DOCSLIB.ORG

Mitogen-Activated Protein Kinase Cascades in Plants

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Mitogen-Activated Protein Kinase Cascades in Plants Opinion TRENDS in Plant Science Vol.7 No.7 July 2002 301 18 Blazquez, M.A. and Weigel, D. (2000) Integration substrate change and catalytic simplification. of genomes. Proc. Natl. Acad. Sci. U. S. A. of floral inductive signals in Arabidopsis. Proc. Natl. Acad. Sci. U. S. A. 93, 9033–9038 99, 1405–1409 Nature 404, 889–892 27 Nowak, M.A. et al. (1997) Evolution of genetic 36 Shu, G. et al. (2000) LEAFY and the evolution of 19 Blazquez, M.A. et al. (1997) LEAFY expression redundancy. Nature 388, 167–171 rosette flowering in violet cress (Jonopsidium and flower initiation in Arabidopsis. Development 28 Lynch, M. et al. (2001) The probability of acaule, Brassicaceae). Am. J. Bot. 87, 634–641 124, 3835–3844 preservation of a newly arisen gene duplicate. 37 Ahearn, K.P. et al. (2001) NFL1, a Nicotiana 20 Parcy, F. et al. (1998) A genetic framework for Genetics 159, 1789–1804 tabacum LEAFY-like gene, controls meristem floral patterning. Nature 395, 561–566 29 Wagner, G.P. and Altenberg, L. (1996) Complex initiation and floral structure. Plant Cell Physiol. 21 Lohmann, J.U. et al. (2001) A molecular link adaptations and the evolution of evolvability. 42, 1130–1139 between stem cell regulation and floral patterning Evolution 50, 967–976 38 Gourlay, C.W. et al. (2000) Pea compound leaf in Arabidopsis. Cell 105, 793–803 30 Coen, E.S. and Meyerowitz, E.M. (1991) The war architecture is regulated by interactions among 22 Weigel, D. et al. (1992) LEAFY controls of the whorls: genetic interactions controlling the genes UNIFOLIATA, COCHLEATA, AFILA, floral meristem identity in Arabidopsis. flower development. Nature 353, 31–37 and TENDRIL-LESS. Plant Cell 12, 1279–1294 Cell 69, 843–859 31 Albert, V.A. et al. (1998) Ontogenetic systematics, 39 Kyozuka, J. et al. (1998) Down-regulation of RFL, 23 Himi, S. et al. (2001) Evolution of MADS-box gene molecular developmental genetics, and the the FLO/LFY homolog of rice, accompanied with induction by FLO/LFY genes. J. Mol. Evol. angiosperm petal. In Molecular Systematics of panicle branch initiation. Proc. Natl. Acad. Sci. 53, 387–393 Plants II: DNA Sequencing (Soltis, D.E. et al., U. S. A. 95, 1979–1982 24 Mouradov, A. et al. (1998) NEEDLY, a Pinus eds), pp. 349–374, Kluwer Academic Publishers 40 Gocal, G.F.W. et al. (2001) Evolution of floral radiata ortholog of FLORICAULA/LEAFY genes, 32 Endress, P.K. (1996) Structure and function of meristem identity genes. Analysis of Lolium expressed in both reproductive and vegetative female and bisexual organ complexes in Gnetales. temulentum genes related to APETALA1 and meristems. Proc. Natl. Acad. Sci. U. S. A. Int. J. Plant Sci. 157, S113–S125 LEAFY of Arabidopsis. Plant Physiol. 95, 6537–6542 33 Norstog, K.J. and Nicholls, T.J. (1997) The Biology 125, 1788–1801 25 Mellerowicz, E.J. et al. (1998) PRFLL – a Pinus of the Cycads, Cornell University Press 41 Soltis, D.E. et al. (2001) Missing links: the genetic radiata homologue of FLORICAULA and LEAFY 34 Shindo, S. et al. (2001) Characterization of a architecture of flowers and floral diversification. is expressed in buds containing vegetative shoot FLORICAULA/LEAFY homologue of Trends Plant Sci. 7, 22–31 and undifferentiated male cone primordia. Planta Gnetum parvifolium and its implications for the 42 Nixon, K.C. (1999) Winclada (BETA) ver. 0.9.9, 206, 619–629 evolution of reproductive organs in seed plants. Published by the author, Ithaca, New York 26 Helariutta, Y. et al. (1996) Duplication and Int. J. Plant. Sci. 162, 1199–1209 43 Krakauer, D.C. and Nowak, M.A. (1999) functional divergence in the chalcone synthase 35 Krakauer, D.C. and Plotkin, J.B. (2002) Evolutionary preservation of redundant duplicated gene