation rate (see Imasaki, K., glutamic acid and aspartic acid; and polypeptides, oligosac Yoshida, M., Fukuzaki, H., Asano, M., Kumakura, M., charides and oligonucleotides, which may or may not con 25 Mashimo, T., Yamanaka, H. and Nagai. T. in Int. J. tain enzyme cleavage Sites. Pharm. (1992) 81, 31–38); In general, Spacer elements may contain cleavable groups viii) polyesters consisting of alternating units of ethylene Such as vicinal glycol, azo, Sulfone, ester, thioester or glycol and terephthalic acid, e.g. Dacron(R), which are disulphide groups. Spacers containing biodegradable meth non-degradable but highly biocompatible, ylene diester or diamide groups of formula iX) block copolymers comprising biodegradable segments of aliphatic hydroxyacid polymers (see e.g. Younes, H., -(Z).Y.X.C(R'R').X.Y.(Z)- Nataf, P. R., Cohn, D., Appelbaum, Y. J., Pizov, G. and Uretzky, G. in Biomater. Artif Cells Artif. Organs where X and Z are selected from -O-, -S-, and (1988) 16, 705–719), for instance in conjunction with -NR- (where R is hydrogen or an organic group); each Y polyurethanes (see Kobayashi, H., Hyon, S. H. and is a carbonyl, thiocarbonyl, Sulphonyl, phosphoryl or similar 35 acid-forming group: m and n are each Zero or 1; and R' and Ikada, Y. in “Water-curable and biodegradable R are each hydrogen, an organic group or a group —X.Y. prepolymers' J. Biomed. Mater. Res. (1991) 25, (Z), , or together form a divalent organic group may also 1481–1494); be useful; as discussed in, for example, WO-A-9217436 X) polyurethanes, which are known to be well-tolerated in 40 implants, and which may be combined with flexible Such groups are readily biodegraded in the presence of “Soft” segments, e.g. comprising poly(tetra methylene esterases, e.g. in Vivo, but are stable in the absence of Such glycol), poly(propylene glycol) or poly(ethylene enzymes. They may therefore advantageously be linked to therapeutic agents to permit slow release thereof. glycol) and aromatic "hard” segments, e.g. comprising PolyN-(2-hydroxyethyl)methacrylamides are poten 4,4'-methylenebis(phenylene isocyanate) (see e.g. 45 Ratner, B. D., Johnston, A. B. and Lenk, T. J. in J. tially useful Spacer materials by virtue of their low degree of Biomed. Mater. Res: Applied Biomaterials (1987) 21, interaction with cells and tissues (see e.g. Volfová, I., Rihov 59–90; Sa Da Costa, V. et al. in J. Coll. Interface Sci. a, B. and V. R. and Vetvicka, P. in J. Bioact. Comp. Polymers (1981) 80, 445-452 and Affrossman, S. et al. in Clini (1992) 7, 175-190). Work on a similar polymer consisting cal Materials (1991) 8, 25–31); mainly of the closely related 2-hydroxypropyl derivative 50 xi) poly(1,4-dioxan-2-ones), which may be regarded as showed that it was endocytosed by the mononuclear phago biodegradable esters in view of their hydrolysable ester cyte System only to a rather low extent (see Goddard, P., linkages (see e.g. Song, C. X., Cui, X. M. and Williamson, I., Bron, J., Hutchkinson, L. E., Nicholls, J. and Schindler, A. in Med. Biol. Eng. Comput. (1993) 31, Petrak, K. in J. Bioct. Compat. Polym. (1991) 6, 4-24). S147-150), and which may include glycolide units to Other potentially useful polymeric Spacer materials 55 improve their absorbability (see Bezwada, R. S., include: Shalaby, S. W. and Newman, H. D. J. in Agricultural i) copolymers of methyl methacrylate with methacrylic and Synthetic polymers. Biodegradability and utiliza acid; these may be erodible (see Lee, P. I. in Pharm. tion (1990) (ed Glass, J. E. and Swift, G.), 167–174 Res. (1993) 10, 980) and the carboxylate substituents ACS symposium Series, #433, Washington D.C., may cause a higher degree of Swelling than with neutral 60 U.S.A.-American Chemical Society); polymers, xii) polyanhydrides Such as copolymers of Sebacic acid ii) block copolymers of polymethacrylates with biode (octanedioic acid) with bis(4-carboxy-phenoxy) gradable polyesters (see e.g. San Roman, J. and propane, which have been shown in rabbit studies (see Guillen-Garcia, P. in Biomaterials (1991) 12, Brem, H., Kader, A., Epstein, J. I., Tamargo, R. J., 236-241); 65 Domb, A., Langer, R. and Leong, K.W. in Sel. Cancer ii) cyanoacrylates, i.e. polymers of esters of Ther. (1989) 5,55–65) and rat studies (see Tamargo, R. 2-cyanoacrylic acid-these are biodegradable and have J., Epstein, J. I., Reinhard, C. S., Chasin, M. and Brem, US 6,264,917 B1 21 22 H. in J. Biomed. Mater. Res. (1989) 23, 253–266) to be useful for controlled release of drugs in the brain -continued without evident toxic effects; Linking agent Reactivity 1 Reactivity 2 Comments xiii) biodegradable polymers containing ortho-ester Sulfo-LC-SPDP -NH, -SH water-soluble groups, which have been employed for controlled sulfo-SAMCA(2) -NH, photoreactive release in vivo (see Maa, Y. F. and Heller, J. in J. Sulfo-SAPB -NH, photoreactive water-soluble Control. Release (1990) 14, 21–28); and Notes: (1) = iodinable; (2) = fluorescent xiv) polyphosphaZenes, which are inorganic polymers Homobifunctional Linking Agents consisting of alternate phosphorus and nitrogen atoms (see Crommen, J. H., Vandorpe, J. and Schacht, E. H. in J. Control. Release (1993) 24, 167–180). The following tables list linking agents and agents for Linking agent Reactivity Comments protein modification which may be useful in preparing 15 BS -NH, targetable agents in accordance with the invention. BMH -SH BASED(1) photoreactive iodinable disulphide linker Heterobifunctional Linking Agents BSCOES -NH, Sulfo-BSCOES -NH, water-soluble DFDNB -NH, DMA -NH, DMP -NH, Linking agent Reactivity 1 Reactivity 2 Comments DMS -NH, DPDPB -SH disulphide linker ABH carbohydrate photoreactive DSG -NH, ANB-NOS -NH, photoreactive DSP disulphide linker APDP(1) -SH photoreactive iodinable -NH, 25 DSS -NH, disulphide DST -NH, linker Sulfo-DST -NH, water-soluble APG -NH, photoreactive reacts DTBP -NH, disulphide linker selectively DTSSP -NH, disulphide linker with Arg at pH EGS -NH, 7-8 Sulfo-EGS -NH, water-soluble ASIB(1) -SH photoreactive iodinable SPBP ASBA(1) -COOH photoreactive iodinable -NH, EDC -NH, -COOH Zero-length linker Biotinylation Agents GMBS -NH, -SH Sulfo-GMBS -NH, -SH water-soluble HSAB -NH, photoreactive 35 Sulfo-HSAB -NH, photoreactive water-soluble MBS -NH, -SH Agent Reactivity Comments Sulfo-MBS -NH, -SH water-soluble MCH carbohydrate -SH biotin-BMCC -SH MPBH carbohydrate -SH biton-DPPE* preparation of NHS-ASA(1) -NH, photoreactive iodinable biotinylated liposomes Sulfo-NHS- -NH, photoreactive water-soluble, 40 biotin-LC-DPPE* preparation of ASA(1) iodinable biotinylated liposomes Sulfo-NHS-LC- -NH, photoreactive water-soluble, biotin-HPDP -SH disulphide linker ASA(1) iodinable biotin-hydrazide carbohydrate PDPH carbohydrate -SH disulphide biotin-LC-hydrazide carbohydrate linker iodoacetyl-LC-biotin -NH, PNP-DTP -NH, photoreactive 45 NHS-iminobiotin reduced affinity for SADP -NH, photoreactive disulphide avidin linker NHS-SS-biotin -NH, disulphide linker Sulfo-SADP -NH, photoreactive water-soluble photoactivatable biotin nucleic disulphide acids linker Sulfo-NHS-biotin -NH, water-soluble SAED -NH, photoreactive disulphide 50 Sulfo-NHS-LC-biotin -NH, linker SAND -NH, photoreactive water-soluble Notes: DPPE = dipalmitoylphosphatidylethanolamine; LC = long chain disulphide linker Agents for Protein Modification SANPAH -NH, photoreactive Sulfo-SANPAH -NH, photoreactive water-soluble 55 SASD(1) -NH, photoreactive water-soluble iodinable Agent Reactivity Function disulphide linker Ellman's reagent quantifies/detects/protects SAB -NH, -SH DTT reduction sulfo-SIAB -NH, -SH water-soluble 60 2-mercaptoethanol reduction SMCC -NH, -SH 2-mercaptylamine reduction Sulfo-SMCC -NH, -SH water-soluble Traut's reagent introduces -SH SMPB -NH, -SH SATA introduces protected -SH Sulfo-SMPB -NH, -SH water-soluble AMCA-NHS fluorescent labelling SMPT -NH, -SH AMCA-hydrazide fluorescent labelling Sulfo-LC-SMPT -NH, -SH water-soluble AMCA-HPDP fluorescent labelling SPDP -NH, -SH 65 SBF-chloride fluorescent detection of -SH Sulfo-SPDP -NH, -SH water-soluble N-ethylmaleimide blocks -SH NHS-acetate blocks and acetylates -NH. US 6,264,917 B1 24 which are associated with many different pathological con -continued ditions. Oligonucleotides may also be designed to bind to specific DNA- or RNA-binding proteins, for example tran Agent Reactivity Function Scription factors which are very often highly overexpressed citraconic anhydride -NH2, reversibly blocks and or activated in tumour cells or in activated immune or introduces negative charges endothelial cells. Combinatorial libraries may be used to DTPA -NH, introduces chelator Select oligonucleotides which bind Specifically to any pos BNPS-skatole tryptophan cleaves tryptophan residue Sible target molecules and which therefore may be employed Bolton-Hunter -NH, introduces iodinable group as Vectors for targeting. v) DNA-binding drugs may behave similarly to Other potentially useful protein modifications include oligonuclotides, but may exhibit biological acitvity and/or partial or complete deglycosidation by neuraminidase, endoglycosydases or periodate, Since deglycosidation often toxic effects if taken up by cells. results in leSS uptake by liver, Spleen, macrophages etc., vi) Protease substrates/inhibitors. Proteases are involved in whereas neo-glycosylation of proteins often results in many pathological conditions. Many Substrates/inhibitors increased uptake by the liver and macrophages); preparation 15 are non-peptidic but, at least in the case of inhibitors, are of truncated forms by proteolytic cleavage, leading to often bioactive. reduced size and Shorter half life in circulation; and Vii) Vector molecules may be generated from combinatorial cationisation, e.g. as described by Kumagi et al. in J. Biol. libraries without necessarily knowing the exact molecular Chem. (1987) 262, 15214-15219; Triguero et al. in Proc. target, by functionally selecting (in vitro, ex vivo or in vivo) Natl. Acad. Sci. USA (1989) 86,4761-4765; Pardridge et al. for molecules binding to the region/structure to be imaged. in J. Pharmacol. Exp. Therap. (1989) 251, 821-826 and viii) Various Small molecules, including bioactive com Pardridge and Boado, Febs Lett. (1991) 288, 30–32. pounds known to bind to biological receptors of various Vectors which may be usefully employed in targetable kinds. Such vectors or their targets may be used for generate agents according to the invention include the following: non-bioactive compounds binding to the Same targets. i) Antibodies, which can be used as vectors for a very wide 25 ix) Proteins or peptides which bind to glucosamioglycan range of targets, and which have advantageous properties Side chains e.g. he paran Sulphate, including Such as very high specificity, high affinity (if desired), the glucosoaminoglycan-binding portions of larger molecules, possiblity of modifying affinity according to need etc. as binding to glucoSoaminoglycans does not result in a Whether or not antibodies will be bioactive will depend on biological response. Proteoglycans are not found on red the Specific vector/target combination. Both conventional blood cells, which eliminates undesirable adsorption to these and genetically engineered antibodies may be employed, the cells. latter permitting engineering of antibodies to particular Other peptide vectors and lipopeptides thereof of particu needs, e.g. as regards affinity and Specificity. The use of lar interest for targeted ultrasound imaging are listed below: human antibodies may be preferred to avoid possible Atherosclerotic plaque binding peptide S Such as immune reactions against the vector molecule. A further 35 YRALVDTLK (SEQ ID NO: 26), YAKFRE useful class of antibodies comprises So-called bi- and multi TLEDTRDRMY (SEQ ID NO: 27) and Specific antibodies, i.e. antibodies having specificity for two RALVDTEFKVKQEAGAK (SEQ ID NO:28); Thrombus or more different antigens in one antibody molecule. Such binding peptides such as NDGDFEEIPEEYLQ (SEQ ID antibodies may, for example, be useful in promoting forma NO:29) and GPRG (SEQ ID NO:30), Platelet binding pep tion of bubble clusters and may also be used for various 40 tides such as PLYKKIIKKLLES (SEQ ID NO:31); and therapeutic purposes, e.g. for carrying toxic moieties to the cholecystokinin, C.-melanocyte-stimulating hormone, heat target. Various aspects of bispecific antibodies are described Stable enterotoxin 1, vasoactive intestinal peptide, Synthetic by McGuinness, B. T. et al. in Nat. Biotechnol. (1996) 14, alpha-M2 peptide from the third heavy chain 1149-1154; by George, A. J. et al. in J. Immunol. (1994) complementarity-determininig region and analogues thereof 152, 1802–1811; by Bonardi et al. in Cancer Res. (1993) 53, 45 for tumour targeting. 3015–3021; and by French, R. R. et al. in Cancer Res. The following tables identify various vectors which may (1991) 51, 2353–2361. be targeted to particular types of targets and indicated areas ii) Cell adhesion molecules, their receptors, cytokines, of use for targetable diagnostic and/or therapeutic agents growth factors, peptide hormones and pieces thereof. Such according to the invention which contain Such vectors. vectors rely on normal biological protein-protein interac 50 tions with target molecule receptors, and So in many cases Protein and Peptide Vectors-Antibodies will generate a biological response on binding with the targets and thus be bioactive; this may be a relatively insignificant concern with vectors which target proteogly Vector type Target Comments/areas of use Ref CS. 55 antibodies CD34 vascular diseases in general, 1. iii) Non-peptide agonists/antagonists or non-bioactive bind (general) normal vessel wall (e.g ers of receptorS for cell adhesion molecules, cytokines, myocardium), activated growth factors and peptide hormones. This category may endothelium, immune cells antibodies ICAM-1 vascular diseases in general 1. include non-bioactive vectors which will be neither agonists (general) normal vessel wall (e.g nor antagonist but which may nonetheless exhibit valuable 60 myocardium), activated targeting ability. endothelium, immune cells iv) oligonucleotides and modified oligonucleotides which antibodies ICAM-2 vascular diseases in general 1. (general) normal vessel wall (e.g bind DNA or RNA through Watson-Crick or other types of myocardium), activated base-pairing. DNA is usually only present in extracellular endothelium, immune cells Space as a consequence of cell damage, So that Such 65 antibodies ICAM-3 vascular diseases in general 1. oligonucleotides, which will usually be non-bioactive, may (general) normal vessel wall (e.g be useful in, for example, targeting of necrotic regions, US 6,264,917 B1 25 26 REFERENCES -continued a) Heider, K. H., M. Sproll, S. Susani, E. Patzelt, P. Beaumier, E. Ostermann, H. Ahorn, and G. R. Adolf. 1996. Vector type Target Comments/areas of use Ref “Characterization of a high-affinity monoclonal antibody myocardium), activated specific for CD44v6 as candidate for immunotherapy of endothelium, immune cells Squamous cell carcinomas'. Cancer Immunology Immuno antibodies E-selectin vascular diseases in general therapy 43: 245-253. (general) normal vessel wall (e.g myocardium), activated b) I. Roitt, J. Brostoff, and D. Male. 1985. Immunology, endothelium, immune cells London: Gower Medical Publishing, p. 4.7 P-selectin vascular diseases in general c) Stromblad, S., and D. A. Cheresh. 1996. “Integrins, normal vessel wall (e.g myocardium), activated angiogenesis and vascular cell Survival’. Chemistry & Biol endothelium, immune cells ogy 3: 881-885. PECAM vascular diseases in general Protein and Peptide Vectors-Cell Adhesion Molecules etc. (general) normal vessel wall (e.g myocardium), activated 15 endothelium, immune cells antibodies Integrins, vascular diseases in general Vector type Target Comments/areas of use Ref (general) e.g. VLA-1, normal vessel wall (e.g VLA-2, myocardium), activated L-selectin CD34 vascular diseases in 3 VLA-3, endothelium, immune cells MadCAM1 general, normal vessel VLA-4, GlyCam 1 wall (e.g. myocar VLA-5, dium), activated VLA-6, endothelium, Lymph f51C-7, nodes B1Cls, B1Clv, Other selectins carbohydrate vascular diseases in 14 LFA-1, Mac ligands general, normal 1, CD41a, (sialyl Lewis X) vessel wall etc. 25 heparan sulfate (e.g. myocardium), antibodies GlyCAM Vessel wall in lymph nodes activated endothelium (general) (quite specific for lymph nodes) RGD-peptides integrins vascular diseases in 2 antibodies MadCam 1 Vessel wall in lymph nodes general, normal (general) (quite specific for lymph nodes) vessel wall antibodies fibrin Thrombi (e.g. myocardium), (general) activated endothelium antibodies Tissue Activated endothelium, tumours PECAM PECAM, Endothelium, 15 (general) Factor and other Cells in antibodies Myosin Necrosis, myocardial infaction immune system (general) Integrins, Laminin, Endothelium, 16 antibodies CEA Tumours e.g. VLA-1, VLA- collagen, Vessel wall (general) (carcino 35 2. VLA-3, VLA-4, fibronectin, etc. embryonal VLA-5, VLA-6, VCAM-1, thrombo antigen) f51C-7, 31Cls. spondin, antibodies Mucins Tumours BC, LFA-1, vitronectin etc. (general) Mac-1, CD41a, antibodies Multiple Tumours etc. (general) drug 40 Integrin Integrins, Cells in immune 17 resistance receptors, e.g. VLA-1, VLA- system vessel 18 protein e.g. Laminin, 2. VLA-3, VLA-4, wall etc. antibod ies Prostate Prostate cancer collagen, VLA-5, VLA-6, (genera ) specific fibronectin, f51C-7, 31Cls. antigen VCAM-1, BC, LFA-1, antibod ies Cathepsin B Tumours (proteases of various 1O 45 thrombospondin, Mac-1, CD41a, (genera ) kinds are often more or less vitronectin etc. etc. specifically overexpressed in a Nerve cell proteoglycans 19 variety of tumours - Cathepsin B adhesion N-CAM is such a protease) molecule (N-CAM) (homophilic) antibodies Transferrin Tumors, 11 integrin Civ3 CD31 (PECAM-1) endothelial cells (genera l) receptor vessel wall RGD-peptides integrins angiogenesis C MOAb Tumours 12 50 9.2.27 Antigen unregulated on cell growth VAP-1 Adhesion molecule 13 Vectors Comprising Cytokines/growth Factors/peptide Hor Band 3 Upregulated during phagocytic protein activity mones and Fragments. Thereof antibodies CD34 endothelial cells (sialomucin) 55 antibodies CD 31 endothelial cells (PECAM-1) Vector type Target Comments fareas of use Ref antibodies intermediate tumour cells filaments Epidermal growth EGF-receptor or Tumours 2O factor related necrotic receptors cells/tissue 60 Nerve growth NGF-receptor Tumours 21 CD44 factor antibodies B2-micro general Somatostatin ST-receptor Tumours 22 antibodies globulin general Endothelin Endothelin- Vessel wall MHC class 1 receptor antibodies integrin tumours; angiogenesis Interleukin-1 IL-1-receptor Inflammation, activated 23 antibodies Civ3 65 cells of different kinds Interleukin-2 IL-2-receptor Inflammation, activated 24 US 6,264,917 B1 27 28

-continued -continued Vector type Target Comments/areas of use Ref Vector type Target Comments fareas of use Ref cells of different kinds apolipoprotein B receptors Chemokines (ca. Chemokine Inflammation 25 (e.g., LDL 20 different receptors, receptor) cytokines partly proteoglycans Apollipoprotein E LDL receptor 42 sharing proteoglycans receptors) Adhesion- proteoglycans 43 Tumour necrosis TNF-receptors Inflammation promoting factor proteins, Parathyroid PTH-receptors Bone diseases e.g. Purpurin hormone Kidney diseases Viral coat proteoglycans 44 Bone BMP-receptors Bone Diseases proteins, Morphogenetic e.g. HIV. Herpes Protein 15 Microbial fibronectin, 45 Calcitonin CT-receptors Bone diseases adhesins, e.g. collagen, Colony Corresponding Endothelium 26 “Antigen 85' fibrinogen, stimulating specific complex of vitronectin, factors (G-CSF, receptors, mycobacteria heparan sulfate GM-CSF, M-CSF, proteoglycans B-amyloid proteoglycans f-amyloid accumulates in 46 IL-3) precursor Alzheimer's disease Insulin like IGF-I receptor Tumours, Tenascin, heparan sulfate, 47 growth factor I other growing tissues e.g. tenascin C integrins Atrial ANF-receptors Kidney, Natriuretic vessel wall Factor Vectors Comprising Non-peptide AgonistS/antagonists or Vasopressin Vasopressin Kidney, receptor vessel wall 25 Non-bioactive Binders of Receptors for Cytokines/growth VEGF VEGF-receptor Endothelium, Factors/peptide Hormones/cell Adhesion Molecules regions of angiogenesis Fibroblast FGF-receptors, Endothelium 27 growth factors Proteoglycans Angiogenesis Schwann cell proteoglycans 28 growth factor specific Vector type Target Comments/areas of use Ref receptors Several agonists/ 48 antagonists are known 49 for such factors acting through Miscellaneous Protein and Peptide Vectors G-protein coupled 35 receptors Endothelin Endothelin Vessel wall antagonist receptor Vector type Target Comments/areas of use Ref Desmopressin Vasopressin Kidney (vasopressin receptor Vessel wall Streptavidin Kidney Kidney diseases 29 analogue) Bacterial Fibronectin Vessel wall 3O 40 Demoxytocin Oxytocin Reproductive organs, fibronectin (Oxytocin Receptor Mammary glands, binding proteins analogue) Brain Fc-part of Fc-receptors Monocytes 31 Angiotensin II Angiotensin II Vessel wall antibodies macrophages receptor receptors brain liver antagonists adrenal gland Transferrin transferrin- Tumours 11 45 CV-11974, receptor vessel walls TCV-116 Streptokinase? thrombi thrombi non-peptide RGD- integrins Cells in immune 50 tissue analogues system vessel plasminogen wall etc. activator Plasminogen, Fibrin Thrombi, 32 plasmin tumours 50 Mast cell proteoglycans 33 Vectors Comprising Anti-angiogenic Factors proteinases Elastase proteoglycans 34 Lipoprotein proteoglycans 35 lipase Vector type Target Comments fareas of use Ref Coagulation proteoglycans 36 55 enzymes Angiostatin EC of tumors plasminogen fragment K Extracellular proteoglycans 37 cartilage-derived EC of tumors J Superoxide inhibitor dismutase B-Cyclodextrin tumors, C Heparin cofactor proteoglycans 38 tetradecasulfate inflammation II 60 fumagillin and analogs tumors, E Retinal survival proteoglycans 39 inflammation factor specific Interferon-C. EC of tumors K receptors Interferon-Y EC of tumors E Heparin-binding proteoglycans 40 interleukin-12 EC of tumors E brain mitogen specific linomide tumors, A. receptors inflammation Apollipoprotein, proteoglycans 41 65 medroxyprogesterone EC of tumors K C.S. specific metalloproteinase EC of tumors K US 6,264,917 B1 29 30

-continued -continued Vector type Target Comments/areas of use Ref Comments/areas Vector type Target of use Ref inhibitors pentosan polysulfate EC of tumors endosialin umors, platelet factor 4 EC of tumors inflamma ion Somatostatin EC of tumors endostatin collagen umors, Suramin EC of tumors fragment inflamma ion Taxol EC of tumors Factor VII related umors, thalidomide EC of tumors antigen inflamma ion Thrombospondin EC of tumors fibrinopeptides umors, inflamma ion fibroblast growth factor, umors, Vectors Comprising Angiogenic Factors basic inflamma ion hepatocyte growth factor umors, 15 inflamma ion insulin-like growth umors, factor inflamma ion Comments/areas interleukins umors, Vector type Target of use Ref inflamma ion leukemia inhibitory umors, acidic fibroblast growth ECO OS factor inflamma ion actor metalloproteinase umors, e.g., batimastat adenosine ECO OS inhibitors inflamma ion Angiogenin ECO OS Monoclonal antibodies umors, for instance: to Angiotensin II ECO OS inflamma ion angiogenetic factors basement membrane tumors e.g., tenascin, or their receptors, components collagen IV or to components of basic fibroblast growth ECO OS 25 the fibrinolytic actor system Bradykinin ECO OS peptides, for instance umors, Calcitonin gene-related ECO OS cyclic RGDFV inflamma ion peptide placental growth factor umors, epidermal growth factor ECO OS inflamma ion Fibrin tumors placental umors, Fibrinogen tumors proliferin-related inflamma ion Heparin ECO OS protein histamine ECO OS plasminogen umors, hyaluronic acid or fragments ECO OS inflamma ion hereof plasminogen activators umors, Interleukin-1C. ECO OS 35 inflamma ion aminin, laminin fragments ECO OS plasminogen activator umors, nicotinamide ECO OS inhibitors inflamma ion platelet activating factor ECO OS platelet activating umors, inhibitors of Platelet-derived endothelial ECO OS actor antagonists inflamma ion angiogenesis growth factor platelet-derived growth umors, prostaglandins E1, E2 ECO OS actor inflamma ion 40 spermine ECO OS pleiotropin umors, spermine ECO OS inflamma ion Substance P ECO OS proliferin umors, ransforming growth factor-C. ECO OS inflamma ion ransforming growth factor-f ECO OS proliferin related umors, Tumor necrosis factor-C. ECO OS protein inflamma ion vascular endothelial growth ECO OS 45 selectins umors, e.g., E-selectin D actor/vascular permeability inflamma ion actor SPARC umors, vitronectin A. inflamma ion snake venoms umors, (RGD-containing) inflamma ion Vector Molecules Other Than Recognized Angiogenetic 50 Tissue inhibitor of umors, eg, TIMP-2 Factors with Known Affinity for Receptors Associated with metalloproteinases inflamma ion thrombin umors, Angiogenesis inflamma ion thrombin-receptor-activating umors, tetradecapeptide inflamma ion 55 thymidine phosphorylase umors, Comments/areas inflamma ion Vector type Target of use Ref tumor growth factor umors, inflamma ion angiopoietin tumors, B inflammation C2-antiplasmin tumors, inflammation 60 ReceptorS/targets ASSociated with Angiogenesis combinatorial libraries, tumors, for instance: compounds from inflammation compounds that bind to basement membrane after Vector type Target Comments fareas of use Ref degradation endoglin tumors, D 65 biglycan tumors, dermatan sulfate inflammation inflammation proteoglycan US 6,264,917 B1 31 32

-continued -continued Vector type Target Comments/areas of use Ref Vector type Target Comments fareas of use Ref

CD34 umors, urokinase-type tumors, D inflamma ion plasminogen activator inflammation CD44 umors, receptor inflamma ion Vascular cellular tumors, D collagen type I, IV, umors, adhesion molecule inflammation VI, VIII inflamma ion (VCAM) decorin umors, dermatan sulfate Vascular endothelial tumors, inflamma ion proteoglycan growth factor related inflammation dermatan sulfate umors, protein proteoglycans inflamma ion Vascular endothelial tumors, K endothelin umors, growth factor-A inflammation inflamma ion receptor endothelin umors, 15 von Willebrand factor- tumors, L receptors inflamma ion related antigen inflammation fibronectin OS FIk-1/KDR, Flt-4 umors, VEGF receptor E. inflamma ion Oligonucleotide Vectors FLT1 (fms-like umors, VEGF-A receptor tyrosine kinase) inflamma ion heparan sulfate umors, inflamma ion hepatocyte growth umors, Vector type Target Comments fareas of use Ref inflamma ion factor receptor (c-met) Oligonucleotides DNA made Tumours 51 insulin-like growth umors, factorfmannose-6- inflamma ion complementary to available by Myocardial infarction phosphate receptor 25 repeated necrosis All other diseases that integrins Tumors, Sequences, e.g. involves necrosis inflamma ion genes for fs and fs, ribosomal RNA, integrin Cly?is, Alu-sequences integrin Clo?1, . laminin receptor Oligonucleotides DNA made Tumours 51 integrins C6, complementary to available by integrins f, disease-specific necrosis in a integrin Clf1, mutations (e.g. region of the integrin Cly?is, mutated relevant disease integrin Cls subunit of the fibronectin oncogenes) receptor Oligonucleotides DNA of infective Viral or bacterial 51 integrin Cly?is, complementary to agent infections fibrin receptors. 35 DNA of infecting Intercellular adhesion umors, agent. molecule -1 and -2 inflamma ion Triple or As in above As in above examples 51 Jagged gene product umors, quadruple-helix examples inflamma ion forming Ly-6 umors, a lymphocyte activation inflamma ion oligonucleotides protein 40 Oligonucleotides DNA-binding Tumours matrix umors, with recognition protein, e.g. Activated endothelium metalloproteinases inflamma ion MHC class II sequence for transcription Activated immune cells umors, DNA- or RNA- factors (often inflamma ion binding proteins Overexpressed/ Notch gene product umors, activated in inflamma ion 45 tumours Or Osteopontin OS activated PECAM umors, alias CD31 inflamma ion immune cells plasminogen activator umors, receptor inflamma ion platelet-derived growth umors, factor receptors inflamma ion 50 Modified Oligonucleotide Vectors Selectins: E-, P umors, inflamma ion Sialyl Lewis-X umors, blood group antigen inflamma ion Vector type Target Comments fareas of use Ref stress proteins: umors, molecular chaperones glucose regulated, inflamma ion 55 Phosphoro- As for unmodified oligos. As for unmodified oligos 51 heat shock families and thioate others oligos syndecan umors, 2'-O-methyl " 51 inflamma ion substituted thrombospondin umors, oligos inflamma ion circular 51 60 TIE receptors umors, tyrosine kinases with Ig oligos inflamma ion and EGF-like domains oligos 51 tissue factor umors, containing inflamma ion hairpin tissue inhibitor of umors, e.g., TIMP-2 Structure to metalloproteinases inflamma ion decrease transforming growth umors, 65 degradation factor receptor inflamma ion oligos with " 51 US 6,264,917 B1 33 34

-continued -continued Vector type Target Comments/areas of use Ref Vector type Target Comments fareas of use Ref terminal inhibitors or less specifi phosphoro e.g. N-acetyl- cally overexpress thioate Leu-Leu- proteases of 2'-fluoro 51 norleucinal various kinds, e.g. oligos Cathepsin B 2'-amino 51 bestatin Aminopeptidases Tumours, oligos ((2S,3R)-3- e.g. on cell surfaces DNA Increased binding affinity 52 Amino-2- binding as compared to pure hydroxy drugs oligos 4-phenyl conjugated butanoyl-L- to oligos leucine (for 15 hydrochloride) examples, Pefabloc (4-(2- Serine proteases Tumours, see below) aminoethyl)- vessel wall Peptide Increased binding affinity 53 benzenesulfonyl etc. Nucleic and stability compared to fluoride Acids standard oligos. hydrochloride) (PNAs, Commercially Angiotensin Endothelial cells oligo available converting nucleotidss inhibitors enzyme with a pep e.g. kaptopril tide enalapri backbone) ricionopril Low specificity Coagulation Vessel wall injury, 25 non-peptidic factors tumours, Nucleoside and Nucleotide Vectors compounds etc. Protease nexins proteoglycans 56 (extracellular protease inhibitors) Vector type Target Comments fareas of use Ref Antithrombin proteoglycans, 57 Adenosine or Adenosine Vessel wall 54 Coagulation analogues receptors Heart factors ADP, UDP, UTP Various Many tissues, e.g. brain, 55 and others nucleotide spinal cord, kidney, spleen receptors Vectors from Combinatorial Libraries 35 Receptors Comprising DNA-binding Drugs Vector type Target Comments fareas of use Ref

40 Antibodies with Any of above Any diseased or normal 58, Vector type Target Comments fareas of use Ref Structure argets - or may structure of interest, e.g. 59, determined be unknown thrombi, tumours or walls of 60 acridine DNA made Tumours, during when make myocardial vessels derivatives available by Myocardial infarction and generation functional distamycin necrosis all other diseases involving process selection of netropsin necrosis or other processes vector binding actinomycin D liberating DNA from cells 45 O chosen echinomycin diseased bleomycin etc. Structure Peptides with Any of above Any diseased or normal 58, sequence argets - or may structure of interest, e.g. 59, Receptors Comprising Protease Substrates determined be unknown thrombi, tumours or walls of 60 50 during when make myocardial vessels generation functional process selection of vector binding Vector type Target Comments fareas of use Ref O chosen Peptidic or non Cathepsin B Tumours, a variety of which diseased 55 Structure peptidic may more or less specifically Oligonucleotides Any of above Any diseased or normal 58, Substrates Overexpress proteases of with sequence argets - or may structure of interest, e.g. 59, various kinds, e.g. determined be unknown thrombi, tumours or walls of 60 Cathepsin B during when make myocardial vessels generation functional process selection of Receptors Comprising Protease Inhibitors 60 vector binding O chosen diseased Structure Vector type Target Comments/areas of use Ref Modifications of Any of above Any diseased or normal 58, oligos obtained argets - or may structure of interest, e.g. 59, Peptidic or non Cathepsin B Tumours, a variety 65 as above be unknown thrombi, tumours or walls of 60 peptidic of which may more when make myocardial vessels US 6,264,917 B1 35 36

-continued -continued Vector type Target Comments fareas of use Ref Vector type Target Comments fareas of use Ref functional Betablockers Adrenergic beta- Myocardium for beta-1 selection of receptors blockers vector binding Alpha-blockers Adrenergic Vessel wall to chosen alpha-receptors diseased benzodiazepines Structure serotonin- Serotonin Other chemicals Any of above Any diseased or normal 58, analogues receptors with structure targets - or may structure of interest, e.g. 59, anti-histamines Histamine- Vessel wall determined be unknown thrombi, tumours or walls of 60 receptors during when make myocardial vessels Acetyl-choline ACh-receptors generation functional receptor process selection of antagonists vector binding 15 Verapamil Ca'-channel Heart muscle to chosen blocker diseased nifedipin Cat-channel Heart muscle Structure blocker

