Mitogen-Activated Protein Kinase Cascades in Plants
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
291533611.Pdf
View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Publications of the IAS Fellows Genome-wide identification, classification, evolutionary expansion and expression analyses of homeobox genes in rice Mukesh Jain, Akhilesh K. Tyagi and Jitendra P. Khurana Interdisciplinary Centre for Plant Genomics and Department of Plant Molecular Biology, University of Delhi South Campus, India Keywords Homeobox genes play a critical role in regulating various aspects of plant abiotic stress; homeobox genes; microarray growth and development. In the present study, we identified a total of 107 analysis; reproductive development; rice homeobox genes in the rice genome and grouped them into ten distinct (Oryza sativa) subfamilies based upon their domain composition and phylogenetic analy- Correspondence sis. A significantly large number of homeobox genes are located in the J. P. Khurana, Department of Plant duplicated segments of the rice genome, which suggests that the expansion Molecular Biology, University of Delhi South of homeobox gene family, in large part, might have occurred due to Campus, Benito Juarez Road, New Delhi segmental duplications in rice. Furthermore, microarray analysis was 110021, India performed to elucidate the expression profiles of these genes in different Fax: +91 011 24115270 tissues and during various stages of vegetative and reproductive develop- Tel: +91 011 24115126 ment. Several genes with predominant expression during various stages of E-mail: [email protected] panicle and seed development were identified. At least 37 homeobox genes (Received 6 November 2007, revised 3 were found to be differentially expressed significantly (more than two-fold; March 2008, accepted 31 March 2008) P < 0.05) under various abiotic stress conditions. -
Supplemental Table S1
Entrez Gene Symbol Gene Name Affymetrix EST Glomchip SAGE Stanford Literature HPA confirmed Gene ID Profiling profiling Profiling Profiling array profiling confirmed 1 2 A2M alpha-2-macroglobulin 0 0 0 1 0 2 10347 ABCA7 ATP-binding cassette, sub-family A (ABC1), member 7 1 0 0 0 0 3 10350 ABCA9 ATP-binding cassette, sub-family A (ABC1), member 9 1 0 0 0 0 4 10057 ABCC5 ATP-binding cassette, sub-family C (CFTR/MRP), member 5 1 0 0 0 0 5 10060 ABCC9 ATP-binding cassette, sub-family C (CFTR/MRP), member 9 1 0 0 0 0 6 79575 ABHD8 abhydrolase domain containing 8 1 0 0 0 0 7 51225 ABI3 ABI gene family, member 3 1 0 1 0 0 8 29 ABR active BCR-related gene 1 0 0 0 0 9 25841 ABTB2 ankyrin repeat and BTB (POZ) domain containing 2 1 0 1 0 0 10 30 ACAA1 acetyl-Coenzyme A acyltransferase 1 (peroxisomal 3-oxoacyl-Coenzyme A thiol 0 1 0 0 0 11 43 ACHE acetylcholinesterase (Yt blood group) 1 0 0 0 0 12 58 ACTA1 actin, alpha 1, skeletal muscle 0 1 0 0 0 13 60 ACTB actin, beta 01000 1 14 71 ACTG1 actin, gamma 1 0 1 0 0 0 15 81 ACTN4 actinin, alpha 4 0 0 1 1 1 10700177 16 10096 ACTR3 ARP3 actin-related protein 3 homolog (yeast) 0 1 0 0 0 17 94 ACVRL1 activin A receptor type II-like 1 1 0 1 0 0 18 8038 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 1 0 0 0 0 19 8751 ADAM15 ADAM metallopeptidase domain 15 (metargidin) 1 0 0 0 0 20 8728 ADAM19 ADAM metallopeptidase domain 19 (meltrin beta) 1 0 0 0 0 21 81792 ADAMTS12 ADAM metallopeptidase with thrombospondin type 1 motif, 12 1 0 0 0 0 22 9507 ADAMTS4 ADAM metallopeptidase with thrombospondin type 1 -
Galectin-4 Interaction with CD14 Triggers the Differentiation of Monocytes Into Macrophage-Like Cells Via the MAPK Signaling Pathway