family of Asteraceae: evolution with Redundancy, antiredundancy, and the robustness genes. Semin. Cell Dev. Biol. 10, 555–559 cascades mediate the intracellular transmission Mitogen-activated and amplification of extracellular stimuli, resulting in the induction of appropriate biochemical and physiological cellular responses [1–4]. MAPKs form protein kinase the terminal components of the prototypical sequential cascades, and are activated by MAPK kinases (MAPKKs or MEKs) via dual phosphorylation of cascades in plants: conserved threonine and tyrosine residues in the motif TxY located in the activation loop (T-loop) between kinase subdomains VII and VIII. MAPKKs a new nomenclature are themselves activated by MAPKK kinases (MAPKKKs or MEKKs) through phosphorylation of conserved serine and/or threonine residues in their MAPK Group (Kazuya Ichimura et al.) T-loop [1–4]. In plants, MAPK cascades are associated with various physiological, developmental and hormonal Mitogen-activated protein kinase (MAPK) cascades are universal signal responses. Molecular and biochemical studies using transduction modules in eukaryotes, including yeasts, animals and plants. specific antibodies to particular MAPKs have These protein phosphorylation cascades link extracellular stimuli to a wide revealed that MAPK activation correlates with range of cellular responses. In plants, MAPK cascades are involved in stimulatory treatments such as pathogen infection, responses to various biotic and abiotic stresses, hormones, cell division and wounding, low temperature, drought, hyper- and developmental processes. Completion of the Arabidopsis genome-sequencing hypo-osmolarity, high salinity, touch, and reactive project has revealed the existence of 20 MAPKs, 10 MAPK kinases and 60 MAPK oxygen species [5–8]. Genetic studies of the Arabidopsis kinase kinases. Here, we propose a simplified nomenclature for Arabidopsis mutants constitutive triple response 1 (ctr1) and MAPKs and MAPK kinases that might also serve as a basis for standard enhanced disease resistance 1 (edr1), which exhibit annotation of these gene families in all plants. altered responses to ethylene and pathogens, respectively, show that their wild-type alleles encode Published online: 13 June 2002 MAPKKKs related to the RAF protein kinase [9,10]. Reverse genetic analysis of the Arabidopsis mpk4 Mitogen-activated protein kinase (MAPK; see Glossary) knockout mutant revealed its importance in regulating cascades are universal modules of signal transduction systemic acquired resistance, including the ability to in eukaryotes. These protein phosphorylation accumulate salicylic acid [11]. A gain-of-function study http://plants.trends.com 1360-1385/02/$ – see front matter © 2002 Elsevier Science Ltd. All rights reserved. PII: S1360-1385(02)02302-6 302 Opinion TRENDS in Plant Science Vol.7 No.7 July 2002 Glossary ANP MEK Ran Arabidopsis NPK1 homolog MAPK/ERK kinase; another name ras-related nuclear protein AtMRK1 for a MAPKK SAMK Arabidopsis thaliana MLK/Raf-related MEKK Stress-activated MAPK protein kinase 1 MAPK/ERK kinase kinase; another name for SIMK BWMK1 a MAPKKK Salt-stress-inducible MAPK Kazuya Ichimura Blast- and wound-induced MAP kinase 1 MHK SIMKK Kazuo Shinozaki* Bck1 Mak-homologous kinase SIMK kinase RIKEN Tsukuba Institute, Bypass of C kinase 1 MKK SIPK Japan. CD domain Another name for a MAPKK Salicylic-acid-induced protein kinase *e-mail: sinozaki@ Common docking domain MMK Ste11 rtc.riken.go.jp JNK Medicago MAPK Sterile 11 c-Jun amino(NH )-terminal kinase Guillaume Tena 2 MPK TDY LRR Jen Sheen Mitogen-activated protein kinase Putative activation motif in MAPK Leucine-rich repeat Harvard Medical School, NB-ARC gene TDY1 MA, USA. MAP3K Mitogen-activated protein kinase Nucleotide-binding adaptor shared by TIR domain Yves Henry kinase kinase APAF-1, certain R-gene