Representative examples of drugs useful in accordance Carbohydrate Vectors with the invention include: abamectin, abundiazole, acaprazine, acabrose, acebrochol, aceburic acid, acebutolol, ace calinide, ace carbromal, aceclidine, ace clofenac, ace dapsone, ace diasulfone, acedoben, ace fluranol, Vector type Target Comments/areas of use Ref acefurtiamine, acefylline clofibrol, acefylline piperazine, CO macrophages general activation? 25 aceglatone, aceglutamide, ace glutamide aluminium, glycoproteins inflammation acemetacin, acenocoumarol, aceperone, acepromazine, oligosaccharides Asialo- liver 61 with terminal glycoprotein aceprometazine, acequinoline, aceSulfame, acetaminophen, galactose receptor acetaminoSalol, acetanilide, acetarSone, acetazolamide, Hyaluronan aggrecan (a 62 acetergamine, acetiamine, acetiromate, acetohexamide, proteoglycan) acetohydroxamic acid, acetomeroctol, acetophenazine, “link proteins' acetorphine, acetoSulfone, acetriozate, acetryptine, acetyl cell-surface receptors: CD44 choline chloride, acetylcolchinol, acetylcy Steine, Mannose Blood brain barrier, 63 acetyldigitoxin, acetylleucine, acetylsalicyclic acid, Brain tumours and other acevaltrate, aceXamic acid, acifran, acipimox, acitemate, diseases causing changes 35 acitretin, acivicin, aclantate, aclarubicin, aclatonium in BBB napadisilate, acodazole, aconiazide, aconitine, acoXatrine, Bacterial Blood brain barrier, 64 glycopeptides Brain tumours and other acridorex, acrihellin, acrisorcin, acrivastine, acrocinide, diseases causing changes acronine, actinoquinol, actodigin, acyclovir, adafenoxate, in BBB adamexine, ademetionine, adenosine phosphate, adibendan, adicillin, adimolol, adinazolam, adiphenine, aditeren, 40 aditoprim, adrafinil, adrenalone, afloqualone, afurolol, (Glyco)Lipid Vectors aganodine, ajmaline, aklomide, alacepril, alafosfalin, ala nine mustard, alanosine, alaproclate, alazanine triclofenate, albendazole, albendazole oxide, albute rol, albutoin, alclofenac, alcometasone dipropionate, alcloxa, alcuronium Vector type Target Comments/areas of use Ref 45 chloride, aldioxa, aldosterone, alepride, aletamine, alexidine, alfacalcidol, alfadeX, alfadolone, alfaprostol, GM1 gangliosides cholera bacteria diagnosis/treatment of in the cholera alfaxalone, alfentanil, alfuZosin, algestone acetonide, alge gastrointestinal Stone acetophenide, alibendol, aliconazole, allife drine, tract aliflurane, alimadol, alinidine, alipamide, alitame, platelet PAF receptors diagnosis of inflammation 50 alizapride, allantoin, alletorphine, allobarbital, alloclamide, activating allocupreide, allomethadione, allopurinol, allylestrenol, factor (PAF) antagonists allyl isothicyanate, allylprodine, allylthiourea, almadrate Prostoglandin Prostoglandin diagnosis of inflammation Sulfate, almasilate, almecillin, almestrone, alminoprofen, antagonists of receptors almitrine, almoxatone, alonacic, alonimid, aloxiStatin, inflammation 55 aloZafone, alpertine, alphacetylmethadol, alphameprodine, Thromboxane Leukotriene diagnosis of inflammation antagonists of receptors alphamethadol, alphaprodine, alpha-Vinylaziridinoethyl inflammation acetate, alpidem, alpiropride, alprazolam, alprenolol, alproStadil, alrestatin, altanserin, altapizone, alteconazole, althiazide, altrenogest, altretamine, aluminium acetate, alu Small Molecule Vectors 60 minium clofibrate, aluminium Subacetate, alverine, amadi none acetate, amafolone, amanozine, amantadine, amanta nium bromide, amantocillin, ambasilide, ambaZone, ambenonium chloride, ambenoxan, ambroXol, ambruticin, Vector type Target Comments/areas of use Ref ambucaine, ambucetamide, ambuphylline, ambuSide, ambu Adrenalin Corresponding 65 tonium bromide, amcinafal, amcinafide, amcinonide, receptors amdinocillin, amdinocillin pivoxil, amebucort, amedalin, ametantrone, ameZepine, ameZinium metilsulfate, amfenac, US 6,264,917 B1 37 38 amfepentorex, amfetaminil, amflutizole, amfonelic acid, benoxaprofen, benoximate, benperidol, beinproperine, amicarbalide, amicibone, amicloral, amicycline, amidantel, benrixate, benSalan, benSeraZide, benSuldaZic acid, amidapsone, amidephrine, amiflamine, amifloverine, bentazepam, bentemazole, bentiamine, bentipimine, amifloxacin, amifostine, amikacin, amikhelline, amiloride, bentiromide, benurestat, benzaldehyde, benzalkonium aminacrine, amindocate, amineptine, aminobenzoic acid, chloride, benzaprinoxide, benzarone, benzbromarone, aminocaproic acid, aminoethyl nitrate, aminoglutethimide, benze Strol, benzethidine, ben Zethonium chloride, aminohippuric acid, aminometradine, aminopentamide, ben Zetimide, ben Zilonium bromide, ben Zindopyrine, aminophylline, aminopromazine, aminopterin, aminopyrine, benziodarone, benzmalecene, benznidazole, benzobarbital, aminoquinol, aminoquinuride, aminorex, aminoSalicyclic benzocaine, benzoclidine, benzoctamide, benzodepa, ben acid, aminothiadiazole, aminothiazole, amiodarone, Zododecinium chloride, benzoic acid, benzoin, benzonatate, amiperone, amiphe azole, amipizone, amiprilose, benzopyrronium bromide, benzoquinium chloride, amidulinsin, amisometradine, amisulpride, amiterol, benzotript, benzoxicuine, benzoxonium chloride, benzoyl amithioZone, amitraz, amitriptyline, amitriptylinoxide, peroxide, benzoylpas, benzphetamine, benzpiperylon, ben amiXetrine, amlexanox, amlodipine, amobarbital, Zpyrinium bromide, be nZGuercin, benzquinamide, a modiaquine, amogastrin, amola none, amonofide, 15 benzthiazide, benztropine, benzydamine, benzylpenicillin, amoproxan, amopyro quin, amorolfine, amocanate, benzylsulfamide, beperidium iodide, bephenium naphtoate, amo Sulalol, amotriphene, amoxapine, amoxecaine, bepiastine, bepridil, beraprost, berberine Sulfate, bermastine, amoxicillin, amoxydramine camsilate, amperozide, bermoprofen, berythromycin, beSulpamide, beslunide, beta amphecloral, amphenidone, amphetamine, amphotalide, caroteine, betacetylmethadol, betahistine, betaine, amphotericin B, amplicillin, ampiroXicam, amprolium, betameprodine, betamethadol, betamethasone, betametha ampyrimine, ampyZine, amduinate, amrinone, amsacrine, Sone acetate, betamethasone acibutate, betamethasone amygdalin, amylene, amylmetacresol, amyl nitrite, anage benzoate, betamethasone dipropionate, betamethasone Stone acetate, anagrelide, anaXirone, anazocine, anazolene, phosphate, betamethasone Valerate, betamicin, betaprodine, ancarolol, ancitabine, androstanediol, androstanol betaxolol, betazole, bethanechol chloride, bethanidine, propionate, androstenetrione, androstenonol propionate, 25 betiatide, betoxycaine, bevantolol, bevonium metilsulfate, anethole, anguidine, anidoxime, anilamate, anilleridine, bezafibrate, bezitramide, bialamicol, bibenzonium bromide, aniline, anilopam, anipamil, aniracetam, anirolac, anisacril, bibrocathol, bicifadine, biclodil, biclofibrate, biclotymol, anisindione, anisopirol, aniSoylbromacrylic acid, bico Zamycin, bidima Zium iodine, bietamiverine, anitraZafen, anpirtoline, anSoxetine, antafenite, antazoline, bietaserpine, bife melane, bife pramide, bifluranol, anta Zonite, anthelmycin, anthiolimine, anthralin, bifonazole, binedaline, binfloxacin, binfibrate, bioallethrin, anthramycin, antienite, antimony potassium tartrate, anti bioresmethrin, biotin, bipenamol, biperiden, biphenamine, mony thioglycolate, antipyrine, antrafenine, apalcillin, biriperone, bisacodyl, bisantrene, bis(aziridinyl)butanediol, apa Zone, apicycline, apomorphine, apo Vincamine, bisbendazole, bisbentiamine, bisfenaZone, bisfentidine, bis apraclonidine, apramycin, aprindine, aprobarbital, aprofene, muth betanaphthol, bismuth-triglycollamate, bismuth aptazapine, aptocaine, arabinosylmercaptopurine, aranotin, 35 Subgallate, bismuth Subsalicylate, bisorbin, bisoprolol, arbaprostil, arbekacin, arclofenin, arfendazam, arginine, bisorcic, bioxatin acetate, bispyrithione magSulfeX, arginine glutamat, arildone, arnolol, aronixil, arotinolol, bithionol, bithionoloxide, bitipaZone, bitoterol, bitOScantate, arpinocid, arpromidine, arSanilic acid, arSthinol, artemisinin, bleomycin, blue nSomycin, bofumustine, bolandiol articaine, asaley, ascorbic acid, ascorbyl palmitate, dipropionate, bolasterone, bolazine, bolde none asocainol, aspartame, aspartic acid, asperlin, aspoxicillin, 40 undecylenate, bolenol, bolmantalate, bometolol, bopindolol, astemizole, atameStane, atenolol, atipameZole, atiproSin, bornaprine, bornaprolol, bornelone, botiacrine, boxidine, atolide, atracurium besilate, atromepine, atropine, atropine brallobarbital, braZergoline, brefonalol, bremazocine, oxide, auranofin, aurothoiglucose, aurothioglycanide, brequinar, bretylium tosylate, brindoxime, brivundine, avilamycin-A, avridine, aXamozide, azabon, azabuperone, brobactam, broclepride, brocresine, brocrinat, brodimoprim, aZacitodine, a Zaclor Zine, a Zaconazole, a Zacosterol, 45 brofaromine, brofe Zil, brofoXine, brolaconazole, azacyclonol, azaftoZine, azaguanidine, azaloxan, azametho brolamfetamine, bromacrylide, bromadoline, bromamid, nium bromide, azamulin, azanator, azanidazole, azaperone, bromazepam, brom chlore none, brome bric acid, aZapicyl, azaprocin, a Zaquinzole, a Zaribine, azarole, bromerguride, brometenamine, bromfenac, brom hexine, aZaSerine, azaspirium chloride, azastene, azastrptonigrin, bromindione, bromisoValum, bromociclen, bromocriptine, aZatodine, azathioprine, azauridine, azelastine, aZepeXole, 50 bromodiphenhydramine, bromofenofos, bromopride, aZepindole, azetepa, azidamfenicol, azidocillin, azimeXon, bromoxandide, bromperidol, bromperidol decanoate, aZintamide, azipramine, azithromycin, azlocillin, azolimine, brompheniramine, bronopol, broparestrol, broperamole, a ZoSemide, a Zotomycin, aztreonam, a Zumolene, bropirimine, broquinaldol, broSotamide, broSuximide, bacampicillin, baclofen, bacmecillinam, balsalazide, brotianide, brotizolam, brovane Xine, brovincamine, bamaluzole, bambuterol, bamethan, bamifylline, bamipine, 55 broXaldine, broXaterol, broxitalamic acid, broXuridine, bamnidazole, baduiloprim, barbexaclone, barbital, broxyquinoline, bruceantin, brucine, bucainide, bucetin, barucainide, batilol, baZinaprine, becanthone, beclamide, buciclovir, bucillamine, bucindolol, bucladeSine, buclizine, beclobrate, beclomethasone dipropionate, beclotiamine, bu closamide, bucloxic acid, bucolome, bucricaine, befiperide, befunolol, befuraline, bekanamycin, belarizine, bucromarone, bucrylate, bucumolol, budesonide, budipine, beloxamide, be marinone, be me gride, be metizide, 60 budotitane, budralazine, bufenadrine, bufeniode, bufetolol, be mitradine, benacty Zine, benafeintrine, benanserin, bufeXamac, bufeZolac, buflomedil, bufogenin, buformin, benapry Zine, benaxibine, benazepril, bencianol, bencisteine, bufrolin, bufuralol, bumadizone, bumecaine, bumepidil, benclonidine, bency clane, bendamustine, bendaZac, bu metanide, bumetrizole, bunaftine, bunamidine, bendazol, benderizine, bendroflumethiazide, benethamide bunamiodyl, bunaprolast, bunaZosin, bunitrolol, bunolol, penicillin, benexate, benflorex, benfosformin, benfotiamine, 65 buparvaquone, bupicomide, bupivacaine, bupranolol, benfurodil hemisuccinate, benhepaZone, benidipine, buprenorphine, bupropion, buquine ran, buquinolate, benmoxin, benolizime, benorilate, benorterone, benoxafos, buquiterine, buramate, burodiline, buSpirone, buSulfan, US 6,264,917 B1 39 40 butabarbital, but acaine, but acetin, but a clamol, chlordiazepoxide, chlordimorine, chlorhexadol, butadia Zamide, butafosfan, but alamine, but albital, chlorhexidine, chlorhexidine phosphanilate, chlorindanol, butamben, butamirate, butamisole, butamoxane, butanediol chlorisondamine chloride, chlormadinone acetate, cyclic Sulfite, butanilicaine, butaniXin, butanserin, chlormero drin, chlorime Zanone, chlormidazole, butantrone, butape razine, but a prost, but averine, chloronaphazine, chloroaZodin, chlorobutanol, chlorocreSol, butedronate, buterizine, bute tamate, but ethamine, chlorodihydroxyandrostenone, chloroethyl meSylate, buthiazide, butibufen, butidrine, butikacin, butilfenin, 5-chloro-3'-fluoro-2'3-dideoxyuridine, chloroguanide, butinazocine, butinoline, butirosin, butixirate, butobendine, chlorophe no thane, chlorop rednisone acetate, butoconazole, butocrolol, butoctamide, butofilolol, chloroprocaine, chloropyramine, chloroquine, butonate, butopamine, butopiprine, butoprozine, butopy chloroSerpidine, chlorothen, chlorothiazide, chlorotriansene, rammonium iodide, butorphanol, butoxamine, butoxylate, chloroxine, chloroxylenol, chlorozotocin, chlorphenesin, butriptyline, butropium bromide, butylated hydroxyanisole, chlorphenesin carbamate, chlorpheniramine, chlorphenoc butylated hydroxytoluene, butylparaben, butynamine, tium amSonate, chlorphenoxamine, chlorphentermine, buZepide metiodide, cabastine, cabergoline, cadralazine, chlorproetha Zine, chlorproguanil, chlorpromazine, cafaminol, cafedrine, caffeine, calcifediol, calcitrol, calcium 15 chlorpropamide, chlorprothixene, chlorquinaldol, citrate, calcium dobesilate, calcium glubionate, calcium chlortetracycline, chlorthalidone, chlorthenoxazine, gluceptate, calcium gluconate, calcium glycerophosphate, chlorZoaXaZone, chloecalciferol, cholic acid, choline calcium hypophosphite, calcium lactate, calcium chloride, choline glycerophosphate, chromocarb, lactobionate, calcium levulinate, calcium mandelate, cal chromonar, ciadox, ciameXon, cianergoline, cianidol, cium pantothenate, calcium phosphate dibasic, calcium cianopramine, ciapilome, cicaprost, cicarperOne, ciclactate, phophate tribasic, calcium Saccharate, calcium Stearate, ciclafrine, ciclaZindol, cicletanine, ciclomenol, ciclonicate, calusterone, camazepam, cambendazole, camiverine, ciclonium bromide, ciclopiroX, ciclopramine, cicloprofen, camoStast, camphotamide, camptothecin, camylofin, cicloprolol, ciclosidomine, ciclotizolam, ciclotropium can bisol, cannabinol, can renoic acid, can re none, bromide, cicloxilic acid, cicloxolone, cicortonide, cicrotic cantharidine, capobenic acid, capreomycin, caproxamine, 25 acid, cido Xepin, cifenline, cifostodine, ciglitaZone, capsaicine, captamine, captodiame, captopril, capuride, ciheptolane, ciladopa, cilastatine, cilaZapril, cilaZaprilat, caracemide, caramiphen, carazolol, carbachol, carbadox, cilobamine, cillofungin, ciloStamide, ciloStaZol, ciltoprazine, carbaldrate, carbamazepine, carbamide peroxide, carbantel cimaterol, cimenoxin, cimepanol, cimetidine, cimetropium lauryl Sulfate, carbaril, carbarSone, carbaspirin calcium, bromide, cimoxatone, cinchonine, cinchophen, cinecromen, carbaZeran, carbazochrome, carbazachrome Salicylate, car cine paXadil, cinepaZet, cinepa Zic acid, cinepa Zide, bazachrome Sulfonate, carbazocine, carbeniciltin, carbeni cinfenine, cinfenoac, cinflumide, cingestol, cinitapride, cillin indanyl, carbencillin phenyl, carbenoXolone, cinmetacin, cinnamaverine, cinnamedrine, cinnarizine, cin carbenzide, carbe Strol, carbe tapentane, carbidopa, narizine clofibrate, cinnofuradione, cincotramide, cinodine, carbimazole, carbinoxamine, carbiphene, carbocloral, cinolazepam, cinoquidox, cinoaxin, cinoxate, cinoXolone, carbocysteine, carbofenotion, carbol-fuSchin, carbomycin, 35 cino OXopaZide, cinperene, cinprazole, cinpropa Zide, carboplatin, carboprost, carboprost methyl, carboquone, cinromide, cintaZone, cintriamide, cinperone, ciprafamide, carbromal, carbubarb, carburazepam, carbutamide, ciprafaZone, ciprefadol, ciprocinonide, ciprofibrate, carbuterol, carcainium chloride, carebastine, carfentanil, ciprofloxacin, cipropride, ciprocquaZone, ciprostene, carfimate, carisoprodol, carmantadine, carmetizide, ciramadol, cirazoline, cisapride, cisconazole, cismadinone, carmofur, carmustine, carnidazole, carnitine, carocainide, 40 cisplatin, cistineXine, citalopram, citatepine, citenamide, caro Verine, caro Xa Zone, carpe ridine, cape rone, cite naZone, citicoline, citiolone, claimidoxic acid, carphenazine, carpindolol, carpiramine, carprofen, carpro clamoxyquin, clanfenur, clanobutin, clantifen, nium chloride, carSalam, cartazolate, carteolol, carubicin, clarithromycin, clavulanic acid, claZolam, clazolimine, carumonam, carvedilol, carZenide, carZolamide, cathine, claZuril, clebopride, clefamide, clemastine, clemeprol, cathinone, cefaclor, cefadroxil, cefalonium, cefaloram, 45 clemizole, clenbuterol, clenpirin, cletoquine, clibucaine, cefamandole, cefamandole naftate, cefaparole, cefatrizine, clidafidine, clidanac, clidinum bromide, climaZolam, cefazaflur, cefazedone, cefazolin, cefbuperaZone, cefcanel, climbazole, climiqualine, clindamycin, clindamycin cefcanel daloxate, cefedrolor, cefempidone, cefepime, palmitate, clindamycin phosphate, clinofibrate, clinolamide, ce fetamet, cefetrizole, cefvitril, cefixime, cefimenoXime, cliquinol, clioxanide, clipoxamine, cliprofen, clobazam, cefmepidium chloride, cefimetazole, cefminox, cefodizime, 50 clobenoside, clobenzepam, clobenzorex, clobenztropine, cefonizid, cefoperaZone, ceforanide, cefotaXime, cefotetan, clobetasol propionate, clobetasone butyrate, clobutinol, cefotiam, cefoxazole, cefoxitin, cefpimizole, cefpiramide, clobu Zarit, clocan famide, clocapramine, clociguanil, ce fpirome, cefpo do Xime, cefpo do Xime proxetil, clocinizine, clocortolone acetate, clocortolone pivalate, cefauinome, cefrotil, cefroXadine, cefSulodin, cefSumide, clocoumarol, clodacaine, clodanolene, clo dazon, ceftazidime, cefteram, cefteZole, ceftiofur, ceftiolene, 55 clodoxopone, clodronic acid, clofazimine, clofenamic acid, ceftioxide, ceftizoxime, ceftriaxone, cefuracetime, clofenamide, clofenciclan, clofenetamine, clofenoxyde, cefuroxime, cefuraxime axetil, cefurZonam, celiprolol, clofen VinfoS, clofeverine, clofeXamide, clofeZone, cephacetrile, cephalexin, cephaloglycin, cephaloridine, clofibrate, clofibric acid, clofibride, clofilium phosphate, cephalothin, cephapirin, cephradine, cetaben, cetamolol, cloflucarban, clofoctol, cloforex, clofurac, clogestone ce theXonium chloride, cetiedil, cetirizine, cetocycline, 60 acetate, cloguanamil, clomacran, clomegestone acetate, cetoheXazine, cetophenicol, cetotiamine, cetoxime, clometacin, clometherone, clomethiazole, clometocillin, ce traXate, chaulmo Sulfone, chendiol, chiniofon, clomifenoxide, clominorex, clomiphene, clomipramine, chlophedianol, chloracy Zine, chloral betaine, chloral clomocycline, clomoxir, clonazepam, clonazoline, hydrate, chloralo Se, chlorambucil, chloramine, clonidine, clonitaZene, clonitrate, clonixeril, clonixin, chloramphenicol, chloramphenicol palmitate, chloram 65 clopamide, clopen thiXol, cloperastine, cloperidone, phenicol Succinate, chlora Zanil, chlorbenzoxamine, clopidogrel, clopidol, clopimozide, clopipazan, clopirac, chlorb et amide, chlorcyclizine, chlordan to in, cloponone, cloprednol, cloprostenol, cloprothiazole, US 6,264,917 B1 41 cloquinate, cloquinozine, cloracetadol, cloranolol, dexfenfluramine, deximafen, dexindoprofen, dexivacaine, cloraZepate, clorethate, clorexolone, clorgiline, cloricromen, de Xlofexidine, de Xime de to midine, de XOXadrol, cloridarol, clorindanic acid, clorindione, clormecaine, de Xpan the nol, de Xpropranolol, de Xproxibute ne, cloroperone, clorophene, cloroqualone, clorotepine, de Xe coverine, de Xtilidine, de Xtroamphetamine, clorprenaline, clorSulon, clortermine, closantel, closiramine, deXtrofemine, dextromethorphan, dextromoramide, clostebol, clothiapine, clothixamide, clotiazepam, clotica dextrorphan, dextrothyroXine, deZaguanine, dezocine, Sone propionate, clotioxone, clotrimazole, clovoxamine, diacerein, diacetamate, diacetolol, diacetylmorphine, cloxace pride, cloxacillin, cloxacillin ben Zathine, diamfenetide, diaminomethylphena Zinium chloride, cloxazolam, cloxestradiol, cloximate, cloXotestosterone, diamo caine, diam promide, diamtha Zole, cloxypendyl, cloxyquin, clozapine, cobamide, cocaine, dian hydrogalactitol, diap amide, diarbarone, cocarboxylase, codeine, codoxime, cofisatin, cogaZOcine, diathymoSulfone, diatrizoic acid, diaveridine, diazepam, colchicine, colestolone, colfenamate, colforsin, colterol, diaziquone, diazoacetylglycine hydrazide, diaZouracil, conessine, conorphone, copper gluconate, cormethasone diaZOxide, dibekacin, dibemethine, dibenamine, dibenzepin, acetate, corticosterone, cortisone acetate, cortisu Zol, dibrompropamidine, dibromsalan, dibroSpidium chloride, cortivaZol, cortodoxone, cotarnine chloride, cotinine, 15 dibucaine, dibuprol, dibupyrone, dibuSadol, dicarbine, cotriptyline, coumaphos, coumaZoline, coumermycin, dicarfen, dichlorallyl lawsone, dichlorisone acetate, columet arol, creatinolfosfate, crisinatol, croconazole, dichlor me Zan one, dichloroflu or me thane, cromakalim, cromitrile, cromolyn, cropropamide, dichloromethotrexate, dichlorophen, dichlorophenarsine, crospovidone, crotamiton, crotetamide, crotoniazide, dichlorote trafluoroethane, dichloro Xylenol, crufomate, cup rimy Xin, cuproxoline, cyacetacide, dichlorphenamide, dichlorvos, diciferron, dicire none, cyamemazine, cyanocobalamine, cyclacillin, cyclandelate, dicla Zuril, diclofenac, diclofen Sine, diclofurime, cyclarbamate, cyclazocine, cyclazodone, cyclexanone, diclometide, diclonixin, dicloxacillin, dicobalt edetate, cyclindole, cycliramine, cyclizine, cyclobarbital, dicolinium iodide, dicreSulene, dicumarol, dicyclomine, cyclobendazole, cycloben Zaprine, cyclobutoic acid, didemnin, dideoxycytidine, didro Valtrate, dieldrin, cyclobutyrol, cyclofenil, cycloguanil, cloheximide, 25 die ne Strol, die noge St, diethadione, dietha Zine, cyclole u cine, cyclo me no l, cyclomethic one, diethylpropion, diethylstilbestrol, diethylstilbestrol cyclomethycaine, cyclopentamine, cyclopenthiazide, diphosphate, diethylStilbe Strol dip ropio nate, cyclopentolate, cyclope naZine, cyclophosphamide, diethylthiambute ne, diethyltolu amide, dietifen, cyclopregnol, cyclopyrronium bromide, cycloSerine, difebarbamate, difemerine, difemetorex, difenamizole, cyciosporine, cyclothiazide, cyclovalone, cycotiamine, difencloxazine, dife noximide, dife noxin, difetarSone, cy crimine, cyheptamide, cyheptropine, cynarine, difeterol, difloraSone diacetate, difloxacin, difluanine, cype namine, cypothrin, cyprazepam, cyprenophine, diflucortolone, diflurcortolone pivalate, diflumidone, cyprodenate, cyproheptadine, cyprolidol, cyproduinate, diflunisal, difluprednate, diftalone, digalloyl trioleate, cyproterone acetate, cyproximide, cystine, cytarabine, digito Xin, digoxin, dihexy verine, dihydrala Zine, dacarbazine, dacemazine, dacisteine, dacinomycin, dacuro 35 dihydroaZacytidine, dihydroergotamine, dihydrolenperone, nium bromide, dagapamil, dalbraminol, daledalin, dihydro Stre p to my cin, dihydro tachy Ste rol, daltroban, dametralast, damotepine, danazol, danitracen, dihydroxy fluoro proge Strone, diisopromine, danoSteine, danthron, dantrolene, dapiprazole, dapsone, diisopropanolamine, dilaZep, dile Valol, dilimefone, daptomycin, darenzepine, darodipine, datelliptium chloride, diloxanide, diltiazem, dimabefylline, dimecamine, dime dunorubicin, daZadrol, dazepinil, daZidamine, dazmegrel, 40 colonium iodide, dimecrotic acid, dimefadane, dimefline, dazolicine, dazopride, dazoquinast, dacoxiben, deanol dimelazine, dimenorfan, dimenhydrinate, dimenoxadol, aceglumate, deanol acetaminobenzoate, deaZauridine, dimeheptanol, dimepranol, dimepregnen, dimeprozan, deboxamet, debrisoquin, decame thonium bromide, dimer cap rol, dime Sna, dime Sone, dimetacrine, decime mide, decitropine, declaben, declenperone, dime tamfe tamine, dime thadio ne, decloxizine, decominol, decoquinate, deditonium bromide, 45 dimethaminostyrylcquinoline, dimethazan, dimethindene, deferoxamine, deflazacort, defosfamide, dehydroacetic acid, dimethiodal, dimethisoquin, dimethisterone, dimetholizine, dehydroe me tine, dehydro-7-methylte Stosterone, dimethoxa nate, dimethylhydroxyte Stosterone, delanterone, delapril, delergotrile, delfantrine, delmadinone dimethylnorandrostadienone, dimethylnortestosterone, acetate, delmetacin, delmopinol, delorazepam, deloxone, dimethylstilbestrol, dimethyl, dimethylthiambutene, dim de lproste nate, dembrexine, demecarium bromide, 50 ethyltubocurarinium chloride, dimetipirium bromide, demeclacycline, demecolcine, demecycline, demegestone, dimetofrine, dimetridazole, diminaZene, dimoxamine, demelverine, demexiptiline, democonazole, demoXepam, dimoxaprost, dimoxyline, dimpylate, dinaline, dinaZafone, de naverine, denbutylline, denipride, denopamine, diniprofylline, dinitolmide, dinoprost, dinoprostone, dinsed, denpidaZone, denZimol, deoxyspergualin, depramine, dioSmin, dioxadillol, dioxadrol, dioxamate, dioxaphetyl deprodone, deprostil, deptropine, derpanicate, desacetyl 55 butyrate, dioxethedrin, dioxifiedrine, dioxybenzone, dipe colchicine tartrate, desaspidin, desiclovir, descinolone nine bromide, diperodon, diphemanil methylsulfate, acetonide, deserpidine, desipramine, deslano Side, diphenadione, diphenan, diphenhydramine, diphendiol, de Smethylcolchicine, de Smethyl misonidazole, diphenoxylate, diphenylpraline, diphoxazide, dipipanone, de Smethylmoramide, de Socriptine, de Soge Strel, dipipoverine, dipliverin, diprafenone, dipre norphine, deSomorphine, desonide, desoximetasone, desoxycorticOS 60 diprobutine, diprofene, diprogulic acid, diproleandomycin, terone acetate, de Soxy cortico Sterone piva late, diprocqualone, diproteverine, diprotriozate, diproXadol, desoxypyridoxine, detajmium bit artrate, detanosal, dipyridamole, dipyrithione, dipyrocetyl, dipyrone, deterenol, detomidine, detorubicin, detrothronine, dirithromycin, disobutamide, disofenin, disoglu Side, devapamil, dexamethasone, dexamethasone acefurate, dex disopyramide, disoxaril, distigmine bromide, disulergine, amethasone acetate, dexamethasone dipropionate, dexam 65 disulfamide, disulfiram, disuprazole, ditazole, ditercalinium ethasone phosphate, dexamisole, dexbrompheniramine, chloride, dithiazanine iodide, ditiocarb, ditiomustine, deXchlorpheniramine, dexclamol, deXetimide, deXetoZoline, ditolamide, ditophal, divabuterol, dixanthogen, dizatrifone, US 6,264,917 B1 43 44 dizocilpine, dobu pride, dobutamine, docarpamine, mercaptopurine, ethyl nitrite, ethylnorepinephrine, doconazole, docusate, doliracetam, domaZoline, domiodol, ethylparaben, ethylphenace mide, ethylStibamine, domiphen bromide, domipizone, domoprednate, domoxin, ethynerone, ethynodiol diacetate, ethypicone, etibendazole, domperidone, don, donetidine, dopamantine, dopamine, eticlopride, eticyclidine, etidocaine, etidronic acid, dopexamine, dopropidil, dogualast, dorastine, doreptide, etifelmine, etifenin, etifoxine, etilamfetamine, etillefrine, doSergoside, dotarizine, dotefonium bromide, dothiepin, etillefrine pivalate, etintidine, etiochlanolone, etipirium doxacurium chloride, doxaminol, doxapram, doxaprost, iodide, etiproston, etiracetam, etiroXate, etisazole, doxazosin, doxefazepam, doxenitoin, doxepin, doxibetasol, etisomicin, etisulergine, etizolam, etocarlide, etocrylene, doxifluridine, doxofylline, doxorubicin, doxpicomine, etodolac, etodroXZine, etofamide, etofenamate, etofenproX, doxycycline, doxylamine, drame dilol, draquinolol, etofibrate, etoformin, etofuradine, etofylline, etoglucid, deaZidox, dribendazole, drindene, drobuline, drocinonide, etolorex, etolotifen, etoloxamine, etomidate, etomidoline, droclidinium bromide, drocode, drofenine, droloxifene, etomoxir, etonitaZene, etoperidone, etoposide, etoprindole, drometrizole, dromoStanolone, dromoStanolone propionate, etoprine, etorphine, etoSalamide, etoxadrol, etoxeridine, dronabinol, dropempine, droperidol, droprenilamine, etoZolin, etrabamine, etretinate, etryptamine, etymemazine, drop ropiZine, drotaverine, drotebanol, droxacin, 15 eucalyptol, eucatropine, eugenol, euprocin, evandamine, droxicainide, droxicam, droxidopa, droxypropine, Evans blue, exalamide, exametazine, exaprolol, exepanol, dulofibrate, dulo Zafone, duo metacin, duoperone, exifone, exiproben, fallintolol, fallipamil, famiraprinium dup racetam, durapatite, dyclonine, dydrogesterone, chloride, famotidine, famotine, famiprofaZone, fanetizole, dymanthine, dyphylline, ebastine, elbrotidine, ebSelen, fantridone, faZadinium bromide, faZaribine, febantel, ecastolol, echinomycin, echothiophate iodide, ecipramidil, febarbamate, februpol, febuverine, feclemine, feclobuZone, eclanamine, eclaZolast, econazole, ectylurea, edelfosine, fedrilate, felbamate, felbinac, felipyrine, felodipine, edetic acid, edetol, edifolone, edogestrone, edoxudine, edro femoxetine, fenabutene, fenacetinol, fenaclon, fenadiazole, phonicum chloride, efaroXan, efetoZole, efornithine, fenaptic acid, fenalamide, fenalcomine, fenamifuril, efloxate, efrotomycin, elantrine, elanzepine, elderfield's pe namole, fenaperone, fenbendazole, fenbencillin, pyrimidine mustard, elfazepam, elagic acid, elliptinium 25 fenbufen, fenbutraZate, fencamfamine, fencibutirol, fen acetate, elmustine, elnadipine, eltenac, eltoprazine, elucaine, cleXonium metilsulfate, fenclofenac, fenclonine, fenclorac, elziverine, embramine, embutramide, emepronium bromide, fenlozic acid, fendiline, fendosal, feneritrol, fenestrel, emetine, emiglitate, e milium to Sylate, emopanil, fenethazine, fenethylline, fenetradil, fenflumizole, emorfaZone, emylcamate, enalapril, enalaprilat, enbucrilate, fenfluramine, fenfluthrin, fengabine, fenharmane, fenimide, encainide, enciprazine, enclomiphene, encyprate, endomide, feniodium chloride, fenipentol, fenirofibrate, fenisorex, endralazine, endry Sone, enefeXine, eneStebol, enfenamic femme to Zole, fen metramide, fenobam, fenocinol, acid, enflurane, eniclobrate, enilconazole, eniloSpirone, fenoctimine, fenofibrate, fenoldopam, fenoprofen, fenoterol, enisoprost, enocitabine, enolicam, enoxacin, enoxamast, fe noverine, fenoxazoline, fenoxe dil, feno Zolone, enoXimone, enoXolone, eniprazole, eniproline, enprazepine, fenpentadiol, femperate, fenipalone, fenipramide, feniprane, enprofylline, enpromate, enproStil, enrofloxacin, entSufon 35 fe npiverinium bromide, fenprinast, fen proporex, Sodium, enviomycin, enviradene, epalretat, epanolol, fenprostalene, fenduizone, fenretinide, fenspiride, fentanyl, eperisone, ephedrine, epicainide, epicillin, epicriptine, fentiazac, fenticlor, fenticonazole, fentonium bromide, epieStriol, epimestrol, epinastine, epinephrine, epinephryl fenyripol, fepentolic acid, fepitrizol, fepradinol, feprazone, borate, epipropidine, epirizole, epiroprim, epirubicin, fepromide, feproSidinine, ferriclate calcium, ferrotrenine, fer epithiazide, epitioStanol, epop rostenol, epoStane, 40 rous fumarate, ferrous gluconate, fetoxylate, feXicaine, eprazinone, eproVafen, eproXindine, eproZinol, epsiprantel, feXinidazole, fezatione, feZolamine, fiacitabine, fibracillin, eptaloprost, eptazocine, equilin, erdosteine, ergocalciferol, filenadol, filipin, fifexide, flamenol, flavamine, flavodic acid, ergoloid meSylates, ergonoVine, ergosterol, ergotamine, flavodil, flavoneactic acid, flavoxate, flazalone, flecainide, ericolol, erizepine, erocainide, erythrityl tetranitrate, flerobuterol, fleroxacin, flesinoxan, flestolol, fletazepam, erythromycin, erythromycin acistrate, erythromycin 45 floctafenine, flomoxef, flopropione, florantyrone, flordipine, ethylsuccinate, erythromycin propionate, erythrosine, floredil, florfenicol, florifenine, floSequinan, flotrenizine, eSaprazole, esculamine, eSeridine, esflurbiprofen, eSmolol, floverine, floxacillin, floxacrine, floxuridine, fluacizine, eSorubicin, esprocquin, estaZolam, estradiol, estradiol fluialamide, fluianisone, fluaZacort, flubanilate, flubendazole, benzoate, estradiol cypionate, estradiol dipropionate, estra flubepride, flucabril, flucetorex, flucindole, fluciprazine, diol enanthate, estradiol undecylate, estradiol Valerate, 50 flucloronide, fluconazole, flucrylate, flucytosine, estramustine, estramustine phosphate, estrapronicate, fludalanine, fludarabine phosphate, fludazonium chloride, estraZinol, estriol, estrofurate, estrone, estrone hydrogen fludiazepam, fluidorex, fluidoxopone, fludrocortisone acetate, Sulfate, estropipate, eSuprone, etabenzarone, etacepride, flufenamic acid, flufenisal, flufosal, flufylline, fluindarol, etafedrine, etafenone, etameStrol, etamiline, etamiphyllin, fluindione, flumazenil, flumecinol, flume droxone-17 etamocycline, etanidazole, etanterol, etaqualone, etasuline, 55 acetate, flumequine, flumeridone, flumethasone, flumetha etazepine, etazolate, etebenecid, eterobarb, etersalate, Sone pivalate, flumethiazide, flumetramide, flumeXadol, ethacridine, ethacrynic acid, ethambu tol, ethamivan, flume Zapine, fluminorex, flumizole, flumoxonide, etham Sylate, ethanolamine oleate, etha verine, flunamine, flunarizine, flunidazole, flunisolide, flunisolide ethchlorVynol, ethenZamide, ethazide, ethidium chloride, acetate, flunitrazepan, fluniXin, flunoprost, flunoxaprofen, ethinamate, ethinyl estradiol, ethiofoS, ethionamide, 60 fluocinolone acetonide, fluocinonide, flourcortin butyrate, eth Sterone, ethoheptazine, ethomoxane, ethonam, fluocortolone, fluocortolone caproate, fluorescein, ethopropazine, ethoSuximide, ethotoin, ethoxazene, fluores one, fluoroadenosine, 3-fluoroandro Stanol, ethoxazorutoSide, ethoXZolamide, ethyybenztropine, ethyl fluorodopane, fluorohydroxyandrosterone, fluorometholone, biscoumacetate, ethyl carfluZepate, ethyl cartrizoate, ethyl fluorometholone acetate, fluorosalan, 6-fluorotestosterone dibunate, ethyl dirazepate, ethylenediamine, ethyleStrenol, 65 propionate, fluorouracil, 9-fluoroXotestenololactone, ethylhydro cup reine, ethyl lofla Ze pate, 9-fluoroXoteStololace tone, fluo trace n, fluoxetine, ethylmethylthiambutene, ethylmorphine, 9-ethyl-6- fluoxymesterone, fluparoXan, flu pentiXol, fluperamide, US 6,264,917 B1 45 46 fluperlapine, fluperolone acetate, fluphenazine, fluphenazine bromide, he Xamethonium bromide, he Xamidine, enanthate, flupimazine, flupirtine, flupranone, fluprazine, hexapradol, hexaprofen, hexapropy mate, heXasonium fluprednidene, fluprednisolone, fluprednisolone Valerate, iodide, heXacarbacholine bromide, hexedine, hexestrol, flu profen, flu profylline, flu produaZone, flu prostenol, heXetidine, heXobarbital, heXobendine, hexocyclium fluguaZone, fluradoline, flurand renoline, flurantel, methylsulfate, heXoprenaline, heXopyrronium bromide, flurazepam, flurbiprofen, fluretofen, flurithromycin, hexylcaine, hexylene glycol, hexylresorcinol, histamine, flurocitabine, flurofamide, flurogestone acetate, flurothyl, histapyrrodine, homarylamine, homatropine, homatropine fluroxene, flusoxolol, fluspiperone, fluspirilene, flutamide, methylbromide, homidium bromide, homochlorcyclizine, flutazolam, flutemazepam, flutiazin, fluticasone propionate, homofenazine, homoharringtonine, homopipramol, flutizenol, flutonidine, flutoprazepam, flutroline, flutropium homosalate, homotestosterone propionate, homprenorphine, bromide, fluvoxamine, flu Zinamide, fluZoperine, folescutol, hopantenic acid, hoquizil, hycanthone, hydracarbazine, folic acid, fomidacillin, fominoben, fomocaine, fonazine, hydra la Zine, hydrarga phen, hydrobe nti Zide, fopiirtoline, forfenimex, formebolone, forme torex, hydrochlorthiazide, hydrocodone, hydrocort amate, formintraZole, formocortal, formoterol, fosarilate, hydrocortisone, hydrocortisone aceponate, hydrocortisone foSazepam, foScarnet, foscolic acid, foSenazide, 15 acetate, hydrocortisone butyrate, hydrocortisone cypionate, foSfocreatine, fosfomycin, foSfonet, fosfosal, foSinapril, foS hydrocortisone-phosphate, hydrocortisone Succinate, hydro menic acid, foSmidomycin, forpirate, fostedil, fostriecin, cortisone Valerate, hydroflumethiazide, hydromadinone, fotemustine, fotreamine, frabuprofen, frentizole, fronepidil, hydromorphinol, hydromorphone, hydroquinone, froxiprost, ftaXilide, ftivazide, ftorafur, ftormetazine, hydroxindasate, hydroxindasol, hydroxyoxocobalamin, ftorpropazine, fubrogonium iodide, fuchsin, fumagillin, hydroxy amphetamine, hydroxy chloroquine, fumoXcillin, fuprazole, furacrinic acid, furafylline, hydroxydimethandroStadienone, hydroxydione Succinate, furalazine, furaltadone, furaprofen, furazabol, furazolidone, hydroxymethylandrostanone, 10-hydroxynorehisterone, furazolium chloride, furbucillin, furcloprofen, furegrelate, hydroxypethidine, hydroxyphenamate, hydroxyprocaine, furethidine, furfenorex, furidarone, furmethoxadone, hydroxyprogeSerone, hydroxyprogesterone caproate, furobufen, furodazole, furofenac, furomazine, furosemide, 25 hydroxypyridine tart rate, hydroxy Stilb amidine, furoStilbestrol, furSalan, furSultiamine, furterene, furtretho 7-hydroxyteStololacetone, hydroxytestosterone propionate, nium iodide, fusidic acid, fuzlocillin, gabapentin, gabexate, hydroxytetracaine, hydroxytoluic acid, hydroxyurea, gaboXadol, galantamine, gallamine triethodide, gallopamil, hydroxy Zine, hymecromone, hyoscyamine, hypericin, galosemide, galtifenin, gampeXine, gamolenic acid, ibacitabine, ibafloxacin, ibazocine, ibopamine, ibrotamide, ganciclovir, gangle fene, gapicomine, gapromidine, ibudilast, ibufenac, ibuprofen, ibuprofen piconol, gefarnate, gemazocine, gemcadiol, gemeprost, gemfibrozil, ibuproxam, ibuterol, ibuverine, icazepam, icosipiramide, gentamicin, gentian Violet, gepefrine, gepirone, geroquinol, icotidine, idarubicin, idaverine, idaZOXan, idebenone, gestaclone, geStadienol, gestodene, gestonorone caproate, idenast, idoxuridine, idralfidine, idrocilamide, idropranolol, gestrinone, giparmen, gitaloxin, gitoformate, glafenine, ifenprodil, ifosfamide, ifoxetine, ilmofoSine, iloprost, glaziovine, glia milide, glibornu ride, glibutimine, 35 imafen, imaniXil, imaZodan, imcarbofoS, ime Xon, glicaramide, glicetanile, geroquinol, gestaclone, gestadienol, imiclopazine, imidazole Salicylate, imidazopyrazole, imide gestodene, geston.orone caproate, gestrinone, giparmen, cyl iodine, imidocarb, imidoline, imidurea, imiloxan, gitaloxin, gitoformate, glafenine, glaziovine, gliamilide, iminophendimide, imipenem, imipramine, imipraminoxide, glibornuride, glibutimine, glicaramide, glicetanile, imire Stat, imolamine, imo Xite rol, impacar Zine, glicla Zide, glicondamide, glidaZamide, gliflumide, 40 impromidine, improSulfan, imuracetam, inaperisone, glimepiride, glipentide, glipizide, gliquidone.glisamuride, indacrinone, indalpine, indanazoline, indanidine, indanorex, glisindamide, glisolamide, glisoxepide, glo XaZone, indapamide, ind atraline, indacainide, indeloxazine, gloximonam, glucame tacin, glucosamine, glucosulfamide, indenolol, indicine-N-oxide, indigotindisulfonic acid, glucosulfone, glucurolactone, glucuronamide, glunicate, indobufen, indocate, indocyanine green, indolapril, glutamic acid, glutaral, glutarimide, glutaurine, 45 indolidan, indomethacin, indopanolol, indopine, indoprofen, glutethimide, glyburide, glybuthiazol, glybuzole, glyceryl indoramin, indorenate, indoxole, indriline, inicarone, mono Ste a rate, glycidyl methacrylate, glycine, inocoterone, inosine, inosine dialdehyde, inositol niacinate, glyclopyramide, glybiar.Sol, glycopyrrolate, glycyclamide, inproduone, intrazole, intriptyline, iobenzamic acid, iobutic glyhexamide, gly midine, gly octamide, glypinamide, acid, iocarmic acid, iocetamic acid, iodamide, iodecimol, glyprothiazol, glySobuzole, gold thiomalate, gold Sodium 50 iodetryl, iodipamide, iodixanol, iodoalphionic acid, iodol, thiosulfate, granisetron, griseofulvin, guabenXan, guacetisal, iodophthalein, iodoquinol, iodothiouracil, iodoxamic acid, guafe cainol, guaiactamine, guaiapate, guaietolin, ioglicic acid, ioglucol, ioglucomide, ioglunide, ioglycamic guaifene Sin, guaime Sal, guaisteine, guaithylline, acid, iogulamide, iohexol, iodlidonic acid, iolixanic acid, guame cycline, guanabe nZ, guanacline, guanadre 