Roles of Wrky Proteins in Mediating the Crosstalk of Hormone Signaling Pathways: an Approach Integrating Bioinformatics and Experimental Biology

UNLV Retrospective Theses & Dissertations

1-1-2006

Roles of Wrky proteins in mediating the crosstalk of hormone signaling pathways: An approach integrating bioinformatics and experimental biology

Zhen Xie University of Nevada, Las Vegas

Follow this and additional works at: https://digitalscholarship.unlv.edu/rtds

Repository Citation Xie, Zhen, "Roles of Wrky proteins in mediating the crosstalk of hormone signaling pathways: An approach integrating bioinformatics and experimental biology" (2006). UNLV Retrospective Theses & Dissertations. 2711. http://dx.doi.org/10.25669/0cw1-sipg

This Dissertation is protected by copyright and/or related rights. It has been brought to you by Digital Scholarship@UNLV with permission from the rights-holder(s). You are free to use this Dissertation in any way that is permitted by the copyright and related rights legislation that applies to your use. For other uses you need to obtain permission from the rights-holder(s) directly, unless additional rights are indicated by a Creative Commons license in the record and/or on the work itself.

This Dissertation has been accepted for inclusion in UNLV Retrospective Theses & Dissertations by an authorized administrator of Digital Scholarship@UNLV. For more information, please contact [email protected]. ROLES OF WRKY PROTEINS IN MEDIATING THE CROSSTALK OF HORMONE

SIGNALING PATHWAYS: AN APPROACH INTEGRATING

BIOINFORMATICS AND EXPERIMENTAL BIOLOGY

Zhen Xie

Bachelor of Sciences Shandong Agricultural University 1998

Master of Sciences Shandong Agricultural University 2001

A dissertation submitted in partial fulfillment of the requirements for the

Doctor of Philosophy Degree in Biological Sciences Department of Biological Sciences College of Sciences

Graduate College University of Nevada, Las Vegas December 2006

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. UMI Number: 3256298

INFORMATION TO USERS

The quality of this reproduction is dependent upon the quality of the copy submitted. Broken or indistinct print, colored or poor quality illustrations and photographs, print bleed-through, substandard margins, and improper alignment can adversely affect reproduction. In the unlikely event that the author did not send a complete manuscript and there are missing pages, these will be noted. Also, if unauthorized copyright material had to be removed, a note will indicate the deletion.

UMI

UMI Microform 3256298 Copyright 2007 by ProQuest Information and Learning Company. All rights reserved. This microform edition is protected against unauthorized copying under Title 17, United States Code.

ProQuest Information and Learning Company 300 North Zeeb Road P.O. Box 1346 Ann Arbor, Ml 48106-1346

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Dissertation Approval The Graduate College University of Nevada, Las Vegas

September 26______, 20 06

The Dissertation prepared by

Zhen X ie

Entitled

Roles of WRKY Proteins in Mediating the Crosstalk of Hormone

Signaling Pathways: an Approach Integrating Bioinformatics and

Experimental Biology ______

is approved in partial fulfillment of the requirements for the degree of

Doctor of Philosophy ______

Examination Committee Chair

duate College

Examination Committee Member

__ ExaminatioifCommittee Member

Gmduate College Faculty Reprêsèfïtative Examin^Mm Committee Member

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. ABSTRACT

Roles of WRKY Proteins in Mediating the Crosstalk of Hormone Signaling Pathways: an Approach Integrating Bioinformatics and Experimental Biology

Zhen Xie

Dr. Jeffery Qingxi Shen, Examination Committee Chair Associate Professor of Biological Sciences University of Nevada, Las Vegas

The goal of my research is to understand the molecular mechanism by which

hormones control seed germination. Gibberellins (GA) promote, while abscisic acid

(ABA) and salicylic acid (SA) inhibit seed germination. Key moleeules in these signaling

pathways include receptors, secondary messengers, protein kinases and phosphatases, and

transcription factors. My study focuses on how WRKY transcription factors modulate the

expression of an a-amylase gene {Amy32b), which is up-regulated by GA, but down-

regulated by ABA and SA in the aleurone eells of germinating seeds.

Chapter 2 started with the annotation and phylogenetic analyses of the WRKY gene

superfamily, followed by functional studies of WRKY proteins in mediating ABA

responses. Eighty-one WRKY genes were identified in the riee genome through

computational analyses. Phylogenetie analyses based on WRKY domain sequences

suggest that extensive duplications and losses of the WRKY domain occurred during

evolution of this gene family. Transient expression studies suggest that among four

WRKY genes that are ABA-inducible in aleurone cells, OsWRKY72 and OsWRKY77

111

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. function as transcription activators while OsWRKY24 and OsWRKY45 are repressors of

the ABA-inducible HVA22 gene.

Chapter 3 presents cellular and biochemical data to support a novel model that two

transcription repressors OsWRKYSl and OsWRKYVl mediate the crosstalk of GA and

ABA signaling. Both genes are ABA-inducible, but GA-repressible in the embryos and

aleurone cells of germinating rice seeds. The interaction of OsWRKY51 and

OsWRKYVl synergistically represses the GA-induced Amy32b expression, likely by

functionally interfering with the GA-inducible transactivator, GAMYB.

The mechanism underlying the crosstalk of SA, ABA and GA is reported in Chapter

4. Similar to ABA, SA blocks seed germination likely through repressing the expression

of a-amylase genes such as Amy32b. Over-expression of the SA-inducible and GA-

repressible HvWRKY38 in aleurone eells bloeks GA-induced Amy32b expression.

Therefore, HvWRKY38 might mediate the crosstalk of SA, ABA and GA signaling in

regulating a-amylase expression and seed germination.

My research demonstrates the high efficiency of the approach integrating

bioinformaties and experimental biology in addressing the cell-biological signaling

network. The finding derived from this research helps advance towards aehieving our

long-term goal: to improve the yield and quality of rice and other eereals.

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. TABLE OF CONTENTS

ABSTRACT...... ni

LIST OF FIGURES...... vii

LIST OF TABLES...... ix

ABBREVIATIONS...... x

ACKNOWLEDGMENTS...... xiii

CHAPTER 1 GENERAL INTRODUCTION...... 1 Gibberellic acid ...... 4 The crosstalk of gibberellin and abscisic acid ...... 9 The crosstalk of gibberellin and salicylic acid ...... 12 WRKY transcription factors ...... 13 The transient expression assay using barley aleurone cells ...... 14 The scope of the dissertation ...... 16 References...... 17

CHAPTER 2 ANNOTATIONS AND FUNCTIONAL ANALYSES OF THE RICE PFRKTGENE SUPERFAMILY REVEAL POSITIVE AND NEGATIVE REGULATORS OF ABSCISIC ACID SIGNALING IN ALEURONE CELLS...... 27 Abstract...... 27 Introduction...... 28 Results...... 31 Discussion...... 52 Materials and methods ...... 59 Acknowledgements ...... 63 References...... 64

CHAPTER 3 E9TERACTI0NS OF TWO ABSCISIC-ACID INDUCED WRKY GENES IN REPRESSING GIBBERELLIN SIGNALING IN ALEURONE CELLS...... 71 Summary ...... 71 Introduction...... 72 Results...... 74 Discussion...... 91 Experimental procedures ...... 96 Acknowledgements ...... 101

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. References...... 101

CHAPTER 4 SALICYLIC ACID INHIBITS GIBBERELLIN-INDUCED ALPHA-AMYLASE EXPRESSION AND SEED GERMINATION VIA A PATHWAY INVOLVING AN ABSCISIC-ACID-INDUCIBLE ITRX7GENE...... 106 Abstract...... 106 Introduction...... 107 Results...... 110 Discussion...... 123 Materials and methods ...... 126 Acknowledgements ...... 132 References...... 132

CHAPTER 5 GENERAL DISCUSSION...... 137 An approaeh integrating bioinformatics and experimental biology ...... 137 WRKY proteins in GA and ABA signaling ...... 140 Transcriptional regulation of a-amylase expression ...... 142 Antagonism of ABA and SA against GA ...... 145 Significanee ...... 150 References...... 151

APPENDIX I CHAPTER 1 SUPPLEMENTAL TABLE...... 156

APPENDIX II CHAPTER 2 SUPPLEMENTAL TABLES AND FIGURES...... 158

APPENDIX III CHAPTER 3 SUPPLEMENTAL FIGURES...... 173

APPENDIX IV CHAPTER 5 SUPPLEMENTAL TABLES...... 175

APPENDIX V PERMISSIONS TO USE COPYRIGHTED MATERIALS...... 182

VITA...... 184

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. LIST OF FIGURES

CHAPTER 1 ...... 1 Figure 1-1. A schematic diagram of a germinating cereal seed ...... 2 Figure 1-2. Struetures of bioactive GA, ABA and SA...... 3 Figure 1-3. Three stages of GA biosynthesis ...... 6 Figure 1-4. A schematic model of GA signaling during seed germination ...... 7 Figure 1-5. cA-Acting elements in the Amy32b promoter region ...... 8 Figure 1-6. A schematic model of GA and ABA signaling in aleurone eells ...... 11

CHAPTER 2 ...... 28 Figure 2-1. Schematic diagrams of alternative splieed gene structures ...... 37 Figure 2-2. Multiple sequence alignment of WRKY ...... 38 Figure 2-3. Phylogenetic analyses of OsWRKY proteins ...... 42 Figure 2-4. Chromosomal distribution of OsWRKY genes ...... 46 Figure 2-5. Schematic diagrams of conserved motifs found in the OsWRKY Peptide Sequences ...... 47 Figure 2-6. Expression patterns of OsWRKY genes in rice aleurone eells...... 51 Figure 2-7. Functional analyses of OsWRKY proteins in ABA signaling ...... 52 Figure 2-8. Deduced evolutionary framework of the OsWRKY gene family ...... 57

CHAPTER 3 ...... 71 Figure 3-1. OsWRKYSl and OsWRKY? 1 mRNA localization in imbibed rice seeds ...... 75 Figure 3-2. OsWRKY51 suppresses GA induction of the Amy32b promoter ...... 76 Figure 3-3. OsWRKY51 and OsWRKY71 synergistically suppress GA induetion of the Amy32b promoter ...... 79 Figure 3-4. Visualization of interactions between WRKY proteins in aleurone cells by bimoleeular fluorescence complementation...... 80 Figure 3-5. Interaction of OsWRKY51 and OsWRKY71 enhances the binding affinity of OsWRKY71 to the Amy32b prom oter ...... 84 Figure 3-6. Mutant OsWRKY71 proteins regulate the expression of Amy32b-GUS by modulating the binding affinity of OsWRKY51 and OsWRKY71 to the W-boxes ...... 88 Figure 3-7. Functional antagonism between OsWRKY51 and OsGAMYB in regulating the expression of Amy32b-GUS ...... 92

