Copyright by Yun Wang 2010

The Dissertation Committee for Yun Wang Certifies that this is the approved version of the following dissertation:

Controlling (NO) Overproduction: Nω, Nω- Dimethylarginine Dimethylaminohydrolase (DDAH) as a Novel Drug Target

Committee:

Walter L. Fast, Supervisor

Christian P. Whitman

Jon D. Robertus

George Georgiou

Sean M. Kerwin

Controlling Nitric Oxide (NO) Overproduction: Nω, Nω- Dimethylarginine Dimethylaminohydrolase (DDAH) as a Novel Drug Target

by

Yun Wang, B.S.; M.S.

Dissertation Presented to the Faculty of the Graduate School of The University of Texas at Austin in Partial Fulfillment of the Requirements for the Degree of

Doctor of Philosophy

The University of Texas at Austin August, 2010

Dedication

To all people who have given me generous help when I am in Austin, including professors, colleagues and friends. To my beloved parents in P.R.China, who always motivate me to pursue my dream.

Acknowledgements

First and foremost, I would like to thank my supervisor, Dr. Walt Fast, for his generous support and for giving me an opportunity to work in his lab four years ago at the University of Texas at Austin. Walt gives me lots of freedom to explore scientific problems and provides a wonderful working environment along with my lovely colleagues. He always gives me useful directions when I meet difficulties. I appreciate every scientific conversation with him. They were especially important to me during the beginning of my Ph.D. study. I wouldn’t have accomplished as much as today without his help. In addition, I’d like to thank colleagues in Fast lab for their generous help during these years. I also want to thank professors in the Medicinal Chemistry Division who have helped me, especially my dissertation committee members. Finally, I give my special thanks to my dear friends in Austin and my parents in China, for their support when I was down. I am proud of myself that I finally stand at the point of finishing my Ph.D. degree. Despite troubles along the way, all’s well that ends well.

v Controlling Nitric Oxide (NO) Overproduction: Nω, Nω- Dimethylarginine Dimethylaminohydrolase (DDAH) as a Novel Drug Target

Publication No.______

Yun Wang, Ph.D. The University of Texas at Austin, 2010

Supervisor: Walter L. Fast

Nitric oxide (NO) overproduction is correlated with numerous human diseases, such as arthritis, asthma, , and septic shock. The activities of both NO synthase (NOS) and dimethylarginine dimethylaminohydrolase-1 (DDAH-1) promote NO production. DDAH-1 mainly colocalizes in the same tissues as the neuronal isoform of NOS and catabolizes the endogenously-produced competitive inhibitors of

NOS, Nω-monomethyl-L-arginine (NMMA) and asymmetric Nω, Nω-dimethyl-L-arginine (ADMA). Inhibition of DDAH-1 leads to elevated concentrations of NMMA and ADMA, which subsequently inhibit NOS. To better understand DDAH-1, I first characterized the catalytic mechanism of human DDAH-1, where Cys274, His173, Asp79 and Asp127 form a catalytic center. Particularly, Cys274 is an nucleophile and His173 plays a dual role in acid/base . I also studied an unusual

mechanism for covalent inhibition of DDAH-1 by S-nitroso-L- (HcyNO), where an N-thiosulfoximide adduct is formed at Cys274. Using a combination of site

vi directed mutagenesis and mass spectrometry, we found that many residues that participate in catalysis also participate in HcyNO mediated inactivation. Following these studies, I then screened a small set of known NOS inhibitors as potential inhibitors of DDAH-1. The most potent of these, an alkylamidine, was selected as a scaffold for homologation. Stepwise lengthening of the alkyl substituent changes an NOS-selective inhibitor into a dual-targeted NOS/DDAH-1 inhibitor then into a DDAH-1 selective inhibitor, as seen in the inhibition constants of N5-(1-iminoethyl)-, N5-(1-iminopropyl)-,

N5-(1-iminopentyl)- and N5-(1-iminohexyl)-L-ornithine for neuronal NOS (1.7, 3, 20, >1,900 µM, respectively) and DDAH-1 (990, 52, 7.5, 110 µM, respectively). X-ray crystal structures suggest that this selectivity is likely due to active site size differences. To rank the inhibitors’ in vivo potency, we constructed a click-chemistry based activity probe to detect inhibition of DDAH-1 in live mammalian culture. In vivo IC50 values for representative alkylamidine based inhibitors were measured in living HEK293T cells. Future application of this probe will address the regulation of DDAH-1 activity in pathophysiological states. In summary, this work identifies a versatile scaffold for developing DDAH targeted inhibitors to control NO overproduction and provides useful biochemical tools to better understand the etiology of endothelial dysfunction.

vii Table of Contents

List of Tables ...... xii

List of Figures ...... xiii

List of Schemes ...... xvi

Chapter 1 Background and Significance...... 1 1.1 Nitric oxide (NO) - a double-edged sword ...... 1 1.1.1 NO is an important cellular second-messenger ...... 1 1.1.2 NO overproduction is a serious problem in a number of severe diseases ...... 4 1.1.3 The dual effects of NO ...... 8 1.2 Dimethylarginine dimethylaminohydrolase (DDAH) as a novel drug target to control NO overproduction ...... 9 1.2.1 Nω-methyl-L-arginine and Nω,Nω-dimethyl-L-arginine are endogenous NOS inhibitors ...... 9 1.2.2 Nω,Nω-dimethyl-L-arginine dimethylaminohyrolase, a novel target for NO regulation...... 12 1.3 Towards finding inhibitors to control diseases marked by NO overproduction ...... 18

Chapter 2 Catalytic participation of human DDAH-1 in its own inactivation by S- nitroso-L-homocysteine ...... 26 2.1 Introduction...... 26 2.2 Material and Methods ...... 30 Construction of human DDAH-1 (hDDAH-1) variants ...... 30 Expression and purification of hDDAH-1 variants ...... 31 Steady-state kinetic studies ...... 32 Preparation of L-homocysteine ...... 33 Preparation of S-nitroso-L-homocysteine ...... 33 Reaction of hDDAH-1 variants with HcyNO ...... 34 Acid quench of covalently modified hDDAH-1 variants ...... 34 LC-ESI-Mass spectrometry analysis ...... 35 viii MALDI-TOF analysis of modified peptides in human DDAH-1 and Pseudomonas aeruginosa DDAH ...... 35 UV-Vis spectroscopy of HcyNO modified hDDAH-1 ...... 36 2.3 Results and Discussion ...... 36 hDDAH-1 uses D79, D127, H173 and C274 to form a catalytic center ...... 36 Other active site amino acids play assisting roles in hDDAH-1 catalysis ...... 40 Trapped reaction intermediates during catalysis turnover reveals active site residues' participation in different catalysis steps ...... 42 Proposed hDDAH-1 catalytic mechanism ...... 46 Covalent inhibition of hDDAH-1 variants by S-nitroso-L-homocysteine yields two different adducts ...... 47

Chapter 3 Developing dual and specific inhibitors of dimethylarginine dimethylaminohydrolase-1 and : Toward a targeted polypharmacology to control nitric oxide...... 57 3.1 Introduction...... 57 3.2 Material and Methods ...... 60 Materials ...... 60 General procedure for synthesis of N5-(1-iminoalkyl)-L-ornithines ...60 Cloning of recombinant human DDAH-1 ...... 61 Site-directed mutagenesis to generate L30A, E78A and L271G muations ...... 63 Expression and purification of DDAH-1 ...... 64 Steady-state kinetic studies ...... 66 Survey of selected NOS inhibitors as DDAH inhibitors ...... 67 Turnover and time-dependent inhibition experiments ...... 67 Reversible inhibition by IPO ...... 68 Analytical sedimentation equilibrium ultracentrifugation ...... 69 Crystallization, data collection and structure determination ...... 70 Atomic coordinates ...... 70 Circular dichroism (CD) spectroscopy ...... 70 3.3 Results and Discussion ...... 70

ix Survey of selected NOS inhibitors as DDAH-1 inhibitors ...... 70 Survey of selected amidino-based NOS inhibitors as DDAH-1 inhibitors ...... 72 Analytical equilibrium sedimentation ultracentrifugation ...... 74 X-ray crystallography ...... 76 Characterization of DDAH-1 inhibition by L-IPO (13) ...... 77 Toward a targeted polypharmacology to control NO ...... 87

Chapter 4 Development of a DDAH-1 inhibitor screening method in intact mammalian cells using a click-chemistry based activity probe...... 90 4.1 Introduction...... 90 4.2 Material and Methods ...... 95 Synthetic procedures for N-but-3-ynyl-2-chloro-acetamidine (1, Click-Cl) ...... 95

Preparation of biotin-PEO3-azide (12)...... 95 Expression and purification of hDDAH-1 ...... 95 Time-dependent inactivation of DDAH-1 by Click-Cl (1) ...... 96 Mass spectral analysis of Click-Cl inactivated DDAH ...... 96 Construction of pEF6a-hDDAH-1, pEF6a-hDDAH-1 plasmid and pEF6a- hDDAH-1 C274A mutant...... 97 In vitro labeling of over-expressed hDDAH-1 in E. coli and HEK 293T cell lysate ...... 98 In vivo labeling of myc-hDDAH-1 and variants in HEK 293T cell ...... 101 Two-color Western blot detection ...... 102 A semi-quantitative assay for DDAH-1 inhibitor screen via Click-Cl (1) in HEK 293T cells...... 103 4.3 Results and Discussion ...... 104 Click-Cl (1) is a time dependent irreversible inhibitor for human DDAH-1 ...... 104 Click-Cl (1) is able to label over-expressed DDAH-1 but not DDAH-2 in cell lysate ...... 107 Click-Cl (1) is able to label over-expressed DDAH-1 in intact HEK 293T cells ...... 113

x Click-Cl (1) mediated time dependent labeling of DDAH-1 in intact HEK 293T cells ...... 116 Click-Cl (1) can be used to develop a semi-quantitative assay for DDAH-1 inhibitor screening in intact mammalian cells ...... 118

In vivo IC50 quantitative determination for DDAH-1 reversible inhibitors ...... 124

Appendix Expression and purification tests for mammalian DDAH-2...... 131

References...... 133

Vita ...... 153

xi List of Tables

Table 1.1: Diseases marked by NO overproduction ...... 4 Table 1.2: Steady-state rate constants for DDAH-catalyzed hydrolysis of substrates ...... 15 Table 1.3: Anti-NO drugs tested in cancer models...... 18 Table 1.4: Representative reversible and irreversible inhibitors discovered for DDAH...... 23 Table 2.1: Steady-state kinetic parameters of hDDAH-1 catalysis...... 38 Table 2.2: Summary of major ions observed in ESI-MS spectra of acid-quenched steady-state reactions with hDDAH-1 variants and various substrates ...... 45 Table 2.3: Masses of the reaction products of hDDAH-1 with HcyNO ...... 51 Table 3.1: and inhibitors of DDAH-1 and nNOS...... 72 Table 3.2: Effects of hDDAH-1 mutations on steady-state kinetics and IPO binding ...... 79 Table 3.3: Secondary structure estimation for IPO and DDAH-1 binding with different stoichiometry...... 80 Table 4.1: Chemical structures of DDAH-1 covalent inhibitors used in this chapter ...... 100

Table 4.2: In vitro Ki values of different alkylamidine inhibitors for DDAH-1 and nNOS inhibition...... 123

xii List of Figures

Figure 1.1: Production of NO by NOS...... 2 Figure 1.2: Common nitric oxide targets in tumor biology...... 6

Figure 1.3: Methylated L-arginine analogues...... 10 Figure 1.4: of ADMA in cells ...... 11 Figure 1.5: Sequence alignments of vertebrate DDAH-1 ...... 13 Figure 1.6: Proposed substrate-assisted mechanism of PaDDAH ...... 15

Figure 2.1: X-ray crystal structure of bovine DDAH-1 with (A) (L- ) bound and (B) covalent adduct bound (N-thiosulfoximide) complexes ...... 38 Figure 2.2: Representative ESI-MS spectra of trapped reaction intermediates for wild-type hDDAH-1 catalyzed hydrolysis of substrates ADMA and SMTC...... 43

Figure 2.3: Representative ESI-MS spectra of S-nitroso-L-homocycsteine (HcyNO) modified and unmodified hDDAH-1 variants...... 50

Figure 2.4: UV-Vis spectra of unmodified hDDAH-1 wt (~267.2 μM, blue), HcyNO modified hDDAH-1 (~211.6 μM, red) and HcyNO (~284 μM, black)...... 54 Figure 3.1: Nitric oxide biosynthesis is promoted by the enzymic activities of both NO synthase (NOS) and DDAH...... 58 Figure 3.2: Diagram of selected substrates and inhibitors of NOS and DDAH-1 ...... 72 Figure 3.3: Analytical sedimentation equilibrium ultracentrifugation of DDAH-1...... 75

xiii Figure 3.4: The active site of DDAH-1 in complex with L-IPO (13) and omit map density...... 77

Figure 3.5: Reversible covalent inhibition of DDAH-1 by L-IPO (13)...... 77

Figure 3.6: Lineweaver-Burk plot of DDAH-1 inhibition by L-IPO (13)...... 78 Figure 3.7: HPLC analysis of L-IPO (6 mM) incubated in assay buffer with and without DDAH-1 (10 µM) 18 h at 25 ºC ...... 82 Figure 3.8: Representative 13C NMR spectra of 13C-labeled IPO - hDDAH-1 complex...... 84 Figure 3.9: Alternative loop conformations observed in DDAH-1 ...... 86 Figure 3.10: Comparison of DDAH-1 and NOS active sites ...... 88 Figure 4.1: Comparison of standard and click chemistry ABPP...... 91 Figure 4.2: Possible mechanisms for modification of Pseudomonas aeruginosa DDAH Cys249 by 2-chloroacetamidine (CAA) ...... 94 Figure 4.3: In vivo activity probe for DDAH-1 ...... 94 Figure 4.4: Kinetics of DDAH inactivation by Click-Cl (1)...... 106 Figure 4.5: ESI-MS spectra of covalent adduct formed between Click-Cl (1) and hDDAH-1 ...... 107 Figure 4.6: In vitro labeling of DDAH-1 in RDP (Rosetta DE3 PlysS) cell lysate ...... 110 Figure 4.7: In vitro labeling of DDAH-1 in HEK 293T cell lysate...... 111 Figure 4.8: In vitro labeling of DDAH-1 and DDAH-2 in HEK 293T cell lysate ...... 112 Figure 4.9: In vivo labeling of DDAH-1 in intact HEK 293T cells ...... 114 Figure 4.10: Fluorescence gel scanning image of in vivo labeling of DDAH-1 in HEK 293T cell lysate...... 115

xiv Figure 4.11: In vivo labeling of DDAH-1 is specific and occurs at Cys 274 in intact HEK 293T cells ...... 116 Figure 4.12: In vivo time dependent labeling of DDAH-1 ...... 118 Figure 4.13: In vivo inhibitor evaluation in HEK 293T cells by click-chemistry mediated activity probe ...... 120 Figure 4.14: In vivo alkylamidine inhibitor evaluation in HEK 293T cells ...... 122

Figure 4.15: In vivo IC50 determination for L-IPO ...... 125

Figure 4.16: In vivo IC50 determination for L-IHO ...... 126

Figure 4.17: In vivo IC50 determination for L-Hcy ...... 128

Figure 4.18: In vivo EC50 determination for Cl-NIO ...... 129

xv List of Schemes

Scheme 2.1: Proposed substrate-assisted mechanism of hDDAH-1. Box indicates acid quench trapped reaction adduct after the first half reaction ...... 47 Scheme 2.2: Proposed inhibitory mechanism for HcyNO-hDDAH-1 inhibition ...... 56

xvi Chapter 1: Background and Significance

1.1 NITRIC OXIDE (NO) - A DOUBLE-EDGED SWORD

1.1.1 NO is an important cellular second-messenger

Nitric oxide (●NO), which is a free radical synthesized from L-arginine in a reaction catalyzed by the NO synthases (NOS, EC 1.14.13.39), is an important second- messenger molecule that affects various physiological functions. It is involved in signaling in the cardiovascular, gastrointestinal, genitourinary, respiratory and nervous systems. Dysregulated NO production has been implicated in a wild range of diseases such as arthritis, asthma, diabetes, septic shock and cancer (1-6). In the cardiovascular system, endothelial-produced NO is important to maintain the vasculature in a relaxed state, inhibit the adhesion of platelets and white cells and suppress the smooth-muscle cells replication (7). In the nervous system, NO controls the release of neurotransmitters and is involved in synaptogenesis, synaptic plasticity, and neuroendocrine secretion (8). NO is also important in vascular and nonvascular smooth muscle relaxation (9). For example, it relaxes sphincters in the gut, mediates relaxation of the corpus cavernosum and leads to penile erection, causes the relaxation of the bladder and urethra, and alters responses in airways (10). NO in the central nervous systems (CNS) might be an important mediator of behavioral inhibition (11). In immune defense systems, NO produced by macrophage cells can destroy pathogens and microorganisms (8). Therefore, NO is a key physiological mediator and is associated with many physiological functions. The NO radical is synthesized by NO synthases (NOS, EC 1.14.13.39). There are three NOS isoforms in humans, which are named according to where they were first discovered (endothelial NOS (eNOS), neuronal NOS (nNOS) and

1 inducible/inflammatory NOS (iNOS)). They share ~50% sequence homology (12, 13). NOS are flavoheme that contain a carboxy-terminal diflavin-reductase domain and an amino-terminal oxygenase domain (10). During the catalytic turnover, nitric oxide synthase (NOS) enzymes must dimerize first by sequestering ZnII, in order to generate a high-affinity binding sites for substrate (L-arginine), (tetrahydrobiopterin (BH4), heme, flavin mononucleotide (FMN) and flavin adenine dinucleotide (FAD)) (Figure 1.1) (10). NOS activity is also dependent on calmodulin (CAM) binding. iNOS has tightly bound calmodulin while eNOS and nNOS’s calmodulin binding is dependent on calcium.

Activated NOS catalyses the NADPH- and O2-dependent oxidation of L-arginine to L-

citrulline and NO, with Nω-hydroxyl-L-arginine formed as a reaction intermediate (13).

Figure 1.1 Production of NO by NOS.

For enzymatic activity, nitric oxide synthase (NOS) enzymes must dimerize and bind the cofactors tetrahydrobiopterin (BH4), heme, flavin mononucleotide (FMN) and flavin adenine dinucleotide (FAD). Upon binding calmodulin (CAM), the active enzyme catalyses the oxidation of L-arginine to citrulline and nitric oxide (NO) and requires molecular oxygen and NADPH as co-substrates. Each NOS dimer coordinates a single zinc (Zn) atom. Figure adapted from (10).

2 NO is unique in its ability to rapidly diffuse from the point of synthesis (the diffusion coefficient is 1.4 times that of oxygen at 37 ºC), to permeate cell membranes, interact selectively with biomolecules within generating and target cells, and in its intrinsic instability (14). All of these properties eliminate the need for extracellular NO receptors or an NO degradation pathway (12, 14). The best characterized physiological target for NO so far is soluble guanylyl cyclase that converts GTP to cGMP, and couples to cGMP-dependent proteins (e.g. protein-kinase-G, PKG) and cyclic nucleotide-gated channels (15). Binding of low concentrations of NO to the iron within the heme moiety of guanylyl cyclase generates a conformational change that leads to enzyme activation (10). The subsequent rise in cyclic GMP concentration accounts for many NO mediated physiological effects. In addition, NO reacts with the heme groups of oxyhemoglobin to form nitrosylheme-hemoglobin, which serves as a NO carrier and leads to NO’s short half-life in vivo (1-5 s). In addition to direct interaction of NO with its target, NO can interact indirectly with metals, and oxides, usually through reactive nitrogen species (RNS) such as nitrogen dioxide (NO2●) (12, 16, 17). NO is oxidized by NO2● to

form dinitrogen dioxide (N2O3), which rapidly decomposes into nitrosonium cations

+ - + (NO ) and nitrite (NO2 ). NO is responsible for protein nitrosylation and DNA base deamination (18). NO can also react with reactive oxygen species (ROS) to form peroxynitrite (ONOO-), which is a powerful oxidant that can modify proteins and lipids by nitration (usually a tyrosine) (19, 20). ROS (e.g. superoxide radical, hydroxyl radical)

- and RNS (e.g. NO2●, N2O3, ONOO ) are important for immune defense function, such as killing invading microorganisms and malignant cells. However, excessive levels of ROS and RNS can cause cellular oxidative (hydroxylation, lipid peroxidation, DNA strand breaks) and nitrosative (nitration, nitrosylation, DNA deamination) stress, which lead to impaired cellular function, enhanced inflammatory reactions, inhibition of mitochondrial

3 respiration, cell apoptosis and genotoxicity due to the damage of DNA, proteins, lipids and heme groups (21).

1.1.2 NO overproduction is a serious problem in a number of severe diseases

Although NO is an important cellular second-messenger molecule, increased NO production has been implicated in pathophysiological changes in many organ systems as evidenced by NO detection studies, NOS isoform expression and NOS inhibitor effects (Table. 1.1). Increased nNOS activity is associated with certain types of neurotoxicity.

NMDA (N-methyl-D-aspartate)-induced neurotoxicity can be reduced by NOS inhibitors in rat models (22), and stroke damage is reduced in nNOS knockout mice (23). iNOS induction is observed in models of septic shock (24), inflammatory and non- inflammatory pain (25, 26), arthritis (1), inflammatory bowel disease (27), asthma (2, 28) and in the brain after ischaemia or trauma, and in various neurodegeneration or cerebral inflammation models (29, 30). eNOS deficiency confers benefit in hyperoxia-induced retinopathy although most interest has focused on the cardioprotective effects of eNOS (31).

Table 1.1 Diseases marked by NO overproduction (Table reproduced from (32)).

Disease Affected tissue Corresponding NOS isoenzymes

Arthritis (1) bone iNOS

Asthma (2) lung iNOS

Diabetes (3) Cardiovascular eNOS

Inflammation (33) Various eNOS (acute), iNOS (chronic)

Ischemia (34) Brain, heart iNOS, nNOS 4 Meningitis (35) Brain iNOS

Migraine (36) Brain iNOS

Neurodegeneration [a](37) Brain iNOS, nNOS

Septic shock (4, 38) Various iNOS

Stroke (cerebral ischemia) (39) Brain nNOS, iNOS

[a] Claims have been made in case of Parkinson’s disease, Alzheimer’s disease, Huntington’s disease, amylotrophic lateral sclerosis (ALS), multiple sclerosis (MS).

Overproduced NO can mediate potential tumor-promoting effects through its interaction with downstream targets as indicated in Figure 1.2 (40, 41). For example, iNOS has been found to express in malignant cells and within the tumor microenvironment in breast cancer (42-44), in 60% of human colon adenomas, 20-25% of colon carcinomas and also in other different types of cancer while the iNOS expression is either low or absent in the surrounding normal tissues (45, 46). eNOS’s expression has been found to strongly correlate with that of iNOS in breast carcinoma (44). nNOS has also been detected in some oligodendroglioma and neuroblastoma cell lines (47). NO can facilitate tumor growth when it is produced by tumor cells at lower concentrations (estimated to be at least 1-2 orders of magnitude lower than cytotoxic concentrations (48)), while cytotoxic concentration NO produced by immune cells can attack tumor cells and induce apopotosis (49, 50).

5

Figure 1.2 Common nitric oxide targets in tumor biology.

6 Akt: also known as protein kinase-B (PKB) (phosphorylates and inactivates four main targets: GSK3, forkhaed transcription factors (activators of FAS-ligand transcription), caspases and proapoptotic factor Bad); β-catenin: activator of transcription factor TCF-4, which promotes transcription of cell survival/proliferation factors (once phosphorylated by glycogen synthase kinase-3 (GSK3), β-catenin is ubiquitinated and degradated by the proteasome); CDK2: cyclin-dependent kinase-2 (phosphorylates and inactivates Rb, thus promoting progression through the cell cycle); c-Fos: transcription factor (upregulated in some tumors); c-Jun: transcription factor (although classified as oncogene product, can mediate both apoptotic and anti-apoptotic effects); COX-2: cyclooxigenase-2 (inducible isoform of prostaglandin synthase, upregulated in some tumors); CREB: cAMP response element protein (transcriptional element for the c-Fos promoter region); DNMT: DNA methyl ; E2F: transcription factor (promotes cell cycle); ELK-1: transcription factor; ERK: mitogen activated protein kinase (MAPK); GUCY: soluble guanylyl cyclase; Hdm2: human homologue of Mdm2 (murine double minute-2, mediates p53 ubiquitination and proteasome-dependent degradation; also inhibits Rb function; upregulated in some tumors); HIF-1: hypoxia inducible factor-1 (transcription factor, upregulated in some tumors); HMOX1: heme oxygenase-1 (inducible isoenzyme, catalyzes the degradation of the heme moiety into biliverdin, carbon monoxide and iron; oxidative/nitrosative stress-induced cytoprotective factor, overexpressed in some tumors); IκB: inhibitor of NFκB; IKK: IκB kinase (causes phosphorylation of IκB, which is followed by its ubiquitination and subsequent degradation); JNK: c-Jun NH2-terminal kinase (mitogen activated protein kinase (MAPK), also known as stress-activated protein kinase (SAPK)); MEK4: MAP2K4 (ERK kinase, MAPK kinase); MEKK1: MAP3K1; MGMT: O-6-methylguanine DNA methyltransferase; MMP: matrix metallo-proteinases; NFκB: nuclear factor kappa-B (transcription factor regulating the expression of several genes encoding antiapoptotic and inflammatory factors; in its inactive form, NFκB is sequestered in the cytoplasm bound by members of the IκB family of inhibitor proteins); NOS: nitric oxide synthase; OGG1: 8-oxoguanine glycosylase-1; PI3K: phosphatidyl- inositol 3-kinase (synthesizes phosphatidyl-inositol 3,4,5-triphosphate [PIP3] from PIP2; PIP3 activates PI-dependent kinase (PDK), which in turn leads to Akt phosphorylation and activation); p21: wild type p53 activated fragment-1, also known as Waf1/Cip1 (cyclin-dependent kinase inhibitor, CDI); p53: transcription factor (tumor suppressor, mutationally inactivated in most tumors; among others, induces transcription of Waf1 and pro-apoptotic factor Bax); PAK1: p21 protein (Cdc42/Rac)-activated kinase 1; PDE: phosphodiesterase; PGE2: prostaglandin E2; PKG: protein kinase-G; RAC1: ras-related C3 botulinum toxin substrate 1 (Rho family, small GTP binding protein); RAF: MAPK kinase kinase (oncogene; together with Ras, transduces the signal of tyrosine kinase receptors activated by the binding of their ligands, such as growth factors); Ras: membranebound GTPase (oncogene product; activating mutations (inhibition of GTPase activity) are found in several tumors); Rb: retinoblastoma protein (tumor suppressor, inhibits cell cycle progression, deleted in some tumors); RRM1: ribonucleotide reductase M1; SOD: superoxide dismutase; VASP: vasodilator-stimulated phosphoprotein; VEGF: vascular endothelial growth factor. Figure adapted from (41).

7 The production of NO within the tumor microenvironment promotes tumor growth mainly by stimulating , which is a multistage process regulated by the expression of angiogenesis–promoting factors such as vascular endothelial growth factor (VEGF), integrins, basic fibroblast growth factor (b-FGF) and hypoxia-inducible factor-1 (HIF-1) (Figure 1.2) (51-53). Another mechanism by which NO promotes tumor growth is by modulating the production of prostaglandins through cyclooxygenase-2 (COX-2) activation (Figure 1.2) (54-57). NO activates COX-2 and generates prostaglandins, which promote angiogenesis and inhibit apoptosis through interaction with downstream target proteins, eg. Bcl-2 (58). In addition, NO can also help tumor progression by enhancing tissue invasion (5). Malignant cells migratory capacity is reduced by inhibition of sGC and MAPK pathways by specific inhibitors (59). Both pathways are involved in NO mediated induction of matrix-metallo-proteinase activation/overexpression, which is a key feature of cancer invasiveness (Figure 1.2) (60, 61). Finally, recent evidence suggests that NO production, especially produced by eNOS, is required for tumor maintenance (62). In particular, the activation of the AKT-eNOS- RAS pathway is required to initiate and maintain tumor growth (Figure 1.2) (63).

1.1.3 The dual effects of NO

Endogenous NO is famous for its beneficial and its harmful effects and is often described metaphorically as a double-edged sword (64). For example, NO can activate or inhibit apoptosis (65), kill tumors or increase their potential for metastasis or vascularization (5), and increase or protect against damage after stroke (66, 67). Some of these dual effects relate to distinct functions of different NOS isoforms. For instance, protective effects in stroke are mediated by eNOS (vascular), while harmful effects are due to nNOS activity (neuronal toxicity) (23, 67). Other dual effects usually relate to the amount and location of NO generated or the state of the cell. Low concentrations of 8 NO are anti-apoptotic, partly through inhibition of caspase activity by S-nitrosation, whereas high concentrations of NO can directly activate caspase (68). The dual effects of NO present one of the biggest challenges for development of inhibitors, because beneficial effects can be offset by harmful effects, if the inhibition is not tightly controlled to ensure target specificity and the appropriate degree of inhibition.

1.2 DIMETHYLARGININE DIMETHYLAMINOHYDROLASE (DDAH) AS A NOVEL DRUG TARGET TO CONTROL NO OVERPRODUCTION

1.2.1 Nω-methyl-L-arginine and Nω,Nω-dimethyl-L-arginine are endogenous NOS inhibitors

Because of the important functions of NO along with its high reactivity and high permeability, a strict regulation mechanism is needed to protect cells from damage and malfunction. One regulation mechanism of NOS isoform involves changes of intracellular Ca2+ concentrations. nNOS and eNOS are activated by Ca2+/calmodulin (CaM) binding, while iNOS is hardly affected because it has Ca2+/CaM very tightly bound (32). iNOS is mainly regulated on the transcriptional level (1, 69, 70). Transcription of the iNOS gene is promoted through various endotoxins (e.g., LPS) and (e.g., IFNγ, IL-1β, TNFα), and its translation is essentially controlled through a number of RNA-binding proteins (70). Posttranslational modification also contributes to NOS isoform regulation, such as palmitoylation (eNOS) and S-nitrosylation (32). In addition, interaction of NOS with other proteins (e.g., Hsp90) is critical for their cellular localization and activities (32). Another important NOS regulation mechanism comes from endogenous NOS inhibitors such as Nω-methyl-L-arginine (NMMA) and Nω,Nω– dimethyl-L-arginine (asymmetric dimethylated L-arginine, ADMA) (Figure 1.3).

9

Figure 1.3 Methylated L-arginine analogues.

L-Arginine (L-Arg), Nω–methyl-L-arginine (monomethylated L-arginine, NMMA), Nω,Nω–dimethyl-L-arginine (asymmetric dimethylated L-arginine, ADMA), and Nω,Nω’– dimethyl-L-arginine (symmetric dimethylated L-arginine, SDMA).

NMMA, ADMA and SDMA (Nω,Nω’–dimethyl-L-arginine) are side-chain-

methylated derivatives of L-Arg and have been detected in blood, , and cerebrospinal fluid at submicromolar concentration in healthy humans (71-73). They are the degradation products of various Arg-methylated proteins such as myelin basic protein (74), histones (75), ribosomal proteins (76), and ewing sarcoma protein (77). ADMA and NMMA but not SDMA, are inhibitors of NOS (78-81). The metabolism of ADMA, which concentration is ~10 fold higher than NMMA, is represented in Figure 1.4. Many clinical studies indicate increased ADMA concentrations in body fluids of patients accompanied with decreases of total NO production, although there are a few exceptions that suggest more complex regulation (32, 82). There are three clearance mechanisms of NMMA and ADMA in human body. One way is through urinary excretion (83), the second way is through regulation of intracellular concentrations by a cationic transporter system (84), and the third way is

10 through catabolism by Nω,Nω-dimethyl-L-arginine dimethylaminohydrolase (DDAH) (85), which is a specific catabolic pathway for NMMA and ADMA.

Figure 1.4 Metabolism of ADMA in cells.

11 i) NOS uses L-Arg as a substrate to produce L-Cit and NO. ii) The latter binds to sGC (soluble guanylate cyclase), which is 400-fold activated and produces the second messenger cGMP from GTP. iii) L-Arg is a substrate for arginine-tRNA synthase and iv) then used in protein transcription at the ribosomes. v) Post-translationally, PRMTs methylate certain proteins at specific Arg residues yielding Nω-monomethylated and Nω,Nω-dimethylated or Nω,Nω’-dimethylated Arg residues, respectively. To accomplish the reaction PRMTs use SAM as a methyl-group donor. SAH is yielded in this reaction. SAM is recovered in a pathway in which Hcy appears as an intermediate. vi) Proteolysis leads to the formation of free ADMA (and also SDMA and NMMA, not displayed in this scheme), which is an inhibitor of NOS. vii) DDAH hydrolyzes ADMA (and NMMA, respectively), through which L-Cit and (CH3)2NH are yielded, thus activating NO production. A direct methylation pathway for L-Arg has not yet been described (a). viii) However, the intracellular concentrations of L-Arg and ADMA (also of SDMA and NMMA) are regulated through transport across the cell membrane. Moreover, the conversion of L-Arg to L-Cit and back is also performed in the urea cycle. ix) Arg decarboxylase and Arg:Gly amidinotransferase are other enzymes that use L-Arg as a substrate. SAH = S-adenosyl-L-homocysteine; Hcy = L-homocysteine. Figure adapted from (32).