products Toll- and interleukin-1-receptor domain Anthony Champion MAPK and CED-4 WIPK Martin Kreis Mitogen-activated protein kinase NPK1 Wound-induced protein kinase Institut de Biotechnologie MAPKK Nucleus- and phragmoplast-localized WRKY des Plantes, Orsay, Mitogen-activated protein kinase kinase protein kinase (renamed from Nicotiana Zinc-finger-type transcription factor France. MAPKKK protein kinase 1) WRKY domain Mitogen-activated protein kinase RAF 60-amino-acid motif that binds to the Shuqun Zhang University of Missouri – kinase kinase Transforming gene W-box domain Columbia, MO, USA. Heribert Hirt showed that ectopic expression of a constitutively RAF-like MAPKKKs have been investigated Cathal Wilson Erwin Heberle-Bors active mutant form of tobacco (Nicotiana tabacum) biochemically. Within the proposed plant MPK and Vienna Biocenter, Austria. NtMEK2 induced the activation of downstream MKK nomenclature, we respect the established rules Brian E. Ellis MAPK, the expression of defense genes and for plant gene naming and numbering, both for University of British hypersensitive-response-like cell death [12]. Recently, consistency and to avoid implying possible functions Columbia, Vancouver, an Arabidopsis MAPK cascade (MEKK1–MKK4-5–MPK6) for specific MPKs and MKKs. In keeping with the Canada. and WRKY transcription factors were shown to be TAIR suggestions for naming Arabidopsis genes Peter C. Morris involved in innate immunity and function downstream (http://www.arabidopsis.org/info/guidelines.html), Heriot–Watt University, of the flagellin receptor FLS2 [13]. we have also not incorporated an ‘At’ prefix into the Edinburgh, UK. In this article, we describe the complete sets formal gene name in this species. Although this is Roger W. Innes of Arabidopsis MAPKs and MAPKKs, and a appropriate within Arabidopsis, we also recognize Indiana University, IN, USA. proposed set of MAPKKKs, and analyze them the informational value of a taxonomic prefix for by phylogenetic methods, together with other situations
Load more

Recommended publications
  • 291533611.Pdf
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Publications of the IAS Fellows Genome-wide identification, classification, evolutionary expansion and expression analyses of homeobox genes in rice Mukesh Jain, Akhilesh K. Tyagi and Jitendra P. Khurana Interdisciplinary Centre for Plant Genomics and Department of Plant Molecular Biology, University of Delhi South Campus, India Keywords Homeobox genes play a critical role in regulating various aspects of plant abiotic stress; homeobox genes; microarray growth and development. In the present study, we identified a total of 107 analysis; reproductive development; rice homeobox genes in the rice genome and grouped them into ten distinct (Oryza sativa) subfamilies based upon their domain composition and phylogenetic analy- Correspondence sis. A significantly large number of homeobox genes are located in the J. P. Khurana, Department of Plant duplicated segments of the rice genome, which suggests that the expansion Molecular Biology, University of Delhi South of homeobox gene family, in large part, might have occurred due to Campus, Benito Juarez Road, New Delhi segmental duplications in rice. Furthermore, microarray analysis was 110021, India performed to elucidate the expression profiles of these genes in different Fax: +91 011 24115270 tissues and during various stages of vegetative and reproductive develop- Tel: +91 011 24115126 ment. Several genes with predominant expression during various stages of E-mail: [email protected] panicle and seed development were identified. At least 37 homeobox genes (Received 6 November 2007, revised 3 were found to be differentially expressed significantly (more than two-fold; March 2008, accepted 31 March 2008) P < 0.05) under various abiotic stress conditions.