CHAPTER 4 ...... 106 Figure 4-1. SA inhibits barley seed germination ...... 111 Figure 4-2. SA suppresses GA induction of a-amylases ...... 112 Figure 4-3. SA treatments decrease a-amylase aetivity in the medium ...... 115

Vll

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Figure 4-4. SA unlikely blocks a-amylase secretion or directly binds and thus inhibits a-amylases ...... 116 Figure 4-5. SA inhibits GA-induced Amy32b expression in aleurone cells...... 118 Figure 4-6. The expression of the HvWRKY38 gene is induced by SA and ABA but suppressed by G A ...... 121 Figure 4-7. HvWRKY38 represses GA induction of the Amy32b expression in aleurone cells...... 122 Figure 4-8. The hypothetic model for the crosstalk between GA and SA signaling ...... 127

CHAPTER 5 ...... 137 Figure 5-1. Proposed roles of OsWRKY51 and OsWRKY71 in the crosstalk of GA and ABA signaling in aleurone cells ...... 143 Figure 5-2. A proposed model of transcriptional control of a-amylase expression ...... 146 Figure 5-3. A hypothetical model of GA, SA and ABA signaling ...... 149

APPENDIX II CHAPTER 2 SUPPLEMENTAL TABLES AND FIGURES...... 156 Supplemental Figure 2-1. Conserved motifs in OsWRKY peptide sequences ...... 169

APPENDIX III CHAPTER 3 SUPPLEMENTAL FIGURES...... 173 Supplemental Figure 3-1. OsWRKY51 gene structure and its homologues in other plant species ...... 174

Vlll

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. LIST OF TABLES

APPENDIX I CHAPTER 1 SUPPLEMENTAL TABLE...... 156 Supplemental Table 1-1. The summary of published WRKY genes ...... 157

APPENDIX II CHAPTER 2 SUPPLEMENTAL TABLES AND FIGURES...... 158 Supplemental Table 2-1. Redundancy information of predicted OsWRKY genes 159 Supplemental Table 2-2. Summary of information on OsWRKY genes ...... 160 Supplemental Table 2-3. Annotation errors in OsWRKY genes ...... 162 Supplemental Table 2-4. The significant matched full-length cDNA of OsWRKY genes ...... 163 Supplemental Table 2-5. Chromosomal localizations of OsWRKY genes ...... 165 Supplemental Table 2-6. Primers for the preparation of gene specific probes ...... 167 Supplemental Table 2-7. Primers for the preparation of effector constructs ...... 168

APPENDIX IV CHAPTER 5 SUPPLEMENTAL TABLES...... 175 Supplemental Table 5-1. Rice transcription factor families ...... 176 Supplemental Table 5-2. The summary of gene finder programs ...... 181

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. ABBREVIATIONS

4-MU 4-methylumbelliferone ABA abscisic acid ABAPl ABA binding protein 1 ABE Avena binding factor ABI ABA insensitive ABRE ABA response element ahg2 ABA hypersensitive germination 2 Amy amylase At Arabidopsis thaliana BAG bacterial artificial chromosome bHLH basic Helix-Loop-Helix BiFC bimoleeular fluorescence complementation BLAST basic local alignment search tool bp base pair BPBF barley prolamine box binding factor calcium ion CaM calmodulin CaMBD calmodulin-binding domain CE coupling element cGMP cyclic guanosine monophosphate Chip chromatin immuno-precipitation CRS coding region sequences cyt cytoplasm DAE downstream amylase element DIG digoxigenin DGF DNA-binding with one finger EDTA Ethylene-diamine-tetra-acetic acid EmBP Em binding protein EMSA electrophoretic mobility-shift assay ER endoplasmic reticulum EST expressed sequence tag FL-cDNA full-length cDNA FRKl FLG22-induced receptor-like kinase 1 GA gibberellins Ga Gossypium arboreum

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. GAI gibberellin insensitive GAMYB GA-responsive Myb protein GARC GA responsive complex GARE GA response element GFP green fluoreseence protein GGDP geranylgeranyl diphosphate GIDl gibberelin insensitive dwarf 1 GID2 gibberelin insensitive dwarf 2 GSA beta-O-D-glucosylsalicylic acid GST glutathione S-transferase GUS beta-glucuronidase HIF hydroxylation motif H IF-la hypoxia-inducible factor 1 a HIS histidine HMM hidden Markov model HRT Hordeum repressor of transcription Hv Hordeum vulgare HVAl Hordeum vulgare ABA responsive gene 1 HVA22 Hordeum vulgare ABA responsive gene 22 HyB hydroxybenzoic acid iso isoamylase JA jasmonic aeid KGM kinase associated with GAMYB LEA late embryogenesis abundant Lt Larrea tridentate LUC luciferase LZ leueine-zipper motif MeJA methyl jasmonate MINI miniseed MKSl MAP kinase substrate 1 MUG 4-methylumbelliferyl-P-D-glucuronide trihydrate NLS nuclear localization signal NMR nuclear magnetic resonance Npr/Niml nonexpressor of PR genes 02S opaque-2 binding sequence ORF open reading frame Os Oryza sativa PARN poly(A)-specific ribonuclease PBF prolamine-box binding factors Pc Petroselinum crispum PCR polymerase chain reaction

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. pi isoeletric point PKABAl ABA induced protein kinase 1 PPA phosphatidic aeid PR pathogensis related Pyr pyrimidine box qRT-PCR quantitative reverse transcription PCR RAB response to ABA RAB21 response to ABA 21 RAmylA rice amylase lA RGA repressor of gal-3 RT-PCR reverse transcription PCR SA salicylic acid SAD scutellum and aleurone-expressed DOF SCF skp-cullin-F-box complex SE standard error SIRK senescence-induced reeeptor kinase SLNl slender barley 1 SERI slender rice 1 slyl sleepy 1 SUMO sumoylation motif SURE sugar responsive SUSIBA sugar signaling in barley T-DNA transferred DNA TTG2 transparent testa glabra 2 UBI ubiquitin VPl viviprarous 1 W51 OsWRKY51 W71 OsWRKY71 YEP yellow fluoreseence protein ZAPl zinc-dependent activator protein 1 zinc ion

Xll

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. ACKNOWLEDGEMENTS

I would like to acknowledge my dissertation advisor Jeffery Qingxi Shen for his

insightful guidanee and tremendous support. Dr. Shen not only taught me how to ask

questions and express ideas, but also showed me different ways to approaeh a research

problem. I learned from him to be persistent to accomplish any goal. I extend my great

gratitude to other members of my advisory committee. Dr s. Andrew Andres, Steven de

Belle, Dawn Neuman, Frank van Breukelen, and Chih-Hsiang Ho, for their extremely

valuable advice and kindest support.

I would like to thank my wife, Xia Wang for her great patience and understanding.

She is a constant source of inspiration and endless moral support. I thank all people of

Shen laboratory, especially Xiaolu Zou, Zhong-Lin Zhang and Paul Ruas for stimulating

discussions and technical support. I extend many thanks to Dr s. Roy H. Ogawa, Deborah

K. Hoshizaki, Daniel B. Thompson, Paul J. Schulte, Eduardo A. Robleto, Allen G. Gibbs

and Helen J. Wing for collaboration or critical reviewing of my manuscripts.

Financial support for this project was provided by USDA (02-35301-12066 to Jeffery

Q. Shen), NIH BRIN and INBRE (P20 RR16464 and P20 RRO16463 to the State of

Nevada), NSF EPSCoR (ACES to Zhen Xie), UNLV funds to Jeffery Q. Shen, UNLV

PIA (to Drs. Chih-Hsiang Ho, Roy Ogawa and Jeffery Q. Shen), UNLV Graduate

Student Association and the Department of Biologieal Sciences.

Xlll

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. CHAPTER 1

GENERAL INTRODUCTION

A seed represents an important developmental structure in higher plants. In most of

monocotyledonous plants, a seed consists of three distinct parts: embryo, endosperm and

seed coat. The embryo can be divided into the specialized absorptive organ (scutellum)

and the embryo proper, which includes shoot and root apical meristems, the first foliage

leaf and coleoptile. During seed development, the endosperm is differentiated into two

tissues: 1) the predominant starchy endosperm which is composed of thin-walled

nonliving cells filled with starch grains at maturity; and 2) one or a few peripheral

aleurone layer(s) consisting of a homogeneous population of aleurone cells with thick

primary cell walls and large number of protein bodies (Figure 1-1). The aleurone layer of

cereal grains is a highly differentiated secretory tissue and the main function of the

aleurone layer is to synthesize and secrete hydrolytie enzymes, principally a-amylases

into starchy endosperm in response to variant environmental signals and hormones, such

as GA, ABA and SA (Figure 1-2). The general foeus of my researeh is to dissect the

hormonal signal crosstalk between GA and ABA or between GA and SA, and identify

molecular components of these pathways in regulating a-amylase gene expression,

thereby modulating seed germination.

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Embryo Endosperm

Coleoptile

First leaf

Scutellum Aleurone layer

Shoot meristeiii CiA

Mobilized reser\es I Kdrolases (sugars) (H-amylascs) Root

Starchy endosperm

Figure 1-1. A schematic diagram of a germinating cereal seed. GA synthesized in the embryo is diffused into the aleurone layer and promotes the production of hydrolytic enzymes such as a-amylases and pro teases. a-Amylases and other hydrolytie enzymes are secreted into the starchy endosperm where they mobilize stored nutrient reserves in the endosperm and weaken the seed coat or the growth-constraining endosperm layer surrounding the embryo.

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 4'OH

GAi GA] GA4

HOHf y r Y J"' or

ABA (C2-cis, C4-trans isomer) SA (2-Hydroxy-benzoic Acid)

Figure 1-2. Structures of bioactive G A, ABA and SA.

