DOCSLIB.ORG

Anisocotyly and Meristem Initiation in an Unorthodox Plant, Streptocarpus Rexii (Gesneriaceae)

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Anisocotyly and Meristem Initiation in an Unorthodox Plant, Streptocarpus Rexii (Gesneriaceae) Planta (2007) 225:653–663 DOI 10.1007/s00425-006-0389-7 ORIGINAL ARTICLE Anisocotyly and meristem initiation in an unorthodox plant, Streptocarpus rexii (Gesneriaceae) RaVaella Mantegazza · Michael Möller · C. Jill Harrison · Simone Fior · Chiara De Luca · Alberto Spada Received: 26 April 2006 / Accepted: 22 August 2006 / Published online: 15 September 2006 © Springer-Verlag 2006 Abstract In common with most Old World Gesneria- ing post-embryonic development on the axis (the pet- ceae; Streptocarpus Lindl. shows anisocotylous growth, iolode) between the two cotyledons. The expression i.e., the continuous growth of one cotyledon after ger- pattern of SrSTM1 suggests a function in maintaining mination. Linked to this phenomenon is an unortho- cell division activity in the cotyledons before becoming dox behaviour of the shoot apical meristem (SAM) localized in the basal meristem, initially at the proximal that determines the growth pattern of acaulescent spe- ends of both cotyledons, later at the base of the contin- cies (subgenus Streptocarpus). In contrast caulescent uously growing macrocotyledon, and the groove meri- species develop a conventional central post-embryonic stem on the petiolode. The latter is equivalent to a SAM (mainly subgenus Streptocarpella). We used S. displaced SAM seemingly originating de novo under rexii Lindl. as a model to investigate anisocotyly and the inXuence of endogenous factors. Applied cytokinin meristem initiation in Streptocarpus by using histologi- retains SrSTM1expression in the small cotyledon, thus cal techniques and analyses of the expression pattern promoting isocotyly and re-establishment of a central of the meristematic marker SrSTM1 during ontogeny. post-embryonic SAM. Hormone-dependent delocal- In contrast to Arabidopsis thaliana (L.) Heynh., S. rexii ization of the process of meristem development could does not establish a SAM during embryogenesis, and underlie anisocotyly and the unorthodox SAM forma- the Wrst evidence of a SAM-like structure occurs dur- tion in Streptocarpus. Keywords Anisocotyly · Cytokinins · Groove meristem · Shoot apical meristem · SrSTM1 · Streptocarpus Electronic supplementary material Supplementary material is available in the online version of this article at http://dx.doi.org/ 10.1007/s00425-006-0389-7 and is accessible for authorized users. Abbreviations BAP 6-Benzylaminopurine R. Mantegazza (&) · S. Fior · C. De Luca · A. Spada CLV CLAVATA Dipartimento di Biologia, Universita degli Studi di Milano, DAP Days after pollination Via Celoria 26, 20133 Milan, Italy e-mail: [email protected] DAS Days after sowing DIG Digoxygenin M. Möller KNOX Class 1 knotted1-like homeobox genes Royal Botanic Garden Edinburgh, 20A Inverleith Row, RAM Root apical meristem Edinburgh, EH3 5LR Scotland, UK SAM Shoot apical meristem C. Jill Harrison SEM Scanning electron microscopy Department of Plant Sciences, University of Oxford, SrSTM1 Streptocarpus rexii SHOOTMERISTEM- South Parks Road, Oxford, OX1 3RB, UK LESS1 homologue A. Spada STM SHOOTMERISTEMLESS CNR, Istituto di BioWsica, Sede Milano, Italy WUS WUSCHEL 123 654 Planta (2007) 225:653–663 Introduction the growth of new phyllomorphs and inXorescences (Fig. 1; Jong 1970, 1978; Jong and Burtt 1975). Genetic understanding of the diverse plant develop- The unique morphology of Streptocarpus is intrinsi- mental pathways found in natural species is taught cally linked to the interplay of these three meristems. from few model plants conforming to a standard bau- They interact at the seedling stage already and are plan that have been analysed in great detail. They pro- responsible for the great vegetative diversity in the genus, vide the basis of our understanding of how plant resulting in species with a single leaf throughout the indi- diversity is genetically controlled, and serve as tem- vidual’s life (unifoliate), species producing several to plates to investigate “unusual” plant forms. One of numerous leaves arranged in a more or less irregular these unusual forms is found in certain Streptocarpus rosette (rosulate), besides “ordinary” caulescent species Lindl. species. They exhibit such an unorthodox bau- possessing a normal shoot apical meristem (SAM) and a plan to necessitate the introduction of new botanical