Immune Netw. 2019 Jun;19(3):e17 https://doi.org/10.4110/in.2019.19.e17 pISSN 1598-2629·eISSN 2092-6685 Original Article Galectin-4 Interaction with CD14 Triggers the Differentiation of Monocytes into Macrophage-like Cells via the MAPK Signaling Pathway So-Hee Hong 1,2,3,4,5, Jun-Seop Shin 1,2,3,5, Hyunwoo Chung 1,2,4,5, Chung-Gyu Park 1,2,3,4,5,* 1Xenotransplantation Research Center, Seoul National University College of Medicine, Seoul 03080, Korea 2Institute of Endemic Diseases, Seoul National University College of Medicine, Seoul 03080, Korea 3Cancer Research Institute, Seoul National University College of Medicine, Seoul 03080, Korea 4Department of Biomedical Sciences, Seoul National University College of Medicine, Seoul 03080, Korea 5Department of Microbiology and Immunology, Seoul National University College of Medicine, Seoul 03080, Korea Received: Jan 28, 2019 ABSTRACT Revised: May 13, 2019 Accepted: May 19, 2019 Galectin-4 (Gal-4) is a β-galactoside-binding protein mostly expressed in the gastrointestinal *Correspondence to tract of animals. Although intensive functional studies have been done for other galectin Chung-Gyu Park isoforms, the immunoregulatory function of Gal-4 still remains ambiguous. Here, we Department of Microbiology and Immunology, Seoul National University College of Medicine, demonstrated that Gal-4 could bind to CD14 on monocytes and induce their differentiation 103 Daehak-ro, Jongno-gu, Seoul 03080, into macrophage-like cells through the MAPK signaling pathway. Gal-4 induced the phenotypic Korea. changes on monocytes by altering the expression of various surface molecules, and induced E-mail: [email protected] functional changes such as increased cytokine production and matrix metalloproteinase expression and reduced phagocytic capacity. -
Targeting the Mitogen-Activated Protein Kinase Pathway: Physiological Feedback and Drug Response
Published OnlineFirst May 14, 2010; DOI: 10.1158/1078-0432.CCR-09-3064 Molecular Pathways Clinical Cancer Research Targeting the Mitogen-Activated Protein Kinase Pathway: Physiological Feedback and Drug Response Christine A. Pratilas1,2 and David B. Solit3,4 Abstract Mitogen-activated protein kinase (MAPK) pathway activation is a frequent event in human cancer and is often the result of activating mutations in the BRAF and RAS oncogenes. Targeted inhibitors of BRAF and its downstream effectors are in various stages of preclinical and clinical development. These agents offer the possibility of greater efficacy and less toxicity than current therapies for tumors driven by oncogenic mutations in the MAPK pathway. Early clinical results with the BRAF-selective in- hibitor PLX4032 suggest that this strategy will prove successful in a select group of patients whose tu- mors are driven by V600E BRAF. Relief of physiologic feedback upon pathway inhibition may, however, attenuate drug response and contribute to the development of acquired resistance. An im- proved understanding of the adaptive response of cancer cells to MAPK pathway inhibition may thus aid in the identification of those patients most likely to respond to targeted pathway inhibitors and provide a rational basis for tailored combination strategies. Clin Cancer Res; 16(13); 3329–34. ©2010 AACR. Background these genetic alterations activate common downstream effectors of transformation. One of the central regulators of growth factor-induced Activating BRAF mutations are found clustered within cell proliferation and survival in both normal and cancer the P-loop (exon 11) and activation segment (exon 15) cells is the RAS protein. -
Plant Mitogen-Activated Protein Kinase Signaling Cascades Guillaume Tena*, Tsuneaki Asai†, Wan-Ling Chiu‡ and Jen Sheen§
392 Plant mitogen-activated protein kinase signaling cascades Guillaume Tena*, Tsuneaki Asai†, Wan-Ling Chiu‡ and Jen Sheen§ Mitogen-activated protein kinase (MAPK) cascades have components that link sensors/receptors to target genes emerged as a universal signal transduction mechanism that and other cellular responses. connects diverse receptors/sensors to cellular and nuclear responses in eukaryotes. Recent studies in plants indicate that In the past few years, it has become apparent that mitogen- MAPK cascades are vital to fundamental physiological functions activated protein kinase (MAPK) cascades play some of the involved in hormonal responses, cell cycle regulation, abiotic most essential roles in plant signal transduction pathways stress signaling, and defense mechanisms. New findings have from cell division to cell death (Figure 1). MAPK cascades revealed the complexity and redundancy of the signaling