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Gibberellic acid

G As are a large family of tetracyclic diterpene molecules. Over 136 G As have been

found in plants and fungi, but in most plant species, only GAi, GA 3 and G A 4 are

bioactive (Olszewski et al., 2002). As shown in Figure 1-3, the synthesis of bioactive

GAs essentially consists of the production of e«/-kaurene in the proplastid, the synthesis

of GA 12/53 in the ER, and the formation of active GAs in cytoplasm by successive

oxidation steps from GA 12/53 (Olszewski et ah, 2002). The biosynthesis of GA 12 can be

block by paclobutrazol, uniconazole and other inhibitors, which specifically suppress the

activity of P450 monooxygenases on ER (Hedden and Kamiya, 1997).

It has been shown that GA controls many aspects of plant growth and development,

including stem elongation, transition to flowering, pollen tube elongation, seed

development and seed germination (Olszewski et ah, 2002; Sun and Gubler, 2004). A

seed is considered germinated when any part of its embryo emerges and penetrates the

seed coat (Bewley and Black, 1994). GA has been implicated in three major steps

towards seed germination: 1) stimulating the production of hydrolytic enzymes to weaken

the seed coat or the growth-constraining endosperm layer surrounding the embryo; 2)

mobilizing stored nutrient reserves in the endosperm to provide energy for germination; 3)

activating the vegetative growth of the embryo to produce new shoots and roots (Bewley

and Black, 1994). The hydrolytic enzymes, such as a-amylases, are secreted from

aleurone cells and diffused into the endosperm where they degrade stored starches for

embryonic growth (Ritchie and Gilroy, 1998b; Lovegrove and Hooley, 2000).

Signal transduction mediating GA responses has been a topic of intensive research.

Soluble receptor for GA (gibberelin insensitive dwarf 1, GlDl) has been recently found

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. (Ueguchi-Tanaka et al., 2005; Nakajima et al., 2006), although cumulative evidence also

argues for the presence of plasma-membrane receptors (Hooley et al., 1991; Gilroy and

Jones, 1994; Ueguchi-Tanaka et al., 2005; Nakajima et al., 2006). As shown in Figure 1-4,

nucleus-located GIDl binds to the negative regulator, DELLA proteins (GAI, RGA,

SERI and SLNl) in a GA-dependent manner, triggering the degradation of these DELLA

proteins by proteasomes through an F-box protein (GID2 in rice or SLEEPY 1 in

Arabidopsis) mediated pathway (Borner et al., 1996; Peng et al., 1997; Silverstone et al.,

1997; Ikeda et al., 2001; McGinnis et al., 2003; Sasaki et al., 2003). GA might also be

recognized by an unknown receptor on the plasma membrane, leading to the activation of

G-proteins (Hooley, 1998) and enhancement of the concentrations of the cytoplasmic

cGMP (Penson et ah, 1996) and Ca^^ (Gilroy and Jones, 1992). During seed germination,

these early GA responses change the ratio of negative and positive regulators of

transcription. For example, GA induces a Myb transcription activator GAMYB, which in

turn promotes the expression of amylases, proteases and P-glucanases by directly binding

to the GA-response element (GARE) in their promoter regions (Cercos et ah, 1999;

Gubler et ah, 1999; Yazaki et ah, 2003). Besides GARE and 02S/W-box, pyrimidine box

(Pyr) and amylase box (Amy) are also required for high-level expression of the low pi a-

amylase gene, Amy32b (Skriver et ah, 1991; Cercos et ah, 1999). All these elements are

bound by one or more transcription factor(s) as shown in Figure 1-5. For example, both a

transcription activator (GAMYB) and a transcription repressor (HRT) can directly

interact with GARE (Gubler et ah, 1995; Raventos et ah, 1998). Several DOF proteins,

OsDofB, BPBF and SAD bind to the pyrimidine (Pyr) box (Diaz et ah, 2002; Isabel-

LaMoneda et ah, 2003; Washio, 2003). Three MYB proteins, OsMYBSl, OsMYBS2,

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. OPP Proplastid

geranylgeranyl e«t-kaurene diphosphate (GGDP) ÏI ..»» OH ER membrane

COoH

'«OH Cytoplasm

COpH COgH

GA4

Figure 1-3. Three stages of GA biosynthesis. The synthesis of bioactive GAs consists of three major stages: the production of gMt-kaurene in the proplastid, the synthesis of GA 12/53 on the ER membrane, and the formation of active GAs in cytoplasm by successive oxidation steps.

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. GA Extracellular Reeeptor Cytoplasm

M t

%GA cGMP & [Ca^+],y, changes GIDl

Nucleus

GA GIDl

DELLA ;-amylas^ Proteasome Seed GAMYB ;-amyias^ germination Degradation of DELLA proteins

Figure 1-4. A schematic model of GA signaling during seed germination. GA is perceived by an unknown receptor on plasma membrane. The activated G protein enhances the concentration of cGMP and Ca^^ in the cytoplasm. In the nucleus, GIDl binds to the negative regulator DELLA proteins in a GA-dependent manner, triggering the degradation of DELLA proteins by proteasomes through an F- box protein (GID2 or SLYl) mediated pathway. Induced GAMYB promotes the expression of hydrolases, such as amylases, which leads to seed germination.

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. ( hr ^

WRKYWRKY (^A M Y ^ TTGACTTGACC CCTTTT TAACAGA TATCCA r Amy3 2b Tandem repeat Pyr GARE Amy W-boxes

Figure 1-5. cA-Acting elements in the AmySlb promoter region. Amy32b is a low pi a-amylase gene in barley. Rectangles represent cA-acting elements with the consensus sequences. Names of the cA-acting elements are shown under the rectangles. Tandem repeat W-boxes: two tandem repeat W-boxes/02S boxes with a consensus sequence of (T/C)TGAC(C/T); Pyr: pyrimidine box; GARE: GA response element; and Amy: amylase box. Circles represent transcription factors bound to each cA-acting element.

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. OsMYBS3 from rice bind to the amylase (Amy) box (Lu et al., 2002). Two WRKY

proteins from wild oat (ABFl and ABF2) were reported to bind to W-boxes (Rushton et

ah, 1995).

The crosstalk of gibberellin and abscisic acid

ABA is a 15-carbon sesquiterpenoid carboxylic acid that is ubiquitous in lower and

higher plants (Figure 1-2). This hormone plays a variety of roles in plant development,

bud and seed dormancy, germination, cell division and movement, leaf senescence and

abscission, and cellular response to environmental stresses (Leung and Giraudat, 1998;

Zhu, 2002). In addition, ABA blocks a number of GA regulated processes in plants, such

as flowering, leaf growth and seed germination (Sun and Gubler, 2004). The details of

ABA signaling have been summarized in my review article (Xie et ah, 2005).

The crosstalk between GA and ABA in regulating seed germination and dormancy

has been intensively studied (Nambara and Marion-Poll, 2003). During seed development,

ABA is perceived by a receptor ABAPl on the plasma membrane and induces the

accumulation of many kinds of proteins, such as storage proteins and late embryogenesis

abundant (LEA) proteins, hence promoting seed dormancy (Shen et ah, 1996; Bethke et

ah, 1997; Razem et ah, 2004). In germinating seeds, the level of ABA drops to the lowest

while the level of GA increases to induce a-amylase gene expression in aleurone cells

(Nambara and Marion-Poll, 2003). However, application of exogenous ABA blocks GA

induction of a-amylases expression and leads to seed dormancy (Sun and Gubler, 2004).

How does ABA block GA induction of a-amylases? ABA is implicated to act

downstream of SLNl to suppress GA induction of a-amylases (Figure 1-6). This

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. conclusion is based on two observations: 1) ABA is still capable of blocking a-amylase

gene expression in the SLNl knock-out mutant; and 2) ABA cannot block GA-induced

SLNl degradation (Fu et al., 2002). The crosstalk of GA and ABA signaling is mediated

by secondary messengers. For instance, application of phosphatidic acid (PPA) to barley

aleurone cells inhibits GA-induced a-amylase production, and promotes the expression of

ABA-inducible amylase inhibitors and RAB (response to ABA) proteins (Ritchie and

Gilroy, 1998a). The discovery of an ABA inducible protein kinase (PKABAl) provides a

link between GA and ABA signal transduction pathways (Gomez-Cadenas et al., 1999;

Gomez-Cadenas et al., 2001). Although PKABAl has little activity on regulating the

expression of ABA-inducible HVAl and HVA22 genes, it almost completely suppresses

the GA induced expression of a-amylase and protease genes, indicating that the ABA

repression pathway in seed germination is independent on the ABA induction pathway

(Zentella et ah, 2002). However, GA-induction and ABA-suppression of the a-amylase

gene expression in barley aleurone cells appear to be dependent on the same set of cis-

acting elements in the amylase promoter (Lanahan et ah, 1992). An intriguing question is

at which site the ABA suppression on the GA signaling pathway is exerted. Recent data

indicate that PKABAl acts upstream from the formation of functional GAMYB but

downstream from the site of action of the SLNl (Gomez-Cadenas et ah, 2001). However,

there is more than one pathway mediating the suppression of GA signaling by PKABAl

because PKABAl RNA interference does not hamper the inhibitory effect of ABA on the

expression of a-amylase (Zentella et ah, 2002).

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Extracellular Receptor ABAPl Cytoplasm

cGMP & [Ca'leyt changes (Gim) PKABAl

Nucleus

I j^^pGID2/SLYI j GIDl ( SLNlJ) < / ( 6 ^ ► dormancy SLNl Storage 1 Proteasome

GAMY^ ► (^^mylas^ ► germination Degradation of SLNl proteins

Figure 1-6. A schematic model of GA and ABA signaling in aleurone cells. GA signaling cascade is described in Figure 1-4. Briefly, GA is perceived by soluble receptor GIDl, which leads to the degradation of DELLA proteins such as SLNl and induction of transactivators such as GAMYB. The expression of a-amylases is induced by GAMYB, resulting in seed germination. ABA is perceived by a receptor ABAPl on plasma membrane, which might increase the level of PPA and change the concentrations of cGMP and Ca^^ in cytoplasm, hence inhibiting a-amylase production and enhancing the expression level of RAB genes. An ABA-induced protein kinase, PKABAl acts upstream from the formation of functional GAMYB but downstream from the site of action of SLNl to block GA-induced a-amylase expression. A PKABAl-independent pathway might exist to suppress GA- and GAMYB-induced a-amylase expression. ABA also increases the expression level of genes encoding storage and LEA proteins, thereby causing seed dormancy.