branched stem system (Hilliard and Burtt 1971). terms to describe their unusual morphological features, To date two main pathways have been shown to such as anisocotyly, petiolode and phyllomorph (Jong aVect meristem establishment and maintenance in Ara- 1970). The unequal development of the two cotyledons bidopsis Heynh. and these are the KNOX pathway, and after germination (anisocotyly) is common to most the WUSCHEL/CLAVATA (WUS/CLV) pathway members of the Old World Gesneriaceae (Jong 1970; (Vollbrecht et al. 1991, 2000; Brand et al. 2000; Schoof Cronk and Möller 1997; Nishii et al. 2004) and likely et al. 2000). Previous work has shown that the KNOX constitutes the prerequisite condition for the develop- pathway is present in Streptocarpus, and that diVerent ment of the extraordinary growth forms of acaulescent patterns of KNOX expression and localization reXect, species of Streptocarpus (Hilliard and Burtt 1971; but do not cause the diVerences in form between spe- Rosenblum and Basile 1984; Möller and Cronk 2001). cies (Harrison et al. 2005). This evidence comes from Anisocotyly is thought to advantage the growth in typi- investigations on the expression of SSTM1, a SHOOT- cally extreme habitats of Streptocarpus in deep shade, MERISTEMLESS (STM) homologue of the KNOX thus to boost the production of photosynthetic tissue gene family (Harrison et al. 2005). STM-like genes are soon after germination from the endospermless seeds expressed in cells of the SAM but down regulated in (Burtt 1970). The vegetative plant body of acaulescent presumptive organ primordia, and they play a funda- Streptocarpus species consists of phyllomorphs. Each mental role among KNOX genes responsible for meri- phyllomorph is composed of a stem-like petiole, stem regulation (Long et al. 1996). Thus, STM-like termed petiolode, and a foliose component, the lamina genes can be used as meristematic markers. (Fig. 1). The development of the phyllomorph is con- In model plants the interaction of plant hormones with trolled by three meristems at the junction of the lamina KNOX genes has been shown to represent one of the and petiolode: (a) the basal meristem which provides key factors regulating the expression of genes required the growth of the lamina; (b) the petiolode meristem, for SAM formation and function (Rupp et al. 1999; Hay involved in the growth of the midrib and elongation of et al. 2004). In this respect, it is interesting to note the petiolode; (c) the groove meristem which provides Rosenblum and Basile (1984) who examined the eVect of Fig. 1 Diagrammatic repre- sentation of phyllomorphic organization in Streptocarpus, modiWed from Jong and Burtt (1975). a Cotyledonary phyllomorph. b Longitudinal section through a petiolode. ar adventitious root, bm basal meristem, gm groove meristem, l lamina, m midrib, pc procambium, pd petiolode, ph secondary phyllomorphs, pm petiolode meristem, vs vasculature 123 Planta (2007) 225:653–663 655 hormone application on the variation of growth forms in Scanning-electron microscopy (SEM) Streptocarpus. They claimed that exogenous hormones re-establish morphogenetic capacities previously thought Seedlings were Wxed in FAA (3.7% formaldehyde and to be “lost” in the rosulate and unifoliate species, such as 5% acetic acid in 50% ethanol) overnight at 4°C. The isocotyly and caulescence. In particular, cytokinins were Wxed material was subjected to dehydration in an etha- found capable of inducing phyllomorphic development nol series (75–90–95–100%), then critical point dried, of the normally non-accrescent microcotyledon, i.e., the mounted on stubs and coated with gold before obser- development of basal meristems in both cotyledons vation with a LEO 1430 scanning electron microscope (Rosenblum and Basile 1984; Nishii et al. 2004). It would (LEO Electron Microscopy, Thornwood, NY, USA). thus be interesting to investigate the interaction of cyto- kinin and SrSTM1 expression in the light of the hormone In situ hybridization eVect on the fate of the SAM. Here we aim to determine when and how the Digoxygenin-labeled (DIG) SrSTM1 RNA was gener- unusual growth patterns of Streptocarpus rexii during ated using an in vitro transcription kit (Roche Diagnos- its ontogeny arise. We describe the meristem initiation tics GmbH, Mannheim, Germany). and development during embryogenesis and seedling The highly variable 5Ј region of the SrSTM1 development by histological techniques and by analyz- sequence of Harrison et al. (2005) spanning from ing the expression of SrSTM1. Coupled