Regulation of Mtorc1 by Upstream Stimuli
Total Page:16
File Type:pdf, Size:1020Kb
Load more
										Recommended publications
									
								- 
												
												Regulation of Dishevelled DEP Domain Swapping by Conserved Phosphorylation Sites
Regulation of Dishevelled DEP domain swapping by conserved phosphorylation sites Gonzalo J. Beitiaa,1, Trevor J. Rutherforda,1, Stefan M. V. Freunda, Hugh R. Pelhama, Mariann Bienza, and Melissa V. Gammonsa,2 aMedical Research Council Laboratory of Molecular Biology, Cambridge Biomedical Campus, Cambridge, CB2 0QH, United Kingdom Edited by Roeland Nusse, Stanford University School of Medicine, Stanford, CA, and approved May 13, 2021 (received for review February 20, 2021) Wnt signals bind to Frizzled receptors to trigger canonical and with these effectors even if present at a low cellular concentra- noncanonical signaling responses that control cell fates during tion (1, 3, 12). animal development and tissue homeostasis. All Wnt signals are The DEP domain is a small globular domain composed of three relayed by the hub protein Dishevelled. During canonical (β-catenin– α-helices and a flexible hinge loop between the first (H1) and sec- dependent) signaling, Dishevelled assembles signalosomes via dy- ond helix (H2), which, in the monomeric configuration, folds back namic head-to-tail polymerization of its Dishevelled and Axin (DIX) on itself to form a prominent “DEP finger” that is responsible domain, which are cross-linked by its Dishevelled, Egl-10, and Pleck- for binding to Frizzled (Fig. 1A) (13). DEP dimerization involves strin (DEP) domain through a conformational switch from monomer a highly unusual mechanism called “domain swapping” (14). During to domain-swapped dimer. The domain-swapped conformation of this process, H1 of one DEP monomer is exchanged with H1 from a DEP masks the site through which Dishevelled binds to Frizzled, im- reciprocal one through outward motions of the hinge loops, replacing plying that DEP domain swapping results in the detachment of Dish- intra- with intermolecular contacts. - 
												
												Hidden Targets in RAF Signalling Pathways to Block Oncogenic RAS Signalling
G C A T T A C G G C A T genes Review Hidden Targets in RAF Signalling Pathways to Block Oncogenic RAS Signalling Aoife A. Nolan 1, Nourhan K. Aboud 1, Walter Kolch 1,2,* and David Matallanas 1,* 1 Systems Biology Ireland, School of Medicine, University College Dublin, Belfield, Dublin 4, Ireland; [email protected] (A.A.N.); [email protected] (N.K.A.) 2 Conway Institute of Biomolecular & Biomedical Research, University College Dublin, Belfield, Dublin 4, Ireland * Correspondence: [email protected] (W.K.); [email protected] (D.M.) Abstract: Oncogenic RAS (Rat sarcoma) mutations drive more than half of human cancers, and RAS inhibition is the holy grail of oncology. Thirty years of relentless efforts and harsh disappointments have taught us about the intricacies of oncogenic RAS signalling that allow us to now get a pharma- cological grip on this elusive protein. The inhibition of effector pathways, such as the RAF-MEK-ERK pathway, has largely proven disappointing. Thus far, most of these efforts were aimed at blocking the activation of ERK. Here, we discuss RAF-dependent pathways that are regulated through RAF functions independent of catalytic activity and their potential role as targets to block oncogenic RAS signalling. We focus on the now well documented roles of RAF kinase-independent functions in apoptosis, cell cycle progression and cell migration. Keywords: RAF kinase-independent; RAS; MST2; ASK; PLK; RHO-α; apoptosis; cell cycle; cancer therapy Citation: Nolan, A.A.; Aboud, N.K.; Kolch, W.; Matallanas, D. Hidden Targets in RAF Signalling Pathways to Block Oncogenic RAS Signalling. - 
												