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. The crosstalk of gibberellin and salicylic acid

Salicylic acid (SA) is another plant hormone characterized by an aromatic ring

bearing a hydroxyl group (Figure 1-2). SA has been shown to be present in leaves,

reproductive structures, and tissues infected with pathogens of a large number of plant

species (Raskin, 1992). Free SA can be transported, metabolized and conjugated, and the

ratio of free SA versus conjugated SA in plants might be determined by the efficiency

and speed of the conjugation process (Raskin, 1992). For example, biosynthesized SA in

rice remains as a free acid for a long time, while endogenously produced SA in tobacco is

quickly converted to conjugated form such as P-O-D-glucosylsalicylic acid (GSA)

(Raskin, 1992; Silverman et al., 1995).

SA plays an essential role in the systemic acquired resistance (Raskin, 1992). Upon

infection of pathogens, the elevated endogenous level of SA triggers the expression of

genes encoding the pathogensis-related (PR) proteins and the activation of disease

resistance (Shah, 2003). It has been shown that the crosstalk between SA and ABA is

essential for plant adaptation to simultaneously occurring abiotic and biotic stresses

(Kunkel and Brooks, 2002; Mauch-Mani and Mauch, 2005). SA is implicated to

antagonize GA effects in several aspects, such as trichome development and seed

germination (Guan and Scandalios, 1995; Traw and Bergelson, 2003; Nishimura et al.,

2005). Biosynthesis of ABA inducible proteins, such as 12S globulin subunits, LEA

proteins, dehydrins and heat shock proteins, are enhanced by SA treatment during the

early period of imbibition (Rajjou et al., 2006). Nevertheless, how SA inhibits GA

induction of germination is still largely unknown.

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. WRKY transcription factors

Two WRKY proteins (ABFl and ABF2) in wild oat bind a cA-element called

02S/W-box in the a-amylase promoter (Rushton et ah, 1995). Beeause 02S/W-box is

essential for the high-level GA induction of a-amylase gene expression, we were

intrigued to study the function of WRKY proteins in regulating the expression of a-

amylases in response to hormones.

WRKY genes has been found in a variety of plant species (Ulker and Somssich, 2004).

The WRKY family has 74 members in Arabidopsis and over 80 members in rice (Eulgem

et al., 2000; Ulker and Somssich, 2004; Xie et al., 2005). Amino acid sequence

alignments reveal that each WRKY protein contains one or two highly conserved WRKY

domain(s) that are involved in its binding to a special DNA sequence motif

(C/T)TGAC(T/C), known as a W-box (Chen and Chen, 2000; Cormack et al., 2002;

Robatzek and Somssich, 2002). Fewer WRKY genes have been identified from lower

plants, such as ferns (Cemtopteris richardii) and mosses {Physcomitrella patens), but no

WRKY gene has been found in animals (Ulker and Somssich, 2004). Furthermore, only

double-domain WRKY genes are identified in green alga {Chlamydomonas reinhardtti),

slime mold (Dictyostelium discoideum) and protist (Giardia lamblia), indicating that

WRKY genes might originate from an ancestral gene containing double-domain WRKY

genes at about 1.5-2 billion years ago (Ulker and Somssich, 2004).

As shown in Supplemental Table 1-1, WRKY proteins play key roles in the

regulation of pathogen defense, and responses to wounding, senescence, cold and drought

(Eulgem et al., 1999; Hara et al., 2000; Hinderhofer and Zentgraf, 2001; Robatzek and

Somssich, 2001; Huang and Duman, 2002; Rizhsky et al., 2002; Mare et al., 2004). In

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. plant species tested, the expression of WRKY genes is strongly up-regulated in response

to biotic and abiotic stresses, senescence and SA treatment (Eulgem et al., 2000). For

example, about two thirds of WRKY genes in Arabidopsis are responsive to elicitors,

pathogen or SA treatment (Dong et al., 2003). These results suggest that stresses might

play a central role in the expansion of the WRKY gene family in higher plants.

Nevertheless, the function of WRKY proteins is highly diverse. AtWRKY70 was

identified as a connection node of SA and jasmonic acid signaling (Li et al., 2004).

TTG2/AtWRKY44 plays a key role in trichome development (Johnson et al., 2002). A

WRKY protein in cotton, GaWRKYl is involved in regulating sesquiterpene

biosynthesis (Xu et al., 2004). It has been shown that MlNB/AtWRKYlO mediates the

regulation of seed size in Arabidopsis (Luo et al., 2005). A WRKY gene from creosote

bush {Larrea tridentate), LtWRKY21 encodes an activator of the ABA signaling (Zou et

al., 2004). A WRKY protein called SUSIBA2 is involved in sugar signaling in barley by

binding to the sugar-responsive elements of the isol promoter (Sun et al., 2003).

The transient expression assay using barley aleurone cells

Because hormones such as GA and ABA are synthesized in embryos of seeds, not in

the aleurone cells, deembryoed half seeds with only aleurone layers and starchy

endosperms provide a convenient system to study a-amylase gene expression in response

to hormones (Bethke et al., 1997). Briefly, this transient expression assay is composed of

the following three steps: 1) preparing effector and P-glucuronidase (GUS) reporter

constructs; 2) introducing these constructs into aleurone cells by the particle co

bombardment; 3) quantitatively testing GUS enzyme activities in response to exogenous

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. hormone treatments. In this study, high concentrations of exogenous G A 3 (1 pM) and

ABA (20 pM) are used to treat aleurone cells in transient expression assay. Although

these concentrations are about 1 0 ^ ~ 1 0 ^ higher than the endogenous levels of GA and

ABA, the response of a-amylases in barley aleurone cells to 1 pM GA 3 and 20 pM ABA

is similar to that in developing or germinating seeds (Green et al., 1997; Chandler and

Robertson, 1999). These results indicate that aleurone cells might only uptake and

response to a small portion of exogenously applied hormones. Barley aleurone cells are

used in this assay because the expression level of the reporter construct in the rice

aleurone cells is typically 1 0 times lower than that obtained in barley aleurone cells,

hence lowering the sensitivity of detecting the difference of expression levels (Sutoh and

Yamauchi, 2003; Washio, 2003; Zhang et al., 2004). It is generally believed that similar

(if not identical) GA pathways are operating in different plant species. Indeed, a partial

GA response pathway integrating GA signaling molecules from different plant species

has been outlined in two elegant reviews (Olszewski et al., 2002; Sun and Gubler, 2004).

We have shown that in barley aleurone cells, OsPKABAl functions as effectively as

TaPKABAI on suppressing GA induction of AmyS2b (Zhang et al., 2004). Likewise,

OsGAMYB transactivates, as effectively as HvGAMYB, the expression of the Amy32b

gene in barley aleurone layers (Zhang et al., 2004). GARE and Amy box are highly

conserved in the a-amylase promoters of barley, wheat, and rice (Huang et al., 1990;

O'Neill et al., 1990; Itoh et al., 1995). Indeed, the wheat protease promoter has been

shown to be responsible to GA in barley aleurone cells (Mena et al., 2002; Isabel-

LaMoneda et al., 2003), and rice effecter genes are functional in barley aleurone cells

(Gubler et al., 1997; Lu et al., 2002). Finally, just as in barley, oat, and wheat, W-box

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. (with a TGAC core) is present in the promoters of several rice a-amylase genes, such as

OsAmylA, OsAmylB, OsAmy3A, OsAmy3D, and OsAmy3E (Zhang, Xie and Shen,

unpublished). Therefore, this transient expression assay is an efficient approach to study

rice gene functions in barley aleurone cells.

The scope of the dissertation

The aim of this research is to study how WRKY genes mediate GA, ABA and SA

signaling in regulating seed germination. Our studies start from identification of WRKY

genes in the rice genome by computer analyses, followed by functional analyses of

WRKY genes in GA-, ABA- and SA-regulated a-amylase expression in aleurone cells.

Chapter 2 describes a comprehensive computational analysis of the 81 rice WRKY

genes. Phylogenetic studies of WRKY domain sequences suggests that gene duplication

of single- and double-domain WRKY genes and loss of the WRKY domain occurred in

the evolutionary history of this gene family in rice. Among four ABA-inducible WRKY

genes found in aleurone cells, two activators and two repressors in ABA signaling are

found by using a transient expression system.

In Chapter 3, I report the co-regulation of OsWRKYSl and OsWRKY71 in embryos

and aleurone cells of rice seeds by ABA and GA. OsWRKY51 and OsWRKYVI

physically interacts in the nuelei to synergistically suppress the induction of Amy32b by

GA. Unlike OsWRKYVI, OsWRKY51 itself does not bind to the W-boxes in the

Amy32b promoter. Instead, it enhances the binding affinity of OsWRKYVI to the W-

boxes. Based on our observations, we propose the roles of OsWRKYSI and OsWRKYVI

in mediating the crosstalk of GA and ABA signaling in aleurone cells.

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Chapter 4 provides evidence of the crosstalk between GA and SA in regulating barley

seed germination. I show that SA inhibited barley seed germination and post-germination

growth, as well as GA-induced of amylase production. This suppression effect was

unlikely due to block of amylase secretion or inhibition of enzyme activity. SA likely

suppresses GA-induced a-amylase expression. An SA-inducible and GA suppressible

barley WRKY gene, HvWRKY38 (a putative ortholog of OsWRKY? 1) suppresses GA

induction of a-amylase expression. Therefore, SA might exert its suppressing activity on

seed germination through enhancing HvWRKY38 expression, which in turn blocks GA

induction of a-amylase expression.

References

Andreasson, E., Jenkins, T., Brodersen, P., Thorgrimsen, S., Petersen, N.H., Zhu, S., Qiu, J.L., Micheelsen, P., Rocher, A., Petersen, M., Newman, M.A., Bjom Nielsen, H., Hirt, H., Somssich, I., Mattsson, O., and Mundy, J. (2005). The MAP kinase substrate MKSl is a regulator of plant defense responses. Embo J 24, 2579-2589.

Asai, T., Tena, G., Plotnikova, J., Willmann, M.R., Chiu, W.L., Gomez-Gomez, L., Boiler, T., Ausubel, P.M., and Sheen, J. (2002). MAP kinase signaling cascade in Arabidopsis innate immunity. Nature 415, 977-983.

Ashida, Y., Nishimoto, M., Matsushima, A., Watanabe, J., and Hirata, T. (2002). Molecular cloning and mRNA expression of geraniol-inducible genes in cultured shoot primordia of Matricaria chamomilla. Biosci Biotechnol Biochem 66, 2511- 2514.

