DOCSLIB.ORG

Development of Anticancer Drugs Targeting the MAP Kinase Pathway

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Development of Anticancer Drugs Targeting the MAP Kinase Pathway Oncogene (2000) 19, 6594 ± 6599 ã 2000 Macmillan Publishers Ltd All rights reserved 0950 ± 9232/00 $15.00 www.nature.com/onc Development of anticancer drugs targeting the MAP kinase pathway Judith S Sebolt-Leopold*,1 1P®zer Global Research and Development, Ann Arbor Laboratories, Ann Arbor, Michigan, MI 48105, USA Since the discovery of the role of ras oncogenes in of low molecular weight G-proteins, ERK has been the tumorigenesis, we have witnessed an explosion of best characterized and is more pertinent to aberrant research in the signal transduction area. In the quest to signaling in human cancer. For some cancers, espe- understand how Ras transmits extracellular growth cially those of hematopoietic origin, the p38 and jun signals, the MAP kinase (MAPK) pathway has emerged kinase pathways may in fact yield targets exploitable as the crucial route between membrane-bound Ras and for anticancer drug development. However, a broad the nucleus. The MAPK pathway encompasses a cascade array of solid tumors is known to express constitutive of phosphorylation events involving three key kinases, levels of phosphorylated ERK1 and ERK2. Activation namely Raf, MEK (MAP kinase kinase) and ERK of ERK is critical for a large number of Ras-induced (MAP kinase). This kinase cascade presents novel cellular responses. Included among these responses is opportunities for the development of new cancer transcriptional activation of multiple genes (Hill and therapies designed to be less toxic than conventional Treisman, 1995). The best-characterized physiological chemotherapeutic drugs. Furthermore, as a signal substrates of ERK are ternary complex factors (TCFs), transduction-based approach to cancer treatment, inhibi- which are directly phosphorylated by ERK to activate tion of any one of these targets has the potential for their transcription activation potential (Gille et al., translational pharmacodynamic evaluation of target 1992; Janknect et al., 1993; Marais et al., 1993). TCFs, suppression. The rationale for targeting the MAP kinase in association with serum response factor, is thought to pathway will be reviewed here along with a discussion of be critical for the activation of numerous mitogen- various pharmacological approaches and the promise inducible genes (Hill and Treisman, 1995). they hold for a new generation of anticancer drugs. Many molecules ultimately contribute to activation Oncogene (2000) 19, 6594 ± 6599. of the Ras-ERK pathway, including a number that are involved in protein-protein interactions. With respect Keywords: mitogen-activated protein kinase (MAPK); to pharmacological intervention, it is generally dicult extracellular signal-regulated kinase (ERK); MAP to selectively target the binding site shared by two kinase kinase (MEK); raf proteins. It is therefore not coincidental that the development of agents targeting the Ras-MAPK path- way has largely focused on the design of small Introduction molecule inhibitors of enzyme function. As will be explored in more detail below, four proteins have Many receptor tyrosine kinases and cytokine receptors in emerged as key players in the quest to intervene in this association with heterotrimeric G proteins are known to pathway: Ras, Raf, MEK (MAP kinase kinase), and activate intracellular protein serine/threonine kinases ERK. Ras is the subject of a paper that appears termed mitogen-activated protein kinases (MAPKs). Of elsewhere in this review issue and therefore will not be the various families of MAPKs, which are also referred covered further here. to as extracellular signal-regulated kinases (ERKs), the ®rst to be characterized were ERK1 and ERK2. Both of Rationale for targeting the MAP kinase pathway these ERKs are activated in response to diverse extracellular stimuli and by protooncogene-encoded Figure 1 provides a simpli®ed schematic representation proteins that induce proliferation. A cascade of of the signaling events leading to activation of the MAP phosphorylation events downstream from Ras activates kinase pathway. Initially, Ras interacts with and these kinases. Upstream regulation of the MAP kinase activates the serine/threonine protein kinase Raf1 in a pathway is complex as evidenced by the number of GTP-dependent manner (Daum et al., 1994; Stokoe et functions ful®lled by its activation. Processes impacted al., 1994). A family of Raf protein kinases has been by MAPK activation encompass the cytoplasm, nucleus, identi®ed and is comprised of A-Raf, B-Raf, and c- cytoskeleton, and the membrane. The reader is referred Raf1. It has been suggested that this family of kinases, elsewhere for comprehensive reviews on the subject of which is known to regulate proliferation, dierentia- regulation through MAPK cascades (Cobb, 1999; Lewis tion, and apoptosis, have both overlapping and unique et al, 1998; Kolch, 2000). regulatory functions (Hagemann and Rapp, 1999). For The Raf-MEK-ERK pathway represents