1.2.2 Nω,Nω-dimethyl-L-arginine dimethylaminohydrolase, a novel target for NO regulation

Nω,Nω-dimethyl-L-arginine dimethylaminohydrolase (DDAH) belongs to the pentein superfamily, which share a β/α propeller fold that has five pseudo-symmetrical repeating ββαβ motifs (86). Individual members in this diverse superfamily include noncatalytic binding proteins (e.g., anti-association factor IF6 (87)) and a family of guanidine modifying enzymes (88). DDAH belongs to the guanidine-modifying enzyme family which include arginine deiminase, arginine:glycine amidinotransferase, arginine:inosamine phosphate amidinotransferase and peptidylarginine deiminase (89). Despite their different substrates and products, all these family members use an S- alkylthiouronium covalent intermediate in their catalytic mechanisms (90). Some prokaryotes such as Pseudomonas aeruginosa encode one DDAH. However, there are two DDAH isoforms in , DDAH-1 and DDAH-2, which are mainly found in the cytosol (32). In addition, DDAH-1 was found in the nucleus (91). Two DDAH isoforms

12 have distinct tissue distributions. DDAH-1 is mostly found in the same tissue as nNOS and DDAH-2 is predominantly expressed in the cardiovascular system and is found in many of the same tissues as eNOS (92, 93). An amino acid sequence alignment of DDAH proteins is shown in Figure 1.5, with more than 90% identity within an isoform and ~50% identity between two isoforms (94). All DDAH isoforms share conserved active site residues, including Cys, Asp and His, though the details of the DDAH-2 catalytic mechanism are not clear.

Figure 1.5 Sequence alignment of DDAH.

13 The sequence alignment of mammalian DDAH sequences and the bacterial PaDDAH sequence (top, based on bacterial and mammalian enzyme structures). The line above the sequences indicates identical, “*”; positively charged, “+”; negatively charged, “-”; differently charged, “0”; tiny polar, “:”; tiny nonpolar, “◊”; aliphatic, “#”; and aromatic residues, “♦” in mammalian DDAH sequences. The green bars indicate residues involved in binding of L-citrulline, red residues indicate residues involved in conversion of the substrate, blue indicates amino acids in the lid region, and yellow indicates residues with a large deviation in Cα position between DDAH-1 and PaDDAH. ClustalW was used for the mammalian sequence alignments, whereas PaDDAH was structurally aligned to DDAH-1 (crystal form I). Figure adapted from (94)

The crystal structure of DDAH from Pseudomonas aeruginosa (PDB: 1H70) indicates PaDDAH is a homodimer with five-blade β/α-propeller topology and a made of Cys 249, His 162 and Glu 114 (95). Catalytic mechanistic study suggests a substrate-assisted cysteine deprotonation mechanism as shown in Figure 1.6. In this proposed mechanism, the binding of a cationic substrate such as ADMA depresses the pKa of Cys249 and triggers deprotonation and activation of this thiolate nucleophile (96). Alternatively, the substrate may preferentially bind to the relatively small Cys deprotonated fraction of the resting enzyme. The active-site His162 plays a dual role in this mechanism, where it first acts as a general acid to protonate the leaving group and subsequently as a general base to generate a hydroxide for hydrolysis of the covalent intermediate (96). These two amino acids provide a for the substrate and also inhibitory metal ions (ZnII) that can stabilize the active-site thiolate (96). The steady state rate constants for PaDDAH-catalyzed substrate hydrolysis are summarized in Table 1.2.

14

Figure 1.6 Proposed substrate-assisted mechanism of PaDDAH. Figure adapted from (96).

Table 1.2 Steady-state rate constants for DDAH-catalyzed hydrolysis of substrates. (Table reproduced from (90)).

15 -1 -1 -1 Substrate kcat (min ) KM (µM) kcat / KM (min mM )

L-argininea 0.10 ± 0.02 940 ± 50 0.11 ± 0.03

Nω-amino-L- 7.2 ± 0.1 1110 ± 60 6.5 ± 0.4 argininea

Nω-hydroxy-L- 20 ± 2 2300 ± 400 9 ± 2 argininea

NMMA, rat DDAHb 5.6 360 ± 10 16

NMMAa 18.6 ± 0.6 670 ± 60 28 ± 3

ADMA, rat DDAHb 9.2 180 ± 10 51

ADMAa 33.6 ± 0.6 310 ± 20 108 ± 9

SMTCa 50.4 ± 0.6 143 ± 5 350 ± 20 aReactions are carried out with Pa DDAH at 25 ºC and pH 6.2. bValues are from (85), and were determined with rat kidney DDAH at 37 ºC and pH 6.5.

Mammalian DDAH studies were first conducted with bovine DDAH-1, which was isolated from bovine brain (94, 97-99), and later conducted with recombinant human protein (100, 101). The X-ray crystal structure of mammalian DDAH-1 indicates a similar active site as that of PaDDAH despite low sequence identity (~30%) (94, 100). The overall fold of the enzyme consists of five repeats of a ββαβ motif, which is consistent with other proteins in the guanidine-modifying enzyme family. Mammalian

DDAH-1 was found to be inhibited by endogenous inhibitors such as L-Citrulline, Zn2+,

L-homocysteine, and S-nitroso-L-homocysteine (94, 99, 102, 103). L-citrulline can inhibit DDAH-1 activity via product accumulation. Zn2+ was found to bind to the active site of bovine DDAH-1 with apparent dissociation constant of 4.2 nM at 25 ºC, which is in the range of cytosolic Zn2+ concentration (103). L-homocysteine is a cardiovascular risk

16 factor and its elevation is usually associated with endothelial dysfunction such as , hypertension and diabetes (101). It is a reversible inhibitor of human DDAH-1 with Ki of 300 µM (101). S-nitroso-L-homocysteine (HcyNO) is an endogenous S-nitrosothiol and is a time-dependent inactivator of DDAH-1 with an inactivation rate constant of 3.79 M-1s-1 (101). HcyNO mediated inactivation gives a unique covalent N-thio-sulfoximide adduct in bovine DDAH-1 instead of the expected reversible S-transnitrosation adduct (98). Because NO overproduction can cause numerous disease states, it is important to find a way to decrease NO production. One direct way is through inhibitor development of NOS, but difficulties have been encountered in achieving isoform specificity, in targeting to specific locations and in ensuring that the correct degree of inhibition is achieved (104). Recently DDAH has been identified as a new target for regulating NO synthesis in humans. Experimental evidence indicates that pharmacological inhibition of DDAH causes a rise in ADMA/NMMA levels sufficient to block NO generation (105). The systemic inhibition of DDAH activity by small molecules leads an elevated ADMA/SDMA ratio in rat (106). Heterozygous Ddah1 gene knockout mice’s pulmonary and systemic vasculature has a consistent pattern of endothelial dysfunction (100). Over- expression of DDAH-1 isoform in transgenic mice result decreases in (107). DDAH-1 is also an important factor in tumor development. Overexpression of DDAH-1 in glioma tumors enhances tumor hypoxia through a stimulation of angiogenesis (108). Taken together, these evidences highlight the importance of DDAH as a potential target to control NO production related diseases in vivo.

17 1.3 TOWARDS FINDING INHIBITORS TO CONTROL DISEASES MARKED BY NO OVERPRODUCTION

NO overproduction is related to diseases such as arthritis, septic shock and cancer (Table 1.1). For example, in some cancers NO accelerates the production of ROS and/or RNS that exceed the cell’s anti-oxidant capacity, inhibit DNA-repair function and cell apoptosis, and ultimately favor carcinogenesis (41). Several therapeutic approaches have been taken to target NO production/activity (Table 1.3). These methods include 1) scavengers of NO/RNS, 2) inhibitors of NOS isoforms, and 3) repression of NOS expression by drugs, antisense oligo DNA (109) or RNA interference (110).

Table 1.3 Anti-NO drugs tested in cancer models (Table reproduced from (41)).

Drug Chemical name Effects Notes 2-phenyl-4,4,5,5- PTIO tetramethyl imidazoline-1- NO scavenger Nitronyl nitroxide oxyl-3-oxide that inactivates NO by oxidative transformation to

nitric dioxide (NO2) and imino nitroxides (111) 2-4-carboxyphenyl-4,4,5,5- c-PTIO tetramethyl imidazoline-1- Water-soluble oxyl-3-oxide derivative of PTIO (6, 14, 112)

Ebselen 2-phenyl-1,2- Clinically benzisoselenazol-3(2H)- investigated for one stroke treatment glutathione- 18 peroxidase mimetic; orally available (6, 14, 112) Under clinical Curcumin Diferuloylmethane NO scavenger and investigation as anticancer agent; no NOS inhibitor toxicity in humans; (isoenzyme non- orally available inhibits COX, specific) favors apoptosis (113) L-arginine analogue; ω L-NAME N -nitro-L-arginine- NOS inhibitor side-effects in humans: methyl-ester (isoenzyme hypertension; may nonspecific) interfere with urea cycle; orally available (114-116)

L-NMMA Nω-monomethyl-L- (117) arginine-acetate

L-NNA Nω-nitro-L-arginine (118, 119)

AMG Aminoguanidine iNOS-specific Orally available inhibitor (120)

MEG Mercaptoethylguanidine (6, 112)

1400W N-[3- (50, 56) (aminomethyl)benzyl] acetamidine

PBIT S,S’-1,4-phenylene-bis-1,2- iNOS-specific Non-amino acid

ethanediyl-bis-isothiourea inhibitor analogue of L- arginine; orally available (121, 122)

19 L-NIL L-N(6)-1-iminoethyl-lysine Structural analogue

of L-arginine (6, 112)

SC-51/NILT L-N(6)-1-iminoethyl-lysine Prodrug of L-NIL tetrazole-amide (122) Allosteric inhibitor BIPPA N-(1,3-benzodioxol-5-yl- of iNOS dimerization; 1000- methyl)-l-(2-1Himidazol- fold more potent 1yl)pyrimidin-4yl)-4- than 1400W and L- NMMA (6, 14, 112) methoxy carbonyl- piperazine-2-acetamide (2E)-3-(4-chlorophenyl)- Inhibits iNOS FR260330 N-[(1S)-2-oxo-2{[2-oxo-2- dimerization; does (4-{[6-(trifluoromethyl)-4- not change arterial pyrimidinyl]oxy}-1- pressure in mice (6, piperidinyl)ethyl] amino}- 14, 112) 1-(2- pyridinylmethyl)ethyl] acrylamide 2-cyano-3,12-dioxooleana- CDDO-ME 1,9(11)-dien-28-oic acid Both iNOS and (CDDO) methyl ester COX (cyclo- oxygenase) inhibitors (123)

CDDO-IM CDDO-Imidazolide (123) Cell-permeable Cavtratin eNOS-specific peptide derived from caveolin-1 inhibitor (putative scaffolding domain, amino acids 82–101) (124) Competitive ODQ 1H-1,2,4-oxadiaxolo-4,3-a- Soluble guanylyl inhibitor of NO binding to the heme quinoxalin-1-one cyclase (sGC) 20 group of sGC; ↓ inhibitor cGMP-dependent pathways (125, 126) Both already Anti-sense Isoenzyme-selective implemented in clinical trials for the DNA, RNA inhibition of NOS treatment of various interference expression diseases (14)

Among NO-scavengers, PTIO reduces cancer-related vascular hyperpermeability (127) and inhibits melanoma cell proliferation (128). Ebselen inhibits matrix- metalloproteinase production by malignant cells (129). Curcumin is a polyphenolic phytochemical with powerful anti-inflammatory properties (113). It is both a NO- scavenger and an inhibitor of iNOS expression through inhibition of NFkB activation (130). In preclinical in vivo models, curcumin is shown to inhibit colon cancer development (131).

Several L-arginine analogues are effective inhibitors of NOS isoforms though their inhibition usually lacks selectivity. The use of NOS-inhibitors as tumor-selective, anti-angiogenic agents is supported by several reports in the literature (16, 132, 133). For

example, L-NAME treated mice have reduced total mass of viable tissue (stroma and tumor cells) and neo-vascularization in a murine breast cancer model compared to the inactive enantiomer D-NAME (114, 115). It suggests that NO is a key mediator of tumor- induced angiogenesis and the antitumor activity of L-NAME is at least partly due to its ability to interfere with the angiogenic pathway. NOS isoform-selective inhibitors are designed mainly based on distinct arginine- binding domains for the three NOS isoforms. Some inhibitors, such as 1400W, achieve selectivity over iNOS by the high turnover of iNOS compared with other isoforms (8). CDDO, a potent inhibitor of both iNOS and cyclo-oxygenase (COX), shows significant antitumor activity in an in vivo lung cancer murine model (123). 1400W inhibits both the 21 NO-mediated overproduction of angiogenic factor prostaglandin-E2 (56) and the growth of solid murine tumors expressing iNOS (50). In colon cancer models, iNOS-specific inhibitors (AMG, PBIT, SC-51) significantly decrease the rate of development of colon carcinoma premalignant lesions (120, 122, 134). Recently DDAH targeted inhibitor development has given several hits. All inhibitor chemical structures are listed in Table 1.4. In the category of reversible inhibitors, NG-(2-methoxyethyl)-L-arginine and its methyl ester are reversible inhibitors

of human DDAH-1 with a half-maximal inhibitory concentration (IC50) of 22 µM (100). Neither compound has direct inhibitory activity against NO synthase (NOS). Treatment of mice with these two compounds increases the ADMA concentration in plasma of 0.2- 0.6 µmol/liter, an increase similar to the patients with multiple cardiovascular risk factors (100, 135). Kotthaus et al. recently reported a series of alkenyl-amidines capable of dual

reversible inhibition of human DDAH and NOS, of which N5-(1-imino-3-butenyl)-L- ornithine is the most potent (Ki,DDAH-1 = 2 μM; Ki,nNOS = 90 nM) (136, 137). Another set of alkylamidine inhibitor was also reported to inhibit human DDAH-1 and NOS reversibly and competitively (138). Stepwise lengthening of alkyl substituent converts an NOS selective inhibitor into a dual targeted NOS/DDAH-1 inhibitor then into a DDAH-1 selective inhibitor. N5-(1-iminopentyl)-L-ornithine is the most potent DDAH inhibitor

with Ki,DDAH-1 = 7.5 μM; Ki,nNOS = 20 nM (138). There are several common

chemical features of these successful substrate-based DDAH inhibitors: 1) Both α-NH2 and α-COOH moieties are important for substrate/inhibitor binding to the active-site pocket. Studies indicate that modification of α-NH2 results a loss of inhibitory potential (106). 2) Side chain length is essential for the binding of inhibitors to the DDAH active site. A smaller side chain will limit this ability to react/bind (98). 3) It is critical to have

an S isomer in the Cα position. Another type of DDAH reversible inhibitor is a

22 pentafluorophenyl (PFP)-sulfonate (IC50: 16~58 µM), which is a non-substrate-like Pseudomonas aeruginosa DDAH inhibitor and is also able to inhibit ADI (arginine deiminase) (139). Virtual screening also identified an indolylthiobarbituric acid scaffold that is able to inhibit PaDDAH (IC50: 2 µM) (140). Besides reversible inhibitors, several irreversible inhibitors have been discovered for DDAH (Table 1.4). 2-Chloroacetamidine (CAA) was found to be a time- and concentration-dependent mechanism based inhibitor for Pseudomonas DDAH and human

-1 peptidylarginine deiminase (PAD4) with KI and kinact of 3.1 ± 0.8 mM and 1.2 ± 0.1 min

-1 for DDAH and KI and kinact of 20 ± 5 mM and 0.7 ± 0.1 min for PAD4 (141). CAA mediated DDAH inhibition forms an acetamidine adduct at the active site Cys249 of

PaDDAH (141). S-nitroso-L-homocysteine (HcyNO) was found to inactivate human DDAH-1 with second order rate constant of 3.79 ± 0.06 M-1s-1 (101). This inactivation happens at the active site Cys274 and form a covalent N-thiosulfoximide adduct (98). Surprisingly, the inactivation rate constant is ~43 fold faster than inactivation rate by

H2O2, and is on the same order of magnitude as modification of redox-regulated Cys- dependent enzymes by small molecule nitrosothiols (101). The unexpected insensitivity

of DDAH to H2O2 mediated inactivation might because the high pKa of the active site Cys in the resting enzyme. Protonated thiols are less susceptible to oxidation than anionic thiolates (142). 4-Hydroxy-2-nonenal (4-HNE) is a highly reactive small molecule coming from free radical oxidation of polyunsaturated fatty acid (143). It can modify human DDAH-1 at pathologically relevant concentrations (IC50 ~ 50 µM) and form Michael adducts at His15 and His173 (143).

Table 1.4 Representative reversible and irreversible inhibitors discovered for DDAH.

23 Inhibitor Source Name Chemical Structure IC50 Ki, kinact

type range

(µM)

Reversible Human NG-(2- 22 -

methoxyethyl)-L-

arginine (100)

Human N5-(1-imino-3- - 2 µM

butenyl)-L-ornithine

(137)

Human N5-(1-iminopentyl)- - 7.5 µM

L-ornithine (138)

P. Indolylthiobarbituric 2 -

aeruginosa acid (140)

P. Pentafluorophenyl 16 - -

aeruginosa (PFP)-sulfonate 58

(139)

- Irreversible Human S-nitroso-L- - 3.79 M

homocysteine (101) 1s-1

Human 4-hydroxy-2- 50 -

nonenal (143)

24 P. 2-chloroacetamidine - 3.1 mM,

aeruginosa (141) 1.2 min-1

Despite this progress in DDAH inhibitor development, further efforts are still needed to discover better DDAH inhibitors with increased potency bioavailability as reagents to control and study NO overproduction. This is also the long-term goal of my Ph.D. study in the Medicinal Chemistry program of UT-Austin. In the following chapters, I will first describe how human DDAH-1 performs its catalysis. Then I will screen a set of known NOS inhibitors to find compounds that can inhibit DDAH-1. Finally, I will use a click-chemistry based activity probe to develop a DDAH inhibitor screening method in live mammalian cells, which takes compound bioavailability and cellular environment into consideration. Hopefully these studies will contribute to the understanding of human DDAH-1 and serve as a foundation for future drug development.

25 Chapter 2: Catalytic Participation of Human DDAH-1 in its Own Inactivation by S-Nitroso-L-Homocysteine

2.1 INTRODUCTION

Nitric oxide (NO) is a second-messenger that regulates many physiological

functions. It is produced from L-arginine by nitric oxide synthases (NOS) and is critical to biological processes such as vasodilatation, neurotransmission, and antibacterial defense (64). Among these functions, NO is most famous for its ability to relax smooth muscle in endothelial cells, which decreases blood pressure. Besides vasorelaxation, -derived NO also has other functions such as inhibition of vascular inflammation (144, 145), prevention of the platelet adhesion and aggregation (146, 147), and induction of apoptosis in proliferating vascular smooth muscle and inflammatory cells (148, 149). Because endothelium-derived NO is a vasoprotective substance that maintains the circulation system in a relaxed and quiescent state, dysregulation of NO synthase (NOS) pathway is often associated with various endothelial dysfunction diseases such as hypercholersterolemia, hypertension, diabetes and hyperhomocysteinemia (10, 150). These diseases and risk factors are usually accompanied by elevated plasma levels

of endogenous NOS inhibitors such as asymmetric Nω, Nω-dimethyl-L-arginine (ADMA) (151, 152). ADMA was first recognized as an endogenous inhibitor of NOS in patients

with renal failure. Together with another monomethylated analog NMMA (Nω-methyl-L- arginine), they are the products of degradation of various Arg-methylated proteins such as histone and are competitive inhibitors of NOS (74, 75). Taken together, ADMA is an endogenous regulator of NO synthesis that associates with endothelial dysfunction. Hyperhomocysteinemia is a pathological condition where the plasma total homocysteine (tHcy) level is elevated (153). Plasma tHcy is a mixture of homocysteine,

26 homocysteine thiolactone and its derivatives, which include homocysteine, homocysteine-cysteine mixed disulfide, and protein-bound disulfide (154). In Western populations, moderate hyperhomocysteinemia usually has a plasma tHcy level between 15 and 50 µM, which is associated with increased risk of stroke, , peripheral vascular disease, and venous thrombosis (155, 156). Adverse vascular effects of Hcy may result from the generation of reactive oxygen species (ROS) as a consequence of autoxidation of its sulfhydryl group and/or decrease in endothelial NO bioavailability (157, 158). The mechanism for decreased bioavailability of NO is not fully understood and may be multi-factorial. One possible mechanism is via the formation of S-nitroso-L-homocysteine (HcyNO) (157, 158). Another possibility is through the inhibition of eNOS activity by its endogenous inhibitor ADMA (153). ADMA may also promote eNOS ‘uncoupling’, which leads to increasing production of superoxide and other reactive oxygen species and causes further decrease in NO bioavailability (153). A potential bridge between ADMA and hyperhomocysteinemia is the enzyme dimethylarginine dimethylaminohydrolase (DDAH), which hydrolyzes ADMA to the

non-inhibitory (or less inhibitory) product L-citrulline thus relieving eNOS inhibition. In hyperhomocysteinemia, it was found that up-regulated tHcy can posttranslational modify DDAH and further cause ADMA accumulation (159). Dimethylarginine

dimethylaminohydrolase (DDAH) is a member of the pentein superfamily, which includes guanidine-modifying enzymes that are able to catalyze nucleophilic substitution

reactions at the guanidinium carbon atom of L-arginine or an L-arginine derivative (160). Recently DDAH was identified as a new target to regulate NO synthesis. Experimental evidence indicate that pharmacological inhibition of DDAH causes a rise in ADMA/MMA levels sufficient to block NO generation (105). The systemic inhibition of

27 DDAH activity by small molecules leads an elevated ADMA/SDMA level in rat (106). Heterozygous ddah1 gene knockout mice’s pulmonary and systemic vasculature has a consistent pattern of endothelial dysfunction (100). Over-expression of the DDAH-1 isoform in transgenic mice results in decreases in blood pressure as predicted (107). Taken together, these evidences highlight the importance of DDAH in controlling ADMA, NO and vasodilation in vivo. DDAH is present in some prokaryotic and some eukaryotic cells. There is only one DDAH isoform in Pseudomonas aeruginosa, which shares a similar overall structural fold and active site cleft with mammalian DDAH-1 despite low sequence identity (94). Pseudomonas DDAH (PaDDAH) is proposed to use a substrate-assisted cysteine deprotonation mechanism that goes through an DDAH-alkythiouronium intermediate in

its catalytic cycle (90, 96). Briefly, cationic substrate binding can lower the pKa of active site cysteine Cys249 and let it serve as a thiolate nucleophile. His162 first acts as a general acid to protonate the leaving group and then serves as a general base to generate a hydroxide for hydrolysis of the covalent intermediate (96). Mutations to alanine of the corresponding Cys and His in human DDAH-1 (hDDAH-1) result no detectable activity, suggesting it may adopt a similar mechanism as PaDDAH (101). Elevated tHcy levels in hyperhomocysteinemia have been proposed to increase

plasma ADMA levels by inhibiting DDAH activity, though the mechanism is unclear. L-

Hcy is a reversible inhibitor for DDAH-1 with a Ki of 300 µM (101). In addition, Hcy can also cause a decrease in DDAH expression levels. For example, mice with hyperhomocysteinemia have decreased levels of mRNA for DDAH-1 and DDAH-2 (161). Other possible mechanisms for Hcy mediated DDAH inhibition include the association of Hcy with reactive oxygen and nitrogen species and with zinc ions released during (32, 159).

28 Recent studies reveal that S-nitro-L-homocysteine (HcyNO) is a human DDAH-1 inhibitor (98). HcyNO is an S-nitrosothiol formed from endogenous Hcy. S-Nitrosothiols, such as S-nitroso-L-cysteine (CysNO) and S-nitrosoglutathione (GSNO), are involved in many biological functions such as NO storage, transport, and delivery (162-164). Different than some other S-nitrosothiols such as GSNO and S-nitroso-N- acetylpenicillamine, HcyNO can be taken up into cells via the amino acid transport system L (165) and can release NO in the presence of Cu+, ascorbate, or thiols (164). HcyNO can also undergo S-transnitrosation reactions which are the direct transfer of NO+ equivalents between RSNO and RSH. This reaction is an important protein function regulation mechanism through specific Cys modification (164). In bovine DDAH-1, HcyNO mediated inactivation forms an unusual N-thiosulfoximide adduct with a 164 Da mass increase observed by ESI-MS (98). HcyNO also inactivates human DDAH-1

(hDDAH-1) with a second order rate constant of 3.79 M-1s-1, which is more potent than

-1 -1 another powerful oxidant H2O2 (0.088 M s ) (101). The formation of a N- thiosulfoximide adduct between HcyNO and bovine DDAH-1 is unique, where other endogenous S-nitrosothiols such as CysNO and GSNO can not form the same adduct with bovine DDAH-1 (166). Similarly, HcyNO cannot form a N-thiosulfoximide adduct with cytidine triphosphate synthetase (CTPS), which is an enzyme with a similar active site structure as DDAH-1 (166).

In this chapter, I studied the hDDAH-1 catalytic mechanism using human DDAH- 1 active site mutants, where I did steady-state kinetics analysis and acid trapping assay to analyze how active site amino acids participate in DDAH-1 catalysis. In addition, I studied the inactivation of hDDAH-1 by HcyNO, which may be an endogenous DDAH-1 regulation mechanism in humans. The previously proposed inactivation mechanism with bovine DDAH-1 may be incomplete, considering the facts that hydroxyl groups are not

29 good leaving group, and the unactivated water is not a good nucleophile. It is highly possible that this unique HcyNO mediated adduct formation in bovine DDAH-1 needs active site amino acids’ participation. Our studies of HcyNO inactivation of human DDAH-1 variants reveal a possible endogenous human DDAH-1 regulation pathway and give insight to its catalytic mechanism. This study will also help us to understand how hDDAH-1 performs its catalysis and serve as a guide for designing human DDAH-1 inhibitors.

2.2 MATERIAL AND METHODS

Construction of human DDAH-1 (hDDAH-1) variants. pET28a-hDDAH-1re plasmid was constructed based on pET28a-hDDAH-1 in order to avoid spontaneous N- terminal His tag gluconoylation as described in (138). The N-terminal sequence of pET-

hDDAH-1 is changed from MGSSH6 to MPH6 as suggested by Geoghegan et al (167). This construction successfully removed the minor +177 Da gluconylation peak in ESI- MS. All mutants used in this paper were made by QuikChange site-directed mutagenesis kit (Stratagene). hDDAH-1 H173A, C274A and C275A mutants were made based on N- terminal sequence unchanged pET28a-hDDAH-1 as described in (101). Other mutants, which include Leu30A, Glu78A, Asp79A, Asp127A, Arg145A, Ser176A and Leu271G, were all constructed using pET28a-hDDAH-1re as template. Briefly, seven pairs of oligonucleotides for these mutants are: 5’-CCAGCACGCGGCGAGAAGCGCC-3' and 5' GGCGCTTCTCGCCGCGTGCTGG-3’; 5’- CGTCTTCGTGGCGGACGTGGCCGTGGTGTGC-3’ and 5’- GCACACCACGGCCACGTCCGCCACGAAGACG-3’; 5'- CGTCTTCGTGGAGGCCGTGGCCGTGGTGTGC-3’ and 5’- GCACACCACGGCCACGGCCTCCACGAAGACG-3’; 5'- GATGAAAATGCAACTTTAGCTGGCGGAGATGTTTTATTCACAGG-3' and 5’- 30 CCTGTGAATAAAACATCTCCGCCAGCTAAAGTTGCATTTTCATC-3’; 5’- GTGGGCCTTTCCAAAGCGACAAATCAACGAGGTGC-3’ and 5’- GCACCTCGTTGATTTGTCGCTTTGGAAAGGCCCAC-3’ ； 5'-

GGCAGATGGGTTGCATTTGAAGGCTTTCTGCAGCATGGCTGGGCC-3’ and 5'- GGCCCAGCCATGCTGCAGAAAGCCTTCAAATGCAACCCATCTGCC-3’; 5'- GGTGGATGGGGGGCTCACCTGCTGC-3' and 5'- GCAGCAGGTGAGCCCCCCATCCACC-3' were used to construct mutants Leu30A, Glu78A, Asp79A, Asp127A, Arg145A, Ser176A and L271G (mutations underlined), respectively. The PCR reaction mixture contains the parent plasmid, the oligonucleotide pair primers, a dNTP mixture and pfuTurbo DNA polymerase in the manufacturer’s buffer (Stratagene). The site-directed mutagenesis procedure to construct these mutants is the same as described in (138). Mutated plasmids sequences were verified by fully DNA sequencing the insert and surrounding sequences (DNA Facility, University of Texas at Austin). Expression and purification of hDDAH-1 variants. Wild-type, L30A, E78A, D79A, D127A, R145A, S176A and L271G hDDAH-1 proteins were purified according to the procedure described in (138). H173A, C274A and C275A hDDAH-1 were purified according to the procedure published in (101). In HcyNO modification experiment, H173A, C274A and C275A hDDAH-1 were subjected to thrombin His tag cleavage to remove the N-terminal His tag gluconoylation peak before reaction with HcyNO. Briefly,

the N-terminal His6 tag of wild-type and mutant hDDAH-1 was cleaved using a thrombin cleavage kit (Sigma-Aldrich) according to the manufacturer’s protocol. The enzyme was incubated with agarose-linked thrombin in a proportion of 100 μl of agarose-thrombin for

1 mg enzyme in digestion buffer (50 mM Tris.HCl, 10 mM CaCl2, pH 8.0) for 16 h at room temperature. Ni-NTA resin (Qiagen) was then added to the digestion mixture in a

31 ratio of 100 μl of resin for 1 mg protein. The mixture was incubated with gentle shaking for 1 h at 4 °C. The agarose-linked thrombin and Ni-NTA resin were spun down by centrifugation at 500 g for 5 min. The supernatant was buffer exchanged to 100 mM

KH2PO4 buffer, pH 7.5 using Amicon ultra-15 (Millipore, 10 kD cutoff) according to the manufacturer’s instruction. Each purified hDDAH-1 variants were verified by SDS-PAGE and subjected to ESI-MS analysis (Analytical Core Facility, College of Pharmacy, The University of

Texas at Austin) and gave their expected masses (all in Da): Wild-type: MWcalc = 33,311,

MWexptl = 33,305; L30A: MWcalc = 33,269, MWexptl = 33,263; E78A: MWcalc = 33,253,

MWexptl = 33,247; D79A: MWcalc = 33,267, MWexptl = 33,260; D127A: MWcalc = 33,267,

MWexptl = 33,262; R145A: MWcalc = 33,226, MWexptl = 33,220; H173A: MWcalc =

33,375, MWexptl = 33,373; H173A (N-terminal cleaved): MWcalc = 31,624, MWexptl =

31,619; S176A: MWcalc = 33,311, MWexptl = 33,288; L271G: MWcalc = 33,245, MWexptl =

33,247; C274A: MWcalc = 33,409, MWexptl = 33,408; C274A (N-terminal cleaved):

MWcalc = 31,658, MWexptl = 31,653; C275A: MWcalc = 33,409, MWexptl = 33,407;

C275A (N-terminal cleaved): MWcalc = 31,658, MWexptl = 31,653. Protein concentrations were determined based on absorption at 280 nm using extinction coefficient (7,680 µM-1cm-1 for wild-type) as described in (138). Steady-state kinetic studies. A discontinuous assay based on

diacetylmonoxime derivatization of the product L-citrulline was used to determine the

steady-state kinetic constants for Nω, Nω-dimethyl-L-arginine (ADMA, Sigma-Aldrich, MO) hydrolysis as described in (168). A continuous spectrophotometric assay based on 5, 5’ –dithiobis(2-nitrobenzoic acid) (DTNB) derivation of the methanethiol product was

used to measure steady-state kinetic constants for S-methyl-L-thiocitrulline (SMTC, Sigma-Aldrich, MO) as described in (138). Both measurements were performed at room

32 temperature 25°C. KaleidaGraph software (Synergy Software, Reading, PA) was used to fit observed rates at various substrate concentrations to the Michaelis-Menten equation.

Preparation of L-homocysteine. L-homocysteine (Hcy) was prepared from L- homocysteine thiolactone hydrochloride (Fluka) according to method as described (98).

Briefly, 0.2 mmol (30.6 mg) L-homocysteine thiolactone was dissolved in 200 μl 5 M NaOH and the solution was incubated at 37 °C for 5 min. Follow then the pH was neutralized by addition of 2 M HCl. Finally the volume was adjusted to 1 ml by addition of 50 mM NH4Ac/NaOH (pH 7.0). The product was analyzed by a Varian Unity 300 MHz spectrometer (Department of Chemistry and Biochemistry, University of Texas at

1 1 Austin). H NMR was obtained upon addition of 10% (v/v) D2O ( H NMR: 300K, 300.1 MHz; δ 3.95 (t, J = 6.4 Hz, 1H), 3.81 (d, J = 1.5 Hz, 1H), 2.67 (td, J = 7.3, 1.5 Hz, 2H), 2.2 (m, 2H). The amount of -groups generated was quantified by UV-Vis absorption measurements at 343nm using 2,2’-dithiodipyridine in 0.2 M NaOAc/HOAc (pH 4.0), 1 mM EDTA as described in (169). The final yield of this reaction is ~ 95%.

Preparation of S-nitroso-L-homocysteine. S-nitroso-L-homocysteine (HcyNO) was prepared as described (98, 170). Briefly, 40 μl of the Hcy solution prepared as described above (0.2 M) was mixed with an equal volume of 0.2 M NaNO2. After acidification with 100 μl of 2 M HCl, the solution immediately turned red. Incubation was continued for 15 min at room temperature to let it finish completely. The final

1 1 product was characterized by H NMR spectroscopy. H NMR (D2O): δ 2.05 (2H, m, 3- H), 3.55 (2H, m, 4-H), 3.97 (1H, t, J = 6.2 Hz, 2-H). 106.7 μl buffer containing 100 mM HEPES/NaOH, 10 mM EDTA (pH 7.3) was then added to reaction mixture. Thiolate detection with 2, 2’-dithiopyridine reveals no detectable SH groups (< 0.1% residual Hcy) left in the reaction mixture. The final HcyNO concentration was estimated by

-1 -1 reading UV-Vis absorbance at 545nm (ε545 = 16.7 M cm ) (170).