Bethke, P.C., Schuurink, R., Jones, R.J., and Hooley, R. (1997). Hormonal signalling in cereal aleurone. J of Exp Bot 48, 1337-1356.

Bewley, J.D., and Black, M. (1994). Seeds; physiology of developments and germination. (New York: Plenum Press).

Borner, A., Plaschke, J., Korzun, V., and Worland, A.J. (1996). The relationships between the dwarfing genes of wheat and rye. Euphytica 89, 69-75.

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Cercos, M., Gomez-Cadenas, A., and Ho, T.H. (1999). Hormonal regulation of a cysteine proteinase gene, EPB-1, in barley aleurone layers: cis- and trans-acting elements involved in the coordinated gene expression regulated by gibberellins and abscisic acid. Plant J 19, 107-118.

Chandler, P.M., and Robertson, M. (1999). Gibberellin dose-response eurves and the characterization of dwarf mutants of barley. Plant Physiol. 120, 623-632.

Chen, C., and Chen, Z. (2000). Isolation and characterization of two pathogen- and salicylic acid-induced genes encoding WRKY DNA-binding proteins from tobacco. Plant Mol Biol 42, 387-396.

Chen, C., and Chen, Z. (2002). Potentiation of developmentally regulated plant defense response by AtWRKY18, a pathogen-induced Arabidopsis transcription factor. Plant Physiol 129, 706-716.

Cormack, R.S., Eulgem, T., Rushton, P.J., Kochner, P., Hahlbrock, K., and Somssich, I.E. (2002). Leucine zipper-containing WRKY proteins widen the spectrum of immediate early elicitor-induced WRKY transcription factors in parsley. Biochim Biophys Acta 1576, 92-100.

de Pater, S., Greco, V., Pham, K., Memelink, J., and Kijne, J. (1996). Characterization of a zinc-dependent transcriptional activator from Arabidopsis. Nucleic Acids Res 24, 4624-4631.

Deslandes, L., Olivier, J., Theulieres, P., Hirsch, J., Feng, D.X., Bittner-Eddy, P., Beynon, J., and Marco, Y. (2002). Resistance to Ralstonia solanacearum in Arabidopsis thaliana is conferred by the recessive RRSl-R gene, a member of a novel family of resistance genes. PNAS USA 99, 2404-2409.

Diaz, 1., Vicente-Carbajosa, J., Abraham, Z., Martinez, M., Isabel-La Moneda, L, and Carbonero, P. (2002). The GAMYB protein from barley interacts with the DOE transcription factor BPBF and activates endosperm-specific genes during seed development. Plant J 29, 453-464.

Dong, L, Chen, C., and Chen, Z. (2003). Expression profiles of the Arabidopsis WRKY gene superfamily during plant defense response. Plant Mol Biol 51, 21-37.

Eulgem, T., Rushton, P.J., Robatzek, S., and Somssich, I.E. (2000). The WRKY superfamily of plant transcription factors. Trends Plant Sci 5, 199-206.

Eulgem, T., Rushton, P.J., Schmelzer, E., Hahlbrock, K., and Somssich, I.E. (1999). Early nuclear events in plant defence signalling: rapid gene activation by WRKY transcription factors. EMBO J 18, 4689-4699.

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Fu, X., Richards, D.E., Ait-Ali, T., Hynes, L.W., Ougham, H., Peng, J., and Harberd, N.P. (2002). Gibberellin-mediated proteasome-dependent degradation of the barley DELLA protein SLNl repressor. Plant Cell 14, 3191-3200.

Gilroy, S., and Jones, R.L. (1992). Gibberellic acid and abscisic acid coordinately regulate cytoplasmic calcium and secretory activity in barley aleurone protoplasts. PNAS USA 89,3591-3595.

Gilroy, S., and Jones, R.L. (1994). Perception of gibberellin and abscisic acid at the external face of the plasma membrane of barley (Hordeum vulgare L.) aleurone protoplasts. Plant Physiol 104, 1185-1192.

Gomez-Cadenas, A., Zentella, R., Walker-Simmons, M.K., and Ho, T.H.D. (2001). Gibberellin/abscisic acid antagonism in barley aleurone cells: site of action of the protein kinase PKABAl in relation to gibberellin signaling molecules. Plant Cell 13, 667-679.

Gomez-Cadenas, A., Verhey, S.D., Holappa, L.D., Shen, Q., Ho, T.H.D., and Walker- Simmons, M.K. (1999). An abscisic acid-induced protein kinase, PKABAl, mediates abscisic acid-suppressed gene expression in barley aleurone layers. PNAS USA 96, 1767-1772.

Green, L.S., Faergestad, E.M., Poole, A., and Chandler, P.M. (1997). Grain Development Mutants of Barley ([alpha]-Amylase Production during Grain Maturation and Its Relation to Endogenous Gibberellic Acid Content). Plant Physiol 114, 203-212.

Guan, L., and Scandalios, J.G. (1995), Developmentally related responses of maize catalase genes to salicylic acid. PNAS USA 92, 5930-5934.

Gubler, F., Kalla, R., Roberts, J.K., and Jacobsen, J.V. (1995). Gibberellin-regulated expression of a myb gene in barley aleurone cells: evidence for Myb transactivation of a high-pl alpha-amylase gene promoter. Plant Cell 7, 1879-1891.

Gubler, F., Raventos, D., Keys, M., Watts, R., Mundy, J., and Jacobsen, J.V. (1999). Target genes and regulatory domains of the GAMYB transcriptional activator in cereal aleurone. Plant J. 17, 1-9.

Gubler, F., Watts, R.J., Kalla, R., Matthews, P., Keys, M., and Jacobsen, J.V. (1997). Cloning of a rice cDNA encoding a transcription factor homologous to barley GAMYB. Plant Cell Physiol 38, 362-365.

Hara, K., Yagi, M., Kusano, T., and Sano, H. (2000). Rapid systemic accumulation of transcripts encoding a tobacco WRKY transcription factor upon wounding. Mol Gen Genet 263, 30-37.

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Hedden, P., and Kamiya, Y. (1997). Gibberellin biosynthesis: enzymes, genes and their regulation. Annu Rev Plant Physiol Plant Mol Biol 48, 431-460.

Hinderhofer, K., and Zentgraf, U. (2001). Identification of a transcription factor specifically expressed at the onset of leaf senescence. Planta 213, 469-473.

Hooley, R. (1998). Plant hormone perception and action: a role for G-protein signal transduetion? Philos Trans R Soc Lond B Biol Sci 353,1425-1430.

Hooley, R., Beale, M.H., and Smith, S.J. (1991). Gibberellin perception at the plasma membrane of Avena fatua aleurone protoplasts. Planta 183, 274-280.

Huang, N., Koizumi, N., Reinl, S., and Rodriguez, R.L. (1990). Structural organization and differential expression of rice alpha-amylase genes. Nucleic Acids Res 18, 7007- 7014.

Huang, T., and Duman, J.G. (2002). Cloning and characterization of a thermal hysteresis (antifreeze) protein with DNA-binding activity from winter bittersweet nightshade, Solanum dulcamara. Plant Mol Biol 48, 339-350.

Ikeda, A., Ueguchi-Tanaka, M., Sonoda, Y., Kitano, H., Koshioka, M., Futsuhara, Y., Matsuoka, M., and Yamaguchi, J. (2001). slender rice, a constitutive gibberellin response mutant, is caused by a null mutation of the SLRl gene, an ortholog of the height-regulating gene GAl/RGA/RHT/D8. Plant Cell 13, 999-1010.

Isabel-LaMoneda, 1., Diaz, 1., Martinez, M., Mena, M., and Carbonero, P. (2003). SAD: a new DOF protein from barley that activates transcription of a cathepsin B-like thiol protease gene in the aleurone of germinating seeds. Plant J 33, 329-340.

Ishiguro, S., and Nakamura, K. (1994). Characterization of a cDNA encoding a novel DNA-binding protein, SPFl, that recognizes SP8 sequences in the 5' upstream regions of genes coding for sporamin and beta-amylase from sweet potato. Mol Gen Genet 244, 563-571.

Itoh, K., Yamaguchi, J., Huang, N., Rodriguez, R.L., Akazawa, T., and Shimamoto, K. (1995). Developmental and hormonal regulation of rice a-amylase (RAmylA)-gusA fusion genes in transgenic rice seeds. Plant Physiol 107, 25-31.

Johnson, C.S., Kolevski, B., and Smyth, D R. (2002). TRANSPARENT TESTA GLABRA2, a trichome and seed coat development gene of Arabidopsis, encodes a WRKY transcription factor. Plant Cell 14, 1359-1375.

Kunkel, B.N., and Brooks, D.M. (2002). Crosstalk between signaling pathways in pathogen defense. Curr Opin Plant Biol 5, 325-331.

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Lagace, M., and Matton, D P. (2004). Characterization of a WRKY transcription factor expressed in late torpedo-stage embryos of Solanum chacoense. Planta 219, 185-189.

Lanahan, M.B., Ho, T.H.D., Rogers, S.W., and Rogers, J.C. (1992). A gibberellin response complex in cereal alpha-amylase gene promoters. Plant Cell 4, 203-211.

Leung, J., and Giraudat, J. (1998). Abscisic acid signal transduction. Annu Rev Plant Physiol Plant Mol Biol 49, 199-222.

Li, J., Brader, G., and Palva, E.T. (2004). The WRKY70 transcription factor: a node of convergence for jasmonate-mediated and salicylate-mediated signals in plant defense. Plant Cell 16,319-331.

Liu, X., Bai, X., Wang, X., and Chu, C. (2006). OsWRKY71, a rice transcription factor, is involved in rice defense response. J Plant Physiol, doi: 10.1016 / j.jplph. 2006.1007.1006.

Liu, X.Q., Bai, X.Q., Qian, Q., Wang, X.J., Chen, M.S., and Chu, C.C. (2005). OsWRKY03, a rice transcriptional activator that functions in defense signaling pathway upstream of OsNPRl. Cell Res 15, 593-603.

Lovegrove, A., and Hooley, R. (2000). Gibberellin and abscisic acid signalling in aleurone. Trends Plant Sci 5, 102-110.

Lu, C.A., Ho, T.H.D., Ho, S.L., and Yu, S.M. (2002). Three novel MYB proteins with one DNA binding repeat mediate sugar and hormone regulation of alpha-amylase gene expression. Plant Cell 14, 1963-1980.