1, iomeglamic acid, iomeprol, iomorinic acid, iopamidol, guana Zodine, guana Zole, guanclofine, guancy dine, 55 iopanoic acid, iopentol, iophendylate, iophenoxic acid, guanethidine, guanfacine, guanisoquin, guanoclor, ioprocemic acid, iopromide, iopronic acid, iopydol, guanoctine, guano Xaben Z, guano Xan, guanoxy fen, iopydone, ioSarcol, iosefamic acid, ioSeric acid, ioSimide, hadacidin, halazepam, halazone, halcinonide, halethazole, ioSulamide, ioSumetic acid, iotasul, iotetric acid, iothalamic halocortolone, halofantrine, halofenate, halofuginone, acid, iotranic acid, iotrizoic acid, iotrolan, iotroXic acid, halometaSone, halonamine, halopemide, halopenium 60 ioVerSol, ioxabrolic acid, ioxaglic acid, ioxitalamic acid, chloride, haloperidol, haloperidol decanoate, haloperidone ioxotrizoic acid, ioZomic acid, ipexidine, ipodic acid, acetate, haloprogesterone, haloprogin, halothane, ipragratine, ipramidil, ipratropium bromide, iprazochrome, haloxazolam, haloxon, halquinols, hedaguinium chloride, ipriflavone, iprindole, iprocinodine, iproclozide, iprocrolol, he pronicate, heptabarbital, heptaminol, heptaverine, iprofenin, iproheptine, iproniazid, iproidazole, iproplatin, heptolamide, hepzidine, hetacillin, hetaflur, heteronium 65 iprotiaZem, iproxamine, ipro Zilamine, ipsala Zide, bromide, hexachlorophene, hexacyclonate, hexacyprone, ipsapirone, iquindamine, irindalone, irloxacin, irolapride, hexadiline, hexadimethrine bromide, hexafluorenium irSogladine, isamfaZone, isamoltan, isamoXole, isaxonine, US 6,264,917 B1 47 48 is bogrel, isepamicin, isoaminile, isobromindione, meclocycline, meclocycline Sulfosalicylate, meclofenamic isobucaine, isobutamben, isocarboxazid, isoconazole, acid, meclofenoxate, meclonazepam, mecloqualone, isocromil, isoetharine, isofeZolac, isoflupredone acetate, mecloralurea, meclorisone dibutyrate, mecloxamine, isoflurane, isoflurophate, isoleucine, isomazole, isomerol, me cobalamin, mecrylate, mecy Steine, medazepam, iSome tamidium, iSomethadone, isome the ptene, 5 medazomide, medetomidine, medibazine, medifoxamine, isomylamine, isoniazid, isonixin, isopraZone, isoprednidene, medorinone, medorubicin, medrogestone, medronic acid, isoprofen, isoprofamide iodide, isopropicillin, isopropyl medroxalol, medroxyprogestrone, medroxyprogestrone myristate, isopropyl palmitate, isoproterenol, isosorbide, acetate, medrylamine, medrySone, mefeclorazine, mefe isosorbide dinitrate, isosorbide mononitrate, isospalglumic namic acid, mefenidil, mefenidramium metilsulfate, acid, isosulfan blue, isoSulpride, isothipendyl, isotic, 10 mefenorex, mefeSerpine, mefeXamide, mefloquine, isotiquimide, isotretinoin, isoxaprolol, isoxepac, isoxicam, mefruSide, megalomicin, megestrol acetate, meglitinide, isoXSuprine, isradipine, itanoXone, itaZigrel, itraconazole, megu cycline, meglumine, meglu tol, meladrazine, itrocainide, ivermectin bib, ivoqualine, joSamycin, kalinic melarSonyl, melarSoprol, melengestrol acetate, meletimide, acid, kalafungin, kanamycin, kebu Zone, keracyanin, melinamide, melitracen, melizame, meloxicam, melperone, ketamine, ketanserin, ketazocine, ketazolam, kethoxal, 15 melphalan, memantine, memotine, menabitan, menadiol, ketipramine, keto be midone, ketocaine, ketocainol, menadiol diphosphate, menadiol disulfate, menadione, ketoconazole, ketoprofen, ketorfanol, ketorolac, ketotifen, menadione Sodium bisulfite, menatetrenone, menbutone, ketotrexate, khellin, khelloSide, kitasamycin, labetalol, menfe gol, mengly tate, me nitrazepam, me noctone, lacidipine, lactalfate, lactose, lactulose, lamotrigine, menogaril, menthol, meobentine, meparfynol, mepazine, lamtidine, lanatoside, lapachol, lapinone, lapyrium chloride, 20 me pen Zolate bromide, me peridine, mephene Sin, lasalocid, laudexium methyl Sulfate, lauralkonium chloride, mephenoxalone, mephen termine, mephenyton, laureth, laurixamine, laurocapram, lauroguadine, lauro- mephobarbital, mepindolol, mepiprazole, mepiroXol, linium acetate, lauryl isoquinolinium, le fetamine, mepitioStane, mepivacaine, mepixanox, mepramidil, leflunomide, leiopyrrole, lemidosul, le nampicillin, meprednisone, meprobamate, meproscillarin, meproxitol, leniquinsin, lenperone, leptacline, lergotrile, letimide, 25 me prylcaine, mepta Zinol, me quido X, me quinol, letosteine, leucine, leucinocaine, leucocianidol, leucovorin, meguitazine, meralein, meralluride, merbarone, merbromin, levacecarnine, levallorphan, levamfetamine, levamisole, mercaptamine, mercap to me rin, mercaptop urine, lev drop ropiZine, le Visoprenaline, le vlofexidine, mercuderamide, mercufenol chloride, mercumatilin, levobunolol, levocabastine, levocarnitine, levodopa, mercurobu tol, mergocriptine, merophan, merSalyl, levofacetoperane, leVofenfluramine, levofuraltadone, 30 mesabolone, meSalamine, meSeclaZone, meSna, mesocarb, levoglutamide, levomenol, levomethadone, levomethadyl meso-hexestrol, meSoridazine, mesipire none,meStanolone, acetate, le Vome thorphan, le Vome tio meprazine, mesterolone, meStranol, meSudipine, meSulergine, levomopranol, levomoramide,levonantradol, levonordeprin, meSulfamide, me Sulfen, meSuprine, metabrom Salan, levonorgestrel, levophenacyl morphan, levopropoxyphene, metacetamol, metaclazepam, metaglycodol, metahexamide, levopropylcillin, levopropylhexedrine, levoprotiline, 35 metamelfalan, metamfa Zone, metamfe pramone, levorin, levorphanol, levothyroXine, leVOXadrol, leXofenac, metampicillin, metanixin, metapramine, metaproterenol, libecillide, libenzapril, lidamidine, lidocaine, lidofenin, metaraminol, metaterol, metaxalone, metaZamide, metazide, lidoflazine, lifibrate, lilopristone, limaprost, lincomycin, metazocine, metbufen, mete neprost, metergoline, lindane, linsidomine, liothyronine, liroldine, lisinopril, metergotamine, mete Scufylline, mete Scule tol, lisuride, lithium carbonate, lithium citrate, litracen, 40 metethoheptazine, metformin, methacholine chloride, lividomycin, lixazinone, lobeline, lobendazole, lobenzarit, methacycline, methadone, methadyl acetate, methallenestril, lobuprofen, locicortone, lodaxaprine, lodace/arlodinixil, methallibure, methalthiazide, methamphetamine, lodiperone, lodoxamide, lodoxamide ethyl, lofemizole, methandriol, methandrostenolone, methaniazide, meth lofendazam, lofentanil, lofepramine, lofexidine, loflucarban, antheline bromide, methaphenilene, methapyrilene, lombazole, lomefloxacin, lometraline, lome Vactone, 45 methaqu alone, met harbital, metha Styridone, lomifylline, lomofungin, lomustine, lonapalene,lonaprofen, methazolamide, methdilazine, methenamine, methenolone lonazolac, lonidamine, loperamide, loperamide oxide, acetate, methenolone enanthate, metheptazine, methestrol, lopirazepam, loprazolam, loprodiol, lorajmine, lorapride, methetoin, methicillin, methimazole, methiodal Sodium, loratadine, lorazepam, lorbamate, lorcainide, lorcinadol, methioguanine, methiomeprazine, methionine, methisaZone, lorglumide, lormetazepam, lortalamine, lorZafone, 50 methitural, methixene, methocarbamol, methohexital, losindole, loSulazine, lotifazole, lotrifen, lotucaine, methopholine, metho Serpidine, methotrexate, lovastatin, loxanast, loxapine, loxiglumide, loxoprofen, methotrimeprazine, methoxamine, methoXSalen, loXtidine, lozilurea, lucanthone, lucartamide, lucimycin, methoxyflurane, methoxyphedrine, methoxyphenamine, lufuradom, lupitidine, luprostiol, luxabendazole, lyapolate methoxypromazine, methScopolamine bromide, Sodium, lycetamine, lydimycin, lymecycline, lynestrenol, 55 methSuximide, methylclothiazide, N-methyladrealone hcl, ly Sergide, lysine, mabuterol, maduramicin, mafenide, methyl alcohol, methylatropine nitrate, methylbenactyzium mafoprazine, mafosfamide, magnesium citrate, magnesium bromide, methylben Zethonium, methylchromone, gluconate, magnesium Salicylate, malathion, malethamer, methyldesorphine, methyldihydromorphine, methyldopa, malic acid, malotilate, manidipine, manganese gluconate, methyldopate, methylene blue, methylphe drine, mannitol, mannitol he Xanitrate, man no mustine, 60 methylergonovine, methylformamide, methyl nicotinate, mannosulfan, manoZodil, maprotiline, maridomycin, 2-methyl-19-nortestosterone, 2-methyl-11-oxoprogestrone, mariptiline, maroxepin, maytansine, maZaticol, mazindol, methyl palmoxirate, methylparaben, methylphendiate, maZipredone, mebanazine, mebendazole, mebenoside, methylprednisolone, methylprednisolone aceponate, meth mebeverine, mebeZonium iodide, mebhydrolin, mebiquine, ylprednisolone acetate, methylprednisolone hemisuccinate, mebolazine, mebrofenin, mebutamate, mebutizide, 65 methylprednisolone phosphate, methylprednisolone mecamylamine, mecarbinate, mecetronium ethylsulfate, Suleptanate, methyl Salicylate, methylstreptonigrin, mechlorethamine, meciadanol, mecinarone, meclizine, 4-methylte Stoster one, 7-methylte Stoster one, US 6,264,917 B1 49 SO 17-methyltestosterone, 7-methylteSosterone propionate, nefazodone, ne flumo Zide, ne fopam, nele Zaprine, methylthiono Sine, 16-methylthioproge Stone, neoarsphenamine, neocinchophen, neomycin, neoStigmine methylthiouracil, methynodiol diacetate, methyprylon, bromide, nequinate, neraminol, nerbacadol, neSapidil, methySergide, metiamide, metiapine, metiaZinic acid, neSOsteine, netilmicin, netobimin, neutramycin, neXeridine, metibride, meticrane, metildigoxin, metindizate, metioprim, niacin, niacinamide, nialamide, niaprazine, nibroxane, metioXate, metipirox, metipranolol, metiprenaline, nicafenine, nicainoprol, nicametate, nicarbazin, nicarpidine, metitepine, metizoline, metkephamid, metochalcone, meto nicergoline, niceritrol, niceverine, niclofolan, niclosamide, cinium iodide, metoclopramide, metocurine iodide, nicoboxil, nico clonate, nicocodine, nicocortonide, metofenazate, metogest, metola Zone, metomidate, nicodicodine, nicofibrate, nicofuranose, nicofurate, me topimazine, me topon, me top rine, metoprolol, nicogrelate, nicomol, nicomorphine, nicopholine, metoquizine, metoserpate, metoStilenol, metoxepin, nicorandil, nicothiaZone, nicotinyl alcohol, nicoxamat, metrafazoline, metralindole, metrazifone, metrenperone, nictiaZem, nictindole, nodroxy Zone, nifedipine, nifenalol, metribolone, metrifonate, metrifudil, metrizamide, metri nife naZone, niflumic acid, nifluridide, nifuradene, Zoic acid, metronidazole, meturedepa, mety rapone, nifuraldeZone, nifuralide, nifuratel, nifuratrone, nifurdazil, mety ridine, me tyrosine, mevastatin, me Xafylline, 15 nifuretha Zone, nifurfoline, nifurimide, nifurizone, me Xa Zolam, me Xenone, mexile tine, mexiproStil, nifurmazole, nifurmerone, nifuroquine, nifuroxazide, meXOprofen, meXre noate, meZacopride, meZepine, nifuroxime, nifurpipone, nifurpirinol, nifurprazine, meZilamine, meZlocillin, mianserin, mibolerone, micinicate, nifurcquinazole, nifurSemizone, nifurSol, nifurthiazole, miconazole, micronomicin, midaflur, midaglizole, nifurtimox, nifurtoinol, nifurVidine, nifurzide, niguldipine, midalcipran, mid amaline, midazogrel, midazolam, nihydraZone, nikethamide, nileprost, nilprazole, niludipine, midecamycin, midodrine, mifentidine, mifepristone, nilutamide, nilvadipine, nima Zone, nime Sullide, mifobate, miglitol, mikamycin, millacemide, milenperone, nimetazepam, nimidane, nimodipine, nimorazole, millipertine, miloxacin, milrinone, milverine, mimbane, nimustine, niometacin, niperotidine, nipradillol, niprofaZone, minaprine, minaXolone, mindolilol, mind operone, niridazole, nisbuterol, nisobamate, niSoldipine, nisoxetine, mine pentate, minocromil, minocycline, minoxidil, 25 nisterime acetate, nitarSone, nitaZoxanide, nithiamide, mioflazine, mipimazole, mirincamycin, miristalkonium nitracrine, nitrafudam, nitralamine, nitramisole, chloride, miroprofen, mirosamicin, misonidazole, nitraduaZone, nitrazepam, nitrefazole, nitrendipine, misoprostol, mitindomide, mitobronitol, mitoclomine, nitricholine, nitrochlofene, nitrocycline, nitrodan, mitoguaZone, mitolactol, mitomycin, mitonafide, nitrofurantoin, nitrofuraZone, nitroglycerin, nitromerSol, mitopodozide, mitoquidone, mitotane, mitotenamine, nitromide, nitromifene, nitroScanate, nitroSulfathiazole, mitoxantrone, mito Zolomide, mivacurium chloride, nitroXinil, nitroxoline, nivaZol, nivimeldone, nixylic acid, mixidine, misoprostol, mitindomide, mitobronitol, nizatidine, nizofenone, noberastine, nocloprost, nocodazole, mitoclomine, mitoguaZone, mitolactol, mitomycin, nofecainide, nogalamycin, nolinium bromide, nomegeStrol, mitonafide, mitopodo Zide, mitocquidone, mitotane, no melidine, nomifensine, nonabine, nonape rone, mitotenamine, mitoxantrone, mitoZolomide, mivacurium 35 nonapyrimine, nonoxynol-4, nonoxynol-9, noracymethadol, chloride, mixidine, mizoribine, mobecarb, mobenzoxamine, norbolethone, norbudrine, nor.clostebol, norcodeine, mocimycin, mocliprazine, moclobemide, moctamide, nordazepam, norde frin, nordinone, norepinephrine, modafinil, modaline, mofe but a Zone, mofloverine, norethandrolone, norethindrone, norethindrone acetate, mofoXime, molfarnate, molina Zone, mollindone, norethynodrel, noreximide, norfenefrine, norfloxacin, nor molracetam, molsidomine, mometasone furoate, monala 40 floxacin Succinil, norflurane, norgesterone, norgestimate, Zone di Sodium, m one in Sin, monoben Zone, norge Stomet, norge Strel, norgestrienone, norletimol, mo no e than olamine, mono metacrine, norlevorphanol, norm ethadone, nor methandrone, monophosphothiamine, monothioglycerol, monoxerutin, normorphine, norpipanone, nortestosterone propionate, montirelin, moperone, mopidamol, mopidralazine, nortetrazepam, nortriptyline, norvinisterone, noSantine, moprolol, moguizone, morantel, moraZone, morclofone, 45 noScapine, noSiheptide, novobiocin, noxiptiline, noxytiolin, morfore X, moricizine, morinamide, morniflu mate, nuclomedone, nuclotixine, nufenoxole, nuVenzepine, morocromen, moroxydine, morpheridine, morphine, nyleStriol, nylidrin, nyStatin, obidoxime, Ocilltide, ocrylate, morSuximide, motapizone, motrazepam, motretinide, octabenzone, octacaine, octafonium chloride, octamoxin, moveltipril, moxadolen, moxalactam, moxaprindine, octamylamine, octanoic acid, octapinol, octastine, mo Xastine, mo Xaverine, moxazocine, moxestrol, 50 octaverine, octaZamide, octenidine, octenidine Saccharin, moxicoumone, moxipraquine, moxisylyte, moxnidazole, Octicizer, Octimibate, octorylene, octodrine, Octopamine, moxonidine, mupirocin, murabutide, murocainide, Octotiamine, Octoxynol-9, octriptyline, octrizole, ofloxacin, muZolimine, mycophenolic acid, my fadol, myralact, ofornine, oftasceine, Olaflur, olaquindox, oleanomycin, myrophine, myrtecaine, nabaZenil, nabilone, nabitan, oletimol, oleyl alcohol, olivomycina, Olmidine, olpimedone, naboctate, nabu metone, nadide, nadolol, nadoxolol, 55 olSalazine, oltipraz, olvanil, omeprazole, omidoline, naepaine, nafamoStat, nafazatrom, nafcaproic acid, nafcillin, omoconazole, omonasteine, onapristone, ondansetron, nafenodone, nafenopin, nafetolol, nafimidone, nafiverine, ontianil, opiniazide, opipramol, oraZamide, orbutopril, naflocort, nafomine,nafoxadol, nafoxidine, nafronyl, orconazole, orestrate, Ormetoprim, ornidazole, ornipressin, naftalofoS, naftaZone, naftifine, naftopidil, naftoxate, ornithine, ornoprostil, orotic acid, orotirelin, orpanoxin, nafty pramide, nalbuphine, nalidixic acid, nalmefene, 60 orphenadrine, Ortetamine, OSalmid, osmadizone, otilonium nalmeXOne, nalorphine, naltrexone, naminterol, namoxyrate, bromide, otimerate Sodium, Ouabain, Oxabolone cipionate, nanaprocin, nandrolone cyclotate, nandrolone decanoate, oXabrexine, oxaceprol, oxacillin, oxadimedine, OxafloZane, nandrolone phen propionate, nanofin, nan tradiol, Oxaflumazine, OXagrelate, oxalinast, Oxaliplatin, OXamarin, napacitadine, napame Zole, naphazoline, naphthonone, Oxametacin, oxamisole, OXamniquine, Oxanamide, nap rodoxime, naproxen, naproxol, naranol, narasin, 65 OXandrolone, OXantel, oxapadol, Oxapium iodide, Oxapropa natamycin, naxagollide, naxaprostene, nealbarbital, nium iodide, oxaprotiline, oxapro Zin, oxarbazole, nebidra Zine, nebivolol, nebracetam, nedocromil, OXatomide, OxaZafone, Oxazepam, oxazidione, Oxazolam, US 6,264,917 B1 S1 52 oXaZorone, oxcarbazepine, oxdralazine, oxeladin, aminosalicylate, phenylbutaZone, phenylrphrine, phenyl Oxendolone, Oxepinac, oxetacillin, oxethazaine, Oxetorone, ethyl alcohol, phenylmercuric acetate, phenylmercuric oxfendazole, Oxfenicine, OXibendazole, OXibetaine, borate, phenylmercuric chloride, phenylmercuric nitrate, Oxiconazole, oxidopamine, oxidronic acid, OXifentorex, phenylmethylbarbituric acid, phenylpropanolamine, oxifungin, OXilorphan, OXimonam, OXindanac, OXiniacic phenylthilone, phenyltoloxamine, phenyramidol, phenytoin, acid, OXiperomide, oxiracetam, oxiramide, oxisopred, phetharbital, pholcodine, pholedrine, phosphoramide OXisuran, OXitefonium bromide, oxitriptan, oxitriptyline, mustard, phoxim, phthalofyne, phthalysulfacetamide, OXitropium bromide, OXmetidine, OXodipine, Oxogestone phthalylsulfame thizole, phthalylsulfathiazole, phenpropionate, oxolamine, OXolinic acid, oxomemazine, physostigmine, phytic acid, phytonadiol diphosphate, oXonazine, oxophenarsine, Oxoprostol, oxpheneridine, 1O phytonadione, pibecarb, pibenzimol, pibecarb, pibenzimol, oXpre noate potassium, OXprenolol, OXtriphylline, piberaline, picafibrate, picartamide, picenadol, picilorex, oxybenzone, oxybutynin, oxychlorosene, oxycinchophen, piclonidine, piclopastine, picloxydine, picobenzide, oxyclozanide, oxycodone, oxydipentonium chloride, picodralazine, picolamine, piconol, picoperine, picoprazole, oxyfedrine, Oxymesterone, oxymetazoline, oxymetholone, picotamide, picotrin diolamine, picumast, pidolic acid, Oxymorphone, Oxypendyl, oxypertine, oxyphenbutaZone, 15 pifarnine, pilfenate, pifeXole, piflutiXole, pilfoxime, oxyphenonium bromide, oxy purinol, oxypyrronium piketoprofen, pildralazine, pilocarpine, pimoclone, bromide, oxyquinoline, Oxyridazine, oxySonium iodide, pimefylline, pimelautde, pimetacin, pimethixene, pimetine, Oxytetracycline, Oxytiocin, OZagrel, Ozolinone, pacrinolol, pimetremide, piminodine, pimobendan, pimondiazole, pactamycin, padimate, pafenolol, palatrigine, paldimycin, pimozide, pinacidil, pinadoline, pinafide, pinaverium palmidrol, palmoxiric acid, pamabrom, pamaquine, bromide, pinazepam, pincainide, pindolol, pinolcaine, pamatolol, pamidronic acid, pancuronium bromide, pino Xepin, pioglita Zone, pipacycline, pip amazine, panidazole, panomifene, patenicate, panthenol, pantothenic pipaperone, pipaZe thate, pipebu Zone, pipe curonium acid, p a nura mine, papa Verine, papa Vero line, bromide, pipemidic acid, pipenzolate bromide, pipequaline, parachlorophenol, paraflutiZide, paraldehyde, piperacetazine, piperacillin, piperamide, piperazine, paramethadione, paramethasone acetate, paranyline, parap 25 piperazinedione, piperidolate, piperilate, piperocaine, enzolate bromide, parapropamol, pararosaniline, pararosa piperoxan, pipery lone, pipobroman, pip octa none, niline embonate, paraXaZone, parbendazole, parconazole, pipofeZine, pipOSulfan, pipotiazine palmiate, pipOXizine, pareptide, parethoxycaine, pargeverine, pargolol, pargyline, pipOXolan, pipradimadol, pipradol, pipramadol, pipratecol, paridocaine, parodilol, paromomycin, paroxetine, piprinhydrinate, piprocurarium iodide, piprofurol, paroxypropione, parsalmide, partricin, parvaquone, piprozolin, piquindone, piquizil, piracetam, pirandamine, pasiniazid, paulomycin, paxamate, paZelliptine, paZOxide, pirarubicin, piraxelate, piraZmonam, piraZolac, pirbenicillin, pcnu, pecilocin, pecocycline, pefloxacin, pelanSerin, pirbuterol, pirdonium bromide, pirenoXine, piremperone, pelretin, pelrinone, pemedolac, peme rid, pemoline, pirenzepine, pirepolol, piretanide, pirfenidone, piribedil, pempidine, penamecillin, penbutolol, pendecamaine, piridicillin, piridocaine, piridoxilate, piridironic acid, penfluridol, penflutizide, pengitoxin, penicillamine, penicil 35 pirifibrate, pirindazole, pirinixic acid, pirinixil, piriprost, lin procaine, penicillin, penimepicycline, penimocycline, piriqualone, pirisudanol, piritramide, piritrexim, pirlimycin, penirolol, penmesterol, penoctonium bromide, penprostene, pirlindole, pirmagrel, pirmenol, pirnabine, piroctone, pentabamate, pentacynium chloride, pentaerythritol pirogliride, piroheptine, pirolate, pirolazamide, piromidic tetranitrate, pentafluranol, pentagastrin, pentagestrone, acid, piroXantrone hcl, piroXicam, piroXicam cinnamate, pental amide, pent a methonium bromide, 40 piroxicillin, piroXimone, pirozadil, pirprofen, pirquinoZol, pentamethylmelamine, pentamidine, pentamoxane, pirralkonium bromide, pirtenidine, pitenodil, pitofenone, pentamustine, pentapiperide, pentapiperium methylsulfate, pituxate, pivampicillin, pivenfrine, pivopril, pivoxazepam, pentaquine, pentazocine, pentetate calcium triSodium, pen pizotyline, plafibride, plaunotol, pleuromulin, plicamycin, tetic acid, penthienate bromide, penthrichloral, pentiapine podilfen, podophylloxoxin, poldine methylsulfate, male ate, pentifylline, pentige tide, pentiSomicin, 45 polidocanol, ploymyxin, polythiazide, ponal restat, pentisomide, pentizidone, pentobarbital, pentolinium ponfibrate, p or firomycin, poskine, potassium tartrate, pentomone, pentopril, pentorex, pentosan poly Sul guaiacolsulfonate, potassium nitrazepate, potassium Sodium fate Sodium, pentostatin, pentoxifylline, pentrinitrol, tartrate, potassium Sorbate, potassium thiocyanate, practolol, pentylenetrazole, peplomycin, pepstatin, peraclopone, prajmalium, pralido Xime chloride, pramipexole, peradoxime, perafensine, peralop ride, peraquinsin, 50 pramiracetam, pramiverine, pramoxime, prampine, prano perastine, peratizole, per bufylline, perfluamine, lium chloride, pranoprofen, pranosal, prasterone, perflunafe ne, pergolide, perhexilene, pericia Zine, pravastatin, praXadine, prazepam, praZepine, praZiquantel, perimetazine, perindopril,perindoprilatperisoxal, perlapine, praZitone, praZOcillin, praZosin, preclamol, prednazate, permethrin, perphenazine, persilic acid, petrichloral, predna Zo line, prednicarbate, prednimu Stine, peXantel, phanquone, phenacaine, phenacemide, phenacetin, 55 prednisolamate, prednisolone, prednisolone acetate, pred phenact tropinium chloride, phenadoxone, phenaglycodol, nisolone hemisuccinate, prednisolone phosphate, predniso phenamaZoline, phenampromide, phenarSone Sulfoxylate, lone Steaglate, prednisolone tebutate, prednisone, prednival, phena Zo cine, phena Zopyridine, phen carb amide, prednylidene, prefenamate, pregnenolone, pregnenolone phencyclidine, phendimetrazine, phenelZine, pheneridine, Succinate, premazepam, prenalterol, pre niste ine, phenesterin, penethicillin, phenformin, phenglutarimide, 60 prenoverine, prenoxdiazine, prenylamine, pretamazium phenicarbazide, phenindamine, phenindione, pheniprazine, iodide, pretiadil, pribecaine, pridefine, prideperone, pridinol, pheniramine, phenisonone, phenmetrazine, phenobarbital, prifelone, pri?inium bromide, prifuroline, prilocaine, phenobutiodil, phenolphtalein, phenolsulfonphthalein, primaperone, primacquine, primidolol, primidone, primycin, phenomorphan, phenoperidine, phenothiazine, phenothrin, prinomide, pristinamycin, prizidilol, proadifen, probarbital, phenoxybenzamine, phenoxypropazine, phenprobamate, 65 probenecid, probicromil, probucol, procainamide, procaine, phen procoumon, phen promethamine, phensuXimide, procarbazine, procaterol, prochlorperazine, procinolol, phen termine, phentolamine, phenylalanine, phenyl procinonide, proclonol, procodiazole, procyclidine, US 6,264,917 B1 S3 S4 procymate, prodeconium bromide, prodilidine, prodipine, rotraxate, roXarSone, roXatidine acetate, roXibolone, prodolic acid, profadol, profeXalone, proflavine, roXindole, roXithromycin, roXolonium metilsulfate, proflazepam, progabide, progesterone, proglu metacin, roXoperone, rufloxacin, rutamycin, rutin, ruvaZone, proglumide, proheptazine, proligestone, proline, prolintane, Sabeluzole, Saccharin, Salacetamide, Salafibrate, Salantel, prolonium iodide, promazine, promegestone, promestriene, Salazodine, SalazoSSulfadimedine, SalazoSulfamide, promethazine, promolate, promoxolane, pronetalol, SalazOSulfathiazole, Salethamide, Salfluverine, Salicin, Sali propacetamol, propafenone, propamidine, propanidid, cyl alcohol, Salicylamide, Salicylanilide, Salicylic acid, propanocaine, propantheline bromide, proparacaine, pro Salinazid, Salinomycin, Salmefanol, Salmeterol, Salmisteine, paty 1 nitrate, propa Zolamide, prope n diazole, Salprotoside, Salsalate, Salverine, Sancycline, Sangivamycin, propentofylline, propenzolate, properidine, propetamide, Saperconazole, Sarcolysin, SarmaZenil, Sarmoxicillin, prope tandrol, propicillin, propikacin, propinetidine, Sarpicillin, Saterinone, Satranidazole, Savoxepin, Scarlet red, propiolactone, propiomazine, propipocaine, propiram, Scopafungin, Scopolamine, Secla Zone, Secnidazole, propisergide, propiverine, propizepine, propofol, propoxate, Secobarbital, Secoverine, Securinine, Sedecamycin, propoxycaine, propoxyphene, propranolol, propyl Segan Serin, Seglitide, Selegiline, Selenium Sulfide, docetrizoate, propylene glycol, propylene glycol 15 Selprazine, Sematilide, Semustine, Sepazonium chloride, mono Stearate, propyl gallate, propylhexe drine, Seperidol, Sequifenadine, Serfibrate, Sergolexole, Serine, propylio done, propylparaben, propylthiou racil, Sermetacin, Serotonin, Sertaconazole, Sertraline, Setastine, propyperone, propyphenaZone, propyromazine bromide, SetaZindol, Setiptiline, Setoperone, Sevitropium mesilate, produaZone, produinolate, prorenoate potassium, proroXan, sevoflurane, Sevopramide, Siagoside, Sibutramine, Siccanin, proscillaridin, prospidium chloride, prostalene, proSulpride, Silandrone, Silibinin, Silicristin, Silidianin, Silver proSultiamine, proterguride, protheobromine, prothipendyl, Sulfadiazine, Simetride, Simfibrate, SimtraZene, Simvastatin, prothixene, protiofate, protionamide, protirelin, protizinic Sinefungin, Sintropium bromide, Sisomicin, Sitalidone, acid, protokylol, protoveratine, protriptyline, proxazole, sitofibrate, Sitogluside, Sodium benzoate, Sodium dibunate, proXibarbal, proxibutene, proXicromil, proxife Zone, Sodium ethasulfate, Sodium formaldehyde Sulfoxylate, proXorphan, proxyphylline, proZapine, pseudoephedrine, 25 Sodium gentisate, Sodium gualenate, Sodium nitrite, Sodium psilocybine, pumiteba, puromycin, pyrabrom, pyran nitroprusSide, Sodium oxybate, Sodium phenylacetate, copolymer, pyrantel, pyrathiazine, pyra Zinamide, Sodium picofoSfate, Sodium picOSulfate, Sodium propionate, pyrazofurin, pyricarbate, pyridarone, pyridofylline, pyri Sodium Stibocaptate, Sodium Stibogluconate, Sodium tetrade do Stigmine bromide, pyrido Xine, pyrilamine, cyl Sulfate, Sodium thiosulfate, Sofalcone, Solasulfone, pyrimethamine, pyrimitate, pyrinoline, pyrithione Zinc, Solpe cainol, Solypertine, Somantadine, SopitaZine, pyrithyldione, pyritidium bromide, pyritinol, pyronine, Sopromidine, Soquinolol, Sorbic acid, Sorbinicate, Sorbinil, pyrophenindane, pyrovalerone, pyroxamine, pyrrobutamine, Sorbitan monolaurate, Sorbitan monooleate, Sorbitan pyrrocaine, pyrroliphene, pyrrolnitrin, pyrVinium chloride, monopalmitate, Sorbitan monoStearate, Sorbitan trioleate, pytamine, quadazocine, quadrosilan, quatacaine, quazepam, Sorbitan triStearate, Sorbitol, Sorndipine, Sotalol, Soterenol, quaZinone, quaZodine, quaZolast, quifenadine, quillifoline, 35 Spaglumic acid, Sparfosic acid, SparSomycin, Sparteine, quinacainol, quinacillin, quinacrine, quinaldine blue, Spectinomycin, Spiclamine, Spiclomazine, Spiperone, quinapril, quinaprilat, quinaZosin, quinbolone, quincarbate, Spiradoline, Spiramide, Spiramycin, Spirapril, Spiraprilat, quinde camine, quindonium bromide, quindo Xin, Spire ndolol, Spirgetine, Spirilene, Spirofylline, quineStradol, quine Strol, quine thaZone, quinetolate, Spirogermanium, Spiromustine, Spironolactone, Spiroplatin, quine Zamide, quin famide, quinge Stanol acetate, 40 Spirore none, Spirotriazine, SpiroXaSone, SpiroXatrine, quingestrone, quindine, quinine, quinocide, quinpirole, SpiroXepin, Spizofurone, Stallimycin, Stanolone, Stanzolol, quinterenol, quintiofoS, quinuclium bromide, quinupramine, Stearic acid, Stearyl alcohol, Stearylsulfamide, Steffimycin, quipazine, quisultazine, race femine, race methionine, Stenbolone acetate, Stepronin, Stercuronium iodide, racemethorphan, racemetirosine, raclopride, ractopamine, Stevaladil, Stibamine glucoside, Stibophen, Stilbamidine, Stil rafoxanide, ralitoline, raloxifene, ramciclane, ramefenaZone, 45 bazium iodide, Stilonium iodide, Stirimazole, Stiripentol, ramipril, ramiprilat, ramiXotidine, ramno dignin, Stirocainide, Stirifos, Streptomycin, Streptonico Zid, ranimustine, ranimycin, ranitidine, ranolazine, rathyronine, Streptonigrin, Streptovarycin, Streptozocin, Strinoline, raZinodil, raZobazam, razoxane, reboxetine, recainam, Strychnine, Styramate, SubathizOne, Subendazole, Succimer, reclazepam, relomycin, remoxipride, renanolone, rentiapril, Succinylcholine chloride, Succinylsulfathiazole, repirinast, repromicin, reproterol, recimetol, rescinnamine, 50 Succisulfone, Suclofenide, Sucralfate, Sucrose octaacetate, reSerpine, resorantel, resorcinol, resorcinol monoacetate, SudeXanox, Sudoxicam, Sufentanil, Sufosfamide, Sufotidine, retelliptine, retinol, revenast, ribavirin, riboflavin, riboflavin Sulazepam, Sulbactam, Sulbactam pivoxil, Sulbenicillin, 5'-phosphate, riboprine, ribostamycin, ridazolol, ridiflone, Sulbenox, Sulbentine, Sulbutiamine, Sulclamide, Sulconazole, rifabutin, rifamide, rifampin, rifamycin, rifapentine, Sulfabenz, Sulfabenzamide, Sulfacarbamide, Sulfacecole, rifaximin, rilapine, rilmaZafone, rillmenidine, rilopiroX, 55 Sulfacetamide, Sulfachlorpyridazine, Sulfachrysoidine, riloZarone, rimantadine, rimazolium metilsulfate, rimcazole, Sulfaclomide, Sulfaclorazole, Sulfaclozine, Sulfacytine, rimeXolone, rimiterol, rimoprogin, riodipine, rioprostil, Sulfadiazine, Sulfadicramide, Sulfadimethoxine, Sulfadoxine, ripazepam, risocaine, risperidone, ristianol, ristocetin, Sulfaethidole, Sulfaguandide, Sulfaguanole, Sulfalene, ritanserin, ritiometan, ritodrine, ritropirronium bromide, Sulfaloxic acid, SulfamaZone, Sulfamerazine, Sulfameter, ritroSulfan, robenidine, rocastine, rociverine, rodocaine, 60 Sulfame thaZine, Sulfamethizole, Sulfamethoxazole, rodorubicin, rofelodine, roflurante, rokitamycin, roletamide, Sulfamethoxypyridazine, Sulfamethoxypyridazine acetyl, rolgamidine, rollicyclidine, rollicyprine, rollipram, Sulfametomidine, Sulfametrole, Sulfamonomethoxine, rolite tracycline, rolodine, rolziracetam, romifenone, Sulfamoxole, Sulfanil amide, Sulfanitran, Sulfaperin, romifidine, ronactolol, ronidazole, ronifibrate, ronipamil, Sulfaphena Zole, Sulfaproxyline, Sulfapyridine, ronnel, ropitoin, ropivacaine, ropiZine, roquinimex, 65 Sulfaquinoxaline, SulfarSphe namine, SulfaSalazine, rosaprostol, rosaramicin, rosaramicin butyrate, rosaramicin SulfaSomizole, SulfaSuccinamide, Sulfasy mazine, propionate, roSoxacin, rosterolone, rotamicillin, rotoxamine, Sulfathiazole, Sulfathiourea, Sulfatolamide, Sulfatroxazole, US 6,264,917 B1 SS S6 Sulfatrozole, Sulfazamet, Sulfinalol, Sulfinpyrazone, Sulfiram, timepidium bromide, timiperone, timobesone acetate, Sulfi So midine, SulfiS oxazole, SulfiS oxazole, timofibrate, timolol, timonacic, timoprazole, tinabinol, Sulfobromophthalein, Sulfonethylmethane, Sulfonmethane, tinazoline, tinidazole, tinisulpride, tinofedrine, tinoridine, Sulfonterol, Sulforidazine, Sulfoxone Sodium, Sullicrinat, tiocarlide, tioclomarol, tioconazole, tioctilate, tiodaZosin, Sulindac, Sulisatin, Sulisobenzone, Sulmarin, Sulmazole, tiodonium chloride, tiomergine, tiomesterone, tioperidone, Sulme pride, Sulinidazole, Sulocarbilate, Suloctidil, tiopinac, tiopronin, tiopropamine, tioSpirone, tiotidine, Sulosemide, Sulotroban, Suloxifen, Sulpiride, Sulprosal, tioxacin, tioXamast, tioxaprofen, tioxidazole, tioxolone, Sulprostone, Sultamicillin, Sulthiame, Sultopride, Sultosilic tipentosin, tipepidine, tipetropium bromide, tipindole, acid, Sultroponium, Sulverapride, Sumacetamol, Sumatriptan, tipredane, tiprenolol, tiprinast, tipropidil, tiproStanide, Sumetizide, Sunagrel, Suncillin, Supidimide, Suproclone, tiprotimod, tiquinamide, tiquizium bromide, tiratricol, Suprofen, Suramin, Suricainide, Suriclone, Suxemerid, Sux tiropramide, tisocromide, tisopurine, tisoquone, tivandizole, ethonium chloride, SuXibuZone, Symclosene, Symetine, tiXadil, tiXanox, tiXocortol pivalate, tiZabrin, tianidine, Synephrine, Syrisingopine, taclamine, tacrine, taglutimide, tizolemide, tizoprolic acid, tobramycin, tobuterol, tocainide, talampicillin, talastine, talbutal, taleranol, tallinolol, to camphyl, tocofenoxate, tocofibrate, tocopherSolan, talipexole, tallisomycin, talmetacin, talmetoprim, 15 todralazine, tofenacin, tofetridine, tofisoline, tofisopam, talniflumate, talopram, taloSalate, taloximine, talsupram, tolamolol, tolaZamide, tolazoline, tolboxane, tolbutamide, taltrimide, tameridone, tameticillin, tametraline, tamitinol, tolciclate, toldimfoS, tolfamide, tolfenamic acid, tolgabide, tamoxipen, tampramine, tandamine, taprostene, tartaric tolimidone, tolindate, toliodium chloride, toliprolol, acid, tasuldine, taurocholic acid, taurolidine, tauromustine, tolmeSoxide, tolmetin, tolnaftate, tolnapersine, tolnidamine, tauroSelcholic acid, taurultam, taxol, taZadolene, taZanolast, toloconium metilsulfate, tolonidine, tolonium chloride, tazaburate, taZeprofen, tazifylline, taZiprinone, tazolol, toloxatone, toloxychlorinol, tolpadol, tolpentamide, tebatizole, tebuduine, teclothiazide, teclozan, tedisamil, tolperisone, toliprazole, tolpronine, tolpropamine, tefazoline, tefenperate, tefludazine, teflurane, teflutiXol, tolpyrramide, tolduinzole, tolrestat, toltraZuril, tolu fazepam, tegafur, telenzepine, temafloxacin, temarotene, temazepam, tolycaine, tomelukast, tomoglumide, tomoxetine, temefoS, temelastine, temocillin, temodox, temozolomide, 25 to moXip role, tona Zo cine, topiramate, toprilidine, temurtide, tenamfetamine, te nilapine, teniloxazine, tonazocine, topiramate, toprilidine, topterone, toguizine, tenilsetam, teniposide, tenocyclidine, tenonitro Zole, torasemide, toebafylline, toremifene, toSifen, toSufloxacin, tenoxicam, tenylidone, teopranitol, teoprolol, tepirindole, toSulur, toyocamycin, toyomycin, traboxepine, tracazolate, tepoxalin, teraZOsin, terbinafine, terbucromil, terbufibrol, tralonide, tramadol, tramaZoline, trandolapril, tranexamic terbuficin, terbuprol, terbutaline, terciprazine, terconazole, acid, tranilast, transcainide, trantellinium bromide, terfenadine, terfluranol, terguride, terizidone, ternidazole, tranylcypromine, trapencaine, trapidil, traXanox, traZilitine, terodiline, terofenamate, teroxalene, teroxirone, terpin traZium esilate, traZodone, traZolopride, trebenzomine, hydrate, tertatolol, teSicam, tesimide, testolactone, trecadrine, treloxinate, trenbolone acetate, trengestone, testosterone, testosterone cypionate, testosterone enanthate, trenizine, troSulfan, trepibutone, trepipam, trepirium iodide, testosterone ketolaurate, testosterone phenylacetate, test 35 treptilamine, trequensin, trestolone acetate, trethinium osterone propionate, tetrabarbital, tetrabenazine, tetracaine, tosilate, trethocanoic acid, tretinoin, tretoquinol, triacetin, tetrachloroethylene, tetracycline, tetradonium bromide, tet triafungin, triamcinolone, triamcinolone acetonide, triamci raethylammonium chloride, tetrahydrozoline, tetramethrin, nolone acetonide-phosphate, triamcinolone benetonide, tri tetramisole, tetrandrine, tetrantoin, tetrazepam, tetriprofen, amcinolone diacetate, triamcinolone furetonide, triamcino tetronasin 5930, tetroquinone, tetroXoprim, tetrydamine, 40 lone hexacetonide, triampyZine, triamterene, triaZinate, texacromil, thalicarpine, thalidomide, thebacon, thebaine, tria Ziquone, tria Zolam, tribendilol, tribe no Side, thenalidine, thenium closylate, thenyldiamine, theobromine, tribromoethanol, tribromsalan, tribuZone, triacetamide, theodrenaline, theofibrate, theophylline, thiabendazole, trichlormethiazide, trichlormethine, trichloroacetic acid, thiacetarsamide, thialbarbital, thiambutosine, thiamine, trichloroethylene, tricribine phosphate, triclabendazole, thiamiprine, thiamphenicol, thiamylal, thiazeSim, thiaZina 45 triclacetamol, triclazate, triclobisonicum chloride, mium chloride, thiazolsulfone, thiethyperazine, thihexinol triclocarban, triclodaZol, triclofenol, piperazine, triclofoS, methylbromide, thimerfonate, thimerosal, thiocarbanidin, triclofylline, triclonide, triclosan, tricyclamol