33 Reaction of hDDAH-1 variants with HcyNO. HcyNO was always freshly prepared according to procedure above in all experiments. 17.2 μM wild-type, L30A, E78A, D79A and R145A, H173A, S176A, L271G, C274A and C275A hDDAH-1 were incubated with 2.5 μl 39.76 mM HcyNO (1 mM final concentration) at 37 °C 30 min (100 μl total volume) in buffer containing 100 mM HEPES/NaOH, 10 mM EDTA (pH

7.3). 100 μl reaction mixtures were then buffer exchanged to 20mM NH4Ac/NH3 (pH 7.4) using Amicon YM10 membrane (Millipore, MA) to remove any unreacted HcyNO. Finally HcyNO-hDDAH-1 reaction adducts were collected in ~100 μl volume. 20 μM of cleaved H173A, C274A and C275A hDDAH-1 were incubated with 1 mM HcyNO in 100 mM KH2PO4, 5 mM EDTA, pH 7.5 for 30 min at 37 °C. The reaction was either quenched with 80 mM TFA or immediately buffer exchanged to 50 mM

NH4OAc, pH 7.0 using a micro Bio-spin 6 column (Bio-Rad, Hercules, CA). These samples were frozen at -80 °C and submitted to LC-ESI-MS analysis (The University of Texas at Austin, CRED Analytical Instrumentation Facility Core). Acid quench of covalently modified hDDAH-1 variants. To characterize a covalent enzyme-substrate intermediate that might accumulate during steady-state reactions, ADMA and SMTC were incubated with hDDAH-1 variants respectively for

different time lengths and then quenched with acid during turnover. Typically, 69 μM protein was mixed with 50 mM ADMA or SMTC in DDAH assay buffer (0.1 M

KH2PO4, 1 mM EDTA, pH 7.27) in 100 μl total volume. Reactions mixtures were incubated for different time (eg: 2 min, 5 min, and 15 min) at 25°C, followed by quenching with 1 M trifluoroacetic acid to a final concentration ~80 mM. Samples were

directly frozen at -80°C and subjected to LC-ESI-MS analysis. LC-ESI-Mass spectrometry analysis. LC-ESI-Mass spectrometry analysis was performed by Dr. Stony Lo in the CRED Analytical Core, College of Pharmacy, UT-

34 Austin. An electrospray ion trap mass spectrometer (LCQ, Finnigan MAT, San Jose, CA) coupled on-line with a microbore HPLC (Magic 2002, Michrom BioResources, Auburn, CA) was used to acquire spectra of proteins. Protein sample was loaded through a protein desalt trap (Michrom BioResource) and desalted by 4 x 50 µL of mobile phase A (acetonitrile : water : acetic acid : trifluoroacetic aicd, 2:98:0.1:0.02) then injected into microbore HPLC. Protein was eluted with a 0.5 x 50 mm PLRP-S column (8 μm particle diameter, 4000 Å pore size; Michrom Bioresources, Auburn, CA) with mobile phase A and B (acetonitrile : water : acetic acid : trifluoroacetic acid, 90:10:0.09:0.02). The gradient used to elute protein was from 5% to 95% of mobile phase B in 10 min followed by 95% B for 5 min at a flow rate of 20 µL/min. Some of the protein samples were eluted with 50% B (40 μl/min) into LCQ without a column. Automated acquisition of full scan MS spectra was executed by Finnigan ExcaliburTM software. The settings for the ESI were as follows: spray voltage, 4.5 kV; nitrogen sheath gas and auxiliary gas flow rates, 60 and 5 psi, respectively; capillary temperature, 200 °C; capillary voltage, 22 V; tube lens offset, 40V. The electron multiplier was set at -860V; the scan time setting was performed with 50msec of max injection time for full scan. The target number of ions for MS was 1e8. The full scan range for MS was 150-2000Da. The acquired convoluted protein spectra from LCQ were deconvoluted by the Finnigan-MAT BIOWORKS software to afford the MH+ m/z value(s) of the protein sample.

MALDI-TOF analysis of modified peptide in human DDAH-1 and Pseudomonas aeruginosa DDAH 150 µM PaDDAH, PaDDAH C249S, hDDAH-1, hDDAH-1 C274A and hDDAH-1 C275A were reacted with 8 mM HcyNO in buffer containing 100 mM HEPES/NaOH, 10 mM EDTA, pH 7.3 at 37ºC, 30 min (100 µl total reaction volume). 100 µL reaction mixtures were then buffer exchanged five times to 50 mM NH4Ac/NH3 (pH 4) using Amicon YM10 membrane (Millipore, MA) to remove any

35 unreacted HcyNO. The resulting product was subsequently digested with Glu-C endoproteinase (Roche, Indianapolis, IN) in a 20:1 (w/w) ratio for 18 h at room temperature. The digested peptides were subjected to MALDI-TOF/TOF analysis by Dr. Maria Person in the CRED Analytical Core, College of Pharmacy, UT-Austin. Digestion products were desalted with a μ-C18 ziptip (Millipore) and analyzed using MALDI- TOF/TOF on an Applied Biosystems 4700 Proteomics Analyzer system using α-cyano-4- hydroxycinnamic acid as the matrix as previously described (171). Theoretical digest masses were calculated with MS-Digest in the Protein Prospector suite using two missed cleavages and peptide fragmentation masses calculated with MS-Product (172). UV-Vis spectroscopy of HcyNO modified hDDAH-1. 267.2 μM hDDAH-1 wt, 284 µM freshly prepared HcyNO and 211.6 μM HcyNO modified hDDAH-1 after buffer exchange were used to measure UV-Vis spectra from 240 nm to 500 nm using a Nanodrop ND-1000 spectrophotometer, where l = 0.1 cm. Results were plotted by Kaleidagraph and absorbances at 330 nm were recorded. Concentration of HcyNO was

-1 -1 calculated based on ε330 = 915 M cm (173). Any possible S-nitrosocysteine (CysNO)

-1 -1 formation was calculated based on ε330 = 594 M cm (173).

2.3 RESULTS AND DISCUSSION

hDDAH-1 uses D79, D127, H173 and C274 to form a catalytic center. hDDAH-1 catalyses the hydrolysis of Nω-monomethyl-L-arginine (NMMA) and Nω,Nω -

dimethyl-L-arginine (asymmetric dimethylarginine, ADMA), which are endogenous inhibitors for human nitric oxide synthase. The accumulation of these methylated arginines, especially ADMA, is an important mechanism to regulate NO production and related to pathology such as renal failure, hypertension and hypercholesterolaemia (82, 174, 175). Here we assayed hDDAH-1 catalytic activity in vitro by using ADMA as its representative natural substrate. The discontinuous colorimetric assay we used is based 36 on diacetylmonoxime derivatization of hydrolysis product L-citrulline (168). In addition, an artificial substrate S-methyl-L-thiocitrulline (SMTC) was used to determine hDDAH-1 variants steady-state kinetic constants. SMTC is similar in structure and charge (the pKa of S-methylthiourea is 9.8) to ADMA (the pKa of N, N’-dimethylguanidine is 13.6) (176). 5,5′-dithiobis(2-nitrobenzoic acid) (DTNB) is used to follow methanethiol production during SMTC based catalysis turnover in a continuous spectrophotometric assay (177). To characterize hDDAH-1 active site residues’ participation in its catalysis and its inactivation by HcyNO, Ala/Gly mutations were made at ten amino acids surrounding hDDAH-1 active site based on the X-ray structure of bovine DDAH-1 (Figure 2.1). These amino acids include: Leu30, Glu78, Asp79, Asp127, Arg145, His173, Ser176, Leu271, Cys274 and Cys275. These mutants were purified and subjected to steady-state kinetic assay using substrate ADMA and SMTC. Among these ten mutants, only four of them show nearly completely activity loss, which includes Asp79, Asp127, His173 and Cys274, suggesting the formation of a catalytic center. As a first complete exploration for human DDAH-1 active site residues, this data confirms the hypothesis of Cys274, Asp127 and His173’s involvement in mammalian DDAH-1 catalysis based on sequence alignment and an X-ray structural study (94). Additionally, Asp79, which forms hydrogen bonds with N atom in substrates’ guanidino group, is first revealed as a critical functional amino acid in human DDAH-1 catalysis. We propose Cys274 acts as an active-site nucleophile residue. His173 and Asp127 form a salt bridge contributing to proton shuffling during DDAH-1 catalysis.

37

Figure 2.1 X-ray crystal structure of bovine DDAH-1 with (A) product (L-citrulline) bound and (B) covalent adduct bound (N-thiosulfoximide) complexes. Orange circles indicate amino acids that have been mutated to Alanine in human DDAH-1. Not all mutated amino acids are listed in this figure (Figure adapted from (94)).

All kinetic constants are summarized in Table 2.1. Because kcat/Km is a second- order rate constant for the reaction between substrate and free enzyme which indicates the degree that the enzyme and substrate can accomplish when there are abundant enzyme sites, we use it for direct comparison of the effectiveness of different enzyme toward same substrate and same enzyme toward different substrate. Results indicate

SMTC is a better substrate than ADMA for hDDAH-1, which gives approximately 100

fold larger kcat/Km. The turnover number difference between two substrates is more significant in human DDAH-1 than previously reported in PaDDAH, where turnover number for SMTC is about 3 fold of ADMA in PaDDAH (90). This effect is probably due to the presence of an activated methane thiol leaving group in SMTC instead of the alkylamine leaving group in ADMA (90).

Table 2.1 Steady-state kinetic parameters of hDDAH-1 catalysis 38 a -1 Source Variant Substrate kcat (min ) Km (μM) kcat/Km

(min-1mM-1)

Humanb WT ADMAc 0.86 ± 0.02 110.2 ± 13.5 7.8 ± 1.1

SMTCd 2.51 ± 0.03 3.14 ± 0.26 800 ± 76

L30A ADMA 1.01 ± 0.06 1400.8 ± 248.0 0.7 ± 0.2

SMTC 2.51 ± 0.02 3.58 ± 0.21 701 ± 47

E78A ADMA 0.09 ± 0.01 13659 ± 2717 0.007 ± 0.002

SMTC 1.75 ± 0.53 18.55 ± 2.53 94 ± 37

R145A ADMA 0.015 ± 564.2 ± 94.9 0.03 ± 0.006

0.0007

SMTC 0.2 ± 0.003 1.5 ± 0.2 133 ± 19

S176A ADMA 0.24 ± 0.007 301 ± 39 0.8 ± 0.1

SMTC 0.2 ± 0.004 0.7 ± 0.1 286 ± 46

L271G ADMA 0.52 ± 0.014 746.3 ± 68.6 0.7 ± 0.1

SMTC 0.58 ± 0.012 1.4 ± 0.2 414 ± 68

C275A ADMAf 0.93 ± 0.07 350 ± 40 2.7 ± 0.5

SMTC 0.17 ± 0.003 0.9 ± 0.1 189 ± 24

D79A ADMA NDe ND ND

SMTC ND ND ND

D127A ADMA ND ND ND

SMTC ND ND ND

H173A ADMAf ND ND ND

39 SMTC ND ND ND

C274A ADMAf ND ND ND

SMTC ND ND ND

a Nω,Nω–dimethyl-L-arginine (ADMA); S-methyl-L-thiocitrulline (SMTC).

b This study was done at pH 7.27 and 25 °C.

c All kinetic constants for ADMA were measured by discontinuous assay

(Material and Methods).

d All kinetic constants for SMTC were measured by continuous assay (Material

and Methods).

e None detected (ND) above background (< 0.0005 s-1).

f From (101), at pH 7.5 and 24 °C.

Other active site amino acids play assisting roles in hDDAH-1 catalysis. Leu30 is proposed to be a critical amino acid in bovine DDAH-1 lid region in a X-ray structure study, where its isobutyl side chain blocks the active site entrance in a ‘closed’ liganded enzyme complex structure (94). In apo bovine DDAH-1, an ‘open’ conformation was observed (94). However, our result indicates that mutation of Leu30 to Ala doesn’t change steady-steady kinetic constants as much as expected, especially when

SMTC was used as substrate. L30A gives a ~10 fold smaller kcat/Km than wild-type for natural substrate ADMA but their is almost no change with SMTC catalysis (Table 2.1). This result suggests the leaving of ADMA’s alkylamine group relies more on the structure strain given by a ‘closed’ compact active site formed by the isobutyl side chain of Leu 30. However, Leu30 is not a single player in maintaining this conformation in

40 human DDAH-1 and its mutation won’t cause a significant detrimental effect in DDAH-1 catalytic activity. Glu78 is distinguished because of its interaction with the substrate’s unmethylated terminal nitrogen, which enables DDAH-1 to hold bulkier methylated arginine substrates (94). In other guanidino-modifying family members such as arginine deiminase (ADI) and Arg:Gly amidinotransferase (AT), an Asp residue located at this position helps coordinate two terminal nitrogen atoms in the guanidine moiety of substrate (94).

Compared to wild-type, E78A gives ~1000 fold decrease in kcat/Km with substrate ADMA and ~10 fold decrease in case of SMTC. This significant loss of activity likely reflects the loss of hydrogen bond between E77 and substrate’s unmethylated nitrogen. ADMA binding may rely more on this interaction than SMTC, because ADMA has a bulkier dimethylated guanidine group. Arg145 is proposed to stabilize the substrate binding by forming salt bridges with substrate’s Cα-carboxyl group in bovine DDAH-1 (94). In R145A, kcat/Km is ~200 fold

smaller with substrate ADMA and ~8 fold smaller in case of SMTC compared to wild- type, which suggests the loss of two salt bridges between R145 and substrate Cα- carboxyl group (Table 2.1). This interaction is critical for substrate binding, espeically for ADMA. But perhaps with the presence of a third salt bridge at this position mediated by Arg98, the activity loss is not as great as the case in Glu78A.

Ser176‘s side chain hydroxyl group is proposed to form a hydrogen bond with active site water in bovine DDAH-1. His173 also participates in this interaction with its proximal nitrogen atom in the imidazole ring (94). Different from His173 where the Ala mutation completely abolish catalytic activity, S176A only causes a ~10 fold decrease in

kcat/Km with ADMA and ~3 fold decrease with SMTC. This data indicatels Ser176 plays a minor role in active site water stabilization in hDDAH-1 catalysis as compared to His173.

41 Leu271 is the amino acid that may account for much of the active site difference between human DDAH-1 and PaDDAH. The previous characterized NOS/DDAH-1 dual targeted reversible competitive inhibitor N5-(1-iminopropyl)-L-ornithine (IPO) gives a ~

10 fold larger IC50 for PaDDAH than hDDAH-1. This affinity difference is possibly due to a Gly substitution at this position in PaDDAH instead of a Leu for human DDAH-1. The substitution of Leu for Gly decreases the hydrophobic interaction with substrate and leads to a loss in substrate binding affinity. Experimental data indicates that L271G gives a ~10 fold decreases in kcat/Km with ADMA and ~2 fold decrease with SMTC, which suggests more binding affinity loss with ADMA. Another piece of supporting evidence is that hDDAH-1 L271G mutation increases the IC50 for IPO to a similar level as PaDDAH. Trapped reaction intermediates during catalytic turnover reveals active site residues’ participation in different catalytic steps. To obtain the evidence for a transient covalent adduct during hDDAH-1 turnover, reactions with substrates ADMA or SMTC were acid-quenched at various time points and analyzed by ESI-MS. The deconvoluted mass spectrum of a control reaction without any substrate addition results a

peak at 33,304 ± 10 Da matching that expected for unmodified hDDAH-1. To differentiate various conversion speeds between mutants, hDDAH-1 reactions were quenched at two time points 5 and 15 min, where the are in their linear phase. Analysis of a steady-state reaction between ADMA and hDDAH-1 that was

quenched after 5 min of turnover clearly shows a peak shift +158 Da to 33,462 Da while part of the protein mass remained unchanged (Figure 2.2A). A reaction quenched after 15 min of turnover results in essentially the same peaks that were seen in the 5 min sample, except the relative peak heights of the modified peak (33,462 Da) and the unmodified enzyme peak (33,303 Da) have changed (Figure 2.2B), suggesting an increase in the covalent modified reaction intermediate forming during 15 min time scale. Analysis of a

42 steady-state reaction between SMTC and hDDAH-1 that was quenched after 5 min of turnover shows a single +158 Da shifted peak (Figure 2.2C). A reaction quenched after 15 min of turnover results in the same peak as in 5 min sample, indicating the reaction hadn’t reached completion at this time point (Figure 2.2D). This +158 Da adduct most likely is a trapped DDAH-alkylthiouronium intermediate modified at active site Cys274 as reported for PaDDAH (90).

Figure 2.2 Representative ESI-MS spectra of trapped reaction intermediates for wild- type hDDAH-1 catalysis with substrate ADMA and SMTC. 43 (A) ADMA 5 min incubation. (B) ADMA 15 min incubation. (C) SMTC 5 min incubation. (D) SMTC 15 min incubation.

Similar acid quench experiments were performed for hDDAH-1 variants. As expected, C274A is the only mutant that remains unmodified for both substrate ADMA and SMTC, which reflects the loss of an active cysteine nucleophile for catalysis (Table 2.2). Other three amino acids in the proposed hDDAH-1 catalytic center, including D79, D127 and H173, are still able to form covalent adducts with certain substrates and times although their mutations all cause near complete loss of hDDAH-1 activity. For example, D79A cannot form a +158 Da adduct during 15 min incubation with ADMA, but will form a +158 Da adduct when SMTC was used. The rate of +158 Da adduct for D79A with SMTC is slower than other DDAH variants, because it is the only mutant to form a modified/unmodified protein mixtures with SMTC at 5 min (Table 2.2). This slow down reflects dramatic loss in substrate binding affinity with D79A mutation. H173A cannot form a +158 adduct with ADMA incubation within 15 min, but it is ~100% converted with SMTC in 5 min (Table 2.2). D127A is able to partially form +158 Da adduct in 15 min with ADMA and is ~100% converted in 5 min with SMTC (Table 2.2). The fact that D127A is still able to partially form a +158 Da adduct with ADMA in 15 min but not H173A suggests that H173 is a primary amino acid responsible for acid/base catalysis. D127 contributes to stabilization of the protonated H173 in hDDAH-1 catalysis. Therefore, the ability to form a reaction intermediate helps us to discriminate the differences in roles for amino acids, even though they have non-detectable turnover (Table 2.2).

44 Table 2.2 Summary of major ions observed in ESI-MS spectra of acid-quenched steady-state reactions with hDDAH-1 variants and various substrates

Protein used Unmodified Incubate with ADMA Incubate with SMTC

in incubations MS 5 min 15 min 5 min 15 min

wild-type 33305 33462 33462 33461** 33461**

L30A 33261 33419 33419 33419** 33419**

E78A 33246 33246* 33239* 33403** 33403**

D79A 33260 33260* 33260* 33417 33417**

D127A 33262 33257* 33417 33418** 33418**

R145A 33218 33218* 33218* 33376** 33376**

H173Aa 33373 33372* 33373* 33529** 33529**

S176A 33288 33447 33447 33446** 33446**

L271G 33247 33402 33402 33404** 33404**

C274Aa 33408 33406* 33406* 33406* 33406*

C275Aa 33407 33561 33561 33565** 33563**

*: ~ 0% adduct formation, MS unchanged **: ~ 100% adduct formation, ~ +158 Da MS increase a: Construct from Dr. Lin Hong, without His tag cleavage.

Other mutants, such as L30A, S176A, L271G and C275A, behave very similar to wild-type in acid quench experiments. They are able to form +158 adducts with ADMA and SMTC. E78A and R145A cannot form +158 Da adduct in 15 min with ADMA, but will have +158 adduct formation with SMTC. This difference reflects the importance of

45 E78 and R145 especially in ADMA catalysis, resulting from substrate stabilization. It also supports the previous observation that SMTC is a better substrate for DDAH-1 than ADMA. This difference is caused by a better leaving group in SMTC, which makes it requires less assistance to form an intermediate and therefore is less affected by active site amino acid mutations except for the loss of active site cysteine. Overall, intermediate trapping data suggests that hDDAH-1 catalysis consists of at least two sequential steps with a +158 Da hDDAH1-alkythiouronium as the reaction intermediate formed at active Cys274. Among four amino acids that constitute the hDDAH-1 catalytic center, C274 is the active site nucleophile. D79 participates in substrate stabilization which is more important to ADMA catalysis. H173 plays a primary role in proton donating/accepting. D127 contributes to stabilization of protonated H173. Other active site amino acids including E78 and R145, especially contribute to binding of ADMA and help ADMA’s alkylamine group leaving to finish the first half reaction, although their mutation will not lead to non-detectable activity. Others residues such as L30, S176, L271 and C275, don’t significantly affect the first half reaction, which is also reflected in steady-state kinetic studies. Taken together, the acid quenching experiments further differentiate different degrees of participation of active site amino acids in the hDDAH-1 catalytic mechanism with substrates ADMA and SMTC. Proposed hDDAH-1 catalytic mechanism. We investigated the hDDAH-1 catalytic mechanism first by measuring steady-state kinetic constants for eleven hDDAH-

1 variants at active site then by using a mechanism based inhibitor S-nitroso-L- homocysteine. Both results support the existence of a similar catalytic mechanism as Pa DDAH, where Cys274 serves as an active site nucleophile and His173 as a general acid and base to assist the substrates’ alkylamine group leaving and to facliate water molecule attack (Scheme 2.1). In addition, Asp127 is important in His173 mediated general

46 acid/base catalysis by forming a salt bridge to stabilize the protonated His173 (Scheme 2.1). Asp79 is critical in forming hydrogen bonds to the two N atoms of the substrate and positions it into active site (Scheme 2.1). Mutation of any of these four amino acids to Ala nearly completely destroys hDDAH-1 catalytic ability. Other active site amino acids, such as Leu30, Glu78, Arg145, Ser176, Leu271 and Cys275, contribute to hDDAH-1 catalysis by stabilizing the substrate binding through hydrogen bonds, salt bridges or hydrophobic interactions.

Scheme 2.1 Proposed substrate-assisted mechanism of hDDAH-1. Box indicates acid quench trapped reaction adduct after the first half reaction.

Covalent inhibition of hDDAH-1 variants by S-nitroso-L-homocysteine yields two different adducts. Mechanism based inhibitors need the inhibitor to be processed catalytically by the enzyme to unmask its inhibitory activity. It is an important inhibitor category and can always be used as a tool for enzyme mechanistic study. Here we 47 characterized an endogenous S-nitrosothiol, S-nitroso-L-homocysteine (HcyNO), as a mechanism based inhibitor for human DDAH-1, which may be a DDAH-1 regulatory mechanism. Understanding the inhibition mechanism of HcyNO can contribute to the mechanistic study of hDDAH-1. HcyNO is an endogenous reactive nitrogen species and is probably associated with human endothelial dysfunction hyperhomocysteinemia (153). Previous studies indicate that HcyNO can irreversibly inhibit hDDAH-1 with a second order inactivation rate constant of 3.79 ± 0.06 M-1s-1 (101). Unlike typical protein S- nitrosylation process which is an exchange reaction with other RS-NO and happens to a great variety of proteins such as hemoglobin and several members of caspase family, bovine DDAH-1 was shown to form a unique +164 Da N-thiosulfoximide adduct (98, 178, 179). In this study, HcyNO inhibition experiments were carried out on eleven hDDAH-1 variants and every reaction product was analyzed by LC-ESI-MS. HcyNO inhibition of wild-type hDDAH-1 results in a covalent adduct similar to bovine DDAH-1 with a mass increase of +164 Da (Fig 2.3A, B), consist with formation of an N-thiosulfoximide (98) (Scheme 2.2). When bound to a folded enzyme, this adduct is stable at pH 4-9, but bovine DDAH-1 lost its modification at pH 9 (98). Similarly, this experiment was performed on different hDDAH-1 mutants. As expected, C274A was not modified by HcyNO because C274 is the active site cysteine. D79A also lost its ability to react with HcyNO probably due to a dramatic loss of binding specificity. Surprisingly, an alternative covalent adduct with a +133 Da mass increase was observed for L30A, D127A, R145A and H173A, which is consistent with a disulfide bond adduct formation (Table 2.3, Scheme 2.2). Representative ESI-MS spectra of HcyNO modified H173A hDAH-1 is shown in Figure 2.3D. The conversion is about 50% without acid quench and increased to 100% with acid quench during 30 min reaction time period. Considering the acid/base roles of H173A and D127A in hDDAH-1 catalysis, we propose an HcyNO

48 inhibition mechanism for hDDAH-1. hDDAH-1 uses His173 to first donate a proton to facilitate the leaving of a hydroxyl group and then to abstract a proton, activating the nuclephilic water molecule. The success of these two steps are the dictating factors to control partitions between two different inactivation pathways, which will lead to the formation of a +164 Da N-thiosulfoximide and a +133 Da disulfide respectively (Scheme 2.2). The amino acids that contribute to these two steps will affect N-thiosulfoximide adduct formation. One particular amino acid is D127, which forms a salt bridge with protonated H173. R145A can also form a +133 Da adduct although the rate slower than H173A and D127A. This is probably because the HcyNO binding is destabilized from the loss of salt bridges with Cα-carboxyl groups. R145A also disrupts the interaction with water molecule indicated by X-ray crystal structure of bovine DDAH-1 (94). The relationship between this water with another active site water molecule which is close to His173 is currently unknown. But it is possible that they come from the same water channel and both are important for the formation of N-thiosulfoximide adduct. In case of L30A, the existence of +164 Da or +132 Da or both adducts were observed. Given longer reaction time (e.g., 1 hr), L30A is more inclined to form +164 Da adduct. This is a piece of evidence that there are two inhibition pathways. The reason why L30 can cause the shift between two inactivation pathways is not very clear but possibly due to its position on hDDAH-1 lid region. Mutation of this amino acid to Ala may destabilize HcyNO binding or the neighboring water atom interaction by shortening its isobutyl side chain. For other mutants such as E78A, S176A, L271G and C275A, they all form +164 Da adducts as wild-type with slower conversion rates. This data suggests that these four amino acid mutations decrease HcyNO binding ability but don’t affect the formation of N-thiosulfoximide adduct.

49

Figure 2.3 Representative ESI-MS spectra of S-nitroso-L-homocycsteine (HcyNO) modified and unmodified hDDAH-1 variants.

(A) hDDAH-1 wild-type. (B) HcyNO modified hDDAH-1 wild-type. (C) hDDAH-1 H173A. (D) HcyNO modified hDDAH-1 H173A 50 Table 2.3 Masses of the reaction products of hDDAH-1 with HcyNO.

Protein used Unmodified Mass Modified Mass Mass difference (hDDAH-1) (Da) (Da) (Da)

wild-typea 33305 33469 164

L30Ac 33263 33395, 33428 132, 165

E78Ad 33247 33412 165

D79Ab 33260 33260 0

D127Ab 33262 33389 127

R145Ae 33220 33356 136

H173Af,g 31619 31752 133

S176A 33288 33449 161

L271Gb 33247 33410 163

C274Af 31653 31654 1

C275Afh 31653 31817 164

a Those proteins have N-terminal sequence modified to prevent non- enzymatic Nα-gluconylation (Material and Methods). Reaction conditions were 100 mM HEPES/NaOH, pH 7.3, 10 mM EDTA. Acid quench was not used in stopping HcyNO reaction b.Sample was incubated 30-60 min at 37 °C. c Two different modified masses both observed. Incubation time varies from 30 min to 120 min at 37 °C. Conversion is not 100%, but with longer incubation time, more 165 increase adduct was formed. d Sample was incubated 30-120 min at 37 °C. Conversion is not 100%, but with longer incubation time, more 165 increase adduct was formed.

51 e Sample was incubated 30-120 min at 37 °C. Conversion is not 100%, but with longer incubation time, more 136 increase adduct was formed. f These proteins were subjected to His tag cleavage before ESI-MS. Reaction conditions were slightly different from others. For details see Materials and Methods. g Conversion is near complete for His173A. However when acid quench was not used, only half H173A was converted to its +133 modification adduct. h Sample was incubated 30 min at 37 °C.

To obtain a more precise mass of the covalent modification adduct, inactivated wild-type hDDAH-1 with +164 Da mass adduct (proved by ESI-MS) was digested with Glu-C endoproteinase and the resulting peptides were detected by MALDI-TOF/TOF analysis. Instead of a +164 Da mass adduct as expected from the protein ESI-MS measurements, the C-terminal 286-306 peptide was found with mass additions of +133/134 Da and also a +32 Da, which suggest a disulfide adduct and a Cys-NO adduct formation. A disulfide bridge between the two neighboring cysteines was also observed in this region and confirmed with MS/MS, which suggest an exchange between Cys274 and Cys275. This disulfide bridge may account for the relative low signal of adduct. Similar experiments with hDDAH-1 C274A and C275A mutants give no adduct

formation for C274A and a +133 Da adduct formation at Cys274 for C275A mutant. In addition, I did HcyNO inactivation experiments with Pseudomonas DDAH (PaDDAH) isoform, which has only one Cys instead of two neighboring Cys in the modified region. Similar as hDDAH-1, PaDDAH will form a +164 Da adduct with HcyNO at its active site Cys249 as confirmed by ESI-MS analysis. MALDI-TOF/TOF indicates PaDDAH’s modification happens at C249 with a +32 Da and a +133/134 Da adducts formation, which suggests a Cys-NO adduct and a disulfide adduct. PaDDAH C249S doesn’t have 52 any adduct formation. The mass discrepancy between the protein ESI-MS and the digested peptide MALDI-TOF measurements has been observed previously (180). In the case of HcyNO mediated inactivation of human DDAH-1, the shift is likely due to the degradation of the adduct with matrix crystal during the deposition process or decomposition during ionization of the sample in the mass spectrometer. Another possibility for the difference between MALDI-TOF and ESI-MS is that a +133 Da (a disulfide adduct) and +30 Da (a Cys-NO adduct) adducts may be present two different amino acids in hDDAH-1. To rule out this possibility, we used UV-Vis spectrometry to characterize the absorption spectra of HcyNO modified hDDAH-1. Since HcyNO and CysNO both have extinction coefficients at 330 nm (915 M-1cm-1 and 594 M- 1cm-1 respectively) (173), we can judge if there is any Cys-NO adduct formed in hDDAH- 1 by monitoring the absorption peak at this wavelength. To get rid of any interference from unreacted HcyNO, HcyNO modified hDDAH-1 sample was subjected to buffer exchange using Amicon 10k filter. Similar concentrations of HcyNO, hDDAH-1 were used as a reference together with HcyNO modified hDDAH-1 and subjected to UV-Vis spectroscopy from 240~500 nm. Absorbance at 330 nm for [HcyNO modified hDDAH-1] = 0.009, while [HcyNO] = 0.026 and [wt hDDAH-1] = 0.012. This result suggests there are no detectable Cys-NO adduct formed in HcyNO modified hDDAH-1 (Figure 2.4). Therefore, the mass difference between ESI-MS and MALDI-TOF is probably due to the

degradation of the adduct during MALDI-TOF. It also implies that a +132 Da disulfide adduct is more stable than a +164 Da N-thiosulfoximide adduct. Therefore, it will be more thermodynamically favorable to form a +132 Da disulfide adduct under unfavorable active site environment, e.g., with disruption from some amino acids mutation.

53

Figure 2.4 UV-Vis spectra of unmodified hDDAH-1 wt (~267.2 μM, blue), HcyNO modified hDDAH-1 (~211.6 μM, red) and HcyNO (~284 μM, black).

Taken together, these data allow us to propose an hDDAH-1 inactivation mechanism by HcyNO. In this mechanism, it is the protein structure and active site amino acids that contribute to the unique N-thiosulfoximide adduct formation in human DDAH- 1. In particular, we emphasis the role of His173 to control partition between different

pathways in HcyNO mediated inhibition. Briefly, a SN2 attack of Cys274:S on HcyNO:Nε forms the N-hydroxysulfinimide (1). The conversion of this intermediate to sulfiliminosulfonium ion (2) needs the assistance of His173 as a general acid. Then His173 acts as a general base to deprotonate the active site water molecule to attack on the formally positively charged S atom of sulfiliminosulfonium ion and form intermediate (3). Finally the reaction is likely to proceed from (3) to yield the N-

54 thiosulfoximide (a). Difficulties in finishing hydroxyl group leaving and water attacking will result inhibition going to the direction of a disulfide bond adduct (c) formation, either directly or via an unstable S-nitrosylated hDDAH-1 (b). The dual role of His173 in proposed HcyNO inactivation pathway remind us the previous reported PaDDAH catalytic mechanism, where His162 appears to play a dual role in the mechanism: first as a general acid to protonate the leaving group and subsequently as a general base to generate a hydroxide for hydrolysis of the covalent intermediate (96). Therefore, it is highly possible hDDAH-1 adopts similar mechanism for both catalysis of normal reaction and to facilitate mechanism-based inactivation.

Scheme 2.2 Proposed inhibitory mechanism for HcyNO-hDDAH-1 inhibition

55 In summary, these studies help us to better understand the hDDAH-1 catalytic mechanism and give direction for future hDDAH-1 inhibitor design. Two possible

inhibitory adducts formed between S-nitroso-L-homocysteine HcyNO and hDDAH-1 variants reveal a unique process distinguished from the typical protein S-nitrosylation and support the proposed hDDAH-1 catalytic mechanism. The mechanistic study of hDDAH- 1 will have pharmacotherapeutic impact in controlling diseases marked by NO overproduction, such as cancer, arthritis, asthma, diabetes, ischemia and septic shock (1, 2, 34, 38, 49, 50).

56 Chapter 3: Developing Dual and Specific Inhibitors of Dimethylarginine Dimethylaminohydrolase-1 and Nitric Oxide Synthase: Toward a Targeted Polypharmacology to Control Nitric Oxide

3.1 INTRODUCTION Nitric oxide (NO) is often described metaphorically as a double-edged sword (64).

When produced at cytotoxic concentrations by immune cells, NO attacks tumor cells, where it induces apopotosis and inhibits their growth and metastasis (49, 181, 182).

However, when produced by tumor cells at lower concentrations (estimated to be at least

1-2 orders of magnitude lower than cytotoxic concentrations (48)), NO cuts the other way by facilitating tumor growth (49, 50). For example, introduction of nitric oxide synthase into a human colonic adenocarcinoma cell line leads to increased growth and vascularity of implanted tumors. Significant low-level NO production has been found in malignant human breast, neuronal, gastric, cervical and ovarian cancers, but not in the surrounding benign tissues. In neuronal, breast, gynecological, head and neck tumors, NO levels have been shown to positively correlate with increasing tumor grade. Although the detailed mechanism of NO participation in tumor biology is still being elucidated, there is increasing evidence that its biosynthesis plays an important role in angiogenesis and tumor progression; thus inhibitors of NO production have been suggested as possible antitumor therapeutics (50, 183).

In humans, NO is biosynthesized by nitric oxide synthase (NOS) from L-arginine

(1), oxygen and NADPH in a highly regulated manner (Figure 1) (10). Natural regulation mechanisms can suggest useful targets for new therapeutics. One such regulation

57 mechanism involves pools of endogenously produced NOS inhibitors, Nω-methyl-L-

arginine (NMMA, 2) and asymmetric Nω, Nω-dimethyl-L-arginine (ADMA, 3) (105, 174,

184, 185). The concentrations of these methylated arginines are controlled in turn by another enzyme, dimethylarginine dimethylaminohydrolase (DDAH), which hydrolyzes both substrates to yield L-citrulline (4) and the corresponding alkylamine, thus relieving

the inhibition of NOS and promoting NO biosynthesis (Figure 1) (85, 107). Notably,

DDAH activity has been detected in a series of human tumors and is particularly high in

brain

Figure 3.1 Nitric oxide biosynthesis is promoted by the enzymic activities of both NO synthase (NOS) and DDAH

DDAH catabolizes endogenous and relieves their inhibition of NOS.

Tumors (186). Artificial over-expression of DDAH in a glioma cell line leads to

increased NO synthesis, increased production of vascular endothelial cell growth factor

and increased angiogenesis (108). Tumors derived from these cells grow almost twice as

58 fast as controls, highlighting the importance of DDAH to tumor progression (108).

Therefore, inhibitors of both NOS and DDAH may serve as antitumor therapeutics.

Designing such inhibitors presents a challenge. NOS and DDAH have similar yet distinct specificities; they share the same product, yet substrates of each enzyme can inhibit the other. There are also multiple isoforms of both enzymes, each with distinct tissue distributions. Selective inhibitors could be very useful as therapeutic agents - considerable progress has recently been made designing isoform-selective NOS inhibitors

(8, 178, 187). However, single compounds capable of inhibiting both NOS and DDAH are also desirable because both of these enzymes promote NO production. Such dual- targeted inhibitors could potentially achieve more effective inhibition of biological NO production than single-target agents. Therefore, understanding the similarities and differences between these enzymes’ pharmacophores is of considerable interest for developing specific pharmacological tools and dual-targeted drugs.

Toward these ends, a small set of known NOS inhibitors are tested for their ability to inhibit recombinant human DDAH-1. The most potent are alkylamidines and this scaffold is selected for homologation. Simple alterations in chain length result in dual- targeted inhibitors or compounds selective for inhibition of either DDAH-1 or NOS. The mechanism of DDAH-1 inhibition by one of the dual-targeted inhibitors is characterized in detail and the implications for design of a targeted polypharmacology for NO control are discussed.

59 3.2 MATERIAL AND METHODS Materials. Synthetic DNA primers were from Invitrogen (Carlsbad, CA).

Chelex-100 was purchased from Bio-Rad (Hercules, CA). Aminoguandine hemisulfate,

1-amino-2-hydroxyguanidine, 2-ethyl-2-thiopseudourea and N5-(1-imnioethyl)-L- ornithine (L-NIO) were purchased from Calbiochem (San Diego, CA), N-(3-

(Aminomethyl)benzyl) acetamidine (1400W) and phenylene-1, 3-bis(ethane-2-

isothiourea) from Alexis Biochemicals (San Diego, CA), S-Ethyl-N-phenylisothiourea

from Toronto Research Chemicals (North York, Canada) and Nα-t-butyloxycarbonyl

(BOC)-L-ornithine from Bachem (Torrance, CA). Unless specified otherwise, all other

chemicals were from the Sigma Aldrich Chemical Co. (St Louis, MO). Figures depicting

bond-line notations of chemical structures were prepared using ChemDraw

(CambridgeSoft, Cambridge, MA). Figures depicting protein structures were prepared

using UCSF Chimera (188) or Pymol (DeLano Scientific, Palo Alto, CA).

General procedure for synthesis of N5-(1-iminoalkyl)-L-ornithines. The

synthesis of N5-(1-iminopropyl)-L-ornithine, N5-(1-iminoisobutyl)-L-ornithine, N5-(1- iminopentyl)-L-ornithine and N5-(1-iminohexyl)-L-ornithine was conducted by Dr.

Shougang Hu. Please refer to (138) for detailed synthetic procedures. Briefly,

proprionitrile, isobutyronitrile, pentanenitrile and hexanenitrile were each converted into their corresponding ethyl imidic esters and then to N5-(1-iminoalkyl)-L-ornithines by a general procedure similar to syntheses reported elsewhere (136, 189-191). The starting nitrile (10-100 mmol) was mixed with anhydrous ethanol (2.6 equiv), cooled to 0° C and bubbled through with dry HCl(g) for 1 h. The resulting solution was then stirred for an

additional 4 h at 0° C and then overnight at room temperature. The reaction mixture was

60 purged with N2(g) to remove most of the dissolved HCl, and volatile solvents were

removed by reduced pressure rotary evaporation. The resulting residue was washed with

cold diethylether and dried to afford the imidate as a white solid or foam. The imidate (2 -

3 equiv) was slowly added in portions to a solution of Nα-BOC-L-ornithine (1 mmol) in water (5 mL) at 5° C while keeping the reaction pH near 10 by dropwise addition of

NaOH (2.5 M). After stirring for 1.5 h, the reaction pH was adjusted to 7 using HCl (1

M). The resulting mixture was stirred overnight and loaded onto Dowex 50WX8-400 ion exchange resin, washed with water, and eluted with 10% aqueous pyridine. After removal of volatile solvents by reduced pressure rotary evaporation, the resulting solid was treated with HCl (6 M) in ethyl acetate (10 mL) at 0° C for 1.5 h and allowed to warm to room temperature for 2 h. After removal of volatile solvents by reduced pressure rotary evaporation, the N5-(1-iminoalkyl)-L-ornithine is afforded as a white or off-white foam with typical yields from 84 – 94 % from the Nα-BOC-L-ornithine starting material.

Cloning of recombinant human DDAH-1. Heterologous overexpression of human DDAH-1 using the pET28a-hDDAH-1 plasmid (101) produces a fraction of total

protein that is N-terminal gluconoylated (90), as is also seen with other proteins

overexpressed using similar vectors (167). This modification could introduce unwanted

complexity to electrospray ionization mass spectrometry (ESI-MS) analysis. To avoid

gluconoylation, the N-terminus was re-engineered by introducing the mutations suggested

by Geoghegan et al (167), changing the encoded sequence from MGSSH6- to MPH6- in two experimental steps. First, the encoded MGSSH6- sequence was mutated to encode

MAH6- by using specific end primers: 5’-

61 AATCCATGGCGCATCATCATCATCATCACAG-3’ and 5’-

TCTTGGATCCTCAGGAGTCTACTTTCTTG-3’. The forward primer contains an NcoI

restriction site (underlined) followed by 22 bases, which encode the mutated N-terminal

sequence. The reverse primer contains a BamHI restriction site (underlined) followed by

19 bases complementary to a stop codon and the codons for the C-terminal DDAH-1

sequence. PCR amplification was carried out using an MJ Research (Waltham, MA) PTC

200 thermal cycler. Reactions included the primers described above, the pET28a-

hDDAH-1 template, dNTPs, and pfu polymerase in the pfu polymerase buffer

(Stratagene, La Jolla, CA) as described in the manufacturer’s instructions, with a

temperature program of 95° C for 2 min, followed by 2 cycles of 95° C for 30 s, 44° C

for 30 s and 72° C for 1 min, followed by 26 cycles of 95° C for 30 s, 54° C for 30 s and

72° C for 1 min, followed by 10 min at 72° C for polishing. The PCR-amplified product

and the expression vector pET-28a (EMD Biosciences, San Diego, CA) were digested with NcoI and BamHI restriction enzymes (New England Biolabs, MA) and the small fragments removed by Qiaquick purification (Qiagen, Valencia, CA) before ligation. The resulting intermediate plasmid was subjected to a second step in which the sequence

encoding MAH6- was changed to MPH6- by Quickchange site-directed mutagenesis

(Stratagene), using the mutagenic oligonucleotides 5’-

CTTTAAGAAGGAGATATACCATGCCGCATCATCATCATCATCAC-3’ and 5’-

GTGATGATGATGATGATGCGGCATGGTATATCTCCTTCTTAAAG-3’ (mutations underlined). A PCR mixture containing the intermediary plasmid generated above as a template, the mutagenic primers, a dNTP mixture and pfuTurbo DNA polymerase in the

manufacturer’s buffer (Stratagene) was run using a temperature program of 95° C for 30 62 s, followed by 12 cycles of 95° C for 30s, 55° C for 1 min, and 68° C for 13 min. DpnI

was then added to the cooled reaction mixture to digest the methylated parent plasmid.

After incubation at 37° C for 1 h, the mixture was transformed into DH5α E. coli cells and selected on LB agar plates supplemented with kanamycin (30 µg/mL). The final plasmid, pET28a-hDDAH-1re, was purified from an overnight culture and the gene insert was fully sequenced (DNA Facility, University of Texas at Austin) to verify the desired sequence.

Site-directed mutagenesis to generate L30A, E78A and L271G mutations.

Three site-directed mutations of DDAH-1 were constructed using a QuikChange site- directed mutagenesis kit (Stratagene). Briefly, three pairs of oligonucleotides: 5’-

CCAGCACGCGGCGAGAAGCGCC-3' and 5' GGCGCTTCTCGCCGCGTGCTGG-3’;

5’-CGTCTTCGTGGCGGACGTGGCCGTGGTGTGC-3’ and 5’-

GCACACCACGGCCACGTCCGCCACGAAGACG-3’; 5'-

GGTGGATGGGGGGCTCACCTGCTGC-3' and 5'-

GCAGCAGGTGAGCCCCCCATCCACC-3' were used to introduce the L30A, E78A

and L271G mutations (underlined), respectively. Each PCR mixture contained template

plasmid (pET28a-hDDAH-1re), one pair of mutagenic primers, a dNTP mixture and

pfuTurbo DNA polymerase in the manufacturer’s buffer (Stratagene). Reactions were

subjected to a temperature program of 95° C for 30 s, followed by 16 cycles of 95° C for

30 s, 55° C for 1 min, and 68° C for 13 min. After cooling, DpnI was added digest the

methylated parent plasmid and the remaining mixture was transformed into DH5α E. coli

cells and selected for resistance on LB agar plates supplemented with kanamycin (30

µg/mL). The resulting plasmids (pET28a-hDDAH-1re-L30A, -E78A and –L271G) were 63 purified from overnight cultures and the inserts fully sequenced to verify the correct

sequences.

Expression and purification of DDAH-1. Recombinant DDAH-1 was

overexpressed in BL21 (DE3) E. coli using pET28a-hDDAH-1, pET28a-hDDAH-1re or

one of the three expression vectors encoding a mutant DDAH-1 (described above), using

the same procedure described earlier (101), except that 30 µg/mL kanamycin was used.

The resulting frozen cell pellets were resuspended in a total of 60 mL His-tag Lysis

Buffer (50 mM NaH2PO4, 300 mM NaCl, 10 mM imidazole, 15% glycerol, pH 8.0) and

sonicated on ice for 5 min with 15 s pulses at 30 s intervals using a sonic dismembrator

(Fisher Scientific Model 500, large tip). Cell debris was pelleted twice by centrifugation

at 34,957 × g for 15 min. The resulting supernatant was incubated batchwise with Lysis

Buffer-equilibrated Ni-NTA affinity resin (8 mL, Qiagen) for 1 h. The resin was

subsequently packed into a column (2 cm diameter), washed with Lysis Buffer (40 mL)

and Wash Buffer (50 mL, 50 mM NaH2PO4, 300 mM NaCl, 20 mM imidazole, 15%

glycerol, pH 8.0) and the desired protein removed with Elute Buffer (15 mL, 50 mM

NaH2PO4, 300 mM NaCl, 250 mM imidazole, 15% glycerol, pH 8.0). Fractions

containing DDAH-1 as gauged by SDS-PAGE (migrating at approximately 33 kDa),

were pooled and concentrated using Amicon Ultra Centrifugal Filter devices (Millipore,

Billerica, MA) with a 10 kDa molecular weight cutoff (MWCO). The concentrated protein fractions (approx 300 µL) were diluted in 20 mL Buffer A (50 mM KH2PO4, 3.0

M NaCl, 2 mM 1,10-phenanathroline, 3 mM dithiothreitol, 15% glycerol, pH 7.0) and loaded onto a 1.5 × 18 cm phenyl-Sepharose column (GE Healthcare, Piscataway, NJ).

64 Proteins were eluted using a linear gradient from 100% Buffer A to 100% Buffer B (50

mM KH2PO4, 2 mM 1,10-phenanathroline, 3 mM dithiothreitol, 15% glycerol, pH 7.0).

As gauged by SDS-PAGE, fractions containing DDAH-1 were pooled and concentrated

to approximately 1 mL using an Amicon Ultra Centrifugal Filter (10 kDa MWCO). The

final protein was dialyzed for 4 × 5 h against 500 mL aliquots of Chelex 100-treated

(BioRad) Dialysis Buffer (50 mM KH2PO4, 10% glycerol, pH 7.0), flash frozen and

stored in aliquots at -80° C. All of the DDAH-1 variants purified using this method were

homogenous by coomassie-stained SDS-PAGE. Wild-type, the N-terminal variant, and the L30A, E78A and L271G variants of DDAH-1 were all purified using the same procedure, with typical yields of 1-2 mg / L culture.

Each purified protein was analyzed by ESI-MS (Analytical Core Facility, College of Pharmacy, The University of Texas) and gave their expected masses (all in Da): Wild- type from pET-28a-hDDAH-1:MWcalc = 33,441, MWexptl = 33,434 (major), 33,612

(minor); N-terminal variant from pET-28a-hDDAH-1re: MWcalc = 33,311, MWexptl =

33,304 (Reconstruction of the N-terminus successfully removed the minor +177 Da

gluconylation peak); L30A: MWcalc = 33,269, MWexptl = 33,263; E78A: MWcalc = 33,253,

MWexptl = 33,247; L271G: MWcalc = 33,245, MWexptl = 33,247.

To determine metal content, purified protein samples (approximately 120 μM) and

buffer-only controls were analyzed by inductively coupled plasma mass spectrometry

(Department of Geological Sciences of The University of Texas at Austin). Metal ion

binding was calculated by subtracting the concentration of metal ions found in the buffer

from those found in the protein sample and dividing by the protein concentration. Protein

65 concentrations were determined by measuring the absorption at 280 nm in buffer

containing 6 M guanidinium hydrochloride and 20 mM phosphate (pH 6.5). The

extinction coefficient of the protein (7,680 M-1 cm-1) was calculated on the basis of the

amino acid sequence (http://workbench.sdsc.edu/) (192). Although protein preparations

that omit 1,10-phenanthroline harbor approximately 0.4 equivalents of inhibitory Zn(II),

the procedure above yields DDAH-1 and variants that contain only trace amounts of

Zn(II).

Steady-state kinetic studies. To determine the steady-state kinetic constants for

hydrolysis of Nω,Nω–dimethyl-L-arginine (ADMA, 3), a discontinuous colorimetric assay based on diacetylmonoxime derivatization of L-citrulline (4) was used, as described

previously (168). To measure the steady-state kinetic constants for hydrolysis of S-

methyl-L-thiocitrulline (SMTC, 5), a continuous spectrophotometric assay based on 5,5’- dithiobis(2-nitrobenzoic acid) (DTNB) derivatization of the methanethiol product was used, as described previously for DDAH from Pseudomonas aeruginosa (177).

Recombinant human DDAH-1 showed linear kinetics for > 10 min, despite the presence of six cysteine residues in its sequence, indicating that DDAH-1 is not inhibited by

DTNB over this timescale. To obtain steady-state constants, KaleidaGraph software

(Synergy Software, Reading, PA) was used to directly fit observed rates at various substrate concentrations to the Michaelis-Menten equation. The constants obtained for hydrolysis of SMTC are somewhat different from those reported earlier (101), likely due to the ability of the continuous assay to more precisely define the linear phase of the hydrolysis kinetics.

66 Survey of selected NOS inhibitors as DDAH inhibitors. A small set of commercially available NOS inhibitors, 2-ethyl-2-thiopseudourea (6), S-ethyl-N- phenylisothiourea (7), phenylene-1,3-bis(ethane-2-isothiourea) (8), aminoguandine (9), 1-

amino-2-hydroxyguanidine (10), N-(3-(aminomethyl)benzyl)acetamidine (11) and N5-(1- imnioethyl)-L-ornithine (12), were each dissolved in assay buffer (100 mM KH2PO4, 1 mM EDTA, pH 7.27) to final concentrations between 0 – 1 mM, with each mixture also containing the substrate S-methyl-L-thiocitrulline (SMTC, 5). Although the KM of SMTC

is 3 µM, inhibitor screens were carried out at 25 μM of SMTC to insure linearity

throughout the experimental timescale (approximately 5 min). Upon addition of DDAH-1

(1 µM), hydrolysis kinetics were measured using the continuous assay described above.

IC50 constants were determined by fitting observed reaction rates at over a series of

inhibitor concentrations to equation 3.1, and corresponding Ki values were calculated

from the IC50 values using equation 3.2, assuming competitive inhibition (124, 193):

100 %Activity = (Eq 3.1) [Inhibitor] 1 + IC50

IC50 Ki = (Eq 3.2) 1+ [SMTC]/ KM

Turnover and time-dependent inhibition experiments. The three S-

alkylisothiourea compounds tested as inhibitors were also assayed as potential DDAH-1

substrates by using the continuous assay described above, but omitting SMTC from the

assay mixture. L-IPO (13) was assayed as a DDAH-1 substrate by preparing 18 h

incubation mixtures (at 25°C) of L-IPO (6 mM) in assay buffer with and without DDAH-

67 1 (10 µM). The reaction mixtures were diluted 3-fold and subjected to Amicon Ultra

Centrifugal Filter devices (10 kDa MWCO) to remove protein. These reaction mixtures were then derivatized using the fluorogenic reagent o-phthalaldehyde (OPA, Agilent

Technologies, Santa Clara, CA), which reacts selectively with primary amines. The OPA regent (10 µL) was mixed with an equal volume of reaction mixtures and incubated for 1 min in the dark. The resulting mixture was then separated by a Shimadzu Prominence high performance liquid chromatograph (HPLC) (Columbia, MD) using a Agilent Eclipse

XDB-C18 column (4.6 mm × 250 mm, 5 µm particle size) and a linear gradient from 8.7

% - 70 % Buffer B (Buffer A: 30 mM Na3PO4 pH 7.56, Buffer B: 100% acetonitrile) and fluorescent detection of the derivatized products (ex: 340 nm; em: 455 nm).

Preincubation mixtures were used to test whether L-IPO (13) displays time dependent inhibition of DDAH-1. Briefly, L-IPO (10 mM) was mixed with hDDAH-1

(80 μM) and incubated 18 hr at 25°C. L-Citrulline (4) (66.7 mM) and no inhibitor were used in control experiments done in parallel. Before and after incubation, aliquots (6 µL) of the reaction mixtures were rapidly diluted approx 40-fold into the continuous assay buffer containing the substrate SMTC (25 μM) to monitor initial hydrolysis rates.

Reversible inhibition by IPO. Varying concentration of L-IPO (13) (0-500

μM) and SMTC (5) (2-256 μM) were mixed in Assay buffer and monitored using the continuous kinetic assay. To obtain a numerical value for Ki, the initial rate data were fit directly using a competitive inhibition model (Equation 3.3) to determine α values, and a linear fit of these α to Equation 3.4. For easy visual interpretation, the same data are also presented graphically as a double reciprocal Lineweaver-Burke plot. Ki values for L-IPO

68 (13) inhibition of mutant DDAH-1 preparations were calculated from IC50 values, determined as described above.

Vmax[S] vo = (Eq 3.3) αKM + [S]

[I] α =1+ (Eq 3.4) Ki

Analytical sedimentation equilibrium ultracentrifugation. Triplicate experiments using 2-channel centerpieces were carried out using a Beckman Optima XL-

I analytical ultracentrifuge with the rotor speed set to 20,000 rpm at 25.0 °C.

Ultracentrifuge cells contained DDAH-1 (1 mg / mL) in Chelex 100-treated buffer (20 mM NaH2PO4 and 100 mM NaCl, pH 7.0), the same conditions as reported for characterization of the DDAH from Pseudomonas aeruginosa (194). Thirteen absorbance scans at 240 nm were performed for each cell, the first after 10 min, and the remaining scans after an additional 2, 4, 8, 16, 26, 29, 31, 33, 35, 37, 39, 41, 43 and 45 h.

Absorbance data were extracted and fitted using Ultrascan II version 8.0 software (195).

A partial specific volume (⎯ν) of 0.7390 mL / g (predicted by Sednterp 1.07 software, www.bbri.org/RASMB/rasmb.html) and a buffer density (ρ) of 1.0 g / mL were used in the analysis. The data were fitted globally to a one component ideal species model using equation 3.5, where X = radius, Xr = reference radius, A = amplitude of monomer*, M = molecular weight of monomer*, E = extinction coefficient, R = gas constant, T = temperature, B = baseline*, ω = angular velocity (* indicates this parameter was floated)

(195).

69 ⎡ ln( A)+Mω 2 (1−ν ρ )( X 2 − X 2 ) ⎤ ⎢ r ⎥ C(X ) = e⎣⎢ 2RT ⎦⎥ + B (Eq 3.5)

Crystallization, data collection and structure determination. The crystallization, data collection and structure determination of IPO human DDAH-1 complex and apo human DDAH-1 were conducted in collaboration with Dr. Arthur F.

Monzingo and Dr. Jon D. Robertus as described elsewhere (138).

Atomic coordinates. Coordinates of the refined model of the apo-human

DDAH-1 and the human DDAH-1 complexed with L-IPO have been deposited in the

Protein Data Bank with entry codes 3I2E and 3I4A, respectively.

Circular dichroism (CD) spectroscopy. About 300 μl 6 μM human DDAH-1 in final dialysis buffer (50 mM KH2PO4, 10% glycerol, pH 7.0) was used for Circular dichroism analysis on a Jasco J-815 CD Spectrometer at Texas Institute for Drug &

Diagnostic Development. CD spectra were taken for samples with apo DDAH-1, DDAH-

1:IPO = 1:1, 1:10, 1:100, and 1:500 at measurement range 200-275 nm with 0.1nm data pitch, 200 nm/min scanning speed at 20 °C. Blank measurements were taken for every sample with the same buffer and corresponding amount of IPO. Fraction ratios of secondary structure were calculated using the standard reference file provided in the software.

3.3 RESULTS AND DISCUSSION Survey of selected NOS inhibitors as DDAH-1 inhibitors. As a limited exploration of the chemical space shared by ligands of both NOS and DDAH, a small set of known NOS inhibitors was assayed for inhibition of recombinant human DDAH-1.

The results are included, along with related compounds, in a graphical summary (Figure 70 2). To simplify the discussion, only the Ki values for nNOS are listed (Table 3.1) because these compounds do not show significant selectivity between the three isoforms of NOS, and nNOS co-localizes to many of the same tissues as DDAH-1 (92).

Three S-alkyl isothiourea compounds, S-ethyl-2-thiopseudourea (6), S-ethyl-N- phenylisothiourea (7) and phenylene-1,3-bis(ethane-2-isothiourea) (8) (nNOS Ki = 29,

120 and 250 nM, respectively) (196, 197) do not inhibit DDAH-1 at concentrations ≤ 1 mM. These compounds were also tested as substrates of DDAH-1 because the structurally related S-methyl-L-thiocitrulline (SMTC, 5) is a good DDAH substrate

-1 (DDAH-1: kcat = 2.5 min ; KM = 3 µM ) as well as a known nNOS inhibitor (Ki = 50 nM)

(198). None of these three compounds were processed as DDAH-1 substrates during 15 min incubations. Therefore, structural elaboration of the thiourea scaffold was not pursued further. Aminoguanidines were the second type of inhibitory fragment surveyed.

Both aminoguanidine (9) and 1-amino-2-hydroxyguanidine (10) (nNOS Ki = 55 and 680

µM, respectively) (199, 200) do not serve as effective inhibitors of DDAH-1, and so were not studied further. The third structural class tested as DDAH-1 inhibitors are amidines:

N-(3-aminomethyl)benzylacetamidine (1400W, 11) and N5-(1-iminoethyl)-L-ornithine (L-

NIO, 12) (nNOS Ki = 2 and 1.7 µM, respectively) (136, 196). Compound 1400W (11) does not inhibit DDAH-1 at concentrations ≤ 1 mM, but L-NIO (12) does inhibit weakly

(Ki = 990 µM), suggesting that the amidino group may be a promising scaffold on which to construct a dual-targeted inhibitor. It is likely that the alpha amino group and carboxylate of 12 play a significant role in binding to both enzymes, but their contribution was not quantified here. Rather, an expanded set of alkyl substituted amidines was prepared and tested. 71 Survey of selected amidino-based NOS inhibitors as DDAH-1 inhibitors. A series of alkyl-substituted amidines have previously been reported as NOS inhibitors

(136, 191, 201). Notably, compounds with shorter alkyl substituents - (N5- (1- iminoethyl)- through N5-(1-iminopentyl)-L-ornithine (12, 14) - are potent NOS inhibitors, but the slightly longer homolog N5-(1-iminohexyl)-L-ornithine(15), can not effectively inhibit NOS.

Figure 3.2 Diagram of selected substrates and inhibitors of NOS and DDAH-1

Table 3.1 Substrate and Inhibitors of DDAH-1 and nNOS

Compound DDAH-1 nNOS

72 a Ki (μM) KM (μM) Ki (μM) KM (μM) NMMA (2) NDb 90 ± 10c 2.0d ND

ADMA (3) ND 110 ± 14c 0.7e ND

SMTC (5) ND 3.1 ± 0.3 0.05 ± 0.01f ND

L-arginine (1) 131 ± 7 ND ND 1.6 ± 0.3i

L-citrulline (4) 3,700 ± 200 ND > 1 mMg ND

L-NIO (12) 990 ± 80 ND 1.7h ND

L-IPO (13) 52 ± 4 ND 3.0h ND

L-IBO 59 ± 3 ND ND ND

14 7.5 ± 0.4 ND 20 ± 4i ND

15 110 ± 10 ND >1,900j ND a b Calculated from IC50 values as described in Materials and Methods. Not determined. c d e f Human DDAH-1 (64). Ki value for human nNOS (202). Rat nNOS (185). Rat nNOS

g h i j (198). Rat nNOS (203). Rat nNOS (136). Human nNOS (191). IC50 value for rat nNOS (201).

We synthesized and tested a similar set of several alkyl-substituted amidines as potential inhibitors of DDAH-1: N5-(1-iminoethyl)-L-ornithne (L-NIO, 12), N5-(1- iminopropyl)-L-ornithine (L-IPO, 13), N5-(1-iminopentyl)-L-ornithine (14), and N5-(1- iminohexyl)-L-ornithine (15). All of these compounds inhibit DDAH-1 with micromolar

Ki values (8 to 990 μM, Table 3.1). Extending the alkyl substituent of 12 by one methylene group to form L-IPO (13) translates into a 20-fold increase in potency. Further extension of the alkyl chain by an additional two methylene units to form 14, translates to a further 7-fold increase in potency. Branching the alkyl chain does not greatly increase 73 5 potency; N -(1-iminoisobutyl)-L-ornithine (L-IBO, structure not shown) has a Ki value that matches (within error) that of L-IPO (13). Linear chain extension to 15 decreases the affinity for DDAH-1 somewhat, but inhibition is still evident (Ki = 110 µM). These results contrast sharply with the same compounds’ potency for inhibiting nNOS. In particular, extending the chain length from that of L-IPO (13) to the longest amidine tested here, 15, results in a 2-fold decrease in potency for DDAH-1 inhibition, but a >

1000-fold decrease in potency for nNOS inhibition (201). It is interesting to note that two previously reported DDAH-selective inhibitor, Nω-(2-methoxyethyl)-L-arginine (L-257,

16) (100, 106) and Nω-(but-3-enyl)-L-arginine (17) (137), are approximately the same length as 15, suggesting that these compounds may achieve their specificity for DDAH through similar means. However, there are probably alternative methods to achieve selectivity, because the shorter analog S-2-amino-4-(3-methylguanidino)butanoic acid

(4124W, 18) is also selective for DDAH, albeit with weak potency (IC50 = 1.5 mM for a crude rat kidney DDAH preparation) (105, 106). Further modifications of the alkyl chain may also increase potency or selectivity. Kotthaus et al. recently reported a series of alkenyl-amidines capable of dual inhibition, of which N5-(1-imino-3-butenyl)-L-ornithine

(19) is the most potent (Ki, DDAH-1 = 2 μM; Ki, nNOS = 90 nM) (136, 137). One of the dual - targeted inhibitors, L-IPO (13), was selected for more detailed studies (below).

Analytical equilibrium sedimentation ultracentrifugation. Both monomeric and dimeric DDAH isoforms have been reported (97, 194), and the closely related enzyme arginine deiminase has shown half-sites reactivity (204). Therefore, to establish the minimal catalytic unit of human DDAH-1, the oligomeric state of its apo form in

74 solution was determined by analytical equilibrium sedimentation ultracentrifugation at

1mg / mL, pH 7.0, 20º C. Each set of experimental data that had reached equilibrium was collected and subjected to a global simultaneous fit to a single ideal species model

(Figure 3). The fitted molecular weight (34,530 Da) matched well with the theoretical monomer molecular weight (33,558 Da); variance = 8.7e-5. Therefore, human DDAH-1 is assigned as a monomeric enzyme.

Figure 3.3 Analytical sedimentation equilibrium ultracentrifugation of DDAH-1.

Symbols represent an overlay of data collected during the last nine scans, indicative that equilibrium had been reached. The solid line represents the global simultaneous fit for a single ideal species model using Ultrascan. The fitted Mw is 34,530 Da (theoretical monomer Mw = 33,558 Da), variance = 8.7e−5. Conditions: DDAH-1 (1 mg/ mL), NaH2PO4 (20 mM), NaCl (100 mM), pH 7.0 at 25 °C with a rotor speed of 20,000 rpm.

75 X-ray crystallography. The overall structure determined for human DDAH-1 in complex with L-IPO (13) is very similar to those described earlier for human DDAH-1 in complex with L-citrulline and with the inhibitor Nω-(2-methoxyethyl)-L-arginine (L-

257, 16) (100). However, inspection of the electron density maps near the active site reveals some unexpected features (Figure 3.4). Continuous density is observed between the active-site Cys274 side chain and the bound inhibitor. The remaining interactions with the bound inhibitor and the enzyme are quite similar to those reported for other inhibitors and those proposed for DDAH substrates (95, 100, 160). The continuous density between enzyme and inhibitor suggests that the active site Cys274 side chain can attack the amidino carbon (Cζ), resulting in a tetrahedral complex (21) (Figure 3.5). This structure is reminiscent of the related structure of an sp2 hybridized thiouronium reaction intermediate trapped in a mutant DDAH from P. aeruginosa (160), but the density observed here at the active site of human DDAH-1 can better accommodate a tetrahedral sp3 species.

76

Figure 3.4 The active site of DDAH-1 in complex with L-IPO (13) and omit map density.

Atoms colored in cyan, blue, red and yellow for carbon, nitrogen, oxygen and sulfur, respectively. Active-site residues and L-IPO are labeled. The Fo − Fc electron density map, with L-IPO and the C274 Sγ atom not included in the calculated structure factors, is shown at 3σ in blue

Figure 3.5 Reversible covalent inhibition of DDAH-1 by L-IPO (13).

The noncovalent complex (20) is expected to be in rapid equilibrium with the (R)- tetrahedral complex (21).

Characterization of DDAH-1 inhibition by L-IPO (13). As a complement to structural studies, the inhibition of DDAH-1 by L-IPO (13) was studied in more detail. 77 Lineweaver−Burk plots of 1/vo and 1/[S] at varying concentrations of L-IPO (13) show intersecting lines at the y-axis, consistent with substrate and inhibitor competing for binding to the same site on DDAH-1 (Figure 3.6). From this analysis, a Ki of 50 ± 4 μM was determined, which matches the Ki calculated from IC50 determinations described above (52 ± 4 μM).

Figure 3.6 Lineweaver-Burk plot of DDAH-1 inhibition by L-IPO (13).

L-IPO is included in assay mixtures at 0 (●), 62.5 (▼), 1.25 (▲), 250 (♦) and 500 (■) µM at pH 7.27, 25 ºC. Interesting fits at 1/Vmax indicate competitive inhibition against the SMTC substrate. A Ki value of 50 ± 4 µM is determined as described in Materials and Methods.

L-IPO (13) binds in a manner similar to that of related DDAH substrates (95, 100,

160), and places its terminal methyl group in the same position as the substrate’s leaving

ω group (N -CH3), indicating potential hydrophobic interactions with Leu271 (Figure 3.5).

The amidine’s Nω also appear to make a hydrogen bond or ionic interaction with the carboxylate side chain of Glu78. We introduced several site-directed mutations to 78 examine these interactions and their contributions to inhibitor potency (Table 3.3).

Typical buried salt bridges have stabilization energies of approximately 3−4 kcal/mol

(205), but Glu78 is also bridged to Lys175, diminishing the expected contribution of this interaction to L-IPO binding. Accordingly, an E78A mutation of DDAH-1 weakens the binding of L-IPO (13) by 1.9 kcal/mol. Typical hydrophobic interactions contribute approximately 1 kcal/mol/CH2 (205). In DDAH-1, an L271G mutation weakens the binding of L-IPO (13) by 1.0 kcal/mol. Therefore, both charged and hydrophobic aspects of the amidine group contribute to the affinity of L-IPO. Additionally, mutation at the apex of the substrate-binding flap (not depicted), L30A, weakens L-IPO (13) binding, suggesting that, like substrate, the inhibitor’s affinity is partially dependent on flap closure (Table 3.2). Changes in the circular dichroism spectrum of DDAH-1 upon L-IPO binding are minimal, which indicates there is no large-scale changes in secondary structure occur upon ligand binding (Table. 3.4). It is notable that changes to the kcat and

KM values of these mutant proteins appear to be quite substrate dependent (Table 3.2), likely consistent with the influence of several kinetic steps on KM values.