are evolutionarily conserved signaling modules with essen- components, the antagonistic nature of distinct pathways, and tial regulatory functions in eukaryotes, including yeasts, the use of both positive and negative regulatory mechanisms. worms, flies, frogs, mammals and plants. The recent enthu- siasm for plant MAPK cascades is backed by numerous Addresses studies showing that plant MAPKs are activated by hor- Department of Molecular Biology, Massachusetts General Hospital, mones, abiotic stresses, pathogens and pathogen-derived Department of Genetics, Harvard Medical School, Wellman 11, elicitors, and are also activated at specific stages during the 50 Blossom Street, Boston, Massachusetts 02114, USA cell cycle [2]. Until recently, studies of MAPK cascades in *e-mail: [email protected] †e-mail: [email protected] plants were focused on cDNA cloning [3,4] and used a ‡e-mail: [email protected] MAPK in-gel assay, MAPK and tyrosine-phosphate anti- §e-mail: [email protected] bodies, and kinase inhibitors to connect signals to MAPKs Current Opinion in Plant Biology 2001, 4:392–400 [2]. -
The PAS Domain Confers Target Gene Specificity of Drosophila Bhlh/PAS Proteins
Downloaded from genesdev.cshlp.org on October 3, 2021 - Published by Cold Spring Harbor Laboratory Press The PAS domain confers target gene specificity of Drosophila bHLH/PAS proteins Elazar Zelzer, Pablo Wappner, and Ben-Zion Shilo1 Department of Molecular Genetics, Weizmann Institute of Science, Rehovot 76100, Israel Trachealess (Trh) and Single-minded (Sim) are highly similar Drosophila bHLH/PAS transcription factors. They activate nonoverlapping target genes and induce diverse cell fates. A single Drosophila gene encoding a bHLH/PAS protein homologous to the vertebrate ARNT protein was isolated and may serve as a partner for both Trh and Sim. We show that Trh and Sim complexes recognize similar DNA-binding sites in the embryo. To examine the basis for their distinct target gene specificity, the activity of Trh–Sim chimeric proteins was monitored in embryos. Replacement of the Trh PAS domain by the analogous region of Sim was sufficient to convert it into a functional Sim protein. The PAS domain thus mediates all the features conferring specificity and the distinct recognition of target genes. The normal expression pattern of additional proteins essential for the activity of the Trh or Sim complexes can be inferred from the induction pattern of target genes and binding-site reporters, triggered by ubiquitous expression of Trh or Sim. We postulate that the capacity of bHLH/PAS heterodimers to associate, through the PAS domain, with additional distinct proteins that bind target-gene DNA, is essential to confer specificity. [Key Words: Gene expression; bHLH/PAS; Trachealess; Single minded; HIF1a; ARNT; trachea; midline] Received February 20, 1997; revised version accepted July 1, 1997. -
Diverse Physiological Functions for Dual-Specificity MAP Kinase
Commentary 4607 Diverse physiological functions for dual-specificity MAP kinase phosphatases Robin J. Dickinson and Stephen M. Keyse* Cancer Research UK Stress Response Laboratory, Ninewells Hospital and Medical School, University of Dundee, Dundee, DD1 9SY, UK *Author for correspondence (e-mail: [email protected]) Accepted 19 September 2006 Journal of Cell Science 119, 4607-4615 Published by The Company of Biologists 2006 doi:10.1242/jcs.03266 Summary A structurally distinct subfamily of ten dual-specificity functions in mammalian cells and tissues. However, recent (Thr/Tyr) protein phosphatases is responsible for the studies employing a range of model systems have begun to regulated dephosphorylation and inactivation of mitogen- reveal essential non-redundant roles for the MKPs in activated protein kinase (MAPK) family members in determining the outcome of MAPK signalling in a variety mammals. These MAPK phosphatases (MKPs) interact of physiological contexts. These include development, specifically with their substrates through a modular kinase- immune system function, metabolic homeostasis and the interaction motif (KIM) located within the N-terminal