one of the example, transfection of oncogenic H-ras led to a best characterized Ras signaling pathways. Raf and preferential activation of endogenous c-Raf1 as op- MEK have consequently emerged as key protein posed to A-Raf (Weber et al., 2000). Mutated Raf-1 is kinases to target for anticancer drug design. While constitutively active and possesses in vitro transforming there exist multiple MAP kinase families, e.g. jun potential (Stanton and Cooper, 1987). The potential for kinase and p38, which are also activated downstream Raf-1 to play a broad role in tumorigenesis is evidenced by its ability to become activated by either PKCa or the antiapoptotic protein Bcl-2 in a Ras-independent *Correspondence: JS Sebolt-Leopold manner (Kolch et al., 1993; Wang et al., 1996). Antitumor potential of Raf, MEK and MAPK inhibitors JS Sebolt-Leopold 6595 Theoretically, it could be argued that intervention in any of the kinase events in the MAPK cascade could represent a viable approach to crippling tumor growth. If so, then Raf-1, MEK, and ERK all emerge as reasonable anticancer drug targets. The advent of high volume screening of pharmaceutical libraries for small molecule inhibitors has most certainly produced reasonable drug candidates targeting all steps of this pathway. For example, a cascade assay has been reported that is capable of identifying inhibitors of cRaf1, MEK1, or ERK2 (McDonald et al, 1999). As we now turn to preclinical and clinical evaluation of these small molecule inhibitors, it is important to keep in mind that their ultimate promise or dierences may depend as much on their pharmacological attributes as on the merits of their targeted kinase. It should be noted that the identi®cation of pathway components in the Ras-MAP kinase pathway is likely Figure 1 Schematic representation of the Ras ± MAP kinase incomplete. For example, a Raf-1-interacting protein, pathway. The MAP kinase cascade contains three sequential RKIP, has recently been reported (Yeung et al., 1999). kinases: a MAP kinase kinase kinase (Raf), MAP kinase kinase This protein inhibits the phosphorylation and activation of (MEK), and MAP kinase (ERK) MEK by Raf-1 and has also been shown to co-localize with Raf-1. It has been proposed that RKIP binding to either Raf-1 or MEK dissociates Raf-MEK complexes, thereby Importantly, raf mutations have been identi®ed in a interrupting MEK activation and downstream signaling range of human tumors (Storm and Rapp, 1993). (Yeung et al., 2000). Discovered with the use of a yeast Independent of its mutation status, Raf is also activated two-hybrid system, the relevance of RKIP expression to in tumor cells containing enhanced growth factor signal transduction in tumor cells is unclear at the present signaling pathways, such as those induced by mutant time. Furthermore, until we learn whether RKIP expres- or constitutively expressed Ras or EGF receptor family sion is negatively regulated, it remains unclear how to members. Therefore, the collective evidence suggests pharmacologically elevate its expression to impair tumor that Raf-1 is a viable anticancer drug target. growth. Although highly speculative based on our current Alternatively, targeting the molecule immediately knowledge of the role of RKIP, it is conceivable that downstream from Raf, that is, the dual speci®city elevated expression of this protein could oer tumor cells a kinase MEK can also be envisioned as representing a mechanism of resistance to MAPK pathway inhibitors. rational approach to anticancer drug design. Subse- There exist a multitude of other newly discovered quent to its activation, Raf-1 phosphorylates and proteins that may provide insight into the design of activates both MEK1 and MEK2 (hereafter referred novel signal transduction-based cancer therapies that to as MEK) on two distinct serine residues (Dent et al., exploit the MAP kinase pathway. These include Sur-8, 1992; Crews et al., 1992; Her et al., 1993). Activated which is thought to act as a scaold to enhance Ras- MEK then phosphorylates ERK1 and ERK2 on both MAP kinase signaling by facilitating Ras-Raf interac- a tyrosine and a threonine residue (Anderson et al., tion (Li et al., 2000), as well as the kinase suppressor of 1990). No substrates for MEK have been identi®ed Ras (KSR). KSR is also thought to act as a scaolding other than ERK1 and ERK2 (Seger et al., 1992). This protein for the Ras-MAPK pathway (Stewart et al., tight selectivity in addition to the unique ability to 1999). Another interesting protein is MP-1, which has phosphorylate both tyrosine and threonine residues are been reported to enhance activation of the MAPK by consistent with this kinase playing a central role in binding MEK (Schaeer et al., 1998). Last but not integration of signals into the MAPK pathway. least, a novel ERK has recently been identi®ed, Constitutive activation of MEK has been shown to ERK1b, which is an alternatively spliced form of result in cellular transformation (Cowley et al., 1994; ERK1, that appears to be elevated in Ras-transformed Mansour et al., 1994). While MEK has not been cells (Yung et al., 2000).