    [Show full text]
  • Supplemental Table S1
    Entrez Gene Symbol Gene Name Affymetrix EST Glomchip SAGE Stanford Literature HPA confirmed Gene ID Profiling profiling Profiling Profiling array profiling confirmed 1 2 A2M alpha-2-macroglobulin 0 0 0 1 0 2 10347 ABCA7 ATP-binding cassette, sub-family A (ABC1), member 7 1 0 0 0 0 3 10350 ABCA9 ATP-binding cassette, sub-family A (ABC1), member 9 1 0 0 0 0 4 10057 ABCC5 ATP-binding cassette, sub-family C (CFTR/MRP), member 5 1 0 0 0 0 5 10060 ABCC9 ATP-binding cassette, sub-family C (CFTR/MRP), member 9 1 0 0 0 0 6 79575 ABHD8 abhydrolase domain containing 8 1 0 0 0 0 7 51225 ABI3 ABI gene family, member 3 1 0 1 0 0 8 29 ABR active BCR-related gene 1 0 0 0 0 9 25841 ABTB2 ankyrin repeat and BTB (POZ) domain containing 2 1 0 1 0 0 10 30 ACAA1 acetyl-Coenzyme A acyltransferase 1 (peroxisomal 3-oxoacyl-Coenzyme A thiol 0 1 0 0 0 11 43 ACHE acetylcholinesterase (Yt blood group) 1 0 0 0 0 12 58 ACTA1 actin, alpha 1, skeletal muscle 0 1 0 0 0 13 60 ACTB actin, beta 01000 1 14 71 ACTG1 actin, gamma 1 0 1 0 0 0 15 81 ACTN4 actinin, alpha 4 0 0 1 1 1 10700177 16 10096 ACTR3 ARP3 actin-related protein 3 homolog (yeast) 0 1 0 0 0 17 94 ACVRL1 activin A receptor type II-like 1 1 0 1 0 0 18 8038 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 1 0 0 0 0 19 8751 ADAM15 ADAM metallopeptidase domain 15 (metargidin) 1 0 0 0 0 20 8728 ADAM19 ADAM metallopeptidase domain 19 (meltrin beta) 1 0 0 0 0 21 81792 ADAMTS12 ADAM metallopeptidase with thrombospondin type 1 motif, 12 1 0 0 0 0 22 9507 ADAMTS4 ADAM metallopeptidase with thrombospondin type 1
    [Show full text]
  • Galectin-4 Interaction with CD14 Triggers the Differentiation of Monocytes Into Macrophage-Like Cells Via the MAPK Signaling Pathway
    Immune Netw. 2019 Jun;19(3):e17 https://doi.org/10.4110/in.2019.19.e17 pISSN 1598-2629·eISSN 2092-6685 Original Article Galectin-4 Interaction with CD14 Triggers the Differentiation of Monocytes into Macrophage-like Cells via the MAPK Signaling Pathway So-Hee Hong 1,2,3,4,5, Jun-Seop Shin 1,2,3,5, Hyunwoo Chung 1,2,4,5, Chung-Gyu Park 1,2,3,4,5,* 1Xenotransplantation Research Center, Seoul National University College of Medicine, Seoul 03080, Korea 2Institute of Endemic Diseases, Seoul National University College of Medicine, Seoul 03080, Korea 3Cancer Research Institute, Seoul National University College of Medicine, Seoul 03080, Korea 4Department of Biomedical Sciences, Seoul National University College of Medicine, Seoul 03080, Korea 5Department of Microbiology and Immunology, Seoul National University College of Medicine, Seoul 03080, Korea Received: Jan 28, 2019 ABSTRACT Revised: May 13, 2019 Accepted: May 19, 2019 Galectin-4 (Gal-4) is a β-galactoside-binding protein mostly expressed in the gastrointestinal *Correspondence to tract of animals. Although intensive functional studies have been done for other galectin Chung-Gyu Park isoforms, the immunoregulatory function of Gal-4 still remains ambiguous. Here, we Department of Microbiology and Immunology, Seoul National University College of Medicine, demonstrated that Gal-4 could bind to CD14 on monocytes and induce their differentiation 103 Daehak-ro, Jongno-gu, Seoul 03080, into macrophage-like cells through the MAPK signaling pathway. Gal-4 induced the phenotypic Korea. changes on monocytes by altering the expression of various surface molecules, and induced E-mail: [email protected] functional changes such as increased cytokine production and matrix metalloproteinase expression and reduced phagocytic capacity.