non- regulation of cellular stress responses. Interestingly, these catalytic domain of the protein. In addition, MAPK binding functions may reflect both restricted subcellular MKP is often accompanied by enzymatic activation of the C- activity and changes in the levels of signalling through terminal catalytic domain, thus ensuring specificity of multiple MAPK pathways. action. Despite our knowledge of the biochemical and structural basis for the catalytic mechanism of the MKPs, we know much less about their regulation and physiological Key words: MAPK, MKP, Signal transduction, Phosphorylation Introduction the activation motif is required for MAPK activity, Mitogen-activated protein kinases (MAPKs) constitute a dephosphorylation of either residue inactivates these enzymes. -
Hypothetical Cytokinin-Binding Riboswitches in Arabidopsis Thaliana Jeremy Grojean1, Brian Downes2*
Grojean and Downes Biology Direct 2010, 5:60 http://www.biology-direct.com/content/5/1/60 HYPOTHESIS Open Access Riboswitches as hormone receptors: hypothetical cytokinin-binding riboswitches in Arabidopsis thaliana Jeremy Grojean1, Brian Downes2* Abstract Background: Riboswitches are mRNA elements that change conformation when bound to small molecules. They are known to be key regulators of biosynthetic pathways in both prokaryotes and eukaryotes. Presentation of the Hypothesis: The hypothesis presented here is that riboswitches function as receptors in hormone perception. We propose that riboswitches initiate or integrate signaling cascades upon binding to classic signaling molecules. The molecular interactions for ligand binding and gene expression control would be the same as for biosynthetic pathways, but the context and the cadre of ligands to consider is dramatically different. The hypothesis arose from the observation that a compound used to identify adenine binding RNA sequences is chemically similar to the classic plant hormone, or growth regulator, cytokinin. A general tenet of the hypothesis is that riboswitch-binding metabolites can be used to make predictions about chemically related signaling molecules. In fact, all cell permeable signaling compounds can be considered as potential riboswitch ligands. The hypothesis is plausible, as demonstrated by a cursory review of the transcriptome and genome of the model plant Arabidopsis thaliana for transcripts that i) contain an adenine aptamer motif, and ii) are also predicted to be cytokinin- regulated. Here, one gene, CRK10 (for Cysteine-rich Receptor-like Kinase 10, At4g23180), contains an adenine aptamer-related sequence and is down-regulated by cytokinin approximately three-fold in public gene expression data. -
The WRKY Transcription Factor Family in Model Plants and Crops
Critical Reviews in Plant Sciences ISSN: 0735-2689 (Print) 1549-7836 (Online) Journal homepage: http://www.tandfonline.com/loi/bpts20 The WRKY Transcription Factor Family in Model Plants and Crops Fei Chen, Yue Hu, Alessandro Vannozzi, Kangcheng Wu, Hanyang Cai, Yuan Qin, Alison Mullis, Zhenguo Lin & Liangsheng Zhang To cite this article: Fei Chen, Yue Hu, Alessandro Vannozzi, Kangcheng Wu, Hanyang Cai, Yuan Qin, Alison Mullis, Zhenguo Lin & Liangsheng Zhang (2018): The WRKY Transcription Factor Family in Model Plants and Crops, Critical Reviews in Plant Sciences, DOI: 10.1080/07352689.2018.1441103 To link to this article: https://doi.org/10.1080/07352689.2018.1441103 Published online: 05 Mar 2018. Submit your article to this journal View related articles View Crossmark data Full Terms & Conditions of access and use can be found at http://www.tandfonline.com/action/journalInformation?journalCode=bpts20 CRITICAL REVIEWS IN PLANT SCIENCES https://doi.org/10.1080/07352689.2018.1441103 The WRKY Transcription Factor Family in Model Plants and Crops Fei Chena, Yue Hua, Alessandro Vannozzib, Kangcheng Wua, Hanyang Caia, Yuan Qina, Alison Mullisc, Zhenguo Linc, and Liangsheng Zhanga aState Key Laboratory of Ecological Pest Control for Fujian and Taiwan Crops; Key Laboratory of Ministry of Education for Genetics, Breeding and Multiple Utilization of Crops; Fujian Provincial Key Laboratory of Haixia Applied Plant Systems Biology; Fujian Agriculture and Forestry University, Fuzhou, China; bDepartment of Agronomy, Food, Natural Resources, Animals, and Environment (DAFNAE), University of Padova, Legnaro, Italy; cDepartment of Biology, Saint Louis University, St Louis, Missouri, USA ABSTRACT KEYWORDS The WRKY gene family in flowering plants encodes a large group of transcription factors (TFs) that environmental stress; gene play essential roles in diverse stress responses, developmental, and physiological processes. -