with experi- amino acids 32 to 98 was used as a template and was ments with exogenously applied cytokinin our results ampliWed using primers 22NOT7P (CCATGATGATG will provide insights into the developmental processes ATGATGCCTGC) and 22T7P (TAATACGACTC leading to anisocotyly and the unconventional SAM ACTATAGGGGCATCTCCGTCTCCTTCCATG) for formation in Streptocarpus. the antisense probe and SENSF (TAATACGACTCAC TATAGGGCCATGATGATGATGATGCCTGC) and SENSR (GCATCTCCGTCTCCTTCCATG) for the Materials and methods sense probe. Hybridization and immunological detection were Plant material performed as described by Lopez-Dee et al. (1999) with minor modiWcations. The hybridization was car- Plants of S. rexii Lindl. (Gesneriaceae; Lindley 1828),
Load more

Recommended publications
  • The Functional Role of Birds As Pollinators in Southern Cape Fynbos
    The functional role of birds as pollinators in southern Cape fynbos. Kellyn J. Whitehead A thesis presented in fulfilment of the academic requirements for the degree of Masters of Science in Ecological Sciences At the University of KwaZulu-Natal, Pietermaritzburg, South Africa January 2018 1 ABSTRACT Nectarivorous birds, particularly sunbirds, are important pollinators of plants in the Cape Flora of South Africa, being responsible for pollinating approximately 5% of plant species. However, interactions between plants and nectarivorous birds in the eastern part of the Cape Floristic Region have not received much attention. This study focussed on two putatively bird-pollinated plant species found within the Nature’s Valley area, namely Kniphofia uvaria and Chasmanthe aethiopica. The breeding systems were determined for each species and, due to their patchy population distribution, potential Allee effects on plant fecundity were also tested for. Flowering phenology in the area was also examined to test for associations between flowering of bird-pollinated plant species and the temporal presence of nectarivorous birds. Selective exclusion experiments showed that sunbirds were the main pollinators of K. uvaria and C. aethiopica – fruit set and the number of viable seeds were much higher for untreated (open control) individuals where birds could visit flowers freely, compared to caged individuals which only allowed for insect visitation. Very few seeds developed when plants of the two species were bagged to exclude all pollinators, indicating that the species are not capable of autonomous self-fertilization. Fruit and seed set were determined for patches of K. uvaria and C. aethiopica in order to test for potential Allee effects.
    [Show full text]
  • Virus-Induced Gene Silencing in Streptocarpus Rexii (Gesneriaceae)
    Molecular Biotechnology (2020) 62:317–325 https://doi.org/10.1007/s12033-020-00248-w ORIGINAL PAPER Virus‑induced Gene Silencing in Streptocarpus rexii (Gesneriaceae) Kanae Nishii1,2 · Yue Fei3 · Andrew Hudson3 · Michael Möller1 · Attila Molnar3 Published online: 7 March 2020 © Springer Science+Business Media, LLC, part of Springer Nature 2020 Abstract Many members of the family Gesneriaceae are cultivated as ornamental plants, including Cape primrose (Streptocarpus) species. The range of plant architecture found in this genus has also made it a model to study leaf and meristem development and their evolution. However, the lack of tools to study gene functions through reverse genetics in Streptocarpus has limited the exploitation of its genetic potential. To aid functional genomic studies in Streptocarpus rexii, we sought to investigate virus-induced gene silencing (VIGS). Using the broad host range Tobacco Rattle Virus (TRV) to target the PHYTOENE DESATURASE (PDS) gene of S. rexii, we show that infection with sap from Nicotiana benthamiana triggered VIGS ef- ciently. VIGS was most efective in the seedling leaves 8 weeks after sowing, but was limited in duration and systemic spread. This study reports the frst successful use of VIGS in Streptocarpus and in the family Gesneriaceae. The inoculation of viral sap derived from N. benthamiana was able to overcome the difculties of standard Agrobacterium-mediated transformation in this genus. Irrespective of its transient efect, this VIGS system will be useful to assess gene function at the cellular level and represent an important tool for further understanding molecular mechanisms in Streptocarpus. Keywords Gesneriaceae · Nicotiana benthamiana · PHYTOENE DESATURASE · Streptocarpus rexii · Tobacco rattle virus · Virus-induced gene silencing Background phyllomorphs.