chloride, tridi thiocarZolamide, thiocolchioside, thiofuradene, thioguanine, heXethyl chloride, trientine, triethylene melamine, thioguanine alpha-deoxyriboside, thioguanine beta triethylenephosphoramide, trifenagrel, trifeZolac, triflocin, deoxyriboside, thioguanosine, thiohexamide, thioinosine, 50 triflubazam, triflumidate, trifluomeprazine, trifluoperazine, thiopental, thiopropazate, thioproperazine, thioridazine, triflu peridol, triflu promazine, trifluridine, triflusal, thiosalan, thiotepa, thiotetrabarbital, thiothixene, thiouracil, trigeVolol, trihexyphenidyl, triletide, triloStane, trimaZosin, thiphenamil, thiphencillin, thiram, thonzonium bromide, trimebutine, trime caine, trime do Xime bromide, thonzylamine, thozalinone, threonine, thymidine, thymol, trimeperidine, trimeprazine, trimetazidine, trimethadione, thymol iodide, thymopentin, thyromedan, thyropropic acid, 55 trimethamide, trimethaphan camsylate, trimethidinium tiacrilast, tiadenol, tiafibrate, tiamenidine, tiametonium metho Sulfate, trimethobe nZamide, trimethoprim, iodide, tiamulin, tianafac, tianeptine, tiapamil, tiapirinol, trimetozine, trimetrexate, trime Xiline, trimipramine, tiapride, tiaprofenic acid, tiaprost, tiaramide, tiazofurin, trimoprostil, trimoxamine, trioxifene, trioxSalen, tripamide, tiaZuril, tibalosin, tibenalast Sodium, tibenzate, tibeZonium triparanol, tripelennamine, tripotassium dicitratobismuthate, iodide, tibolone, tibric acid, tibrofan, tic-mustard, ticabeSone 60 triprolidine, tritioZine, tritoqualine, trityl cysteine, trixolane, propionate, ticarbodine, ticarcillin, ticarcillin creSyl, trizoxime, trocimine, troclosene potassium, trofosfamide, ticlatone, ticlopidine, ticrynafen, tidiacic, tiemoium iodide, troleandomycin, trolnitrate, tromantadine, tromethamine, tie nocarbine, tienopramine, tienoxoloi, tifemoxone, tropabazate, tropanserin, tropapride, tropatepine, tropen tiflamizole, tiflorex, tifluadom, tiflucarbine, tiformin, tifurac, Ziline bromide, tropicamide, tropigline, tropiprine, tigemonam, tigestol, tigloidine, tilbroquinol, tiletamine, 65 tropodifene, trospectomycin, troSpium chloride, troXerutin, tilidine, tiliquinol, tilisolol, tilmicosin, tilomisole, tillorone, troXipide, troXolamide, troxonium tosilate, troxypyrrolium tilozepine, tilSuprost, timefurone, timegadine, timelotem, tosilate, troxypyrrolium tosilate, truXicurium iodide, truxi US 6,264,917 B1 57 58 picurium iodide, tryparsamide, tryptophan, tryptophane the poly-L-lysine Solution for 15 minutes at room tempera mustard, tuaminoheptane, tubercidine, tubocurarine ture. Zeta potential measurements confirmed that the poly chloride, tubulozole, tuclazepam, tulobutrol, tuvatidine, L-lysine-coated microbubbles were positively charged while tybamate, tylocrebin, tylosin, tyramine, tyropanic acid, the uncoated bubbles were negatively charged. A cell adhe tyrosine, ubenimex, ubidecarenone, ubisindine, ufenamate, Sion Study using human endothelial cells grown in culture ufiprazole, uldazepam, ulobetasol, undecoylium chloride, dishes was performed with the above-described undecyclenic acid, uracil mustard, urapidil, urea, uredepa, microbubbles, the uncoated microbubbles being used as a uredofos, urefibrate, urethane, uridine, urSodeoxycholic control. Microscopy of the endothelial cells after incubation acid, urSucholic acid, Vadocaine, Valconazole, Valdetamide, showed a much increased number of poly-L-lysine-coated Valdipromide, Valine, Valnoctamide, Valofane, Valperinol, microbubbles adhering to endothelial cells in comparison to Valproate pivoxil, Valproic acid, Valpromide, Valtrate, van the uncoated microbubbles. comycin hc l, Vane prim, Vanillin, Vanitolide, Vanyldisulfamide, Vapi.prost, vecuronium bromide, Velna EXAMPLE 2 crine male ate, Venlafaxine, Veradoline, Veralipride, Gas-filled Microbubbles Comprising Verapamil, Verazide, Verilopam, Verofylline, Vesnarinone, 15 Phosphatidylserine and RGDC-Mal-PEGo-DSPE Vetrabutine, Vidarabine, Vidarabine phophate, vigabatrin, (SEQ ID NO:1) Viloxazine, Viminol, Vinbarbital, vinblastine, Vinburnine, a) Synthesis of Boc-NH-PEGoo-DSPE (t-butyl carbamate Vincamine, Vincanol, Vincantril, VincofoS, Vinconate, poly(ethylene glycol)distearoylphosphatidylethanolamine) Vincristine, Vindrburnol, Vindesline, Vindepidine, Vinformide, DSPE (distearoylphosphatidylethanolamine) (31 mg, Vinglycinate, Vinorelbine, Vin pocetine, Vinpoline, Sygena Inc.) was added to a solution of Boc-NH-PEGoo Vinrosidine, Vintiamol, Vintriptol, Vinylbital, Vinylether, SC (t-butyl carbamate poly(ethylene glycol)-Succinimidyl Vinzolidine, Viomycin, Viprostol, Viqualine, Vicquidil, Virgin carbonate) (150 mg) in chloroform (2 ml), followed by iamycin factors, ViroXime, Visnadine, Visnafylline, Vitamin triethylamine (33 ul). The mixture formed a clear solution e, volazocine, warfarin, Xamoterol, Xanoxic acid, Xanthinol after stirring at 41 C. for 10 minutes. The solvent was rotary niacinate, Xanthiol, Xantifibrate, Xantocillin, Xenalipin, Xena 25 evaporated and the residue taken up in acetonitrile (5 ml). Zoic acid, Xenbucin, Xenipentone, Xenthiorate, Xenygloxal, The thus-obtained dispersion was cooled to 4 C. and Xenyhexenic acid, Xeny tropium bromide, Xibenolol, centrifuged, whereafter the Solution was separated from the Xibornol, Xilobam, Ximoprofen, Xinidamine, Xinomiline, undissolved material and evaporated to dryneSS. The Struc Xipamide, Xipranolol, Xorphanol, Xylamidine, Xylazine, ture of the resulting product was confirmed by NMR. Xylocoumarol, Xylometazoline, Xyloxemine, yohimbic acid, b) Synthesis of HN-PEGo-DSPE (amino-poly(ethylene Zabicipril, Zacopride, Zafuleptine, Zaltidine, Zapizolam, glycol)-distearoylphosphatidylethanolamine) Zaprinast, Zardaverine, Zenazocine meSylate, Zepastine, Boc-NH-PEGo-DSPE (167 mg) was stirred in 4 M Zeranol, Zetidoline, Zidapamide, Zidometacin, Zidovudine, hydrochloric acid in dioxane (5 ml) for 2.5 hours at ambient Zilantel, Zimeldine, Zimidoben, Zinc acetate, Zinc temperature. The Solvent was removed by rotary evapora phenolsulfonate, Zinc undecylenate, Zindotrine, Zindoxifene, 35 tion and the residue was taken up in chloroform (1.5 ml) and Zinoconazole, Zinterol, ZinviroXime, Zipeprol, Zocainone, washed with water (2x1.5 ml). The organic phase was Zofenopril, Zoficonazole, Zolamine, Zolazepam, Zolenzepine, removed by rotary evaporation. TLC (chloroform/methanol/ Zollertine, Zolimidine, Zoliprofen, Zoloperone, Zolpidem, water 13:5:0.8) gave the title product with Rf=0.6; the Zomeba Zam, Zome pirac, Zome tapine, Zonisamide, Structure of the product, which was ninhydrin positive, was Zopiclone, Zorubicin, Zote pine, Zoxazolamine, 40 confirmed by NMR. Zuclomiphene, Zuclophenthixol, Zylofuramine. c) Synthesis of Mal-PEG - D SPE The following non-limitative examples Serve to illustrate (3-male imidopropio nate poly (ethylene glycol) the invention. Confirmation of the microparticulate nature of distearoylphosphatidylethanolamine) products is performed using microscopy as described in A Solution of N-Succinimidyl-3-maleimidopropionate WO-A-9607434. Ultrasonic transmission measurements 45 (5.6 mg, 0.018 mmol) in tetrahydrofuran (0.2 ml) is added may be made using a broadband transducer to indicate to HN-PEGoo-DSPE (65 mg, 0.012 mmol) dissolved in microbubble Suspensions giving an increased Sound beam tetrahydrofuran (1 ml) and 0.1 M sodium phosphate buffer attenuation compared to a Standard. Flow cytometric analy pH 7.5 (2 ml). The reaction mixture is heated to 30° C. and sis of products can be used to confirm attachment of mac the reaction is followed to completion by TLC, whereafter romolecules thereto. The ability of targeted microbubbles to 50 the Solvent is evaporated. bind Specifically to cells expressing a target may be Studied d) Synthesis of RGDC-Mal-PEGo-DSPE (SEQ ID NO:1) in vitro by microScopy and/or using a flow chamber con Mal-PEGoo-DSPE (0.010 mmol) in 0.1 M sodium phos taining immobilised cells, for example employing a popu phate buffer having a pH of 7.5 is added to the peptide lation of cells expressing the target Structure and a further RGDC (SEQID NO: 1) (0.010 mmol). The reaction mixture population of cells not expressing the target. Radioactive, 55 is heated to 37 C. if necessary and the reaction is followed fluorescent or enzyme-labelled Streptavidin/avidin may be by TLC to completion, whereafter the solvent is removed. used to analyse biotin attachment. e) Preparation of Gas-filled Microbubbles Encapsulated by phosphatidylserine and RGDC-Mal-PEGoo-DSPE (SEQ EXAMPLE 1. ID NO:1) 60 To a mixture (5 mg) of phosphatidylserine (90-99.9 mol Adhesion of poly-L-lysine-coated %) and Mal-PEG-DSPE (10-0.1 mol %) is added 5 phosphatidylserine-encapsulated Microbubbles to propylene glycol-glycerol in water (1 ml). The dispersion is Endothelial Cells heated to not more than 80 C. for 5 minutes and then cooled Poly-L-lysine (8 mg) having a molecular weight of 115 to ambient temperature. The dispersion (0.8 ml) is then kDa was dissolved in water (400 ul). Freshly redispersed 65 transferred to a vial (1 ml) and the head space is flushed with microbubbles of phosphatidylserine-encapsulated perfluo perfluorobutane. The vial is shaken in a cap-mixer for 45 robutane (40 ul) were incubated in either water (400 ul) or Seconds, whereafter the Sample is put on a roller table. After US 6,264,917 B1 59 60 centrifugation the infranatant is exchanged with 0.1 M cholesterol dissolved in tetrahydrofuran and 0.1 M sodium Sodium phosphate buffer having a pH of 7.5. The peptide phosphate buffer having a pH of 7.5 (2 ml). The reaction RGDC (SEQ ID NO:1), dissolved in 0.1 M sodium phos mixture is heated to 30° C. and the reaction is followed to phate buffer having a pH of 7.5, is added to the washed completion by TLC, whereafter the solvent is evaporated. microbubbles, which are placed on the roller table. The f) Preparation of Gas-filled Microbubbles Encapsulated with Washing procedure is then repeated. Phosphatidylserine, Phosphatidylcholine and f) Alternative Preparation of Gas-filled Microbubbles biotinamidocaproate-PEG-Ala-cholesterol Encapsulated by Phosphatidylserine and RGDC-Mal To a mixture (5 mg) of phosphatidylserine and phosphati PEG-DSPE (SEQ ID NO:1) dylcho line (in total 90-99.9 mol %) and To phosphatidylserine (5 mg) is added 5% propylene biotinamidocaproate-PEG-Ala-cholesterol (10-0.1 mol glycol-glycerol in water (1 ml). The dispersion is heated to %) is added 5% propylene glycol-glycerol in water (1 ml). not more than 80 C. for 5 minutes and then cooled to The dispersion is heated to not more than 80 C. for 5 ambient temperature. The dispersion (0.8 ml) is transferred minutes and then cooled to ambient temperature. The dis to a vial (1 ml) and the head space is flushed with perfluo persion (0.8 ml) is then transferred to a vial (1 ml) and the robutane. The Vial is shaken in a cap-mixer for 45 seconds, 15 head space is flushed with perfluorobutane. The vial is whereafter the Sample is put on a roller table. After cen Shaken in a cap-mixer for 45 seconds, whereafter the Sample trifugation the infranatant is exchanged with 0.1 M Sodium is put on a roller table. After centrifugation the infranatant is phosphate buffer having a pH of 7.5. RGDC-Mal-PEGoo eXchanged with water and the Washing is repeated. DSPE (SEQ ID NO: 1) dissolved in 0.1 M sodium phosphate g) Alternative Preparation of Gas-filled Microbubbles buffer having a pH of 7.5 is added to the washed Encapsulated with Phosphatidylserine, Phosphatidylcholine microbubbles, which are then placed on the roller table. The and biotinamidocaproate-PEGoo-Ala-cholesterol Washing procedure is repeated following incorporation of To a mixture (5 mg) of phosphatidylserine and phosphati the RGDC-Mal-PEG-DSPE (SEQ ID NO:1) into the dylcholine is added 5% propylene glycol-glycerol in water microbubble membranes. (1 ml). The dispersion is heated to not more than 80° C. for EXAMPLE 3 25 5 minutes and then cooled to ambient temperature. The dispersion (0.8 ml) is then transferred to a vial (1 ml) and the Gas-filled Microbubbles Encapsulated with head space is flushed with perfluorobutane. The vial is Phosphatidylserine, Phosphatidylcholine and biotin Shaken in a cap-mixer for 45 seconds, whereafter the Sample amidocaproate-PEG-4oo-Ala-cholesterol is put on a roller table. After centrifugation the infranatant is a) Synthesis of Z-Ala-cholesterol (3-O-(carbobenzyloxy-L- eXchanged with water. Biotinamidocaproate-PEGoo-Ala alanyl)cholesterol) cholesterol dissolved in water is added to the washed Cholesterol (4 mmol), Z-alanine (5 mmol) and dimethy microbubbles, which are placed on a roller table for several laminopy ridine (4 mmol) were dissolved in hours. The washing procedure is repeated following incor dimethylformamide/tetrahydrofuran (20 ml +5 ml) and dicy poration of the biotinamidocaproate-PEGoo-Ala clohexylcarbodiimide was added. The reaction mixture was 35 Stirred at ambient temperature overnight. Dicyclohexylurea cholesterol into the microbubble membranes. was filtered off and the solvent was rotary evaporated. The EXAMPLE 4 residue was taken up in chloroform, undissolved dicyclo hexylurea was filtered off and the solvent was removed by Gas-filled Microbubbles Comprising rotary evaporation. The residue was placed on a column of 40 Phosphatidylserine, Phosphatidylcholine, Silica gel, and Z-Ala-cholesterol was eluted with toluene/ biotinamidocaproate-PEGoo-Ala-Cholesterol and petroleum ether (20:2) followed by toluene/diethyl ether Drug-cholesterol (20:2). The fractions containing the title compound were combined and the Solvent was removed by rotary evapora a) Synthesis of Drug-cholesterol tion. The structure of the product was confirmed by NMR. 45 Cholesterol (4 mmol), a drug having an acid group and b) Synthesis of Ala-cholesterol (3-O-(L-alanyl)-cholesterol) dimethylaminopyridine (4 mmol) are dissolved in Z-Ala-cholesterol (0.48 mmol) is placed in tetrahydrofu dimethylformamide/tetrahydrofuran (20 ml+5 ml) and dicy ran (20 ml) and glacial acetic acid (3 ml) and hydrogenated clohexylcarbodiimide is added. The reaction mixture is in the presence of 5% palladium on charcoal for 2 hours. The Stirred at ambient temperature overnight. Dicyclohexylurea reaction mixture is filtered and concentrated in vacuo. 50 is filtered off and the solvent is rotary evaporated. The title c) Synthesis of Boc-NH-PEGoo-Ala-cholesterol compound is purified by chromatography. Ala-cholesterol is added to a solution of Boc-NH b) Preparation of Gas-filled Microbubbles Encapsulated PEGoo-SC (t-butyl carbamate poly(ethylene glycol)- with Phosphatidylserine, Phosphatidylcholine, succinimidyl carbonate) in chloroform, followed by triethy biotinamidocaproate-PEGoo-Ala-cholesterol and Drug lamine. The suspension is stirred at 41 C. for 10 minutes. 55 cholesterol The crude product is purified by chromatography. To a mixture (5 mg) of phosphatidylserine and phosphati d) Synthesis of H-N-PEGoo-Ala-cholesterol dylcho line (in total 90-99.9 mol %) and Boc-NH-PEGoo-Ala-cholesterol is stirred in 4M hydro biotinamidocaproate-PEGoo-Ala-cholesterol (prepared as chloric acid in dioxane for 2.5 hours at ambient temperature. in Example 3) and drug-cholesterol (in total 10-0.1 mol%) The solvent is removed by rotary evaporation and the 60 is added 5% propylene glycol-glycerol in water (1 ml). The residue is taken up in chloroform and washed with water. dispersion is heated to not more than 80 C. for 5 minutes The organic phase is rotary evaporated to dryneSS. The crude and then cooled to ambient temperature. The dispersion (0.8 product may be purified by chromatography. ml) is transferred to a vial (1 ml) and the head space is e) Synthesis of biotinamidocaproate-PEGoo-Ala flushed with perfluorobutane. The vial is shaken in a cap cholesterol 65 mixer for 45 Seconds whereafter the Sample is put on a roller A Solution of biotinamidocaproate N-hydroxySuccinimide table. After centrifugation the infranatant is exchanged with ester in tetrahydrofuran is added to HN-PEG-400-Ala water and the Washing is repeated. US 6,264,917 B1 61 62 EXAMPLE 5 measured by Coulter Counter. Ultrasound transmission mea surements using a 3.5 MHz broadband transducer showed Gas-filled Microbubbles Encapsulated with that a particle dispersion of <2 mg/ml gave a Sound beam Phosphatidylserine and thiolated-anti-CD34-Mal attenuation higher than 5 dB/cm. PEGo-DSPE a) Preparation of Thiolated anti-CD34 Antibodies EXAMPLE 8 Thiolation of anti-CD34 antibodies may be effected as described by Hansen, C. B. et al.(1995) Biochim. BiophyS. Gas-filled Microbubbles Encapsulated with Acta 1239, 133-144. Phosphatidylserine and Biotinylated Antibody Non b) Preparation of Gas-filled Microbubbles Encapsulated covalently Bound to streptavidin-Succ-PEG-DSPE with Phosphatidylserine and thiolated-anti-CD34-Mal a) Synthesis of Succ-PEGoo-DSPE PEG-DSPE NH-PEGo-DSPE (prepared as in Example 2) is car To a mixture (5 mg) of phosphatidylserine (90-99.9 mol boxylated using Succinic anhydride, e.g. by a similar method %) and Mal-PEGo-DSPE (10-0.1 mol %, prepared as in to that described by Nayar, R. and Schroit, A. J. in Bio Example 2) is added 5% propylene glycol-glycerol in water 15 chemistry (1985) 24, 5967-71. (1 ml). The dispersion is heated to not more than 80° C. for b) Preparation of Gas-filled Microbubbles Encapsulated 5 minutes and then cooled to ambient temperature. The with Phosphatidylserine and Succ-PEG-DSPE dispersion (0.8 ml) is transferred to a vial (1 ml) and the head To a mixture (5 mg) of phosphatidylserine (90-99.9 mol space is flushed with perfluorobutane. The vial is shaken in %) and Succ-PEG-DSPE (10-0.1 mol %) is added 5% a cap-mixer for 45 Seconds, whereafter the Sample is put on propylene glycol-glycerol in water (1 ml). The dispersion is a roller table. After centrifugation the infranatant is heated to not more than 80 C. for 5 minutes and then eXchanged with an appropriate buffer and coupling of the coooled to ambient temperature. The dispersion (0.8 ml) is thiolated antibody to the microbubbles is performed, e.g. as transferred to a vial (1 ml) and the head space is flushed with described by Goundalkar, A., Ghose, T. and Mezei, M. in J. perfluorobutane. The vial is shaken in a cap-mixer for 45 Pharm. Pharmacol. (1984) 36 465–66 or Hansen, C. B. et 25 Seconds, whereafter the Sample is put on a roller table. After al.(1995) Biochim. Biophys. Acta 1239 133–144. The centrifugation the infranatant is exchanged with water and microbubbles are then placed on a roller table for several the Washing is repeated. Alternatively the microbubbles may hours and are washed. Flow cytometric analysis of the be prepared as described in Example 20f). resulting microbubbles (employing a fluorescently labeled c) Coupling of Streptavidin to Gas-filled Microbubbles Secondary antibody) is used to confirm attachment of the Encapsulated with Phosphatidylserine and Succ-PEGoo anti-CD34 antibody to the bubbles. The ability of the DSPE bubbles to bind specifically to CD34-expressing cells is Streptavidin is covalently bound to Succ-PEGo-DSPE Studied by microscopy employing one population of cells in the microbubble membranes by Standard coupling meth expressing CD34 and one population that do not express ods using a water-Soluble carbodiimide. The sample is CD34. placed on a roller table during the reaction. After centrifu 35 gation the infranatant is exchanged with water and the EXAMPLE 6 Washing is repeated. The functionality of the attached Streptavidin is analysed by binding, e.g. to fluorescently Biotin Attached to Gas-filled Microbubbles labeled biotin, biotinylated antibodies (detected with a fluo rescently labeled Secondary antibody) or biotinylated and Biotin may be attached to microbubbles in many different 40 fluorescence- or radioactively-labeled oligonucleotides. ways, e.g. in a similar way to that described by Corley, P. and Analysis is performed by fluorescence microscopy or Scin Loughrey, H. C. in (1994) Biochim. Biophys. Acta 1195, tillation counting. 149-156. The resulting bubbles are analysed by flow d) Preparation of Gas-filled Microbubbles Encapsulated cytometry, e.g. by employing fluorescent Streptavidin to with Phosphatidylserine and Biotin Non-covalently Bound detect attachment of biotin to the bubbles. Alternatively 45 to streptavidin-Succ-PEGo-DSPE radioactive or enzyme-labelled Streptavidin/avidin is used to Microbubbles from Example 8(c) are incubated in a analyse biotin attachment. Solution containing biotinylated vectors, e.g. biotinylated EXAMPLE 7 antibodies. The vector-coated microbubbles are washed as described above. Gas-filled Microbubbles Encapsulated with 50 Distearoylphosphatidylserine and biotin-DPPE EXAMPLE 9 To distearoylphosphatidylserine (DSPS) (22.6 mg) was Gas-filled Microbubbles Encapsulated with added 4% propylene glycol-glycerol in water (4 ml). The Phosphatidylserine and Biotinylated dispersion was heated to not more than 80 C. for five 55 Oligonucleotide Non-covalently Bound to minutes and then cooled to ambient temperature. An acque streptavidin-Succ-PEG-DSPE ous dispersion of biotin-DPPE (1.5 mg) in 4% propylene a) Synthesis of Succ-PEGoo-DSPE glycol-glycerol (1 ml) was added and the sample was put on NH-PEGoo-DSPE (prepared as in Example 2) is car a roller table for 1-2 hours. The Suspension was filled into boxylated using Succinic anhydride, e.g. by a similar method Vials and the head Spaces were flushed with perfluorobutane. 60 to that described by Nayar, R. and Schroit, A. J. in Bio The vials were shaken for 45 seconds, whereafter they were chemistry (1985) 24, 5967-71. put on a roller table. After centrifugation for 7 minutes the b) Preparation of Gas-filled Microbubbles Encapsulated infranatant was exchanged with water and the Washing was with Phosphatidylserine and Succ-PEG-DSPE repeated twice. Normal phase HPLC with an Evaporative To a mixture (5 mg) of phosphatidylserine (90-99.9 mol Light Scattering Detector confirmed that the membranes of 65 %) and Succ-PEGo-DSPE (10-0.1 mol %) is added 5% the microbubbles contained 4 mol % biotin-DPPE. The propylene glycol-glycerol in water (1 ml). The dispersion is mean particle diameter of the microbubbles was 4 um heated to not more than 80 C. for 5 minutes and then cooled US 6,264,917 B1 63 64 to ambient temperature. The dispersion (0.8 ml) is trans b) Preparation of thiolated-anti-ICAM-1 Antibodies ferred to a vial (1 ml) and the head space is flushed with perfluorobutane. The vial is shaken in a cap-mixer for 45 Thiolation of anti-ICAM-1 antibodies may be effected as Seconds, whereafter the Sample is put on a roller table. After described by Hansen, C. B. et al. in (1995) Biochim. centrifugation the infranatant is exchanged with water and Biophys. Acta 1239, 133-144. the Washing is repeated. Alternatively the microbubbles may c) Preparation of thiolated-anti-E-selectin Antibodies be prepared as described in Example 20f). Thiolation of anti-E-selectin antibodies may be effected as c) Coupling of Streptavidin to Gas-filled Microbubbles described by Hansen, C. B. et al. in (1995) Biochim. Encapsulated with Phosphatidylserine and Succ-PEGoo Biophys. Acta 1239, 133-144. DSPE Streptavidin is covalently bound to Succ-PEGoo-DSPE d) Preparation of Gas-filled Microbubbles Encapsulated in the microbubble membraneSS by Standard coupling meth with Phosphatidylserine and thiolated-anti-CD34-Mal ods using a water-Soluble carbodiimide. The Sample is PEGoo-DSPE, thiolated-anti-ICAM-1-Mal-PEGoo placed on a roller table during the reaction. After centrifu DSPE thiolated-anti-E-selectin-Mal-PEGo-DSPE gation the infranatant is exchanged with water and the To a mixture (5 mg) of phosphatidylserine (90-99.9 mol Washing is repeated. The functionality of the attached Streptavidin is analyzed by binding, e.g. to fluorescently 15 %) and Mal-PEG-DSPE (10-0.1 mol %, prepared as in labeled biotin, biotinylated antibodies (detected with a fluo Example 2) is added 5 propylene glycol-glycerol in water (1 rescently labeled Secondary antibody) or biotinylated and ml). The dispersion is heated to not more than 80° C. for 5 fluorescence- or radioactively-labeled oligonucleotides. minutes and is then cooled to ambient temperature. The Analysis is performed by fluorescence microScopy or Scin dispersion (0.8 ml) is transferred to a vial (1 ml) and the head tillation counting. space is flushed with perfluorobutane. The vial is shaken in d) Preparation of Gas-filled Microbubbles Encapsulated a cap-mixer for 45 Seconds, whereafter the Sample is put on with Phosphatidylserine and a Biotinylated Oligonucleotide a roller table. After centrifugation the infranatant is Non-covalently Bound to streptavidin-Succ-PEGo-DSPE eXchanged with an appropriate buffer, and coupling of the Microbubbles from Example 9(c) are incubated in a Solution containing a biotinylated oligonucleotide. The antibodies from Example 11(a), 11(b) and 11(c) to the oligonucleotide-coated bubbles are washed as described 25 microbubbles is performed, e.g. as described by Goundalkar, above. Binding of the oligonucleotide to the bubbles is A., Ghose, T. and Mezei, M. in J. Pharm. Pharmacol. (1984) detected e.g. by using fluorescent-labeled oligonucleotides 36, 465-466 or by Hansen, C. B. et al. in (1995) Biochim. for attachment to the bubbles, or by hybridising the attached Biophys. Acta 1239, 133-144. The microbubbles are placed oligonucleotide to a labeled (fluorescence or radioactivity) on a roller table for several hours and are then washed. complementary oligonucleotide. The functionality of the oligonucleotide-carrying microbubbles is analysed, e.g. by EXAMPLE 12 hybridising the bubbles with immobilized DNA-containing Sequences complementary to the attached oligonucleotide. AS examples, an oligonucleotide complementary to riboso The peptide FNFRLKAGQKIRFGAAAWEPPRARI mal DNA (of which there are many copies per haploid (SEQ ID NO:2) Attached to Gas-filled genome) and an oligonucleotide complementary to an onco 35 Microbubbles Encapsulated with Phosphatidylserine gene (e.g. ras of which there is one copy per haploid genome) may be used. The peptide FNFRLKAGOKIRFGAAAWEPPRARI EXAMPLE 10 (SEQ ID NO:2), comprising Phosphatidylserine-binding Gas-filled Microbubbles Encapsulated with and heparin-binding Sections, is Synthesised. The peptide is Phosphatidylserine and Folate-PEG-Succ-DSPE 40 added to preformed Phosphatidylserine-encapsulated per a) Preparation of Folate-PEG-Succ-DSPE fluorobutane microbubbles and thoroughly mixed. Folate-PEG-Succ-DSPE is synthesised as described by Lee, R. J. and Low, P. S. in (1995) Biochimica. Biophysica. Acta 1233, 134-144. EXAMPLE 13 b) Preparation of Gas-filled Microbubbles Encapsulated with Phosphatidylserine and Folate-PEG-Succ-DSPE 45 Fibronectin Covalently Bound to Gas-filled To a mixture (5 mg) of phosphatidylserine (90-99.9 mol Microbubbles Encapsulated with Phosphatidylserine %) and folate-PEG-DSPE (10-0.1 mol %) is added 5% and Phosphatidylethanolamine propylene glycol-glycerol in water (1 ml). The dispersion is heated to not more than 80 C. for 5 minutes and is then a) Microbubbles Preparation cooled to ambient temperature. The dispersion (0.8 ml) is DSPS (25 mg) and DSPE (5.0 mg) were weighed into a transferred to a vial (1 ml) and the head space is flushed with 50 clean vial and 5 ml of a solution of 1.4% propylene perfluorobutane. The vial is shaken in a cap-mixer for 45 glycol/2.4% glycerol was added. The mixture was warmed Seconds, whereafter the Sample is put on a roller table. After to 80° C. for 5 minutes. The sample was cooled to room centrifugation the infranatant is exchanged with water and temperature and the head Space was flushed with perfluo the Washing is repeated. Alternatively the microbubbles are robutane gas. The Vials were Shaken in a cap mixer for 45 prepared as described in Example 20e) or 20f). Analysis of 55 folate attachment may for example be done by microscopic Seconds and the microbubbles were twice washed with study of the binding of the folate-containing microbubbles to distilled water then resuspended in 0.1 M Sodium borate cells expressing different levels of folate receptors. buffer, pH 9. EXAMPLE 11 b) Modification of Fibronectin Gas-filled Microbubbles Encapsulated with 60 Fibronectin (1.0 mg) in 5 ml 0.01 M Hepes buffer, pH 8, Phosphatidylserine and thiolated-anti-CD34-Mal was added to 0.1 mmol of the crosslinker SDBP. The PEGo-DSPE, thiolated-anti-ICAM-1-Mal mixture was incubated on ice for 2 hours. PEG-DSPE and thiolated-anti-E-Selectin-Mal PEGo-DSPE c) Microbubble Modification. a) Preparation of thiolated-anti-CD34 Antibodies To the protein solution from (b) was added the Thiolation of anti-CD34 antibodies may be effected as 65 microbubble Suspension from (a) and incubation was described by Hansen, C. B. et al. in (1995) Biochim. allowed to proceed for 2 hours at room temperature on a Biophys. Acta 1239, 133-144. roller table. Unreacted material was removed by allowing US 6,264,917 B1 65 66 the microbubbles to float and then replacing the buffer with b) Preparation of Gas-filled Microbubbles Encapsulated 0.1 M sodium borate buffer, pH 9. This process was repeated with Phosphatidylserine and Succ-PEG-DSPE three times. To a mixture (5 mg) of phosphatidylserine (90-99.9 mol d) In vitro Analysis. %) and Succ-PEGoo-DSPE (10-0.1 mol %, prepared as in The microbubbles were tested in the in vitro assay 5 detailed in Example 21. A gradual accumulation of Example 9(a)) was added 5% propylene glycol-glycerol in microbubbles binding to the cells was observed. water (1 ml). The dispersion was heated to not more than 80 C. for 5 minutes and was then cooled to ambient tempera EXAMPLE 1.4 ture. The dispersion (0.8 ml) was transferred to a vial (1 ml) Gas-filled Microbubbles Encapsulated with and the head space was flushed with perfluorobutane. The Phosphatidylserine, and 3.3-N-(N,N'- dimethylaminoethane)carbamoylcholesterol Vial was Shaken in a cap-mixer for 45 Seconds, whereafter a) Synthesis of 3 B-N-(N',N'-dimethylaminoethane) the Sample was put on a roller table. After centrifugation the carbamoylcholesterol (DC-chol) (Farhood H., Gao, X, infranatant was exchanged with water and the Washing was Barsoum, J. and Huang, L., Anal. Biochem. 225, 89-93 repeated. Alternatively the microbubbles may be prepared as (1995)) 15 described in Example 2(f). To a stirred solution of 2-dimethylaminoethylamine c) Preparation of Gas-filled Microbubbles Encapsulated (19.40 mg, 24:1, 0.22 mmol) and triethylamine (310 ul, 2.23 with Phosphatidylserine and Inactivated Human thrombin mmol) in dichloromethane (3 ml) at room temperature was Succ-PEGo-DSPE slowly added a solution of cholesteryl chloroformate (100 mg, 0.22 mmol) in 1,4-dioxane. When the reaction was Inactivated human thrombin was covalently bound to completed, the mixture was evaporated to dryneSS and the Succ-PEGo-DSPE in the microbubbles from Example residue was purified by flash chromatography (CHCl/ 16(b) by Standard coupling methods using a water-Soluble MeOH, 4:1). A white solid was obtained, yield 105 mg carbodiimide. The Sample was placed on a roller table (95%). The structure was verified by NMR and MALDI. during the reaction. After centrifugation the infranatant was b) Preparation of Microbubble Dispersion eXchanged with water and the Washing was repeated. Monolayer-encapsulated Microbubbles containing per 25 fluorobutane are made from a mixture of 90% phosphati EXAMPLE 1.7 dylserine and 10% (DC-chol) by weighing DSPS (4.5 mg) and (DC-chol) (0.5 mg) into a 2 ml vial. 0.8 ml propylene glycol/glycerol (4%) in water was added. The Solution was Gas-filled Microbubbles Having Methotrexate and heated at 80 C. for 5 minutes and shaken. The solution was Prodrug-activating Enzyme Attached then cooled to ambient temperature and the headspace was a) Methotrexate Attached via a Peptide Linker to Gas-filled flushed with perfluorobutane. The vial was shaken on a Micrububbles cap-mixer at 4450 oscillations/minute for 45 seconds and put on a roller table. The Sample was washed by centrifuging Methods for attaching aminoacids to the anticancer drug at 2000 rpm for 5 minutes. The infranatant was removed by 35 methotrexate (MTX) are well described in the literature (see a Syringe and distilled water was added to the same Volume. e.g. Huennekens, F. M. (1994), TIBTECH 12, 234-239 and The headspace was again flushed with perfluorobutane and references therein). Instead of a single amino acid a peptide the Sample was kept on a roller table until a homogeneous may be attached to MTX using the same technology. Such appearance was obtained. The Washing procedure was a peptide may constitute a linker for the attachment of MTX repeated again. to the Surface of microbubbles. One class of Such linkers 40 comprises peptides of the general structure (MTX)-F-K/R- EXAMPLE 1.5 X-R-Z-C where X is any amino acid and Z is a hydrophobic Gas-filled Microbubbles Encapsulated with amino acid. A specific example of Such a linker is (MTX)- Phosphatidylserine and WEPPRARI-PE (SEQ ID F-K-L-R-L-C (SEQ ID NO:4). The SH-group in the Cys NO:3) 45 residue is employed for attachment of the MTX-peptide to Phosphatidylethanolamine (PE) is reacted with an the microbubbles (e.g. composed of phosphatidylserine and e quimolar amount of the cro SS linker Mal-PEG-DSPE) using standard technology, e.g. as in N-hydroxysuccinimidyl-2,3-dibromopropionate in a 1:1 Example 2. A linker of this kind is expected to be cleaved by mixture of dioxane and 0.02 M HEPES buffer, pH 8.0. the enzyme cathepsin B which often is Selectively overex Following incubation for 2 hours on ice, an equimolar pressed outside and on the Surface of tumour cells (Panchal, amount of the heparin-binding peptide WEPPRARI (SEQ 50 R. G. et al. (1996), Nat. Biotechnol. 14, 852-856). Thus, the ID NO:3) is added, the pH is brought to 9 by the addition of potential prodrug (MTX)-F-K/R-X-R would be liberated 0.2 M disodium tetraborate, and the incubation is continued Selectively in tumours. This prodrug can further be activated for 2 hours at room temperature. The reaction product is to the active drug MTX by the action of carboxypeptidases, purified by chromatography. Monolayer-encapsulated either present endogeneously in the tumour or targeted to the microbubbles containing perfluorobutane are made from a 55 tumour e.g. by tumour-associated antibodies (see below). mixture of 80–95% phosphatidylserine (PS) and 5-20% of b) Prodrug-activating Enzyme Covalently Attached to the peptide-substituted PE. Surface of Gas-filled Microbubbles EXAMPLE 16 An example of a prodrug-activating enzyme is carbox Gas-filled Microbubbles Encapsulated with 60 ypeptidase A (CPA), which may be conjugated to the Surface Phosphatidylserine and Inactivated Human of microbubbles encapsulated by, for example, a mixture of thrombin-Succ-PEGoo-DSPE phosphatidylserine and phosphatidylethanolamine, e.g. by a) Inactivation of Human Thrombin using a 3400 Da poly(ethylene glycol) chain bearing an Human thrombin was inactivated by incubation with a N-hydroxysuccinimide group at both ends (Perron, M.J. and 20% molar excess of D-Phe-L-Pro-L-Arg-chloromethyl 65 Page, M., Br. J. Cancer 73,281-287); the microbubbles may ketone in 0.05 M HEPES buffer, pH 8.0, at 37° C. for 30 be prepared by standard methods. Microbubbles containing minutes. CPA may be targeted to areas of pathology by incorporating US 6,264,917 B1 67 68 a Suitable targeting vector in the CPA-containing bubbles. b) Preparation of Gas-filled Microbubbles Encapsulated Alternatively CPA may be attached directly to a vector (e.g. with Phosphatidylserine, thiolated-anti-CEA-Mal-PEGoo an antibody), for example by the method as described above. DSPE and the Anticancer Prodrug N-trifluoroacetyl In this latter case the CPA-vector conjugate will be attached adriamycin-14-Valerate to the Surface of the microbubbles as described in Hansen, C. B. et al. (1995) Biochim. Biophys. Acta 1239 133-144. To a mixture (5 mg) of phosphatidylserine (90-99.9 mol Examples of the many possible prodrug-enzyme pairs are %), Mal-PEG-DSPE (10-0.1 mol %, prepared as in described in e.g. Huennekens, F. M. (1994) TIBTECH 12, Example 2) and the anticancer prodrug N-trifluoroacetyl 234-239. adriamycin-14-valerate (Mori, A. et al. (1993) Pharm. Res. 10, 507–514), is added 5% propylene glycol-glycerol in EXAMPLE 1.8 water (1 ml). The dispersion is heated to not more than 80 C. for 5 minutes and is then cooled to ambient temperature. The dispersion (0.8 ml) is transferred to a vial (1 ml) and the 15 Gas-filled Microbubbles Encapsulated with head space is flushed with perfluorobutane. The vial is Phosphatidylserine, thiolated-anti-CEA-Mal Shaken in a cap-mixer for 45 seconds, whereafter the Sample PEGoo-DSPE and the Anticancer Prodrug. 3',5'-O- is put on a roller table. After centrifugation the infranatant is dipamitoyl-5-fluoro-2'-deoxyuridine eXchanged with an appropriate buffer, and coupling of the antibody to the microbubble is performed, e.g. as described by Goundalkar, A., Ghose, T. and Mezei, M. in J. Pharm. a) Preparation of Thiolated anti-CEA Antibodies Pharmacol. (1984) 36 465–66 or by Hansen, C. B. et al. in Thiolation of anti-CEA antibodies may be effected as (1995) Biochim. Biophys. Acta 1239 133-144. The described by Hansen, C. B. et al. in (1995) Biochim. microbubbles are placed on a roller table for several hours Biophys. Acta 1239, 133-144. 25 and are then washed. b) Preparation of Gas-filled Microbubbles Encapsulated with Phosphatidylserine, thiolated-anti-CEA-Mal-PEGoo EXAMPLE 2.0 DSPE and the Anticancer Prodrug. 3',5'-O-dipamitoyl-5- fluoro-2'-deoxyuridine To a mixture (5 mg) of phosphatidylserine (90-99.9 mol Method of Use %), Mal-PEG-DSPE (10-0.1 mol %, prepared as in Example 2) and the anticancer prodrug 3',5'-O-dipamitoyl 35 5-fluoro-2'-deoxyuridine (Mori, A. et al. (1995) Cancer An agent comprising phosphatidylserine-encapsulated Chemother: Pharmacol. 35, 447-456) is added 5% propy microbubbles having inactivated human thrombin-Succ lene glycol-glycerol in water (1 ml). The dispersion is heated PEGoo-DSPE incorporated into the encapsulating mem to not more than 80 C. for 5 minutes and is then cooled to brane is lyophilised from 0.01 M phosphate buffer, pH 7.4. ambient temperature. The dispersion (0.8 ml) is transferred 40 The product is redispersed in Sterile water and injected to a vial (1 ml) and the head space is flushed with perfluo intravenously into a patient with Suspected venous throm robutane. The Vial is shaken in a cap-mixer for 45 seconds, bosis in a leg vein. The leg is examined by Standard whereafter the Sample is put on a roller table. After cen ultrasound techniques. The thrombus is located by increased trifugation the infranatant is exchanged with an approperiate 45 contrast as compared with Surrounding tissue. buffer, and coupling of the antibody to the microbubble is performed, e.g. as described by Goundalkar, A., Ghose, T. and Mezei, M. in J. Pharm. Pharmacol. (1984)36 465-466 EXAMPLE 21 or by Hansen, C. B. et al. in (1995) Biochim. Biophys. Acta 1239 133-144. The microbubbles are placed on a roller table 50 for Several hours and are then washed. Preparation and Biological Evaluation of Gas containing Microbubbles of DSPS doped with a EXAMPLE 1.9 Lipopeptide Comprising a Heparin Sulphate 55 Binding Peptide (KRKR) (SEQ ID NO:5) and a Fibronectin Peptide (WOPPRARI) (SEQ ID NO:6) Gas-filled Microbubbles Encapsulated with Phosphatidylserine, thiolated-anti-CEA-Mal PEGoo-DSPE and the Anticancer Prodrug N 60 This example is directed at the preparation of targeted trifluoroacetyl-adriamycin-14-Valerate microbubbles comprising multiple peptidic vectors arranged in a linear Sequence. a) Preparation of Thiolated anti-CEA Antibodies

Thiolation of anti-CEA antibodies may be effected as 65 a) Synthesis of a Lipopeptide Consisting of a Heparin described by Hansen, C. B. et al. in (1995) Biochim. Sulphate Binding Peptide (KRKR) (SEQ ID NO:5) and Biophys. Acta 1239 133-144. Fibronectin Peptide (WOPPRARI) (SEQ ID NO:6)

US 6,264,917 B1 71 72 The lipopeptide was synthesised on an ABI 433A auto and cells was viewed directly. A camera mounted on the matic peptide Synthesiser Starting with Fmoc-Ile-Wang resin microScope was connected to a colour Video printer and a on a 0.1 mmol Scale using 1 mmolamino acid cartridges. All monitor. A gradual accumulation of microbubbles on the amino acids and palmitic acid were preactivated using cells took place at a rate dependent on the flow rate. On HBTU before coupling. The simultaneous removal of pep further increasing the flow rate, cells Started to become tide from the resin and Side-chain protecting groups was detached from the coverslip, but the microbubbles remained carried out in TFA containing 5% phenol, 5% EDT, 5% bound to the cells. Control bubbles not carrying the vector aniSole and 5% H2O for 2 hours, giving a crude product did not adhere to the endothelial cells and disappeared from yield of 150 mg. Purification by preparative HPLC of a 40 the chamber under minimal flow conditions. mg aliquot of crude material was carried out using a gradient d) In vivo Experiment in Dog of 70 to 100% B over 40 minutes (A=0.1% TFA/water and Case 1) B=MeOH) at a flow rate of 9 ml/min. After lyophilisation, A 22 kg mongrel dog was anaesthetised with pentobar 16 mg of pure material were obtained (analytical HPLC, bital and mechanically ventilated. The chest was opened by gradient 70–100% B where B=MeOH, A=0.01% TFA/wa a midline Sternotomy, the anterior pericardium was ter: detection-UV 260 and fluorescence, EX-so, Emsso 15 removed, and a 30 mm gelled Silicone rubber spacer was product retention time=19.44 minutes). Further product inserted between the heart and a P5-3 transducer of an ATL characterisation was carried out using MALDI maSS Spec HDI-3000 ultrasound Scanner. The scanner was set for trometry: expected M+H at 2198, found at 2199. intermittent Short axis imaging once in each end-Systole by b) Preparation of Gas-filled Microbubbles of DSPS "doped delayed EGC triggering. A net Volume of 2 ml of with a Multiple-Specific Lipopeptide Consisting of a Hep microbubbles from (b) was injected as a rapid intravenous arin Sulphate Binding Peptide (KRKR) (SEQ ID NO:5) and bolus, 3 Seconds later, the imaged right ventricle was seen to Fibronectin Peptide (WOPPRARI) (SEQ ID NO:6) contain contrast material, and another 3 Seconds later the left DSPS (4.5 mg) and lipopeptide from (a) (0.5 mg) were Ventricle was also filled and a transient attenuation shadow weighed into each of two vials and 0.8 ml of a solution of which obscured the view of the posterior parts of the left 1.4% propylene glycol/2.4% glycerol was added to each 25 Ventricle was observed. Substantial increases in brightness vial. The mixtures were warmed to 80 C. for 5 minutes were seen in the myocardium and, when the attenuation (vials shaken during warming). The samples were cooled to shadow subsided, in the portions of the heart distal to the left room temperature and the head Spaces flushed with perfluo Ventricle. After passage of the inital bolus, the ultrasound robutane gas. The Vials were Shaken in a cap mixer for 45 Scanner was Set to continuous, high frame rate, high output seconds and rolled overnight. The resulting microbubbles power imaging, a procedure known to cause destruction of were washed Several times with deionised water and analy ultrasound contrast agent microbubbles in the imaged tissue sed by Coulter counter size: 1-3 micron (87%), 3-5 micron regions. After a few Seconds, the Scanner was adjusted back (11.5%) and acoustic attenuation (frequency at maximum to its initial Setting. The myocardium was then darker, and attenuation: 3.5 MHz). closer to the baseline value. Moving the imaged slice to a The microbubbles were stable at 120 mm Hg. MALDI 35 new position resulted in re-appearance of contrast effects, mass spectral analysis was used to confirm incorporation of moving the slice back to the initial position again resulted in lipopeptide into DSPS microbubbles as follows: ca. a tissue brightness close to baseline. 0.05-0.1 ml of microbubble suspension was transferred to a Case 2) comparative clean vial and 0.05-0.1 ml methanol was added. The Sus A net volume of 2 ml microbubbles prepared in an pension was Sonicated for 30 Seconds and the Solution was 40 identical manner to (b) above with the exception that no analysed by MALDI MS. Positive mode gave M+H at 2200 lipopeptide was included in the preparation was injected, (expected for lipopeptide, 2198). using the same imaging procedure as above. The myocardial c) In vitro Study of Gas-filled Microbubbles of DSPS echo enhancement was far less intense and of Shorter doped with a Multiple-Specific Lipopeptide Consisting of duration than that observed in Case 1. At the completion of a Heparin Sulphate-binding Peptide (KRKR) (SEQ ID 45 the left ventricular attenuation phase, there was also almost NO:5) and Fibronectin Peptide (WOPPRARI) (SEQ ID complete loSS of myocardial contrast effects, and the myo NO:6): Binding to Endothelial Cells Under Flow Conditions cardial echo increases in the posterior part of the left The human endothelial cell line ECV 304, derived from a ventricle noted in Case 1 were not observed. normal umbilical cord (ATCC CRL-1998) was cultured in EXAMPLE 22 260 mL Nunc culture flasks (chutney 153732) in RPMI 1640 50 medium to which L-glutamine (200 mM), penicillin/ Preparation of Gas-filled Microbubbles Encapsuled streptomycin (10,000U/mland 10,000 ug/ml) and 10% fetal with DSPS Comprising Thiolated anti-CD34-MAL bovine serum were added. The cells were Subcultured with PEGooo-PE a split ratio of 1:5 to 1:7 when reaching confluence. Cover a) Preparation of Gas-filled Microbubbles Encapsuled with glasses, 22 mm in diameter, were Sterilised and placed on the 55 DSPS and PE-PEGo-Mal bottom of 12 well culture plates, whereafter cells in 0.5 ml DSPS (4.5 mg, 3.9 mmol) and PE-PEG-Mal from complete medium with Serum were added above the plates. Example 50 (0.5 mg) were weighed into a clean vial and 1 When the cells reached confluence the coverslips were ml of a Solution of 1.4% propylene glycol/2.4% glycerol was placed in a custom-made flow chamber consisting of a added. The mixture was warmed to 80 C. for 5 minutes then groove carved into a glass plate upon which the cover Slip 60 filtered through a 4.5 micron filter. The sample was cooled with cells was placed, with the cells facing the groove, So as to room temperature and the head Space was flushed with to form a flow channel. Microbubbles prepared as in (b) perfluorbutane gas. The Vials were Shaken in a cap mixer for were passed from a reservoir held at 37 C. through the flow 45 seconds and the resulting microbubbles were washed chamber and back to the reservoir using a peristaltic pump. three times with distilled water. The flow rate was adjusted to Simulate physiologically 65 b) Thiolation of anti-CD34 Antibodies relevant shear rates. The flow chamber was placed under a To 0.3 mg of anti-CD34 antibody dissolved in 0.5 ml microScope and the interaction between the microbubbles phosphate buffered saline (PBS), pH7, was added 0.3 mg US 6,264,917 B1 73 74 Traut's reagent and the Solution was stirred at room tem for 1 hour. ExceSS reagent was separated from the modified perature for 1 hour. ExceSS reagent was separated from the protein on a NAP-5 column. modified protein on a NAP-5 column. c) Conjugation of Thiolated anti-CD62 and anti-ICAM-1 c) Conjugation of Thiolated anti-CD34 Antibody to Gas filled Microbubbles Encapsuled with DSPS and Comprising Antibodies to Gas-filled Microbubbles Encapsulated with DSPE-PEG-MAL DSPS and DSPE-PEGo-Mal 0.5 ml of the thiolated antibody praparation from (b) was 0.5 ml of the mixed thiolated antibody preparation from added to an aliquot of microbubbles from (a) and the (b) was added to an aliquot of Microbubbles from (a) and the conjugation reaction was allowed to proceed for 30 minutes conjugation reaction was allowed to proceed for 30 minutes on a roller table. Following centifugation at 2000 rpm for 5 on a roller table. Following centrifugation at 2000 rpm for minutes the infranatant was removed. The microbubbles 5 minutes, the infranatant was removed. The microbubbles were washed a further three times with water. were washed a further three times with water. d) Detection of the Antibody Encapsulated in the The PEG spacer length may be varied to include longer Microbubbles Using a FITC-conjugated Secondary Anti (e.g. PEGaloo and PEGsooo) or shorter (e.g. PEGoo or body 15 PEGsoo) chains. Addition of a third antibody Such as To the microbubble suspension from (c) was added 0.025 thiolated-anti-CD34 is also possible. mL FITC-conjugated goat-anti-mouse antibody. The mix ture was incubated in the dark at room temperature for 30 EXAMPLE 26 minutes on a roller table and was then centrifuged at 2000 rpm for 5 minutes. The infranatant was then removed and the Targeted Gas-filled Microbubbles Comprising microbubbles were washed a further three times with water. DSPS Coated Non-covalently with Polylysine and a Flow cytometric analysis of the microbubble suspension Fusion Peptide Comprising a PS-binding showed that 98% of the population was fluorescent. Component and a Fibronectin Peptide Sequence FNFRLKAGOKIRFGGGGWOPPRAI (SEQ ID EXAMPLE 23 25 NO:8) Preparation of Gas-filled Microbubbles Encapsuled a) Synthesis of PS-binding/fibronectin Fragment Fusion with DSPS Comprising Thiolated anti-CD62-MAL Peptide FNFRLKAGOKIRFGGGGWOPPRAI (SEQ ID PEGooo-PE NO:8) The peptide was synthesised on an ABI 433A automatic An identical procedure to that described in Example 22 peptide Synthesiser Starting with Fmoc-Ile-Wang resin on a was used to prepare microbubbles comprising anti-CD62 0.1 mmol Scale using 1 mmol amino acid cartridges. All antibodies. amino acids were preactivated using HBTU before coupling. The Simultaneous removal of peptide from the resin and EXAMPLE 24 Side-chain protecting groups was carried out in TFA con 35 taining 5% phenol, 5% EDT and 5% HO for 2 hours, giving Preparation of Gas-filled Microbubbles Encapsuled a crude product yield of 302 mg. Purification by preparative with DSPS Comprising Thiolated anti-ICAM-1- HPLC of a 25 mg aliquot of crude material was carried out MAL-PEG-PE using a gradient of 20 to 40% B over 40 minutes (A=0.1% An identical procedure to that described in Example 22 40 TFA/water and B=0.1%TFA/acetonitrile) at a flow rate of 9 was used to prepare microbubbles comprising anti-ICAM-1 ml/min. After lyophilisation 10 mg of pure material was antibodies. obtained (analytical HPLC, gradient 20 to 50% B where B=0.1% TFA/acetonitrile, A=0.01% TFA/water: detection EXAMPLE 25 UV 214 and 260 nm product retention time=12.4 minutes). Further product characterization was carried out using Preparation of Gas-filled Microbubbles 45 MALDI mass spectrometry: expected M+H at 2856, found Encapsulated with DSPS and Thiolated anti-CD62 at 2866. Mal-PEGooo-PE and thiolated-anti-ICAM-1-Mal b) Preparation of Gas-filled Microbubbles Comprising PEGooo-PE DSPS Coated Non-covalently with Polylysine and the This example is directed to the preparation of 50 PS-binding/fibronectin Fragment Fusion Peptide FNFRLK microbubbles comprising multiple antibody vectors for tar AGOKIRFGGGGWOPPRAI (SEQ ID NO:8) geted ultrasound imaging. DSPS (5 mg) was weighed into a clean vial along with a) Preparation of Gas-filled Microbubbles Encapsulated poly-L-lysine (0.2 mg) and peptide from (a) above (0.2 mg). with DSPS and PE-PEG-Mal To the vial was added 1.0 ml of a solution of 1.4% propylene DSPS (4.5 mg) and PE-PEGooo-Mal from Example 2(a) 55 glycol/2.4% glycerol. The mixture was warmed to 80 C. for (0.5 mg) were weighed into a clean vial and 1 ml of a 5 minutes. The Sample was cooled to room temperature and Solution of 1.4% propylene glycol/2.4% glycerol was added. the head Space was flushed with perfluorobutane gas. The The mixture was warmed to 80 C. for 5 minutes and then Vials were shaken in a cap mixer for 45 Seconds and the filtered through a 4.5 micron filter. The sample was cooled resulting microbubbles were centrifuged at 1000 rpm for 3 to room temperature and the head Space was flushed with 60 minutes. Following extensive washing with water, PBS and perfluorobutane gas. The Vials were Shaken in a cap mixer water, the final Solution was examined for polylysine and for 45 seconds and the microbubbles were washed three peptide content using MALDI MS. No polypeptide material times with distilled water. was observed in the final wash solution. Acetonitrile (0.5 ml) b) Thiolation of anti-CD62 and anti-ICAM-1 Antibodies was then added and the microbubbles were destroyed by To 0.3 mg each of anti-CD62 and anti-ICAM-1 antibodies 65 Sonication. Analysis of the resulting Solution for polylysine dissolved in PBS buffer (pH 7, 0.5 ml) was added Traut’s and PS-binding/fibronectin fusion peptide was then carried reagent and the Solutions were Stirred at room temperature out using MALDI MS. The results were as follows: US 6,264,917 B1 75 76 This peptide was Synthesised and purified using similar protocols to those described in (b) above. The pure product was characterised by HPLC and MALDI MS. MALDI expected MALDI found d) Preparation of Multiple-specific Gas-filled Microbubbles Poly-L-lysine 786,914, 790,919, 5 Encapsulated with Phosphatidylserine and biotin-PEGoo 1042, 1170 1048, 1177 b-Alanine Cholesterol DSPS-binding peptide 2856 2866 DSPS (4.5 mg) and biotin-PEGoo-b-alanine cholesterol from (a) (0.5 mg) were weighed into a vial and 0.8 ml of a The spacer element contained within the PS-binding/ Solution of 1.4% propylene glycol/2.4% glycerol was added. fibronectin fusion peptide (-GGG-) may also be replaced The mixture was warmed to 80° C. for 5 minutes (vials with other spacers Such as PEG or polyalanine (-AAA-). Shaken during warming). The sample was cooled to room A form of pre-targeting may also be employed, whereby the temperature and the head Space was flushed with perfluo DSPS-binding/fibronectin fragment fusion peptide is firstly robutane gas. The Vial was Shaken in a cap-mixer for 45 seconds and the vial was rolled overnight. The microbubble allowed to associate with cells via fibronectin peptide 15 binding, followed by administration of PS microbubbles Suspension was washed Several times with deionised water which then bind to the PS-binding peptide. and analysed by Coulter counter and acoustic attenuation. e) Conjugation with Fluorescein-labelled Streptavidin and EXAMPLE 27 Biotinylated Peptides from (b) and (c) To the microbubble preparation from (d) was added fluorescein-conjugated Streptavidin (0.2 mg) dissolved in Gas-filled Microbubbles Encapsulated with PBS (1 ml). The bubbles were placed on a roller table for 3 Phosphatidylserine and biotin-PEG-alanyl hours at room temperature. Following extensive Washing cholesterol and Functionalised with streptavidin/ with water and analysis by fluorescence microscopy, the biotinyl-endothelin-1 Peptide (biotin-D-Trp-Leu microbubbles were incubated in 1 ml of PBS containing Asp-Ile-Ile-Trp.OH) (SEQ ID NO:9) and biotinyl 25 biotinyl-endothelin-1 peptide (0.5 mg) and biotinyl-fibrin fibrin-anti-polymerant Peptide (biotin anti-polymerant peptide (0.5 mg) from (b) and (c) respec GPRPPERHOS.NH) (SEQ ID NO:10) tively for 2 hours. Extensive washing of the microbubbles was performed to remove unconjugated peptide. This example is directed at the preparation of targeted ultrasound microbubbles whereby streptavidin is used as a EXAMPLE 28 lihker between biotinylated reporter(s) and vector(s). a) Synthesis of biotin-PEGoo-b-Alanine Cholesterol Gas-filled Microbubbles Encapsulated with Phosphatidylserine and biotin-DPPE used to To a solution of cholesteryl-b-alanine hydrochloride (as Prepare a Streptavidin Sandwich with a Mixture described in Example 59) (15 mg, 0.03 mmol) in 3 ml 35 of biotinyl-endothelin-1 Peptide (biotin-D-Trp-Leu chloroform/wet methanol (2.6:1) was added triethylamine Asp-Ile-Ile-Trp.OH) (SEQ ID NO:9) and biotinyl (42 ml, 0.30 mmol). The mixture was stired for 10 minutes fibrin-anti-polymerant Peptide (biotin at room temperature and a solution of biotin-PEGo-NHS (100 mg, 0.03 mmol) in 1,4-dioxane (1 ml) was added GPRPPERHOS.NH) (SEQ ID NO:10) dropwise. After Stirring at room temperature for 3 hours, the 40 a) Preparation of Biotin-containing Microbubbles mixture was evaporated to dryneSS and the residue purified To a mixture of phosphatidylserine (5 mg) and biotin by flash chromatography to give white crystals, yield 102 DPPE (0.6 mg) in a clean vial was added 5% propylene mg (89%). The structure was verified by MALDI-MS and glycol-glycerol in water (1 ml). The dispersion was heated NMR. to 80 C. for 5 minutes and then cooled to ambient tem 45 perature. The head space was then flushed with perfluorobu b) Synthesis of biotinylated Endothelin-1 Peptide (biotin tane and the Vial was shaken in a cap-mixer for 45 seconds. D-Trp-Leu-Asp-Ile-Ile-Trp.OH) (SEQ ID NO:9) After centrifugation the infranatant was removed and the The peptide was synthesised on a ABI 433A automatic microbubbles were washed extensively with water. peptide synthesiser starting with Fmoc-Trp.(Boc)-Wang b) Conlugation of Gas-filled Microbubbles Encapsulated resin on a 0.1 mmol Scale using 1 mmol amino acid 50 with Phosphatidylserine and biotin-DPPE with Streptavidin cartridges. All amino acids were preactivated using HBTU and a Mixture of biotinyl-endothelin-1 (biotin-D-Trp-Leu before coupling. The Simultaneous removal of peptide from Asp-Ile-Ile-Trp.OH) (SEQ ID NO:9) and biotinyl-fibrin the resin and Side-chain protecting groups was carried out in anti-polymerant Peptide (biotin-GPRPPERHOS.NH) (SEQ TFA containing 5% anisole and 5% HO for 2 hours giving ID NO:10) a crude product yield of 75 mg. Purification by preparative 55 HPLC of a 20 mg aliquot of crude material was carried out The procedure detailed in Example 27 was followed. using a gradient of 30 to 80% B over 40 minutes (A=0.1% TFA/water and B=0.1% TFA/acetonitrile) and a flow rate of EXAMPLE 29 9 ml/min. After lyophilisation of the pure fractions 2 mg of pure material was obtained (analytical HPLC, gradient 60 PFB Gas-containing Microbubbles of DSPS 30–80% B where B=0.1% TFA/acetonitrile, A=0.01% TFA/ Functionalised with Heparin Sulphate Binding water: detection UV 214 nm product retention time=12.6 Peptide/Fibronectin peptide/RGD Peptide and minutes). Further product characterization was carried out Fluorescein using MALDI mass spectrometry: expected M--H at 1077, a) Synthesis of a Lipopeptide Containing the RGD Sequence found at 1077. 65 and a Fluorescein Reporter Group: Dipalmitoyl-Lys-Lys c) Synthesis of biotinyl-fibrin-anti-polymerant Peptide Lys-Lysacetyl-Arg-Gly-Asp-Lys(fluorescein)Gly.OH (biotin-GPRPPERHOS.NH)(SEQ ID NO:10) (SEQ ID NO:11)

US 6,264,917 B1 79 80 The lipopeptide was Synthesised as described in Example were warmed to 80° C. for 5 minutes (vials shaken during 21(a) using commercially available amino acids and poly warming). The samples were cooled to room temperature mers. The lipopeptide was cleaved from the resin in TFA and the head Spaces were flushed with perfluorobutane gas. containing 5% water, 5% phenol and 5% EDT for 2 hours. The Vials were Shaken in a cap mixer for 45 Seconds and then Following evaporation in vacuo the crude product was rolled overnight. The microbubbles so obtained were precipitated and triturated with diethyl ether. Purification by washed Several times with deionised water and analysed by preparative HPLC of a 40 mg aliquot of crude material was MALDI mass spectrometry as described in Example 21(b). carried out using a gradient of 60 to 100% B over 40 minutes The microbubbles were investigated by microscopy and (A=0.1%TFA/water and B=0.1%TFA/acetonitrile) at a flow were Seen to have a range of sizes between 1 and 5 microns. rate of 9 ml/min. After lyophilisation 10 mg of pure material Furthermore the microbubbles were fluorescent. (analytical HPLC, gradient 60–100% B where B=0.1% TFA/acetonitrile, A=0.01% TFA/water: detection-UV 260 EXAMPLE 30 product retention time=20–22 minutes). Further product Gas-filled Microbubbles Comprising DSPS characterisation was carried out using MALDI maSS Spec Covalently Modified with CD71 FITC-labelled trometry: expected M+H at 1922, found at 1920. 15 b) Synthesis of a Lipopeptide Containing a Heparin anti-transferrin Receptor Antibody and doped with Sulphate-binding Sequence and a Fibronectin Peptide a Lipopeptide with Affinity for Endothelial Cells Synthesis and purification were carried out as described in This example is directed at the preparation of multiple Example 21(a). vector targeted ultrasound agents. c) Preparation of Multiple-specific Gas-filled Microbubbles a) Synthesis of an Endothelial Cell Binding Lipopeptide: of DSPS Functionalised with a Heparin Sulphate-binding 2-n-hexadecylstearyl-Lys-Leu-Ala-Leu-Lys-Leu-Ala-Leu Peptide, a Fibronectin Peptide, Acetyl-RGD Peptide and Lys-Ala-Leu-Lys-Ala-Ala-Leu-Lys-Leu-Ala-NH. (SEQ Fluorescein ID NO:12) DSPS (4 mg., 3.9 mmol), lipopeptide from (a) (0.5 mg, 0.2 The lipopeptide shown below was synthesised on a ABI mmol) and lipopeptide from (b) (0.5 mg) were weighed into 25 433A automatic peptide Synthesiser Starting with a Rink each of two vials and 0.8 ml of a solution of 1.4% propylene amide resin on a 0.1 mmol Scale using 1 mmol amino acid glycol/2.4% glycerol was added to each vial. The mixtures cartridges.

US 6,264,917 B1 83 84 All amino acids and 2-m-hexadecylstearic acid were pre FITC-labelled CD71 anti-transferrin receptor Ab (100 activated using HBTU before coupling. The simultaneous mg/ml in PBS, 0.7 ml) was reacted with Traut's reagent (0.9 removal of peptide from the resin and Side-chain protecting mg) at room temperature for 1 hour. Excess reagent was groups was carried out in TFA containing 5% EDT and 5% separated from modified protein on a NAP-S column. HO for 2 hours, giving a crude product yield of 150 mg. d) Conjugation of Thiolated FITC-labelled Anti-transferrin Purification by preparative HPLC of a 40 mg aliquot of Receptor Antibody to Gas-filled Microbubbles Comprising crude material was carried out using a gradient of 90 to DSPS "doped with an Endothelial Cell-binding Lipopeptide 100% B over 50 minutes (A=0.1% TFA/water and and DSPE-PEGooo-Mal B=MeOH) at a flow rate of 9 ml/min. After lyophilisation, A0.5 ml aliquot of the protein fraction (2 ml in total) from 10 mg of pure material was obtained (analytical HPLC, (c) above was added to the microbubbles from (b) and the gradient 90–100% B where B=MeOH, A=0.01% TFA/wa conjugation reaction was allowed to proceed for 10 minutes ter: detection-UV 214 nm product retention time=23 on a roller table. Following centrifugation at 1000 rpm for minutes). Further product characterisation was carried out 3 minutes the protein Solution was removed and the conju using MALDI mass spectrometry: expected M--H at 2369, gation repeated twice more with 1 ml and 0.5 ml aliquots of found at 2373. 15 protein solution respectively. The bubbles were then washed b) Preparation of Gas-filled Microbubbles Comprising four times in distilled water and a Sample analysed for the DSPS doped with a Endothelial Cell-binding Lipopeptide presence of antibody by flow cytometry and microScopy. A and PE-PEGooo-Mal fluorescent population of >92% was observed (see FIG. 1). DSPS (4.5 mg) and lipopeptide from (a) (0.5 mg) along Incorporation of lipopeptide into the microbubbles was with PE-PEGooo-Mal from Example 50 (0.5 mg) were confirmed by MALDI mass spectrometry as described in weighed into a clean vial and 1 ml of a solution of 1.4% Example 21(b). propylene glycol/2.4% glycerol was added. The mixture was warmed to 80 C. for 5 minutes and then filtered through a EXAMPLE 31 4.5 micron filter. The Sample was cooled to room tempera Gas-filled Microbubbles Comprising DSPS, a ture and the head Space was flushed with perfluorobutane 25 gas. The Vial was shaken in a cap mixer for 45 seconds and Lipopeptide for Endothelial Cell Targeting and a the resulting microbubbles were washed three times with Captopril-containing Molecule distilled water. This example is directed to the preparation of ultrasound c) Thiolation of FITC-labelled Anti-transferrin Receptor agents for combined targeting and therapeutic applications. Antibody a) Synthesis of a Lipopeptide Functionalised with Captopril US 6,264,917 B1 85 86

HO

O

~~~~~~~~ O (~~~~~~~ US 6,264,917 B1 87 88 The Structure shown above was Synthesised using a preparative liquid chromatography using a gradient of 70 to manual nitrogen bubbler apparatus Starting with Fmoc 100% B over 60 minutes (A=0.1% TFA/water and B=0.1% protected Rink Amide MBHA resin on a 0.125 mmol scale. TFA/acetonitrile) at a flow rate of 10 ml/min. After lyophi Coupling was carried out using standard TBTU/HOBt/DIEA lisation a yield of 2 mg of pure material was obtained protocols. Bromoacetic acid was coupled through the Side- 5 (analytical HPLC, gradient 70–100% B over 20 minutes, chain of Lys as a Symmetrical anhydride using DIC preac A=0.1% TFA/water and B=0.1% TFA/acetonitrile, flow rate tivation. Captopril dissolved in DMF was introduced on the 1 ml/min., detection UV 214 nm, retention time 26 minutes). solid-phase using DBU as base. Simultaneous removal of Further characterisation was carried out using MALDI maSS the peptide from the resin and deprotection of Side-chain Spectrometry, giving M--H at 1265 as expected. protecting groups was carried out in TFA containing 5%. 10 b) Synthesis of a lipopeptide with affinity for endothelial EDT, 5% water and 5% ethyl methyl sulphide for 2 hours. cells: Dipalmitoyl-Lys-Lys-Lys-Aca-Ile-Arg-Arg-Val-Ala An aliquot of 10 mg of the crude material was purified by Arg-Pro-Pro-Leu-NH. (SEQ ID NO:14)

US 6,264,917 B1 91 92 The lipopeptide was synthesised on a ABI 433A auto EXAMPLE 32 matic peptide Synthesiser Starting with Rink amide resin on Preparation of Gas-filled Microbubbles Comprising a 0.1 mmol Scale using 1 mmol amino acid cartridges. All DSPS Loaded with a Lipopeptide Comprising a amino acids and palmitic acid were preactivated using Helical Peptide with Affinity for Cell Membranes HBTU before coupling. The simultaneous removal of pep and the Peptide Antibiotic Polymixin B Sulphate tide from the resin and Side-chain protecting groups was This example is directed to the preparation of targeted carried out in TFA containing 5% phenol, 5% EDT and 5% microbubbles comprising multiple peptidic vectors having a HO for 2 hours, giving a crude product yield of 160 mg. combined targeting and therapeutic application. Purification by preparative HPLC of a 35 mg aliquot of a) Synthesis of a Lipopeptide Comprising a Helical Peptide crude material was carried out using a gradient of 70 to with Affinity for Cell Membranes: Hexadecylstearyl-Lys 100% B over 40 minutes (A=0.1% TFA/water and Leu-Ala-Leu-Lys-Leu-Ala-Leu-Lys-Ala-Leu-Lys-Ala-Ala B=MeOH) at a flow rate of 9 ml/min. After lyophilisation, Leu-Lys-Leu-Ala-NH. (SEQ ID NO:12) 20 mg of pure material was obtained (analytical HPLC, This is prepared as described in Example 30(a). gradient 70–100% B where B=MeOH, A=0.01% TFA/wa b) Preparation of Multiple-specific Gas-filled Microbubbles ter: detection-UV 214 and 260 nm product retention 15 DSPS (5.0 mg), lipopeptide from (a) (0.3 mg) and poly time=16 minutes). Further product characterisation was car mixin B Sulphate (0.5 mg) were weighed into a clean Vial ried out using MALDI mass spectrometry: expected M--H at and 1.0 ml of a solution of 1.4% propylene glycol/2.4% 2050, found at 2055. glycerol was added. The mixture was Sonicated for 3-5 c) Preparation of Gas-filled Microbubbles Comprising minutes, warmed to 80 C. for 5 minutes and then filtered DSPS, a Lipopeptide for Endothelial Cell Targeting and a through a 4.5 micron filter. The mixture was cooled to room Captopril-containing Molecule for Drug Delivery temperature and the head Space was flushed with perfluo DSPS (4.5 mg), product from (a) (0.5 mg) and product robutane gas. The Vial was Shaken in a cap-mixer for 45 from (b) (0.5 mg) were weighed into a vial and 1.0 ml of a Seconds and the resulting microbubbles were centrifuged at Solution of 1.4% propylene glycol/2.4% glycerol was added. 1000 rpm for 3 minutes. The microbubbles were washed The mixture was warmed to 80° C. for 5 minutes (vial 25 with water until no polymixin B Sulphate or lipopeptide Shaken during warming). The sample was cooled to room could be detected in the infranatant by MALDI-MS. Micros temperature and the head Space was flushed with perfluo copy showed that the size distribution of the bubble popu robutane gas. The Vial was firstly shaken in a cap-mixer for lation was in the desired range of 1-8 micron. To the washed 45 seconds then rolled for 1 hour, whereafter the contents bubbles (ca. 0.2 ml) was added methanol (0.5 ml), and the were extensively washed with deionised water. No detect mixture was placed in a Sonicator bath for 2 minutes. The able level of starting material was found in the final wash resulting clear Solution, on analysis by MALDI-MS, was solution as evidenced by MALDI MS. MALDI mass spec found to contain both lipopeptide and polymixin B Sulphate tral analysis was used to confirm incorporation of the (expected 1203, found 1207). products from (a) and (b) into the microbubbles as described EXAMPLE 33 in Example 21(b) 35 d) In vitro Study of Gas-filled Microbubbles Comprising Preparation of Gas-filled Microbubbles Comprising DSPS, a Lipopepitcle for Endothelial Cell Targeting and a DSPS doped with a Lipopeptide Comprising a IL Captopril-containing Molecule for Therapeutic Applications 1 Receptor-binding Sequence and Modified with a The in vitro assay decribed in Example 21(c) was used to Branched Structure Containing the Drug examine cell binding under flow conditions. A gradual 40 Methotrexate accumulation of microbubbles on the cells took place, This example is directed to the preparation of targeted depending on the flow rate. On further increasing the flow microbubbles comprising multiple vectors for targeted/ rate cells Started to become detached from the coverSlip, but therapeutic applications. the microbubbles remained bound to the cells. Control a) Synthesis of a lipopeptide comprising an interleukin-1 microbubbles not carrying the vector did not adhere to the 45 receptor-binding peptide: Dipalmitoyl-Lys-Gly-Asp-Trp endothelial cells and disappeared from the chamber under Asp-Gln-Phe-Gly-Leu-Trp-Arg-Gly-Ala-Ala.OH (SEQ ID minimal flow conditions. NO:15)

US 6,264,917 B1 95 96 The lipopeptide was synthesised on a ABI 433A auto 5 minutes and then filtered through a 4.5 micron filter. The matic peptide Synthesiser Starting with Fmoc-Ala-Wang mixture was cooled to room temperature and the head Space resin on a 0.1 mmol Scale using 1 mmol amino acid was flushed with perfluorobutane gas. The Vial was Shaken cartridges. in a cap mixer for 45 Seconds and the resulting microbubbles All amino acids and palmitic acid were preactivated using were centrifuged at 1000 rpm for 3 minutes, whereafter the HBTU before coupling. The simultaneous removal of infranatant was discarded. lipopeptide from the resin and Side-chain protecting groups d) Conjugation of Methotrexate Branched Structure to Thi was carried out in TFA containing 5% HO, 5% anisole, 5% olated Microbubbles phenol and 5% EDT for 2 hours, giving a crude product yield of 150 mg. Purification by preparative HPLC of a 30 The methotrexate structure from (b) above (0.5 mg) was mg aliquot of crude material was carried out using a gradient dissolved in PBS, pH 8.0. The solution was then added to the of 90 to 100% B over 40 minutes (A=0.1% TFA/water and thiol-containing microbubbles from (c) and disulphide bond B=MeOH) at a flow rate of 9 milmin. After lyophilisation, 4 formation was allowed to proceed for 16 hours. Following mg of pure material was obtained (analytical HPLC, gradi extensive washing with PBS and water the bubbles were ent 90–100% Bover 20 minutes where B=MeOH, A=0.01% 15 analysed by microscopy and MALDI MS. TFA/water: detection-UV 214 nm product retention The disulphide bond linking the methotrexate structure to time=23 minutes). Further product characterisation was car the microbubbles may be reduced in vivo to liberate the free ried out using MALDI mass spectrometry: expected M--H at drug molecule, So that Such microbubbles in combination 2083, found at 2088. with a tumour Specific vector comprise a drug delivery b) Synthesis of a Branched Methotrexate Core Structure 20 System. A physiologically acceptable reducing agent Such as Containing a Thiol Moiety glutathione may be used to bring about drug release.