    [Show full text]
  • Targeting the Mitogen-Activated Protein Kinase Pathway: Physiological Feedback and Drug Response
    Published OnlineFirst May 14, 2010; DOI: 10.1158/1078-0432.CCR-09-3064 Molecular Pathways Clinical Cancer Research Targeting the Mitogen-Activated Protein Kinase Pathway: Physiological Feedback and Drug Response Christine A. Pratilas1,2 and David B. Solit3,4 Abstract Mitogen-activated protein kinase (MAPK) pathway activation is a frequent event in human cancer and is often the result of activating mutations in the BRAF and RAS oncogenes. Targeted inhibitors of BRAF and its downstream effectors are in various stages of preclinical and clinical development. These agents offer the possibility of greater efficacy and less toxicity than current therapies for tumors driven by oncogenic mutations in the MAPK pathway. Early clinical results with the BRAF-selective in- hibitor PLX4032 suggest that this strategy will prove successful in a select group of patients whose tu- mors are driven by V600E BRAF. Relief of physiologic feedback upon pathway inhibition may, however, attenuate drug response and contribute to the development of acquired resistance. An im- proved understanding of the adaptive response of cancer cells to MAPK pathway inhibition may thus aid in the identification of those patients most likely to respond to targeted pathway inhibitors and provide a rational basis for tailored combination strategies. Clin Cancer Res; 16(13); 3329–34. ©2010 AACR. Background these genetic alterations activate common downstream effectors of transformation. One of the central regulators of growth factor-induced Activating BRAF mutations are found clustered within cell proliferation and survival in both normal and cancer the P-loop (exon 11) and activation segment (exon 15) cells is the RAS protein.
    [Show full text]
  • Plant Mitogen-Activated Protein Kinase Signaling Cascades Guillaume Tena*, Tsuneaki Asai†, Wan-Ling Chiu‡ and Jen Sheen§
    392 Plant mitogen-activated protein kinase signaling cascades Guillaume Tena*, Tsuneaki Asai†, Wan-Ling Chiu‡ and Jen Sheen§ Mitogen-activated protein kinase (MAPK) cascades have components that link sensors/receptors to target genes emerged as a universal signal transduction mechanism that and other cellular responses. connects diverse receptors/sensors to cellular and nuclear responses in eukaryotes. Recent studies in plants indicate that In the past few years, it has become apparent that mitogen- MAPK cascades are vital to fundamental physiological functions activated protein kinase (MAPK) cascades play some of the involved in hormonal responses, cell cycle regulation, abiotic most essential roles in plant signal transduction pathways stress signaling, and defense mechanisms. New findings have from cell division to cell death (Figure 1). MAPK cascades revealed the complexity and redundancy of the signaling are evolutionarily conserved signaling modules with essen- components, the antagonistic nature of distinct pathways, and tial regulatory functions in eukaryotes, including yeasts, the use of both positive and negative regulatory mechanisms. worms, flies, frogs, mammals and plants. The recent enthu- siasm for plant MAPK cascades is backed by numerous Addresses studies showing that plant MAPKs are activated by hor- Department of Molecular Biology, Massachusetts General Hospital, mones, abiotic stresses, pathogens and pathogen-derived Department of Genetics, Harvard Medical School, Wellman 11, elicitors, and are also activated at specific stages during the 50 Blossom Street, Boston, Massachusetts 02114, USA cell cycle [2]. Until recently, studies of MAPK cascades in *e-mail: [email protected] †e-mail: [email protected] plants were focused on cDNA cloning [3,4] and used a ‡e-mail: [email protected] MAPK in-gel assay, MAPK and tyrosine-phosphate anti- §e-mail: [email protected] bodies, and kinase inhibitors to connect signals to MAPKs Current Opinion in Plant Biology 2001, 4:392–400 [2].