    [Show full text]
  • Florilegium-Species-List.Pdf
    ROYAL BOTANIC GARDEN EDINBURGH FLORILEGIUM: List of Plants Notes Plants chosen for their association with RBGE, by name or its staff; their particular value in a glasshouse; their scientific value; or horticultural value. Some subjects are in commercial cultivation and can be obtained from nurseries. Aeschynanthus (Gesneriaceae) is a National Collection at RBGE. Members of the Zingiberaceae are subjects of ongoing scientific research at RBGE. It is possible many subjects can be found in other botanic gardens in other parts of the world. If painting in areas where the subject is distributed in the wild, it is strongly encouraged that you consult with your local botany authorities first. Artists wishing to take on any on the list are asked to let the Artist Coordinator know Sarah Howard [email protected] She will direct you to a member of RBGE staff, who will be happy to help you with specimens, descriptions etc. Facilities are being made available at RBGE for artists painting their subject in UK. Species Family Distribution Comment Aeschynanthus burtii Mendum Gesneriaceae Sulawesi Collection and naming reflects 3 generations RBGE staff Aeschynanthus mendumiae D.J. Gesneriaceae South Asia Named after former RBGE Botanist and Botanical Middleton artist Dr.Mary Mendum Aeschylanthus citrinus Gesneriaceae Sulawesi Unusual yellow flower. Only cultivated at RBGE Mendum&S.Scott Agathis australis Araucariaceae New Zealand In Temperate Lands glasshouse RBGE Archontophoenix cunninghamae Aracaceae Australia In Temperate Palm House, RBGE Argyranthemum ‘Logan Pompom’ Compositae Logan Botanic Garden?? Beaucarnea recurvate Asparagaceae Eastern Mexico In RBGE Arid House. ‘Ponytail Palm’ Begonia mendumae M.Hughes Begoniaceae Sulawesi Named after former RBGE Botanist and Botanical artist Dr.Mary Mendum Begonia stevei M.Hughes Begoniaceae Sulawesi Named After Steve Scott former RBGE Horticulturist?? Betula utilis D.Don var.
    [Show full text]
  • Seedling Ecology and Evolution
    P1: SFK 9780521873053pre CUUK205/Leck et al. 978 0 521 87305 5 June 26,2008 16:55 Seedling Ecology and Evolution Editors Mary Allessio Leck Emeritus Professor of Biology,Rider University,USA V. Thomas Parker Professor of Biology,San Francisco State University,USA Robert L. Simpson Professor of Biology and Environmental Science,University of Michigan -- Dearborn,USA iii P1: SFK 9780521873053pre CUUK205/Leck et al. 978 0 521 87305 5 June 26,2008 16:55 CAMBRIDGE UNIVERSITY PRESS Cambridge, New York, Melbourne, Madrid, Cape Town, Singapore, S˜ao Paulo, Delhi Cambridge University Press The Edinburgh Building, Cambridge CB2 8RU, UK Published in the United States of America by Cambridge University Press, New York www.cambridge.org Information on this title: www.cambridge.org/9780521873055 c Cambridge University Press 2008 This publication is in copyright. Subject to statutory exception and to the provisions of relevant collective licensing agreements, no reproduction of any part may take place without the written permission of Cambridge University Press. First published 2008 Printed in the United Kingdom at the University Press, Cambridge A catalog record for this publication is available from the British Library Library of Congress Cataloging in Publication data ISBN 978-0-521-87305-5 hardback ISBN 978-0-521-69466-7 paperback Cambridge University Press has no responsibility for the persistence or accuracy of URLs for external or third-party Internet Web sites referred to in this publication, and does not guarantee that any content on such Web sites is, or will remain, accurate or appropriate. iv P1: SFK 9780521873053c04 CUUK205/Leck et al.