HN N N

NYN 2-2 N COOH N N O NH2 NNulls NH NH NH N O N O O HN N N COOH

NYN 2- N COOH H O N N2 O HN NullsCOOH H H E NH2 Nulls N nu- ( O E\ E O SH O N O COOH

The methotrexate structure was synthesised on an ABI EXAMPLE 34 433A automatic peptide Synthesiser Starting with Fmoc-CyS (Trt) Tentagel resin on a 0.1 mmol Scale. The simultaneous Preparation of Gas-filled Microbubbles Coated with removal of product from the resin and deprotection of poly-L-lysine Complexed to Fluorescein-labeled protecting groups was carried out in TFA containing 5% 50 DNA Fragments from Plasmid pBR322 EDT and 5% HO for 2 hours, giving a crude product yield of 160 mg. Purification by preparative HPLC of a 30 mg This example is directed to the preparation of aliquot of crude material was carried out using a gradient of microbubbles for gene therapy/anti-Sense applications. Spe 10 to 30% B over 40 minutes (A=0.1% TFA/water and cific targeting may be achieved by further doping of B=0.1%TFA/acetonitrile) and a flow rate of 9 ml/min. After 55 microbubble membranes with vector-modified lipid struc lyophilisation of the pure fractions, 9 mg of pure material tures as described in Example 21. was obtained (analytical HPLC, gradient 5-50% B where a) Preparation of DSPS-encapsulated Gas-filled B=0.1% TFA/acetonitrile, A=0.01% TFA/water: detection Microbubbles UV 214 nm-product retention time=9.5 minutes). Further DSPS (4.5 mg) was weighed into a clean vial. 1.0 ml of product characterisation was carried out using MALDI maSS 60 a Solution of 1.4% propylene glycol/2.4% glycerol was spectrometry: expected M--H at 1523, found at 1523. added and the mixture was Sonicated for 2 minutes and then c) Preparation of Multiple-specific Gas-filled Microbubbles warmed to 80° C. for 5 minutes. Immediately following DSPS (4.5 mg), thiol-containing lipopeptide from warming the Solution was filtered through a 4 micron filter. Example 64(a) (0.5 mg) and lipopeptide from (a) (0.2 mg) The Sample was cooled to room temperature and the head were weighed into a clean vial and 1.0 ml of a Solution of 65 Space was flushed with perfluorobutane gas. The Vial was 1.4% propylene glycol/2.4% glycerol was added. The mix Shaken in a cap mixer for 45 Seconds. The resulting ture was Sonicated for 3-5 minsutes, warmed to 80° C. for microbubbles were then washed once with deionised water US 6,264,917 B1 97 98 and the infranatant was discarded. The microbubbles were EXAMPLE 35 then resuspended in 0.5 ml water. b) Preparation of poly-L-lysine/DNA Complex and Loading Preparation of Gas-filled Microbubbles Containing of DSPS-encapsulated Microbubbles a Branched Core Peptide Comprising a Dabsylated To 1 mg of poly-L-lysine (70-150 kD) in a clean vial was added 0.1 ml of a fluorescein-labeled digest of plasmid atherosclerotic Plaque-binding Sequence and RGDS pBR322 dissolved in TE buffer (10 mM tris-HCl, pH8). The This example is directed to the preparation of solution was made up to a total of 0.6 ml by addition of water and the pH was adjusted to 8. Complexing was microbubbles having a thiol group on the Surface for modi allowed to proceed for 1 hour, after which 0.05 mL of the fication with thiol-containing vectors for targeting/drug polylysine-DNA solution was added to the microbubble delivery and drug release. Suspension from (a) above. After 1 hour microscopy was a) Synthesis of the branched peptide DabSyl-Tyr-Arg-Ala used to show that the bubbles were fluorescent, confirming Leu-Val-Asp-Thr-leu-Lys-Lys (NH -Arg-Gly-Asp-Ser)- the presence of DNA. Gly-Cys.OH (SEQ ID NO:16)

US 6,264,917 B1 101 102 The peptide was synthesised on an ABI 433A automatic Gas-filled microbubbles were prepared by mixing DSPS peptide Synthesiser Starting with Fmoc-Cys(Trt)-Tentagel and biotin-PEGoo-acyl-phosphatidylethanolamine as resin on a 0.1 mmol Scale using 1 mmol amino acid described in previous examples. The microbubble Suspen cartridges. All amino acids were preactivated using HBTU Sion was divided into 0.2 ml aliquots and fluorescein before coupling. The Simultaneous removal of peptide from conjugated Streptavidin was added as shown in the table the resin and Side-chain protecting groups was carried out in below. The samples were incubated on a roller table for 15 TFA containing 5% phenol, 5% EDT and 5% HO for 2 or 30 minutes at ambient temperature before removal of hours, giving a crude product yield of 160 mg. Purification excess protein by washing in PBS. The samples were by preparative HPLC of a 30 mg aliquot of crude material analysed by flow cytometry and Coulter Counter. The results was carried out using a gradient of 10 to 60% B over 40 are Summarized in the table below. minutes (where A=0.1% TFA/water and B=acetonitrile) at a flow rate of 9 ml/min. After lyophilisation, 2.5 mg of pure Results: material was obtained (analytical HPLC, gradient 10-50% B over 20 minutes where B=0.1% TFA/acetonitrile and 15 A=0.01% TFA/water: detection-UV 214 and 435 Added Particle nim-product retention time 21 minutes). Further product Streptavidin Incubation 26 median characterisation was carried out using MALDI maSS Spec Aliquot (mg/200:1 time (amb. Fluorescent diameter trometry: expected M+H at 2070, found at 2073. O. sample) temp.) particles (microns) 1. O 2.O b) Preparation of Thiol-containing Gas-filled Microbubbles 2 O 12 (foam) These were prepared as described in Example 64(a). 3 O.2 30 min 7.8 3.9 (3 x 10 mmol) c) Oxidative Coupling of Thiolated Microbubbles with 4 2 30 min 26.2 4.2 Multiple-specific Peptide via Disulphide Bond Formation (3 x 10 mmol) 25 5 1O 15 min 30.5 la The infranatant from the microbubbles from (b) above (1.5 x 107 mmol) was discarded and replaced with a Solution of dabsyl-peptide 6 2O 30 min 97.9 5.2 from (a) (1 mg) in 0.7 ml dilute ammonia solution (pH 8). (3 x 107mmol) 7 40 15 min 96.7 5.1 To this was added 0.2 ml of a Stock Solution containing 6 mg (6 x 107 mmol) of potassium ferricyanate dissolved in 2 ml of water. The 8 DSPS 2O 15 min O6 3.7 vial was placed on a roller table and thiol oxidation allowed control (3 x 107 mmol) to proceed for 2 hours. The bubbles were then washed extensively with water until the infranatant was free of the dabsyl-peptide as evidenced by HPLC and MALDI MS. c) Conjugation of Streptavin-coated Microbubbles with the Detection of microbubble-bound peptide was carried out by Oligo nucleotide biotin reduction of the disulphide bond using the water souble 35 GAAAGGTAGTGGGGTCGTGTGCCGG (SEQ ID reducing agent tris-(2-carboxyethyl)-phosphine. Following NO:17) and Biotinylated Fibrin-anti-polymerant Peptide reduction, the infranatant was found to contain free dabsyl biotin-GPRPPERHOS (SEQ ID NO:10) peptide as evidenced by HPLC and MALDI MS. Other The particles from aliquot no. 6 above were centrifuged physiologically acceptable reducing agents Such as reduced 40 and the Supernatant was replaced with 1 ml PBS buffer, pH glutathione may also be useful for initiating release. 7.5, containing O2 mg of biotin GAAAGGTAGTGGGGTCGTGTGCCGG (SEQ ID EXAMPLE 36 NO:17) and 0.2 mg of biotin-GPRPPERHQS (SEQ ID NO:10) (prepared as in Example 27(b) and (c)). After Preparation of Gas-filled Microbubbles 45 incubation for 24 hours the particles were washed exten Encapsulated with DSPS and biotin-PEG-acyl sively with PBS and water. phosphatidylethanolamine and Functionalised with Other biotinylated vectors or therapeutic agents may be Streptavidin, Oligonucleotide biotin conjugated to Streptavidin- or avidin-coated microbubbles GAAAGGTAGTGGGGTCGTGTGCCGG (SEQ ID using this procedure. NO:17) and Biotinylated Fibrin-anti-polymerant 50 Peptide (Biotin-GPRPPERHOS.NH)(SEQ ID NO:10) EXAMPLE 37 a) Synthesis of biotin-PEG-acyl-phosphatidyl Ethanola mine 55 Preparation of Gas-filled Microbubbles Encapsulated with DSPS and Functionalised with a A mixture of dipalmitoyl phosphatidyl ethanolamine, Thrombi-targeting Lipopeptide and the (21.00 mg, 0.03 mmol), biotin-PEG-CO-NHS, (100 mg, Thrombolytic Enzyme Tissue Plasminogen 0.03 mmol) and triethylamine (42 ul, 0.30 mmol) in a solution of chloroform/methanol (3:1) was stirred at room Activator temperature for 2 hours. After evaporation of the Solvents 60 under reduced pressure, the residue was flash chromato This example is directed at the preparation of thrombus graphed (methylene chloride/methanol/water, 40:8:1). The targeted ultrasound contrast agents comprising a therapeutic product was obtained as a yellow gum (112 mg, 94%), and thromolytic agent. structure was verified by NMR and MALDI-MS. 65 a) synthesis of a lipopeptide with affinity for thrombi b) Binding of Fluorescein-conjugated Streptavidin to Gas (Dipalmitoyl- Lys-Asn-Asp-Gly-Asp-Phe-Glu-Glu-Ile-Pro filled Microbubbles Glu-Glu-Tyr-Leu-Gln-NH) (SEQ ID NO:18) US 6,264,917 B1 103 104

HOOC) HO

HOOC) HOOC)

HOOC) US 6,264,917 B1 105 106 The lipopeptide was synthesised on an ABI 433 A auto and then warmed to 80° C. for 5 minutes. Immediately matic peptide Synthesiser Starting with Rink amide resin on following warming, the Solution was filtered through a 4 a 0.1 mmol Scale using 1 mmol amino acid cartridges. All micron filter. The Sample was cooled to room temperature amino acids and palmitic acid were preactivated using and the head Space flushed with perfluorobutane gas. The HBTU before coupling. The simultaneous removal of pep Vial was shaken in a cap mixer for 45 Seconds and the tide from the resin and Side-chain protecting groups was resulting microbubbles were washed twice with deionised carried out in TFA containing 5% phenol, 5% EDT, 5% water. The infranatant was discarded and replaced with a 1 aniSole and 5% H2O for 2 hours, giving a crude product ml aliquot of the protein solution from (b) above. The yield of 80 mg. Purification by preparative HPLC of a 20 mg conjugation reaction was allowed to proceed for 1 hour. The aliquot of the crude material was carried out. After lyophi microbubbles were centrifuged and the infranatant was lisation, 6 mg of pure material was obtained. The product exchanged with a further 1 ml of protein solution. The was characterised by MALDI mass spectrometry and ana incubation Step was repeated until all protein Solution was lytical HPLC. used up. The microbubbles were then washed extensively b) Modification of Tissue Plasminogen Activator with with water and analysed by Coulter counter. The Sulpho-SMPB 15 microbubbles were tested in the flow chamber assay A Solution of 0.1 ml of ammonim carbonate buffer con described in Example 21(c). Microbubbles modified with taining 0.1 mg oft-PA was made up to 0.2 ml by the addition protein were found to bind in higher numbers than those of water. To this solution was added 0.4 mg of Sulpho comprising either lipopeptide/DSPS or DSPS alone. SMPB (dissolved in 0.05 ml DMSO. The protein solution The targeting/therapeutic/ultrasound activities of these was left Standing at room temperature for 45 minutes, microbubbles be evaluated in models of both in vitro and in whereafter purification was carried out on a Superdex 200 Vivo thrombogenisis. column. The product was eluted in PBS and the modified protein fraction was collected. EXAMPLE 38 c) Preparation of Gas-filled Microbubbles Encapsulated Preparation of Gas-filled Microbubbles Comprising with DSPS/thrombi-binding Lipopeptide and Thiol 25 containing Lipopeptide and Conjugation of Modified Tissue DSPS Loaded with a Lipopeptide Comprising a Plasminogen Activator Helical Peptide with Affinity for Cell Membranes DSPS (5.0 mg) was weighed into a clean vial along with This example is directed to the preparation of targeted 0.5 mg of the lipopeptide from (a) and 0.5 mg of the microbubbles comprising a peptidic vector for targeting of thiol-containing lipopeptide from Example 64(a). To this cell membrane Structures. was added 1.0 ml of a solution of 1.4% propylene glycol/ a) Synthesis of a lipopeptide comprising a helical peptide 2.4% glycerol and the mixture was Sonicated for 2 minutes with affinity for cell membranes (SEQ ID NO:12) US 6,264,917 B1 107 108 US 6,264,917 B1 109 110 The lipopeptide was synthesised on an ABI 433A auto tridges. All amino acids and palmitic acid were preactivated matic peptide Synthesiser Starting with Rink amide resin on using HBTU before coupling. The simultaneous removal of a 0.2 mmol Scale using 1 mmol amino acid cartridges. All peptide from the resin and Side-chain protecting groups was amino acids and 2-m-hexadecylstearic acid were preacti carried out in TFA containing 5% phenol, 5% EDT, 5% vated using HBTU before coupling. The simultaneous aniSole and 5% HO for 2 hours, giving a crude product removal of lipopeptide from the resin and Side-chain pro yield of 150 mg. Purification by preparative HPLC of a 40 tecting groups was carried out in TFA containing 5% HO mg aliqout of crude material was carred out using a gradient for 2 hours, giving a crude product yield of 520 mg. of 70 to 100% B over 40 minutes (A=0.1% TFA/water and Purification by preparative HPLC of a 30 mg aliqout of B=MeOH) at a flow rate of 9 ml/min. After lyophilisation. crude material was carried out using a gradient of 90 to 14 mg of pure material (analytical HPLC, gradient 70–100% 100% B over 40 minutes (A=0.1% TFA/water and B where B=MeOH, A=0.01% TFA/water: detection-UV B=MeOH) at a flow rate of 9 ml/min. After lyophilisation, 260 and fluorescence, Ex280, Em350 product retention 10 mg of pure material was obtained (analytical HPLC, time=22 minutes). Further product characterisation was car gradient 90–100% B over 20 minutes where B=MeOH, ried out using MALDI mass spectrometry: expected M--H at A=0.01% TFA/water: detection-UV 214 nm product 15 1478, found at 1471. retention time=23 minutes). Further product characterisation b) Preparation of Gas-filled Microbubbles Comprising was carried out using MALDI mass spectrometry: expected DSPS "doped with the Biotinylated Lipopeptide Sequence M+H at 2369, found at 2375. from (a) b) Preparation of Gas-filled Microbubbles DSPS (4.5 mg) and lipopeptide from (a) (0.5 mg, 0.2 DSPS (4.5 mg) and lipopeptide from (a) (0.5 mg) were mmol) were weighed into each of two vials, and 0.8 ml of weighed into a clean vial and 1.0 ml of a solution of 1.4% a Solution of 1.4% propylene glycol/2.4% glycerol was propylene glycol/2.4% glycerol was added. The mixture was added to each vial. The mixtures were warmed to 80 C. for Sonicated for 3-5 minutes, warmed to 80 C. for 5 minutes 5 minutes (vials shaken during warming). The samples were and then filtered through a 4.5 mm filter. The mixture was cooled to room temperature and the head Spaces were cooled to room temperature and the head Space was flushed 25 flushed with perfluorobutane gas. The vials were shaken in with perfluorobutane gas. The vial was shaken in a cap mixer a cap mixer for 45 Seconds and then rolled overnight. The for 45 seconds and the resulting microbubbles were centri resulting microbubbles were washed several times with fuged at 1000 rpm for 3 minutes. The fnicrobubbles were deionised water and analysed by Coulter counter and acous then washed with water until no lipopeptide could be tic attenuation. MALDI mass spectral analysis was used to detected by MALDI-MS. Coulter counter, acoustic attenu confirm incorporation of lipopeptide into DSPS ation and pressure Stability Studies were performed. To an microbubbles as follows: ca. 50-100 ml of microbubbles aliquot of the washed bubbles (ca. 0.2 ml) was added were transferred to a clean vial and 50-100 ml water were methanol (0.5 ml), and the mixture was placed in a Sonicator added. The mixture was Sonicated for 30 Seconds and bath for 2 minutes. The resulting clear Solution, on analysis spotted onto a clean target disc (1 ml+0.5 ml ACH matrix). by MALDI-MS, was found to contain the lipopeptide. 35 Positive mode gave M+H at 1474, expected for lipopeptide c) In vitro and in vivo Tests at 1478. The microbubbles had similar characteristics in vitro and in vivo as was found for the microbubbles made in Example EXAMPLE 40 21. 40 Preparation of Multiple-specific Gas-filled EXAMPLE 39 Microbubbles Comprising DSPS Loaded with a Lipopeptide Comprising a Non-bioactive Gas-filled Microbubbles Encapsulated with Interleukin-1 Receptor-binding Peptide Phosphatidylserine and a Biotinylated Lipopeptide a) Synthesis of Lipopeptide dipalmitoyl-lysinyl 45 This example is directed to the preparation of targeted tryptophanyl-lysinyl-lysinyl-lysinyl(biotinyl)-glycine (SEQ microbubbles comprising a non-bioactive peptidic vector for ID NO:19) targeting at the IL-1 recptor which does not induce Signal The lipopeptide was synthesised on an ABI 433A auto tranduction or prevent IL-1 binding. matic peptide Synthesiser Starting with Fmoc-Gly-Wang a) Synthesis of lipopeptide comprising a non-bioactive resin on a 0.1 mmol Scale using immol amino acid car interleukin-1 receptor-binding peptide SEQ ID NO:15) US 6,264,917 B1 111 112 US 6,264,917 B1 113 114 The lipopeptide was synthesised on an ABI 433A auto added 0.5 mg of the lipopeptide from Example 31(b). The matic peptide Synthesiser Starting with Fmoc-Ala-Wang mixture was heated to 80° C. for 5 minutes and shaken. The resin on a 0.1 mmol Scale using 1 mmol amino acid Solution was then cooled to ambient temperature and the cartridges. All amino acids and palmitic acid were preacti headspace was flushed with Sulphur hexafluoride gas. The vated using HBTU before coupling. The simultaneous Vial was shaken on a cap-mixer for 45 Seconds and placed removal of lipopeptide from the resin and Side-chain pro on a roller table for 5 minutes. The Sample was centrifuged tecting groups was carried out in TFA containing 5% HO, at 2000 rpm for 5 minutes and the infranatant was removed and replaced with distilled water. The headspace was again 5% anisole, 5% phenol and 5% EDT for 2 hours, giving a flushed with Sulphur hexafluoride and the Sample was kept crude product yield of 150 mg. Purification by preparative on a roller table until a homogenous appearance was HPLC of a 30 mg aliquot of crude material was carried out obtained. The Washing procedure was repeated. The result using a gradient of 90 to 100% B over 40 minutes (A=0.1% ing ultrasound contrast agent was confirmed by Coulter TFA/water and B=MeOH) at a flow rate of 9 ml/min. After counter, acoustic attenuation measurements and resistance lyophilisation, 4 mg of pure material was obtained (analyti to external preSSure. cal HPLC, gradient 90–100% B over 20 minutes where B=MeOH, A=0.01% TFA/water: detection-UV 214 15 EXAMPLE 43 nim-product retention time=23 minutes). Further product Preparation of Gas-filled Microbubbles Comprising characterisation was carried out using MALDI maSS Spec DSPG and Endothelial Cell-binding Lipopeptide for trometry: expected M+H at 2083, found at 2088. Targeted Ultrasound Imaging b) Preparation of Gas-filled Microbubbles To 0.8 ml of a solution containing DSPG (5 mg/ml) in DSPS (4.5 mg) and lipopeptide from (a) (0.5 mg) were propylene glycol/glycerol (4% in water) was added 0.5 mg weighed into a clean vial and 1.0 ml of a solution of 1.4% of the lipopeptide from Example 31(b). The mixture was propylene glycol/2.4% glycerol was added. The mixture was heated to 80° C. for 5 minutes and shaken. The solution was Sonicated for 3-5 mins, warmed to 80 C. for 5 minutes and then cooled to ambient temperature and the headspace was then filtered through a 4.5 micron filter. The mixture was flushed with perfluorobutane. The vial was shaken on a cooled to room temperature and the head Space was flushed 25 cap-mixer for 45 Seconds and placed on a roller table for 5 with perfluorobutane gas. The Vials were shaken in a cap minutes. The sample was centrifuged at 2000 rpm for 5 mixer for 45 seconds and the resulting microbubbles were minutes and the infranatant was removed and replaced with centrifuged at 1000 rpm for 3 minutes. The microbubbles distilled water. The headspace was again flushed with per were then washed with water until no lipopeptide could be fluorobutane and the Sample was kept on a roller table until detected by MALDI-MS. To the washed microbubbles (ca. a homogenous appearance was obtained. The Washing pro 0.2 ml) was added methanol (0.5 ml), and the mixture was cedure was repeated. The resulting ultrasound contrast agent placed in a Sonicator bath for 2 minutes. The resulting clear was characterised by Coulter counter analysis, acoustic Solution, on analysis by MALDI-MS, was found to contain attenuation measurements and resistance to external pres lipopeptide (expected 2083, found 2088). sure. The microbubbles were tested in the in vitro assay as 35 detailed in Example 21: a gradual accumulation of EXAMPLE 41 microbubbles binding to the cells was observed. Preparation of Perfluoropropane-filled Microbubbles EXAMPLE 44 Comprising DSPC, DSPS and Endothelial Cell Preparation of Perfluoropropane-filled Microbubbles binding Lipopeptide for Targeted Ultrasound Comprising DSPG and Endothelial Cell Binding Imaging 40 Lipopeptide for Targeted Ultrasound Imaging To 0.8 ml of a solution containing DSPC:DSPS (3:1) (5 To 0.8 ml of a solution containing DSPG (5 mg/ml) in mg/ml) in propylene glycol/glycerol (4% in water) was propylene glycol/glycerol (4% in water) was added 0.5 mg added 0.5 mg of the lipopeptide from Example 31(b). The of the lipopeptide from Example 31(b). The mixture was mixture was heated to 80° C. for 5 minutes and shaken. The 45 heated to 80° C. for 5 minutes and then shaken. The Solution Solution was then cooled to ambient temperature and the was then cooled to ambient temperature and the headspace headspace was flushed with perfluoropropane. The Vial was was flushed with perfluoropropane. The Vial was shaken on Shaken on a cap-mixer for 45 Seconds and placed on a roller a cap-mixer for 45 Seconds and placed on a roller table for table for 5 minutes. The sample was centrifuged at 2000 rpm 5 minutes. The sample was centrifuged at 2000 rpm for 5 for 5 minutes and the infranatant was removed and replaced 50 minutes and the infranatant was removed and replaced with with distilled water. The headspace was again flushed with distilled water. The headspace was again flushed with per perfluoropropane and the Sample was kept on a roller table fluorobutane and the Sample was kept on a roller table until until a homogeneous appearance was obtained. The Washing a homogeneous appearance was obtained. The Washing procedure was repeated. The resulting ultrasound contrast procedure was repeated. The resulting ultrasound contrast agent was characterised by Coulter counter analysis, acous 55 agent was characterised by Coulter counter analysis, acous tic attenuation measurements and resistance to external tic attenuation measurements and resistance to external pressure. The microbubbles were tested in the in vitro assay pressure. The microbubbles were tested in the in vitro assay as detailed in Example 21. A gradual accumulation of as detailed in Example 21: a gradual accumulation of microbubbles binding to the cells was observed. microbubbles binding to the cells was observed. EXAMPLE 42 60 EXAMPLE 45 Preparation of Sulphur Hexafluoride-containing Preparation of Sulphur Hexafluoride-containing Microbubbles Comprising DSPC, DSPS and Microbubbles Comprising DSPG and Endothelial Endothelial Cell-binding Lipopeptide for Targeted Cell-binding Lipopeptide for Targeted Ultrasound Ultrasound Imaging 65 Imaging To 0.8 ml of a solution containing DSPC:DSPS (3:1) (5 To 0.8 ml of a solution containing DSPG (5 mg/ml) in mg/ml) in propylene glycol/glycerol (4% in water) was propylene glycol/glycerol (4% in water) was added 0.5 mg US 6,264,917 B1 115 116 of the lipopeptide from Example 31(b). The mixture was with water, PBS and water, the final Solution was examined heated to 80 C. for 5 minutes and shaken. The solution was for polylysine content using MALDI MS. No polypeptide then cooled to ambient temperature and the headspace was material was observed in the final wash Solution. Acetoni flushed with Sulphur hexafluoride gas. The vial was shaken trile (0.5 ml) was then added and the microbubbles were on a cap-mixer for 45 Seconds and placed on a roller table Sonicated until all bubbles had burst. Analysis of the result for 5 minutes. The sample was centrifuged at 2000 rpm for ing Solution for polylysine was again carried out using 5 minutes and the infranatant was removed and replaced MALDI MS. The results were as follows: with distilled water. The headspace was again flushed with Sulphur hexafluoride and the sample was kept on a roller table until a homogeneous appearance was obtained. The Washing procedure was repeated. The resulting ultrasound MALDI expected MALDI found contrast agent was characterised by Coulter counter Poly-L-lysine 786,914, 1042, 117O 790,919, 1048, 1177 analysis, acoustic attenuation measurements and resistance to external pressure. 15 EXAMPLE 46 EXAMPLE 47 Targeted Gas-filled Microbubbles Comprising Preparation of Functionalised Gas-filled DSPS Coated Non-covalently with Polylysine Microbubbles for Targeted Ultrasound Imaging (SEQ ID NO:20) DSPS (5 mg) was weighed into a clean vial along with poly-L-lysine (0.2 mg). To the vial was added 1.0 ml of a This example is directed to the preparation of solution of 1.4% propylene glycol/2.4% glycerol. The mix microbubbles having a reactive group on the Surface for ture was warmed to 80° C. for 5 minutes. The sample was non-specific targeting, principally utilising disulphide cooled to room temperature and the head Space flushed with eXchange reactions to effect binding to a multiplicity of perfluorobutane gas. The Vial was shaken in a cap mixer for 25 cellular targets. 45 Seconds and the resulting microbubbles were centrifuged a) Synthesis of a thiol-functionalised lipid molecule (SEQ at 1000 rpm for 3 minutes. Following extensive washing ID NO:20) US 6,264,917 B1 117 118 US 6,264,917 B1 119 120 The lipid structure shown above was Synthesised on an DSPS (4.5 mg) and the lipid structure from (a) above (0.5 ABI 433A automatic peptide synthesiser starting with Fmoc mg, 0.4 mmol) were weighed into a clean vial and 0.8 ml of Cys(Trt)-Wang resin on a 0.25 mmol scale using 1 mmol a Solution containing 1.4 upropylene glycol/2.4% glycerol in amino acid cartridges. All amino acids and palmitic acid water was added. The mixture was warmed to 80 C. for 5 were preactivated using HBTU coupling chemistry. The minutes (vial Shaken during warming) and filtered while still Simultaneous removal of peptide from the resin and depro hot through a 40 mm filter. The sample was cooled to room tection of Side-chain protecting groups was carried out in temperature and the head Space was flushed with perfluo TFA containing 5% EDT and 5% HO for 2 hours, giving a robutane gas. The Vial was Shaken in a cap mixer for 45 crude product yield of 250 mg. Purification by preparative Seconds and then placed on roller table overnight. The HPLC of a 40 mg aliquot of crude material was carried out resulting microbubbles were washed several times with using a gradient of 90 to 100% B over 50 minutes (A=0.1% deionised water and analysed for thiol group incorporation TFA/water and B=MeOH) at a flow rate of 9 ml/min. After using Ellmans Reagent. lyophilisation, 24 mg of pure material was obtained (ana lytical HPLC, gradient 70–100% B where B=0.1% TFA/ EXAMPLE 48 acetonitrile, A=0.01% TFA/water: detection-UV 214 15 nim-product retention time=23 minutes). Further product Preparation of Gas-filled Microbubbles Comprising characterisation was carried out using MALDI maSS Spec DSPS Doped with a Thrombus-binding Lipopeptide trometry: expected M+H at 1096, found at 1099. a) Synthesis of a lipopeptide with affinity for thrombi b) Preparation of Gas-filled Microbubbles Comprising (Dipalmitoyl-Lys-Asn-Asp-Gly-Asp-Phe-Glu-Glu-Ile-Pro DSPS "doped with a Thiol-containing Lipid Structure Glu-Glu-Tyr-Leu-Gln-NH) (SEQ ID NO:18)

US 6,264,917 B1 123 124 The lipopeptide was synthesised on an ABI 433 A auto propylene glycol/2.4% glycerol was added. The mixture was matic peptide Synthesiser Starting with Rink amide resin on warmed to 80 C. for 5 minutes and then filtered through a a 0.1 mmol Scale using 1 mmol amino acid cartridges. All 4 micron filter. After cooling to room temperature the head amino acids and palmitic acid were preactivated using Space was flushed with perfluorobutane gas. The Vial was HBTU before coupling. The simultaneous removal of pep 5 Shaken in a cap mixer for 45 Seconds and the resulting tide from the resin and Side-chain protecting groups was microbubbles were washed extensively with deionised carried out in TFA containing 5% phenol, 5% EDT, 5% water. The microbubbles were characterised by microscopy aniSole and 5% H2O for 2 hours, giving a crude product and Coulter counter analysis. MALDI-MS was used to yield of 80 mg. Purification by preparative HPLC of a 20 mg confirm the presence of lipopeptide as described in previous aliquot of the crude material was carried out. After lyophi examples. lisation, 6 mg of pure material were obtained. The product was characterised by MALDI mass spectrometry and ana EXAMPLE 49 lytical HPLC. b) Preparation of Thromi-targeting Ultrasound Preparation of Transferrin-coated Gas-filled Microbubbles 15 Microbubbles for Targeted Ultrasound Imaging DSPS (4.5 mg) and lipopeptide from (a) (1.0 mg) were a) Synthesis of a thiol-functionalised lipid molecule (SEQ weighed into a vial and 0.8 ml of a solution of 1.4% ID NO:20) US 6,264,917 B1 125 126 US 6,264,917 B1 127 128 The lipid structure shown above was Synthesised on an temperature. The Solvent was removed by rotary evapora ABI 433A automatic peptide synthesiser starting with Fmoc tion and the residue was taken up in chloroform (1.5 ml) and Cys(Trt)-Wang resin on a 0.25 mmol scale using 1 mmol washed with water (2x1.5 ml). The organic phase was amino acid cartridges. All amino acids and palmitic acid evaporated in vacuo. TLC analysis (chloroform/methanol/ were preactivated using HBTU before coupling. The simul water 13:5:0.8) gave a single ninhydrin positive spot with taneous removal of peptide from the resin and deprotection Rf=0.6; confirmation of the structure was obtained by NMR. of Side-chain protecting groups was carried out in TFA c) Synthesis of Mal-PEG-D SPE containing 5% EDT and 5% HO for 2 hours, giving a crude (3-male imidopropio nate poly (ethylene glycol) product yield of 250 mg. Purification by preparative HPLC distearoylphosphatidylethanolamine) of a 40 mg aliquot of crude material was carried out using a gradient of 90 to 100% B over 50 minutes (A=0.1% A Solution of N-Succinimidyl-3-maleimidopropionate TFA/water and B=MeOH) at a flow rate of 9 ml/min. After (5.6 mg, 0.018 mmol) in tetrahydrofuran (0.2 ml) was added lyophilisation, 24 mg of pure material was obtained (ana to HN-PEG-ooo-DSPE (65 mg, 0.012 mmol) dissolved in lytical HPLC, gradient 70–100% B where B=0.1% TFA/ tetrahydrofuran (1 ml) and 0.1 M sodium phosphate buffer acetonitrile, A=0.01% TFA/water: detection-UV 214 pH 7.5 (2 ml). The mixture was warmed to 30° C. and the nim-product retention time=23 minutes). Further product 15 reaction was followed to completion by TLC, whereafter the characterisation was carried out using MALDI maSS Spec Solvent was removed in vacua. The title material was trometry: expected M+H at 1096, found at 1099. purified on a flash silica column using 80:20 chloroform b) Preparation of Gas-filled Microbubbles Comprising :methanol as eluent. The Structure of the pure product was DSPS "doped with a Thiol-containing Lipid Structure confirmed by NMR and mass spectrometry. DSPS (4.5 mg) and lipid structure from (a) above (0.5 mg, d) Preparation of Gas-filled Microbubbles of DSPS doped 0.4 mmol) were weighed into a clean vial and 0.8 ml of a with PE-PEGo-Mal Solution of 1.4% propylene glycol/2.4% glycerol was added. DSPS (4.5 mg) and PE-PEGooo-Mal from (c) above (0.5 The mixture was warmed to 80° C. for 5 minutes (vial mg) were weighed into a clean vial and 1 ml of a Solution Shaken during warming) and filtered while still hot through of 1.4% propylene glycol/2.4% glycerol was added. The a 40 mm filter. The Sample was cooled to room temperature 25 mixture was warmed to 80 C. for 5 minutes and then and the head Space was flushed with perfluorobutane gas. filtered through a 4.5 mm filter. The sample was cooled to The Vial was shaken in a cap mixer for 45 Seconds and then room temperature and the head Space was flushed with placed on roller table overnight. The resulting microbubbles perfluorobutane gas. The Vial was shaken in a cap mixer for were washed Several times with deionised water and analy 45 seconds and the resulting microbubbles were washed Sed for thiol group incorporation using Ellmans Reagent. three times with distilled water. c) Modification of Transferrin with Fluorescein-NHS and e) Preparation of Fluorescein-labelled Trypsin Sulpho-SMPB To 5 mg of trypsin in PBS (1 ml) was added 0.2 ml DMSO To 4 mg of transferrin (Holo, human) in PBS (1 ml) was Solution containing 1 mg of fluorescein-NHS. The mixture added 0.5 ml DMSO solution containing 1 mg Sulpho was stirred for 45 minutes at room temperature. A SephadeX SMPB and 0.5 mg fluorescein-NHS. The mixture was stirred 35 200 column was then charged with the modified protein for 45 minutes at room temperature and then passed through mixture and product was eluted at a flow rate of 1 ml/min a Sephadex 200 column using PBS as eluent. The protein using PBS. The protein fraction (5 ml) was collected and fraction was collected and Stored at 4 C. prior to use. stored at 4 C. d) Microbubble Conjugation with Transferrin f) Preparation of Thiolated, Fluorescein-labelled Trypsin To the thiol-containing microbubbles from (b) was added 40 To the protein fraction from (e) was added 1 mg of Traut’s 1 ml of the modified transferrin protein solution from (c). reagent and the mixture Stirred at room temperature for a After adjusting the pH of the Solution to 9 the conjugation further 1 hour. 4 ml of the Trauts-modified product was then reaction was allowed to proceed for 2 hours at room tem charged on a SephadeX 200 column and the product was perature. Following extensive Washing with deionised water eluted with PBS. The protein fraction containing maximum the microbubbles were analysed by Coulter counter (97% 45 fluorescent intensity was collected in a total Volume of 6 ml. between 1 and 5 mm) and fluorescence microscopy (highly g) Conjugation of Microbubbles with Thiolated, fluorescent microbubbles). Fluorescein-labelled Trypsin Microbubbles from (d) were incubated on a roller table in EXAMPLE 50 1 ml of protein Solution from (f) above. The conjugation was Gas-filled Microbubbles Comprising DSPS 50 allowed to proceed at pH 7.3–7.8 for 10 minutes before Incorporating PE-PEGooo-Mal Conjugated to centrifugation and removal of the infranatant. The process Thiolated Trypsin Fluorescein was repeated a further three times, after which the bubbles a) Synthesis of Boc-NH-PEGooo-DSPE (t-butyl carbamate were washed four times with water to remove unconjugated poly(ethylene glycol)distearoylphosphatidyl-ethanolamine) protein. DSPE (31 mg) was added to a solution of Boc-NH 55 D. Bubbles contained active enzyme as evidenced by the PEG-SC (150 mg) in chloroform (2 ml), followed by cleavage of an Arg-pNA derivative in PBS. triethylamine (33 ul). The mixture was stirred at 41° C. for E. Analysis of the bubbles by Coulter and measurement of 10 minutes until the starting material had dissolved. The echogenicity was carried out. Solvent was rotary evaporated and the residue was taken up Bubbles were pressure stable (see FIG. 2) in acetonitrile (5 ml). The resulting dispersion was cooled to 60 4 C. and centrifuged, whereafter the solution was filtered and evaporated to dryneSS. The Structure of the resulting product was confirmed by NMR. FEK-O22-O15 b) Synthesis of HN-PEGooo-DSPE (amino-poly(ethylene Total O.83 glycol)-distearoylphosphatidylethanolamine) 65 concentration Boc-NH-PEGooo-DSPE (167 mg) was stirred in 4M Diameter 1-3 mm 40 hydrochloric acid in dioxane (5 ml) for 2.5 hours at ambient US 6,264,917 B1 130 was shaken in a cap mixer for 45 Seconds and the resulting -continued microbubbles were extensively washed with deionised water. MALDI mass spectrometry showed no detectable FEK-O22-O15 level of compound from (a) in the final wash solution. Diameter 3-5 mm 28 Incorporation of captopril-containing lipopeptide into the Diameter 5-7 mm 13 microbubbles was confirmed by MALDI-MS as follows: ca. Freq of max Atten. 3.3 Atten at 2. Mhz. 4.9 50 ul of microbubbles were transferred to a clean vial Atten at 3.5 Mhz. 7.8 containing ca. 100 ul of 90% methanol. The mixture was Atten at 5.0 MHZ 7.2 Sonicated for 30 seconds and analysed by MALDI mass Spectrometry, giving a M--H peak corresponding to lipopep tide from (a). EXAMPLE 51 EXAMPLE 52 Gas-filled Microbubbles Comprising DSPS and a Gas-filled Microbubbles Comprising DSPS and a Captopril-containing Molecule for Diagnostic and 15 Vector with Affinity for Adrenergic Receptors for Therapeutic Applications Diagnostic and Therapeutic Applications a) Synthesis of a lipopeptide functionalised with captopril a) Synthesis of a Protected Atenolol Derivative Suitable for (SEQ ID NO:13) Solid Phase Coupling ~ssO

O O O H N --~~~~ N H O O is s NH2 HN rry~us s

The structure shown above was synthesised by the manual i) Synthesis of methyl 4-(2,3-epoxy)propoxy “bubbler method starting with Fmoc-protected Rink Amide 40 phenylacetate MBHA resin on a 0.125 mmol scale. Coupling was carried A mixture of methyl 4-hydroxyphenylacetate (4.98 g, out using standard TBTU/HOBt/DIEA protocol. Bromoace 0.030 mol), epichlorohydrin (23.5 ml, 0.30 mol) and pyri tic acid was coupled through the Side-chain of Lys as a dine (121 ul, 1.5 mmol) was stirred at 85°C. for 2 hours. The Symmetrical anhydride using DIC preactivation. Captopril reaction mixture was cooled and exceSS epichlorohydrin was dissolved in DMF was introduced on the Solid phase using 45 distilled off (rotavapor). The residue was taken up in ethyl DBU as base. Simultaneous removal of the peptide from the acetate, washed with brine and dried (NaSO). The solution resin and deprotection of Side-chain protecting groups was was filtered and concentrated. The dark residue was chro carried out in TFA containing 5% EDT, 5% water and 5% matographed (silica, hexane/ethyl acetate 7:3) to give 2.25g ethyl methylsulphide for 2 hours. An aliquot of 10 mg of the (34%) of a colourless oil. "H (300 MHz) and 'C NMR (75 crude material was purified by preparative liquid chroma 50 MHz) spectra were in accordance with the structure. tography using a gradient of 70 to 100% B over 60 minutes ii) Synthesis of methyl 4-2-hydroxy-3-(1-methylethyl) (A=0.1%TFA/water and B=0.1%TFA/acetonitrile) at a flow aminopropoxyphenylacetate rate of 10 ml/min. After lyophilisation, a yield of 2 mg of A mixture of methyl 4-(2,3-epoxy) propoxy pure material was obtained (analytical HPLC, gradient phenylacetate (2.00 g, 9.00 mmol), isopropylamine (23 ml, 70–100% B over 20 minutes, A=0.1% TFA/water and 55 0.27 mol) and water (1.35 ml, 74.7 mmol) was stirred at B=0.1% TFA/acetonitrile, flow rate 1 ml/min, detection UV room temperature overnight. The reaction mixture was con 214 nm, retention time 26 minutes). Further characterisation centrated (rotavapor) and the oily residue was dissolved in was carried out using MALDI mass spectrometry, giving chloroform and dried (NaSO). Filtration and concentration M+H at 1265 as expected. gave quantitative yield of a yellow oil that was used in the b) Preparation of Gas-filled Microbubbles Comprising 60 next Step without further purification. The Structure was DSPS and a Compound Containing Captopril verified by H and 'C NMR analysis. A solution of 1.4% propylene glycol/2.4% glycerol (1.0 iii) Synthesis of 4-2-hydroxy-3-(1-methylethyl)amino ml) was added to a mixture of DSPS (4.5 mg) and product propoxyphenylacetic acid hydrochloride from (a) (0.5 mg) in a vial. The mixture was sonicated for A solution of methyl 4-2-hydroxy-3-(1-methylethyl) 5 minutes and then warmed to 80°C. for 5 minutes (vial was 65 aminopropoxyphenylacetate (563 mg, 2.00 mmol) in 6M Shaken during warming). The vial was then cooled and the hydrochloric acid (15 ml) was heated at 100° C. for 4 hours. head Space was flushed with perfluorobutane gas. The Vial The reaction mixture was concentrated (rotavapor) and the US 6,264,917 B1 131 132 residue was taken up in water and lyophilised. "H and 'C version was complete. The reaction mixture was poured onto NMR spectra were in accordance with the strucure and water Saturated with potassium hydrogen Sulphate and MALDI mass spectrometry gave a M+H at 268 as expected. organic material was extracted into ethyl acetate. The iv) Synthesis of N-Boc-4-2-hydroxy-3-(1-methylethyl) aminopropoxyphenylacetic acid organic phase was washed with water and brine, dried A solution of the 4-2-hydroxy-3-(1-methylethyl)amino (NaSO) and filtered to give 0.6 g of crude material. The propoxyphenylacetic acid hydrochloride (2.0 mmol) in product was purified by chromatography (silica, CHCl/ water (2 ml) was added to a solution of sodium bicarbonate MeOH/AcOH 85:10:5). The solution was concentrated and (0.60 g, 7.2 mmol) in water/dioxane (2:1, 15 ml). A solution the residue was taken up in glacial acetic acid and lyophi of di-tert-butyl dicarbonate (0.48g, 2.2 mmol) in dioxane (5 lised. Yield 415 mg (56%), white solid. The structure was ml) was added. Progress of the reaction was monitored by confirmed by H and 'C NMR analysis. TLC analysis (silica, CHCl/MeOH/AcOH 85:10:5), and b) Synthesis of a lipopeptide functionalised with atenolol portions of di-tert-butyl dicarbonate were added until con (SEQ ID NO:21) US 6,264,917 B1 133 134