												Viewed Under 23 (B) Or 203 (C) fi M M Male Cko Mice, and Largely Unaffected Magni Cation; Scale Bars, 500 M (B) and 50 M (C)
BRIEF COMMUNICATION www.jasn.org Renal Fanconi Syndrome and Hypophosphatemic Rickets in the Absence of Xenotropic and Polytropic Retroviral Receptor in the Nephron Camille Ansermet,* Matthias B. Moor,* Gabriel Centeno,* Muriel Auberson,* † † ‡ Dorothy Zhang Hu, Roland Baron, Svetlana Nikolaeva,* Barbara Haenzi,* | Natalya Katanaeva,* Ivan Gautschi,* Vladimir Katanaev,*§ Samuel Rotman, Robert Koesters,¶ †† Laurent Schild,* Sylvain Pradervand,** Olivier Bonny,* and Dmitri Firsov* BRIEF COMMUNICATION *Department of Pharmacology and Toxicology and **Genomic Technologies Facility, University of Lausanne, Lausanne, Switzerland; †Department of Oral Medicine, Infection, and Immunity, Harvard School of Dental Medicine, Boston, Massachusetts; ‡Institute of Evolutionary Physiology and Biochemistry, St. Petersburg, Russia; §School of Biomedicine, Far Eastern Federal University, Vladivostok, Russia; |Services of Pathology and ††Nephrology, Department of Medicine, University Hospital of Lausanne, Lausanne, Switzerland; and ¶Université Pierre et Marie Curie, Paris, France ABSTRACT Tight control of extracellular and intracellular inorganic phosphate (Pi) levels is crit- leaves.4 Most recently, Legati et al. have ical to most biochemical and physiologic processes. Urinary Pi is freely filtered at the shown an association between genetic kidney glomerulus and is reabsorbed in the renal tubule by the action of the apical polymorphisms in Xpr1 and primary fa- sodium-dependent phosphate transporters, NaPi-IIa/NaPi-IIc/Pit2. However, the milial brain calcification disorder.5 How- molecular identity of the protein(s) participating in the basolateral Pi efflux remains ever, the role of XPR1 in the maintenance unknown. Evidence has suggested that xenotropic and polytropic retroviral recep- of Pi homeostasis remains unknown. Here, tor 1 (XPR1) might be involved in this process. Here, we show that conditional in- we addressed this issue in mice deficient for activation of Xpr1 in the renal tubule in mice resulted in impaired renal Pi Xpr1 in the nephron. - 
												
												Supplementary Data
Supplemental Data A novel mouse model of X-linked nephrogenic diabetes insipidus: Phenotypic analysis and therapeutic implications Jian Hua Li, Chung-Lin Chou, Bo Li, Oksana Gavrilova, Christoph Eisner, Jürgen Schnermann, Stasia A. Anderson, Chu-Xia Deng, Mark A. Knepper, and Jürgen Wess Supplemental Methods Metabolic cage studies. Animals were maintained in mouse metabolic cages (Hatteras Instruments, Cary, NC) under controlled temperature and light conditions (12 hr light and dark cycles). Mice received a fixed daily ration of 6.5 g of gelled diet per 20 g of body weight per day. The gelled diet was composed of 4 g of Basal Diet 5755 (Test Diet, Richmond, IN), 2.5 ml of deionized water, and 65 mg agar. Preweighted drinking water was provided ad libitum during the course of the study. Mice were acclimated in the metabolic cages for 1-2 days. Urine was collected under mineral oil in preweighted collection vials for successive 24 hr periods. Analysis of GPCR expression in mouse IMCD cells via TaqMan real-time qRT-PCR. Total RNA prepared from mouse IMCD tubule suspensions was reverse transcribed as described under Experimental Procedures. Tissues from ten 10-week old C57BL/6 WT mice were collected and pooled for each individual experiment. cDNA derived from 640 ng of RNA was mixed with an equal volume of TaqMan gene expression 2 x master mix (Applied Biosystems, Foster City, CA). 100 μl-aliquots of this mixture (corresponding to 80 ng of RNA) were added to each of the 8 fill ports of a 384-well plate of a mouse GPCR array panel (Applied Biosystems). - 
												
												Function of Deptor and Its Roles in Hematological Malignancies
www.aging-us.com AGING 2021, Vol. 13, No. 1 Review Function of Deptor and its roles in hematological malignancies Mario Morales-Martinez1, Alan Lichtenstein2, Mario I. Vega1,2 1Molecular Signal Pathway in Cancer Laboratory, UIMEO, Oncology Hospital, Siglo XXI National Medical Center, IMSS, México, México 2Department of Medicine, Hematology-Oncology Division, Greater Los Angeles VA Healthcare Center, UCLA Medical Center, Jonsson Comprehensive Cancer Center, Los Angeles, CA 90024, USA Correspondence to: Mario I. Vega; email: [email protected] Keywords: Deptor, Multiple Myeloma, leukemia, Non-Hodgkin Lymphoma, hematological malignances Received: November 6, 2020 Accepted: December 10, 2020 Published: January 7, 2020 Copyright: © 2020 Morales-Martinez et al. This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 3.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. ABSTRACT Deptor is a protein that interacts with mTOR and that belongs to the mTORC1 and mTORC2 complexes. Deptor is capable of inhibiting the kinase activity of mTOR. It is well known that the mTOR pathway is involved in various signaling pathways that are involved with various biological processes such as cell growth, apoptosis, autophagy, and the ER stress response. Therefore, Deptor, being a natural inhibitor of mTOR, has become very important in its study. Because of this, it is important to research its role regarding the development and progression of human malignancies, especially in hematologic malignancies. Due to its variation in expression in cancer, it has been suggested that Deptor can act as an oncogene or tumor suppressor depending on the cellular or tissue context. - 
												
												Supplementary Information Material and Methods
MCT-11-0474 BKM120: a potent and specific pan-PI3K inhibitor Supplementary Information Material and methods Chemicals The EGFR inhibitor NVP-AEE788 (Novartis), the Jak inhibitor I (Merck Calbiochem, #420099) and anisomycin (Alomone labs, # A-520) were prepared as 50 mM stock solutions in 100% DMSO. Doxorubicin (Adriablastin, Pfizer), EGF (Sigma Ref: E9644), PDGF (Sigma, Ref: P4306) and IL-4 (Sigma, Ref: I-4269) stock solutions were prepared as recommended by the manufacturer. For in vivo administration: Temodal (20 mg Temozolomide capsules, Essex Chemie AG, Luzern) was dissolved in 4 mL KZI/glucose (20/80, vol/vol); Taxotere was bought as 40 mg/mL solution (Sanofi Aventis, France), and prepared in KZI/glucose. Antibodies The primary antibodies used were as follows: anti-S473P-Akt (#9271), anti-T308P-Akt (#9276,), anti-S9P-GSK3β (#9336), anti-T389P-p70S6K (#9205), anti-YP/TP-Erk1/2 (#9101), anti-YP/TP-p38 (#9215), anti-YP/TP-JNK1/2 (#9101), anti-Y751P-PDGFR (#3161), anti- p21Cip1/Waf1 (#2946), anti-p27Kip1 (#2552) and anti-Ser15-p53 (#9284) antibodies were from Cell Signaling Technologies; anti-Akt (#05-591), anti-T32P-FKHRL1 (#06-952) and anti- PDGFR (#06-495) antibodies were from Upstate; anti-IGF-1R (#SC-713) and anti-EGFR (#SC-03) antibodies were from Santa Cruz; anti-GSK3α/β (#44610), anti-Y641P-Stat6 (#611566), anti-S1981P-ATM (#200-301), anti-T2609 DNA-PKcs (#GTX24194) and anti- 1 MCT-11-0474 BKM120: a potent and specific pan-PI3K inhibitor Y1316P-IGF-1R were from Bio-Source International, Becton-Dickinson, Rockland, GenTex and internal production, respectively. The 4G10 antibody was from Millipore (#05-321MG). - 
												
												Panoply™ Human NPR3 Over-Expressing Stable Cell Line
Panoply™ Human NPR3 Over-expressing Stable Cell Line HEK293-NPR3 Lot. No. (See product label) CELL LINE INFORMATION Cat.No. CSC-SC010567 Cell Line Description HEK293-NPR3 cell line is clonally derived from HEK293 cell line, which has been transduced with a lentiviral vector encoding: 1) full length human NPR3 under the CMV promoter, and 2) puromycin resistance gene under the control of PGK promoter. Overexpression of human NPR3 has been quantified by qPCR. Background NPR3 (natriuretic peptide receptor 3) is an atrial natriuretic peptide receptor that in humans is encoded by the NPR3 gene. This protein is one of three natriuretic peptide receptors. It is responsible for clearing circulating and extracellular natriuretic peptides through endocytosis of the receptor. Natriutetic peptides are small peptides which regulate blood volume and pressure, pulmonary hypertension, and cardiac function as well as some metabolic and growth processes. Host Cell HEK293 Gene Information Gene Name Natriuretic peptide receptor 3 Official Symbol NPR3 Species Homo sapiens (human) GeneID 4883 mRNA Reference NM_000908.3 Protein Reference NP_000899.1 Synonyms NPRC; ANP-C; ANPRC; NPR-C; ANPR-C; GUCY2B; C5orf23 SAFETY AND PACKAGING Mycoplasma Mycoplasma Status: Negative (MycoAlert Kit) Format One frozen vial Storage Liquid nitrogen Safety Considerations The following safety precautions should be observed. 1. Use pipette aids to prevent ingestion and keep aerosols down to a minimum. 2. No eating, drinking or smoking while handling the stable line. 3. Wash hands after handling the stable line and before leaving the lab. 4. Decontaminate work surface with disinfectant or 70% ethanol before and after working with stable cells. - 
												
												Identification and Characterization of RHOA-Interacting Proteins in Bovine Spermatozoa1
BIOLOGY OF REPRODUCTION 78, 184–192 (2008) Published online before print 10 October 2007. DOI 10.1095/biolreprod.107.062943 Identification and Characterization of RHOA-Interacting Proteins in Bovine Spermatozoa1 Sarah E. Fiedler, Malini Bajpai, and Daniel W. Carr2 Department of Medicine, Oregon Health & Sciences University and Veterans Affairs Medical Center, Portland, Oregon 97239 ABSTRACT Guanine nucleotide exchange factors (GEFs) catalyze the GDP for GTP exchange [2]. Activation is negatively regulated by In somatic cells, RHOA mediates actin dynamics through a both guanine nucleotide dissociation inhibitors (RHO GDIs) GNA13-mediated signaling cascade involving RHO kinase and GTPase-activating proteins (GAPs) [1, 2]. Endogenous (ROCK), LIM kinase (LIMK), and cofilin. RHOA can be RHO can be inactivated via C3 exoenzyme ADP-ribosylation, negatively regulated by protein kinase A (PRKA), and it and studies have demonstrated RHO involvement in actin-based interacts with members of the A-kinase anchoring (AKAP) cytoskeletal response to extracellular signals, including lyso- family via intermediary proteins. In spermatozoa, actin poly- merization precedes the acrosome reaction, which is necessary phosphatidic acid (LPA) [2–4]. LPA is known to signal through for normal fertility. The present study was undertaken to G-protein-coupled receptors (GPCRs) [4, 5]; specifically, LPA- determine whether the GNA13-mediated RHOA signaling activated GNA13 (formerly Ga13) promotes RHO activation pathway may be involved in acrosome reaction in bovine through GEFs [4, 6]. Activated RHO-GTP then signals RHO caudal sperm, and whether AKAPs may be involved in its kinase (ROCK), resulting in the phosphorylation and activation targeting and regulation. GNA13, RHOA, ROCK2, LIMK2, and of LIM-kinase (LIMK), which in turn phosphorylates and cofilin were all detected by Western blot in bovine caudal inactivates cofilin, an actin depolymerizer, the end result being sperm. - 
												
												Establishment and Genomic Characterization of a Sporadic Malignant Peripheral Nerve Sheath Tumor Cell Line Jody Fromm Longo1, Stephanie N
www.nature.com/scientificreports OPEN Establishment and genomic characterization of a sporadic malignant peripheral nerve sheath tumor cell line Jody Fromm Longo1, Stephanie N. Brosius3,5,7, Iya Znoyko1, Victoria A. Alers1, Dorea P. Jenkins1, Robert C. Wilson1,2, Andrew J. Carroll4, Daynna J. Wolf1, Kevin A. Roth6 & Steven L. Carroll1,2,3* Malignant peripheral nerve sheath tumors (MPNSTs) are aggressive Schwann cell-derived neoplasms that occur sporadically or in patients with neurofbromatosis type 1 (NF1). Preclinical research on sporadic MPNSTs has been limited as few cell lines exist. We generated and characterized a new sporadic MPNST cell line, 2XSB, which shares the molecular and genomic features of the parent tumor. These cells have a highly complex karyotype with extensive chromothripsis. 2XSB cells show robust invasive 3-dimensional and clonogenic culture capability and form solid tumors when xenografted into immunodefcient mice. High-density single nucleotide polymorphism array and whole exome sequencing analyses indicate that, unlike NF1-associated MPNSTs, 2XSB cells have intact, functional NF1 alleles with no evidence of mutations in genes encoding components of Polycomb Repressor Complex 2. However, mutations in other genes implicated in MPNST pathogenesis were identifed in 2XSB cells including homozygous deletion of CDKN2A and mutations in TP53 and PTEN. We also identifed mutations in genes not previously associated with MPNSTs but associated with the pathogenesis of other human cancers. These include DNMT1, NUMA1, NTRK1, PDE11A, CSMD3, LRP5 and ACTL9. This sporadic MPNST-derived cell line provides a useful tool for investigating the biology and potential treatment regimens for sporadic MPNSTs. Malignant peripheral nerve sheath tumors (MPNSTs) are aggressive neoplasms derived from the Schwann cell lineage1,2. - 
												
												Glycogen Synthase Kinase-3 Is Activated in Neuronal Cells by G 12
The Journal of Neuroscience, August 15, 2002, 22(16):6863–6875 Glycogen Synthase Kinase-3 Is Activated in Neuronal Cells by G␣ ␣ 12 and G 13 by Rho-Independent and Rho-Dependent Mechanisms C. Laura Sayas, Jesu´ s Avila, and Francisco Wandosell Centro de Biologı´a Molecular “Severo Ochoa”, Consejo Superior de Investigaciones Cientı´ficas, Universidad Auto´ noma de Madrid, Cantoblanco, Madrid 28049, Spain ␣ ␣ ␣ ␣ Glycogen synthase kinase-3 (GSK-3) was generally considered tively active G 12 (G 12QL) and G 13 (G 13QL) in Neuro2a cells a constitutively active enzyme, only regulated by inhibition. induces upregulation of GSK-3 activity. Furthermore, overex- Here we describe that GSK-3 is activated by lysophosphatidic pression of constitutively active RhoA (RhoAV14) also activates ␣ acid (LPA) during neurite retraction in rat cerebellar granule GSK-3 However, the activation of GSK-3 by G 13 is blocked by neurons. GSK-3 activation correlates with an increase in GSK-3 coexpression with C3 transferase, whereas C3 does not block ␣ tyrosine phosphorylation. In addition, LPA induces a GSK-3- GSK-3 activation by G 12. Thus, we demonstrate that GSK-3 is ␣ ␣ mediated hyperphosphorylation of the microtubule-associated activated by both G 12 and G 13 in neuronal cells. However, ␣ protein tau. Inhibition of GSK-3 by lithium partially blocks neu- GSK-3 activation by G 13 is Rho-mediated, whereas GSK-3 ␣ rite retraction, indicating that GSK-3 activation is important but activation by G 12 is Rho-independent. The results presented not essential for the neurite retraction progress. GSK-3 activa- here imply the existence of a previously unknown mechanism of ␣ tion by LPA in cerebellar granule neurons is neither downstream GSK-3 activation by G 12/13 subunits. - 
												
												G-Protein-Coupled Receptor Signaling and Polarized Actin Dynamics Drive
RESEARCH ARTICLE elifesciences.org G-protein-coupled receptor signaling and polarized actin dynamics drive cell-in-cell invasion Vladimir Purvanov, Manuel Holst, Jameel Khan, Christian Baarlink, Robert Grosse* Institute of Pharmacology, University of Marburg, Marburg, Germany Abstract Homotypic or entotic cell-in-cell invasion is an integrin-independent process observed in carcinoma cells exposed during conditions of low adhesion such as in exudates of malignant disease. Although active cell-in-cell invasion depends on RhoA and actin, the precise mechanism as well as the underlying actin structures and assembly factors driving the process are unknown. Furthermore, whether specific cell surface receptors trigger entotic invasion in a signal-dependent fashion has not been investigated. In this study, we identify the G-protein-coupled LPA receptor 2 (LPAR2) as a signal transducer specifically required for the actively invading cell during entosis. We find that 12/13G and PDZ-RhoGEF are required for entotic invasion, which is driven by blebbing and a uropod-like actin structure at the rear of the invading cell. Finally, we provide evidence for an involvement of the RhoA-regulated formin Dia1 for entosis downstream of LPAR2. Thus, we delineate a signaling process that regulates actin dynamics during cell-in-cell invasion. DOI: 10.7554/eLife.02786.001 Introduction Entosis has been described as a specialized form of homotypic cell-in-cell invasion in which one cell actively crawls into another (Overholtzer et al., 2007). Frequently, this occurs between tumor cells such as breast, cervical, or colon carcinoma cells and can be triggered by matrix detachment (Overholtzer et al., 2007), suggesting that loss of integrin-mediated adhesion may promote cell-in-cell invasion. - 
												
