Pyruvate Kinase Deficiency
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Phenotypic and Molecular Genetic Analysis of Pyruvate Kinase Deficiency in a Tunisian Family
The Egyptian Journal of Medical Human Genetics (2016) 17, 265–270 HOSTED BY Ain Shams University The Egyptian Journal of Medical Human Genetics www.ejmhg.eg.net www.sciencedirect.com ORIGINAL ARTICLE Phenotypic and molecular genetic analysis of Pyruvate Kinase deficiency in a Tunisian family Jaouani Mouna a,1,*, Hamdi Nadia a,1, Chaouch Leila a, Kalai Miniar a, Mellouli Fethi b, Darragi Imen a, Boudriga Imen a, Chaouachi Dorra a, Bejaoui Mohamed b, Abbes Salem a a Laboratory of Molecular and Cellular Hematology, Pasteur Institute, Tunis, Tunisia b Service d’Immuno-He´matologie Pe´diatrique, Centre National de Greffe de Moelle Osseuse, Tunis, Tunisia Received 9 July 2015; accepted 6 September 2015 Available online 26 September 2015 KEYWORDS Abstract Pyruvate Kinase (PK) deficiency is the most frequent red cell enzymatic defect responsi- Pyruvate Kinase deficiency; ble for hereditary non-spherocytic hemolytic anemia. The disease has been studied in several ethnic Phenotypic and molecular groups. However, it is yet an unknown pathology in Tunisia. We report here, the phenotypic and investigation; molecular investigation of PK deficiency in a Tunisian family. Hemolytic anemia; This study was carried out on two Tunisian brothers and members of their family. Hematolog- Hydrops fetalis; ical, biochemical analysis and erythrocyte PK activity were performed. The molecular characteriza- PKLR mutation tion was carried out by gene sequencing technique. The first patient died few hours after birth by hydrops fetalis, the second one presented with neonatal jaundice and severe anemia necessitating urgent blood transfusion. This severe clinical pic- ture is the result of a homozygous mutation of PKLR gene at exon 8 (c.1079G>A; p.Cys360Tyr). -
Isozymes of Pyruvate Kinase in Liver and Hepatomas of the Rat1
[CANCER RESEARCH 34, 1439-1446, June 1974] Isozymes of Pyruvate Kinase in Liver and Hepatomas of the Rat1 Francis A. Farina,2 Jennie B. Shatton, Harold P. Morris, and Sidney Weinhouse The Fels Research Institute and the Department of Biochemistry, Temple University School oj Medicine, Philadelphia. Pennsylvania IV140 (F. A. F., J. B. S.. S. W.\, and the Department of Biochemistry. Howard University School of Medicine. Washington. D. C. 20001 [H. P. M .\ SUMMARY 23, 32, 41, 57). These alterations involve the replacement of those isozymes that are under dietary and hormonal control Pyruvate kinase (PK) (EC 2.7.1.40) isozymes were assayed by the host, and that have important metabolic functions in in normal rat liver and a series of transplantable rat the adult differentiated liver by other isozymes which are hepatomas ranging widely in growth rate and degree of normally either low in, or absent from, the adult tissue. As differentiation, with the use of gradient elution by chloride part of an ongoing study of this phenomenon, we have ion from columns of DEAE-cellulose. In agreement with examined the alteration of PK3 (EC 2.7.1.40) isozymes in other studies, three noninterconvertible forms were found in the Morris hepatomas (30. 31), a series of chemically rat tissues: isozyme I, the major form in adult rat liver: induced, transplantable rat hepatomas ranging widely in isozyme II, the sole form in heart and skeletal muscle: and growth rate and degree of differentiation. This enzyme isozyme III, the sole form in poorly differentiated hepato occupies a key position in the metabolism of cells and, as we mas, the major form in normal kidney and lung, and the pointed out previously (27, 28. -
Pyruvate Kinase: Function, Regulation and Role in Cancer
Pyruvate kinase: Function, regulation and role in cancer The MIT Faculty has made this article openly available. Please share how this access benefits you. Your story matters. Citation Israelsen, William J., and Matthew G. Vander Heiden. “Pyruvate Kinase: Function, Regulation and Role in Cancer.” Seminars in Cell & Developmental Biology 43 (2015): 43–51. As Published http://dx.doi.org/10.1016/j.semcdb.2015.08.004 Publisher Elsevier Version Author's final manuscript Citable link http://hdl.handle.net/1721.1/105833 Terms of Use Creative Commons Attribution-NonCommercial-NoDerivs License Detailed Terms http://creativecommons.org/licenses/by-nc-nd/4.0/ HHS Public Access Author manuscript Author Manuscript Author ManuscriptSemin Cell Author Manuscript Dev Biol. Author Author Manuscript manuscript; available in PMC 2016 August 13. Published in final edited form as: Semin Cell Dev Biol. 2015 July ; 43: 43–51. doi:10.1016/j.semcdb.2015.08.004. Pyruvate kinase: function, regulation and role in cancer William J. Israelsena,1,* and Matthew G. Vander Heidena,b,* aKoch Institute for Integrative Cancer Research, Massachusetts Institute of Technology, Cambridge, MA 02139, USA bDepartment of Medical Oncology, Dana-Farber Cancer Institute, Boston, MA 02115, USA Abstract Pyruvate kinase is an enzyme that catalyzes the conversion of phosphoenolpyruvate and ADP to pyruvate and ATP in glycolysis and plays a role in regulating cell metabolism. There are four mammalian pyruvate kinase isoforms with unique tissue expression patterns and regulatory properties. The M2 isoform of pyruvate kinase (PKM2) supports anabolic metabolism and is expressed both in cancer and normal tissue. The enzymatic activity of PKM2 is allosterically regulated by both intracellular signaling pathways and metabolites; PKM2 thus integrates signaling and metabolic inputs to modulate glucose metabolism according to the needs of the cell. -
Reduced Expression of Pyruvate Kinase in Kidney Proximal Tubule
www.nature.com/scientificreports OPEN Reduced expression of pyruvate kinase in kidney proximal tubule cells is a potential mechanism Received: 29 March 2018 Accepted: 22 January 2019 of pravastatin altered glucose Published: xx xx xxxx metabolism Yong Pyo Lee1, Yuri Cho2, Eun Jee Kim2,3, Hyojung Lee2, Hoon Young Choi4, Hye Jin Wang5, Eun Seok Kang 5, Yu Seun Kim2,6, Myoung Soo Kim1,2,6 & Beom Seok Kim2,3,7 Recent studies have reported that statins are associated with increased incidence of diabetes. Although several mechanisms have been proposed, the role of the kidney’s glucose metabolism upon statin treatment is still unclear. Thus, we investigated the role of pravastatin in gluconeogenesis and glycolysis. HK-2 and HepG2 cells were treated with pravastatin and cultured under either high- or normal-cholesterol conditions. In HK-2 cells treated with pravastatin under both high- and normal- cholesterol conditions, the protein expression of only pyruvate kinase isozymes L/R (PKLR) decreased in a dose-dependent manner, while the protein expression of other glucose metabolism related enzymes remained unchanged. Within the in vivo experiment, male C57BL/6 mice were fed either pravastatin-treated normal-fat diets for 2 or 4 weeks or pravastatin-treated high-fat diets for 16 weeks. Protein expression of PKLR in the kidneys from mice that consumed pravastatin-treated high-fat diets decreased signifcantly compared to the controls. Upon the treatments of pravastatin, only the PKLR expression decreased in lean mice. Furthermore, PKLR activity decreased signifcantly in the kidney after pravastatin treatments. However, there was no change in enzyme activity in the liver, suggesting that pravastatin decreased PKLR activity only in the kidney. -
Supporting Information
Supporting Information Wakabayashi et al. 10.1073/pnas.1521754113 SI Materials and Methods DNA Transfection and Puromycin Selection. K562 cells were cotrans- Plasmid Preparation. Short guide RNA (sgRNA) sequences (Table fected with 1 μg total of Cas9 nuclease and sgRNA plasmids using S1) were cloned into the pSg1 vector (Addgene) and the XPR5 Lipofectamine LTX Plus Reagent (Thermo Fisher Scientific) at a lentiviral vector (Broad Institute), respectively. [The XPR5 1:2 ratio of Cas9 to sgRNA. For a control, K562 cells were co- vector contains the Cas9 nuclease and a red fluorescent protein transfectedwith1μg total of Cas9 nuclease and pLKO.1-GFP (RFP) cassette.] The Cas9 nuclease expression vector used was plasmid at a 1:2 ratio of Cas9 to pLKO.1-GFP. At 24 h after co- μ pxPR_BRD001, which contains a puromycin resistance cassette transfection, puromycin was added at a concentration of 2 g/mL, μ as a selection marker. Off-target scores for each guide were followed 24 h later by a reduction to 1 g/mL for an additional 24 h. calculated using the CRISPR design tool (CRISPR Design; Selection efficiency was assessed by flow cytometry with propidium crispr.mit.edu); only guides with a score >50 (except for a score iodide staining (to assess viability) on a FACSCanto II flow cy- of 49 in one case) were used. tometer (BD Biosciences). Limiting dilutions were performed to obtain single cell-derived clonal populations for both cells targeted Cell Culture and Lentivirus Production. The K562 cells (American with sgRNAs as well as for GFP controls. Unless specified other- Type Culture Collection) were maintained in RPMI medium 1640 wise, three matching clonal GFP controls were analyzed for each plus L-glutamine (Life Technologies) supplemented with 10% experiment. -
Prevalence of Pyruvate Kinase Deficiency
P3513 Prevalence of Red Cell Pyruvate Kinase Deficiency: A Systematic Literature Review Mike Storm1, Matthew H Secrest2*, Courtney Carrington2, Deb Casso2, Keely Gilroy1, Leanne Pladson1, Audra N Boscoe1 1Agios Pharmaceuticals Inc., Cambridge, MA, USA; 2IQVIA Epidemiology & Drug Safety, Seattle, WA and Cambridge, MA, USA; *Affiliation at the time research was conducted BACKGROUND METHODS (continued) RESULTS (continued) RESULTS (continued) • Pyruvate Kinase (PK) deficiency is a rare congenital hemolytic anemia Exclusion Criteria The remaining 34 studies were grouped based on methods and study Among these 4 studies, an important distinction was made between studies characterized by diminished activity of the PK enzyme in red blood population (Table 1). reporting diagnosed prevalence (n=3) and overall disease prevalence cells (RBC).1 • Non-human studies; (diagnosed and undiagnosed PK deficiency; n=1). Table 1. Distribution of extracted studies by type of study (n=34) • Low PK enzyme activity can lead to lifelong chronic hemolysis with • Publications that were not the primary report of the data • Two studies estimated diagnosed PK deficiency prevalence as 3.2 per associated symptoms and complications such as anemia, jaundice, (e.g., literature reviews); Type of study Number million4 and 8.5 per million5 by identifying diagnosed PK deficiency cases of studies gallstones, splenectomy and associated thrombosis, iron overload, and • Studies of PK deficiency prevalence/incidence conducted within a source from source populations of known size. liver cirrhosis.2 Population-based prevalence 2 population of patients with symptoms of PK deficiency such as anemia • We estimated the prevalence of diagnosed PK deficiency in a general • PK deficiency is caused by compound heterozygosity or homozygosity for or jaundice; Molecular PKLR screening in a general population 5 population to be 6.5 per million6 using data from another high-quality study 3 one or more of the >300 known mutations to the PKLR gene. -
Table S1. List of Oligonucleotide Primers Used
Table S1. List of oligonucleotide primers used. Cla4 LF-5' GTAGGATCCGCTCTGTCAAGCCTCCGACC M629Arev CCTCCCTCCATGTACTCcgcGATGACCCAgAGCTCGTTG M629Afwd CAACGAGCTcTGGGTCATCgcgGAGTACATGGAGGGAGG LF-3' GTAGGCCATCTAGGCCGCAATCTCGTCAAGTAAAGTCG RF-5' GTAGGCCTGAGTGGCCCGAGATTGCAACGTGTAACC RF-3' GTAGGATCCCGTACGCTGCGATCGCTTGC Ukc1 LF-5' GCAATATTATGTCTACTTTGAGCG M398Arev CCGCCGGGCAAgAAtTCcgcGAGAAGGTACAGATACGc M398Afwd gCGTATCTGTACCTTCTCgcgGAaTTcTTGCCCGGCGG LF-3' GAGGCCATCTAGGCCATTTACGATGGCAGACAAAGG RF-5' GTGGCCTGAGTGGCCATTGGTTTGGGCGAATGGC RF-3' GCAATATTCGTACGTCAACAGCGCG Nrc2 LF-5' GCAATATTTCGAAAAGGGTCGTTCC M454Grev GCCACCCATGCAGTAcTCgccGCAGAGGTAGAGGTAATC M454Gfwd GATTACCTCTACCTCTGCggcGAgTACTGCATGGGTGGC LF-3' GAGGCCATCTAGGCCGACGAGTGAAGCTTTCGAGCG RF-5' GAGGCCTGAGTGGCCTAAGCATCTTGGCTTCTGC RF-3' GCAATATTCGGTCAACGCTTTTCAGATACC Ipl1 LF-5' GTCAATATTCTACTTTGTGAAGACGCTGC M629Arev GCTCCCCACGACCAGCgAATTCGATagcGAGGAAGACTCGGCCCTCATC M629Afwd GATGAGGGCCGAGTCTTCCTCgctATCGAATTcGCTGGTCGTGGGGAGC LF-3' TGAGGCCATCTAGGCCGGTGCCTTAGATTCCGTATAGC RF-5' CATGGCCTGAGTGGCCGATTCTTCTTCTGTCATCGAC RF-3' GACAATATTGCTGACCTTGTCTACTTGG Ire1 LF-5' GCAATATTAAAGCACAACTCAACGC D1014Arev CCGTAGCCAAGCACCTCGgCCGAtATcGTGAGCGAAG D1014Afwd CTTCGCTCACgATaTCGGcCGAGGTGCTTGGCTACGG LF-3' GAGGCCATCTAGGCCAACTGGGCAAAGGAGATGGA RF-5' GAGGCCTGAGTGGCCGTGCGCCTGTGTATCTCTTTG RF-3' GCAATATTGGCCATCTGAGGGCTGAC Kin28 LF-5' GACAATATTCATCTTTCACCCTTCCAAAG L94Arev TGATGAGTGCTTCTAGATTGGTGTCggcGAAcTCgAGCACCAGGTTG L94Afwd CAACCTGGTGCTcGAgTTCgccGACACCAATCTAGAAGCACTCATCA LF-3' TGAGGCCATCTAGGCCCACAGAGATCCGCTTTAATGC RF-5' CATGGCCTGAGTGGCCAGGGCTAGTACGACCTCG -
Protein Interactions in the Cancer Proteome† Cite This: Mol
Molecular BioSystems View Article Online PAPER View Journal | View Issue Small-molecule binding sites to explore protein– protein interactions in the cancer proteome† Cite this: Mol. BioSyst., 2016, 12,3067 David Xu,ab Shadia I. Jalal,c George W. Sledge Jr.d and Samy O. Meroueh*aef The Cancer Genome Atlas (TCGA) offers an unprecedented opportunity to identify small-molecule binding sites on proteins with overexpressed mRNA levels that correlate with poor survival. Here, we analyze RNA-seq and clinical data for 10 tumor types to identify genes that are both overexpressed and correlate with patient survival. Protein products of these genes were scanned for binding sites that possess shape and physicochemical properties that can accommodate small-molecule probes or therapeutic agents (druggable). These binding sites were classified as enzyme active sites (ENZ), protein–protein interaction sites (PPI), or other sites whose function is unknown (OTH). Interestingly, the overwhelming majority of binding sites were classified as OTH. We find that ENZ, PPI, and OTH binding sites often occurred on the same structure suggesting that many of these OTH cavities can be used for allosteric modulation of Creative Commons Attribution 3.0 Unported Licence. enzyme activity or protein–protein interactions with small molecules. We discovered several ENZ (PYCR1, QPRT,andHSPA6)andPPI(CASC5, ZBTB32,andCSAD) binding sites on proteins that have been seldom explored in cancer. We also found proteins that have been extensively studied in cancer that have not been previously explored with small molecules that harbor ENZ (PKMYT1, STEAP3,andNNMT) and PPI (HNF4A, MEF2B,andCBX2) binding sites. All binding sites were classified by the signaling pathways to Received 29th March 2016, which the protein that harbors them belongs using KEGG. -
Pyruvate Kinase, Rbc
Lab Dept: Chemistry Test Name: PYRUVATE KINASE, RBC General Information Lab Order Codes: PYKI Synonyms: Pyruvate Kinase, Erythrocytes CPT Codes: 84220 – Pyruvate kinase Test Includes: Pyruvate kinase RBC level reported in U/g Hb. Logistics Test Indications: Useful for the workup of cases of nonspherocytic hemolytic anemia, for a family workup to determine inheritance pattern (pyruvate kinase deficiency is autosomal recessive), and for genetic counseling. Lab Testing Sections: Chemistry - Sendouts Referred to: Mayo Medical Laboratories (MML Test: PK) Phone Numbers: MIN Lab: 612-813-6280 STP Lab: 651-220-6550 Test Availability: Daily, 24 hours Turnaround Time: 1 - 4 days, test set up Monday - Saturday Special Instructions: N/A Specimen Specimen Type: Whole blood Container: Yellow top (ACD- Solution B) tube Alternate tube: Lavender (EDTA) top tube Draw Volume: 6 mL (Minimum: 1 mL) blood Processed Volume: Same as Draw Volume Collection: Routine blood collection Special Processing: Lab Staff: Do Not centrifuge. Send whole blood refrigerated in original collection container. Do Not transfer blood to other containers. Store and ship at refrigerated temperatures. Forward promptly. Patient Preparation: None Sample Rejection: Specimen cannot be frozen; mislabeled or unlabeled specimens; gross hemolysis Interpretive Reference Range: ≥12 months: 6.7 – 14.3 U/g Hb Reference values have not been established for patients <12 months of age. Interpretation: Most hemolytic anemias due to pyruvate kinase (PK) deficiency are associated with activity levels less than 40% of mean normal. However, some patients with clinically significant hemolysis can have normal or only mildly decreased PK enzyme activity, which paradoxically may occur in individuals with most severe symptoms. -
Chrebp Regulates Fructose-Induced Glucose Production Independently of Insulin Signaling
ChREBP regulates fructose-induced glucose production independently of insulin signaling Mi-Sung Kim, … , Michelle Lai, Mark A. Herman J Clin Invest. 2016;126(11):4372-4386. https://doi.org/10.1172/JCI81993. Research Article Endocrinology Metabolism Obese, insulin-resistant states are characterized by a paradoxical pathogenic condition in which the liver appears to be selectively insulin resistant. Specifically, insulin fails to suppress glucose production, yet successfully stimulates de novo lipogenesis. The mechanisms underlying this dysregulation remain controversial. Here, we hypothesized that carbohydrate-responsive element-binding protein (ChREBP), a transcriptional activator of glycolytic and lipogenic genes, plays a central role in this paradox. Administration of fructose increased hepatic hexose-phosphate levels, activated ChREBP, and caused glucose intolerance, hyperinsulinemia, hypertriglyceridemia, and hepatic steatosis in mice. Activation of ChREBP was required for the increased expression of glycolytic and lipogenic genes as well as glucose-6- phosphatase (G6pc) that was associated with the effects of fructose administration. We found that fructose-induced G6PC activity is a major determinant of hepatic glucose production and reduces hepatic glucose-6-phosphate levels to complete a homeostatic loop. Moreover, fructose activated ChREBP and induced G6pc in the absence of Foxo1a, indicating that carbohydrate-induced activation of ChREBP and G6PC dominates over the suppressive effects of insulin to enhance glucose production. This ChREBP/G6PC signaling axis is conserved in humans. Together, these findings support a carbohydrate-mediated, ChREBP-driven mechanism that contributes to hepatic insulin resistance. Find the latest version: https://jci.me/81993/pdf RESEARCH ARTICLE The Journal of Clinical Investigation ChREBP regulates fructose-induced glucose production independently of insulin signaling Mi-Sung Kim,1 Sarah A. -
Inhibition of Spinach Phosphoribulokinase by DL-Glyceraldehyde by ANTONI R
Biochem. J. (1976) 153, 613-619 613 Printed in Great Britain Inhibition of Spinach Phosphoribulokinase by DL-Glyceraldehyde By ANTONI R. SLABAS and DAVID A. WALKER Department ofBotany, University ofSheffield, Sheffield S1O 2TN, U.K. (Received 10 September 1975) Spinach chloroplast phosphoribulokinase is inhibited by DL-glyceraldehyde. The in- hibition is non-competitive with respect to ribulose 5-phosphate (Ki 19mM) and ATP (Ki 20mM). The inhibition is discussed in relation to a previously reported inhibition of CO2 assimilation in intact and envelope-free chloroplasts by DL-glyceraldehyde. It is concluded that the inhibition of phosphoribulokinase is insufficient to account for the inhibition, by DL-glyceraldehyde, of 02 evolution with ribose 5-phosphate as substrate and that a further site of inhibition is also present in this system. DL-Glyceraldehyde inhibits photosynthetic carbon glycylglycine buffer, pH7.4, in a total volume of assiniilation by intact chloroplasts and by the re- 13 ml. The reaction was terminated by the addition constituted chloroplast system (Stokes & Walker, of 2ml of 50 % (w/v) trichloroacetic acid and the pH 1972). The inhibition is most pronounced with intact was adjusted to pH8.0 with KOH. After the addition chloroplasts, a concentration of 1OmM being sufficient of Sml of 1.OM-barium acetate the solution was to suppress 02 evolution completely. It is important centrifuged and the precipitate discarded after because DL-glyceraldehyde is the only known inhibi- washing with Sml of water. Cold ethanol (4vol.) was tor of photosynthesis that is entirely without detect- added to the combined supernatants (total volume able effect on photophosphorylation or photo- 25.4ml); the new precipitate was recovered by synthetic electron transport. -
Structure-Function Studies of Enzymes from Ribose Metabolism
Comprehensive Summaries of Uppsala Dissertations from the Faculty of Science and Technology 939 Structure-Function Studies of Enzymes from Ribose Metabolism BY C. EVALENA ANDERSSON ACTA UNIVERSITATIS UPSALIENSIS UPPSALA 2004 !"" #$"" % & % % ' ( ) * + &( , +( !""( - . - % + / % 0 ( , ( 1#1( ( ( 2-3 1. 45 ." 2 * & & * % * &( , % . * % % ( ) % / ( 0 6 / % ,)' & % % & ( )* % 6 % 6 * ( 0 6 * * % ( - % & 7 % & % & && ( ' && ,)' % /( 2 8 * ,)' & ,'.'' ( ) * % / % * 6 & & / 6 ( 0 . . . ( - * & * % %% & ( 9 * 6 / %% % ( -: % & * . & . , /( , & % * /( ) % / % & % ( ! 6 . . & / 6 % " # $ % # %& '()# %$# # *+',-. # ; ( + , !"" 2--3 ".!#!< 2-3 1. 45 ." $ $$$ .#111 = $>> (6(> ? @ $ $$$ .#111A List of Papers This thesis is based on the following papers, which are referred to in the text by their Roman numerals: I Andersson, C. E. & Mowbray, S. L. (2002). Activation of ribokinase by monovalent cations. J. Mol. Biol. 315, 409-19 II Zhang, R., Andersson, C. E., Savchenko,