s

;

Z US 6,264,917 B1 135 136 The structure shown above was synthesised by the manual a cap mixer for 45 Seconds, whereafter the contents were bubbler method starting with Fmoc-protected Rink Amide extensively washed with deionised water. MALDI mass MBHA resin on a 0.125 mmol scale, using the compound Spectrometry showed no detectable level of compound from from (a). Coupling was carried out using standard TBTU/ (b) in the final wash solution. Incorporation of atenolol HOBt/DIEA protocols. Simultaneous removal of the peptide containing lipopeptide into the microbubbles was confirmed from the resin and deprotection of Side-chain protecting by MALDI-MS as follows: ca. 50 ul of microbubbles were groups was carried out in TFA containing 5% EDT and 5% transferred to a clean vial containing ca. 100 ul of 90% water for 2 hours. Crude material was precipitated from methanol. The mixture was Sonicated for 30 seconds and ether and purified by preparative liquid chromatography analysed by MALDI-MS (ACH-matrix), giving a M+H peak using a gradient of 70 to 100% B over 60 minutes (A=0.1% at 1259 corresponding to lipopeptide (b). TFA/water and B=0.1% TFA/acetonitrile) at a flow rate of d) In vitro Analysis 10 ml/min. After lyophilisation, a yield of 38 mg of pure The microbubbles were tested in the in vitro assay as material was obtained (analytical HPLC, gradient 70–100% detailed in Example 21. A gradual accumulation of B over 20 minutes, A=0.1% TFA/water and B=0.1% TFA/ microbubbles binding to the cells was observed. acetonitrile, flow rate 1 ml/minute, detection UV 214 nm, 15 retention time 25 minutes). Further characterisation was EXAMPLE 53 carried out using MALDI mass spectrometry (ACH matrix), giving M+H at 1258, expected 1257. Gas-filled Microbubbles Comprising DSPS and a c) Preparation of Gas-filled Microbubbles Comprising Lipopeptide Consisting of a Heparin Sulphate DSPS and a Lipopeptide Containing Atenolol binding Peptide (KRKR) (SEQ ID NO:5) and a A solution of 1.4% propylene glycol/2.4% glycerol (1.0 Fibronectin Peptide (WOPPRARI) (SEQ ID NO:6) ml) was added to a mixture of DSPS (4.5 mg) and product for Targeting and a Lipopeptide Containing from (b) (0.5 mg) in a vial. The mixture was sonicated for Atenolol for Therapeutic Application 5 minutes, heated at 80° C. for 5 minutes (vial was shaken a) Synthesis of a Lipopeptide Consisting of a Heparin during warming) and then cooled. The head space was 25 Sulphate-binding Peptide (KRKR) (SEQ ID NO:5) and a flushed with perfluorobutane gas and the Vial was Shaken in Fibronectin Peptide (WOPPRARI) (SEQ ID NO:6)

US 6,264,917 B1 139 140 The lipopeptide was synthesised on an ABI 433A auto room temperature overnight. The reaction mixture was con matic peptide Synthesiser Starting with Fmoc-Ile-Wang resin centrated (rotavapor) and the oily residue was dissolved in on a 0.1 mmol Scale using 1 mmolamino acid cartridges. All chloroform and dried (NaSO). Filtration and concentration amino acids and palmitic acid were preactivated using gave quantitative yield of a yellow oil that was used in the HBTU before coupling. The simultaneous removal of pep next Step without further purification. The Structure was tide from the resin and Side-chain protecting groups was verified by H and 'C NMR analysis. carried out in TFA containing 5% phenol, 5% EDT, 5% iii) Synthesis of 4-2-hydroxy-3-(1-methylethyl)amino aniSole and 5% H2O for 2 hours, giving a crude product propoxyphenylacetic acid hydrochloride yield of 150 mg. Purification by preparative HPLC of a 40 A solution of methyl 4-2-hydroxy-3-(1-methylethyl) mg aliquot of crude material was carried out using a gradient aminopropoxyphenylacetate (563 mg, 2.00 mmol) in 6M of 70 to 100% B over 40 minutes (A=0.1% TFA/water and hydrochloric acid (15 ml) was heated at 100° C. for 4 hours. B=MeOH) at a flow rate of 9 ml/min. After lyophilisation, The reaction mixture was concentrated (rotavapor) and the 16 mg of pure material was obtained (analytical HPLC, residue was taken up in water and lyophilised. "H and 'C gradient 70–100% B where B=MeOH, A=0.01% TFA/wa NMR spectra were in accordance with the strucure and ter: detection-UV 260 and fluorescence, EX280, Em350 15 MALDI mass spectrometry gave a M+H at 268 as expected. product retention time=19.44 minutes). Further product iv) Synthesis of N-Boc-4-2-hydroxy-3-(1-methylethyl) characterisation was carried out using MALDI maSS Spec aminopropoxyphenylacetic acid trometry: expected M+H at 2198, found at 2199. A solution of the 4-2-hydroxy-3-(1-methylethyl)amino b) Synthesis of a Protected Atenolol Derivative Suitable for propoxyphenylacetic acid hydrochloride (2.0 mmol) in Solid Phase Coupling water (2 ml) was added to a solution of sodium bicarbonate i) Synthesis of methyl 4-(2,3-epoxy)propoxy (0.60 g, 7.2 mmol) in water/dioxane (2:1, 15 ml). A solution phenylacetate of di-tert-butyl dicarbonate (0.48g, 2.2 mmol) in dioxane (5 A mixture of methyl 4-hydroxyphenylacetate (4.98 g, ml) was added. Progress of the reaction was monitored by 0.030 mol), epichlorohydrin (23.5 ml, 0.30 mol) and pyri TLC analysis (silica, CHCl/MeOH/AcOH 85:10:5), and dine (121 ul, 1.5 mmol) was stirred at 85°C. for 2 hours. The 25 portions of di-ter-butyl dicarbonate were added until con reaction mixture was cooled, and exceSS epichlorohydrin version was complete. was distilled off (rotavapor). The residue was taken up in The reaction mixture was poured onto water Saturated ethyl acetate, washed with brine and dried (NaSO). The with potassium hydrogen Sulphate and organic material was Solution was filtered and concentrated. The dark residue was extracted into ethyl acetate. The organic phase was washed chromatographed (silica, hexane/ethyl acetate 7:3) to give with water and brine, dried (NaSO) and filtered to give 0.6 2.25 g (34%) of a colourless oil. "H (300 MHz) and 'C g of crude material. The product was purified by chroma NMR (75 MHz) spectra were in accordance with the struc tography (silica, CHCl/MeOH/AcOH 85:10:5). The solu ture. tion was concentrated and the residue Was taken up in glacial i) Synthesis of methyl 4-2-hydroxy-3-(1-methylethyl) acetic acid and lyophilised. Yield 415 mg (56%), white aminopropoxyphenylacetate 35 solid. The structure was confirmed by H and 'C NMR A mixture of methyl 4-(2,3-epoxy) propoxy analysis. phenylacetate (2.00 g, 9.00 mmol), isopropylamine (23 ml, c) Synthesis of a lipopeptide functionalised with atenolol 0.27 mol) and water (1.35 ml, 74.7 mmol) was stirred at (SEQ ID NO:21) US 6,264,917 B1 141 142

s

;

Z US 6,264,917 B1 143 144 The structure shown above was synthesised by the manual 0.27 mol) and water (1.35 ml, 74.7 mmol) was stirred at bubbler method starting with Fmoc-protected Rink Amide room temperature overnight. The reaction mixture was con MBHA resin on a 0.125 mmol Scale, using appropriate centrated (rotavapor) and the oily residue was dissolved in amino acids, palmitic acid and the compound from (a). chloroform and dried (NaSO). Filtration and concentration Coupling was carried out using standard TBTU/HOBt/DIEA 5 gave quantitative yield of a yellow oil that was used in the protocols. Simultaneous removal of the peptide from the next Step without further purification. The Structure was resin and deprotection of Side-chain protecting groups was verified by H and 'C MR analysis. carried out in TFA containing 5% EDT and 5% water for 2 ii) Synthesis of 4-2-hydroxy-3-(1-methylethyl)amino hours. Crude material was precipitated from ether and propoxyphenylacetic acid hydrochloride purified by preparative liquid chromatography using a gra A solution of methyl 4-2-hydroxy-3-(1-methylethyl) dient of 70 to 100% B over 60 minutes (A=0.1% TFA/water aminopropoxyphenylacetate (563 mg, 2.00 mmol) in 6M and B=0.1% TFA/acetonitrile) at a flow rate of 10 ml/min. hydrochloric acid (15 ml) was heated at 100° C. for 4 hours. After lyophilisation, a yield of 38 mg of pure material was The reaction mixture was concentrated (rotavapor) and the obtained (analytical HPLC, gradient 70–100% B over 20 residue was taken up in water and lyophilised. H and 'C minutes, A=0.1% TFA/water and B=0.1% TFA/acetonitrile, NMR spectra were in accordance with the strucure and flow rate 1 ml/minute, detection UV 214 nm, retention time 15 MALDI mass spectrometry gave a M+H at 268 as expected. 25 minutes). Further characterisation was carried out using iv) Synthesis of N-Boc-4-2-hydroxy-3-(1-methylethyl) MALDI mass spectrometry (ACH matrix), giving M+H at aminopropoxyphenylacetic acid A Solution of the 4-2- 1258, expected 1257. hydroxy-3-(1-methylethyl)aminopropoxyphenylacetic d) Preparation of Gas-filled Microbubbles Comprising acid hydrochloride (2.0 mmol) in water (2 ml) was added to DSPS and a Lipopeptide Consisting of a Heparin Sulphate a solution of sodium bicarbonate (0.60 g, 7.2 mmol) in binding Peptide (KRKR) (SEQ ID NO:5), a Fibronectin water/dioxane (2:1, 15 ml). A solution of di-tert-butyl dicar Peptide (WOPPRARI) (SEQ ID NO:6) and a Lipopeptide bonate (0.48 g, 2.2 mmol) in dioxane (5 ml) was added. Containing Atenolol Progress of the reaction was monitored by TLC analysis A solution of 1.4% propylene glycol/2.4% glycerol (1.0 (silica, CHCl/MeoH/AcOH 85:10:5), and portions of ml) was added to a mixture of DSPS (5.0 mg), product from 25 di-tert-butyl dicarbonate were added until conversion was (a) (0.5 mg) and product from (c) (0.5 mg) in a vial. The complete. The reaction mixture was poured onto water mixture was Sonicated for 5 minutes and then heated at 80 Saturated with potassium hydrogen Sulphate and organic C. for 5 minutes (vial was shaken during warming). The material was extracted into ethyl acetate. The organic phase Solution was filtered and cooled. The head Space was flushed was washed with water and brine, dried (NaSO) and with perfluorobutane gas and the vial was shaken in a cap filtered to give 0.6 g of crude material. The product was mixer for 45 Seconds, whereafter the contents were exten purified by chromatography (silica, CHCl/MeOH/AcOH sively washed with deionised water. Incorporation of 85:10:5). The solution was concentrated and the residue was atenolol-containing lipopeptide into the microbubbles was taken up in glacial acetic acid and lyophilised. Yield 415 mg confirmed by MALDI-MS as follows: ca. 50 ul of (56%), white solid. The structure was confirmed by H and microbubbles were transferred to a clean vial containing ca. 35 'C NMR analysis. 100 ul of 90% methanol. The mixture was Sonicated for 30 v) Synthesis of N'-Boc, N-hexadecyl-4-2-hydroxy-3-(1- seconds and analysed by MALDI-MS (ACH matrix), giving methylethyl)aminopropoxyphenylacetamide two M--H peaks at 2202 and 1259, corresponding to lipopep A solution of N-Boc-4-2-hydroxy-3-(1-methylethyl) tide (a) and to lipopeptide (c) respectively. aminopropoxyphenylacetic acid (92 mg, 0.25 mmol) and e) In vitro Analysis 40 hexadecylamine (60 mg, 0.25 mmol) in DMF (5 ml) was The microbubbles were tested in the in vitro assay as cooled to 0° C. HOBt (39 mg, 0.25 mmol) and N-(3- detailed in example 21. A gradual accumulation of dimethylaminopropyl)-N'-ethylcarbodiimide hydrochloride microbubbles binding to the cells was observed. (water soluble carbodiimide) (48 mg, 0.25 mmol) were added. The reaction mixture was stirred at 0° C. for 1 hour EXAMPLE 54 45 and then at room temperature overnight. The reaction mix Gas-filled Microbubbles Comprising DSPS and a ture was poured onto water (25 ml) containing Sodium Lipophilic Derivative of Atenolol with Affinity for carbonate (2.5 g) and Sodium chloride (4.0 g). Precipitated Adrenergic Receptors for Diagnostic and material was filtered off, washed with water and taken up in Therapeutic Applications chloroform. The chloroform phase was washed with 5% a) Synthesis of N-hexadecyl-4-2-hydroxy-3-(1- 50 sodium carbonate and water and dried (NaSO). The solu methylethyl)aminopropoxyphenylacetamide tion was filtered and concentrated to give 150 mg of yellow i) Synthesis of methyl 4-(2,3-epoxy)propoxy white crude material. The product was purified by column phenylacetate chromatography (silica, chloroform/methanol 95.5) to give A mixture of methyl 4-hydroxyphenylacetate (4.98 g, 118 mg (80%) of white material. The structure was verified 0.030 mol), epichlorohydrin (23.5 ml, 0.30 mol) and pyri 55 by H (500 MHz) and 'C (125 MHz) NMR. The product dine (121 ul, 1.5 mmol) was stirred at 85°C. for 2 hours. The was further characterised by MALDI mass spectrometry, reaction mixture was cooled and exceSS epichlorohydrin was giving a M+Na peak at 614 as expected. distilled off (rotavapor). The residue was taken up in ethyl vi) Synthesis of N-hexadecyl-4-2-hydroxy-3-(1- acetate, washed with brine and dried (Na2SO). The solution methylethyl)aminopropoxyphenylacetamide was filtered and concentrated. The dark residue was chro 60 To a solution of N'-Boc-N-hexadecyl-4-2-hydroxy-3-(1- matographed (silica, hexane/ethyl acetate 7:3) to give 2.25g methyl-ethyl)aminopropoxyphenylacetamide (10 mg) in (34%) of a colourless oil. "H (300 MHz) and 'C NMR (75 dichloromethane (9 ml) was added trifluoroacetic acid (1 MHz) spectra were in accordance with the structure. ml). The reaction mixture was stirred for 2 hours at room ii) Synthesis of methyl 4-2-hydroxy-3-(1-methylethyl) temperature. TLC (silica, chloroform/methanol 95:5) aminopropoxyphenylacetate 65 showed complete conversion of Starting material. A mixture of methyl 4-(2,3-epoxy) propoxy Solvents were evaporated off and the residue was taken up phenylacetate (2.00 g, 9.00 mmol), isopropylamine (23 ml, in water/acetonitrile and lyophilised to give a quantitative US 6,264,917 B1 145 146 yield of white solid material. The structure was verified by N-hexadecyl-4-2-hydroxy-3-(1-methylethyl)amino H (500 MHz) and C (125 MHz) NMR analysis and propoxyphenylacetamide. further characterised by MALDI mass Spectrometry, giving M+H at 492 and M--Na at 514 as expected. EXAMPLE 55 b) Preparation of Gas-filled Microbubbles Comprising Gas-filled microbubbles Encapsulated with DSPS DSPS and N-hexadecyl-4-2-hydroxy-3-(1-methylethyl) and a Compound Containing Folic Acid for aminopropoxyphenylacetamide for Diagnostic and Thera Diagnostic Applications peutic Applications a) Synthesis of a Lipopeptide Containing Folic Acid

(SEQ ID NO: 22) O

NH NH2

O O O H H N N N N NH2 H H O R O R

NH2 HN n R

l NH2

O

NH2

A solution of 1.4% propylene glycol/2.4% glycerol (1.0 The structure shown above was synthesised by the manual ml) was added to a mixture of DSPS (4.5 mg) and bubbler method starting with Fmoc-protected Rink Amide N-hexadecyl-4-2-hydroxy-3-(1-methylethyl)amino 55 MBHA resin on a 0.125 mmol Scale, using appropriate propoxyphenylacetamide (0.5 mg) in a vial. The mixture amino acids, palmitic acid and folic acid. Coupling was was Sonicated for 5 minutes and then heated at 80 C. for 5 carried out using standard TBTU/HOBt/DIEA protocols. minutes (vial was shaken during warming). The Solution was Simultaneous removal of the peptide from the resin and filtered and cooled. The head space was flushed with per deprotection of Side-chain protecting groups was carried out fluorobutane gas and the Vial was shaken in a cap mixer for 60 in TFA containing 5% EDT and 5% water for 2 hours. Crude 45 Seconds, whereafter the contents were extensively material was precipitated from ether and analysed by washed with deionised water. Incorporation of compound MALDI mass spectrometry, giving a M--H peak correspond from (a) into the microbubbles was confirmed by MALDI ing to the structure at 1435, expected 1430. The material was MS as follows; ca. 50 ul of microbubbles were transferred further characterised by analytical HPLC, gradient 70-100% to a clean vial containing ca. 100 ul of 90% methanol. The 65 B over 20 minutes, A=0.1% TFA/water and B=0.1% TFA/ mixture was Sonicated for 30 Seconds and analysed by acetonitrile, flow rate 1.0 ml/minute, giving a product peak MALDI-MS, giving a M+H peak at 492 corresponding to with retention time 27 minutes detected at UV 368 nm. US 6,264,917 B1 147 148 b) Preparation of Gas-filled Microbubbles Comprising EXAMPLE 57 DSPS and a Lipopeptide Containing Folic Acid A solution of 1.4% propylene glycol/2.4% glycerol (1.0 Gas-filled Microbubbles Comprising DSPS and a ml) was added to a mixture of DSPS (4.5 mg) and product Lipopeptide Containing Atenolol and a Cholesterol from (a) (0.5 mg) in a vial. Dilute ammonia (to pH 8) and Derivative of Chlorambucil for Diagnostic and DMSO (40 ul) were added and the mixture was sonicated for Therapeutic Applications 5 minutes and then heated at 80° C. for 5 minutes (vial was Shaken during warming). The Solution was filtered and a) Synthesis of a Protected Atenolol Derivative Suitable for cooled. The head space was flushed with perfluorobutane Solid Phase Coupling gas and the Vial was Shaken in a cap mixer for 45 seconds, i) Synthesis of methyl 4-(2,3-epoxy) propoxy whereafter the contents were extensively washed with deio phenylacetate nised water. Incorporation of structure from (a) into the A mixture of methyl 4-hydroxyphenylacetate (4.98 g, bubbles was confirmed by MALDI-MS as follows: ca. 50 ul 0.030 mol), epichlorohydrin (23.5 ml, 0.30 mol) and pyri of microbubbles were transferred to a clean vial containing dine (121 ul, 1.5 mmol) was stirred at 85°C. for 2 hours. The ca. 100 ul of 90% methanol. The mixture was Sonicated for 15 reaction mixture was cooled and exceSS epichlorohydrin was 30 seconds and analysed by MALDI-MS (ACH matrix), distilled off (rotavapor). The residue was taken up in ethyl giving a M-H peak at 1238 corresponding to Structure from acetate, washed with brine and dried (NaSO). The solution (a). was filtered and concentrated. The dark residue was chro c) In vitro Analysis matographed (silica, hexane/ethyl acetate 7:3) to give 2.25g The microbubbles were tested in the in vitro assay as (34%) of a colourless oil. "H (300 MHz) and 'C NMR (75 detailed in Example 21. A gradual accumulation of MHz) spectra were in accordance with the structure. microbubbles binding to the cells was observed. ii) Synthesis of methyl 4-2-hydroxy-3-(1-methylethyl) aminopropoxyphenylacetate EXAMPLE 56 25 A mixture of methyl 4-(2,3-epoxy) propoxy phenylacetate (2.00 g, 9.00 mmol), isopropylamine (23 ml, Gas-filled Microbubbles Comprising DSPS and a 0.27 mol) and water (1.35 ml, 74.7 mmol) was stirred at Cholesteryl Ester of Chlorambucil for Diagnostic room temperature overnight. The reaction mixture was con and Therapeutic Applications centrated (rotavapor) and the oily residue was dissolved in a) Synthesis of Cholesteryl 4-4-bis(2-chloroethyl)amino chloroform and dried (NaSO). Filtration and concentration phenylbutanoate gave quantitative yield of a yellow oil that was used in the DIC (170 ul, 1.10 mmol) was added to a solution of next Step without further purification. The Structure was chlorambucil (669 mg, 2.20 mmol) in dry dichloromethane verified by H and 'C NMR analysis. (15 ml). The mixture was stirred at room temperature for 0.5 35 iii) Synthesis of 4-2-hydroxy-3-(1-methylethyl)amino hour and added to a solution of cholesterol (387 mg, 1.00 propoxyphenylacetic acid hydrochloride mmol) and DMAP (122 mg, 1.00 mmol) in dichloromethane (10 ml). The reaction mixture was stirred overnight and then A solution of methyl 4-2-hydroxy-3-(1-methylethyl) poured onto 5% sodium bicarbonate. The phases were aminopropoxyphenylacetate (563 mg, 2.00 mmol) in 6M Separated and the organic phase was washed with brine and hydrochloric acid (15 ml) was heated at 100° C. for 4 hours. dried (MgSO). The solution was filtered and concentrated 40 The reaction mixture was concentrated (rotavapor) and the and the product was purified by column chromatography residue was taken up in water and lyophilised. "H and 'C (silica, chloroform) to give 560 mg (83%)of colouless oil. NMR spectra were in accordance with the structure and The product was characterised by MALDI mass MALDI mass spectrometry gave a M+H at 268 as expected. Spectrometry, giving M-H at 674 as expected. Further 45 iv) Synthesis of N-Boc-4-2-hydroxy-3-(1-methylethyl) characterisation was carried out using H (500 MHz) and aminopropoxyphenylacetic acid 'C (125 MHz) NMR analysis, giving spectra in accordance A solution of the 4-2-hydroxy-3-(1-methylethyl)amino with the structure. propoxyphenylacetic acid hydrochloride (2.0 mmol) in b) Preparation of Gas-filled Microbubbles Comprising water (2 ml) was added to a solution of sodium bicarbonate DSPS and a Cholesteryl Ester of Chlorambucil for Diag 50 (0.60 g, 7.2 mmol) in water/dioxane (2:1, 15 ml). A solution nostic and/or Therapeutic Applications of di-tert-butyl dicarbonate (0.48g, 2.2 mmol) in dioxane (5 A solution of 1.4% propylene glycol/2.4% glycerol (1.0 ml) was added. Progress of the reaction was monitored by ml) was added to a mixture of DSPS (4.5 mg) and product TLC analysis (silica, CHCl/MeOH/AcOH 85:10:5), and from (a) (0.5 mg) in a vial. The mixture was sonicated for portions of di-tert-butyl dicarbonate were added until con 5 minutes and then heated at 80° C. for 5 minutes (vial was 55 Shaken during warming) and cooled. The head space was version was complete. The reaction mixture was poured onto flushed with perfluorobutane gas and the Vial was Shaken in water Saturated with potassium hydrogen Sulphate and a cap mixer for 45 Seconds, whereafter the contents were organic material was extracted into ethyl acetate. The extensively washed with deionised water. MALDI mass organic phase was washed with water and brine, dried Spectrometry showed no detectable level of compound from 60 (NaSO) and filtered to give 0.6 g of crude material. The (a) in the final wash Solution. Incorporation of chlorambucil product was purified by chromatography (silica, CHCl/ cholesteryl ester into the bubbles was confirmed by MALDI MeOH/AcOH 85:10:5). The solution was concentrated and MS as follows: ca. 50 ul of microbubbles were transferred the residue was taken up in glacial acetic acid and lyophi to a clean vial containing ca. 100 ul of 90% methanol. The lised. Yield 415 mg (56%), white solid. The structure was mixture was Sonicated for 30 Seconds and analysed by 65 confirmed by H and 'C NMR analysis. MALDI-MS, giving a M+H peak at 668 corresponding to b) Synthesis of a lipopeptide functionalised with atenolol Structure from (a). (SEQ ID NO:21) US 6,264,917 B1 149 150

s

;

Z US 6,264,917 B1 151 152 The structure shown above was synthesised by the manual EXAMPLE 58 bubbler method starting with Fmoc-protected Rink Amide MBHA resin on a 0.125 mmol Scale, using appropriate Gas-filed Microbubbles Comprising DSPS and a amino acids, palmitic acid and the compound from (a). Lipopeptide Containing Atenolol for Cell Targeting Coupling was carried out using standard TBTU/HOBt/DIEA 5 and a Lipophilic Thiol Ester of Captopril for protocols. Simultaneous removal of the peptide from the Therapeutic Use resin and deprotection of Side-chain protecting groups was a) Synthesis of a Protected Atenolol Derivative Suitable for carried out in TFA containing 5% EDT and 5% water for 2 Solid Phase Coupling hours. Crude material was precipitated from ether and i) Synthesis of methyl 4-(2,3-epoxy) propoxy purified by preparative liquid chromatography using a gra phenylacetate dient of 70 to 100% B over 60 minutes (A=0.1% TFA/water A mixture of methyl 4-hydroxyphenylacetate (4.98 g, and B=0.1% TFA/acetonitrile) at a flow rate of 10 ml/min. 0.030 mol), epichlorohydrin (23.5 ml, 0.30 mol) and pyri After lyophilisation, a yield of 38 mg of pure material was dine (121 ul, 1.5 mmol) was stirred at 85°C. for 2 hours. The obtained (analytical HPLC, gradient 70–100% B over 20 15 reaction mixture was cooled and exceSS epichlorohydrin was minutes, A=0.1% TFA/water and B=0.1% TFA/acetonitrile, distilled off (rotavapor). The residue was taken up in ethyl flow rate 1 ml/minute, detection UV 214 nm, retention time acetate, washed with brine and dried (NaSO). The solution 25 minutes). Further characterisation was carried out using was filtered and concentrated. The dark residue was chro MALDI mass spectrometry (ACH matrix), giving M+H at matographed (silica, hexane/ethyl acetate 7:3) to give 2.25g 1258, expected 1257. (341) of a colourless oil. "H (300 MHz) and 'C NMR (75 c) Synthesis of Cholesteryl 4-4-bis(2-chloroethyl)amino MHz) spectra were in accordance with the structure. phenylbutanoate ii) Synthesis of methyl 4-2-hydroxy-3-(1-methylethyl) aminopropoxyphenylacetate DIC (170 ul, 1.10 mmol) was added to a solution of 25 A mixture of methyl 4-(2,3-epoxy) propoxy chlorambucil (669 mg, 2.20 mmol) in dry dichloromethane phenylacetate (2.00 g, 9.00 mmol), isopropylamine (23 ml, (15 ml). The mixture was stirred at room temperature for 0.5 0.27 mol) and water (1.35 ml, 74.7 mmol) was stirred at hour and added to a solution of cholesterol (387 mg, 1.00 room temperature overnight. The reaction mixture was con mmol) and DMAP (122 mg, 1.00 mmol) in dichloromethane centrated (rotavapor) and the oily residue was dissolved in (10 ml). The reaction mixture was stirred overnight and then chloroform and dried (NaSO). Filtration and concentration poured onto 5% sodium bicarbonate. The phases were gave quantitative yield of a yellow oil that was used in the Separated and the organic phase was washed with brine and next Step without further purification. The Structure was dried (MgSO). The solution was filtered and concentrated verified by H and 'C NMR analysis. and the product was purified by column chromatography 35 iii) Synthesis of 4-2-hydroxy-3-(1-methylethyl)amino (silica, chloroform) to give 560 mg (83%) of colouless oil. propoxyphenylacetic acid hydrochloride The product was characterised by MALDI mass A solution of methyl 4-2-hydroxy-3-(1-methylethyl) Spectrometry, giving M-H at 674 as expected. Further aminopropoxyphenylacetate (563 mg, 2.00 mmol) in 6M characterisation was carried out using H (500 MHz) and hydrochloric acid (15 ml) was heated at 100° C. for 4 hours. 'C (125 MHz) NMR analysis, giving spectra in accordance 40 The reaction mixture was concentrated (rotavapor) and the with the structure. residue was taken up in water and lyophilised. "H and 'C d) Preparation of Gas-filled Microbubbles Comprising NMR spectra were in accordance with the strucure and DSPS and a Lipopeptide Containing Atenolol and a Cho MALDI mass spectrometry gave a M+H at 268 as expected. lesteryl Ester of Chloambucil 45 iv) Synthesis of N-Boc-4-2-hydroxy-3-(1-methylethyl) aminopropoxyphenylacetic acid A Solution of 1.4% propylene glycol/2.4 uglycerol (1.0 A solution of the 4-2-hydroxy-3-(1-methylethyl)amino ml) was added to a mixture of DSPS (5.0 mg), product from propoxyphenylacetic acid hydrochloride (2.0 mmol) in (b) (0.5 mg) and product from (c) (0.5 mg) in a vial. The water (2 ml) was added to a solution of sodium bicarbonate mixture was Sonicated for 5 minutes and then warmed to 80 50 (0.60 g, 7.2 mmol) in water/dioxane (2:1, 15 ml). A solution C. for 5 minutes (vial was shaken during warming). The of di-tert-butyl dicarbonate (0.48g, 2.2 mmol) in dioxane (5 Solution was filtered and cooled. The head Space was flushed ml) was added. Progress of the reaction was monitored by with perfluorobutane gas and the vial was shaken in a cap TLC analysis (silica, CHCl/MeOH/AcOH 85:10:5), and mixer for 45 Seconds, whereafter the contents were exten portions of di-tert-butyl dicarbonate were added until con Sively washed with deionised water. Incorporation of com 55 version was complete. The reaction mixture was poured onto pounds (b) and (c) into the microbubbles was confirmed by water Saturated with potassium hydrogen Sulphate and MALDI-MS as follows: ca. 50 ul of microbubbles were organic material was extracted into ethyl acetate. The transferred to a clean vial containing ca. 100 ul of 90% organic phase was washed with water and brine, dried methanol. The mixture was Sonicated for 30 seconds and 60 (NaSO) and filtered to give 0.6 g of crude material. The analysed by MALDI-MS (ACH-matrix), giving a M+H peak product was purified by chromatography (silica, CHCl/ corresponding to lipopeptide (b) and cholesteryl ester (c). MeOH/AcOH 85:10:5). The solution was concentrated and the residue was taken up in glacial acetic acid and lyophi e) In vitro Analysis lised. Yield 415 mg (56%), white solid. The structure was The microbubbles were tested in the in vitro assay as 65 confirmed by H and 'C NMR analysis. detailed in Example 21. A gradual accumulation of b) Synthesis of a lipopeptide functionalised with atenolol microbubbles binding to the cells was observed. (SEQ ID NO:21) US 6,264,917 B1 153 154

s

;

Z US 6,264,917 B1 15S 156 The structure shown above was synthesised by the manual EXAMPLE 59 bubbler method starting with Fmoc-protected Rink Amide Gas-filled Microbubbles Comprising MBHA resin on a 0.125 mmol Scale, using appropriate Phosphatidylserine and biotinamide-PEG-B-Ala amino acids, palmitic acid and the compound from (a). cholesterol and a Cholesteryl Ester of Chlorambucil Coupling was carried out using standard TBTU/HOBt/DIEA 5 for Diagnostic and Therapeutic Applications protocols. Simultaneous removal of the peptide from the a) Synthesis of Cholesteryl N-Boc-B-alaninate DIC (510 ul) was added to a solution of Boc-B-Ala-OH resin and deprotection of Side-chain protecting groups was (1.25 g. 6.60 mmol) in dichloromethane (15 ml) under an carried out in TFA containing 5% EDT and 5% water for 2 inert atmosphere. The reaction mixture was stirred for 30 hours. Crude material was precipitated from ether and minutes and then transferred to a flask containing a Solution purified by preparative liquid chromatography using a gra of cholesterol (1.16 g, 3.00 mmol) and DMAP (367 mg, 3.00 dient of 70 to 100% B over 60 minutes (A=0.1% TFA/water mmol) in dichloromethane (15 ml). The reaction mixture and B=0.1% TFA/acetonitrile) at a flow rate of 10 ml/min. was Stirred for 2 hours and then poured onto an aqeous After lyophilisation, a yield of 38 mg of pure material was Solution of potassium hydrogen Sulphate. After phase Sepa obtained (analytical HPLC, gradient 70–100% B over 20 15 ration the aqueous phase was extracted with chloroform. The combined organic phases were washed with aqueous potas minutes, A=0.1% TFA/water and B=0.1% TFA/acetonitrile, sium hydrogen Sulphate and water and dried (MgS). After flow rate 1 ml/minute, detection UV 214 nm, retention time filtration and evaporation the crude product was chromato 25 minutes). Further characterisation was carried out using graphed (silica, chloroform/methanol 99:1) to give 1.63 g MALDI mass spectrometry (ACH matrix), giving M+H at (97%) of white solid. The structure was confirmed by 'H 1258, expected 1257. NMR (500 MHz). c) Synthesis of Cholanic Acid Thiol Ester of Captopril b) Synthesis of Cholesteryl B-alaninate Hydrochloride A solution of compound from (a) (279 mg, 0.500 mmol) A mixture of 5-B-cholanic acid (361 mg, 1.00 mmol) and in 1M hydrochloric acid in 1,4-dioxane (5 ml) was stirred at DIC (77 ul, 0.50 mmol) in dichloromethane (5 ml) was 25 room temperature for 4 hours. The reaction mixture was stirred for 10 minutes and then added to a Solution of concentrated to give a quantitative yield of cholesteryl captopril (130 mg, 0.600 mmol) and DBU (180 ul, 1.20 B-alaninate hydrochloride. The structure was confirmed by mmol) in dichloromethane (10 ml). The reaction mixture "H NMR (500 MHz) analysis and by MALDI mass was Stirred overnight and then poured onto dilute hydro Spectrometry, giving a M+Na peak at 482, expected 481. chloric acid. Chloroform (30 ml) was added. The phases c) Biotin-PEG-B-Ala-Cholesterol were separated and the organic phase was washed with water To a solution of cholesteryl B-alaninate hydrochloride (15 and brine and dried (MgSO). After filtration and mg, 0.03 mmol) in chloroform/wet methanol (2.6:1, 3 ml) concentration, the crude material was chromatographed was added triethylamine (42 ul, 0.30 mmol). The mixture (silica, chloroform/methanol/acetic acid 95:4:1). The prod was stirred for 10 minutes at room temperature and a 35 solution of biotin-PEG-NHS (100 mg, 0.03 mmol) in uct was lyophilised from a acetonitrile/water/ethanol mix 1,4-dioxane (1 ml) was added dropwise. After stirring at ture. Yield 137 mg (49%) of off-white solid. The structure room temperature for 3 hours the mixture was evaporated to was verified by H (500 MHz) and 'C (125 MHz) NMR dryneSS and the residue was purified by flash chromatogra Spectroscopy. Further characterisation was carried out using phy to give white crystals, yield 102 mg (89%). The struc MALDI mass spectrometry, giving a M--Na peak in positive 40 ture was verified by MALDI-MS and by NMR analysis. mode at m/z 584. d) Synthesis of Cholesteryl 4-4-bis(2-chloroethyl)amino d) Preparation of Gas-filled Microbubbles Comprising phenylbutanoate DSPS and a Lipopeptide Containing Atenolol for Cell DIC (170 ul, 1.10 mmol) was added to a solution of Targeting and a Lipophilic Thiol Ester of Captopril for chlorambucil (669 mg, 2.20 mmol) in dry dichloromethane Therapeutic Use 45 (15 ml). The mixture was stirred at room temperature for 0.5 hour and added to a solution of cholesterol (387 mg, 1.00 A solution of 1.4% propylene glycol/2.4% glycerol (1.0 mmol) and DMAP (122 mg, 1.00 mmol) in dichloromethane ml) was added to a mixture of DSPS (5.0 mg) and products (10 ml). The reaction mixture was stirred overnight and then from (b) (0.5 mg) and (c) (0.5 mg) in a vial. The mixture was poured onto 5% sodium bicarbonate. The phases were Sonicated for 5 minutes and then heated at 80 C. for 5 50 Separated and the organic phase was washed with brine and minutes (vial was shaken during warming) and cooled. Head dried (MgSO). The solution was filtered and concentrated Space was flushed with perfluorobutane gas and the vial was and the product was purified by column chromatography Shaken in a cap mixer for 45 Seconds followed by extensive (silica, chloroform) to give 560 mg (83%) yield of colouless washing with deionised water. MALDI mass spectrometry oil. The product was characterised by MALDI mass showed no detectable level of compound from (b) or (c) in 55 Spectrometry, giving M-H at 674 as expected. Further the final wash Solution. Incorporation of compounds from characterisation was carried out using H (500 MHz) and (b) and (c) into the microbubbles was confirmed by MALDI 'C (125 MHz) NMR analysis, giving spectra in accordance MS as follows: ca. 50 ul of microbubbles were transferred with the structure. to a clean vial containing ca. 100 ul of 90% methanol. The e) Preparation of Gas-filled Microbubbles mixture was Sonicated for 30 Seconds and analysed by 60 A solution of 1.4% propylene glycol/2.4% glycerol (1.0 MALDI-MS (ACH-matrix), giving peaks according to ml) was added to a mixture of DSPS (5 mg) and products from (c) (0.5 mg) and (d) (0.5 mg) in a vial. The mixture was Structures from (b) and (c) respectively. Sonicated for 5 minutes and then heated at 80° C. for 5 e) In vitro Analysis minutes (vial was shaken during warming) and cooled. The The microbubbles were tested in the in vitro assay as 65 head Space was flushed with perfluorobutane gas and the Vial detailed in Example 21. A gradual accumulation of was shaken in a cap mixer for 45 Seconds, whereafter the microbubbles binding to the cells was observed. contents were extensively washed with deionised water. US 6,264,917 B1 157 158 MALDI mass spectrometry showed no detectable level of EXAMPLE 60 compound from (c) or (d) in the final wash Solution. Incor poration of compounds from (c) and (d) into the microbubbles was confirmed by MALDI-MS as follows: ca. Gas-filled Microbubbles Comprising DSPS and a 50 ul of microbubbles were transferred to a clean vial 5 Lipopeptide Containing a Derivative of Bestatin for containing ca. 100 ul of 90% methanol. The mixture was Diagnostic and Therapeutic Applications Sonicated for 30 seconds and analysed by MALDI-MS (ACH-matrix), giving M-H peaks corresponding to com- a) Synthesis of a lipopeptide containing a derivative of pounds from (c) and (d). bestatin (SEQ ID NO:23) US 6,264,917 B1 159 160

;

Z US 6,264,917 B1 161 162 The structure shown above was synthesised by the manual 5 minutes and then heated at 80° C. for 5 minutes (vial was bubbler method starting with Fmoc-protected Rink Amide Shaken during warming) and cooled. The head space was MBHA resin on a 0.125 mmol Scale, using appropriate flushed with perfluorobutane gas and the Vial was Shaken in amino acids and palmitic acid. Coupling was carried out a cap mixer for 45 seconds and the contents were extensively using standard TBTU/HOBt/DIEA protocols. Simultaneous washed with deionised water. MALDI mass spectrometry removal of the peptide from the resin and deprotection of showed no detectable level of compound from (b) in the final Side-chain protecting groups was carried out in TFA con wash Solution. Incorporation of atenolol-containing lipopep taining 5% EDT and 5% water for 2 hours. Crude material tide into the microbubbles was confirmed by MALDI-MS as was precipitated from ether and purified by preparative follows: ca. 50 ul of microbubbles were transferred to a liquid chromatography using a gradient of 70 to 100% B clean vial containing ca. 100 ul of 90% methanol. The over 60 minutes (A=0.1% TFA/water and B=0.1% TFA/ mixture was Sonicated for 30 Seconds and analysed by acetonitrile) at a flow rate of 10 ml/min. After lyophilisation, MALDI-MS (ACH-matrix), giving a M+H peak at 1320, a yield of 12 mg of pure material was obtained (analytical expected at 1314, corresponding to lipopeptide from (a). HPLC, gradient 70–100% B over 20 minutes, A=0.1% c) In vitro Analysis TFA/water and B=0.1% TFA/acetonitrile, flow rate 1 15 The microbubbles were tested in the in vitro assay as ml/minute, detection UV 214 nm, retention time 25 min detailed in Example 21. A gradual accumulation of utes). Further characterisation was carried out using MALDI microbubbles binding to the cells was observed. mass spectrometry (ACH matrix), giving M+H at 1315, expected 1314. EXAMPLE 61 b) Preparation of Gas-filled Microbubbles Comprising DSPS and a Lipopeptide Containing a Derivative of Bestatin Gas-filled Microbubbles Comprising DSPS and a for Diagnostic and Therapeutic Applications Lipopeptide Containing Chlorambucil for A solution of 1.4% propylene glycol/2.4% glycerol (1.0 Diagnostic and Therapeutic Applications ml) was added to a mixture of DSPS (4.5 mg) and product a) Synthesis of a lipopeptide containing chlorambucil (SEQ from (a) (0.5 mg) in a vial. The mixture was sonicated for ID NO:24) US 6,264,917 B1 163 164