Luo, M., Dennis, E.S., Berger, F., Peacock, W.J., and Chaudhury, A. (2005). MIN1SEED3 (M1NI3), a WRKY family gene, and HA1KU2 (IKU2), a leucine-rich repeat (LRR) KINASE gene, are regulators of seed size in Arabidopsis. PNAS USA 102, 17531-17536.

Mare, C., Mazzucotelli, E., Crosatti, C., Francia, E., Stanca, A.M., and Cattivelli, L. (2004). Hv-WRKY38: a new transcription factor involved in cold- and drought- response in barley. Plant Mol Biol 55, 399-416.

Mauch-Mani, B., and Mauch, F. (2005). The role of abscisic acid in plant-pathogen interactions. Curr Opin Plant Biol 8, 409-414.

Mena, M., Cejudo, F.J., Isabel-Lamoneda, 1., and Carbonero, P. (2002). A role for the DOF transcription factor BPBF in the regulation of gibberellin-responsive genes in barley aleurone. Plant Physiol 130, 111-119.

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. McGinnis, K.M., Thomas, S.G., Soule, J.D., Strader, L.C., Zale, J.M., Sun, T.P., and Steber, C.M. (2003). The Arabidopsis SLEEPYl gene encodes a putative F-Box subunit of an SCF E3 ubiquitin ligase. Plant Cell 15, 1120-1130.

Miao, Y., Laun, T., Zimmermann, P., and Zentgraf, U. (2004). Targets of the WRKY53 transcription factor and its role during leaf senescence in Arabidopsis. Plant Mol Biol 55,853-867.

Nakajima, M., Shimada, A., Takashi, Y., Kim, Y.C., Park, S.H., Ueguchi-Tanaka, M., Suzuki, H., Katoh, E., luchi. S., Kobayashi, M., Maeda, T., Matsuoka, M., and Yamaguchi, I. (2006). Identification and characterization of Arabidopsis gibberellin receptors. Plant J 46, 880-889.

Nambara, E., and Marion-Poll, A. (2003). ABA action and interactions in seeds. Trends Plant Sci 8,213-217.

Nishimura, N., Kitahata, N., Seki, M., Narusaka, Y., Narusaka, M., Kuromori, T., Asami, T., Shinozaki, K., and Hirayama, T. (2005). Analysis of ABA hypersensitive germination! revealed the pivotal functions of PARN in stress response in Arabidopsis. Plant J 44, 972-984.

Noutoshi, Y., Ito, T., Seki, M., Nakashita, H., Yoshida, S., Marco, Y., Shirasu, K., and Shinozaki, K. (2005). A single amino acid insertion in the WRKY domain of the Arabidopsis TIR-NBS-LRR-WRKY-type disease resistance protein SLHl (sensitive to low humidity 1) causes aetivation of defense responses and hypersensitive cell death. Plant J 43, 873-888.

Oh, S.K., Yi, S.Y., Yu, S.H., Moon, J.S., Park, J.M., and Choi, D. (2006). CaWRKY2, a chili pepper transcription factor, is rapidly induced by incompatible plant pathogens. Mol Cells 22, 58-64.

Olszewski, N., Sun, T.P., and Gubler, F. (2002). Gibberellin signaling: biosynthesis, catabolism, and response pathways. Plant Cell 14, S61-S80.

O'Neill, S.D., Kumagai, M.H., Majumdar, A., Huang, N., Sutliff, T.D., and Rodriguez, R.L. (1990). The alpha-amylase genes in Oryza sativa: characterization of cDNA clones and mRNA expression during seed germination. Mol Gen Genet 221, 235-244.

Park, C.J., Shin, Y.C., Lee, B.J., Kim, K.J., Kim, J.K., and Pack, K.H. (2006). A hot pepper gene encoding WRKY transcription factor is induced during hypersensitive response to tobacco mosaic virus and Xanthomonas campestris. Planta 223, 168-179.

Park, C.Y., Lee, J.H., Yoo, J.H., Moon, B.C., Choi, M.S., Kang, Y.H., Lee, S.M., Kim, H.S., Kang, K.Y., Chung, W.S., Lim, C.O., and Cho, M.J. (2005). WRKY group lid transcription factors interact with calmodulin. FEBS Lett 579, 1545-1550.

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Peng, J., Carol, P., Richards, D.E., King, K.E., Cowling, R.J., Murphy, G.P., and Harberd, N.P. (1997). The Arabidopsis GAI gene defines a signaling pathway that negatively regulates gibberellin responses. Genes Dev 11, 3194-3205.

Penson, S.P., Schuurink, R.C., Path, A., Gubler, F., Jacobsen, J.V., and Jones, R.L. (1996). cGMP is required for gibberellic acid-induced gene expression in barley aleurone. Plant Cell 8, 2325-2333.

Pnueli, L., Hallak-Herr, E., Rozenberg, M., Cohen, M., Goloubinoff, P., Kaplan, A., and Mittler, R. (2002). Molecular and biochemical mechanisms associated with dormancy and drought tolerance in the desert legume Retama raetam. Plant J 31, 319-330.

Rajjou, L., Belghazi, M., Huguet, R., Robin, C., Moreau, A., Job, C., and Job, D. (2006). Proteomic investigation of the effect of salicylic acid on Arabidopsis seed germination and establishment of early defense mechanisms. Plant Physiol 141, 910- 923.

Raskin, 1. (1992). Role of salicylic acid in plants. Annu Rev Plant Physiol Plant Mol Biol 43, 439-463.

Raventos, D., Skriver, K., Schlein, M., Kamahl, K., Rogers, S.W., Rogers, J.C., and Mundy, J. (1998). HRT, a novel zinc finger, transcriptional repressor from barley. J Biol Chem 273, 23313-23320.

Razem, F.A., Luo, M., Liu, J.H., Abrams, S.R., and Hill, R.D. (2004). Purification and characterization of a barley aleurone abscisic acid-binding protein. J Biol Chem 279, 9922-9929.

Ritchie, S., and Gilroy, S. (1998a). Abscisic acid signal transduction in the barley aleurone is mediated by phospholipase D activity. PNAS USA 95, 2697-2702.

Ritchie, S., and Gilroy, S. (1998b). Gibberellins: regulating genes and germination. New Phytol 140, 363-383.

Rizhsky, L., Liang, H., and Mittler, R. (2002). The combined effect of drought stress and heat shock on gene expression in tobacco. Plant Physiol 130, 1143-1151.

Rizhsky, L., Davletova, S., Liang, H., and Mittler, R. (2004). The zinc finger protein Zatl2 is required for cytosolic ascorbate peroxidase 1 expression during oxidative stress in Arabidopsis. J Biol Chem 279, 11736-11743.

Robatzek, S., and Somssich, I.E. (2001). A new member of the Arabidopsis WRKY transcription factor family, AtWRKY6, is associated with both senescence- and defence-related processes. Plant J 28, 123-133.

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Robatzek, S., and Somssich, I.E. (2002). Targets of AtWRKY6 regulation during plant senescence and pathogen defense. Genes Dev 16, 1139-1149.

Rushton, P.J., Macdonald, H., Huttly, A.K., Lazarus, C.M., and Hooley, R. (1995). Members of a new family of DNA-binding proteins bind to a conserved cw-element in the promoters of alpha-Amy2 genes. Plant Mol Biol 29, 691-702.

Sasaki, A., Itoh, H., Gomi, K., Ueguchi-Tanaka, M., Ishiyama, K., Kobayashi, M., Jeong, D.H., An, G., Kitano, H., Ashikari, M., and Matsuoka, M. (2003). Accumulation of phosphorylated repressor for gibberellin signaling in an E-box mutant. Science 299, 1896-1898.

Shah, J. (2003). The salicylic acid loop in plant defense. Curr Opin Plant Biol 6, 365-371.

Shen, Q., Zhang, P., and Ho, T.H.D. (1996). Modular nature of abscisic acid (ABA) response complexes: composite promoter units that are necessary and sufficient for ABA induction of gene expression in barley. Plant Cell 8, 1107-1119.

Silverman, P., Seskar, M., Kanter, D., Schweizer, P., Metraux, J.P., and Raskin, 1. (1995). Salicylic acid in rice (biosynthesis, conjugation, and possible Role). Plant Physiol 108,633-639.

Silverstone, A.L., Mak, P.Y., Martinez, E C., and Sun, T.P. (1997). The new RGA locus encodes a negative regulator of gibberellin response in Arabidopsis thaliana. Genetics 146, 1087-1099.

Skriver, K., Olsen, F.L., Rogers, J.C., and Mundy, J. (1991). cw-Acting DNA elements responsive to gibberellin and its antagonist abscisic acid. PNAS USA 88, 7266-7270.

Sun, C., Hoglund, A.S., Olsson, H., Mangelsen, E., and Jansson, C. (2005). Antisense oligodeoxynucleotide inhibition as a potent strategy in plant biology: identification of SUS1BA2 as a transcriptional activator in plant sugar signalling. Plant J 44, 128- 138.

Sun, C., Palmqvist, S., Olsson, H., Boren, M., Ahlandsberg, S., and Jansson, C. (2003). A novel WRKY transcription factor, SUS1BA2, participates in sugar signaling in barley by binding to the sugar-responsive elements of the isol promoter. Plant Cell 15, 2076-2092.

Sun, T.P., and Gubler, F. (2004). Molecular mechanism of gibberellin signaling in plants. Annu Rev Plant Physiol Plant Mol Biol 55, 197-223.

Sutoh, K., and Yamauchi, D. (2003). Two cis-acting elements necessary and sufficient for gibberellin-upregulated proteinase expression in rice seeds. Plant J 34, 635-645.

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Traw, MB., and Bergelson, J. (2003). Interactive effects of jasmonic acid, salicylic acid, and gibberellin on induction of trichomes in Arabidopsis. Plant Physiol 133, 1367- 1375.

Turck, F., Zhou, A., and Somssich, I.E. (2004). Stimulus-dependent, promoter-specific binding of transcription factor WRKYl to its native promoter and the defense-related gene PcPRl-1 in Parsley. Plant Cell 16, 2573-2585.

Ueguchi-Tanaka, M., Ashikari, M., Nakajima, M., Itoh, H., Katoh, E., Kobayashi, M., Chow, T.Y., Hsing, Y.I., Kitano, H., Yamaguchi, 1., and Matsuoka, M. (2005). GIBBERELLIN INSENSITIVE DWARF I encodes a soluble receptor for gibberellin. Nature 437, 693-698.