Load more

Recommended publications
  • Plant Mitogen-Activated Protein Kinase Signaling Cascades Guillaume Tena*, Tsuneaki Asai†, Wan-Ling Chiu‡ and Jen Sheen§
    392 Plant mitogen-activated protein kinase signaling cascades Guillaume Tena*, Tsuneaki Asai†, Wan-Ling Chiu‡ and Jen Sheen§ Mitogen-activated protein kinase (MAPK) cascades have components that link sensors/receptors to target genes emerged as a universal signal transduction mechanism that and other cellular responses. connects diverse receptors/sensors to cellular and nuclear responses in eukaryotes. Recent studies in plants indicate that In the past few years, it has become apparent that mitogen- MAPK cascades are vital to fundamental physiological functions activated protein kinase (MAPK) cascades play some of the involved in hormonal responses, cell cycle regulation, abiotic most essential roles in plant signal transduction pathways stress signaling, and defense mechanisms. New findings have from cell division to cell death (Figure 1). MAPK cascades revealed the complexity and redundancy of the signaling are evolutionarily conserved signaling modules with essen- components, the antagonistic nature of distinct pathways, and tial regulatory functions in eukaryotes, including yeasts, the use of both positive and negative regulatory mechanisms. worms, flies, frogs, mammals and plants. The recent enthu- siasm for plant MAPK cascades is backed by numerous Addresses studies showing that plant MAPKs are activated by hor- Department of Molecular Biology, Massachusetts General Hospital, mones, abiotic stresses, pathogens and pathogen-derived Department of Genetics, Harvard Medical School, Wellman 11, elicitors, and are also activated at specific stages during the 50 Blossom Street, Boston, Massachusetts 02114, USA cell cycle [2]. Until recently, studies of MAPK cascades in *e-mail: [email protected] †e-mail: [email protected] plants were focused on cDNA cloning [3,4] and used a ‡e-mail: [email protected] MAPK in-gel assay, MAPK and tyrosine-phosphate anti- §e-mail: [email protected] bodies, and kinase inhibitors to connect signals to MAPKs Current Opinion in Plant Biology 2001, 4:392–400 [2].
    [Show full text]
  • Diverse Physiological Functions for Dual-Specificity MAP Kinase
    Commentary 4607 Diverse physiological functions for dual-specificity MAP kinase phosphatases Robin J. Dickinson and Stephen M. Keyse* Cancer Research UK Stress Response Laboratory, Ninewells Hospital and Medical School, University of Dundee, Dundee, DD1 9SY, UK *Author for correspondence (e-mail: [email protected]) Accepted 19 September 2006 Journal of Cell Science 119, 4607-4615 Published by The Company of Biologists 2006 doi:10.1242/jcs.03266 Summary A structurally distinct subfamily of ten dual-specificity functions in mammalian cells and tissues. However, recent (Thr/Tyr) protein phosphatases is responsible for the studies employing a range of model systems have begun to regulated dephosphorylation and inactivation of mitogen- reveal essential non-redundant roles for the MKPs in activated protein kinase (MAPK) family members in determining the outcome of MAPK signalling in a variety mammals. These MAPK phosphatases (MKPs) interact of physiological contexts. These include development, specifically with their substrates through a modular kinase- immune system function, metabolic homeostasis and the interaction motif (KIM) located within the N-terminal non- regulation of cellular stress responses. Interestingly, these catalytic domain of the protein. In addition, MAPK binding functions may reflect both restricted subcellular MKP is often accompanied by enzymatic activation of the C- activity and changes in the levels of signalling through terminal catalytic domain, thus ensuring specificity of multiple MAPK pathways. action. Despite our knowledge of the biochemical and structural basis for the catalytic mechanism of the MKPs, we know much less about their regulation and physiological Key words: MAPK, MKP, Signal transduction, Phosphorylation Introduction the activation motif is required for MAPK activity, Mitogen-activated protein kinases (MAPKs) constitute a dephosphorylation of either residue inactivates these enzymes.