    [Show full text]
  • Virus-Induced Gene Silencing in Streptocarpus Rexii
    Edinburgh Research Explorer Virus-induced gene silencing in Streptocarpus rexii (Gesneriaceae) Citation for published version: Nishii, K, Fei, Y, Hudson, A, Möller, M & Molnar, A 2020, 'Virus-induced gene silencing in Streptocarpus rexii (Gesneriaceae)', Molecular Biotechnology. https://doi.org/10.1007/s12033-020-00248-w Digital Object Identifier (DOI): 10.1007/s12033-020-00248-w Link: Link to publication record in Edinburgh Research Explorer Document Version: Peer reviewed version Published In: Molecular Biotechnology Publisher Rights Statement: This is a post-peer-review, pre-copyedit version of an article published in Molecular Biotechnology. The final authenticated version is available online at: http://dx.doi.org/10.1007/s12033-020-00248-w General rights Copyright for the publications made accessible via the Edinburgh Research Explorer is retained by the author(s) and / or other copyright owners and it is a condition of accessing these publications that users recognise and abide by the legal requirements associated with these rights. Take down policy The University of Edinburgh has made every reasonable effort to ensure that Edinburgh Research Explorer content complies with UK legislation. If you believe that the public display of this file breaches copyright please contact [email protected] providing details, and we will remove access to the work immediately and investigate your claim. Download date: 08. Oct. 2021 1 Title 2 Virus-induced gene silencing in Streptocarpus rexii (Gesneriaceae) 3 4 Authors 5 Kanae Nishii1,2 (ORCID: 0000-0001-8141-8908) 6 Yue Fei3 7 Andrew Hudson3 8 Michael Möller1 (ORCID: 0000-0002-2819-0323) 9 Attila Molnar3 (ORCID: 0000-0002-1044-6327) 10 11 12 Kanae Nishii and Yue Fei have contributed equally to this work.
    [Show full text]
  • Gesneriaceae) ⁎ ⁎ K
    Available online at www.sciencedirect.com South African Journal of Botany 81 (2012) 50–60 www.elsevier.com/locate/sajb Light as environmental regulator for germination and macrocotyledon development in Streptocarpus rexii (Gesneriaceae) ⁎ ⁎ K. Nishii a,b, , T. Nagata c, C.-N. Wang b, M. Möller a, a Royal Botanic Garden Edinburgh, 20A Inverleith Row, Edinburgh EH3 5LR, Scotland, United Kingdom b Institute of Ecology and Evolutionary Biology, Department of Life Science, National Taiwan University, Room 1207, Life Science Building, No. 1, Sec.4, Roosevelt Road, Taipei 10617, Taiwan c Faculty of Bioscience and Applied Chemistry, Hosei University, 3-7-2 Kajino-cho, Koganei-shi, Tokyo 184‐8584, Japan Received 25 January 2012; received in revised form 17 May 2012; accepted 18 May 2012 Available online xxxx Abstract The light requirements for seed germination and seedling development have not been studied widely in Gesneriaceae. Here we report on the effects of light on these aspects in Streptocarpus rexii (Gesneriaceae). Seeds did not germinate in the dark but required light, indicating photoblastic seed germination. Light exposure was also required for the establishment of post-germination anisocotylous development, with the seedlings showing the typical basal meristem in the proximal region of the macrocotyledon. In the dark, however, the basal meristem was not established and the seedlings showed two equally sized microcotyledons. Hypocotyl elongation, a typical skotomorphogenesis, was also observed in the dark. Different wavelengths of light, in the red and blue spectrum, differentially affected seedling development. While seedlings exposed to blue light showed typical anisocotyly, seedlings under red light did not and basal meristem activity was not observed.