;

Z US 6,264,917 B1 165 166 The structure shown above was synthesised by the manual i) Synthesis of methyl 4-(2,3-epoxy) propoxy bubbler method starting with Fmoc-protected Rink Amide phenylacetate MBHA resin on a 0.125 mmol Scale, using appropriate amino acids and palmitic acid. Coupling was carried out A mixture of methyl 4-hydroxyphenylacetate (4.98 g, using standard TBTU/HOBt/DIEA protocol. Chlorambucil 5 0.030 mol), epichlorohydrin (23.5 ml, 0.30 mol) and pyri was coupled through the Side-chain of Lys as a Symmetrical dine (121 ul, 1.5 mmol) was stirred at 85°C. for 2 hours. The anhydride using DIC preactivation. reaction mixture was cooled, and exceSS epichlorohydrin Simultaneous removal of the peptide from the resin and was distilled off (rotavapor). The residue was taken up in ethyl acetate, washed with brine and dried (NaSO). The deprotection of Side-chain protecting groups was carried out Solution was filtered and concentrated. The dark residue was in TFA containing 5% EDT, 5% water and 5% ethyl methyl chromatographed (silica, hexane/ethyl acetate 7:3) to give sulphide for 2 hours. An aliqout of 10 mg of the crude 2.25 g (34%) of a colourless oil. "H (300 MHz) and 'C material was purified by preparative liquid chromatography NMR (75 MHz) spectra were in accordance with the struc using a gradient of 70 to 100% B over 60 minutes (A=0.1% ture. TFA/water and B=0.1% TFA/acetonitrile) at a flow rate of 15 10 ml/min. After lyophilisation, a yield of 30 mg of pure ii) Synthesis of methyl 4-2-hydroxy-3-(1-methylethyl) material was obtained (analytical HPLC, gradient 70–100% aminopropoxyphenylacetate B over 20 minutes, A=0.1% TFA/water and B=0.1% TFA/ acetonitrile, flow rate 1 ml/minute, detection UV 214 nm. A mixture of methyl 4-(2,3-epoxy) propoxy retention time 26.5 minutes). Further characterisation was phenylacetate (2.00 g, 9.00 mmol), isopropylamine (23 ml, carried out using MALDI mass spectrometry, giving M+H at 0.27 mol) and water (1.35 ml, 74.7 mmol) was stirred at 1295, expected 1294. room temperature overnight. The reaction mixture was con centrated (rotavapor) and the oily residue was dissolved in b) Preparation of Gas-filled Microbubbles Comprising 25 chloroform and dried (NaSO). Filtration and concentration DSPS and a Lipopeptide Containing Chlorambucil for Diag gave quantitative yield of a yellow oil that was used in the nostic and Therapeutic Applications next Step without further purification. The Structure was verified by H and 'C NMR analysis. A solution of 1.4% propylene glycol/2.4% glycerol (1.0 ml) was added to a mixture of DSPS (4.5 mg) and product iii) Synthesis of 4-2-hydroxy-3-(1-methylethyl)amino from (a) (0.5 mg) in a vial. The mixture was sonicated for propoxyphenylacetic acid hydrochloride 5 minutes and then heated at 80° C. for 5 minutes (vial was Shaken during warming) and cooled. The head space was A solution of methyl 4-2-hydroxy-3-(1-methylethyl) flushed with perfluorobutane gas and the Vial was Shaken in 35 aminopropoxyphenylacetate (563 mg, 2.00 mmol) in 6M a cap mixer for 45 Seconds, whereafter the contents were hydrochloric acid (15 ml) was heated at 100° C. for 4 hours. extensively washed with deionised water. MALDI mass The reaction mixture was concentrated (rotavapor) and the Spectrometry showed no detectable level of compound from residue was taken up in water and lyophilised. "H and 'C (a) in the final wash Solution. Incorporation of chlorambucil NMR spectra were in accordance with the strucure and containing lipopeptide into-the bubbles was confirmed by 40 MALDI mass spectrometry gave a M+H at 268 as expected. MALDI-MS as follows: ca. 50 ul of microbubbles were transferred to a clean vial containing ca. 100 ul of 90% methanol. The mixture was Sonicated for 30 seconds and iv) Synthesis of N-Boc-4-2-hydroxy-3-(1-methylethyl) analysed by MALDI-MS (ACH-matrix), giving a M+H peak aminopropoxyphenylacetic acid at 1300, expected at 1294 and a M+Na peak at 1324, 45 expected 1317. A solution of the 4-2-hydroxy-3-(1-methylethyl)amino propoxyphenylacetic acid hydrochloride (2.0 mmol) in c) In vitro Analysis water (2 ml) was added to a solution of sodium bicarbonate (0.60 g, 7.2 mmol) in water/dioxane (2:1, 15 ml). A solution 50 of di-tert-butyl dicarbonate (0.48g, 2.2 mmol) in dioxane (5 The microbubbles were tested in the in vitro assay as ml) was added. Progress of the reaction was monitored by detailed in Example 21. A gradual accumulation of TLC analysis (silica, CHCl/MeOH/AcOH 85:10:5), and microbubbles binding to the cells was observed. portions of di-tert-butyl dicarbonate were added until con version was complete. The reaction mixture was poured onto 55 water Saturated with potassium hydrogen Sulphate and EXAMPLE 62 organic material was extracted into ethyl acetate. The organic phase was washed with water and brine, dried (NaSO) and filtered to give 0.6 g of crude material. The Gas-filled Microbubbles Comprising DSPS, a 60 product was purified by chromatography (silica, CHCl/ Lipopeptide Containing Atenolol and a Lipophilic MeOH/AcOH 85:10:5). The solution was concentrated and Derivative of Captopril for Diagnostic and the residue was taken up in glacial acetic acid and lyophi Therapeutic Applications lised. Yield 415 mg (56%), white solid. The structure was confirmed by H and 'C NMR analysis. 65 a) Synthesis of a Protected Atenolol Derivative Suitable for b) Synthesis of a lipopeptide functionalised with atenolol Solid Phase Coupling (SEQ ID NO:21) US 6,264,917 B1 167 168

s

;

Z US 6,264,917 B1 169 170 The structure shown above was synthesised by the manual EXAMPLE 63 bubbler method starting with Fmoc-protected Rink Amide Gas-filled Microbubbles Comprising DSPS and a MBHA resin on a 0.125 mmol Scale, using appropriate Cholesterol Derivative of Atenolol for Diagnostic amino acids, palmitic acid and the compound from (a). and Therapeutic Applications Coupling was carried out using standard TBTU/HOBt/DIEA 5 a) Synthesis of Methyl 4-(2,3-epoxy)propoxy phenylacetate protocols. Simultaneous removal of the peptide from the A mixture of methyl 4-hydroxyphenylacetate (4.98 g, resin and deprotection of Side-chain protecting groups was 0.030 mol), epichlorohydrin (23.5 ml, 0.30 mol) and pyri carried out in TFA containing 5% EDT and 5% water for 2 dine (121 ul, 1.5 mmol) was stirred at 85°C. for 2 hours. The hours. Crude material was precipitated from ether and reaction mixture was cooled, and exceSS epichlorohydrin purified by preparative liquid chromatography using a gra was distilled off (rotavapor). The residue was taken up in dient of 70 to 100% B over 60 minutes (A=0.1% TFA/water ethyl acetate, washed with brine and dried (Na2SO). The and B=0.1% TFA/acetonitrile) at a flow rate of 10 ml/min. Solution was filtered and concentrated. The dark residue was After lyophilisation, a yield of 38 mg of pure material was chromatographed (silica, hexane/ethyl acetate 7:3) to give 15 2.25 g (34%) of a colourless oil. "H (300 MHz) and 'C obtained (analytical HPLC, gradient 70–100% B over 20 NMR (75 MHz) spectra were in accordance with the struc minutes, A=0.1% TFA/water and B=0.1% TFA/acetonitrile, ture. flow rate 1 ml/minute, detection UV 214 nm, retention time b) Synthesis of Methyl 4-2-hydroxy-3-(1-methylethyl) 25 minutes). Further characterisation was carried out using aminopropoxyphenylacetate MALDI mass spectrometry (ACH matrix), giving M+H at A mixture of methyl 4-(2,3-epoxy) propoxy 1258, expected 1257. phenylacetate (2.00 g, 9.00 mmol), isopropylamine (23 ml, 0.27 mol) and water (1.35 ml, 74.7 mmol) was stirred at c) Synthesis of N-(S)-3-hexadecylthio-2-methylpropionyl room temperature overnight. The reaction mixture was con proline centrated (rotavapor) and the oily residue was dissolved in DIEA (18841, 1.10 mmol) was added to a solution of chloroform and dried (NaSO). Filtration and concentration 25 gave quantitative yield of a yellow oil that was used in the 1-iodohexadecane (176 mg, 0.500 mmol), captopril (120 next Step without further purification. The Structure was mg, 0.550 mmol) and DBU (165 pl, 1.10 mmol) in tetrahy verified by H and 'C NMR analysis. drofuran (5 ml). The mixture was heated at 70° C. for 2 c) Synthesis of 4-2-hydroxy-3-(1-methylethyl)amino hours and then concentrated. The residue was poured onto propoxyphenylacetic acid hydrochloride water Saturated with potassium hydrogen Sulphate and A solution of methyl 4-2-hydroxy-3-(1-methylethyl) organic material was extracted into chloroform. The organic aminopropoxyphenylacetate (563 mg, 2.00 mmol) in 6M phase was washed with water and dried (MgSO). The hydrochloric acid (15 ml) was heated at 100° C. for 4 hours. product was purified by chromatography (silica, CHCl/ The reaction mixture was concentrated (rotavapor) and the MeOH/AcOH 85:10:5) and lyophilised to give 105 mg residue was taken up in water and lyophilised. "H and 'C 35 NMR spectra were in accordance with the strucure and (48%) of white solid material. The structure was verified by MALDI mass spectrometry gave a M+H at 268 as expected. "H (500 Mhz) and 'C (125 Mhz) NMR analysis and further d) Synthesis of N-Boc-4-2-hydroxy-3-(1-methylethyl) characterised by MALDI mass spectrometry, giving M-H in aminopropoxyphenylacetic acid negative mode at m/z 440 as expected. A solution of the 4-2-hydroxy-3-(1-methylethyl)amino d) Preparation of Gas-filled Microbubbles Comprising 40 propoxyphenylacetic acid hydrochloride (2.0 mmol) in DSPS, a Lipopeptide Containing Atenolol and a Lipophilic water (2 ml) was added to a solution of sodium bicarbonate Derivative of Captopril for Diagnostic and Therapeutic (0.60 g, 7.2 mmol) in water/dioxane (2:1, 15 ml). A solution Applications of di-tert-butyl dicarbonate (0.48g, 2.2 mmol) in dioxane (5 ml) was added. Progress of the reaction was monitored by A solution of 1.4% propylene glycol/2.4% glycerol (1.0 45 TLC analysis (silica, CHCI3/MeOH/AcOH 85:10:5), and ml) was added to a mixture of DSPS (4.5 mg) and products portions of di-tert-butyl dicarbonate were added until con from (b) (0.5 mg) and (c) in a vial. The mixture was version was complete. The reaction mixture was poured onto Sonicated for 5 minutes and then heated at 80 C. for 5 water Saturated with potassium hydrogen Sulphate and minutes (vial was shaken during warming) and cooled. The organic material was extracted into ethyl acetate. The head Space was flushed with perfluorobutane gas and the Vial 50 organic phase was washed with water and brine, dried (NaSO) and filtered to give 0.6 g of crude material. The was shaken in a cap mixer for 45 Seconds, whereafter the product was purified by chromatography (silica, CHCl/ contents were extensively washed with deionised water. MeOH/AcOH 85:10:5). The solution was concentrated and MALDI mass spectrometry showed no detectable level of the residue was taken up in glacial acetic acid and lyophi compound from (b) or (c) in the final wash Solution. Incor 55 lised. Yield 415 mg (56%), white solid. The structure was poration of compounds (b) and (c) into the microbubbles confirmed by H and 'C NMR analysis. was confirmed by MALDI-MS as follows: ca. 50 ul of e) Synthesis of Cholesteryl N-Boc-B-alaninate microbubbles were transferred to a clean vial containing ca. DIC (510 ul) was added to a solution of Boc-B-Ala-OH 100 ul of 90% methanol. The mixture was Sonicated for 30 (1.25 g. 6.60 mmol) in dichloromethane (15 ml) under an seconds and analysed by MALDI-MS (ACH-matrix), giving 60 inert atmosphere. The reaction mixture was stirred for 30 M+H peaks corresponding to structures (b) and (c) respec minutes and then transferred to a flask containing a Solution tively. of cholesterol (1.16 g, 3.00 mmol) and DMAP (367 mg, 3.00 mmol) in dichloromethane (15 ml). The reaction mixture e) In vitro Analysis was Stirred for 2 hours and then poured onto an aqeous The microbubbles were tested in the in vitro assay as 65 Solution of potassium hydrogen Sulphate. detailed in Example 21. A gradual accumulation of After phase Separation the aqueous phase was extracted microbubbles binding to the cells was observed. with chloroform. The combined organic phases were washed US 6,264,917 B1 171 172 with aqueous potassium hydrogen Sulphate and water and Shaken during warming) and cooled. The head space was dried (MgSO). After filtration and evaporation the crude flushed with perfluorobutane gas and the Vial was Shaken in product was chromatographed (silica, chloroform/methanol a cap mixer for 45 Seconds, whereafter the contents were 99:1) to give 1.63 g (97%) of white solid. The structure was extensively washed with deionised water. MALDI mass confirmed by H NMR (500 MHz). Spectrometry showed no detectable level of compound from f) Synthesis of Cholesteryl B-alaninate Hydrochloride (b) in the final wash Solution. Incorporation of compound A solution of compound from (a) (279 mg, 0.500 mmol) from (h) into the microbubbles was confirmed by MALDI in 1M hydrochloric acid in 1,4-dioxane (5 ml) was stirred at mass Spectrometry. room temperature for 4 hours. The reaction mixture was j) In vitro Analysis concentrated to give a quantitative yield of cholesteryl The microbubbles were tested in the in vitro assay as B-alaninate hydrochloride. The structure was confirmed by detailed in Example 21. A gradual accumulation of bubbles 1H NMR (500 MHz) analysis and by MALDI mass binding to the cells was observed. Spectrometry, giving a M+Na peak at 482, expected 481. g) Synthesis of Cholesteryl N-Boc-4-2-hydroxy-3-1- EXAMPLE 64 methylethyl)aminopropoxyphenylacetyl-3-alaninate. Preparation of Multiple-sepecific Transferrin/avidin To a solution of N-Boc-4-2-hydroxy-3-(1-methylethyl) 15 coated Gas-filled Microbubbles for Targeted aminopropoxyphenylacetic acid (55 mg, 0.15 mmol) and Ultrasound Imaging cholesteryl B-alaninate hydrochloride (74 mg., 0.15 mmol) in This example is directed to the preparation of DMF (5 ml) was added DIEA (26 ml, 0.15 mmol). HOBt (23 microbubbles containing vectors for targeted ultrasound/ mg, 0.15 mmol) and water-soluble carbodiimide (WSC) (29 therapy. mg, 0.15 mmol) were added. The reaction mixture was a) Synthesis of a thiol-functionalised lipid molecule: Stirred at room temperature overnight and then poured onto Dipalmitoyl-Lys-Lys-Lys-Aca-CyS.OH (SEQ ID NO:20)

O

NH2

S O O O H H --~~~~ Nulls N N--- N OH H H O O O

40 water (25 ml) containing Sodium carbonate (2.5 g) and The lipid structure shown above was Synthesised on an Sodium chloride (4.0 g). Precipitated material was extracted ABI 433A automatic peptide synthesiser starting with Fmoc into chloroform. The organic phase was washed with water Cys(Trt)-Wang resin on a 0.25 mmol scale using 1 mmol and dried (MgSO). After filtration and concentration, crude amino acid cartridges. All amino acids and palmitic acid material (132 mg) was purified by column chromatography 45 were preactivated using HBTU coupling chemistry. The (silica, chloroform/methanol/acetic acid, 95:4:1). Pooled Simultaneous removal of peptide from the resin and depro fractions were concentrated, taken up in glacial acetic acid tection of Side-chain protecting groups was carried out in and lyophilised. Yield 83 mg (69%), yellow-white solid. TFA containing 5% EDT and 5% HO for 2 hours, giving a Structure was confirmed by H NMR analysis. crude product yield of 250 mg. Purification by preparative h) Synthesis of Cholesteryl 4-2-hydroxy-3-(1- 50 HPLC of a 40 mg aliquot of crude material was carried out methylethyl)aminopropoxyphenylacetyl-3-alaninate Trif using a gradient of 90 to 100% B over 50 minutes (A 0.1% luoroacetate TFA/water and B=MeOH) at a flow rate of 9 ml/min. After To a solution of N-Boc-4-2-hydroxy-3-(1-methylethyl) lyophilisation, 24 mg of pure material was obtained aminopropoxyphenylacetyl-f-alaninate (40 mg, 0.05 (analytical HPLC, gradient 70–100% B where B 0.1% mmol) in dry dichloromethane (4 ml) was added trifluoro 55 TFA/acetonitrile, A 0.01% TFA/water: detection-UV 214 acetic acid (2 ml). The reaction mixture was stirred for 2 nim-product retention time=23 minutes). Further product hours and then concentrated. The product was lyophilised characterisation was carried out using MALDI maSS Spec from a acetonitrile/water mixture to give a quantitative yield trometry: expected M+H at 1096, found at 1099. of white-yellow material. The product was characterised by b) Preparation of gas-containing Microbubbles Comprising MALDI mass spectrometry giving M+H at 708 as expected. 60 DSPS "doped with a Thiol-containing Lipid Structure i) Preparation of Gas-filled Microbubbles Comprising DSPS DSPS (4.5 mg) and the lipid structure from (a) above (0.5 and a Cholesterol Derivative of Atenolol for Diagnostic and mg) were weighed into a clean vial and 0.8 ml of a Solution Therapeutic Applications containing 1.4% propylene glycol/2.4% glycerol in water A solution of 1.4% propylene glycol/2.4% glycerol (1.0 was added. The mixture was warmed to 80 C. for 5 minutes ml) was added to a mixture of DSPS (4.5 mg) and product 65 (vial shaken during warming) and filtered while still hot from (h) (0.5 mg) in a vial. The mixture was sonicated for through a 40 micron filter. The sample was cooled to room 5 minutes and then heated at 80° C. for 5 minutes (vial was temperature and the head Space was flushed with perfluo US 6,264,917 B1 173 174 robutane gas. The Vial was Shaken in a cap mixer for 45 d) Incubation and Examination Seconds and then placed on aroller table overnight. The The cells were further incubated in the cell culture incu resulting microbubbles were washed several times with bator (37° C.) for approximately 4.5 hours. The medium deionised water and analysed for thiol group incorporation containing DNA-microbubbles was then removed by using Ellmans Reagent. aspiration, and 2 ml complete RPMI medium was added. c) Modification of Transferrin and Avidin with Fluorescein The cells were incubated for 40-70 hours before examina NHS and Sulpho-SMPB tion. Most of the medium was then removed and the cells To a mixture of 2 mg of transferrin (Holo, human) and 2 were examined by fluorescence microscopy. The results mg of avidin in PBS (1 ml) was added 0.5 ml of a DMSO were compared to the results from control experiments solution containing 1 mg Sulpho-SMPB and 0.5 mg where DNA or DNA-polylysine were added to the cells. flucrescein-NHS. The mixture was stirred for 45 minutes at room temperature then passed through a SephadeX 200 EXAMPLE 66 column using PBS as eluent. The protein fraction was collected and stored at 4 C. prior to use. Flotation of Endothelial Cells by Microbubbles d) Microbubble Conjugation with Modified Transferrin/ 15 with Vectors that Specifically Bind to the aidin Endothelial Cells To the thiol-containing microbubbles from (b) was added This experiment was carried out to show that the present 1 ml of the modified transferrin/avidin protein solution from invention can be used for Separation of cells to which the (c). After adjusting the pH of the Solution to 9, the conju microbubbles are targeted. The human endothelial cell line gation reaction was allowed to proceed for 2 hours at room ECV 304, derived from a normal umbilical cord (ATCC temperature. Following extensive Washing with deionised CRL-1998) was cultured in Nunc culture flasks (chutney water the microbubbles were analysed by Coulter counter 153732) in RPMI 1640 medium to which L-glutamine (200 (81% between 1 and 7 micron) and fluorescence microscopy mM), penicillin/streptomycin (10,000 U/ml and 10,00 (highly fluorescent microbubbles were observed). ug/ml) and 10% fetal calf serum were added. The cells were 25 subcultured following trypsination with a split ratio of 1:5 to EXAMPLE 65 1:7 when reaching confluence. 2 million cells from trypsi nated confluent cultures were added to each Set of five Gene Transfer by Gas-filled Microbubbles centrifuge tubes. Then control microbubbles or This example is directed at the preparation of targeted microbubbles binding to endothelial cells, made as microbubbles for gene transfer. described in Example 21 and in Example 38, were added at a) Preparation of Gas-filled Microbubbles Comprising 2, 4, 6.8 or 10 million bubbles per tube. The cells at the DSPS and Lipopeptide Coated with Poly-L-lysine bottom of the tubes after centrifugation at 400 g for 5 DSPS (4.5 mg) and lipopeptide from Example 41 (0.5 minutes were counted with a Coulter counter. It was found mg) were weighed in two 2 ml vials. To each vial, 0.8 ml the 4 or more microbubbles binding to a cell brought the propylene glycol/glycerol (4%) in water was added. Each 35 cells to the top of the fluid in the centrifugation tube. All Solution was heated at 80° C. for 5 minutes, shaken and then cells were floated by the microbbbles from Example 38 cooled to ambient temperature, whereafter the headspaces whereas about 50% were floated with the microbubbles from were flushed with perfluorobutane. The vials were shaken on Example 21. a cap-mixer at 4450 oscillations/minute for 45 Seconds and put on a roller table for 5 minutes. The content of the vials 40 EXAMPLE 67 were mixed and the resulting Sample was washed by cen trifugation at 2000 rpm for 5 minutes. The infranatant was Gas-filled Microbubbles of Distearoyl removed and the same volume of distilled water was added. phosphatidylserine Comprising a Lipopeptide The Washing procedure was repeated once. Poly-L-lysine Containing a Vector with Affinity for Endothelin HBr (20.6 mg) was dissolved in 2 ml water, then an aliquot 45 Receptors for Targeted Ultrasound Imaging (0.4 ml) was made up to 2 ml with water. To 1.2 ml of the a) Synthesis of 4'-(3,4-dimethyl-5-isoxazolyl)sulfamoyl diluted poly-L-lysine solution was added 0.12 ml of the Succinanilic acid DSPS-lipopeptide microbubble suspension. Following To a solution of sulfisoxazole (267 mg, 1.00 mmol) in incubation, exceSS polylysine was removed by extensive DMF (10 ml) was added succinic anhydride (1.00 g, 10.0 Washing with water. 50 mmol) and 4-dimethylaminopyridine (122 mg, 1.00 mmol). b) Transfection of Cells The reaction mixture was stirred at 80° C. for 2 hours and Endothelial cells (ECV304) were cultured in 6 well plates then concentrated. The residue was taken up in 5% aqueous to a uniform Subconfluent layer. A transfection mixture Sodium bicarbonate solution and extracted with ethyl consisting of 5 ug DNA (an Enhanced Green Fluorescent acetate. The aqueous Solution was acidified with dilute Protein vector from CLONTECH) and 50 ul of microbubble 55 hydrochloric acid and organic material was extracted into suspension from (a) in RPMI medium at a final volume of ethyl acetate. The organic phase was washed with dilute 250 ul was prepared. The mixture was left standing for 15 hydrochloric acid, water and brine, treated with active minutes at room temperature then 1 ml of complete RPMI charcoal and dried (MgSO). The solution was filtered and medium was added. The medium was removed from the cell concentrated to give 280 mg (76%) of white solid. The culture dish and the DNA-microbubble mixture was added 60 structure was verified by H (300 MHz) and 'C (75 MHz) to the cells. The cells were incubated in a cell culture NMR spectroscopy. Further characterisation was carried out incubator (37° C). using MALDI mass spectrometry (ACH matrix), giving a c) Ultrasonic Treatment M+Na peak at m/z 390 and a M--K peak at m/z 406 as After 15 minutes incubation, Selected wells were exposed expected. to continious wave ultrasound of 1 MHz, 0.5 W/cm', for 30 65 b) Synthesis of a lipopeptide functionalised with sulfisox Seconds. azole (SEQ ID NO:25) US 6,264,917 B1 175 176 US 6,264,917 B1 177 178 The Structure shown above was Synthesised on a manual A solution of 1.4% propylene glycol/2.4% glycerol (1.0 nitrogen bubbler apparatus Starting with Fmoc-protected ml) was added to a mixture of DSPS (4.5 mg) and product Rink Amide BMHA resin on a 0.125 mmol scale, using from (b) (0.5 mg) in a vial. The mixture was sonicated for appropriate amino acids, palmitic acid and the compound 5 minutes and then heated at 80° C. for 5 minutes (vial was from (a). Coupling was carried out using standard TBTU/ 5 HOBt/DIEA protocols. Simultaneous removal of the peptide Shaken during warming) and cooled. The head space was from the resin and deprotection of Side-chain protecting flushed with perfluorobutane gas and the Vial was Shaken in groups was carried out in TFA containing 5% EDT and 5% a cap mixer for 45 Seconds followed by extensive Washing water for 2 hours. Crude material was precipitated from with deionised water. MALDI mass spectrometry showed no ether. The product was analysed by analytical HPLC, gra detectable level of compound from (b) in the final wash dient 70–100% B over 20 minutes, A=0.1% TFA/water and Solution. Incorporation of isoxazole-containing lipopeptide B=0.1% TFA/acetonitrile, flow rate 1 ml/minute, detection into the microbubbles was confirmed by MALDI-MS as UV 214 nm, retention time 27 minutes). Further characteri follows: ca. 50 ul of microbubbles were transferred to a sation was carried out using MALDI mass Spectrometry, clean vial containing ca. 100 ul of 90% methanol. The giving a M+H at m/z 1359, expected 1356. 15 mixture was Sonicated for 30 Seconds and analysed by c) Preparation of Gas-filled Microbubbles Comprising the MALDI-MS (ACH-matrix), giving a m+H peak at m/z 1359 Compound from (b) corresponding to lipopeptide (b).

SEQUENCE LISTING

<160> NUMBER OF SEQ ID NOS : 31

<21 Oc SEQ ID NO 1 <211 LENGTH 4 <212> TYPE PRT <213> ORGANISM: Artificial Sequence <22O > FEATURE OTHER INFORMATION: Description of Artificial Sequence:RGDC-Mal-PEG3400-DSPE

<400 SEQUENCE: 1 Arg Gly Asp Cys 1

SEQ ID NO 2 LENGTH 25 TYPE PRT ORGANISM: Artificial Sequence FEATURE OTHER INFORMATION: Description of Artificial Sequence:Peptide comprising phosphatidylserine-binding and heparin-binding sections <400 SEQUENCE: 2 Phe Asn. Phe Arg Lieu Lys Ala Gly Glin Lys Ile Arg Phe Gly Ala Ala 1 5 10 15 Ala Trp Glu Pro Pro Arg Ala Arg Ile 20 25

<210> SEQ ID NO 3 &2 11s LENGTH 8 &212> TYPE PRT <213> ORGANISM: Artificial Sequence &22O > FEATURE <223> OTHER INFORMATION: Description of Artificial Sequence: Heparin-binding peptide

<400 SEQUENCE: 3 Trp Glu Pro Pro Arg Ala Arg Ile 1 5

SEQ ID NO 4 LENGTH 6 TYPE PRT ORGANISM: Artificial Sequence FEATURE OTHER INFORMATION: Description of Artificial Sequence: US 6,264,917 B1 179 18O

-continued Linker sequence NAME/KEY: MODRES LOCATION: (1) OTHER INFORMATION: MTX-phenylalanine <400 SEQUENCE: 4 Phe Lys Lieu Arg Lieu. Cys 1 5

SEQ ID NO 5 LENGTH 4 TYPE PRT ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Description of Artificial Sequence: Heparin sulphate binding peptide

<400 SEQUENCE: 5 Lys Arg Lys Arg 1

SEQ ID NO 6 LENGTH 8 TYPE PRT ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Description of Artificial Sequence: Fibronectin peptide <400 SEQUENCE: 6 Trp Gln Pro Pro Arg Ala Arg Ile 1 5

SEQ ID NO 7 LENGTH 13 TYPE PRT ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Description of Artificial Sequence: Lipopeptide consisting of a heparin sulphate binding peptide and a fibronectin peptide NAME/KEY: MODRES LOCATION: (1) OTHER INFORMATION: Dipalmitoyl-lysine <400 SEQUENCE: 7 Lys Lys Arg Lys Arg Trp Gln Pro Pro Arg Ala Arg Ile 1 5 10

SEQ ID NO 8 LENGTH 24 TYPE PRT ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Description of Artificial Sequence: Fibronectin peptide sequence

<400 SEQUENCE: 8 Phe Asn. Phe Arg Lieu Lys Ala Gly Glin Lys Ile Arg Phe Gly Gly Gly 1 5 10 15 Gly Trp Gln Pro Pro Arg Ala Ile

SEQ ID NO 9 LENGTH 6 TYPE PRT ORGANISM: Artificial Sequence FEATURE: US 6,264,917 B1 181 182

-continued <223> OTHER INFORMATION: Description of Artificial Sequence: Biotinylated endothelin-1 peptide <221 NAME/KEY: MOD RES <222> LOCATION: (1) <223> OTHER INFORMATION: Biotin-D-Trp <400 SEQUENCE: 9 Trp Lieu. Asp Ile Ile Trp 1 5

<210> SEQ ID NO 10 &2 11s LENGTH 10 &212> TYPE PRT <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: Description of Artificial Sequence: Biotinylated fibrin-anti-polymerant peptide <221 NAME/KEY: MODRES <222> LOCATION: (1) <223> OTHER INFORMATION: Biotinylated-Gly <221 NAME/KEY: MODRES <222> LOCATION: (10) &223> OTHER INFORMATION AMIDATION

<400 SEQUENCE: 10 Gly Pro Arg Pro Pro Glu Arg His Glin Ser 1 5 10

<210> SEQ ID NO 11 &2 11s LENGTH 5 &212> TYPE PRT <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: Description of Artificial Sequence: Lipopeptide containing RGD sequence and fluorescein reporter group <221 NAME/KEY: MODRES <222> LOCATION: (1) <223> OTHER INFORMATION: Dipalmitoyl-Lys <221 NAME/KEY: MODRES <222> LOCATION: (4) <223> OTHER INFORMATION: Acetyl-RGD-K-fluorescein side chain <400 SEQUENCE: 11 Lys Lys Lys Lys Gly 1 5

<210> SEQ ID NO 12 &2 11s LENGTH 18 &212> TYPE PRT <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: Description of Artificial Sequence: Endothelial cell binding lipopeptide <221 NAME/KEY: MOD RES <222> LOCATION: (1) <223> OTHER INFORMATION: 2-n-hexadecyl stearyl-Lys <221 NAME/KEY: MODRES <222> LOCATION: (18) &223> OTHER INFORMATION AMIDATION

<400 SEQUENCE: 12 Lys Lieu Ala Lieu Lys Lieu Ala Lieu Lys Ala Lieu Lys Ala Ala Lieu Lys 1 5 10 15

Leu Ala

<210> SEQ ID NO 13 <211& LENGTH 4 &212> TYPE PRT <213> ORGANISM: Artificial Sequence US 6,264,917 B1 183 184

-continued

&220s FEATURE <223> OTHER INFORMATION: Description of Artificial Sequence: Lipopeptide functionalised with captopril <221 NAME/KEY: MODRES <222> LOCATION: (1) <223> OTHER INFORMATION: Dipalmitoyl-Lys <221 NAME/KEY: MOD RES <222> LOCATION: (4) <223> OTHER INFORMATION: Amide linked via side chain to captopril <221 NAME/KEY: MODRES <222> LOCATION: (4) &223> OTHER INFORMATION AMIDATION

<400 SEQUENCE: 13 Lys Lys Lys Lys 1

<210> SEQ ID NO 14 &2 11s LENGTH 13 &212> TYPE PRT <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: Description of Artificial Sequence: Lipopeptide with an affinity for endothelial cells <221 NAME/KEY: MODRES <222> LOCATION: (1) <223> OTHER INFORMATION: Dipalmitoyl-Lys <221 NAME/KEY: MOD RES <222> LOCATION: (4) <223> OTHER INFORMATION: Acp <221 NAME/KEY: MODRES <222> LOCATION: (13) &223> OTHER INFORMATION AMIDATION

<400 SEQUENCE: 14 Lys Lys Lys Xala Ile Arg Arg Val Ala Arg Pro Pro Leu 1 5 10

<210 SEQ ID NO 15 <211& LENGTH: 14 &212> TYPE PRT <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: Description of Artificial Sequence: Lipopeptide comprising an interleukin-1 receptor binding peptide <221 NAME/KEY: MODRES <222> LOCATION: (1) <223> OTHER INFORMATION: Dipalmitoyl-Lys <400 SEQUENCE: 15 Lys Gly Asp Trp Asp Glin Phe Gly Lieu Trp Arg Gly Ala Ala 1 5 10

<210> SEQ ID NO 16 <211& LENGTH: 12 &212> TYPE PRT <213> ORGANISM: Artificial Sequence &220s FEATURE <221 NAME/KEY: MODRES <222> LOCATION: (1) <223> OTHER INFORMATION: Dabsyl-Tyr <221 NAME/KEY: MODRES <222> LOCATION: (10) <223> OTHER INFORMATION: RGDS chain linked via NH2 group of lysine <223> OTHER INFORMATION: Description of Artificial Sequence:Branched core peptide comprising a dabsylated atherosclerotic plague-binding sequence and RGDS <400 SEQUENCE: 16 Tyr Arg Ala Lieu Val Asp Thr Lieu Lys Lys Gly Cys 1 5 10 US 6,264,917 B1 18S 186

-continued

SEQ ID NO 17 LENGTH 25 TYPE DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide NAME/KEY: misc feature LOCATION: (1) OTHER INFORMATION: Biotinylated <400 SEQUENCE: 17 gaaagg tagt ggggtogtgt gcc.gg 25

SEQ ID NO 18 LENGTH 15 TYPE PRT ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Description of Artificial Sequence: Lipopeptide with affinity for thrombi NAME/KEY: MOD RES LOCATION: (1) OTHER INFORMATION: Dipalmitoyl-Lys NAME/KEY: MODRES LOCATION: (15) OTHER INFORMATION AMIDATION

<400 SEQUENCE: 18 Lys Asn Asp Gly Asp Phe Glu Glu Ile Pro Glu Glu Tyr Lieu Glin 1 5 10 15

SEQ ID NO 19 LENGTH 6 TYPE PRT ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Description of Artificial Sequence: Lipopeptide NAME/KEY: MODRES LOCATION: (1) OTHER INFORMATION: Dipalmitoyl-Lys NAME/KEY: MOD RES LOCATION: (5) OTHER INFORMATION: Biotinylated-Lys <400 SEQUENCE: 19 Lys Trp Llys Lys Lys Gly 1 5

SEQ ID NO 20 LENGTH 5 TYPE PRT ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Description of Artificial Sequence Thiol-functionalised lipid molecule NAME/KEY: MODRES LOCATION: (1) OTHER INFORMATION: Dipalmitoyl-Lys NAME/KEY: MODRES LOCATION: (4) OTHER INFORMATION: Acp <400 SEQUENCE: 20 Lys Lys Lys Xala Cys 1 5

SEQ ID NO 21 US 6,264,917 B1 187 188

-continued

LENGTH 4 TYPE PRT ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Description of Artificial Sequence: Lipopeptide functionalised with atenolol NAME/KEY: MOD RES LOCATION: (1) OTHER INFORMATION: Dipalmitoyl-Lys NAME/KEY: MODRES LOCATION: (4) OTHER INFORMATION: Lysine with side chain linked via amide bond to atenolol NAME/KEY: MODRES LOCATION: (4) OTHER INFORMATION AMIDATION

<400 SEQUENCE: 21 Lys Lys Lys Lys 1

SEQ ID NO 22 LENGTH 4 TYPE PRT ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Description of Artificial Sequence: Lipopeptide containing folic acid NAME/KEY: MODRES LOCATION: (1) OTHER INFORMATION: Dipalmitoyl-Lys NAME/KEY: MOD RES LOCATION: (4) OTHER INFORMATION AMIDATION NAME/KEY: MODRES LOCATION: (4) OTHER INFORMATION: Lysine with side chain linked via amide bond to folic acid

<400 SEQUENCE: 22 Lys Lys Lys Lys 1

SEQ ID NO 23 LENGTH 4 TYPE PRT ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Description of Artificial Sequence: Lipopeptide containing a derivative of bestatin NAME/KEY: MODRES LOCATION: (1) OTHER INFORMATION: Dipalmitoyl-Lys NAME/KEY: MODRES LOCATION: (4) OTHER INFORMATION AMIDATION NAME/KEY: MOD RES LOCATION: (4) OTHER INFORMATION: Lysine with side chain linked via amide bond to derivative of bestatin

<400 SEQUENCE: 23 Lys Lys Lys Lys 1

SEQ ID NO 24 LENGTH 4 TYPE PRT ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Description of Artificial Sequence: Lipopeptide containing chlorambucil <221 NAME/KEY: MODRES US 6,264,917 B1 189 190

-continued LOCATION: (1) OTHER INFORMATION: Dipalmitoyl-Lys NAME/KEY: MOD RES LOCATION: (4) OTHER INFORMATION AMIDATION NAME/KEY: MODRES LOCATION: (4) OTHER INFORMATION: Lysine with side chain linked via amide bond to chlorambucil

<400 SEQUENCE: 24 Lys Lys Lys Lys 1

SEQ ID NO 25 LENGTH 4 TYPE PRT ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Description of Artificial Sequence: Lipopeptide functionalised with sulfisoxazole NAME/KEY: MODRES LOCATION: (1) OTHER INFORMATION: Dipalmitoyl-Lys NAME/KEY: MODRES LOCATION: (4) OTHER INFORMATION AMIDATION NAME/KEY: MOD RES LOCATION: (4) OTHER INFORMATION: Lysine with side chain linked via amide bond to sulfisoxazole

<400 SEQUENCE: 25 Lys Lys Lys Lys 1.

SEQ ID NO 26 LENGTH 9 TYPE PRT ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Description of Artificial Sequence: Atherosclerotic plaque-binding peptide <400 SEQUENCE: 26 Tyr Arg Ala Lieu Val Asp Thr Lieu Lys 1 5

SEQ ID NO 27 LENGTH 16 TYPE PRT ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Description of Artificial Sequence: Atherosclerotic plaque-binding peptide

<400 SEQUENCE: 27 Tyr Ala Lys Phe Arg Glu Thir Lieu Glu Asp Thr Arg Asp Arg Met Tyr 1 5 10 15

SEQ ID NO 28 LENGTH 17 TYPE PRT ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Description of Artificial Sequence: Atherosclerotic plaque-binding peptide

<400 SEQUENCE: 28 Arg Ala Lieu Val Asp Thr Glu Phe Lys Val Lys Glin Glu Ala Gly Ala US 6,264,917 B1 191 192

-continued

10 15

SEQ ID NO 29 LENGTH 14 TYPE PRT ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Description of Artificial Sequence: Thrombus binding peptide

<400 SEQUENCE: 29 Asn Asp Gly Asp Phe Glu Glu Ile Pro Glu Glu Tyr Lieu Glin 1 5 10

SEQ ID NO 30 LENGTH 4 TYPE PRT ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Description of Artificial Sequence: Thrombus binding peptide

<400 SEQUENCE: 30 Gly Pro Arg Gly 1

SEQ ID NO 31 LENGTH 13 TYPE PRT ORGANISM: Artificial Sequence FEATURE OTHER INFORMATION: Description of Artificial Sequence:Platelet binding peptide

<400 SEQUENCE: 31 Pro Leu Tyr Lys Lys Ile Ile Lys Lys Lieu Lieu Glu Ser 1 5 10

What is claimed is: non-polymerisable wall-forming Surfactant material, a poly 1. A combined formulation comprising: mer Surfactant material or a phospholipid. i) a first administrable composition comprising a tar 6. A combined formulation as claimed in claim 5 wherein getable ultrasound diagnostic agent comprising a Sus 45 at least 75% of the film-forming surfactant material com pension in an aqueous carrier liquid of a reporter prises phospholipid molecules individually bearing net over comprising gas filled microbubbles Stabilised by mono all charge. layers of film forming Surfactant, Said microbubbles further comprising at least one vector which binds a 7. A combined formulation as claimed in claim 6 wherein target, and 50 at least 75% of the film-forming surfactant material com ii) a Second administrable composition comprising a prises one or more phospholipids Selected from the group Substance which displaces or releaseS Said consisting of phosphatidylserines, phosphatidylglycerols, microbubbles from its target. phosphatidylinositols, phosphatidic acids and cardiolipins. 2. A combined formulation as claimed in claim 1 wherein 8. A combined formulation as claimed in claim 7 wherein the gas is air, nitrogen, oxygen, carbon dioxide, hydrogen, an 55 at least 80% of Said phospholipids are phosphatidylserines. inert gas, a Sulphur fluoride, Selenium hexafluoride, a low 9. A combined formulation as claimed in claim 1 wherein molecular weight hydrocarbon, a ketone, an ester, a halo the film-forming Surfactant material comprises a lipopep genated low molecular weight hydrocarbon or a mixture of tide. any of the foregoing. 10. A combined formulation as claimed in claim 1 3. A combined formulation as claimed in claim 2 wherein 60 wherein the vector is Selected from the group consisting of the gas is a perfluorinated ketone, a perfluorinated ether or antibodies, cell adhesion molecules, cell adhesion molecule a perfluorocarbon. receptors, cytokines, growth factors, peptide hormones, 4. A combined formulation as claimed in claim 2 wherein non-peptide agonists/antagonists and non-bioactive binders the gas is Sulphur hexafluoride or a perfluoropropane, a of receptors for cell adhesion molecules, cytokines, growth perfluorobutane or a perfluoropentane. 65 factors and peptide hormones, oligonucleotides, DNA 5. A combined formulation as claimed in claim 1 wherein binding drugs, protease Substrates/inhibitors, and Small bio the film-forming Surfactant material is a non-polymeric and active molecules. US 6,264,917 B1 193 194 11. A combined formulation as claimed in claim 1 wherein 15. A combined formulation as claimed in claim 1 the vector or vectors have affinity for targets at a level Such wherein the Vector is coupled or linked to the reporter that the agent interacts with but does not fixedly bind to said through electroStatic charge interactions. targets. 16. A combined formulation as claimed in claim 1 12. A combined formulation as claimed in claim 11 wherein the vector is coupled or linked to the reporter by wherein the Vector or vectors are Selected from the group means of avidin-biotin and/or Streptavidin-biotin interac consisting of ligands for cell adhesion proteins and cell tions. adhesion proteins which have corresponding ligands on 17. A method to determine a perfusion rate in a targeted endothelial cell Surfaces. area which method comprises administering the combined 13. A combined formulation as claimed in claim 1 formulation of claim 1 to a targeted area and measuring the wherein the Vector or vectors are sited Such that they are not rate at which the agent of the first composition is displaced readily exposed to the target. or released from the targeted area after the administration of 14. A combined formulation as claimed in claim 1 the Second composition using ultrasound imaging. wherein the vector is covalently coupled or linked to the reporter. k k k k k