    [Show full text]
  • G Protein Regulation of MAPK Networks
    Oncogene (2007) 26, 3122–3142 & 2007 Nature Publishing Group All rights reserved 0950-9232/07 $30.00 www.nature.com/onc REVIEW G Protein regulation of MAPK networks ZG Goldsmith and DN Dhanasekaran Fels Institute for Cancer Research and Molecular Biology, Temple University School of Medicine, Philadelphia, PA, USA G proteins provide signal-coupling mechanisms to hepta- the a-subunits has been used as a basis for the helical cell surface receptors and are criticallyinvolved classification of G proteins into Gs,Gi,Gq and G12 in the regulation of different mitogen-activated protein families in which the a-subunits that show more than kinase (MAPK) networks. The four classes of G proteins, 50% homology are grouped together (Simon et al., defined bythe G s,Gi,Gq and G12 families, regulate 1991). In G-protein-coupled receptor (GPCR)-mediated ERK1/2, JNK, p38MAPK, ERK5 and ERK6 modules by signaling pathways, ligand-activated receptors catalyse different mechanisms. The a- as well as bc-subunits are the exchange of the bound GDP to GTP in the a-subunit involved in the regulation of these MAPK modules in a following which the GTP-bound a-subunit disassociate context-specific manner. While the a- and bc-subunits from the receptor as well as the bg-subunit. The GTP- primarilyregulate the MAPK pathwaysvia their respec- bound a-subunit and the bg-subunit stimulate distinct tive effector-mediated signaling pathways, recent studies downstream effectors including enzymes, ion channels have unraveled several novel signaling intermediates and small GTPase, thus regulating multiple signaling including receptor tyrosine kinases and small GTPases pathways including those involved in the activation of through which these G-protein subunits positivelyas well mitogen-activated protein kinase (MAPK) modules as negativelyregulate specific MAPK modules.
    [Show full text]
  • Table S1. List of Oligonucleotide Primers Used
    Table S1. List of oligonucleotide primers used. Cla4 LF-5' GTAGGATCCGCTCTGTCAAGCCTCCGACC M629Arev CCTCCCTCCATGTACTCcgcGATGACCCAgAGCTCGTTG M629Afwd CAACGAGCTcTGGGTCATCgcgGAGTACATGGAGGGAGG LF-3' GTAGGCCATCTAGGCCGCAATCTCGTCAAGTAAAGTCG RF-5' GTAGGCCTGAGTGGCCCGAGATTGCAACGTGTAACC RF-3' GTAGGATCCCGTACGCTGCGATCGCTTGC Ukc1 LF-5' GCAATATTATGTCTACTTTGAGCG M398Arev CCGCCGGGCAAgAAtTCcgcGAGAAGGTACAGATACGc M398Afwd gCGTATCTGTACCTTCTCgcgGAaTTcTTGCCCGGCGG LF-3' GAGGCCATCTAGGCCATTTACGATGGCAGACAAAGG RF-5' GTGGCCTGAGTGGCCATTGGTTTGGGCGAATGGC RF-3' GCAATATTCGTACGTCAACAGCGCG Nrc2 LF-5' GCAATATTTCGAAAAGGGTCGTTCC M454Grev GCCACCCATGCAGTAcTCgccGCAGAGGTAGAGGTAATC M454Gfwd GATTACCTCTACCTCTGCggcGAgTACTGCATGGGTGGC LF-3' GAGGCCATCTAGGCCGACGAGTGAAGCTTTCGAGCG RF-5' GAGGCCTGAGTGGCCTAAGCATCTTGGCTTCTGC RF-3' GCAATATTCGGTCAACGCTTTTCAGATACC