    [Show full text]
  • Functional Integration of Floral Plant Traits: Shape and Symmetry, Optical Signal, Reward and Reproduction in the Angiosperm Flower
    Functional Integration of Floral Plant Traits: Shape and Symmetry, Optical Signal, Reward and Reproduction in the Angiosperm Flower Dissertation zur Erlangung des Doktorgrades (Dr. rer. nat.) der Mathematisch-Naturwissenschaftlichen Fakultät der Rheinischen Friedrich-Wilhelms-Universität Bonn vorgelegt von Andreas Wilhelm Mues aus Kirchhellen Bonn, den 20. Januar 2020 1 2 Angefertigt mit Genehmigung der Mathematisch-Naturwissenschaftlichen Fakultät der Rheinischen Friedrich-Wilhelms-Universität Bonn Erstgutachter: Prof. Dr. Maximilian Weigend, Universität Bonn Zweitgutachter: Prof. Dr. Eberhard Fischer, Universität Koblenz Tag der Promotion: 30. April 2020 Erscheinungsjahr: 2020 3 4 Acknowledgements I thank Prof. Dr. Maximilian Weigend, supervisor, for his guidance and support, and for giving me the opportunity to study the holistic subject of floral functional integration and plant-animal interaction. I am grateful for the experience and for the research agendas he entrusted to me: Working with the extensive Living Collections of Bonn Botanical Gardens was an honour, and I have learned a lot. I thank Prof. Dr. Eberhard Fisher, for agreeing to be my second supervisor, his advice and our shared passion for the plant world. I would like to thank many people of the Nees Institute and Bonn Botanical Gardens who contributed to this work and who gave me good memories of my years of study: I thank Lisabeth Hoff, Tianjun Liu, Luisa Sophie Nicolin and Simon Brauwers for their contribution in collecting shares of the raw data together with me, and for being eager students – especially counting pollen and ovule numbers and measuring nectar reward was a test of patience sometimes, and we have counted and measured a lot … Thank you! Special thanks go to Gardeners of the Bonn Botanical Gardens, for their constant support throughout the years, their love for the plant world in general and their commitment and care for the Living Collection: Klaus Mahlberg (Streptocarpus), Birgit Emde (carnivorous plants), Klaus Bahr (Geraniales), Bernd Reinken and Klaus Michael Neumann.
    [Show full text]
  • Agalmyla Parasitica
    GESNE RIADS The Journal for Gesneriad Growers Vol. 61, No. 1 First Quarter 2 011 Agalmyla clarkei The Gesneriad Society, Inc. A non-profit membership corporation chartered by the State of Missouri HONORARY OFFICERS Founder — Elvin McDonald Co-Editor of THE GLOXINIAN — Peggie Schulz (1951–1961) Past Presid ents — Mrs. H. E. Dillard (1954–56); Mr. F. W. Mitchell (1956–58); Bruce A. Thompson (1958–62); William H. Hull (1962–65); Charles Marvinny (1965–68); Dr. Thomas E. Talpey (1968–69); Alice Courage (1969–72); Ann Spencer (1972–75); Martin Tanner (1975–77); Emma Lahr (1977–79); Laura Progebin (1979–81); David Masterson (1981–83); Patricia Van Deventer (1983–85); Michael A. Riley (1985–89); Jessie Crisafulli (198 9–93); Lee Linett (1993–97); Jon Dixon (1997–2001), Susan Grose (2001–2005); Carol Ann Bonner (2005–2007) OFFICERS President (Term 2009-11) — Peter Shalit, 1122 East Pike St., PMB 637, Seattle, WA 98122-3916 <[email protected]> First V-P (Term 2010-12) — Paul Susi, 117-01 Park Lane South, Apt. C1A, Kew Gardens, NY 11418 <ps1 [email protected]> Second V-P (Term 2009-11) — Julie Mavity-Hudson, 1015 Park Lane, Joelton, TN 37080 <[email protected]> Corresponding Secretary (Term 2010-12) — Kathy Spissman, 4086 Brownlee Dr., Tucker, GA 30084 <[email protected]> Recording Secretary (Term 2009-11) — Allison Brigham, 1122 8th St., Golden, CO 80401-1109 <[email protected]> Treasurer (Term 2010-12) —Becky Fontes, 1621 W. Cedar Hills Dr., Dunlap, IL 61525 <[email protected]> DIRECTORS Term 2008-2011 — Jacquie Eisenhut, Gussie Farrice, Dariane Joshlin, Stephen Maciejewski, Charlene Marietti, Julie Mavity- Hudson, Leonard Re Term 2009-2012 — Allison Brigham, Doris Brownlie, John R.
    [Show full text]
  • GLOXINIAN the Journal for Gesneriad Growers
    the GLOXINIAN The Journal for Gesneriad Growers Vol. 49, No. 3 Third Quarter 1999 Streptocarpus American Gloxinia and Gesneriad Society, Inc. A non-profit membership corporation chartered by the State of Missouri HONORARY OFFICERS Founder — Elvin McDonald Co-Editor of THE GLOXINIAN — Peggie Schulz (1951–1961) Past Presidents — Mrs. H. E. Dillard (1954–56); Mr. F. W. Mitchell (1956–58); Bruce A. Thompson (1958–62); William H. Hull (1962–65); Charles Marvinny (1965–68); Dr. Thomas E. Talpey (1968–69); Alice Courage (1969–72); Ann Spencer (1972–75); Martin Tanner (1975–77); Emma Lahr (1977–79); Laura Progebin (1979–81); David Masterson (1981–83); Patricia Van Deventer (1983–85); Michael A. Riley (1985–89); Jessie Crisafulli (1989–93); Lee Linett (1993-97) OFFICERS President — Jon Dixon, 55 Tum Suden Way, Woodside, CA 94062 <[email protected]> First Vice-President — Susan Grose, 4201 W. 99th St., Overland Park, KS 66207 <[email protected]> Second Vice-President — Arleen Dewell, #311-2366 Wall St., Vancouver, BC Can. V5L 4Y1 <[email protected]> Corresponding Secretary — Paul Kroll, 4325 Two Rod Rd., East Aurora, NY 14052-9693 <[email protected]> Recording Secretary — Peter Shalit, 1312 E. Denny Way, Seattle, WA 98122-2519 <[email protected]> Treasurer — Helen Bortvedt, 20 Beeson Rd., P.O. Box 2584, Sequim, WA 98382 <[email protected]> DIRECTORS Term 1996–1999 — Helen Bortvedt, Robert Connelly, Earl Deroche, Arleen Dewell, Suzie Larouche, Bob Nicholson, Pat Richards Term 1997–2000 — Marlene Beam, Susan Grose, Paul Kroll, Dale Martens, Nellie Sleeth, Dee Stewart, Colleen Turley Term 1998–2001 — Carol Ann Bonner, Doris Brownlie, Doris Carson, Jon Dixon, Helen Freidberg, Ben Paternoster, Peter Shalit COMMITTEE CHAIRMEN Archives — Lee Linett, 12314 Sweetbriar Pl., Waldorf, MD 20602 Awards — Colleen Turley, 6118 Windsor Dr., Fredericksburg, VA 22407 <[email protected]> Awards of Appreciation — Molly Schneider, 608 Hillwood Dr., Nashville, TN 37205-1314 Botanical Review — John Boggan, Dept.
    [Show full text]
  • A Complex Case of Simple Leaves: Indeterminate Leaves Co-Express ARP and KNOX1 Genes
    Dev Genes Evol (2010) 220:25–40 DOI 10.1007/s00427-010-0326-4 ORIGINAL ARTICLE A complex case of simple leaves: indeterminate leaves co-express ARP and KNOX1 genes Kanae Nishii & Michael Möller & Catherine Kidner & Alberto Spada & Raffaella Mantegazza & Chun-Neng Wang & Toshiyuki Nagata Received: 27 November 2009 /Accepted: 15 April 2010 /Published online: 26 May 2010 # Springer-Verlag 2010 Abstract The mutually exclusive relationship between Here, we present several datasets illustrating the co- ARP and KNOX1 genes in the shoot apical meristem and expression of ARP and KNOX1 genes in the shoot apical leaf primordia in simple leaved plants such as Arabidopsis meristem, leaf primordia, and developing leaves in plants has been well characterized. Overlapping expression with simple leaves and simple primordia. Streptocarpus domains of these genes in leaf primordia have been plants produce unequal cotyledons due to the continued described for many compound leaved plants such as activity of a basal meristem and produce foliar leaves Solanum lycopersicum and Cardamine hirsuta and are termed “phyllomorphs” from the groove meristem in the regarded as a characteristic of compound leaved plants. acaulescent species Streptocarpus rexii and leaves from a shoot apical meristem in the caulescent Streptocarpus Communicated by K. Schneitz glandulosissimus. We demonstrate that the simple leaves Electronic supplementary material The online version of this article in both species possess a greatly extended basal meriste- (doi:10.1007/s00427-010-0326-4) contains supplementary material, matic activity that persists over most of the leaf’s growth. which is available to authorized users. The area of basal meristem activity coincides with the co- K.
    [Show full text]
  • Modeling and Explaining the Distribution of Lantana Camara in South African Savanna Ecosystems
    Modeling and explaining the distribution of Lantana camara in South African savanna ecosystems by Xivutiso Glenny Maluleke 218085601 A dissertation submitted in the fulfilment for the degree of Master of Science in Environmental Sciences, in the School of Agricultural, Earth and Environmental Sciences, University of KwaZulu-Natal. Supervisor: Professor O Mutanga Co-Supervisor: Professor T Dube Pietermaritzburg, South Africa December 2019 Abstract Globally, the Invasive Alien Plant (IAPs) species pose a great threat to global biodiversity, agro-ecological systems and socio-economic development. In particular, Lantana camara (L. camara) is amongst the most notorious and problematic of all invasive plants globally. Its threats and effects are undeniably recognizable and it is ranked amongst the world’s ten worst weeds. As a result, it is one of the most documented weeds in the world. Most studies have focused mainly on detecting and mapping the spatial distribution of L. camara. Although its spatial distribution remains rudimentary, the mechanisms driving its distribution are not yet fully understood, especially in savanna rangelands. This study aimed at modelling and explaining the distribution of L. camara in South African savanna ecosystems (the Kruger National Park and Bushbuckridge communal lands). Specifically, the study sought to identify the environmental factors influencing the spatial distribution of L. camara in savanna ecosystems using the Maximum Entropy (Maxent) algorithm, coupled with remotely-sensed derivatives from Sentinel-2 satellite data. The performance of the model was assessed by using the Area Under Curve (AUC), the True Skills Statistic (TSS) and the Kappa Statistic. From the findings, the Bushbuckridge communal lands had the highest L.
    [Show full text]
  • From Shoot to Leaf: Step-Wise Shifts in Meristem and KNOX1 Activity Correlate with the Evolution of a Unifoliate Body Plan in Gesneriaceae
    Dev Genes Evol (2017) 227:41–60 DOI 10.1007/s00427-016-0568-x ORIGINAL ARTICLE From shoot to leaf: step-wise shifts in meristem and KNOX1 activity correlate with the evolution of a unifoliate body plan in Gesneriaceae Kanae Nishii1,2 & Bing-Hong Huang3 & Chun-Neng Wang4 & Michael Möller1 Received: 6 March 2016 /Accepted: 24 November 2016 /Published online: 8 December 2016 # Springer-Verlag Berlin Heidelberg 2016 Abstract Typical dicots possess equal-sized cotyledons and (Brassicales, rosids). In all examined Lamiales samples, un- leaf-bearing shoots topped withashootapicalmeristem like Arabidopsis, BM activity accompanied by STM expres- (SAM), the source of lateral organs, and where KNOX1 ho- sion was found in both cotyledons in early stages. Foliage meobox genes act as key regulators. New World Gesneriaceae leaves of Gesneriaceae and Jovellana also showed the corre- show typical cotyledons, whereas Old World Gesneriaceae lation of BM and STM expression. An extension of BM ac- show anisocotyly, the unequal post-germination growth of tivity was found following a phylogenetic trajectory towards cotyledons, and include unifoliate (one-leaf) plants. One-leaf one-leaf plants where it is active throughout the lifetime of the plants show an extremely reduced body plan: the adult above- macrocotyledon. Our results suggest that KNOX1 involve- ground photosynthetic tissue consisting of a single cotyledon, ment in early cotyledon expansion originated early on in the a macrocotyledon enlarged by the basal meristem (BM), but diversification of Lamiales and is proposed as the prerequisite lacking a SAM. To investigate the origin and evolution of the for the evolution of vegetative diversity in Gesneriaceae.
    [Show full text]