Ulker, B., and Somssich, I.E. (2004). WRKY transcription factors: from DNA binding towards biological function. Curr Opin Plant Biol 7, 491-498.

Washio, K. (2003). Functional dissections between GAMYB and Dof transcription factors suggest a role for protein-protein associations in the gibberellin-mediated expression of the RAmylA gene in the rice aleurone. Plant Physiol 133, 850-863.

Willmott, R.L., Rushton, P.J., Hooley, R., and Lazarus, C.M. (1998). DNase 1 footprints suggest the involvement of at least three types of transcription factors in the regulation of alpha-Amy2/A by gibberellin. Plant Mol Biol 38, 817-825.

Xie, Z., Ruas, P., and Shen, Q.J. (2005). Regulatory networks of the phytohormone abscisic acid. Vitam Horm 72, 235-269.

Xie, Z., Zhang, Z.L., Zou, X., Huang, J., Ruas, P., Thompson, D., and Shen, Q.J. (2005b). Annotations and functional analyses of the rice WRKY gene superfamily reveal positive and negative regulators of abscisic acid signaling in aleurone cells. Plant Physiol 137, 176-189.

Xu, X., Chen, C., Fan, B., and Chen, Z. (2006). Physical and functional interactions between pathogen-induced Arabidopsis WRKYl8, WRKY40, and WRKY60 transcription factors. Plant Cell 18, 1310-1326.

Xu, Y.H., Wang, J.W., Wang, S., Wang, J.Y., and Chen, X.Y. (2004). Characterization of GaWRKYl, a cotton transcription factor that regulates the sesquiterpene synthase gene (+)-delta-cadinene synthase-A. Plant Physiol 135, 507-515.

Yamamoto, S., Nakano, T., Suzuki, K., and Shinshi, H. (2004). Elicitor-induced activation of transcription via W box-related cA-acting elements from a basic chitinase gene by WRKY transcription factors in tobacco. Biochim Biophys Acta 1679,279-287.

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Yazaki, J., Kishimoto, N., Nagata, Y., Ishikawa, M., Fujii, F., Hashimoto, A., Shimbo, K., Shimatani, Z., Kojima, K., Suzuki, K., Yamamoto, M., Honda, S., Endo, A., Yoshida, Y., Sato, Y., Takeuchi, K., Toyoshima, K., Miyamoto, C., Wu, J., Sasaki, T., Sakata, K., Yamamoto, K., Iba, K., Oda, T., Otomo, Y., Murakami, K., Matsubara, K., Kawai, J., Caminci, P., Hayashizaki, Y., and Kikuchi, S. (2003). Genomics approach to abscisic acid- and gibberellin-responsive genes in rice. DNA Res 10, 249-261.

Zentella, R., Yamauchi, D., and Ho, T.H.D. (2002). Molecular dissection of the gibberellin/abscisic acid signaling pathways by transiently expressed RNA interference in barley aleurone cells. Plant Cell 14, 2289-2301.

Zhang, Z.L., Xie, Z., Zou, X., Casaretto, J., Ho, T.H., and Shen, Q.J. (2004). A rice WRKY gene encodes a transcriptional repressor of the gibberellin signaling pathway in aleurone cells. Plant Physiol 134, 1500-1513.

Zhu, J.K. (2002). Salt and drought stress signal transduction in plants. Annu Rev Plant Biol 53, 247-273.

Zou, X., Seemann, JR., Neuman, D., and Shen, Q.J. (2004). A WRKY gene from creosote bush encodes an activator of the abscisic acid signaling pathway. J Biol Chem 279, 55770-55779.

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. CHAPTER 2

ANNOTATIONS AND FUNCTIONAL ANALYSES OF THE RICE fERATGENE

SUPERFAMILY REVEAL POSITIVE AND NEGATIVE REGULATORS OF

ABSCISIC ACID SIGNALING IN ALEURONE CELLS

This chapter has been published in Plant Physiology and is presented in the style of that

journal. The complete citation is:

Xie Z., Zhang Z.L., Zou X., Huang J., Ruas P., Thompson D., Shen Q.J. (2005)

Annotations and functional analyses of the rice WRKY gene superfamily reveal positive

and negative regulators of abscisic acid signaling in aleurone cells. Plant Physiology

137(1):176-189.

Abstract

The WRKY proteins are a superfamily of regulators that control diverse

developmental and physiological processes. This family was believed to be plant specific

until the recent identification of WRKY genes in non-photosynthetic eukaryotes. We have

undertaken a comprehensive computational analysis of the rice genomic sequences and

predicted the structures of 81 OsWRKY genes, 48 of which are supported by full-length

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. cDNA (FL-cDNA) sequences. Eleven OsWRKY proteins contain two conserved WRKY

domains while the rest have only one. Phylogenetic analyses of the WRKY domain

sequences provide support for the hypothesis that gene duplication of single and two

domain WRKY genes and loss of the WRKY domain occurred in the evolutionary

history of this gene family in rice. The phylogeny deduced from the WRKY domain

peptide sequences is further supported by the position and phase of the intron in the

regions encoding the WRKY domains. Analyses for chromosomal distributions reveal

that 26% of the predicted OsWRKY genes are located on chromosome 1. Among the

dozen genes tested, OsWRKY24, -51, -71 and -72 are induced by abscisic acid (ABA) in

aleurone eells. Using a transient expression system, we have demonstrated that

OsWRKY24 and -45 repress ABA induetion of the HVA22 promoter-P-glucuronidase

construct, while OsWRKY72 and -77 synergistically interact with ABA to activate this

reporter construct. This study provides a solid base for functional genomics studies of this

important superfamily of regulatory genes in monocotyledonous plants and reveals a

novel function for WRKY genes, i.e. mediating plant responses to ABA.

Introduction

The WRKY genes encode a large group of transcription factors. There are over 70

WRKY genes in Arabidopsis (Eulgem et al., 2000; Dong et al., 2003) and rice (Oryza

sativa, Goff et al., 2002; Zhang et al., 2004). This family is defined by a domain of 60

amino acids, which contains the amino acid sequence WRKY at its amino-terminal end

and a putative zinc-finger motif at the carboxy-terminal end. Some of the WRKY

proteins contain two WRKY domains while others have only one. Most of the published

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. WRKY proteins bind to the cognate cA-aeting element (C/T)TGAC(T/C) in the promoter

(for review, see Eulgem et al., 2000) or 5’ untranslated regions of target genes (Yu et al.,

2001). For the WRKY proteins containing two WRKY domains, such as PcWRKYl

(Eulgem et al., 1999), SPFl (Ishiguro and Nakamura, 1994) and AtZAPI (de Pater et al.,

1996), the C-terminal domain has the major DNA binding activities.

WRKY proteins function as transcriptional activators and repressors. For example,

the Pc WRKY I protein functions as a transcription activator binding to the W-box in the

PcWRKYl promoter as shown in the assays with parsley (Petroselinum crispum)

protoplasts and yeast (Saccharomyces cerevisiae) as LexA-WRKY 1 fusion (Eulgem et

al., 1999). Similarly Arabidopsis ZAP I binds to and activates a synthetic promoter

containing the W-box in yeast and C. roseus suspension cells (de Pater et al., 1996).

AtWRKY22 and AtWRKY29 transactivate the promoters of WRKY29 and FRKl

{FLG22-1NDUCED RECEPTOR-LIKE KINASE 1) respectively in the Arabidopsis

protoplasts (Asai et al., 2002). Overexpression of AtWRKYlS in transgenic Arabidopsis

plants results in enhanced expression of pathogenesis-related genes (Chen and Chen,

2002). Recently, we have demonstrated that rice WRKY71, a homologue of wild oat

{Avena sativa subsp. fatua) ABF2 (Rushton et al., 1995), encodes a transeriptional

repressor of gibberellin (GA) signaling in aleurone cells (Zhang et al., 2004). Some

WRKY genes can function as either a repressor or an activator. For instance, AtWRKYô

suppresses its own promoter as well as the promoter of a closely related WRKY family

member whereas it activates the promoters of a receptor-like protein kinase (SIRK) and

the senescence- and pathogen-defense-associated PR l genes (Robatzek and Somssieh,

2002).

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. WRKY genes play a variety of developmental and physiological roles in plants. The

most reported studies for this superfamily of genes address their involvement in salicylic

acid (SA) and disease responses (Chen and Chen, 2000; Dellagi et al., 2000; Du and

Chen, 2000; Eulgem et al., 2000; Kim et al., 2000; Asai et al., 2002). In addition, WRKY

genes are involved in plant responses to freezing (Huang and Duman, 2002), wounding

(Hara et al., 2000), oxidative stress (Rizhsky et al., 2004), drought, salinity, cold and heat

(Pnueli et al., 2002; Rizhsky et al., 2002; Seki et al., 2002). SomeWRKY genes regulate

embryogenesis (Lagace and Matton, 2004), seed coat and trichome development

(Johnson et al., 2002), and senescence (Hinderhofer and Zentgraf, 2001; Robatzek and

Somssich, 2001). Biosynthesis of anthocyanin (Johnson et al., 2002), starch (Sun et al.,

2003) and sesquiterpene (Xu et al., 2004) are also dependent on WRKY proteins. WRKY

genes may control seed germination and post-germination growth as well because two

wild oat {Avena sativa subsp. fatua) WRKY proteins (ABFl and ABF2) bind to the

Box2/W-box of the GA regulated a-Amy2 promoter (Rushton et al., 1995) and

OsWRKY71 encodes a transcriptional repressor of GA signaling in aleurone cells (Zhang

et al,, 2004). The report of AtWRKY70 in mediating both SA and jasmonic acid (JA)

responses indicates the importance of this gene in the crosstalk of hormone signaling (Li

et al., 2004).

Previously we reported the annotations of 77 OsWRKY genes (Zhang et al., 2004).

Here we present more OsWRKY genes, along with the bioinformatic analysis data such as

their chromosomal localizations, intron-exon structures, full-length cDNA support,

alternative splicing, phylogenetic relationships, and the related protein motifs for these 81

OsWRKY genes. Our studies also reveal that there are at least four OsWRKY genes

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. involved in ABA signaling in aleurone cells, with two functioning as positive and two as

negative regulators. To our knowledge, this is the first report of such activity by a WRKY

protein.