												Table S1. List of Oligonucleotide Primers Used
Table S1. List of oligonucleotide primers used. Cla4 LF-5' GTAGGATCCGCTCTGTCAAGCCTCCGACC M629Arev CCTCCCTCCATGTACTCcgcGATGACCCAgAGCTCGTTG M629Afwd CAACGAGCTcTGGGTCATCgcgGAGTACATGGAGGGAGG LF-3' GTAGGCCATCTAGGCCGCAATCTCGTCAAGTAAAGTCG RF-5' GTAGGCCTGAGTGGCCCGAGATTGCAACGTGTAACC RF-3' GTAGGATCCCGTACGCTGCGATCGCTTGC Ukc1 LF-5' GCAATATTATGTCTACTTTGAGCG M398Arev CCGCCGGGCAAgAAtTCcgcGAGAAGGTACAGATACGc M398Afwd gCGTATCTGTACCTTCTCgcgGAaTTcTTGCCCGGCGG LF-3' GAGGCCATCTAGGCCATTTACGATGGCAGACAAAGG RF-5' GTGGCCTGAGTGGCCATTGGTTTGGGCGAATGGC RF-3' GCAATATTCGTACGTCAACAGCGCG Nrc2 LF-5' GCAATATTTCGAAAAGGGTCGTTCC M454Grev GCCACCCATGCAGTAcTCgccGCAGAGGTAGAGGTAATC M454Gfwd GATTACCTCTACCTCTGCggcGAgTACTGCATGGGTGGC LF-3' GAGGCCATCTAGGCCGACGAGTGAAGCTTTCGAGCG RF-5' GAGGCCTGAGTGGCCTAAGCATCTTGGCTTCTGC RF-3' GCAATATTCGGTCAACGCTTTTCAGATACC Ipl1 LF-5' GTCAATATTCTACTTTGTGAAGACGCTGC M629Arev GCTCCCCACGACCAGCgAATTCGATagcGAGGAAGACTCGGCCCTCATC M629Afwd GATGAGGGCCGAGTCTTCCTCgctATCGAATTcGCTGGTCGTGGGGAGC LF-3' TGAGGCCATCTAGGCCGGTGCCTTAGATTCCGTATAGC RF-5' CATGGCCTGAGTGGCCGATTCTTCTTCTGTCATCGAC RF-3' GACAATATTGCTGACCTTGTCTACTTGG Ire1 LF-5' GCAATATTAAAGCACAACTCAACGC D1014Arev CCGTAGCCAAGCACCTCGgCCGAtATcGTGAGCGAAG D1014Afwd CTTCGCTCACgATaTCGGcCGAGGTGCTTGGCTACGG LF-3' GAGGCCATCTAGGCCAACTGGGCAAAGGAGATGGA RF-5' GAGGCCTGAGTGGCCGTGCGCCTGTGTATCTCTTTG RF-3' GCAATATTGGCCATCTGAGGGCTGAC Kin28 LF-5' GACAATATTCATCTTTCACCCTTCCAAAG L94Arev TGATGAGTGCTTCTAGATTGGTGTCggcGAAcTCgAGCACCAGGTTG L94Afwd CAACCTGGTGCTcGAgTTCgccGACACCAATCTAGAAGCACTCATCA LF-3' TGAGGCCATCTAGGCCCACAGAGATCCGCTTTAATGC RF-5' CATGGCCTGAGTGGCCAGGGCTAGTACGACCTCG