Table 3.2 Effects of hDDAH-1 mutations on steady-state kinetics and IPO binding

-1 Enzyme Substrate kcat (min ) KM (µM) kcat/KM L-IPO (13) ∆∆Gbinding -1 -1 a b (min mM ) Ki (µM) (kcal/mol)

DDAH-1 ADMA 0.86 ± 110 ± 14 8 ± 1 52 ± 4 NAc 0.02

79 SMTC 2.51 ± 3.1 ± 0.3 810 ± 80 0.02

L30A ADMA 1.01 ± 1,400 ± 0.7 ± 0.2 1,400 ± 80 2.0 0.06 250

SMTC 2.51 ± 3.6 ± 0.2 700 ± 40 0.02

E78A ADMA 0.09 ± 13,700 ± 0.007 ± 1,200 ± 100 1.9 0.01 2,700 0.002

SMTC 1.8 ± 0.5 19 ± 3 95 ± 40

L271G ADMA 0.52 ± 750 ± 70 0.69 ± 0.08 290 ± 20 1.0 0.01

SMTC 0.58 ± 1.4 ± 0.2 410 ± 70 0.01

PaDDAH SMTC 71.4 ± 22.3 ± 3,201.8 ± 2,269.6 ± 2.34 3.0 538.0 234.4

a Ki values calculated from IC50 values determined using SMTC as substrate (Materials b c d and Methods). ∆∆Gbinding = RT ln (Ki mutant / Ki wild-type). Not applicable. Estimate. Highest [ADMA] tested was 10 mM.

Table 3.3 Secondary structure estimation for IPO and DDAH-1 binding with different stoichiometry. hDDAH-1:IPO 1:0 1:1 1:10 1:100 1:500

Helix% 32.3 27.6 32.7 36.7 37.1

80 Beta% 40.9 43.3 40.5 40 33.2

Turn% 0 0 0 0 0

Random% 26.8 29.1 26.8 23.3 29.7

Total% 100 100 100 100 100

Because the structural model suggests a covalent mode of inhibition, time- dependence and reversibility of inhibition were examined. The onset of inhibition by L-

IPO (13) is rapid, with no apparent time-dependence and no covalent adducts that are detected via ESI-MS after 18 h incubations (MWcalc = 33,311 Da; MWexptl = 33,303 Da).

Dilution of inhibited enzyme into inhibitor-free mixtures rapidly restores activity. These observations suggest that L-IPO (13) is not an irreversible or metabolically activated inhibitor. The possibility of slow L-IPO (13) hydrolysis catalyzed by DDAH-1 was also considered because hydrolysis proceeds through a tetrahedral adduct, and because slow substrates can act as de facto inhibitors. This is the case with L-arginine (1), a slow substrate of DDAH-1 and structural homologue of L-IPO (13) (Table 3.1). Two likely metabolites of L-IPO (13) are L-ornithine (L-Orn) and N5-(1-oxopropyl)-L-ornithine, neither of which would be detectable by the diacetylmonoxime derivatization assay (168) typically used to detect substituted urea products of the DDAH-catalyzed reaction.

Therefore, after incubation of L-IPO (13) with DDAH-1, the Nα group of remaining L-

IPO (13) and the primary amines of any resulting reaction products were derivatized by o-phthalaldehyde and separated by HPLC to detect turnover. No new peaks appeared in the chromatogram after a 18 h incubation, and the peak area corresponding to L-IPO (13)

81 did not significantly change (Figure 3.7), indicating that hydrolysis of L-IPO (13) is not catalyzed by DDAH-1 over this time scale.

Figure 3.7 HPLC analysis of L-IPO (6 mM) incubated in assay buffer with and without DDAH-1 (10 µM) 18 h at 25 ºC.

OPA was used to derivatized primary amines. There is no new peak formation followed by 18 h incubation, indicating IPO is not the substrate of DDAH-1.

Experimental attempts were made to detect covalent bond formation between L-

IPO and Cys274 in solution by monitoring 13C NMR shifts of the amidino Cζ carbon of the inhibitor (Figure. 3.8). Similar experiments with a peptide aldehyde inhibitor of papain revealed a 125 ppm upfield shift upon tetrahedral adduct formation between the active-site cysteine and the aldehyde inhibitor (206). With DDAH-1, formation of a tetrahedral adduct (21) between Cys274 and the Cζ carbon of L-IPO is expected to similarly shift the resonance of Cζ considerably upfield (> 100 ppm) from its resonance in

82 the sp2 hybridized free ligand (Figure 3.5). In contrast, a purely noncovalent complex

(20) would be expected to display a much more modest shift (<10 ppm) for the Cζ carbon upon binding (For related examples see refs (207-209)). Starting from 13C-labeled potassium cyanide (99 atom % 13C), L-IPO was synthesized with the Cζ position isotopically enriched in 13C. However, at a variety of stoichiometries and pH values, the bound inhibitor could not be detected by 1-dimensional 13C NMR (125.7 MHz), most likely due to line broadening of the signal (Figure 3.7). Therefore, this technique could not be used to detect covalent bond formation in solution.

83

Figure 3.8 Representative 13C NMR spectra of 13C-labeled IPO - hDDAH-1 complex.

(A) Representative 13C NMR spectra of IPO only. (B) Representative 13C NMR spectra of hDDAH-1 : IPO = 1: 10 mixture. [hDDAH-1] = 160.9 µM in buffer (50 mM KH2PO4, pH = 8). Both spectra have chemical shifts around 172 ppm. Inset, a proposed reversible covalent adduct formed between IPO and DDAH-1.

In summary, the inhibitor L-IPO (13) and the substrate Nω-methyl-L-arginine (2) have similar chemical structures, their only difference stemming from substitution of a guanidino-nitrogen with a methylene. Accordingly, L-IPO (13) acts as a competitive, 84 nonhydrolyzable substrate analogue that binds at the active site of DDAH-1 in a manner similar to substrate, but places a stable C−C bond in place of the scissile Cζ−Nω bond.

Structural studies strongly suggest that Cys274 attacks the Cζ carbon resulting in a tetrahedral adduct. This covalent adduct is expected to be in rapid equilibrium with the parent compound and the unmodified enzyme, consistent with the observation that inhibition is rapidly reversible. A similar tetrahedral complex was found to develop during crystal soaking of a related enzyme, arginine deiminase (210, 211). Analogous reversible covalent inhibition has been reported of other thiol-dependent enzymes by nitriles, cyanamides and aldehydes, which form reversible thioimidate, thioamidine and hemithioacetal bonds, respectively (212-214). Also, structural studies of other reversible tetrahedral adducts have been reported, such as carbinolamine formation between pyruvate and Lys133 of aldolase (215).

The L-IPO-complexed DDAH-1 structure also reveals a perturbation of the active site His173 side chain in one molecule of the asymmetric unit (Figure 3.9). This histidine plays an essential role as a general acid and general base in the catalytic mechanism of

DDAH (96, 160), so changes at this position are noteworthy. When the structure of apo

DDAH-1 is compared with the L-citrulline, L-IPO (13) or L-257 (16) complexes (Figure

3.7) (100), considerable variation is observed both in the conformation of the ligand and the orientation of some protein residues, most notably in the loop that precedes the active site His173 (169ADGLH173). His173 is positioned closest to the active-site ligand in the L- citrulline-bound structure, but is rotated farther away in the apo-, L-257 (16), and L-IPO

(13) complexes. The loop preceding His173 is most ordered in the apo structure and is

85 similar to that seen in the L-IPO complex. However, some rearrangement and disorder of the loop is present in the L-citrulline complex and it is further rearranged in the L-257 complex, allowing for a bent conformation of the bound inhibitor. Relative to L-citrulline and L-IPO, a slight shift of the carboxylate of L-257 is also seen with a corresponding movement of Arg145, although this appears to be the result of side-chain repositioning rather than loop motion. If the L-IPO complex resembles a tetrahedral intermediate and the L-citrulline complex resembles the product complex, it is tempting to suggest that the observed conformational states resemble species found along the reaction coordinate, unlike the nonproductive L-257 complex. However, additional evidence is needed to support such claims. Nonetheless, flexibility in both the ligand and the protein structures is observed, and these are important considerations for future inhibitor design and virtual screening efforts.

Figure 3.9 Alternative loop conformations observed in DDAH-1.

86 Structural variance in residues 167-173 is observed depending on the bound inhibitor. Protein backbone is shown as a ribbon representation, bound inhibitors are shown as ball and stick representations, and selected residues (Arg 145, Leu172, His 173, Cys 274) are shown in stick form. Apo protein is in white, and the L-citrulline (4), L-IPO (13) and L- 257 (16) complexed structures are in green, light blue and orange, respectively. The figure is constructed using coordinates from this work and from Protein Data Bank accession codes 2JAI and 2JAJ (100).

Toward a targeted polypharmacology to control NO. Despite the prevailing

“one drug, one target” approach, there is growing evidence that supports the efficacy of selectively targeting multiple receptors by a single chemotherapeutic agent (216). Some of the many terms that encompass this approach include network pharmacology (217), targeted polypharmacology (218), designed multiple ligands (219), dirty drugs and magic shotguns (220). Targeted pharmacology is quite different than the promiscuous inhibition that occurs through aggregation processes (221) and different from non-selective inhibition that affects irrelevant targets. Rather, multiple targets are specifically selected for the design of a single ligand that exploits overlapping pharmacophores. The need to bind different targets could alternatively be addressed by using combinations of single- target drugs, but the differential metabolism of each agent may vary between patients and can lead to very complex pharmacokinetic and pharmacodynamic behaviors that are difficult to predict. Therefore, a single-agent targeted polypharmacology approach is an attractive strategy.

DDAH and NOS represent a compelling combination for developing dual- targeted inhibitors to control biological NO production. Based on a limited exploration of the chemical space shared by NOS and DDAH ligands, we investigated a series of alkyl- substituted amidines to illuminate the similarities and differences between nNOS and 87 DDAH-1 pharmacophores. In short, nNOS is effectively inhibited by amidines with alkyl substituents 2-5 carbons in length (including the sp2 hybridized amidino-carbon) (12, 13,

14) (201), but potent DDAH-1 inhibition requires alkyl-substituents 3-6 carbons in length

(13, 14, 15) (Figure 3.2). Therefore, by choosing the appropriate alkyl chain length, it is possible to selectively target either NOS or DDAH for inhibition, or to achieve dual inhibition of both enzymes. Comparison of inhibitor-bound structures of both DDAH and

NOS reveals some of the active-site constraints that underlie this behavior (Figure 3.10).

Figure 3.10 Comparison of DDAH-1 and NOS active sites.

The left panel shows a superimposition of human DDAH-1 with bound L-IPO (13) (green) and L-257 (16) (pink). The right panel shows a superimposition of bovine eNOS bound by L-NIO (12) (green) and rat nNOS bound by Nω-propyl-L-arginine (pink), a compound of comparable length to N5-(1-iminopentyl)-L-ornithine (14). Inhibitors are shown in ball and stick format and colored by heteroatom as described earlier. The hemegroups of NOS are shown in stick models. Surface features (light blue) are shown for the L-257-DDAH-1 complex and the Nω-propyl-L-arginine-nNOS complex to highlight the active-site cavity shape. Figures are constructed using coordinates from this work and Protein Data Bank accession codes 2JAJ, 1ED6 and 1MMV(100, 191, 222).

88 The active site of DDAH-1 is slightly larger and demonstrates structural plasticity of both protein residues and bound inhibitor, thereby allowing longer substituents. In contrast, the smaller active site of NOS limits the size of ligand by steric demands. Some plasticity in the NOS active site has been observed, but appears to be mediated by residues distant from the binding site of L-NIO (12) and its homologs (187). Therefore, the medium- length members of the alkyl-amidine series investigated here are able to occupy the common part of these overlapping pharmacophores, and a simple lengthening or shortening of the alkyl substituent can tip the specificity for one enzyme or the other.

Although the bioavailabilities of most of these compounds have not been reported, we note that in activated macrophages, Nω-methyl-L-arginine (2) and L-NIO (12) are effectively transported by the same y+ cationic amino acid transporter as L-arginine (1)

(223). These results should enable a more informed choice among pharmacological inhibitors of NO production, and will facilitate the future design of therapeutics and polypharmacological reagents to specifically impact NO production.

89 Chapter 4: Development of a DDAH-1 Inhibitor Screening Method in Intact Mammalian Cells using a Click-Chemistry Based Activity Probe

4.1 INTRODUCTION

Activity based protein profiling (ABPP) is one of the emerging targeted proteomic platforms which utilizes active site-directed chemical probes to determine the functional state of enzymes directly in native biological systems on a global scale. It is complementary technology to abundance-based genomic and proteomic techniques, in order to globally characterize protein expression and function (224). There are two kinds of ABPP, standard ABPP and click chemistry based ABPP. Both of the two approaches use an ABPP probe that consists of at least two elements: (i) a reactive group (RG) or a binding group for increasing probe binding to the enzyme active site or covalently labeling the active sites of an enzyme class or classes. (ii) one or more reporter tags, usually biotin or a fluorophore, for rapid detection and isolation of probe-labeled enzymes (Fig. 4.1). To date, activity-based probes have been developed for multiple classes of enzymes, such as serine (225, 226), cysteine proteases (227-230), protein tyrosine phosphatases (231), glycosidases (232), cytochrome P450 (233), lipases (234), (235), protein arginine deiminase (236) and multiple (237, 238). Standard ABPP methods are limited in their use in vivo because of the bulky nature of their reporter tags, which are usually 700-1000 Da and have poor bioavailiablity. Click chemistry ABPP enables in vivo profiling by introducing a “tag- free” version of ABPP, where the reporter group will be attached to the activity-based probe by bioorthogonal coupling reactions after covalent labeling of enzyme targets (239). One commonly used bioorthogonal coupling pairs are the azide and alkyne, which

90 can react via Cu(I)-catalyzed Huisgen’s 1,3-dipolar cycloaddition to form a stable triazole product (240-243). This Cu(I)-catalyzed concerted triazole synthesis is referred as “click chemistry’, which is a reaction that occurs with fast speed and good biocompatibility and therefore potentially feasible for ABPP. Using click chemistry ABPP methodology, it is possible to label enzymes with an activity-based probe both in vivo and in cell/tissue homogenates. It can be used for comparative analysis of the enzyme activity profiles of living and homogenized samples, for example, human breast cancer cells, which lead to the discovery of enzyme targets that were labeled in vivo but not in vitro (224).

Figure 4.1 Comparison of standard and click chemistry ABPP.

ABPP probes consist of a reactive group (RG), binding group (BG), and tag (e.g., rhodamine, biotin). In contrast to standard ABPP, click chemistry ABPP allows for the profiling of living cells and organisms by treating them with tag free probes, followed by the conjugation to the complementary tag under cycloaddition reaction conditions in vitro to visualize probe-labeled proteins. Figure reproduced from (224).

In addition, ABPP can be used to discover small molecules that selectively regulate protein activity. The ABPP method for the discovery of irreversible inhibitors

91 involves preincubation of cell or tissue proteomes with enzyme inhibitors followed by addition of activity-based probes that carries one or more reporter groups. Enzymes modified by irreversible inhibitors are not able to react with probes. Therefore, the presence of irreversible inhibitors can be detected by a reduction in signal intensity from the reporter group (227, 244). In addition, the ABPP method can be applied to discovery of reversible inhibitors when the kinetics of probe-proteome reactions are taken into account (225). Reversible inhibitors can only affect probe labeling of a given enzyme for a restricted period of time, depending on both the affinity of the inhibitor and the probe’s reactivity. For ABPP to serve as an effective proteomic screen for reversible enzyme inhibitors, a special assay condition is needed where the extent of probe labeling for the majority of enzymes could be monitored at a single, kinetically relevant time point (245). In this chapter, I employed the ABPP methodology to establish a live mammalian cell based inhibitor screening platform for human DDAH-1. Human DDAH-1 is an important enzyme because of its ability to hydrolyze asymmetric Nω,Nω-dimethyl-L- arginine (ADMA), which is an endogenously produced inhibitor of human nitric oxide synthase and an emerging biomarker for endothelial dysfunction in cardiovascular disease (92, 246). Dysregulation of DDAH activity has been studied as a mediating factor for endothelial dysfunction in a number of disease states including hyperhomocysteinemia (247), renal failure (248), and diabetes (249). However, the existing methodology has shortcomings. Measurements of transcript mRNAs and immunoblots by DDAH-selective antibodies have been used to monitor changes in DDAH expression, but these values do not always correlate well with the activity of DDAH because the enzyme can be inhibited by physiologically relevant modulators such as homocysteine (159), S-nitroso-L-homocysteine (98, 101, 166), zinc(II) (103), 4- hydroxy-2-nonenal (143), nitric oxide (99, 102), and other reactive nitrogen and oxygen

92 species. Likewise, enzyme activity assays are also problematic because they are performed after cell lysis and homogenation, which removes DDAH from its cellular environment and alters the concentrations of modulators. A cell permeable probe to detect enzyme activity would likely prove more relevant for the study of biological function. Therefore, to better understand the regulation of DDAH in normal and pathophysiology, we developed a two-part click chemistry mediated activity-based probe that labels active DDAH-1 in intact mammalian cells but does not label an inactive mutant or inhibited enzyme. In prior work, we discovered that 2-chloroacetamidine (CAA) selectively modifies the active site Cys of Pseudomonas aeruginosa DDAH, which leads to the

-1 formation of a covalent acetamidine adduct with KI of 3.1 mM and kinact of 1.2 min (141) (Figure 4.2). Subsequently, a similar 2-haloamidine activity probe specific for a related enzyme, peptidylarginine deiminase-4, was demonstrated in Escherichia coli cell lysates (236). As a candidate DDAH probe for in vivo use with mammalian cell cultures, we synthesized N-but-3-ynyl-2-chloroacetamidine (1, Click-Cl). The simple butynyl chain was appended to CAA to minimize its impact on selectivity and bioavailability yet still provide a handle for variable functionalization using a click reaction after cell lysis, here a Cu (I) catalyzed 1,3-dipolar cycloaddition with an azide labeled-biotin (241) (Figure 4.3), a strategy proven successful with other enzyme superfamilies (239). In this chapter, I explored the usage of this candidate DDAH probe in its ability to label purified DDAH-1, over-expressed DDAH-1 in bacterial and mammalian cell lysates, and active DDAH-1 in intact mammalian cells. In addition, this probe can be developed as a tool to screen irreversible and reversible DDAH-1 inhibitors in mammalian cells and other biologically relevant environments.

93

Figure 4.2 Possible mechanisms for modification of Pseudomonas aeruginosa DDAH Cys249 by 2-chloro-acetamidine (CAA).

The inactivation occurs by either a direct attack of the active-site Cys249 on the methylene carbon of CAA, displacing a Cl- ion and resulting in a stable thioether bond (a), or occurs through a sulfonium intermediate (b) analogous to mechanisms proposed for halomethyl ketone inactivation of some cysteine proteases (250).

Figure 4.3 In vivo activity probe for DDAH-1. HEK 293T cells expressing myc-tagged DDAH-1 are treated with 1 (Click-Cl), washed, lysed, and reacted with biotin-PEO3-azide and catalysts to biotinylate the active fraction of DDAH- 1. The syn/anti ratio of 3 has not been determined.

94

4.2 MATERIAL AND METHODS

Synthetic procedures for N-but-3-ynyl-2-chloro-acetamidine (1, Click-Cl). The synthesis of Click-Cl was conducted by Dr Shougang Hu as summarized as the following scheme. For details information, please refer to (251).

abc e NH Cl OH OMs N 6 7 3 8 NH2 5 HCl + NH NH HCl 1 N d + Cl HO Cl 9 10 O

Reaction conditions: a) MsCl, Et3N, Et2O, 0° C-RT, 62% yield; b) NaN3, DMF,

70° C, 3.5 hrs; c) Ph3P, Et2O, 0°- 25° C, two steps in 48.6% yield; d) HCl(g), 0° C, 30min,

48% yield; e) H2O, pH=10, 0° C, 62.6% yield.

Preparation of biotin-PEO3-azide (12). Biotin-PEO3-azide was also prepared by Dr. Shougang Hu as outlined below. For detailed procedure, please refers to (251).

O

NaN3 + Tf2O TfN3 Tf = F3CS H2O / CH2Cl2 O O

HN NH H H H TfN3 N O NH2 O O H O / CH Cl / MeOH S H 2 2 2 11 O Et3N, CuSO4, 62 % O

HN NH H H H N O N O O 3 S H 12 O Expression and purification of hDDAH-1. Wild-type hDDAH-1 protein was expressed using pET28a-hDDAH-1re vector in E. coli cells and purified according to the 95 procedure described in (138). Purified hDDAH-1 variants were verified by SDS-PAGE and subjected to ESI-MS analysis (Analytical Core Facility, College of Pharmacy, The

University of Texas at Austin) and gave expected masses: MWcalc = 33,311 Da, MWexptl = 33,305 Da. Time-dependent inactivation of DDAH-1 by Click-Cl (1). Incubations of purified recombinant His6-DDAH-1 (100 µM) and Click-Cl (64-1500 µM) were tested for time-dependent loss of activity by removing aliquots (4 µl) from inactivation mixtures at each time point, and measuring the remaining enzyme activity by diluting into an assay solution (196 µl) containing an excess (0.5 mM) of substrate, Nω,Nω-dimethyl-L-arginine

(ADMA) in DDAH-1 assay buffer (0.1 M KH2PO4, 1 mM EDTA, pH 7.27) at 25 ºC. Activity assays were incubated for 29 min each and quenched by addition of 10 µl of trichloroacetic acid (6 M). Formation of product, L-citrulline, was assessed by derivatization and quantification of the resulting chromophore at 540 nm using a Cary 50 UV-Vis spectrophotometer (Varian, Inc, Walnut Creek, CA) as described elsewhere (168, 177). For every set of experiment, controls without 1 addition were taken for every time points and later subtracted for data recorded at corresponding time point as a background. The kinetic parameters of the inactivation reaction were obtained by fitting the data to the flowing equations:

A t A ∞ A 0 − A ∞ = − ( ) exp( − k obs • t )( Eq 4 .1) A 0 A 0 A 0

k i × []I k obs = ( Eq 4 .2 ) K I + []I

Mass spectral analysis of Click-Cl inactivated DDAH. To determine if Click- Cl is able to form any covalent adduct with DDAH during the inactivation, 30 min incubations of Click-Cl (267 µM) with hDDAH-1 (26.7 µM) were carried out at 25 ºC under the same conditions used in the preincubation as described above. hDDAH-1 96 C274A (31.6 µM) was incubated with Click-Cl (316 µM) under same condition. To test the reversibility of Click-Cl mediated modification, 5 mM glutathione (GSH) was added to the above Click-Cl incubation mixture and sat another 30 min. Both samples were subjected to three times buffer exchange to 20mM NH4Ac/NH3 (pH 7.4) using Amicon Microcon YM10 membrane (Millipore, MA) to remove any reacted Click-Cl. Finally Click-Cl-hDDAH-1 reaction adducts were collected in ~100 μl volume and subjected to ESI-MS analysis as described in Chapter. 2.

Construction of pEF6a-hDDAH-1, pEF6a-hDDAH-2 plasmid and pEF6a- hDDAH-1 C274A mutant. The coding region for human DDAH-1 was amplified from plasmid pET28a-hDDAH-1re (138) using two specific end primers: 5’- aaaaaggatccatggccgggctcggc-3’ and 5’-aaaaagaattcggagtctactttcttgttaattaaaactgagc-3’. The forward primer contains a BamHI restriction site (underlined) followed by 15 bases corresponding to the hDDAH-1 coding sequence. The reverse primer contains an EcoRI restriction site (underlined) followed by 32 bases complementary to the end of hDDAH-1 coding sequence, but omitting the stop codon. The coding region for human DDAH-2 was amplified from previous constructed pCold-hDDAH-2 vector (Appendix 2) using two specific end primers: 5’-aaaaaggatccatggggacgccgggg-3’ and 5’- aaaaagaattcgctgtgggggcgtgtgc-3’. A polymerase chain reaction (PCR) was carried out by an MJ Research (Waltham, MA) PTC 200 thermal cycler with the mixture of aforementioned primers, template, dNTPs, and pfu polymerase in pfu polymerase buffer (Stratagene, La Jolla, CA). The temperature program is 95 °C for 2 min, followed by 2 cycles of 95° C for 30 s, 47° C for 30 s, 72° C for 1 min, 26 cycles of 95° C for 30 s, 57° C for 30 s, 72° C for 1 min, followed by a 10 min hold at 72° C. The PCR-amplified product and the mammalian expression plasmid pEF6a (Invitrogen, Carlsbad, CA) was digested with BamHI and EcoRI restriction enzymes (New England Biolabs, MA) and

97 the small fragments removed by Qiaquick (Qiagen, Valencia, CA) purified before ligation. The resulting plasmid, pEF6a-hDDAH-1, was transformed into E. coli DH5α cells for amplification, and the insert was fully sequenced (DNA Facility, The University of Texas at Austin) to verify the desired sequence. Construction of a C274A mutant was achieved using a QuikChange site-directed mutagenesis kit (Stratagene). Oligonucleotide pairs: 5'- ggatgggctgctcaccgcctgctcagttttaattaacaag-3’ and 5'- cttgttaattaaaactgagcaggcggtgagcagcccatcc-3’ were used to introduce the C274A mutation (underlined). The PCR mixture contained template plasmid (pEF6a-hDDAH-1), mutagenic primers, a dNTP mixture and pfu DNA polymerase in the manufacturer’s buffer (Stratagene). Reactions were subjected to a temperature program of 95° C for 30 s, followed by 16 cycles of 95° C for 30s, 55° C for 1 min, and 68° C for 13 min. DpnI was then added to the cooled reaction mixture to digest the parent methylated plasmid. After incubation at 37° C for 1 h, the remaining unmethylated mutant plasmid was transformed into E. coli DH5α competent cells. Amplified plasmid was extracted from a 5 mL E. coli

DH5α overnight culture with 50 μg/ml ampicillin and the plasmid sequence was verified by DNA sequencing (DNA Facility, The University of Texas at Austin).

In vitro labeling of over-expressed hDDAH-1 in E. coil and HEK 293T cell lysate. pET28a-hDDAH-1re vector was electro-transformed into E. Coli Rosetta DE3 PlysS (RDP) cells (138). DDAH-1 expression was induced and cells were harvested as described in (138). 2 mg/ml DDAH-1 over-expressed RDP proteome in PB buffer (10 mM sodium / potassium phosphate buffer at pH 8.0 containing the complete mini EDTA- free protease cocktail inhibitor (Roche, Indianapolis, IN) and Triton X-100 (1%)) was reacted with 4.4, 8.8, 13.2, 17.6, 22, 30.8, 44, 88 μM Click-Cl (1) in 50 μl total volume for 90 min at 25 ºC room temperature. The reaction mixtures were then mixed with

98 various amount of compound 12 (2.5 mM stock), 1 μl CuSO4 (50 mM), 1 μl tris(2- carboxyethyl)phosphine (TCEP, 50 mM) and 3.3 μl tris[(1-benzyl-1H-1,2,3-trazol-4- yl)methyl]amine (TBTA, 1.5 mM), vortexed and incubated at 25° C for 1 h. For samples with 4.4 and 8.8 μM 1 labeling, 1 μl 12 (2.5 mM stock) was added. For samples with 13.2 and 17.6 μM 1 labeling, 2 μl 12 (2.5 mM stock) was added. For samples with 22 and 30.8 μM 1 labeling, 3 μl 12 (2.5 mM stock) was added. For samples with 44 and 88 μM 1 labeling, 4 μl 12 (2.5 mM stock) was added. Controls were made using 2 mg/mL heat inactivated (100 ºC, 10 min) DDAH-1 over-expressing RDP cell lysate and RDP cell lysate, followed by labeling of 88 μM 1. In addition, 200 μM N5-(1-imino-2-chloroethyl)-

L-ornithine (Cl-NIO) and 1 mM 2-phenyl-1,2-benzisoselenazol-3(2H)-one (ebselen) were added respectively and incubated for 10 min before addition of 88 μM 1 (Chemical structures list in Table. 4.1). Reactions were quenched by addition of 2 × SDS loading buffer and heat inactivated at 100° C for 10 min. Samples were directly used for SDS- PAGE or stored at -80° C before analysis. HEK 293T cells were seeded on a 6 well polystyrene plate using complete growth medium containing DMEM with 10% FBS (Invitrogen, Carlsbad, CA) and grow to 90-95 % confluency. pEF6a-DDAH-1 vector was transient tranfected into HEK 293T cells on six well plate using lipofectamine 2000 (Invitrogen, Carlsbad, CA). After 48 h, old medium was removed and cells were harvested after three times wash with 1ml PBS (pH 7.4) and harvested by suspension in PBS (1 mL) and centrifugation at 1000 rpm for 5 min at 4° C. Cell pellets were stored at -80° C. Frozen cell pellets were resuspended in PB buffer. The resulting solution underwent three cycles of vortexing, flash freezing using

N2(l), and thawing at room temperature to lyse the cells. The cell lysates were centrifuged at 14,000 rpm, 4° C, for 10 min to pellet and discard insoluble cell debris. Total protein concentrations of the resulting lysates were estimated by the Bradford assay. 0.5 mg/ml

99 DDAH-1 over-expressed HEK 293T cell lysate proteome in PB buffer was reacted with

0, 1.1, 2.2, 3.3, 4.4, 5.5, 7.7, 11, 22 μM Click-Cl (1) in 200 μl total volume for 90 min at 25 ºC room temperature. 0.5 mg/ml mock transfected (pEF6a vector transfected) and pEF6a-PAD2 vector (From Lynn Guo) transfected HEK 293T cell lysate were subjected to the same labeling experiment with 22 μM Click-Cl (1) addition as one of the control. Another control uses 0.5 mg/ml heat inactivated (100 ºC, 10 min) DDAH-1 over- expressed HEK 293T cell lysate and subjected to 22 μM Click-Cl (1) labeling. The reaction mixtures were then mixed with various amount of compound 12 (2.5 mM stock),

1 μl CuSO4 (50 mM), 1 μl tris(2-carboxyethyl)phosphine (TCEP, 50 mM) and 3.3 μl tris[(1-benzyl-1H-1,2,3-trazol-4-yl)methyl]amine (TBTA, 1.5 mM), vortexed and incubated at 25° C for 1 h. For samples with 0 ~ 2.2 μM 1 labeling, 1 μl 12 (2.5 mM stock) was added. For samples with 3.3 ~ 4.4 μM 1 labeling, 2 μl 12 (2.5 mM stock) was added. For samples with 5.5 ~ 7.7 μM 1 labeling, 3 μl 12 (2.5 mM stock) was added. For samples with 11 ~ 22 μM 1 labeling, 4 μl 12 (2.5 mM stock) was added. Reactions were quenched by addition of 2 × SDS loading buffer and heat inactivated at 100° C for 10 min. Samples were directly used for SDS-PAGE or stored at -80° C before analysis.

Table 4.1 Chemical structures of DDAH-1 covalent inhibitors used in this chapter.

Name Structure Kinact KI (mM)

-1 2-chloroacetamidine 1.2 ± 0.1 min 3.1 ± 0.8 (141)

(CAA) (141)

2-phenyl-1,2- 40,000 M-1s-1, -

benzisoselenazol- Linsky, T.W., Fast,

3(2H)-one (ebselen) W., unpublished

observations

100 N5-(1-imino-2- Wang, Y., Fast, W., Wang, Y., Fast, W.,

chloroethyl)-L- unpublished unpublished

ornithine (Cl-NIO) observations observations

In vivo labeling of myc-hDDAH-1 and variants in HEK 293T cells. pEF6a- hDDAH-1 and its C274A variant were each transient transfected into HEK 293T cells on six well plate using lipofectamine 2000 (Invitrogen, Carlsbad, CA) as described above. pEF6a-hDDAH-2, pEF6a-PAD2 and pcDNA3.1+-PAD4 (Both PAD plasmids from Lynn. Quo) were also transient transfected in some experiments. After 48 h, old medium was removed. For best labeling concentration determination, different concentration of compound Click-Cl (1) (44 to 440 μM) was added in growth medium (1 mL) and incubated at 37 °C in a CO2 incubator for 90 min. For enzyme labeling, compound 1 (154 μM, can be varied, determined by best labeling concentration test) was added in growth medium. For time dependent labeling test, 154 μM 1 was added in growth medium and incubated for 2 to 90 min, where at certain time points cells were taken out and washed with 1 mL PBS (pH 7.4) for three times followed by cell harvesting. For competitive enzyme labeling in the presence of an irreversible inhibitor (25 μM, chemical structures list in Table. 4.1), such as 2-chloroacetamidine (CAA), Cl-NIO and ebselen, were first added in growth medium (1 mL) to cells and incubated for 30 min at 37 °C in a CO2 incubator before subsequent addition of compound 1 (154 μM) and an additional 90 min incubation. For competitive labeling in the presence of a reversible inhibitor, L-IPO (0 to

1280 μM), L-IHO (0 to 4000 μM), L-homocysteine (L-Hcy, 0 to 4 mM) were first added to cells in growth medium (1 mL) and incubated for 30 min at 37° C in a CO2 incubator before subsequent addition of compound 1 (154 μM) and an additional 10 min (determined by time dependent labeling test) incubation. After these treatments, cells 101 were washed three times with PBS (1 mL) at pH 7.4 and harvested by centrifugation at 1000 rpm for 5 min at 4° C. Cell pellets were stored at -80° C. Cells were lysed and centrifuged to remove insoluble cell debris as described in in vitro labeling experiments. Total protein concentrations of the resulting lysates were estimated by the Bradford assay. Biotin-PEO3-azide (12) was appended to alkyne labeled proteins using the Cu (I) catalyzed 1,3 dipolar cycloaddition reaction as follows: 25 μg total protein in 50 μl PB buffer was mixed with 0.5 μl of compound 12 (2.5 mM), 0.5 μl CuSO4 (50 mM), 0.5 μl tris(2-carboxyethyl)phosphine (TCEP, 50 mM) and 1.65 μl tris[(1-benzyl-1H-1,2,3- trazol-4-yl)methyl]amine (TBTA, 1.5 mM), vortexed and incubated at 25° C for 1 h. Reactions were quenched by addition of 2 × SDS loading buffer and heat inactivated at 100° C for 10 min. Samples were directly used for SDS-PAGE or stored at -80° C before analysis.

Besides biotin-PEO3-azide (12), other fluorescence based azide tag can be linked to 1 after in vivo or in vitro labeling. Alexa Fluor 594 azide tag (Ex/Em: 590/617) (Invitrogen, Carlsbad, CA) was used to visualize 1 mediated in vivo labeling. SDS-PAGE gel was directly scanned using Typhoon Trio imager Typhoon Trio imager with green (532 nm) excitation and 610 nm emission filter under 450 v (Core DNA Facility, University of Texas, Austin). Two-color Western blot detection. Western blots were performed using typical procedures using two primary antibodies, IgG fraction monoclonal mouse anti- biotin (1:200, Jackson ImmunoResearch, West Grove, PA) and rabbit polyclonal anti- myc (1:1000, Abcam, Cambridge, MA), coupled with the two-color Odyssey IR Dye Western Blot Kit I (Li-Cor Biosciences, Lincoln, NE), which contains IR Dye 800CW goat anti-mouse secondary antibody and IRDye 680CW goat anti-rabbit secondary antibody (1:10000). Images were scanned using an Odyssey Infrared Imaging System

102 (Li-Cor Biosciences, Lincoln, NE) at the core DNA Facility (University of Texas, Austin). Integrated fluorescence intensities were taken for both 680 nm and 800 nm channels. The 680 nm value (the response to myc, displayed in red) was used for normalization and the resulting fluorescence intensities for the response to biotin (displayed in green). For time dependent labeling experiment, normalized intensity was fitted to time progression equation 4.3: I800/ I700 = A×(1− exp(−k ×t))(Eq 4.3)

For in vivo IC50 quantification experiment, normalized intensity was fit to the following equation 4.4:

h % Fluorescence Intensity = 100% - (100% / 1 + (IC50/[Inhibitor]) ) where h is floated give a Hill coefficient (Eq 4.4).

A semi-quantitative assay for DDAH-1 inhibitor screen via Click-Cl (1) in HEK 293T cells. pEF6a–hDDAH-1 vector was constructed as described in (251) and used to over-express myc tagged hDDAH-1 recombinant protein in HEK 293T cells. HEK 293T cells were seeded on a 6 well polystyrene plate using complete growth medium containing DMEM with 10% FBS (Invitrogen, Carlsbad, CA) and grow to 50-60 % confluency. pEF6a-hDDAH-1 was transfected into HEK 293T cells using lipofectamine 2000 (Invitrogen, Carlsbad, CA). After 24 h, old medium was removed and cells were washed with 1 mL and 0.5 mL PBS (pH = 7.2, Invitrogen, Carlsbad, CA). 350

μM L-NIO, L-IPO, L-IPnO, L-IHO were added to cells in growth medium (1 mL) and incubated for 30 min at 37° C in a CO2 incubator before subsequent addition of compound 1 (110 μM) and an additional 10 min incubation. After these treatments, cells were washed two times with PBS (1 mL) at pH 7.4 and harvested by suspension in PBS (1 mL) and centrifugation at 1000 rpm for 5 min at 4° C. Cell pellets were stored at -80° C. Frozen cell pellets were lysed and followed by click chemistry reaction with the

103 addition of Biotin-PEO3-azide (12) as described in (251). Two-color western blot detection was used to detect the expression levels of myc-DDAH-1 and response to the biotin tag as described in (251). Images were scanned using an Odyssey Infrared Imaging System (Li-Cor Biosciences, Lincoln, NE) at the core DNA Facility (University of Texas, Austin). Integrated fluorescence intensities were taken for both 680 nm and 800 nm channels. The 680 nm value (the response to myc, displayed in red) was used for normalization and the resulting fluorescence intensities for the response to biotin (displayed in green) was converted to a percentage ratio for every treated inhibitors. The percentage activity left was calculated using Eq. 4.5. Normalized biotin intensities in the sample with 1 addition but no inhibitor addition was viewed as 100%, and the intensities in the sample without inhibitor and 1 addition was 0%. Same experiment was repeated four times to get an average response percentage for every inhibitor. Standard errors were calculated for every inhibitor testing group by Kaleidagraph (Synergy Software) and plotted as error bar in a column graph.

(Ibiotin/Imyc)inhibitor Activity% = 100× (Eq 4.5) (Ibiotin/Imyc)control

4.3 RESULTS AND DISCUSSION

Click-Cl (1) is a time dependent irreversible inhibitor for human DDAH-1. Click-Cl was first tested for its ability as a human DDAH-1 inhibitor. Preincubation mixtures of DDAH with 1 result in time- and concentration-dependent enzyme

-1 inactivation, with KI and kinact values of 2.2 ± 0.7 mM and 6.7 ± 1.5 min , respectively (Figure 4.4 A, B). Inhibition is observed after rapid dilution of the preincubation mixtures into a large excess of substrate and after extensive buffer exchange to remove noncovalently bound inhibitors, consistent with an irreversible mechanism. ESI-MS was used to analyze the covalent adduct formed between 1 and human DDAH-1. After 30 min 104 incubation and extensive buffer exchange, ESI-MS analysis gives a Mwexptl = 33,413 Da for 1 modified hDDAH-1 (Figure 4.5 B). Comparing with unmodified DDAH-1 wild- type with a MWcalc = 33,305 Da (Figure 4.5 A), Click-Cl modification causes a +108 Da mass increases which indicates the formation of a one to one irreversible adduct despite the presence of excess Click-Cl. The structure of modified adduct is shown in 2 (Figure 4.3). Addition of excess glutathione can not reverse the modification between 1 and human DDAH-1. It gives a Mwexptl = 33,413 Da in ESI-MS which suggests the covalent adduct is irreversible in presence of excess glutathione. This modification happens at the active site cysteine (Cys274) of DDAH-1, which is proved by the unaltered mass after 1 mediated C274A mutant inactivation.

105

Figure 4.4 Kinetics of DDAH inactivation by Click-Cl (1).

(A) Time and concentration dependence of DDAH inactivation by 1. The experimental points are represented by various symbols, and the line connecting them is fitted to eq 4.1 to yield pseudo-first-order rate constant kobs. The concentration of 1was as follows: ○, 64 µM; x, 125 µM; +, 250 µM; □, 500 µM; ◊, 1000 µM. (B) Concentration dependence of the pseudo-first-order rate constant kobs for 1 mediated hDDAH-1 inactivation. All experimental points are fitted to eq 4.2 to give fitted KI and kinact values.

106

Figure 4.5 ESI-MS spectra of covalent adduct formed between Click-Cl (1) and hDDAH-1.

(A) ESI-MS spectra of purified DDAH-1, Mw exptl = 33,305 Da. (B) ESI-MS spectra of Click-inactivated DDAH-1 after extensive buffer exchange, Mw exptl = 33,413 Da

Click-Cl (1) is able to label over-expressed DDAH-1 but not DDAH-2 in cell lysate. Click-Cl (1) has been proved to be able to form a covalent adduct with DDAH-1 as described above. The next step is the addition of a biotin-PEO3-azide to the 1 by Cu (I) catalyzed click chemistry. Over-expressed DDAH-1 in E. Coli (Rosetta DE3 PlysS, RDP) and HEK 293T cell lysate were incubated with biotin-PEO3-azide and catalysts for the 107 cycloaddition reaction followed by SDS-PAGE to resolve the crude protein mixture. The presence of myc (only for DDAH-1 in HEK 293T cells) and biotin were demonstrated by Western blot using rabbit antimyc and mouse antibiotin primary antibodies and two near- infrared dye labeled secondary antibodies with emissions at 680 nm (antirabbit, red) and 800 nm (antimouse, green), which were chosen for their linear concentration-dependent response (252). In E. coli cell lysate, response to the biotin tag (green) was observed when cell lysate was treated by 1 with concentration 13.2 ~ 88 µM (Figure 4.6). 1 can not label heat inactivated cell lysate (There was a bubble during western blot, which lead to partial loss of the signal at lane9 in Figure 4.6. There was no labeled band in lane 9 as confirmed by a rerun western blot, though blot signal is weaker than Figure 4.6). Addition of two DDAH-1 covalent inhibitors, Cl-NIO (200 µM) and ebselen (1 mM) prior to addition of 1 blocks biotinylation, indicating that Cl-NIO, ebselen and 1 compete for the same site. Similarly, response to the biotin tag (green) was observed when HEK 293T cell lysate was treated by 1, but not when cell lysate was heat inactivated. Response to the myc tag (red) indicated consistent levels of DDAH-1 expression and loading (Figure 4.7). Addition of 1 first labeled DDAH-1 in HEK293T cell lysate. With the concentration increasing, 1 also labels other protein targets in cell lysate. 1 mediated labeling is specific to DDAH-1 at certain concentration range. Surprisingly, 1 cannot label peptidylarginine deiminase 2 (PAD; EC 3.5.3.15) which is another enzyme in the amidinotransferase superfamily that catalyzes hydrolysis of substituted arginines. Although the particular substrates differ, PAD2 and DDAH-1 are proposed to proceed through similar covalent S-alkyl-thiouronium intermediates formed by nucleophilic attack of an active-site Cys residue (89). CAA is also a time dependent inhibitor for PAD4 with KI ~ 20 mM and kinact ~ 0.7 min-1 (141). In addition to PAD2, 1 cannot in vitro label over-expressed PAD4 and

108 DDAH-2 in HEK 293T cell lysate. PAD enzyme labeling experiments were tried multiple times with varies concentration of 1 (11 ~ 176 µM) and with/without 2 ~ 10 mM Ca2+, 5 mM DTT addition, although there are non-activity dependent labeling happens at more than 44 µM 1 in purified PAD4 protein. DDAH-2 labeling experiment was performed with the same condition as DDAH-1. Human DDAH-2 in HEK 293T cell lysate cannot be labeled by 1 while DDAH-1 was labeled successfully (Figure 4.8). In summary, Click-Cl (1) is able to label over-expressed DDAH-1 in both bacterial and mammalian cell lysate. This labeling is DDAH-1 activity dependent and happens at DDAH-1 active site. It is specific to human DDAH-1 but not similar enzymes such as DDAH-2, PAD2 and PAD4 in the same amidinotransferase superfamily. However, 1 is able to label other unknown protein targets in cell lysate especially at high concentrations, which is the topic of further investigation.

109 [Click-Cl] 4.4 8.8 13.2 17.6 22 30.8 44 88 88 88 88 88 (µM) hDDAH-1 + + + + + + + + + + + - transfected RDP

RDP ------+

Cl-NIO ------+ - -

Ebselen ------+ -

Heat ------+ - - -

Figure 4.6 In vitro labeling of DDAH-1 in RDP (Rosetta DE3 PlysS) cell lysate.

110 (A) In vitro labeling of DDAH-1 in RDP (Rosetta DE3 PlysS) cell lysate by increasing concentration of Click-Cl (1) (4.4 ~ 88 µM). Green coloring corresponds to antibiotin Western blot signals. (B) Coomassie staining of the same samples used for (A).The MWcalcd of His6-DDAH-1 is 33,305 Da.

Figure 4.7 In vitro labeling of DDAH-1 in HEK 293T cell lysate.

(A) In vitro labeling of DDAH-1 in HEK 293T cell lysate by increasing concentration of Click-Cl (1) (0 ~ 22 µM). Red and green coloring corresponds to antimyc and antibiotin Western blot signals. (B) Coomassie staining of the same samples used for (A). The MWcalcd of myc-DDAH-1 is 35,894 Da and myc-PAD-2 is 75,564 Da.

111

[Click-Cl] 0 4.4 5.5 7.7 11 22 Marker 0 4.4 5.5 7.7 11 22 (µM) hDDAH-2 + + + + + + ------transfected 293T hDDAH-1 ------+ + + + + + transfected 293T

Figure 4.8 In vitro labeling of DDAH-1 and DDAH-2 in HEK 293T cell lysate.

(A) In vitro labeling of DDAH-1 and DDAH-2 in HEK 293T cell lysate by increasing concentration of Click-Cl (1) (0 ~ 22 µM). Red and green coloring corresponds to antimyc and antibiotin Western blot signals. (B) Coomassie staining of the same samples used for (A). The MWcalcd of myc-DDAH-1 is 35,894 Da and myc-DDAH-2 is 34,416 Da.

112

Click-Cl (1) is able to label over-expressed DDAH-1 in intact HEK 293T cells. Although Click-Cl (1) is proved to be a DDAH-1 specific probe in vitro in both bacterial and mammalian cell lysate, it is of high interest to study whether 1 is an in vivo DDAH-1 activity probe and can label active DDAH-1 inside of intact mammalian cells. By transient transfection, human DDAH-1 bearing an N-terminal Myc-tag was expressed in HEK 293T cells. Addition of differenct concentration of 1 (44 ~ 440 μM) to the growth medium was followed by a short incubation, cell washing, and harvesting. Cells were subsequently lysed by multiple freeze/thaw cycles, and the resulting lysate was incubated with biotin-PEO3-azide and catalysts for the cycloaddition reaction followed by SDS-PAGE to resolve the crude protein mixture. The presence of myc and biotin were demonstrated by two color western blot with red color corresponding to antimyc signal and green color corresponding to antibiotin signal (Figure 4.9). Response to the myc tag (red) indicated consistent levels of DDAH-1 expression and loading. Results indicate 1 is able to label over-expressed DDAH-1 inside intact HEK 293T cells. 1 mediated in vivo labeling is relative specific to DDAH-1 in a DDAH-1 over-expressing mammalian cell system with a concentration ≤ 154 µM. 1 will also label other cellular protein targets when it reaches higher concentrations. Therefore, I choose 154 µM 1 as the labeling concentration for in vivo DDAH-1 labeling in DDAH-1 overexpressed HEK 293T cells since it is relatively specific and gives the best Western blot signal. Besides the biotin tag, other reporter tags can also be linked to 1 by click chemistry reaction after in vivo labeling, for example, Alexa Fluor 594 with Ex/Em (590/617). Gel scanning after SDS- PAGE using Typhoon Trio imager indicates the successfully labeling of over-expressed DDAH-1 in HEK 293T cell lysate (Figure 4.10).

113 It is worthwhile to notice that this best labeling concentration for the probe (1) can vary with cell condition change or the purity of the probe. It is important to repeat this experiment and re-determine the best working condition, especially when there is obvious change in the experimental materials. Non-optimized labeling concentration can increase nonspecific labeling or cause faint labeling signal. Besides, it is important to keep mammalian cells in a healthy and active state when perform in vivo labeling. Otherwise, 1 cannot be effectively taken into the mammalian cells during the incubation period.

Figure 4.9 In vivo labeling of DDAH-1 in intact HEK 293T cells.

114 Above, Red and green coloring correspond to antimyc and antibiotin Western blot signals, respectively. Below, coomassie staining of the same samples used for the Western blot. The Mwcalcd of myc-DDAH-1 is 35,894 Da

Figure 4.10 Fluorescence gel scanning image of in vivo labeling of DDAH-1 in HEK 293T cell lysate.

(A) Fluorescence gel scanning image use Typhoon Trio imager with green (532 nm) excitation and 610 nm emission filter. Alexa Fluor 594 azide tag was used instead of biotin-PEO3-azide. 75 kD and 25 kD marker also have fluorescence signal because their red color (Biorad dual color marker). (B) Coomassie staining of the same samples used for (A).

Using the labeling conditions as described above, I tested the specificity of 1 mediated in vivo labeling in HEK 293T cells (Figure 4.11). Response to the biotin tag (green) was observed when cells were treated by 1, but not when 1 was omitted. An inactive DDAH-1 in which the active-site Cys274 is mutated to Ala is also not labeled by 1, despite the presence of five other Cys residues in its primary sequence. Addition of 115 CAA (25 μM) prior to addition of 1 blocks biotinylation, indicating that CAA has sufficient bioavailability to react with DDAH-1 in 293T cells and that CAA and 1 compete for the same site. Mock transfection with an empty expression vector or 293T cells alone did not result in a labeled band at the expected position for DDAH-1. These experiments clearly demonstrate that 1 can label active DDAH-1 in cultured mammalian cells and this labeling occurs at the active site Cys274 of DDAH-1.

Figure 4.11 In vivo labeling of DDAH-1 is specific and occurs at Cys 274 in intact HEK 293T cells.

116 (A) Red and green coloring correspond to antimyc and antibiotin Western blot signals, respectively. (B) Coomassie staining of the same samples used for (A).The MWcalcd of myc-DDAH-1 is 35,894 Da

Click-Cl (1) mediated time dependent labeling of DDAH-1 in intact HEK 293T cells. Activity-based probes can be used to discover irreversible inhibitors which involve preincubation of cell or tissue proteomes with enzyme inhibitors followed by addition of activity-based probes that bear one or more reporter groups (such as biotin or fluorophores). Enzymes modified by irreversible inhibitors are unable to react with probes and can be detected by a reduction or completely loss in labeling signal from the reporter group. Covalent DDAH-1 inhibitors, such as CAA, Ebselen and Cl-NIO, have been shown to reduce Click-Cl (1) mediated labeling signal in Figure 4.10. However, irreversible inhibitors display poor target selectivity by virtue of their inherent reactivity for most enzyme classes, and are thus less desirable than reversible inhibitors as lead compounds for pharmacological studies and drug development (253). The strategy for irreversible inhibitor discovery cannot be directly applied to reversible inhibitor discovery, for which the kinetics of probe-proteome reactions must be taken into account (245). Depending on the affinity of the inhibitor and the rate of probe reactivity, reversible inhibitors will only affect probe labeling of a given enzyme target for a restricted period of time. In order to establish an in vivo screen assay for reversible DDAH-1 inhibitors, we have to find a good assay condition where the majority of target protein labeling hasn’t reached its completion but proceeded to a sufficient extent to enable visualization. Therefore, I performed time dependent labeling in HEK 293T cells where I monitored the labeling progression (Figure 4.12). I analyzed the signal intensity of anti-biotin tag which is the labeling signal, and normalized by the signal intensity of anti-myc tag which is the level of DDAH-1 expression. The normalized labeling signal

117 was plotted and fitted to a time progression curve. With time increasing, active DDAH-1 in intact HEK 293T cells was gradually labeled by 1 and this labeling reached its saturation around 20 min (Figure 4.12). Therefore, the best labeling time for reversible inhibitor discovery is 10 min where 1 mediated DDAH-1 labeling was close but not reached saturation.

Figure 4.12 In vivo time dependent labeling of DDAH-1.

118 (A) Red and green coloring correspond to antimyc and antibiotin Western blot signals, respectively. (B) Labeling progressing curve for 1. I800 green color antibiotin signal was normalized by I700 red color antimyc signal. Dashed line highlights a 10-in time point at which the labeling reactions for the majority of DDAH-1 had proceeded to a sufficient extent to permit protein visualization by two color western blot, but had not reached saturation.

Click-Cl (1) can be used to develop a semi-quantitative assay for DDAH-1 inhibitor screening in intact mammalian cells. Activity-based probes serve as powerful tools for the discovery of enzyme activities associated with discrete physiological and pathological processes. In addition, it has been applied to identify irreversible inhibitors and reversible inhibitors (245, 254). Click-Cl (1) has been demonstrated as an in vivo DDAH-1 activity probe in mammalian cells as described above. It will be useful if we can use 1 as a DDAH-1 activity probe to develop a semi-quantitative screen assay for good DDAH-1 inhibitors in live mammalian cells. It can give a more accurate estimation of inhibitor potency compared to the enzyme activity assays that removes DDAH from its physiological environment. An in vivo inhibitor assay performed in live mammalian cells can integrate the factors such as compound bioavailability, protein binding, competition with endogenous DDAH-1 modulators, competitive binding with other protein targets, and other variables not easily mimicked during in vitro tests. The methodology I proposed for a semi-quantitative screen assay for DDAH-1 inhibitors in HEK 293T cells is summarized in Figure 4.13. Briefly, myc-DDAH-1 transfected HEK 293T cells were pretreated with a certain concentration of different inhibitors followed by addition of Click-Cl (1) into cell growth medium, a short incubation, cell washing, and harvesting. Cells were subsequently lysed by multiple freeze/thaw cycles, and the resulting lysate was incubated with biotin-PEO3-azide (12) and catalysts for the cycloaddition reaction followed by SDS-PAGE to resolve the crude protein mixture. A two color western blot assay was used to detect DDAH-1 expression 119 level and biotin labeling signal, where anti-biotin response is green and anti-myc response is red. Individual response to the biotin tag for every inhibitor was normalized for expression levels of myc-DDAH-1. In order to compare in vivo inhibition potency among inhibitors, every normalized response was converted to percentage activity using normalized response without inhibitor addition as 100%. Normalized response without 1 and inhibitor addition was treated as 0%.

Figure 4.13 In vivo inhibitor evaluation in HEK 293T cells by click-chemistry mediated activity probe.

HEK 293T cells expressing myc-tagged DDAH-1 are pretreated with certain concentration of different inhibitors followed by treating with 1, washed, lysed, and reacted with biotin-PEO3-azide (12) and catalysts to biotinylate the active fraction of DDAH-1. Biotinylation response for every inhibitor was normalized for DDAH-1 expression level and converted to inhibition percentage using the response without inhibitor addition as 100%.

This semi-quantitative inhibitor screening assay was first tested on the in vitro characterized amidino-based DDAH-1 reversible inhibitors, such as N5-(1-imnioethyl)-L-

120 ornithine (L-NIO), N5-(1-iminopropyl)-L-ornithine (L-IPO), N5-(1-iminopentyl)-L-

5 ornithine (L-IPnO) and N -(1-iminohexyl)-L-ornithine (L-IHO) (Ki = 990, 52, 7.5, 110 μM respectively), as described in Chapter 3. 350 μM each of different inhibitors were added into the growth medium of HEK 293T cells and followed by the procedures described above. The in vivo inhibition evaluation result is shown in Figure. 4.14, with every column data is the mean ± standard error for n >3 experiments. Treatment with 350

μM L-NIO, L-IHO, L-IPO and L-IPnO left 93.8 ± 5.6%, 90.0 ± 6.7%, 62.3 ± 3.9% and

36.1 ± 1.7% activity respectively. In other words, pretreatment with 350 μM L-NIO can barely inhibit DDAH-1 activity in intact HEK 293T cells under these experimental conditions. Extending the alkyl substituent of L-NIO by one methylene group to form L- IPO increase inhibition potency and can decrease 40% DDAH activity under the same condition, which is consistent with previously reported 350 ± 90 μM in vivo IC50 for L-

IPO (251). Further extending the alkyl chain of L-IPO by an additional two methylene group to form L-IPnO leads to further potency increase and can cause 60% DDAH activity decrease in vivo. Linear chain extension to L-IHO decreases the affinity for

DDAH and 350 μM compound addition can only cause 10% DDAH activity decrease. In summary, the in vivo DDAH inhibit potency for alkylamidine scaffold inhibitors as gauged by 350 μM compound treating in HEK 293T cells can be ranked as: L-IPnO > L-

IPO > L-IHO > L-NIO. In particular, L-IPO has reached its ~50% inhibition under 350

μM treatment condition, and L-IPnO’s in vivo IC50 must be below 350 μM.

121

Figure 4.14 In vivo alkylamidine inhibitor evaluation in HEK 293T cells.

(A) Two-color Western blots reflect presence of myc (red) and biotin (green) tags after labeling of overexpressing human DDAH-1 in intact HEK 293T cells in the presence of 350 μM inhibitors. (B) Normalized fluorescence intensities for the biotin-derived signal are calculated for every inhibitor. They were converted to percentage inhibition using normalized response with only 1 addition as 100%, and normalized response without 1 and inhibitor addition (-) as 0%. Data shown in (B) are the mean ± standard error (n >3).

This in vivo potency trend for alkylamidine scaffold inhibitors is in consistent with previous in vitro Ki calculation using purified DDAH recombinant protein (Table

4.2), where there is a 20-fold potency increase from L-NIO (Ki = 990 μM) to L-IPO (Ki =

122 52 μM), 7-fold potency increase from L-IPO to L-IPnO (Ki = 7.5 μM), 15-fold potency decrease from L-IPnO to L-IHO while inhibition still evident (Ki = 110 μM).(138) The similar trend both in vitro and in vivo suggests similar uptake of alkylamidine scaffold inhibitors with different length of alkyl chain in HEK 293T cells, possibly through the same y+ cationic amino acid transporter as L-Arginine transport as reported in activated macrophages (223). This assay will be particularly useful when inhibitor behaves different in vivo from in vitro, for example, when inhibitor cannot be uptaken into mammalian cells.

Table 4.2. In vitro Ki values of different alkylamidine inhibitors for DDAH-1 and nNOS inhibition.

DDAH- nNOS Structure Ki Ki (μM) 1(μM)a

L-NIO 990 ± 80 1.7b

L-IPO 52 ± 4 3.0b

L-IPnO 7.5 ± 0.4 20 ± 4c

L-IHO 110 ± 10 >1900d

a b c Calculated from IC50 values, human DDAH-1 (138). Rat nNOS (136). Human nNOS

d (191). IC50 value for rat nNOS (201).

123

In vivo IC50 quantitative determination for DDAH-1 reversible inhibitors. In addition to semi-quantitative inhibitor in vivo screen, Click-Cl (1) can also be used to give a quantitative measurement of compound in vivo IC50 especially for reversible

5 inhibitors. N -(1-iminopropyl)-L-ornithine (L-IPO, Ki ~ 50 μM) is a competitive reversible inhibitor of DDAH-1, that we previously developed as a nonhydrolyzable analogue of the substrate Nω-methyl-L-arginine (Chapter 3) (138). Cells were preincubated with varying concentrations of L-IPO, followed by addition of 1, washing, harvesting, and lysis. For dose dependent studies, response to the biotin tag was normalized for expression levels of myc-DDAH-1. In the absence of inhibitor, DDAH-1 was effectively biotinylated, indicating that the active site Cys274 was available to react with 1 (Figure 4.15). Biotinylation of DDAH-1 diminished with increasing concentrations of L-IPO, indicating both the bioavailability of L-IPO and its competition with 1 for binding to the active site of DDAH-1, resulting in a level of inhibition that defines an in vivo IC50 value of 350 ± 90 μM and a Hill coefficient of 0.9 ± 0.3. The value of the Hill coefficient suggests noncooperative binding event. The in vivo IC50 is approximately 7-fold higher than the in vitro Ki value, with the difference in potency representing a combination of factors including bioavailability, protein binding, competition with endogenous DDAH-1 modulators, and other variables not easily mimicked during in vitro tests.

124

Figure 4.15 In vivo IC50 determination for L-IPO.

Normalized fluorescence intensities for the biotin-derived signal are fit with an in vivo IC50 of 350 ± 90 µM, hill coefficient is 0.9 ± 0.3. (Inset) Two-color Western blots reflect presence of myc (red) and biotin (green) tags after labeling of intact HEK 293T cells in the presence of 0, 10, 20, 40, 80, 160, 320, 640, and 1280 µM L-IPO (left to right).

A similar method was applied to test other reversible inhibitors, such as N5-(1- iminohexyl)-L-ornithine (L-IHO, Figure 4.16) and L-homocysteine (L-Hcy, Figure 4.17).

L-IHO is another amidino based competitive reversible inhibitor of DDAH-1, which is the linear extension of the alkyl chain by an additional three methylene units (138).

Compared with L-IPO, L-IHO decreases slightly in potency for DDAH-1 inhibition (Ki.~

110 μM). But L-IHO is the most selective DDAH-1 inhibitor with more than ten fold Ki difference between nitric oxide synthase (NOS) and DDAH-1 in a series of amidino 125 based inhibitor, which include L-NIO, L-IPO, L-IPnO and L-IHO (138). L-IHO’s in vivo

IC50 in HEK 293T cell was assayed in a similar way as L-IPO except for 0 ~ 4000 µM

IHO was used. After curve fitting, the in vivo IC50 value for L-IHO is 980 ± 270 µM, which is approximately 9-fold higher than the in vitro Ki value (Figure 4.16). This difference is slightly larger than L-IPO (7-fold), which may due to the decrease of compound uptake because of L-IHO’s bulky alkyl chain. The fitted Hill coefficient is 0.8 ± 0.2, which suggests noncooperative binding.

Figure 4.16 In vivo IC50 determination for L-IHO.

Normalized fluorescence intensities for the biotin-derived signal are fit with an in vivo IC50 of 980 ± 270 µM, hill coefficient is 0.8 ± 0.2. (Inset) Two-color Western blots reflect presence of myc (red) and biotin (green) tags after labeling of intact HEK 293T cells in the presence of 0, 31.25, 62.5, 125, 250, 500, 1000, 2000, and 4000 µM L-IHO (left to right). 126 L-homocysteine (L-Hcy) is an endogenous low molecular thiols who’s elevation is a cardiovascular risk factor that correlates with decreased levels of endothelium-derived nitric oxide (NO) and subsequent endothelial dysfunction (101). L-Hcy is a reversible inhibitor of DDAH-1 in vitro with a calculated Ki of 330 µM (101, 159). Therefore it is of interest to investigate the in vivo inhibitory effect of L-Hcy to DDAH-1, which can be important mechanism of endothelial NO regulation. L-Hcy’s in vivo IC50 in HEK 293T cell was assayed in a way as described above, with a concentration range from 0 ~ 4 mM.

Inhibition curve fitting gives an in vivo IC50 value of 2.4 ± 0.2 mM, which is approximately 7-fold higher than the in vitro Ki value (Figure 4.17). The fitted Hill coefficient is 2.0 ± 0.4, which suggests positively cooperative binding. This positively cooperative binding mode is unique comparing to other reversible inhibitors, which suggests possible DDAH-1 conformational change induced by L-Hcy binding. Another possibility is the mixed effect of L-Hcy extracellular administration, which may increase the intracellular concentration of L-Hcy and HcyNO at the same time in living mammalian cell. HcyNO is a time dependent covalent inhibitor of human DDAH-1 (kinact ~ 3.79 ± 0.06 M-1S-1) and is able to form an unusual N-thiosulfoximide adduct (Chapter

2) (98, 101). Therefore, it is possible that the reversible binding of L-Hcy makes DDAH- 1 active site more accessible to irreversible HcyNO modification.

127

Figure 4.17 In vivo IC50 determination for L-Hcy.

Normalized fluorescence intensities for the biotin-derived signal are fit with an in vivo IC50 of 2.4 ± 0.2 mM, hill coefficient is 2.0 ± 0.4. (Inset) Two-color Western blots reflect presence of myc (red) and biotin (green) tags after labeling of intact HEK 293T cells in the presence of 0, 1, 1.5, 2, 3 and 4 mM L-Hcy (left to right). Experiment was repeated in duplicate.

Click-Cl (1) was also used to estimate EC50 values for covalent DDAH-1 inhibitors, especially when there are difficulties in performing an in vitro enzymatic assay. EC50 is a more general term than IC50, which refers to the concentration of a drug, antibody or toxicant that induces a response 50% between the baseline and maximum after specified exposure time. N5-(1-imino-2-chloroethyl)-L-ornithine (Cl-NIO) is a 128 synthesized covalent DDAH-1 inhibitor which carries the same reactive group as Click- Cl probe. Preliminary testing by a time dependent inactivation assay was not very successful due to the extreme fast reaction rate, which limits our measurement accuracy. Direct addition of Cl-NIO into HEK 293T cell growth medium followed by 15 min incubation in 37 ºC incubator causes diminishing biotinylation signal after 1 labeling.

The normalized antibiotin response can be used to estimate an EC50 for Cl-NIO at a 15 min incubation time in HEK 293T cells, which is ~ 5.5 µM (Figure 4.18). It is worth notice that this value is not a measure of affinity, but does indicate useful parameters for experimental use of this compound.

Figure 4.18 In vivo EC50 determination for Cl-NIO.

129 Cl-NIO was added into HEK 293T cell growth medium followed by 15 min incubation in 37 ºC incubator. Normalized fluorescence intensities for the biotin-derived signal are fit with equation 100/(1+[Cl-NIO]/EC50) and give an estimation about 5.5 µM (Inset). Two- color Western blots reflect presence of myc (red) and biotin (green) tags after labeling of intact HEK 293T cells in the presence of 0, 5, 10, 20, 40 and 80 µM Cl-NIO (left to right). Experiment was repeated in duplicate.

In conclusion, the data presented herein demonstrate that 1 serves as a novel click chemistry mediated in vivo activity probe that labels the active fraction of DDAH-1 in intact mammalian cells and that can be blocked by the presence of competitive reversible and irreversible inhibitors. Incorporation of the alkyne tag allows the flexibility to derivatize with a variety of reagents after in vivo tagging (255). The two-color imaging system enables normalization to account for variable protein expression when determining in vivo IC50 values of inhibitors. Additionally, the small size and simplicity of 1 suggest its use as a broad-specificity probe for labeling endogenous DDAH isoforms and enzymes with similar pharmacophores, the subject of ongoing studies. This probe provides a novel tool for the analysis of DDAH-1 activity in normal and pathophysiological states relevant to cardiovascular disorders and should allow more meaningful studies of the etiology of endothelial dysfunction.

130 Appendix. Expression and purification tests for mammalian DDAH-2

Source Vector Cloning Cloning Primersa Expression Purification sites resultb result Human pGEX BamHI, 5'- Over- Protein stays 6p-1 EcoRI aaaaaggatccatggggacgc expressed with in inclusion cgggggagg -3’ 0.1, 0.25, 0.5, bodies. 5'- 1 mM IPTG. acaaagaattctcagctgtggg ggcgtgtgc -3’

pCold BamHI, 5'- Over- DDAH-2 TF EcoRI aaaaaggatccatggggacgc expressed, best seems to cgggggagg -3’ with 0.5 mM degrade. 5'- IPTG addition. Fusion aaaagaattctcagctgtgggg But I doubt if protein can gcgtgtgc -3’ DDAH-2 is not be cut by expressed. thrombin pET32_ BamHI, Same as pGEX6p-1 Over- Protein stays Trx- EcoRI expressed, best in inclusion H6_TE with 0.1 mM bodies. V_Olga IPTG. Mouse pET28a BamHI, 5'- Not very good Protein stays EcoRI aaaaaggatccatggggacgc over- in inclusion cgggggagg -3’ expression bodies. 5'- with 0.25 mM acaaagaattctcagcagtggg IPTG ggcgtgtgc -3’ pGEX BamHI, Same as pET28a Over- Protein stays 6p-1 EcoRI expressed, best in inclusion with 0.25 mM bodies. IPTG. pCold BamHI, Same as pET28a Over- Protein stays TF EcoRI expressed with in inclusion 0.25 mM bodies. IPTG. pET32_ BamHI, Same as pET28a Over- Protein stays Trx- EcoRI expressed, best in inclusion H6_TE with 0.25 mM bodies and V_Olga IPTG. insoluble. Bovine pET28a BamHI, 5'- Not very good Protein stays EcoRI aaaaaggatccatggggacgc over- in inclusion caggggagg -3’ expression bodies. 131 5'- with 0.25 mM acaaagaattctcagttgtggg IPTG ggcgtgtgc -3’ pGEX BamHI, Same as pET28a Over- Protein stays 6p-1 EcoRI expressed, best in inclusion with 0.25 mM bodies. IPTG. pCold BamHI, Same as pET28a Haven’t tested. - TF EcoRI pET32_ BamHI, Same as pET28a Over- Protein stays Trx- EcoRI expressed, best in inclusion H6_TE with 0.25 mM bodies. V_Olga IPTG. a: PCR program for DDAH-2 gene amplification:

PCR amplification was carried out using an MJ Research (Waltham, MA) PTC 200 thermal cycler. PCR mixture contains the template (Human DDAH-2: from pET28a- DDAH-2; Mouse DDAH-2: from ATCC plasmid PCMV-Sport6; Bovine DDAH-2: from imaGenes), dNTPs, and pfu polymerase in the pfu polymerase buffer (Stratagene, La Jolla, CA) as described in the manufacturer’s instructions, with a temperature program of:

Human DDAH-2: 95° C for 2 min, followed by 2 cycles of 95° C for 30 s, 51.9° C for 30 s and 72° C for 1 min, followed by 26 cycles of 95° C for 30 s, 61.9° C for 30 s and 72° C for 1 min, followed by 10 min at 72° C for polishing.

Mouse DDAH-2: 95° C for 2 min, followed by 2 cycles of 95° C for 30 s, 51° C for 30 s and 72° C for 1 min, followed by 26 cycles of 95° C for 30 s, 61° C for 30 s and 72° C for 1 min, followed by 10 min at 72° C for polishing.

Bovine DDAH-2: 95° C for 2 min, followed by 2 cycles of 95° C for 30 s, 49° C for 30 s and 72° C for 1 min, followed by 26 cycles of 95° C for 30 s, 59° C for 30 s and 72° C for 1 min, followed by 10 min at 72° C for polishing. b: All expression tests were performed at 15ºC after IPTG addition.

132 References

(1) van't Hof, R. J., and Ralston, S. H. (2001) Nitric oxide and bone. Immunology 103, 255-61. (2) Sanders, S. P. (1999) Nitric oxide in asthma. Pathogenic, therapeutic, or diagnostic? Am J Respir Cell Mol Biol 21, 147-9. (3) Pannirselvam, M., Anderson, TJ, Troiggle, CR. (2003) Endothelial cell dysfunction in type I and II diabetes: The cellular basis for dysfunction. Drug Dev. Res. 58, 28-41. (4) Giusti-Paiva, A., Martinez, M. R., Felix, J. V., da Rocha, M. J., Carnio, E. C., Elias, L. L., and Antunes-Rodrigues, J. (2004) Simvastatin decreases nitric oxide overproduction and reverts the impaired vascular responsiveness induced by endotoxic shock in rats. Shock 21, 271-5. (5) Lala, P. K., and Chakraborty, C. (2001) Role of nitric oxide in carcinogenesis and tumour progression. Lancet Oncol 2, 149-56. (6) Coulter, J. A., McCarthy, H. O., Xiang, J., Roedl, W., Wagner, E., Robson, T., and Hirst, D. G. (2008) Nitric oxide--a novel therapeutic for cancer. Nitric Oxide 19, 192-8. (7) Napoli, C., and Ignarro, L. J. (2001) Nitric oxide and atherosclerosis. Nitric Oxide 5, 88-97. (8) Silverman, R. B. (2009) Design of selective neuronal nitric oxide synthase inhibitors for the prevention and treatment of neurodegenerative diseases. Acc Chem Res 42, 439-51. (9) Rand, M. J. (1992) Nitrergic transmission: nitric oxide as a mediator of non- adrenergic, non-cholinergic neuro-effector transmission. Clin Exp Pharmacol Physiol 19, 147-69. (10) Vallance, P., and Leiper, J. (2002) Blocking NO synthesis: how, where and why? Nat Rev Drug Discov 1, 939-50. (11) Baranano, D. E., and Snyder, S. H. (2001) Neural roles for heme oxygenase: contrasts to nitric oxide synthase. Proc Natl Acad Sci U S A 98, 10996-1002. (12) Hanafy, K. A., Krumenacker, J. S., and Murad, F. (2001) NO, nitrotyrosine, and cyclic GMP in signal transduction. Med Sci Monit 7, 801-19. (13) Alderton, W. K., Cooper, C. E., and Knowles, R. G. (2001) Nitric oxide synthases: structure, function and inhibition. Biochem J 357, 593-615. (14) Mocellin, S., Bronte, V., and Nitti, D. (2007) Nitric oxide, a double edged sword in cancer biology: searching for therapeutic opportunities. Med Res Rev 27, 317- 52.

133 (15) Ignarro, L. J., Cirino, G., Casini, A., and Napoli, C. (1999) Nitric oxide as a signaling molecule in the vascular system: an overview. J Cardiovasc Pharmacol 34, 879-86. (16) Hofseth, L. J., Hussain, S. P., Wogan, G. N., and Harris, C. C. (2003) Nitric oxide in cancer and chemoprevention. Free Radic Biol Med 34, 955-68. (17) Marnett, L. J., Riggins, J. N., and West, J. D. (2003) Endogenous generation of reactive oxidants and electrophiles and their reactions with DNA and protein. J Clin Invest 111, 583-93. (18) Foster, M. W., McMahon, T. J., and Stamler, J. S. (2003) S-nitrosylation in health and disease. Trends Mol Med 9, 160-8. (19) O'Donnell, V. B., Eiserich, J. P., Bloodsworth, A., Chumley, P. H., Kirk, M., Barnes, S., Darley-Usmar, V. M., and Freeman, B. A. (1999) Nitration of unsaturated fatty acids by nitric oxide-derived reactive species. Methods Enzymol 301, 454-70. (20) Stamler, J. S., Lamas, S., and Fang, F. C. (2001) Nitrosylation. the prototypic redox-based signaling mechanism. Cell 106, 675-83. (21) Davis, K. L., Martin, E., Turko, I. V., and Murad, F. (2001) Novel effects of nitric oxide. Annu Rev Pharmacol Toxicol 41, 203-36. (22) Izumi, Y., Benz, A. M., Clifford, D. B., and Zorumski, C. F. (1992) Nitric oxide inhibitors attenuate N-methyl-D-aspartate excitotoxicity in rat hippocampal slices. Neurosci Lett 135, 227-30. (23) Huang, Z., Huang, P. L., Panahian, N., Dalkara, T., Fishman, M. C., and Moskowitz, M. A. (1994) Effects of cerebral ischemia in mice deficient in neuronal nitric oxide synthase. Science 265, 1883-5. (24) Vallance, P., and Charles, I. (1998) Nitric oxide as an antimicrobial agent: does NO always mean NO? [ comment]. Gut 42, 313-4. (25) Luo, Z. D., and Cizkova, D. (2000) The role of nitric oxide in nociception. Curr Rev Pain 4, 459-66. (26) Saban, M. R., Nguyen, N. B., Hammond, T. G., and Saban, R. (2002) Gene expression profiling of mouse bladder inflammatory responses to LPS, substance P, and antigen-stimulation. Am J Pathol 160, 2095-110. (27) Kubes, P., and McCafferty, D. M. (2000) Nitric oxide and intestinal inflammation. Am J Med 109, 150-8. (28) Silkoff, P. E., Robbins, R. A., Gaston, B., Lundberg, J. O., and Townley, R. G. (2000) Endogenous nitric oxide in allergic airway disease. J Allergy Clin Immunol 105, 438-48. (29) Iravani, M. M., Kashefi, K., Mander, P., Rose, S., and Jenner, P. (2002) Involvement of inducible nitric oxide synthase in inflammation-induced dopaminergic neurodegeneration. Neuroscience 110, 49-58. 134 (30) Wada, K., Chatzipanteli, K., Kraydieh, S., Busto, R., and Dietrich, W. D. (1998) Inducible nitric oxide synthase expression after traumatic brain injury and neuroprotection with aminoguanidine treatment in rats. Neurosurgery 43, 1427- 36. (31) Ando, A., Yang, A., Mori, K., Yamada, H., Yamada, E., Takahashi, K., Saikia, J., Kim, M., Melia, M., Fishman, M., Huang, P., and Campochiaro, P. A. (2002) Nitric oxide is proangiogenic in the retina and choroid. J Cell Physiol 191, 116- 24. (32) Knipp, M. (2006) How to control NO production in cells: N(omega),N(omega)- dimethyl-L-arginine dimethylaminohydrolase as a novel drug target. Chembiochem 7, 879-89. (33) Laroux, F. S., Pavlick, K. P., Hines, I. N., Kawachi, S., Harada, H., Bharwani, S., Hoffman, J. M., and Grisham, M. B. (2001) Role of nitric oxide in inflammation. Acta Physiol Scand 173, 113-8. (34) Schulz, R., Kelm, M., and Heusch, G. (2004) Nitric oxide in myocardial ischemia/reperfusion injury. Cardiovasc Res 61, 402-13. (35) Korytko, P. J., and Boje, K. M. (1996) Pharmacological characterization of nitric oxide production in a rat model of meningitis. Neuropharmacology 35, 231-7. (36) Ashina, M., Lassen, L. H., Bendtsen, L., Jensen, R., and Olesen, J. (1999) Effect of inhibition of nitric oxide synthase on chronic tension-type headache: a randomised crossover trial. Lancet 353, 287-9. (37) Hantraye, P., Brouillet, E., Ferrante, R., Palfi, S., Dolan, R., Matthews, R. T., and Beal, M. F. (1996) Inhibition of neuronal nitric oxide synthase prevents MPTP- induced parkinsonism in baboons. Nat Med 2, 1017-21. (38) Cobb, J. P. (2001) Nitric oxide synthase inhibition as therapy for sepsis: a decade of promise. Surg Infect (Larchmt) 2, 93-100; discussion 100-1. (39) Zhang, J., and Snyder, S. H. (1995) Nitric oxide in the nervous system. Annu Rev Pharmacol Toxicol 35, 213-33. (40) Pacher, P., Beckman, J. S., and Liaudet, L. (2007) Nitric oxide and peroxynitrite in health and disease. Physiol Rev 87, 315-424. (41) Mocellin, S. (2009) Nitric oxide: cancer target or anticancer agent? Curr Cancer Drug Targets 9, 214-36. (42) Reveneau, S., Arnould, L., Jolimoy, G., Hilpert, S., Lejeune, P., Saint-Giorgio, V., Belichard, C., and Jeannin, J. F. (1999) Nitric oxide synthase in human breast cancer is associated with tumor grade, proliferation rate, and expression of progesterone receptors. Lab Invest 79, 1215-25. (43) Vakkala, M., Kahlos, K., Lakari, E., Paakko, P., Kinnula, V., and Soini, Y. (2000) Inducible nitric oxide synthase expression, apoptosis, and angiogenesis in in situ and invasive breast carcinomas. Clin Cancer Res 6, 2408-16. 135 (44) Loibl, S., von Minckwitz, G., Weber, S., Sinn, H. P., Schini-Kerth, V. B., Lobysheva, I., Nepveu, F., Wolf, G., Strebhardt, K., and Kaufmann, M. (2002) Expression of endothelial and inducible nitric oxide synthase in benign and malignant lesions of the breast and measurement of nitric oxide using electron paramagnetic resonance spectroscopy. Cancer 95, 1191-8. (45) Ambs, S., Merriam, W. G., Bennett, W. P., Felley-Bosco, E., Ogunfusika, M. O., Oser, S. M., Klein, S., Shields, P. G., Billiar, T. R., and Harris, C. C. (1998) Frequent nitric oxide synthase-2 expression in human colon adenomas: implication for tumor angiogenesis and colon cancer progression. Cancer Res 58, 334-41. (46) Nosho, K., Yamamoto, H., Adachi, Y., Endo, T., Hinoda, Y., and Imai, K. (2005) Gene expression profiling of colorectal adenomas and early invasive carcinomas by cDNA array analysis. Br J Cancer 92, 1193-200. (47) Cobbs, C. S., Brenman, J. E., Aldape, K. D., Bredt, D. S., and Israel, M. A. (1995) Expression of nitric oxide synthase in human central nervous system tumors. Cancer Res 55, 727-30. (48) Jenkins, D. C., Charles, I. G., Thomsen, L. L., Moss, D. W., Holmes, L. S., Baylis, S. A., Rhodes, P., Westmore, K., Emson, P. C., and Moncada, S. (1995) Roles of nitric oxide in tumor growth. Proc Natl Acad Sci U S A 92, 4392-6. (49) Wink, D. A., and Mitchell, J. B. (2003) Nitric oxide and cancer: an introduction. Free Radic Biol Med 34, 951-4. (50) Thomsen, L. L., and Miles, D. W. (1998) Role of nitric oxide in tumour progression: lessons from human tumours. Cancer Metastasis Rev 17, 107-18. (51) Bing, R. J., Miyataka, M., Rich, K. A., Hanson, N., Wang, X., Slosser, H. D., and Shi, S. R. (2001) Nitric oxide, prostanoids, cyclooxygenase, and angiogenesis in colon and breast cancer. Clin Cancer Res 7, 3385-92. (52) Morbidelli, L., Donnini, S., and Ziche, M. (2004) Role of nitric oxide in tumor angiogenesis. Cancer Treat Res 117, 155-67. (53) Singh, R. P., and Agarwal, R. (2007) Inducible nitric oxide synthase-vascular endothelial growth factor axis: a potential target to inhibit tumor angiogenesis by dietary agents. Curr Cancer Drug Targets 7, 475-83. (54) Park, S. W., Lee, S. G., Song, S. H., Heo, D. S., Park, B. J., Lee, D. W., Kim, K. H., and Sung, M. W. (2003) The effect of nitric oxide on cyclooxygenase-2 (COX-2) overexpression in head and neck cancer cell lines. Int J Cancer 107, 729-38. (55) Marrogi, A. J., Travis, W. D., Welsh, J. A., Khan, M. A., Rahim, H., Tazelaar, H., Pairolero, P., Trastek, V., Jett, J., Caporaso, N. E., Liotta, L. A., and Harris, C. C. (2000) Nitric oxide synthase, cyclooxygenase 2, and vascular endothelial growth factor in the angiogenesis of non-small cell lung carcinoma. Clin Cancer Res 6, 4739-44. 136 (56) Cianchi, F., Cortesini, C., Fantappie, O., Messerini, L., Sardi, I., Lasagna, N., Perna, F., Fabbroni, V., Di Felice, A., Perigli, G., Mazzanti, R., and Masini, E. (2004) Cyclooxygenase-2 activation mediates the proangiogenic effect of nitric oxide in colorectal cancer. Clin Cancer Res 10, 2694-704. (57) Mollace, V., Muscoli, C., Masini, E., Cuzzocrea, S., and Salvemini, D. (2005) Modulation of prostaglandin biosynthesis by nitric oxide and nitric oxide donors. Pharmacol Rev 57, 217-52. (58) Thun, M. J., Henley, S. J., and Patrono, C. (2002) Nonsteroidal anti-inflammatory drugs as anticancer agents: mechanistic, pharmacologic, and clinical issues. J Natl Cancer Inst 94, 252-66. (59) Jadeski, L. C., Chakraborty, C., and Lala, P. K. (2003) Nitric oxide-mediated promotion of mammary tumour cell migration requires sequential activation of nitric oxide synthase, guanylate cyclase and mitogen-activated protein kinase. Int J Cancer 106, 496-504. (60) Okamoto, T., Akaike, T., Sawa, T., Miyamoto, Y., van der Vliet, A., and Maeda, H. (2001) Activation of matrix metalloproteinases by peroxynitrite-induced protein S-glutathiolation via disulfide S-oxide formation. J Biol Chem 276, 29596-602. (61) Ishii, Y., Ogura, T., Tatemichi, M., Fujisawa, H., Otsuka, F., and Esumi, H. (2003) Induction of matrix metalloproteinase gene transcription by nitric oxide and mechanisms of MMP-1 gene induction in human melanoma cell lines. Int J Cancer 103, 161-8. (62) Ying, L., and Hofseth, L. J. (2007) An emerging role for endothelial nitric oxide synthase in chronic inflammation and cancer. Cancer Res 67, 1407-10. (63) Lim, K. H., Ancrile, B. B., Kashatus, D. F., and Counter, C. M. (2008) Tumour maintenance is mediated by eNOS. Nature 452, 646-9. (64) Colasanti, M., and Suzuki, H. (2000) The dual personality of NO. Trends Pharmacol Sci 21, 249-52. (65) Moncada, S., and Erusalimsky, J. D. (2002) Does nitric oxide modulate mitochondrial energy generation and apoptosis? Nat Rev Mol Cell Biol 3, 214-20. (66) Huang, P. L. (2000) Mouse models of nitric oxide synthase deficiency. J Am Soc Nephrol 11 Suppl 16, S120-3. (67) Dawson, V. L., and Dawson, T. M. (1998) Nitric oxide in neurodegeneration. Prog Brain Res 118, 215-29. (68) Kim, P. K., Kwon, Y. G., Chung, H. T., and Kim, Y. M. (2002) Regulation of caspases by nitric oxide. Ann N Y Acad Sci 962, 42-52. (69) Beck, K. F., Eberhardt, W., Frank, S., Huwiler, A., Messmer, U. K., Muhl, H., and Pfeilschifter, J. (1999) Inducible NO synthase: role in cellular signalling. J Exp Biol 202, 645-53. 137 (70) Kleinert, H., Pautz, A., Linker, K., and Schwarz, P. M. (2004) Regulation of the expression of inducible nitric oxide synthase. Eur J Pharmacol 500, 255-66. (71) Lou, M. F. (1979) Human muscular dystrophy: elevation of urinary dimethylarginines. Science 203, 668-70. (72) Kakimoto, Y., and Akazawa, S. (1970) Isolation and identification of N-G,N-G- and N-G,N'-G-dimethyl-arginine, N-epsilon-mono-, di-, and trimethyllysine, and glucosylgalactosyl- and galactosyl-delta-hydroxylysine from human urine. J Biol Chem 245, 5751-8. (73) Jung, C. S., Iuliano, B. A., Harvey-White, J., Espey, M. G., Oldfield, E. H., and Pluta, R. M. (2004) Association between cerebrospinal fluid levels of asymmetric dimethyl-L-arginine, an endogenous inhibitor of endothelial nitric oxide synthase, and cerebral vasospasm in a primate model of subarachnoid hemorrhage. J Neurosurg 101, 836-42. (74) Pritzker, L. B., Joshi, S., Harauz, G., and Moscarello, M. A. (2000) Deimination of myelin basic protein. 2. Effect of methylation of MBP on its deimination by peptidylarginine deiminase. Biochemistry 39, 5382-8. (75) Davie, J. K., and Dent, S. Y. (2002) Transcriptional control: an activating role for arginine methylation. Curr Biol 12, R59-61. (76) Bouvet, P., Diaz, J. J., Kindbeiter, K., Madjar, J. J., and Amalric, F. (1998) Nucleolin interacts with several ribosomal proteins through its RGG domain. J Biol Chem 273, 19025-9. (77) Belyanskaya, L. L., Gehrig, P. M., and Gehring, H. (2001) Exposure on cell surface and extensive arginine methylation of ewing sarcoma (EWS) protein. J Biol Chem 276, 18681-7. (78) Olken, N. M., Rusche, K. M., Richards, M. K., and Marletta, M. A. (1991) Inactivation of macrophage nitric oxide synthase activity by NG-methyl-L- arginine. Biochem Biophys Res Commun 177, 828-33. (79) Pollock, J. S., Forstermann, U., Mitchell, J. A., Warner, T. D., Schmidt, H. H., Nakane, M., and Murad, F. (1991) Purification and characterization of particulate endothelium-derived relaxing factor synthase from cultured and native bovine aortic endothelial cells. Proc Natl Acad Sci U S A 88, 10480-4. (80) Tsikas, D., Boger, R. H., Sandmann, J., Bode-Boger, S. M., and Frolich, J. C. (2000) Endogenous nitric oxide synthase inhibitors are responsible for the L- arginine paradox. FEBS Lett 478, 1-3. (81) Griffith, O. W., and Kilbourn, R. G. (1996) Nitric oxide synthase inhibitors: amino acids. Methods Enzymol 268, 375-92. (82) Vallance, P., Leone, A., Calver, A., Collier, J., and Moncada, S. (1992) Accumulation of an endogenous inhibitor of nitric oxide synthesis in chronic renal failure. Lancet 339, 572-5.

138 (83) Siroen, M. P., van der Sijp, J. R., Teerlink, T., van Schaik, C., Nijveldt, R. J., and van Leeuwen, P. A. (2005) The human liver clears both asymmetric and symmetric dimethylarginine. Hepatology 41, 559-65. (84) Hatanaka, T., Nakanishi, T., Huang, W., Leibach, F. H., Prasad, P. D., Ganapathy, V., and Ganapathy, M. E. (2001) Na+ - and Cl- -coupled active transport of nitric oxide synthase inhibitors via amino acid transport system B(0,+). J Clin Invest 107, 1035-43. (85) Ogawa, T., Kimoto, M., and Sasaoka, K. (1989) Purification and properties of a new enzyme, NG,NG-dimethylarginine dimethylaminohydrolase, from rat kidney. J Biol Chem 264, 10205-9. (86) Teichmann, S. A., Murzin, A. G., and Chothia, C. (2001) Determination of protein function, evolution and interactions by structural genomics. Curr Opin Struct Biol 11, 354-63. (87) Groft, C. M., Beckmann, R., Sali, A., and Burley, S. K. (2000) Crystal structures of ribosome anti-association factor IF6. Nat Struct Biol 7, 1156-64. (88) Shirai, H., Mokrab, Y., and Mizuguchi, K. (2006) The guanidino-group modifying enzymes: structural basis for their diversity and commonality. Proteins 64, 1010-23. (89) Shirai, H., Blundell, T. L., and Mizuguchi, K. (2001) A novel superfamily of enzymes that catalyze the modification of guanidino groups. Trends Biochem Sci 26, 465-8. (90) Stone, E. M., Person, M. D., Costello, N. J., and Fast, W. (2005) Characterization of a transient covalent adduct formed during dimethylarginine dimethylaminohydrolase catalysis. Biochemistry 44, 7069-78. (91) Birdsey, G. M., Leiper, J. M., and Vallance, P. (2000) Intracellular localization of dimethylarginine dimethylaminohydrolase overexpressed in an endothelial cell line. Acta Physiol Scand 168, 73-9. (92) Leiper, J. M., Santa Maria, J., Chubb, A., MacAllister, R. J., Charles, I. G., Whitley, G. S., and Vallance, P. (1999) Identification of two human dimethylarginine dimethylaminohydrolases with distinct tissue distributions and homology with microbial arginine deiminases. Biochem J 343 Pt 1, 209-14. (93) Tran, C. T., Fox, M. F., Vallance, P., and Leiper, J. M. (2000) Chromosomal localization, gene structure, and expression pattern of DDAH1: comparison with DDAH2 and implications for evolutionary origins. Genomics 68, 101-5. (94) Frey, D., Braun, O., Briand, C., Vasak, M., and Grutter, M. G. (2006) Structure of the mammalian NOS regulator dimethylarginine dimethylaminohydrolase: A basis for the design of specific inhibitors. Structure 14, 901-11. (95) Murray-Rust, J., Leiper, J., McAlister, M., Phelan, J., Tilley, S., Santa Maria, J., Vallance, P., and McDonald, N. (2001) Structural insights into the hydrolysis of

139 cellular nitric oxide synthase inhibitors by dimethylarginine dimethylaminohydrolase. Nat Struct Biol 8, 679-83. (96) Stone, E. M., Costello, A. L., Tierney, D. L., and Fast, W. (2006) Substrate- assisted cysteine deprotonation in the mechanism of dimethylargininase (DDAH) from Pseudomonas aeruginosa. Biochemistry 45, 5618-30. (97) Bogumil, R., Knipp, M., Fundel, S. M., and Vasak, M. (1998) Characterization of dimethylargininase from bovine brain: evidence for a zinc binding site. Biochemistry 37, 4791-8. (98) Knipp, M., Braun, O., and Vasak, M. (2005) Searching for DDAH inhibitors: S- nitroso-L-homocysteine is a chemical lead. J Am Chem Soc 127, 2372-3. (99) Knipp, M., Braun, O., Gehrig, P. M., Sack, R., and Vasak, M. (2003) Zn(II)-free dimethylargininase-1 (DDAH-1) is inhibited upon specific Cys-S-nitrosylation. J Biol Chem 278, 3410-6. (100) Leiper, J., Nandi, M., Torondel, B., Murray-Rust, J., Malaki, M., O'Hara, B., Rossiter, S., Anthony, S., Madhani, M., Selwood, D., Smith, C., Wojciak- Stothard, B., Rudiger, A., Stidwill, R., McDonald, N. Q., and Vallance, P. (2007) Disruption of metabolism impairs vascular homeostasis. Nat Med 13, 198-203. (101) Hong, L., and Fast, W. (2007) Inhibition of human dimethylarginine dimethylaminohydrolase-1 by S-nitroso-L-homocysteine and hydrogen peroxide. Analysis, quantification, and implications for hyperhomocysteinemia. J Biol Chem 282, 34684-92. (102) Leiper, J., Murray-Rust, J., McDonald, N., and Vallance, P. (2002) S-nitrosylation of dimethylarginine dimethylaminohydrolase regulates enzyme activity: further interactions between nitric oxide synthase and dimethylarginine dimethylaminohydrolase. Proc Natl Acad Sci U S A 99, 13527-32. (103) Knipp, M., Charnock, J. M., Garner, C. D., and Vasak, M. (2001) Structural and functional characterization of the Zn(II) site in dimethylargininase-1 (DDAH-1) from bovine brain. Zn(II) release activates DDAH-1. J Biol Chem 276, 40449-56. (104) Kubes, P. (2000) Inducible nitric oxide synthase: a little bit of good in all of us. Gut 47, 6-9. (105) MacAllister, R. J., Parry, H., Kimoto, M., Ogawa, T., Russell, R. J., Hodson, H., Whitley, G. S., and Vallance, P. (1996) Regulation of nitric oxide synthesis by dimethylarginine dimethylaminohydrolase. Br J Pharmacol 119, 1533-40. (106) Rossiter, S., Smith, C. L., Malaki, M., Nandi, M., Gill, H., Leiper, J. M., Vallance, P., and Selwood, D. L. (2005) Selective substrate-based inhibitors of mammalian dimethylarginine dimethylaminohydrolase. J Med Chem 48, 4670-8. (107) Jacobi, J., Sydow, K., von Degenfeld, G., Zhang, Y., Dayoub, H., Wang, B., Patterson, A. J., Kimoto, M., Blau, H. M., and Cooke, J. P. (2005) Overexpression

140 of dimethylarginine dimethylaminohydrolase reduces tissue asymmetric dimethylarginine levels and enhances angiogenesis. Circulation 111, 1431-8. (108) Kostourou, V., Robinson, S. P., Whitley, G. S., and Griffiths, J. R. (2003) Effects of overexpression of dimethylarginine dimethylaminohydrolase on tumor angiogenesis assessed by susceptibility magnetic resonance imaging. Cancer Res 63, 4960-6. (109) Lesoon-Wood, L. A., Pierce, L. M., Lau, A. F., and Cooney, R. V. (1999) Enhancement of methylcholanthrene-induced neoplastic transformation in murine C3H 10T1/2 fibroblasts by antisense phosphorothioate oligodeoxynucleotide sequences. Cancer Lett 147, 163-73. (110) Beeharry, N., Chambers, J. A., Faragher, R. G., Garnett, K. E., and Green, I. C. (2004) Analysis of -induced NO-dependent apoptosis using RNA interference or inhibition by 1400W. Nitric Oxide 10, 112-8. (111) Goldstein, S., Russo, A., and Samuni, A. (2003) Reactions of PTIO and carboxy- PTIO with *NO, *NO2, and O2-*. J Biol Chem 278, 50949-55. (112) Wink, D. A., Ridnour, L. A., Hussain, S. P., and Harris, C. C. (2008) The reemergence of nitric oxide and cancer. Nitric Oxide 19, 65-7. (113) Duvoix, A., Blasius, R., Delhalle, S., Schnekenburger, M., Morceau, F., Henry, E., Dicato, M., and Diederich, M. (2005) Chemopreventive and therapeutic effects of curcumin. Cancer Lett 223, 181-90. (114) Jadeski, L. C., Hum, K. O., Chakraborty, C., and Lala, P. K. (2000) Nitric oxide promotes murine mammary tumour growth and metastasis by stimulating tumour cell migration, invasiveness and angiogenesis. Int J Cancer 86, 30-9. (115) Jadeski, L. C., and Lala, P. K. (1999) Nitric oxide synthase inhibition by N(G)- nitro-L-arginine methyl ester inhibits tumor-induced angiogenesis in mammary tumors. Am J Pathol 155, 1381-90. (116) Uneda, S., Hata, H., Matsuno, F., Nagasaki, A., Harada, N., Mitsuya, Y., Matsuzaki, H., and Mitsuya, H. (2003) A nitric oxide synthase inhibitor, N(G)- nitro-l-arginine-methyl-ester, exerts potent antiangiogenic effects on plasmacytoma in a newly established multiple myeloma severe combined immunodeficient mouse model. Br J Haematol 120, 396-404. (117) Matthews, N. E., Adams, M. A., Maxwell, L. R., Gofton, T. E., and Graham, C. H. (2001) Nitric oxide-mediated regulation of chemosensitivity in cancer cells. J Natl Cancer Inst 93, 1879-85. (118) Korbelik, M., Parkins, C. S., Shibuya, H., Cecic, I., Stratford, M. R., and Chaplin, D. J. (2000) Nitric oxide production by tumour tissue: impact on the response to photodynamic therapy. Br J Cancer 82, 1835-43. (119) Zareba, M., Niziolek, M., Korytowski, W., and Girotti, A. W. (2005) Merocyanine 540-sensitized photokilling of leukemia cells: role of post-

141 irradiation chain peroxidation of plasma membrane lipids as revealed by nitric oxide protection. Biochim Biophys Acta 1722, 51-9. (120) Rao, C. V., Indranie, C., Simi, B., Manning, P. T., Connor, J. R., and Reddy, B. S. (2002) Chemopreventive properties of a selective inducible nitric oxide synthase inhibitor in colon carcinogenesis, administered alone or in combination with celecoxib, a selective cyclooxygenase-2 inhibitor. Cancer Res 62, 165-70. (121) Chen, T., Nines, R. G., Peschke, S. M., Kresty, L. A., and Stoner, G. D. (2004) Chemopreventive effects of a selective nitric oxide synthase inhibitor on carcinogen-induced rat esophageal tumorigenesis. Cancer Res 64, 3714-7. (122) Rao, C. V., Kawamori, T., Hamid, R., and Reddy, B. S. (1999) Chemoprevention of colonic aberrant crypt foci by an inducible nitric oxide synthase-selective inhibitor. Carcinogenesis 20, 641-4. (123) Liby, K., Royce, D. B., Williams, C. R., Risingsong, R., Yore, M. M., Honda, T., Gribble, G. W., Dmitrovsky, E., Sporn, T. A., and Sporn, M. B. (2007) The synthetic triterpenoids CDDO-methyl ester and CDDO-ethyl amide prevent lung cancer induced by vinyl carbamate in A/J mice. Cancer Res 67, 2414-9. (124) Gratton, J. P., Lin, M. I., Yu, J., Weiss, E. D., Jiang, Z. L., Fairchild, T. A., Iwakiri, Y., Groszmann, R., Claffey, K. P., Cheng, Y. C., and Sessa, W. C. (2003) Selective inhibition of tumor microvascular permeability by cavtratin blocks tumor progression in mice. Cancer Cell 4, 31-9. (125) Zhao, Y., Brandish, P. E., DiValentin, M., Schelvis, J. P., Babcock, G. T., and Marletta, M. A. (2000) Inhibition of soluble guanylate cyclase by ODQ. Biochemistry 39, 10848-54. (126) Haramis, G., Zhou, Z., Pyriochou, A., Koutsilieris, M., Roussos, C., and Papapetropoulos, A. (2008) cGMP-independent anti-tumour actions of the inhibitor of soluble guanylyl cyclase, ODQ, in prostate cancer cell lines. Br J Pharmacol 155, 804-13. (127) Wu, J., Akaike, T., and Maeda, H. (1998) Modulation of enhanced vascular permeability in tumors by a bradykinin antagonist, a cyclooxygenase inhibitor, and a nitric oxide scavenger. Cancer Res 58, 159-65. (128) Grimm, E. A., Ellerhorst, J., Tang, C. H., and Ekmekcioglu, S. (2008) Constitutive intracellular production of iNOS and NO in human melanoma: possible role in regulation of growth and resistance to apoptosis. Nitric Oxide 19, 133-7. (129) Zhang, H. J., Zhao, W., Venkataraman, S., Robbins, M. E., Buettner, G. R., Kregel, K. C., and Oberley, L. W. (2002) Activation of matrix metalloproteinase- 2 by overexpression of manganese superoxide dismutase in human breast cancer MCF-7 cells involves reactive oxygen species. J Biol Chem 277, 20919-26. (130) Surh, Y. J., Chun, K. S., Cha, H. H., Han, S. S., Keum, Y. S., Park, K. K., and Lee, S. S. (2001) Molecular mechanisms underlying chemopreventive activities of 142 anti-inflammatory phytochemicals: down-regulation of COX-2 and iNOS through suppression of NF-kappa B activation. Mutat Res 480-481, 243-68. (131) Kawamori, T., Lubet, R., Steele, V. E., Kelloff, G. J., Kaskey, R. B., Rao, C. V., and Reddy, B. S. (1999) Chemopreventive effect of curcumin, a naturally occurring anti-inflammatory agent, during the promotion/progression stages of colon cancer. Cancer Res 59, 597-601. (132) Tozer, G. M., Prise, V. E., and Chaplin, D. J. (1997) Inhibition of nitric oxide synthase induces a selective reduction in tumor blood flow that is reversible with L-arginine. Cancer Res 57, 948-55. (133) Lu, W., and Schroit, A. J. (2005) Vascularization of melanoma by mobilization and remodeling of preexisting latent vessels to patency. Cancer Res 65, 913-8. (134) Ahn, B., and Ohshima, H. (2001) Suppression of intestinal polyposis in Apc(Min/+) mice by inhibiting nitric oxide production. Cancer Res 61, 8357-60. (135) Cooke, J. P. (2004) Asymmetrical dimethylarginine: the Uber marker? Circulation 109, 1813-8. (136) Babu, B. R., and Griffith, O. W. (1998) N5-(1-Imino-3-butenyl)-L-ornithine. A neuronal isoform selective mechanism-based inactivator of nitric oxide synthase. J Biol Chem 273, 8882-9. (137) Kotthaus, J., Schade, D., Muschick, N., Beitz, E., and Clement, B. (2008) Structure-activity relationship of novel and known inhibitors of human dimethylarginine dimethylaminohydrolase-1: alkenyl-amidines as new leads. Bioorg Med Chem 16, 10205-9. (138) Wang, Y., Monzingo, A. F., Hu, S., Schaller, T. H., Robertus, J. D., and Fast, W. (2009) Developing dual and specific inhibitors of dimethylarginine dimethylaminohydrolase-1 and nitric oxide synthase: toward a targeted polypharmacology to control nitric oxide. Biochemistry 48, 8624-35. (139) Vallance, P., Bush, H. D., Mok, B. J., Hurtado-Guerrero, R., Gill, H., Rossiter, S., Wilden, J. D., and Caddick, S. (2005) Inhibition of dimethylarginine dimethylaminohydrolase (DDAH) and arginine deiminase (ADI) by pentafluorophenyl (PFP) sulfonates. Chem Commun (Camb), 5563-5. (140) Hartzoulakis, B., Rossiter, S., Gill, H., O'Hara, B., Steinke, E., Gane, P. J., Hurtado-Guerrero, R., Leiper, J. M., Vallance, P., Rust, J. M., and Selwood, D. L. (2007) Discovery of inhibitors of the pentein superfamily protein dimethylarginine dimethylaminohydrolase (DDAH), by virtual screening and hit analysis. Bioorg Med Chem Lett 17, 3953-6. (141) Stone, E. M., Schaller, T. H., Bianchi, H., Person, M. D., and Fast, W. (2005) Inactivation of two diverse enzymes in the amidinotransferase superfamily by 2- chloroacetamidine: dimethylargininase and peptidylarginine deiminase. Biochemistry 44, 13744-52.

143 (142) Luo, D., Smith, S. W., and Anderson, B. D. (2005) Kinetics and mechanism of the reaction of cysteine and hydrogen peroxide in aqueous solution. J Pharm Sci 94, 304-16. (143) Forbes, S. P., Druhan, L. J., Guzman, J. E., Parinandi, N., Zhang, L., Green- Church, K. B., and Cardounel, A. J. (2008) Mechanism of 4-HNE mediated inhibition of hDDAH-1: implications in no regulation. Biochemistry 47, 1819-26. (144) Tsao, P. S., Buitrago, R., Chan, J. R., and Cooke, J. P. (1996) Fluid flow inhibits endothelial adhesiveness. Nitric oxide and transcriptional regulation of VCAM-1. Circulation 94, 1682-9. (145) Tsao, P. S., Wang, B., Buitrago, R., Shyy, J. Y., and Cooke, J. P. (1997) Nitric oxide regulates monocyte chemotactic protein-1. Circulation 96, 934-40. (146) Stamler, J., Mendelsohn, M. E., Amarante, P., Smick, D., Andon, N., Davies, P. F., Cooke, J. P., and Loscalzo, J. (1989) N-acetylcysteine potentiates platelet inhibition by endothelium-derived relaxing factor. Circ Res 65, 789-95. (147) Oelze, M., Mollnau, H., Hoffmann, N., Warnholtz, A., Bodenschatz, M., Smolenski, A., Walter, U., Skatchkov, M., Meinertz, T., and Munzel, T. (2000) Vasodilator-stimulated phosphoprotein serine 239 phosphorylation as a sensitive monitor of defective nitric oxide/cGMP signaling and endothelial dysfunction. Circ Res 87, 999-1005. (148) Dimmeler, S., Hermann, C., Galle, J., and Zeiher, A. M. (1999) Upregulation of superoxide dismutase and nitric oxide synthase mediates the apoptosis- suppressive effects of shear stress on endothelial cells. Arterioscler Thromb Vasc Biol 19, 656-64. (149) Wang, B. Y., Ho, H. K., Lin, P. S., Schwarzacher, S. P., Pollman, M. J., Gibbons, G. H., Tsao, P. S., and Cooke, J. P. (1999) Regression of atherosclerosis: role of nitric oxide and apoptosis. Circulation 99, 1236-41. (150) Cooke, J. P. (2005) ADMA: its role in vascular disease. Vasc Med 10 Suppl 1, S11-7. (151) Boger, R. H. (2005) Asymmetric dimethylarginine (ADMA) and cardiovascular disease: insights from prospective clinical trials. Vasc Med 10 Suppl 1, S19-25. (152) Maas, R., and Boger, R. H. (2003) Old and new cardiovascular risk factors: from unresolved issues to new opportunities. Atheroscler Suppl 4, 5-17. (153) Lentz, S. R., Rodionov, R. N., and Dayal, S. (2003) Hyperhomocysteinemia, endothelial dysfunction, and cardiovascular risk: the potential role of ADMA. Atheroscler Suppl 4, 61-5. (154) Mudd, S. H., Finkelstein, J. D., Refsum, H., Ueland, P. M., Malinow, M. R., Lentz, S. R., Jacobsen, D. W., Brattstrom, L., Wilcken, B., Wilcken, D. E., Blom, H. J., Stabler, S. P., Allen, R. H., Selhub, J., and Rosenberg, I. H. (2000)

144 Homocysteine and its disulfide derivatives: a suggested consensus terminology. Arterioscler Thromb Vasc Biol 20, 1704-6. (155) Boushey, C. J., Beresford, S. A., Omenn, G. S., and Motulsky, A. G. (1995) A quantitative assessment of plasma homocysteine as a risk factor for vascular disease. Probable benefits of increasing folic acid intakes. Jama 274, 1049-57. (156) Eikelboom, J. W., Lonn, E., Genest, J., Jr., Hankey, G., and Yusuf, S. (1999) Homocyst(e)ine and cardiovascular disease: a critical review of the epidemiologic evidence. Ann Intern Med 131, 363-75. (157) Stamler, J. S., Osborne, J. A., Jaraki, O., Rabbani, L. E., Mullins, M., Singel, D., and Loscalzo, J. (1993) Adverse vascular effects of homocysteine are modulated by endothelium-derived relaxing factor and related oxides of nitrogen. J Clin Invest 91, 308-18. (158) Heinecke, J. W., Rosen, H., Suzuki, L. A., and Chait, A. (1987) The role of sulfur-containing amino acids in superoxide production and modification of low density lipoprotein by arterial smooth muscle cells. J Biol Chem 262, 10098-103. (159) Stuhlinger, M. C., Tsao, P. S., Her, J. H., Kimoto, M., Balint, R. F., and Cooke, J. P. (2001) Homocysteine impairs the nitric oxide synthase pathway: role of asymmetric dimethylarginine. Circulation 104, 2569-75. (160) Linsky, T. W., Monzingo, A. F., Stone, E. M., Robertus, J. D., and Fast, W. (2008) Promiscuous partitioning of a covalent intermediate common in the pentein superfamily. Chem Biol 15, 467-75. (161) Dayal, S., and Lentz, S. R. (2005) ADMA and hyperhomocysteinemia. Vasc Med 10 Suppl 1, S27-33. (162) Gaston, B. (1999) Nitric oxide and thiol groups. Biochim Biophys Acta 1411, 323- 33. (163) Hogg, N. (2002) The biochemistry and physiology of S-nitrosothiols. Annu Rev Pharmacol Toxicol 42, 585-600. (164) Wang, P. G., Xian, M., Tang, X., Wu, X., Wen, Z., Cai, T., and Janczuk, A. J. (2002) Nitric oxide donors: chemical activities and biological applications. Chem Rev 102, 1091-134. (165) Zhang, Y., and Hogg, N. (2005) S-Nitrosothiols: cellular formation and transport. Free Radic Biol Med 38, 831-8. (166) Braun, O., Knipp, M., Chesnov, S., and Vasak, M. (2007) Specific reactions of S- nitrosothiols with cysteine hydrolases: A comparative study between dimethylargininase-1 and CTP synthetase. Protein Sci 16, 1522-34. (167) Geoghegan, K. F., Dixon, H. B., Rosner, P. J., Hoth, L. R., Lanzetti, A. J., Borzilleri, K. A., Marr, E. S., Pezzullo, L. H., Martin, L. B., LeMotte, P. K., McColl, A. S., Kamath, A. V., and Stroh, J. G. (1999) Spontaneous alpha-N-6-

145 phosphogluconoylation of a "His tag" in Escherichia coli: the cause of extra mass of 258 or 178 Da in fusion proteins. Anal Biochem 267, 169-84. (168) Knipp, M., and Vasak, M. (2000) A colorimetric 96-well microtiter plate assay for the determination of enzymatically formed citrulline. Anal Biochem 286, 257- 64. (169) Grassetti, D. R., and Murray, J. F., Jr. (1967) Determination of sulfhydryl groups with 2,2'- or 4,4'-dithiodipyridine. Arch Biochem Biophys 119, 41-9. (170) Stamler, J. S. F., M., (1996) Methods in Nitric Oxide Research, John Wiley & Sons Ltd., Chichester. (171) Person, M. D., Monks, T. J., and Lau, S. S. (2003) An integrated approach to identifying chemically induced posttranslational modifications using comparative MALDI-MS and targeted HPLC-ESI-MS/MS. Chem Res Toxicol 16, 598-608. (172) Clauser, K. R., Baker, P., and Burlingame, A. L. (1999) Role of accurate mass measurement (+/- 10 ppm) in protein identification strategies employing MS or MS/MS and database searching. Anal Chem 71, 2871-82. (173) Mathews, W. R., and Kerr, S. W. (1993) Biological activity of S-nitrosothiols: the role of nitric oxide. J Pharmacol Exp Ther 267, 1529-37. (174) Leiper, J., and Vallance, P. (1999) Biological significance of endogenous methylarginines that inhibit nitric oxide synthases. Cardiovasc Res 43, 542-8. (175) Ito, A., Tsao, P. S., Adimoolam, S., Kimoto, M., Ogawa, T., and Cooke, J. P. (1999) Novel mechanism for endothelial dysfunction: dysregulation of dimethylarginine dimethylaminohydrolase. Circulation 99, 3092-5. (176) Regenstein, W. P. J. a. J. (1968) Handbook of Biochemistry, Cleveland, Ohio. (177) Stone, E. M., and Fast, W. (2005) A continuous spectrophotometric assay for dimethylarginine dimethylaminohydrolase. Anal Biochem 343, 335-7. (178) Jia, L., Bonaventura, C., Bonaventura, J., and Stamler, J. S. (1996) S- nitrosohaemoglobin: a dynamic activity of blood involved in vascular control. Nature 380, 221-6. (179) Li, J., Billiar, T. R., Talanian, R. V., and Kim, Y. M. (1997) Nitric oxide reversibly inhibits seven members of the caspase family via S-nitrosylation. Biochem Biophys Res Commun 240, 419-24. (180) Wang, S. C., Person, M. D., Johnson, W. H., Jr., and Whitman, C. P. (2003) Reactions of trans-3-chloroacrylic acid dehalogenase with acetylene substrates: consequences of and evidence for a hydration reaction. Biochemistry 42, 8762-73. (181) Ohshima, H., Tatemichi, M., and Sawa, T. (2003) Chemical basis of inflammation-induced carcinogenesis. Arch Biochem Biophys 417, 3-11. (182) Xu, W., Liu, L. Z., Loizidou, M., Ahmed, M., and Charles, I. G. (2002) The role of nitric oxide in cancer. Cell Res 12, 311-20. 146 (183) Fukumura, D., Kashiwagi, S., and Jain, R. K. (2006) The role of nitric oxide in tumour progression. Nat Rev Cancer 6, 521-34. (184) Tran, C. T., Leiper, J. M., and Vallance, P. (2003) The DDAH/ADMA/NOS pathway. Atheroscler Suppl 4, 33-40. (185) Cardounel, A. J., and Zweier, J. L. (2002) Endogenous methylarginines regulate neuronal nitric-oxide synthase and prevent excitotoxic injury. J Biol Chem 277, 33995-4002. (186) Kostourou, V., Robinson, S. P., Cartwright, J. E., and Whitley, G. S. (2002) Dimethylarginine dimethylaminohydrolase I enhances tumour growth and angiogenesis. Br J Cancer 87, 673-80. (187) Garcin, E. D., Arvai, A. S., Rosenfeld, R. J., Kroeger, M. D., Crane, B. R., Andersson, G., Andrews, G., Hamley, P. J., Mallinder, P. R., Nicholls, D. J., St- Gallay, S. A., Tinker, A. C., Gensmantel, N. P., Mete, A., Cheshire, D. R., Connolly, S., Stuehr, D. J., Aberg, A., Wallace, A. V., Tainer, J. A., and Getzoff, E. D. (2008) Anchored plasticity opens doors for selective inhibitor design in nitric oxide synthase. Nat Chem Biol 4, 700-7. (188) Pettersen, E. F., Goddard, T. D., Huang, C. C., Couch, G. S., Greenblatt, D. M., Meng, E. C., and Ferrin, T. E. (2004) UCSF Chimera--a visualization system for exploratory research and analysis. J Comput Chem 25, 1605-12. (189) Fast, W., Nikolic, D., VanBreemen, R. B., and Silverman, R. B. (1999) Mechanistic Studies of the Inactivation of Inducible Nitric Oxide Synthase by N5(1-Iminoethyl)-L-ornithine (L-NIO). J Am Chem Soc 121, 903-916. (190) Moore, W. M., Webber, R. K., Jerome, G. M., Tjoeng, F. S., Misko, T. P., and Currie, M. G. (1994) L-N6-(1-iminoethyl)lysine: a selective inhibitor of inducible nitric oxide synthase. J Med Chem 37, 3886-8. (191) Bretscher, L. E., Li, H., Poulos, T. L., and Griffith, O. W. (2003) Structural characterization and kinetics of nitric-oxide synthase inhibition by novel N5- (iminoalkyl)- and N5-(iminoalkenyl)-ornithines. J Biol Chem 278, 46789-97. (192) Gill, S. C., and von Hippel, P. H. (1989) Calculation of protein extinction coefficients from amino acid sequence data. Anal Biochem 182, 319-26. (193) Copeland, R. A. (2005) Evaluation of enzyme inhibitors in drug discovery : a guide for medicinal chemists and pharmacologists, Wiley-Interscience, Hoboken, N.J. (194) Plevin, M. J., Magalhaes, B. S., Harris, R., Sankar, A., Perkins, S. J., and Driscoll, P. C. (2004) Characterization and manipulation of the Pseudomonas aeruginosa dimethylarginine dimethylaminohydrolase monomer--dimer equilibrium. J Mol Biol 341, 171-84. (195) Demeler, B. (2005) in www.ultrascan.uthscsa.edu, The University of Texas Health Science Center at San Antonio.

147 (196) Garvey, E. P., Oplinger, J. A., Furfine, E. S., Kiff, R. J., Laszlo, F., Whittle, B. J., and Knowles, R. G. (1997) 1400W is a slow, tight binding, and highly selective inhibitor of inducible nitric-oxide synthase in vitro and in vivo. J Biol Chem 272, 4959-63. (197) Shearer, B. G., Lee, S., Oplinger, J. A., Frick, L. W., Garvey, E. P., and Furfine, E. S. (1997) Substituted N-phenylisothioureas: potent inhibitors of human nitric oxide synthase with neuronal isoform selectivity. J Med Chem 40, 1901-5. (198) Narayanan, K., Spack, L., McMillan, K., Kilbourn, R. G., Hayward, M. A., Masters, B. S., and Griffith, O. W. (1995) S-alkyl-L-thiocitrullines. Potent stereoselective inhibitors of nitric oxide synthase with strong pressor activity in vivo. J Biol Chem 270, 11103-10. (199) Jianmongkol, S., Vuletich, J. L., Bender, A. T., Demady, D. R., and Osawa, Y. (2000) Aminoguanidine-mediated inactivation and alteration of neuronal nitric- oxide synthase. J Biol Chem 275, 13370-6. (200) Wolff, D. J., Gauld, D. S., Neulander, M. J., and Southan, G. (1997) Inactivation of nitric oxide synthase by substituted aminoguanidines and aminoisothioureas. J Pharmacol Exp Ther 283, 265-73. (201) Babu, B. R., Frey, C., and Griffith, O. W. (1999) L-arginine binding to nitric- oxide synthase. The role of H-bonds to the nonreactive guanidinium nitrogens. J Biol Chem 274, 25218-26. (202) Reif, D. W., and McCreedy, S. A. (1995) N-nitro-L-arginine and N-monomethyl- L-arginine exhibit a different pattern of inactivation toward the three nitric oxide synthases. Arch Biochem Biophys 320, 170-6. (203) Rogers, N. E., and Ignarro, L. J. (1992) Constitutive nitric oxide synthase from cerebellum is reversibly inhibited by nitric oxide formed from L-arginine. Biochem Biophys Res Commun 189, 242-9. (204) Weickmann, J. L., Himmel, M. E., Smith, D. W., and Fahrney, D. E. (1978) Arginine deiminase: demonstration of two active sites and possible half-of-the- sites reactivity. Biochem Biophys Res Commun 83, 107-13. (205) Petsko, G. a. R., D (2004) Protein structure and function, New Science Press, Sinauer Associate, Blackwell Pub, London Sunderland, MA Oxford. (206) Gamcsik, M. P., Malthouse, J. P. G., Primrose, W. U., Mackenzie, N. E., Boyd, A. S .F., Russell, R. A., and Scott, A. I. (1983) Structure and Stereochemistry of Tetrahedral Inhibitor Complexes of Papain by Direct NMR Observation. J. Am. Chem. Soc 105, 6324-6325. (207) Mackenzie, N. E., Malthouse, J. P., and Scott, A. I. (1984) Studying enzyme mechanism by 13C nuclear magnetic resonance. Science 225, 883-9.

148 (208) Malthouse, J. P., Mackenzie, N. E., Boyd, A. S. F., and Scott, A. I. . (1983) Detection of a tetrahedral adduct in a trypsin-chloromethyl ketone specific inhibitor complex by 13C NMR. J. Am. Chem. Soc 105, 1685-1686. (209) Richarz, R., Tschesche, H., and Wuthrich, K. (1980) Carbon-13 nuclear magnetic resonance studies of the selectively isotope-labeled reactive site peptide bond of the basic pancreatic trypsin inhibitor in the complexes with trypsin, trypsinogen, and anhydrotrypsin. Biochemistry 19, 5711-5. (210) Galkin, A., Lu, X., Dunaway-Mariano, D., and Herzberg, O. (2005) Crystal structures representing the Michaelis complex and the thiouronium reaction intermediate of Pseudomonas aeruginosa arginine deiminase. J Biol Chem 280, 34080-7. (211) Das, K., Butler, G. H., Kwiatkowski, V., Clark, A. D., Jr., Yadav, P., and Arnold, E. (2004) Crystal structures of arginine deiminase with covalent reaction intermediates; implications for catalytic mechanism. Structure 12, 657-67. (212) Falgueyret, J. P., Oballa, R. M., Okamoto, O., Wesolowski, G., Aubin, Y., Rydzewski, R. M., Prasit, P., Riendeau, D., Rodan, S. B., and Percival, M. D. (2001) Novel, nonpeptidic cyanamides as potent and reversible inhibitors of human cathepsins K and L. J Med Chem 44, 94-104. (213) Mackenzie, N. E., Grant, S. K., Scott, A. I., and Malthouse, J. P. (1986) 13C NMR study of the stereospecificity of the thiohemiacetals formed on inhibition of papain by specific enantiomeric aldehydes. Biochemistry 25, 2293-8. (214) Liang, T. C., and Abeles, R. H. (1987) Inhibition of papain by nitriles: mechanistic studies using NMR and kinetic measurements. Arch Biochem Biophys 252, 626-34. (215) Allard, J., Grochulski, P., and Sygusch, J. (2001) Covalent intermediate trapped in 2-keto-3-deoxy-6- phosphogluconate (KDPG) aldolase structure at 1.95-A resolution. Proc Natl Acad Sci U S A 98, 3679-84. (216) Hopkins, A. L., Mason, J. S., and Overington, J. P. (2006) Can we rationally design promiscuous drugs? Curr Opin Struct Biol 16, 127-36. (217) Hopkins, A. L. (2008) Network pharmacology: the next paradigm in drug discovery. Nat Chem Biol 4, 682-90. (218) Apsel, B., Blair, J. A., Gonzalez, B., Nazif, T. M., Feldman, M. E., Aizenstein, B., Hoffman, R., Williams, R. L., Shokat, K. M., and Knight, Z. A. (2008) Targeted polypharmacology: discovery of dual inhibitors of tyrosine and phosphoinositide kinases. Nat Chem Biol 4, 691-9. (219) Morphy, R., and Rankovic, Z. (2005) Designed multiple ligands. An emerging drug discovery paradigm. J Med Chem 48, 6523-43.

149 (220) Roth, B. L., Sheffler, D. J., and Kroeze, W. K. (2004) Magic shotguns versus magic bullets: selectively non-selective drugs for mood disorders and schizophrenia. Nat Rev Drug Discov 3, 353-9. (221) Coan, K. E., and Shoichet, B. K. (2008) Stoichiometry and physical chemistry of promiscuous aggregate-based inhibitors. J Am Chem Soc 130, 9606-12. (222) Li, H., Raman, C. S., Martasek, P., Masters, B. S., and Poulos, T. L. (2001) Crystallographic studies on endothelial nitric oxide synthase complexed with nitric oxide and mechanism-based inhibitors. Biochemistry 40, 5399-406. (223) Baydoun, A. R., and Mann, G. E. (1994) Selective targeting of nitric oxide synthase inhibitors to system y+ in activated macrophages. Biochem Biophys Res Commun 200, 726-31. (224) Speers, A. E., and Cravatt, B. F. (2004) Profiling enzyme activities in vivo using click chemistry methods. Chem Biol 11, 535-46. (225) Kidd, D., Liu, Y., and Cravatt, B. F. (2001) Profiling serine activities in complex proteomes. Biochemistry 40, 4005-15. (226) Liu, Y., Patricelli, M. P., and Cravatt, B. F. (1999) Activity-based protein profiling: the serine hydrolases. Proc Natl Acad Sci U S A 96, 14694-9. (227) Greenbaum, D., Baruch, A., Hayrapetian, L., Darula, Z., Burlingame, A., Medzihradszky, K. F., and Bogyo, M. (2002) Chemical approaches for functionally probing the proteome. Mol Cell Proteomics 1, 60-8. (228) Thornberry, N. A., Peterson, E. P., Zhao, J. J., Howard, A. D., Griffin, P. R., and Chapman, K. T. (1994) Inactivation of interleukin-1 beta converting enzyme by peptide (acyloxy)methyl ketones. Biochemistry 33, 3934-40. (229) Faleiro, L., Kobayashi, R., Fearnhead, H., and Lazebnik, Y. (1997) Multiple species of CPP32 and Mch2 are the major active caspases present in apoptotic cells. Embo J 16, 2271-81. (230) Martins, L. M., Kottke, T., Mesner, P. W., Basi, G. S., Sinha, S., Frigon, N., Jr., Tatar, E., Tung, J. S., Bryant, K., Takahashi, A., Svingen, P. A., Madden, B. J., McCormick, D. J., Earnshaw, W. C., and Kaufmann, S. H. (1997) Activation of multiple interleukin-1beta converting enzyme homologues in cytosol and nuclei of HL-60 cells during etoposide-induced apoptosis. J Biol Chem 272, 7421-30. (231) Lo, L. C., Pang, T. L., Kuo, C. H., Chiang, Y. L., Wang, H. Y., and Lin, J. J. (2002) Design and synthesis of class-selective activity probes for protein tyrosine phosphatases. J Proteome Res 1, 35-40. (232) Tsai, C. S., Li, Y. K., and Lo, L. C. (2002) Design and synthesis of activity probes for glycosidases. Org Lett 4, 3607-10. (233) Wright, A. T., Song, J. D., and Cravatt, B. F. (2009) A suite of activity-based probes for human cytochrome P450 enzymes. J Am Chem Soc 131, 10692-700.

150 (234) Schicher, M., Jesse, I., and Birner-Gruenberger, R. (2009) Activity-based profiling of lipases in living cells. Methods Mol Biol 580, 251-66. (235) Salisbury, C. M., and Cravatt, B. F. (2008) Optimization of activity-based probes for proteomic profiling of histone deacetylase complexes. J Am Chem Soc 130, 2184-94. (236) Luo, Y., Knuckley, B., Bhatia, M., Pellechia, P. J., and Thompson, P. R. (2006) Activity-based protein profiling reagents for protein arginine deiminase 4 (PAD4): synthesis and in vitro evaluation of a fluorescently labeled probe. J Am Chem Soc 128, 14468-9. (237) Adam, G. C., Cravatt, B. F., and Sorensen, E. J. (2001) Profiling the specific reactivity of the proteome with non-directed activity-based probes. Chem Biol 8, 81-95. (238) Adam, G. C., Sorensen, E. J., and Cravatt, B. F. (2002) Proteomic profiling of mechanistically distinct enzyme classes using a common chemotype. Nat Biotechnol 20, 805-9. (239) Speers, A. E., Adam, G. C., and Cravatt, B. F. (2003) Activity-based protein profiling in vivo using a copper(i)-catalyzed azide-alkyne [3 + 2] cycloaddition. J Am Chem Soc 125, 4686-7. (240) Kolb, H. C., Finn, M. G., and Sharpless, K. B. (2001) Click Chemistry: Diverse Chemical Function from a Few Good Reactions. Angew Chem Int Ed Engl 40, 2004-2021. (241) Rostovtsev, V. V., Green, L. G., Fokin, V. V., and Sharpless, K. B. (2002) A stepwise huisgen cycloaddition process: copper(I)-catalyzed regioselective "ligation" of azides and terminal alkynes. Angew Chem Int Ed Engl 41, 2596-9. (242) Tornoe, C. W., Christensen, C., and Meldal, M. (2002) Peptidotriazoles on solid phase: [1,2,3]-triazoles by regiospecific copper(i)-catalyzed 1,3-dipolar cycloadditions of terminal alkynes to azides. J Org Chem 67, 3057-64. (243) Wang, Q., Chan, T. R., Hilgraf, R., Fokin, V. V., Sharpless, K. B., and Finn, M. G. (2003) Bioconjugation by copper(I)-catalyzed azide-alkyne [3 + 2] cycloaddition. J Am Chem Soc 125, 3192-3. (244) Greenbaum, D. C., Arnold, W. D., Lu, F., Hayrapetian, L., Baruch, A., Krumrine, J., Toba, S., Chehade, K., Bromme, D., Kuntz, I. D., and Bogyo, M. (2002) Small molecule affinity fingerprinting. A tool for enzyme family subclassification, target identification, and inhibitor design. Chem Biol 9, 1085-94. (245) Leung, D., Hardouin, C., Boger, D. L., and Cravatt, B. F. (2003) Discovering potent and selective reversible inhibitors of enzymes in complex proteomes. Nat Biotechnol 21, 687-91. (246) Boger, R. H., Sullivan, L. M., Schwedhelm, E., Wang, T. J., Maas, R., Benjamin, E. J., Schulze, F., Xanthakis, V., Benndorf, R. A., and Vasan, R. S. (2009) Plasma

151 asymmetric dimethylarginine and incidence of cardiovascular disease and death in the community. Circulation 119, 1592-600. (247) Dayal, S., Rodionov, R. N., Arning, E., Bottiglieri, T., Kimoto, M., Murry, D. J., Cooke, J. P., Faraci, F. M., and Lentz, S. R. (2008) Tissue-specific downregulation of dimethylarginine dimethylaminohydrolase in hyperhomocysteinemia. Am J Physiol Heart Circ Physiol 295, H816-25. (248) Matsuguma, K., Ueda, S., Yamagishi, S., Matsumoto, Y., Kaneyuki, U., Shibata, R., Fujimura, T., Matsuoka, H., Kimoto, M., Kato, S., Imaizumi, T., and Okuda, S. (2006) Molecular mechanism for elevation of asymmetric dimethylarginine and its role for hypertension in chronic kidney disease. J Am Soc Nephrol 17, 2176- 83. (249) Onozato, M. L., Tojo, A., Leiper, J., Fujita, T., Palm, F., and Wilcox, C. S. (2008) Expression of NG,NG-dimethylarginine dimethylaminohydrolase and protein arginine N-methyltransferase isoforms in diabetic rat kidney: effects of angiotensin II receptor blockers. Diabetes 57, 172-80. (250) Powers, J. C., Asgian, J. L., Ekici, O. D., and James, K. E. (2002) Irreversible inhibitors of serine, cysteine, and threonine proteases. Chem Rev 102, 4639-750. (251) Wang, Y., Hu, S., and Fast, W. (2009) A click chemistry mediated in vivo activity probe for dimethylarginine dimethylaminohydrolase. J Am Chem Soc 131, 15096- 7. (252) Weldon, S., Ambroz, K., Schutz-Geschwender, A., and Olive, D. M. (2008) Near- infrared fluorescence detection permits accurate imaging of loading controls for Western blot analysis. Anal Biochem 375, 156-8. (253) Jessani, N., and Cravatt, B. F. (2004) The development and application of methods for activity-based protein profiling. Curr Opin Chem Biol 8, 54-9. (254) Li, W., Blankman, J. L., and Cravatt, B. F. (2007) A functional proteomic strategy to discover inhibitors for uncharacterized hydrolases. J Am Chem Soc 129, 9594- 5. (255) Sadaghiani, A. M., Verhelst, S. H., and Bogyo, M. (2007) Tagging and detection strategies for activity-based proteomics. Curr Opin Chem Biol 11, 20-8.

152 Vita

Yun Wang was born in Hangzhou, Zhejiang, P.R. China, on Oct. 20th, 1981, the daughter of Xiangkun Wang and Yuju Liu. She grew up in Hangzhou, which is the capital of Zhejiang province and one of the most prosperous cities in China for the last 1,000 years. She went to Hangzhou Xuejun High School in 1995, where she developed her interest in chemistry by participating Chinese National Chemistry Olympiad Competition for high school students and won the first prize of the competition in Zhejiang province in 1997. Motivated by the slogan “The twenty-first century is the century of life science”, she went to Fudan University in Shanghai for her college and got her B.S. in Biology in 2002. After she finished college, she made an important decision to apply for graduate school in the United States. She was fortunate to be accepted by Department of Biochemistry and Biophysics at Texas A&M University, where she got her M.S. degree under the direction of Dr. David P. Giedroc in 2005. With the dream of performing research related to biomedical science and drug discovery, she applied to the Medicinal Chemistry Division of College of Pharmacy in The University of Texas at Austin in 2005 for a Ph.D. degree. She joined in Dr. Walt Fast’s laboratory in 2006, where she devoted her Ph.D. study to discover new therapeutics in order to control diseases marked by nitric oxide overproduction.

153 Publications: Wang, Y., Kendall, J., Cavet, J.S., and Giedroc, D.P., Elucidation of the functional metal binding profile of a CdII/PbII sensor CmtRSc from Streptomyces coelicolor, 2010, accepted by Biochemistry Wang, Y., Hu, S., and Fast, W., A click chemistry mediated in vivo activity probe for dimethylarginine dimethylaminohydrolase, J. Am. Chem. Soc, 2009, 131, 15096- 15097 Wang, Y., Monzingo, A., Hu, S., Robertus, J., and Fast, W., Developing dual and specific inhibitors of dimethylarginine dimethylaminohydrolase-1 and nitric oxide synthase: toward a targeted polypharmacology to control nitric oxide, Biochemistry, 2009, 48(36), 8624-8635 Lu, CS., Zhu, J., Wang, Y., Umeda, A., Cowmeadow, R.B., Lai, E., Moreno, G.N., Person, M.D., and Zhang, Z.W., Staphylococcus aureus sortase A exists as a dimeric protein in vitro. Biochemistry, 2007, 46(32), 9346-9354 Wang, Y., Hemmingsen, L., and Giedroc, D.P., Structural and functional characterization of Mycobacterium tuberculosis CmtR, a PbII/CdII-sensing SmtB/ArsR metalloregulatory repressor. Biochemistry, 2005, 44(25), 8976-8988

Permanent address: 1634 West Sixth Street Apt. J Austin, TX 78703 This dissertation was typed by Yun Wang.

154