    [Show full text]
  • The PAS Domain Confers Target Gene Specificity of Drosophila Bhlh/PAS Proteins
    Downloaded from genesdev.cshlp.org on October 3, 2021 - Published by Cold Spring Harbor Laboratory Press The PAS domain confers target gene specificity of Drosophila bHLH/PAS proteins Elazar Zelzer, Pablo Wappner, and Ben-Zion Shilo1 Department of Molecular Genetics, Weizmann Institute of Science, Rehovot 76100, Israel Trachealess (Trh) and Single-minded (Sim) are highly similar Drosophila bHLH/PAS transcription factors. They activate nonoverlapping target genes and induce diverse cell fates. A single Drosophila gene encoding a bHLH/PAS protein homologous to the vertebrate ARNT protein was isolated and may serve as a partner for both Trh and Sim. We show that Trh and Sim complexes recognize similar DNA-binding sites in the embryo. To examine the basis for their distinct target gene specificity, the activity of Trh–Sim chimeric proteins was monitored in embryos. Replacement of the Trh PAS domain by the analogous region of Sim was sufficient to convert it into a functional Sim protein. The PAS domain thus mediates all the features conferring specificity and the distinct recognition of target genes. The normal expression pattern of additional proteins essential for the activity of the Trh or Sim complexes can be inferred from the induction pattern of target genes and binding-site reporters, triggered by ubiquitous expression of Trh or Sim. We postulate that the capacity of bHLH/PAS heterodimers to associate, through the PAS domain, with additional distinct proteins that bind target-gene DNA, is essential to confer specificity. [Key Words: Gene expression; bHLH/PAS; Trachealess; Single minded; HIF1a; ARNT; trachea; midline] Received February 20, 1997; revised version accepted July 1, 1997.
    [Show full text]
  • Diverse Physiological Functions for Dual-Specificity MAP Kinase
    Commentary 4607 Diverse physiological functions for dual-specificity MAP kinase phosphatases Robin J. Dickinson and Stephen M. Keyse* Cancer Research UK Stress Response Laboratory, Ninewells Hospital and Medical School, University of Dundee, Dundee, DD1 9SY, UK *Author for correspondence (e-mail: [email protected]) Accepted 19 September 2006 Journal of Cell Science 119, 4607-4615 Published by The Company of Biologists 2006 doi:10.1242/jcs.03266 Summary A structurally distinct subfamily of ten dual-specificity functions in mammalian cells and tissues. However, recent (Thr/Tyr) protein phosphatases is responsible for the studies employing a range of model systems have begun to regulated dephosphorylation and inactivation of mitogen- reveal essential non-redundant roles for the MKPs in activated protein kinase (MAPK) family members in determining the outcome of MAPK signalling in a variety mammals. These MAPK phosphatases (MKPs) interact of physiological contexts. These include development, specifically with their substrates through a modular kinase- immune system function, metabolic homeostasis and the interaction motif (KIM) located within the N-terminal non- regulation of cellular stress responses. Interestingly, these catalytic domain of the protein. In addition, MAPK binding functions may reflect both restricted subcellular MKP is often accompanied by enzymatic activation of the C- activity and changes in the levels of signalling through terminal catalytic domain, thus ensuring specificity of multiple MAPK pathways. action. Despite our knowledge of the biochemical and structural basis for the catalytic mechanism of the MKPs, we know much less about their regulation and physiological Key words: MAPK, MKP, Signal transduction, Phosphorylation Introduction the activation motif is required for MAPK activity, Mitogen-activated protein kinases (MAPKs) constitute a dephosphorylation of either residue inactivates these enzymes.
    [Show full text]
  • Hypothetical Cytokinin-Binding Riboswitches in Arabidopsis Thaliana Jeremy Grojean1, Brian Downes2*
    Grojean and Downes Biology Direct 2010, 5:60 http://www.biology-direct.com/content/5/1/60 HYPOTHESIS Open Access Riboswitches as hormone receptors: hypothetical cytokinin-binding riboswitches in Arabidopsis thaliana Jeremy Grojean1, Brian Downes2* Abstract Background: Riboswitches are mRNA elements that change conformation when bound to small molecules. They are known to be key regulators of biosynthetic pathways in both prokaryotes and eukaryotes. Presentation of the Hypothesis: The hypothesis presented here is that riboswitches function as receptors in hormone perception. We propose that riboswitches initiate or integrate signaling cascades upon binding to classic signaling molecules. The molecular interactions for ligand binding and gene expression control would be the same as for biosynthetic pathways, but the context and the cadre of ligands to consider is dramatically different. The hypothesis arose from the observation that a compound used to identify adenine binding RNA sequences is chemically similar to the classic plant hormone, or growth regulator, cytokinin. A general tenet of the hypothesis is that riboswitch-binding metabolites can be used to make predictions about chemically related signaling molecules. In fact, all cell permeable signaling compounds can be considered as potential riboswitch ligands. The hypothesis is plausible, as demonstrated by a cursory review of the transcriptome and genome of the model plant Arabidopsis thaliana for transcripts that i) contain an adenine aptamer motif, and ii) are also predicted to be cytokinin- regulated. Here, one gene, CRK10 (for Cysteine-rich Receptor-like Kinase 10, At4g23180), contains an adenine aptamer-related sequence and is down-regulated by cytokinin approximately three-fold in public gene expression data.