Ipl1 LF-5' GTCAATATTCTACTTTGTGAAGACGCTGC M629Arev GCTCCCCACGACCAGCgAATTCGATagcGAGGAAGACTCGGCCCTCATC M629Afwd GATGAGGGCCGAGTCTTCCTCgctATCGAATTcGCTGGTCGTGGGGAGC LF-3' TGAGGCCATCTAGGCCGGTGCCTTAGATTCCGTATAGC RF-5' CATGGCCTGAGTGGCCGATTCTTCTTCTGTCATCGAC RF-3' GACAATATTGCTGACCTTGTCTACTTGG Ire1 LF-5' GCAATATTAAAGCACAACTCAACGC D1014Arev CCGTAGCCAAGCACCTCGgCCGAtATcGTGAGCGAAG D1014Afwd CTTCGCTCACgATaTCGGcCGAGGTGCTTGGCTACGG LF-3' GAGGCCATCTAGGCCAACTGGGCAAAGGAGATGGA RF-5' GAGGCCTGAGTGGCCGTGCGCCTGTGTATCTCTTTG RF-3' GCAATATTGGCCATCTGAGGGCTGAC Kin28 LF-5' GACAATATTCATCTTTCACCCTTCCAAAG L94Arev TGATGAGTGCTTCTAGATTGGTGTCggcGAAcTCgAGCACCAGGTTG L94Afwd CAACCTGGTGCTcGAgTTCgccGACACCAATCTAGAAGCACTCATCA LF-3' TGAGGCCATCTAGGCCCACAGAGATCCGCTTTAATGC RF-5' CATGGCCTGAGTGGCCAGGGCTAGTACGACCTCG
    [Show full text]
  • G Protein-Coupled Receptor Signalling in Neuroendocrine Systems
    117 G PROTEIN-COUPLED RECEPTOR SIGNALLING IN NEUROENDOCRINE SYSTEMS ‘Location, location, location’: activation and targeting of MAP kinases by G protein-coupled receptors L M Luttrell Department of Medicine, Duke University Medical Center, Durham, North Carolina 27710, USA and The Geriatrics Research, Education and Clinical Center, Durham Veterans Affairs Medical Center, Durham, North Carolina 27705, USA (Requests for offprints should be addressed to L M Luttrell, N3019 The Geriatrics Research, Education and Clinical Center, Durham Veterans Affairs Medical Center, 508 Fulton Street, Durham, North Carolina 27710, USA; Email: [email protected]) Abstract A growing body of data supports the conclusion that G protein-coupled receptors can regulate cellular growth and differentiation by controlling the activity of MAP kinases. The activation of heterotrimeric G protein pools initiates a complex network of signals leading to MAP kinase activation that frequently involves cross-talk between G protein-coupled receptors and receptor tyrosine kinases or focal adhesions. The dominant mechanism of MAP kinase activation varies significantly between receptor and cell type. Moreover, the mechanism of MAP kinase activation has a substantial impact on MAP kinase function. Some signals lead to the targeting of activated MAP kinase to specific extranuclear locations, while others activate a MAP kinase pool that is free to translocate to the nucleus and contribute to a mitogenic response. Journal of Molecular Endocrinology (2003) 30, 117–126 Introduction between intracellular receptor domains and the GDP-bound G subunit of a heterotrimeric G The G protein-coupled receptors (GPCRs) make protein triggers GTP for GDP exchange on the G up the largest superfamily of cell surface receptors subunit and dissociation of the GTP-bound G in the human genome, where they are represented subunit from the G heterodimer.
    [Show full text]
  • Mitogen-Activated Protein Kinase and Its Activator Are Regulated by Hypertonic Stress in Madin-Darby Canine Kidney Cells
    Mitogen-activated protein kinase and its activator are regulated by hypertonic stress in Madin-Darby canine kidney cells. T Itoh, … , N Ueda, Y Fujiwara J Clin Invest. 1994;93(6):2387-2392. https://doi.org/10.1172/JCI117245. Research Article Madin-Darby canine kidney cells behave like the renal medulla and accumulate small organic solutes (osmolytes) in a hypertonic environment. The accumulation of osmolytes is primarily dependent on changes in gene expression of enzymes that synthesize osmolytes (sorbitol) or transporters that uptake them (myo-inositol, betaine, and taurine). The mechanism by which hypertonicity increases the transcription of these genes, however, remains unclear. Recently, it has been reported that yeast mitogen-activated protein (MAP) kinase and its activator, MAP kinase-kinase, are involved in osmosensing signal transduction and that mutants in these kinases fail to accumulate glycerol, a yeast osmolyte. No information is available in mammals regarding the role of MAP kinase in the cellular response to hypertonicity. We have examined whether MAP kinase and MAP kinase-kinase are regulated by extracellular osmolarity in Madin-Darby canine kidney cells. Both kinases were activated by hypertonic stress in a time- and osmolarity-dependent manner and reached their maximal activity within 10 min. Additionally, it was suggested that MAP kinase was activated in a protein kinase C- dependent manner. These results indicate that MAP kinase and MAP kinase-kinase(s) are regulated by extracellular osmolarity. Find the latest version:
    [Show full text]
  • M:\Printing\Categories\Signal Transduction\Mapkinaserevpdf1.Cdr
    FUNCTIONS AND MODULATION OF MAP KINASE PATHWAYS 1,25,43,46,56,57,68,71- Gray Pearson and Melanie Cobb isoforms and ERKs 5 and 7. 73,108,109,126 Department of Pharmacology, University of ERK3 was found as a cDNA library 11 Texas Southwestern Medical Center, Dallas, clone. A summary of the cellular processes these Texas 75390, USA. MAP kinases are involved in is shown in Table 1. Gray Pearson’s research focuses on studying the Upstream regulation of ERK1/2 regulation of MEK5 and ERK5 and Melanie The collaborative findings from a number of Cobb’s laboratory studies various aspects of MAP laboratories led to the connection of ERK1/2 to their kinase signaling. upstream regulators MEK1 and 2, the identification of Raf-1 as the upstream activator of these MEKs, and the observation that Raf-1 is an effector of the proto- oncogene Ras.17,67,69,101,119 The linear connection of Ras to ERK1/2 suggested a function for ERK1/2 in Background proliferation and oncogenic growth.76 This conclusion was later supported by the observation that an The transmission of extracellular signals into activated mutant of MEK1 can transform cells.85 intracellular responses is a complex process which Subsequently, through the use of dominant interfering often involves the activity of mitogen-activated protein mutants and the pharmacological inhibitors of (MAP) kinases.96 The activation of a MAP kinase MEK1/2, these ubiquitous kinases have been shown involves a three kinase cascade consisting of a MAP to be intimately involved in processes including kinase kinase (MAPKKK or MEKK) which activates a embryogenesis, cell differentiation, glucose sensing MAP/ERK kinase (MAPKK or MEK), which then and synaptic plasticity.32,40,63,98 stimulates a phosphorylation-dependent increase in the activity of the MAP kinase.
    [Show full text]
  • Novel Regulation of Mtor Complex 1 Signaling by Site-Specific Mtor Phosphorylation
    Novel Regulation of mTOR Complex 1 Signaling by Site-Specific mTOR Phosphorylation by Bilgen Ekim Üstünel A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy (Cell and Developmental Biology) in The University of Michigan 2012 Doctoral Committee: Assistant Professor Diane C. Fingar, Chair Associate Professor Billy Tsai Associate Professor Anne B. Vojtek Assistant Professor Patrick J. Hu Assistant Professor Ken Inoki “Our true mentor in life is science.” (“Hayatta en hakiki mürşit ilimdir.”) Mustafa Kemal Atatürk, the founder of Turkish Republic © Bilgen Ekim Üstünel 2012 Acknowledgements This thesis would not have been possible without the enormous support and encouragement of my Ph.D. advisor Diane C. Fingar. I am sincerely thankful for her research insight and guidance during my Ph.D. training. I would like to express my great appreciation to Billy Tsai, Anne B. Vojtek, Ken Inoki, and Patrick J. Hu for serving on my thesis committee, whose advice and help have been valuable. I would like to thank all members of the Fingar, Tsai, and Verhey labs for the discussion in our group meetings. I also would like to thank the CDB administrative staff, especillay Kristen Hug, for their help. I thank Ed Feener for performing the liquid chromatography tandem mass spectrometry analysis to identify novel phosphorylation sites on mTOR and Steve Riddle for performing the in vitro kinome screen to identify candidate kinases for mTOR S2159 phosphorylation site. I thank Brian Magnuson, Hugo A. Acosta-Jaquez, and Jennifer A. Keller for contributing to my first-author paper published in Molecular and Cellular Biology Journal in 2011.
    [Show full text]
  • Regulation of Mitogen-Activated Protein Kinases by a Calcium/Calmodulin-Dependent Protein Kinase Cascade HERVEI ENSLEN*, HIROSHI TOKUMITSU*, PHILIP J
    Proc. Natl. Acad. Sci. USA Vol. 93, pp. 10803-10808, October 1996 Cell Biology Regulation of mitogen-activated protein kinases by a calcium/calmodulin-dependent protein kinase cascade HERVEI ENSLEN*, HIROSHI TOKUMITSU*, PHILIP J. S. STORK*, ROGER J. DAVISt, AND THoMAS R. SODERLING*t *Vollum Institute, Oregon Health Sciences University, 3181 Southwest Sam Jackson Park Road, Portland, OR 97201; and tProgram in Molecular Medicine and Howard Hughes Medical Institute, University of Massachusetts Medical School, Worcester, MA 01605 Communicated by Edwin G. Krebs, University of Washington, Seattle, WA, July 17, 1996 (received for review March 23, 1996) ABSTRACT Membrane depolarization of NG108 cells terminal kinase (JNK; ref. 13) cascade (3-5). The JNK family gives rapid (<5 min) activation of Ca2+/calmodulin- generally promotes cell growth inhibition (14-17) and apo- dependent protein kinase IV (CaM-KIV), as well as activation ptosis (18) in response to stress signals. Thus, while it is clear of c-Jun N-terminal kinase (JNK). To investigate whether the that Ca2+ can modulate the MAP kinase pathways, the de- Ca2+-dependent activation of mitogen-activated protein ki- tailed mechanisms are not established. nases (ERK, JNK, and p38) might be mediated by the CaM One of the most common mechanisms by which elevated kinase cascade, we have transfected PC12 cells, which lack intracellular Ca2+ regulates cellular events is through its CaM-KIV, with constitutively active mutants of CaM kinase association with calmodulin (CaM). The Ca2+/CaM complex kinase and/or CaM-KIV (CaM-KK, and CaM-KIVc, respec- binds to and modulates the functions of multiple key regula- tively).
    [Show full text]
  • A Dissertation Entitled the Regulatory Role of Mixed Lineage Kinase 4
    A Dissertation entitled The Regulatory Role of Mixed Lineage Kinase 4 Beta in MAPK Signaling and Ovarian Cancer Cell Invasion by Widian F. Abi Saab Submitted to the Graduate Faculty as partial fulfillment of the requirements for the Doctor of Philosophy Degree in Biology _________________________________________ Dr. Deborah Chadee, Committee Chair _________________________________________ Dr. Douglas Leaman, Committee Member _________________________________________ Dr. Fan Dong, Committee Member _________________________________________ Dr. John Bellizzi, Committee Member _________________________________________ Dr. Max Funk, Committee Member _________________________________________ Dr. Robert Steven, Committee Member _________________________________________ Dr. William Taylor, Committee Member _________________________________________ Dr. Patricia R. Komuniecki, Dean College of Graduate Studies The University of Toledo May 2013 Copyright 2013, Widian Fouad Abi Saab This document is copyrighted material. Under copyright law, no parts of this document may be reproduced without the expressed permission of the author. An Abstract of The Regulatory Role of Mixed Lineage Kinase 4 Beta in MAPK Signaling and Ovarian Cancer Cell Invasion by Widian F. Abi Saab Submitted to the Graduate Faculty as partial fulfillment of the requirements for the Doctor of Philosophy Degree in Biology The University of Toledo May 2013 Mixed lineage kinase 4 (MLK4) is a member of the MLK family of mitogen- activated protein kinase kinase kinases (MAP3Ks). As components of a three-tiered signaling cascade, MAP3Ks promote activation of mitogen-activated protein kinase (MAPK), which in turn regulates different cellular processes including proliferation and invasion. Here, we show that the beta form of MLK4 (MLK4β), unlike its close relative, MLK3, and other known MAP3Ks, negatively regulates the activities of the MAPKs, p38, ERK and JNK, even in response to stimuli such as sorbitol or TNFα.
    [Show full text]
  • INDUCTION of RIBOTOXIC STRESS RESPONSE by MYCOTOXIN DEOXYNIVALENOL: a PROTEOMIC VIEW by Xiao Pan a DISSERTATION Submitted To
    INDUCTION OF RIBOTOXIC STRESS RESPONSE BY MYCOTOXIN DEOXYNIVALENOL: A PROTEOMIC VIEW By Xiao Pan A DISSERTATION Submitted to Michigan State University in partial fulfillment of the requirements for the degree of Biochemistry and Molecular Biology - Environmental Toxicology – Doctor of Philosophy 2013 ABSTRACT INDUCTION OF RIBOTOXIC STRESS RESPONSE BY MYCOTOXIN DEOXYNIVALENOL: A PROTEOMIC VIEW By Xiao Pan The trichothecene mycotoxin deoxynivalenol (DON) is a common food contaminant that is of public health significance (Pestka, 2010) because it is a translational inhibitor that targets the innate immune system. DON-induced proinflammatory gene expression and apoptosis in the lymphoid tissue have been associated with a ribotoxic stress response (RSR) that involves rapid phosphorylation of mitogen-activated protein kinases (MAPKs). While it is recognized that DON-induced RSR involves protein phosphorylation and that DON targets the ribosome, a comprehensive assessment of how these events contribute to signaling, modulation of ribosome function and regulation of key biological processes is lacking. To encapture global signaling events mediating DON-induced RSR and immunotoxicity, we employed quantitative proteomics to evaluate the dynamics of protein phosphorylation during early (≤30 min) DON-induced RSR in RAW 264.7 murine macrophage treated with a toxicologically relevant concentration of DON (250 ng/mL) and in the spleens of mice orally exposed to 5 mg/kg body weight DON. Large-scale phosphoproteomic analysis employing stable isotope labeling of amino acids in cell culture (SILAC) for RAW 264.7 or stable isotope dimethyl labeling for mouse spleen, in conjunction with titanium dioxide chromatography revealed that DON-induced RSR involves extensive phosphorylation alterations. In RAW 264.7, transcriptional regulation was the main target during early DON-induced RSR involving transcription factors/cofactors and epigenetic modulators.
    [Show full text]
  • 1 Molecular Pathways Targeting the BMK1 MAP Kinase Pathway in Cancer Therapy Qingkai Yang and Jiing-Dwan Lee Running Title: BMK1
    Author Manuscript Published OnlineFirst on March 8, 2011; DOI: 10.1158/1078-0432.CCR-10-2504 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Molecular Pathways Targeting the BMK1 MAP Kinase Pathway in Cancer Therapy Qingkai Yang and Jiing-Dwan Lee Running Title: BMK1 as Cancer Drug Target Author Affiliation: Department of Immunology and Microbial Science, The Scripps Research Institute, La Jolla Corresponding Author: Jiing-Dwan Lee, Department of Immunology and Microbial Science, The Scripps Research Institute, 10550 North Torrey Pines Road, La Jolla, CA 92037, USA. Phone: 858-784-8703; Fax: 858-784-8343; E- mail: [email protected] 1 Downloaded from clincancerres.aacrjournals.org on October 1, 2021. © 2011 American Association for Cancer Research. Author Manuscript Published OnlineFirst on March 8, 2011; DOI: 10.1158/1078-0432.CCR-10-2504 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Abstract The big mitogen-activated protein kinase 1 (BMK1) pathway is the most recently discovered and least-studied mammalian mitogen-activated protein (MAP) kinase cascade, ubiquitously expressed in all types of cancer cells tested so far. Mitogens and oncogenic signals strongly activate this cellular MAP kinase pathway, thereby passing down proliferative, survival, chemo-resistance, invasive and angiogenic signals in tumor cells. Recently, several pharmacological small molecule inhibitors of this pathway have been developed. Among them, BMK1 inhibitor, XMD8-92, blocks cellular BMK1 activation and significantly suppresses tumor growth in lung and cervical tumor models and is well tolerated in animals. On the other hand, MEK5 inhibitors, BIX02188, BIX02189 and compound 6, suppress cellular MEK5 activity but no data yet on their effectiveness in animal.
    [Show full text]