G Protein Regulation of MAPK Networks
Oncogene (2007) 26, 3122–3142 & 2007 Nature Publishing Group All rights reserved 0950-9232/07 $30.00 www.nature.com/onc REVIEW G Protein regulation of MAPK networks ZG Goldsmith and DN Dhanasekaran Fels Institute for Cancer Research and Molecular Biology, Temple University School of Medicine, Philadelphia, PA, USA G proteins provide signal-coupling mechanisms to hepta- the a-subunits has been used as a basis for the helical cell surface receptors and are criticallyinvolved classification of G proteins into Gs,Gi,Gq and G12 in the regulation of different mitogen-activated protein families in which the a-subunits that show more than kinase (MAPK) networks. The four classes of G proteins, 50% homology are grouped together (Simon et al., defined bythe G s,Gi,Gq and G12 families, regulate 1991). In G-protein-coupled receptor (GPCR)-mediated ERK1/2, JNK, p38MAPK, ERK5 and ERK6 modules by signaling pathways, ligand-activated receptors catalyse different mechanisms. The a- as well as bc-subunits are the exchange of the bound GDP to GTP in the a-subunit involved in the regulation of these MAPK modules in a following which the GTP-bound a-subunit disassociate context-specific manner. While the a- and bc-subunits from the receptor as well as the bg-subunit. The GTP- primarilyregulate the MAPK pathwaysvia their respec- bound a-subunit and the bg-subunit stimulate distinct tive effector-mediated signaling pathways, recent studies downstream effectors including enzymes, ion channels have unraveled several novel signaling intermediates and small GTPase, thus regulating multiple signaling including receptor tyrosine kinases and small GTPases pathways including those involved in the activation of through which these G-protein subunits positivelyas well mitogen-activated protein kinase (MAPK) modules as negativelyregulate specific MAPK modules. -
Table S1. List of Oligonucleotide Primers Used
Table S1. List of oligonucleotide primers used. Cla4 LF-5' GTAGGATCCGCTCTGTCAAGCCTCCGACC M629Arev CCTCCCTCCATGTACTCcgcGATGACCCAgAGCTCGTTG M629Afwd CAACGAGCTcTGGGTCATCgcgGAGTACATGGAGGGAGG LF-3' GTAGGCCATCTAGGCCGCAATCTCGTCAAGTAAAGTCG RF-5' GTAGGCCTGAGTGGCCCGAGATTGCAACGTGTAACC RF-3' GTAGGATCCCGTACGCTGCGATCGCTTGC Ukc1 LF-5' GCAATATTATGTCTACTTTGAGCG M398Arev CCGCCGGGCAAgAAtTCcgcGAGAAGGTACAGATACGc M398Afwd gCGTATCTGTACCTTCTCgcgGAaTTcTTGCCCGGCGG LF-3' GAGGCCATCTAGGCCATTTACGATGGCAGACAAAGG RF-5' GTGGCCTGAGTGGCCATTGGTTTGGGCGAATGGC RF-3' GCAATATTCGTACGTCAACAGCGCG Nrc2 LF-5' GCAATATTTCGAAAAGGGTCGTTCC M454Grev GCCACCCATGCAGTAcTCgccGCAGAGGTAGAGGTAATC M454Gfwd GATTACCTCTACCTCTGCggcGAgTACTGCATGGGTGGC LF-3' GAGGCCATCTAGGCCGACGAGTGAAGCTTTCGAGCG RF-5' GAGGCCTGAGTGGCCTAAGCATCTTGGCTTCTGC RF-3' GCAATATTCGGTCAACGCTTTTCAGATACC Ipl1 LF-5' GTCAATATTCTACTTTGTGAAGACGCTGC M629Arev GCTCCCCACGACCAGCgAATTCGATagcGAGGAAGACTCGGCCCTCATC M629Afwd GATGAGGGCCGAGTCTTCCTCgctATCGAATTcGCTGGTCGTGGGGAGC LF-3' TGAGGCCATCTAGGCCGGTGCCTTAGATTCCGTATAGC RF-5' CATGGCCTGAGTGGCCGATTCTTCTTCTGTCATCGAC RF-3' GACAATATTGCTGACCTTGTCTACTTGG Ire1 LF-5' GCAATATTAAAGCACAACTCAACGC D1014Arev CCGTAGCCAAGCACCTCGgCCGAtATcGTGAGCGAAG D1014Afwd CTTCGCTCACgATaTCGGcCGAGGTGCTTGGCTACGG LF-3' GAGGCCATCTAGGCCAACTGGGCAAAGGAGATGGA RF-5' GAGGCCTGAGTGGCCGTGCGCCTGTGTATCTCTTTG RF-3' GCAATATTGGCCATCTGAGGGCTGAC Kin28 LF-5' GACAATATTCATCTTTCACCCTTCCAAAG L94Arev TGATGAGTGCTTCTAGATTGGTGTCggcGAAcTCgAGCACCAGGTTG L94Afwd CAACCTGGTGCTcGAgTTCgccGACACCAATCTAGAAGCACTCATCA LF-3' TGAGGCCATCTAGGCCCACAGAGATCCGCTTTAATGC RF-5' CATGGCCTGAGTGGCCAGGGCTAGTACGACCTCG -
Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase