DOCSLIB.ORG

Natural England Commissioned Report NECR009

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Natural England Commissioned Report NECR009 Natural England Commissioned Report NECR009 Horizon scanning for new invasive non-native animal species in England First published 22 May 2009 www.naturalengland.org.uk Introduction Natural England commission a range of reports from external contractors to provide evidence and advice to assist us in delivering our duties. The views in this report are those of the authors and do not necessarily represent those of Natural England. Background Invasive non-native species (INNS) are For the purposes of this report non-native recognised as one of the main causes of global species refers to a species introduced by human biodiversity loss and current evidence action outside its natural past or present demonstrates that this is a problem which is distribution. An invasive non-native species is a increasing. Consequently there are a large non-native species whose introduction and or number of agreements, conventions, legislation spread threatens biodiversity. and strategies pertaining to INNS. It is important for Natural England: In May 2008 the GB Strategy for invasive non- native species was launched. One of the key To be informed of potential new invasive non- areas of work identified was the prevention and native species. rapid action for newly arriving, or newly invasive To understand the challenges that new non-native species. invasive non-native species may bring. To consider appropriate responses to such Recognising which species will become invasive species. is notoriously difficult. The best predictor is the invasiveness elsewhere. To assist in the The purpose of this report is to help Natural prioritisation and targeting of prevention work, England: Natural England sought a horizon scanning exercise to pick out non-native species that are As the lead delivery body for the England most likely to become invasive in England in the Biodiversity Strategy develop a view on future. potential new invasive non-native species in England and their impacts to biodiversity. The aim of the report was to produce a list of Implement its invasive non-native species potential new invasive non-native animal policy. species in England using existing information on INNS. These might be species which are Further contribute towards the implementation already here but aren’t established or species of the Invasive Non-native Species Framework which are yet to arrive. It is envisaged that such Strategy for Great Britain. a report will stimulate debate and help inform the targeting of resources. Natural England Project Managers - Ben McCarthy & Dr Ruth Waters, Natural England, Bullring House, Northgate, Wakefield WF1 3BJ Contractor - Dr Dave Parrott (Consortium Leader), Food & Environment Research Agency, Sand Hutton, York, YO41 1LZ in association with CEH, Cefas, Bournemouth University and Imperial College London Keywords - invasive non-native species, horizon scanning, new invasive species Further information This report can be downloaded from the Natural England website: www.naturalengland.org.uk. For information on Natural England publications contact the Natural England Enquiry Service on 0845 600 3078 or e-mail [email protected] You may reproduce as many individual copies of this report as you like, provided such copies stipulate that copyright remains with Natural England, 1 East Parade, Sheffield, S1 2ET ISSN 2040-5545 © Copyright Natural England 2009 HORIZON SCANNING FOR NEW INVASIVE NON-NATIVE ANIMAL SPECIES IN ENGLAND Natural England Contract No. SAE03-02-189 May 2009 Horizon scanning for new invasive non-native animal species in England Horizon scanning for new invasive non-native animal species in England HORIZON SCANNING FOR NEW INVASIVE NON-NATIVE ANIMAL SPECIES IN ENGLAND Natural England Contract No. SAE03-02-189 Dr. Dave Parrott, Dr. Sugoto Roy Wildlife Management & Ecology Group Dr. Richard Baker, Dr. Ray Cannon, Mr. Dominic Eyre Plant Health Group Central Science Laboratory Dr. Mark Hill, Dr Markus Wagner, Dr Chris Preston, Dr. Helen Roy & Mr. Björn Beckmann Centre for Ecology & Hydrology (CEH) Prof. Gordon H. Copp, Mr. Nathan Edmonds, Dr. Jim Ellis & Mr. Ian Laing Centre for Environment, Fisheries & Aquaculture Science (Cefas) Dr. J. Robert Britton & Prof. Rodolphe E. Gozlan Bournemouth University Prof. John Mumford Imperial College London Horizon scanning for new invasive non-native animal species in England Horizon scanning for new invasive non-native animal species in England Contents Page 1. Executive Summary ................................................................................................... 1 2. Background ................................................................................................................ 4 3. Aims and objectives ................................................................................................... 5 4. Methodology .............................................................................................................. 5 4.1 Review of existing INNS information – species lists .......................................... 5 4.2 Assessment of species risk priority ...................................................................... 7 4.3 Species information sheets ................................................................................. 11 4.4 Risk assessment summary spreadsheet .............................................................. 12 5. Results and discussion ............................................................................................. 13 5.1 Species risk categorisation ................................................................................. 13 5.2 Mammals............................................................................................................ 13 5.3 Birds ................................................................................................................... 15 5.4 Amphibians and Reptiles ................................................................................... 17 5.5 Terrestrial invertebrates ..................................................................................... 19 5.6 Fish ..................................................................................................................... 21 5.7 Freshwater invertebrates .................................................................................... 24 5.8 Marine invertebrates .......................................................................................... 25 5.9 Species information sheets ................................................................................. 26 5.10 Summary spreadsheets ..................................................................................... 26 6. Conclusions .............................................................................................................. 26 7. Bibliography ............................................................................................................ 28 Appendix I: Species information sheets ...................................................................... 40 Appendix II: Risk assessment summary spreadsheets ............................................... 103 Horizon scanning for new invasive non-native animal species in England 1. EXECUTIVE SUMMARY . This report identifies potential new invasive non-native animal species in England and assesses the relative risk posed by each species. The analysis was carried out to identify new and emerging threats, and so it does not consider non-native species that have already become invasive in England. Invasive non-native species constitute one of the leading threats to natural ecosystems and biodiversity, through consumption, resource competition, introduction of diseases, interbreeding and disturbance. The guiding principles adopted by the Convention on Biological Diversity (CBD) toward the management of invasive non-native species follows a hierarchical process: prevention, eradication, containment and control and mitigation; with an emphasis on preventive measures. Central to an approach of prevention and rapid, targeted action is the identification of those non-native species that are likely to become newly invasive in England; across all taxonomic groups this constitutes a significant number of species. A number of non-native risk assessment schemes are available but which are too detailed and labour-intensive for the rapid evaluation of large numbers of species. In this study, a relatively rapid screening process was used to produce a list of potential new invasive non-native species in England, and to assess their relative risks; covering terrestrial, freshwater and marine environments. Potential new non-native species fall into two categories: (i) species already present in England but which are currently either not widely established or not acting invasively in the wild, (ii) species that have not entered the country yet but are reasonably likely to do so. A list of vertebrate and invertebrate species meeting one or other of these criteria was collated from a number of sources that included non-native species databases, reference literature and expert opinion. The prioritisation process used to evaluate the environmental risk of these species was adapted from an existing protocol developed by the Belgian Forum on Invasive Species; which assigns species to a list system designed as a two- dimensional ordination - environmental impact x invasion stage. Environmental impact was categorised as high, medium or low; invasion stage was categorised
Load more

Recommended publications
  • Applications of Machine Learning in Common Agricultural Policy at the Rural Payments Agency
    Applications of Machine Learning in Common Agricultural Policy at the Rural Payments Agency Sanjay Rana Senior GIS Analyst GI Technical Team Reading 1 What are you gonna find out? • Knowing me and RPA (and knowing you - aha ?!) • How are we using Machine Learning at the RPA? – Current Activities – Random Forest for Making Crop Map of England – Work in Progress Activities – Deep Learning for Crop Map of England, Land Cover Segmentation, and locating Radio Frequency Interference • I will cover more on applications of Machine Learning for RPA operations, and less about technical solutions. 2 My resume so far… Geology GIS GeoComputation Academics Researcher & Radio DJ Consultant Civil Servant Lecturer Profession 3 Rural Payments Agency Rural Payments Agency (RPA) is the Defra agency responsible for the distribution of subsidies to farmers and landowners in England under all the EU's Common Agricultural Policy (CAP) schemes. 4 Area Based Payments/Subsidies Claim Claim Validation Visual Checks Machine Learning Control Helpline 5 A bit more info on Controls • To calculate correct CAP payments, the RPA Land Parcel Information System (LPIS) is constantly being updated with information from customers, OS MasterMap, Aerial Photographs and Satellite Images. • But, in addition as per EU regulations, claims from approximately 5% of customers must be controlled (i.e. checked) annually. Failure to make correct payments lead to large penalties for Member States. France had a disallowance of 1 billion euro for mismanaging CAP funds during 2009- 2013. • Controls/Checks are done either through regular Field Inspections (20%), or Remotely with Very High Resolution Satellite Images (80%) for specific areas* to ascertain farmer declaration of agricultural (e.g.
    [Show full text]
  • Mechanoreceptors in Early Developmental Stages of the Pycnogonida
    UACE2019 - Conference Proceedings Mechanoreceptors in Early Developmental Stages of the Pycnogonida John A. Fornshell * a a U.S. National Museum of Natural History Department of Invertebrate Zoology Smithsonian Institution Washington, D.C. USA *Correspondence: [email protected]; Tel. (571) 426-2398 ABSTRACT Members of the phylum Arthropoda detect fluid flow and sound/particle vibrations using sensory organs called sensilla. These sensilla detect sound/particle vibrations in the boundary layer. In the present study, archived specimens from the United States National Museum of Natural History were examined in an effort to extend our knowledge of the presence of sensilla on the early post hatching developmental stages, first and second instars, of pycnogonids. In the work presented here we look at three families, four genera and ten species of early post hatching developmental stages of sea spiders. They are Family Ammotheidae, Achelia cuneatis Child, 1999, Ammothea allopodes Fry and Hedgpeth, 1969, Ammothea carolinensis Leach 1814, Ammothea clausi Pfeffer, 1889, Ammothea striata (Möbius, 1902), Family Nymphonidae, Nymphon grossipes (Fabricius, 1780), N. australe Hodgson, 1902, N. charcoti Bouvier, 1911, N. Tenellum (Sars, 1888) and Pycnogonidae, Pentapycnon charcoti Bouvier, 1910. Electron micrograph images of these species were used to identify and describe the sensilla present. Most body organs such as mouthparts, the eye tubercle, appendages and spines are proportionally much smaller in the early post hatching developmental stages compared to their size in the adults, while the sensilla are comparable in size and shape to those found on the adults. In the first instar of Pentapycnon charcoti sensilla are present, but not in the adult.
    [Show full text]
  • First Detection of Pine Wood Nematode Vector, Monochamus Sutor Sutor (Linnaeus, 1758) in Lebanon (Coleoptera, Cerambycidae, Lamiinae)
    Bulletin de la Société entomologique de France, 121 (4), 2016 : 455-460. First detection of Pine Wood Nematode Vector, Monochamus sutor sutor (Linnaeus, 1758) in Lebanon (Coleoptera, Cerambycidae, Lamiinae) by Zinette MOUSSA1, Christian COCQUEMPOT2 & Dany YAMMOUNI1 1 Laboratory of Entomology − Lebanese Agricultural Research Institute, Fanar, Lebanon <[email protected]> <[email protected]> 2 INRA, UMR CBGP, Campus International de Baillarguet, F − 34988 Montferrier-sur-Lez cedex, France <[email protected]> Abstract. − An adult of Monochamus (Monochamus) sutor sutor (Linnaeus, 1758) has been found alive in Lebanon in 2014. This potential vector of the phytoparasitic pine nematodes Bursaphelenchus spp., the causal agents of pine wilt disease, is a serious threat to Lebanese forest. The circumstances of the discovery are given, followed by information about the genera Monochamus and Bursaphelenchus applied to Lebanon. An evaluation of the risk for forests of Lebanon is specified. Résumé. − Premier signalement du vecteur du Nématode du Pin, Monochamus sutor sutor (Linnaeus, 1758) au Liban (Coleoptera, Cerambycidae, Lamiinae). Un adulte de Monochamus (Monochamus) sutor sutor (Linnaeus, 1758) vivant a été découvert au Liban en 2014. Ce vecteur potentiel des Nématodes phytoparasites Bursaphe lenchus spp., agents du dépérissement des Conifères, représente une menace sérieuse pour la forêt libanaise. Les circonstances de la découverte sont données et suivies des informations sur les genres Monochamus et Bursaphelenchus appliquées au Liban. Une évaluation du risque encouru par les forêts du Liban est précisée. Keywords. − Bursaphelenchus spp., Pine wilt disease, Lebanon, interception, risks. _________________ Monochamus Dejean, 1821 (Coleoptera, Cerambycidae, Lamiinae) is a large genus of wood-boring beetles comprising approximately 150 species reported in Asia, Europe, Africa and North America (VILLIERS, 1978; USDA-APHIS, 2011).
    [Show full text]
  • Rhinogobius Mizunoi, a New Species of Freshwater Goby (Teleostei: Gobiidae) from Japan
    Bull. Kanagawa prefect. Mus. (Nat. Sci.), no. 46, pp. 79-95, Feb. 2017 79 Original Article Rhinogobius mizunoi, A New Species of Freshwater Goby (Teleostei: Gobiidae) from Japan Toshiyuki Suzuki 1), Koichi Shibukawa 2) & Masahiro Aizawa 3) Abstract. A new freshwater goby, Rhinogobius mizunoi, is described based on six specimens from a freshwater stream in Shizuoka Prefecture, Japan. The species is distinguished from all congeneric species by the following combination of characters: I, 8 second dorsal-fin rays; 18–20 pectoral-fin rays; 13–18 predorsal scales; 33–35 longitudinal scales; 8 or 9 transverse scales; 10+16=26 vertebrae 26; first dorsal fin elongate in male, its distal tip reaching to base of fourth branched ray of second dorsal fin in males when adpressed; when alive or freshly-collected, cheek with several pale sky spots; caudal fin without distinct rows of dark dots; a pair of vertically- arranged dark brown blotches at caudal-fin base in young and females. Key words: amphidoromous, fish taxonomy, Rhinogobius sp. CO, valid species Introduction 6–11 segmented rays; anal fin with a single spine and 5–11 The freshwater gobies of the genus Rhinogobius Gill, segmented rays; pectoral fin with 14–23 segmented rays; 1859 are widely distributed in the East and Southeast pelvic fin with a single spine and five segmented rays; Asian regions, including the Russia Far East, Japan, 25–44 longitudinal scales; 7–16 transverse scales; P-V 3/ Korea, China, Taiwan, the Philippines, Vietnam, Laos, II II I I 0/9; 10–11+15–18= 25–29 vertebrae; body mostly Cambodia, and Thailand (Chen & Miller, 2014).
    [Show full text]
  • Information on Distribution of Round Goby
    Baltic Marine Environment Protection Commission Continuation of the project on Baltic-wide assessment of FISH-PRO II 4-2017 coastal fish communities in support of an ecosystem-based management Tallinn, Estonia, 13-15 February 2017 Document title Information on distribution of round goby Code 2-2 Category INF Agenda Item 2 – Information of relevance to FISH-PRO II Submission date 6.2.2017 Submitted by Estonia Reference Paragraph 3.13 of the Outcome of FISH-PRO II 3-2016 Background FISH-PRO II 3-2016 agreed that it would be valuable to compile information on the distribution and national monitoring of round goby. The attached document is a paper by Kotta et al.: “Shipping and natural environmental conditions determine the distribution of the invasive non-indigenous round goby Neogobius melanostomus in a regional sea.” Action requested The Meeting is invited to take note and make use of the information as appropriate. Page 1 of 1 Estuarine, Coastal and Shelf Science 169 (2016) 15e24 Contents lists available at ScienceDirect Estuarine, Coastal and Shelf Science journal homepage: www.elsevier.com/locate/ecss Shipping and natural environmental conditions determine the distribution of the invasive non-indigenous round goby Neogobius melanostomus in a regional sea * Jonne Kotta a, , Kristiina Nurkse a, Riikka Puntila b, c, Henn Ojaveer a a Estonian Marine Institute, University of Tartu, Maealuse€ 14, 12618 Tallinn, Estonia b Finnish Environment Institute, Marine Research Center, Erik Palmenin aukio 1, FI-00560 Helsinki, Finland c University of Helsinki, Department of Aquatic Sciences, P.O. Box 65, Biocenter 3, Viikinkaari 1, FI-00014, Finland article info abstract Article history: Introductions of non-indigenous species (NIS) are considered a major threat to aquatic ecosystems Received 5 March 2015 worldwide.
    [Show full text]
  • Lepidoptera, Limacodidae) 23 Doi: 10.3897/Zookeys.306.5216 Research Article Launched to Accelerate Biodiversity Research
    A peer-reviewed open-access journal ZooKeys 306: 23–36A review (2013) of the genus Monema Walker in China (Lepidoptera, Limacodidae) 23 doi: 10.3897/zookeys.306.5216 RESEARCH ARTICLE www.zookeys.org Launched to accelerate biodiversity research A review of the genus Monema Walker in China (Lepidoptera, Limacodidae) Zhaohui Pan1,†, Chaodong Zhu2,‡, Chunsheng Wu2,§ 1 Institute of Plateau Ecology, Agriculture and Animal Husbandry College of Tibet University, Linzhi 860000, P.R. China 2 Key Laboratory of Zoological Systematics and Evolution, Institute of Zoology, Chinese Academy of Sciences, Beijing 100101, P.R. China † urn:lsid:zoobank.org:author:327D5273-1638-4F19-BF87-345AA1E264D9 ‡ urn:lsid:zoobank.org:author:8B542B39-2118-4146-83F8-73AB65257FB9 § urn:lsid:zoobank.org:author:9ED21D9F-83DB-4F22-AAB2-C9F0F5ABD12C Corresponding author: Chaodong Zhu ([email protected]); Chunsheng Wu ([email protected]) Academic editor: E. van Nieukerken | Received 27 March 2013 | Accepted 29 May 2013 | Published 3 June 2013 urn:lsid:zoobank.org:pub:4FFDB920-7E4A-4F33-9D8E-16CC7189723F Citation: Pan Z, Zhu C, Wu C (2013) A review of the genus Monema Walker in China (Lepidoptera, Limacodidae). ZooKeys 306: 23–36. doi: 10.3897/zookeys.306.5216 Abstract Four species and one subspecies of the genus Monema Walker, 1855 are recognized from China, in which M. tanaognatha Wu & Pan sp. n. is described as new, M. coralina Dudgeon, 1895 and M. meyi Solovyev & Witt, 2009 are newly recorded for China. The female of M. meyi is reported for the first time. Monema ni- grans de Joannis, 1901 and M. melli Hering, 1931 are synonymized with M.
    [Show full text]
  • Disease and Clinical Signs Poster
    African Clawed Frog Xenopus laevis Diseases and Clinical Signs in Photographs Therese Jones-Green University Biomedical Services Abstract Reported clinical signs associated with ill health and Clinical signs found between 2016 to 2018 Many diseases of Xenopus laevis frogs have been described in the • Opened in 2005, the biofacility can hold up to 900 female and 240 disease Clinical signs found between 2016 to 2018 male frogs in a Marine Biotech (now serviced by MBK Installations Ltd.) • 80 recirculating aquatic system. • Buoyancy problems 70 bridge this gap using photographs taken of frogs with clinical signs. The system monitors parameters such as: temperature, pH, • • Changes in activity e.g. lethargy or easily startled. My aims are: conductivity, and Total Gas Pressure. 60 • Unusual amount of skin shedding. 2018 • To share my experiences, via images, to help improve the welfare and • Frogs are maintained on mains fed water with a 20% water exchange. 50 ases • Weight loss, or failure to feed correctly. c husbandry of this species. • 2017 • Coelomic (body cavity) distention. 40 • To stimulate a dialogue which results in further sharing of ideas and 2016 Whole body bloat. 30 information. • Frogs are held under a 12 hour light/dark cycle. • Number of • Each tank has a PVC enrichment tube (30cm x 10cm), with smoothed • Fungal strands/tufts. 20 Introduction cut edges. • Sores or tremors at extremities (forearms and toes). 10 Between January 2016 and October 2018, cases of ill health and disease • Frogs are fed three times a week with a commercial trout pellet. • Redness or red spots. 0 Oedema Red leg Red leg (bad Red leg Gas bubble Sores on forearm Opaque cornea Skeletal Growth (cartilage Scar Cabletie Missing claws Eggbound in a colony of Xenopus laevis frogs housed by the University Biological hormone) (nematodes) disease deformity under skin) • The focus of the research undertaken in the biofacility is embryonic and • Excessive slime/mucous production or not enough (dry dull skin).