    [Show full text]
  • The WRKY Transcription Factor Family in Model Plants and Crops
    Critical Reviews in Plant Sciences ISSN: 0735-2689 (Print) 1549-7836 (Online) Journal homepage: http://www.tandfonline.com/loi/bpts20 The WRKY Transcription Factor Family in Model Plants and Crops Fei Chen, Yue Hu, Alessandro Vannozzi, Kangcheng Wu, Hanyang Cai, Yuan Qin, Alison Mullis, Zhenguo Lin & Liangsheng Zhang To cite this article: Fei Chen, Yue Hu, Alessandro Vannozzi, Kangcheng Wu, Hanyang Cai, Yuan Qin, Alison Mullis, Zhenguo Lin & Liangsheng Zhang (2018): The WRKY Transcription Factor Family in Model Plants and Crops, Critical Reviews in Plant Sciences, DOI: 10.1080/07352689.2018.1441103 To link to this article: https://doi.org/10.1080/07352689.2018.1441103 Published online: 05 Mar 2018. Submit your article to this journal View related articles View Crossmark data Full Terms & Conditions of access and use can be found at http://www.tandfonline.com/action/journalInformation?journalCode=bpts20 CRITICAL REVIEWS IN PLANT SCIENCES https://doi.org/10.1080/07352689.2018.1441103 The WRKY Transcription Factor Family in Model Plants and Crops Fei Chena, Yue Hua, Alessandro Vannozzib, Kangcheng Wua, Hanyang Caia, Yuan Qina, Alison Mullisc, Zhenguo Linc, and Liangsheng Zhanga aState Key Laboratory of Ecological Pest Control for Fujian and Taiwan Crops; Key Laboratory of Ministry of Education for Genetics, Breeding and Multiple Utilization of Crops; Fujian Provincial Key Laboratory of Haixia Applied Plant Systems Biology; Fujian Agriculture and Forestry University, Fuzhou, China; bDepartment of Agronomy, Food, Natural Resources, Animals, and Environment (DAFNAE), University of Padova, Legnaro, Italy; cDepartment of Biology, Saint Louis University, St Louis, Missouri, USA ABSTRACT KEYWORDS The WRKY gene family in flowering plants encodes a large group of transcription factors (TFs) that environmental stress; gene play essential roles in diverse stress responses, developmental, and physiological processes.
    [Show full text]
  • G Protein Regulation of MAPK Networks
    Oncogene (2007) 26, 3122–3142 & 2007 Nature Publishing Group All rights reserved 0950-9232/07 $30.00 www.nature.com/onc REVIEW G Protein regulation of MAPK networks ZG Goldsmith and DN Dhanasekaran Fels Institute for Cancer Research and Molecular Biology, Temple University School of Medicine, Philadelphia, PA, USA G proteins provide signal-coupling mechanisms to hepta- the a-subunits has been used as a basis for the helical cell surface receptors and are criticallyinvolved classification of G proteins into Gs,Gi,Gq and G12 in the regulation of different mitogen-activated protein families in which the a-subunits that show more than kinase (MAPK) networks. The four classes of G proteins, 50% homology are grouped together (Simon et al., defined bythe G s,Gi,Gq and G12 families, regulate 1991). In G-protein-coupled receptor (GPCR)-mediated ERK1/2, JNK, p38MAPK, ERK5 and ERK6 modules by signaling pathways, ligand-activated receptors catalyse different mechanisms. The a- as well as bc-subunits are the exchange of the bound GDP to GTP in the a-subunit involved in the regulation of these MAPK modules in a following which the GTP-bound a-subunit disassociate context-specific manner. While the a- and bc-subunits from the receptor as well as the bg-subunit. The GTP- primarilyregulate the MAPK pathwaysvia their respec- bound a-subunit and the bg-subunit stimulate distinct tive effector-mediated signaling pathways, recent studies downstream effectors including enzymes, ion channels have unraveled several novel signaling intermediates and small GTPase, thus regulating multiple signaling including receptor tyrosine kinases and small GTPases pathways including those involved in the activation of through which these G-protein subunits positivelyas well mitogen-activated protein kinase (MAPK) modules as negativelyregulate specific MAPK modules.
    [Show full text]
  • Table S1. List of Oligonucleotide Primers Used
    Table S1. List of oligonucleotide primers used. Cla4 LF-5' GTAGGATCCGCTCTGTCAAGCCTCCGACC M629Arev CCTCCCTCCATGTACTCcgcGATGACCCAgAGCTCGTTG M629Afwd CAACGAGCTcTGGGTCATCgcgGAGTACATGGAGGGAGG LF-3' GTAGGCCATCTAGGCCGCAATCTCGTCAAGTAAAGTCG RF-5' GTAGGCCTGAGTGGCCCGAGATTGCAACGTGTAACC RF-3' GTAGGATCCCGTACGCTGCGATCGCTTGC Ukc1 LF-5' GCAATATTATGTCTACTTTGAGCG M398Arev CCGCCGGGCAAgAAtTCcgcGAGAAGGTACAGATACGc M398Afwd gCGTATCTGTACCTTCTCgcgGAaTTcTTGCCCGGCGG LF-3' GAGGCCATCTAGGCCATTTACGATGGCAGACAAAGG RF-5' GTGGCCTGAGTGGCCATTGGTTTGGGCGAATGGC RF-3' GCAATATTCGTACGTCAACAGCGCG Nrc2 LF-5' GCAATATTTCGAAAAGGGTCGTTCC M454Grev GCCACCCATGCAGTAcTCgccGCAGAGGTAGAGGTAATC M454Gfwd GATTACCTCTACCTCTGCggcGAgTACTGCATGGGTGGC LF-3' GAGGCCATCTAGGCCGACGAGTGAAGCTTTCGAGCG RF-5' GAGGCCTGAGTGGCCTAAGCATCTTGGCTTCTGC RF-3' GCAATATTCGGTCAACGCTTTTCAGATACC Ipl1 LF-5' GTCAATATTCTACTTTGTGAAGACGCTGC M629Arev GCTCCCCACGACCAGCgAATTCGATagcGAGGAAGACTCGGCCCTCATC M629Afwd GATGAGGGCCGAGTCTTCCTCgctATCGAATTcGCTGGTCGTGGGGAGC LF-3' TGAGGCCATCTAGGCCGGTGCCTTAGATTCCGTATAGC RF-5' CATGGCCTGAGTGGCCGATTCTTCTTCTGTCATCGAC RF-3' GACAATATTGCTGACCTTGTCTACTTGG Ire1 LF-5' GCAATATTAAAGCACAACTCAACGC D1014Arev CCGTAGCCAAGCACCTCGgCCGAtATcGTGAGCGAAG D1014Afwd CTTCGCTCACgATaTCGGcCGAGGTGCTTGGCTACGG LF-3' GAGGCCATCTAGGCCAACTGGGCAAAGGAGATGGA RF-5' GAGGCCTGAGTGGCCGTGCGCCTGTGTATCTCTTTG RF-3' GCAATATTGGCCATCTGAGGGCTGAC Kin28 LF-5' GACAATATTCATCTTTCACCCTTCCAAAG L94Arev TGATGAGTGCTTCTAGATTGGTGTCggcGAAcTCgAGCACCAGGTTG L94Afwd CAACCTGGTGCTcGAgTTCgccGACACCAATCTAGAAGCACTCATCA LF-3' TGAGGCCATCTAGGCCCACAGAGATCCGCTTTAATGC RF-5' CATGGCCTGAGTGGCCAGGGCTAGTACGACCTCG
    [Show full text]
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
    [Show full text]