    [Show full text]
  • This Document Was Withdrawn on 6 November 2017
    2017. November 6 on understanding withdrawn was water for wildlife document This Water resources and conservation: the eco-hydrological requirements of habitats and species Assessing We are the Environment Agency. It’s our job to look after your 2017. environment and make it a better place – for you, and for future generations. Your environment is the air you breathe, the water you drink and the ground you walk on. Working with business, Government and society as a whole, we are makingNovember your environment cleaner and healthier. 6 The Environment Agency. Out there, makingon your environment a better place. withdrawn was Published by: Environment Agency Rio House Waterside Drive, Aztec West Almondsbury, Bristol BS32 4UD Tel: 0870document 8506506 Email: [email protected] www.environment-agency.gov.uk This© Environment Agency All rights reserved. This document may be reproduced with prior permission of the Environment Agency. April 2007 Contents Brief summary 1. Introduction 2017. 2. Species and habitats 2.2.1 Coastal and halophytic habitats 2.2.2 Freshwater habitats 2.2.3 Temperate heath, scrub and grasslands 2.2.4 Raised bogs, fens, mires, alluvial forests and bog woodland November 2.3.1 Invertebrates 6 2.3.2 Fish and amphibians 2.3.3 Mammals on 2.3.4 Plants 2.3.5 Birds 3. Hydro-ecological domains and hydrological regimes 4 Assessment methods withdrawn 5. Case studies was 6. References 7. Glossary of abbreviations document This Environment Agency in partnership with Natural England and Countryside Council for Wales Understanding water for wildlife Contents Brief summary The Restoring Sustainable Abstraction (RSA) Programme was set up by the Environment Agency in 1999 to identify and catalogue2017.
    [Show full text]
  • Table S1. Nakharuthai and Srisapoome (2020)
    Primer name Nucleotide sequence (5’→3’) Purpose CXC-1F New TGAACCCTGAGCTGAAGGCCGTGA Real-time PCR CXC-1R New TGAAGGTCTGATGAGTTTGTCGTC Real-time PCR CXC-1R CCTTCAGCTCAGGGTTCAAGC Genomic PCR CXC-2F New GCTTGAACCCCGAGCTGAAAAACG Real-time PCR CXC-2R New GTTCAGAGGTCGTATGAGGTGCTT Real-time PCR CXC-2F CAAGCAGGACAACAGTGTCTGTGT 3’RACE CXC-2AR GTTGCATGATTTGGATGCTGGGTAG 5’RACE CXC-1FSB AACATATGTCTCCCAGGCCCAACTCAAAC Southern blot CXC-1RSB CTCGAGTTATTTTGCACTGATGTGCAA Southern blot CXC1Exon1F CAAAGTGTTTCTGCTCCTGG Genomic PCR On-CXC1FOverEx CATATGCAACTCAAACAAGCAGGACAACAGT Overexpression On-CXC1ROverEx CTCGAGTTTTGCACTGATGTGCAATTTCAA Overexpression On-CXC2FOverEx CATATGCAACTCAAACAAGCAGGACAACAGT Overexpression On-CXC2ROverEx CTCGAGCATGGCAGCTGTGGAGGGTTCCAC Overexpression β-actinrealtimeF ACAGGATGCAGAAGGAGATCACAG Real-time PCR β-actinrealtimeR GTACTCCTGCTTGCTGATCCACAT Real-time PCR M13F AAAACGACGGCCAG Nucleotide sequencing M13R AACAGCTATGACCATG Nucleotide sequencing UPM-long (0.4 µM) CTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT RACE PCR UPM-short (2 µM) CTAATAC GACTCACTATA GGGC RACE PCR Table S1. Nakharuthai and Srisapoome (2020) On-CXC1 Nucleotide (%) Amino acid (%) On-CXC2 Nucleotide (%) Amino acid (%) Versus identity identity similarity Versus identity identity Similarity Teleost fish 1. Rock bream, Oplegnathus fasciatus (AB703273) 64.5 49.1 68.1 O. fasciatus 70.7 57.7 75.4 2. Mandarin fish, Siniperca chuatsi (AAY79282) 63.2 48.1 68.9 S. chuatsi 70.5 54.0 78.8 3. Atlantic halibut, Hippoglossus hippoglossus (ACY54778) 52.0 39.3 51.1 H. hippoglossus 64.5 46.3 63.9 4. Common carp IL-8, Cyprinus carpio (ABE47600) 44.9 19.1 34.1 C. carpio 49.4 21.9 42.6 5. Rainbow trout IL-8, Oncorhynchus mykiss (CAC33585) 44.0 21.3 36.3 O. mykiss 47.3 23.7 44.4 6. Japanese flounder IL-8, Paralichthys olivaceus (AAL05442) 48.4 25.4 45.9 P.
    [Show full text]
  • Phylogenomic Resolution of Sea Spider Diversification Through Integration Of
    bioRxiv preprint doi: https://doi.org/10.1101/2020.01.31.929612; this version posted February 2, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Phylogenomic resolution of sea spider diversification through integration of multiple data classes 1Jesús A. Ballesteros†, 1Emily V.W. Setton†, 1Carlos E. Santibáñez López†, 2Claudia P. Arango, 3Georg Brenneis, 4Saskia Brix, 5Esperanza Cano-Sánchez, 6Merai Dandouch, 6Geoffrey F. Dilly, 7Marc P. Eleaume, 1Guilherme Gainett, 8Cyril Gallut, 6Sean McAtee, 6Lauren McIntyre, 9Amy L. Moran, 6Randy Moran, 5Pablo J. López-González, 10Gerhard Scholtz, 6Clay Williamson, 11H. Arthur Woods, 12Ward C. Wheeler, 1Prashant P. Sharma* 1 Department of Integrative Biology, University of Wisconsin–Madison, Madison, WI, USA 2 Queensland Museum, Biodiversity Program, Brisbane, Australia 3 Zoologisches Institut und Museum, Cytologie und Evolutionsbiologie, Universität Greifswald, Greifswald, Germany 4 Senckenberg am Meer, German Centre for Marine Biodiversity Research (DZMB), c/o Biocenter Grindel (CeNak), Martin-Luther-King-Platz 3, Hamburg, Germany 5 Biodiversidad y Ecología Acuática, Departamento de Zoología, Facultad de Biología, Universidad de Sevilla, Sevilla, Spain 6 Department of Biology, California State University-Channel Islands, Camarillo, CA, USA 7 Départment Milieux et Peuplements Aquatiques, Muséum national d’Histoire naturelle, Paris, France 8 Institut de Systématique, Emvolution, Biodiversité (ISYEB), Sorbonne Université, CNRS, Concarneau, France 9 Department of Biology, University of Hawai’i at Mānoa, Honolulu, HI, USA Page 1 of 31 bioRxiv preprint doi: https://doi.org/10.1101/2020.01.31.929612; this version posted February 2, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder.
    [Show full text]
  • Schütt, Kärnten) Von Sandra Aurenhammer, Christian Komposch, Erwin Holzer, Carolus Holzschuh & Werner E
    Carinthia II n 205./125. Jahrgang n Seiten 439–502 n Klagenfurt 2015 439 Xylobionte Käfergemeinschaften (Insecta: Coleoptera) im Bergsturzgebiet des Dobratsch (Schütt, Kärnten) Von Sandra AURENHAMMER, Christian KOMPOscH, Erwin HOLZER, Carolus HOLZscHUH & Werner E. HOLZINGER Zusammenfassung Schlüsselwörter Die Schütt an der Südflanke des Dobratsch (Villacher Alpe, Gailtaler Alpen, Villacher Alpe, Kärnten, Österreich) stellt mit einer Ausdehnung von 24 km² eines der größten dealpi­ Totholzkäfer, nen Bergsturzgebiete der Ostalpen dar und ist österreichweit ein Zentrum der Biodi­ Arteninventar, versität. Auf Basis umfassender aktueller Freilanderhebungen und unter Einbeziehung Biodiversität, diverser historischer Datenquellen wurde ein Arteninventar xylobionter Käfer erstellt. Collection Herrmann, Die aktuellen Kartierungen erfolgten schwerpunktmäßig in der Vegetations­ Buprestis splendens, periode 2012 in den Natura­2000­gebieten AT2112000 „Villacher Alpe (Dobratsch)“ Gnathotrichus und AT2120000 „Schütt­graschelitzen“ mit 15 Kroneneklektoren (Kreuzfensterfallen), materiarius, Besammeln durch Handfang, Klopfschirm, Kescher und Bodensieb sowie durch das Acanthocinus Eintragen von Totholz. henschi, In Summe wurden in der Schütt 536 Käferspezies – darunter 320 xylobionte – Kiefernblockwald, aus 65 Familien nachgewiesen. Das entspricht knapp einem Fünftel des heimischen Urwaldreliktarten, Artenspektrums an Totholzkäfern. Im Zuge der aktuellen Freilanderhebungen wurden submediterrane 216 xylobionte Arten erfasst. Durch Berechnung einer Artenakkumulationskurve
    [Show full text]
  • Attraction of Monema Flavescens Males to Synthetic Blends of Sex Pheromones
    Bulletin of Insectology 69 (2): 193-198, 2016 ISSN 1721-8861 Attraction of Monema flavescens males to synthetic blends of sex pheromones 1 2 1 2 3 2 Shuzhen YANG , Hongxia LIU , Haixia ZHENG , Meihong YANG , Yanxia REN , Jintong ZHANG 1Agronomy College, Shanxi Agricultural University, Taigu, Shanxi, China 2Institute of Chemical Ecology, Shanxi Agricultural University, Taigu, Shanxi, China 3Shanxi Branch Valley Biological Pesticide Co. Ltd, Taigu, Shanxi, China Abstract This study was performed in Luanxian County, Hebei Province, China, from June to August of 2014 and 2015. We sought to de- velop a new and effective method for controlling the moth Monema flavescens. We synthesized the principal female sex phero- mones and conducted a series of field experiments using traps baited with (E)-8-decen-1-ol (E8-10:OH), (Z)-7,9-decadien-1-ol (Z7,9-10:OH), and (Z)-9,11-dodecadien-1-ol (Z9,11-12:OH), alone or in combination. The number of males captured by traps baited with synthetic E8-10:OH increased when Z7,9-10:OH, Z9,11-12:OH, or both was/were added. Traps baited with a 10:2:1 (w/w/w) mixture of E8-10:OH, Z7,9-10:OH, and Z9,11-12:OH at a total dose of 650 µg septum−1 were the most efficient. Further, a delta trap hung about 1.5 m above the ground was very effective. Our work will facilitate safer and more environmentally friendly management of M. flavescens. Key words: Monema flavescens, sex pheromone trapping, (E)-8-decen-1-ol, (Z)-7,9-decadien-1-ol, (Z)-9,11-dodecadien-1-ol.
    [Show full text]