Results

Identification of 81 WRKY genes in the rice genome

A systematic analysis was carried out to identify WRKY genes in the rice genome

using the publicly available genomic sequences of Oryza sativa L. ssp. yqpon/ca (Goff et

al., 2002) and ssp. indica (Yu et al., 2002) that were downloaded from GenBank® and

from the website of the Beijing Genomics Institute (http://btn.genomics.org.cn/rice).

Using gene prediction program, GENSCAN (Burge and Karlin, 1997), we constructed

databases of the predicted rice coding regions and peptides (Zhang et al., 2004). WRKY

genes were identified by using the HMMsearch program and a Hidden Markov Model

(PF03106; http://pfam.wustl.edu), with a cutoff E-value of O.I. A total of 158 WRKY

genes were identified in japonica and indica rice genome sequences. Manual inspections

eliminated 32 candidate genes because the deduced proteins for these genes do not

contain any of the conserved amino acid residues, W(R/K)(K/R)Y, in the N-terminus of

the WRKY domain. The corresponding coding region sequences of the remaining 126

sequences were analyzed for redundant sequences by performing pair-wise comparisons.

An arbitrary cutoff value of 95% was used to take into account of sequencing errors and

natural variations in the japonica and indica rice genomes. Thus, if the identity between

two coding region sequences (CRS, including both exon and intron sequences between

the start and stop codons) is equal to or higher than 95%, they are considered to be

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. redundant and only one is kept. This analysis eliminated 54 sequences. The WRKY

domain peptide sequences of the remaining 72 putative WRKY genes were aligned using

CLUSTALW (Thompson et al., 1994). The alignment output was used to build a rice-

specific WRKY HMM model using HMMbuild and HMMcalibrate in the HMMER

package. Scanning with this new model against the rice peptide databases (Zhang et al.,

2004), also with a cutoff E-value of 0.1, resulted in 178 candidates. Twenty-nine of these

candidate sequenees were eliminated because they did not contain the eonserved WRKY

motif. One gene identified in Contig96377 (accession number AAAAO 1094809.1) was

eliminated because it was very short, missing both the 5’ and 3’ regions of the gene. The

coding region sequences of the remaining 148 candidates were retrieved and a

redundancy analysis was carried out as described, eliminating 67 sequences

(Supplemental Table 2-1). In total, 81 WRKY genes were identified, with 45 in the

japonica genome sequences and 36 in the indica genome sequences. The detailed

information of these 81 OsWRKY genes is listed in Supplemental Table 2-2.

Manual inspections reveal annotation errors and

alternative spliced open reading frames

Approximately 36% of Arabidopsis genes identified through the automated

predictions contained errors (Haas et al., 2002; Meyers et al., 2003). We took several

approaches to refine the accuracy of the collected OsWRKY genes. First of all, three

genes (OsWRKY41, -43, and -44) were re-annotated using FGENESH

(www.softberry.com) because the first introns of these genes were too small

(Supplemental Table 2-3). Second, two partial genes published previously (Zhang et al.,

2004), OsWRKY46 (missing both the 5’ and 3’ ends) and OsWRKY63 (missing the 3’ end)

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. were replaced with full-length genes we identified in newly available BAG sequences.

However, no new sequences for OsWRKYSO have been identified yet and hence it is still

short at the 3’ end . Third, the predicted genes were analyzed by comparison to DNA and

deduced amino acid sequences of the rice FL-cDNA sequences (Kikuchi et al., 2003)

using BLAST (Basic Local Alignment Search Tool) analyses. An annotation is

considered to have a significant FL-cDNA match if 1) the predicted coding sequence

(CDS) is > 95% identical to the corresponding region of its FL-cDNA sequence at both

the DNA and deduced amino acid sequence levels; and 2) the length of the identical

region between the predicted and FL-cDNA sequences is > 95% of the length of the

entire sequence at both the DNA and deduced amino acid sequence levels. In contrast, a

cDNA is considered as a partial match if the identity is > 95%, but the length of the

identical region is between 50% and 94% (Supplemental Table 2-4). Among the 81

predicted OsWRKY genes, 36 had significant matches. This analysis also revealed that 17

predicted sequences had annotation errors, including incorrect intron/exon splice

boundaries, incorrect number of exons and wrong start/stop codons (Supplemental Table

2-3). After manual corrections, 48 OsWRKY genes had significant matches; 2 had partial

matches; and 31 did not have matches. The accession numbers of the matched FL-cDNA

sequences are listed in Supplemental Table 2-2.

Recently, it has been reported that about 27% of 18,933 transcription units in rice

genome contain two or more transcripts (Kikuchi et al., 2003) due to alternative slicing,

which results in alternative open reading frames (ORFs) that differ in initiation and

termination sites, as well as splice donor and acceptor sites. To date, three Arabidopsis

WRKY genes (AtWRKYl, -4 and -43) have been identified as having two ORFs. Because

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 66 out of 81 OsWRKY genes in our collection have more than two exons, we tested

whether they contain alternative ORFs. In this study, we found that five OsWRKY loci

(OsWRKYl, -8, -35, -39 and -57) contain alternative structures (Figure 2-1). In two of

these OsWRKY genes, OsWRKYl and OsWRKY51, one of the alternative peptides does

not contain a WRKY domain. In another one (OsWRKY35), the alternative splice variant

retains part (54 out of 88 nucleotides) of the fourth intron located in the C-terminal

WRKY domain, resulting in an addition of 18 amino acids to the deduced peptide. The

predicted gene structure of OsWRKY39 is supported by a FL-cDNA (accession

AK066775). In addition, an alternative structure (variant I) is revealed by another FL-

cDNA (AKI19593). This splice variant retains the first intron of the predicted structure,

which introduced a stop codon right after the 127* codon, thereby eliminating the

WRKY domain that lies downstream of codon 127. OsWRKY34 has a significant FL-

cDNA match (AK072906), but it retains the 3rd predicted intron. No FL-cDNA that

completely matches the predicted structure has been found yet. These results suggest that

alternative splicing might be involved in modulating the function of WRKY proteins.

OsWRKY proteins are classified into four subgroups

based on their WRKY domain sequences

The most prominent structural feature of these proteins is the WRKY domain of 60

amino acid residues. Among 93 WRKY domains found in WRKY proteins, 87 domains

contain the highly conserved WRKY motif, including 77 with WRKYGQK, six with

WRKYGKK and four with WRKYGEK. However, six domains in OsWRKY4I, -60, -

61, -63, and -81 have either one or two mismatched amino acids within WRKY motif

(referred to as an atypical WRKY motif). Thus we suggest that W(R/K)(K/R)Y be

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. considered as a new consensus WRKY motif. Similar to the Arabidopsis WRKY proteins

(Eulgem et al., 2000), OsWRKY proteins were classified into four groups (Figure 2-2):

11 members with two WRKY domains belong to group I; the WRKY domains of 46

group II members have a C2H2 type (C-X4-5-C-X22-24-H-X1.2-H) zinc finger motif; 19

WRKY proteins belong to group III with a C2HC type (C-X6-7-C-X23-33-H-X1-C) zinc

finger motif; and five group IV WRKY proteins contain no zinc finger motif. The zinc

finger motif patterns in group II and III OsWRKY proteins are slightly different from

those in group II (C-X4.5-C-X22-23-H-X1-H) and group III (C-X7-C-X23-H-X1-C) of

Arabidopsis WRKY proteins respeetively (Eulgem et al., 2000). In addition, based on

their zinc finger motifs, members in groups I and IV can be further divided into four

subgroups (la, Ib, I Va and IVb). Group la proteins contain a C 2H2 type zinc finger motif

with a common WRKY motif; group Ib proteins contain a C2HC type zinc finger motif,

usually with an atypical WRKY motif. Group I Va proteins have only a partial zinc finger

motif (CX4C), while group IVb proteins do not contain the conserved cysteine or

histidine residues at all. With the exception of OsWRKY56 that is supported by a FL-

cDNA sequence, group IV genes might contain annotation errors caused by genomic

sequencing or gene prediction software, or they might be pseudogenes with no biological

functions.

Phylogenetic analysis of the OsWRKY gene family

To study the phylogénie relationship among the OsWRKY genes and generate an

evolutionary framework of this gene family, a multiple peptide sequence alignment of all

93 WRKY domains, including both C-terminal and N-terminal domains of group I genes,

was constructed using CLUSTALW (Thompson et al., 1994). For the WRKY genes that

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. OsWRKYl ..1..T"L_ 1 2 1 3 M p""’! ^ 1 1

2 3 4 5 6 10

Variant 2 (NM_188767) 1 3 4 5 6 7 9 10

OsWRKYS I— r - [±> - [ Z h - 0 - 4 3 Variant I (AY341857) I 2 I 3 | 4 |

Variant 2 (AK109568) I 2 [ 3 I 5 I 6 |7| 8 I

OsWRKYS 5 1

Variant 1 (AY341851) 1 1 1 2 1 1 4 # ! ^ # 6

Variant 2 (A Y341843) I 1 1 2 1 4 # # 6 1

ÜSWRKY39 1

Variant I (AKI 19593)

Variant 2 (AK066775)

OsWRKY57 1 3

Variant 2 (AY341860)

Figure 2-1. Schematic diagrams of alternative spliced gene structures. Accession numbers of the significantly matched FL-cDNA sequences are shown in parentheses. Rectangles with numbers represent exons; thick lines represent introns; hatched regions represent WRKY domains. The diagrams were drawn in scale.

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Group I U:a) OsWRm4.Dl OsKRKTTO.Dl OgKUOfTB.Dl OsKHKYSO.Dl 0SWRKY53.D1 OsKRKÏ35vl.Dl OmKKYSM.Dl Os«RKy4.Dl DaKyro.:: 03wa}?:4 03R%T3=.:: OaKRIT:5-:.r2 OaMüVàSvl.rZ DR5I. osk%"Y: 0, r: OaRRKY'E . :: 3aKari'4.L: Cb, 03î«n.'4i :: DaKStric-.:. 03'S!"i'e: CiaK!U15_.:: 3aK5ri4^ osii’Rf'jV': ,r: OaKR^Tfl.:: OaKRlTS:,:.

Group II

OaWRKYSl 1 PI IP 61 Oa«REI42 1 p; oswracifps 1 p; OSMRKY44 Î PI oaMUoree 1 PI IP «1 OaNRKYG 1 = ; Oa%U(Y37 1 ; ■ OaM«Y66 1 :. OsSWCfP 1 FI OaHRKIlS 1 F: OaNBKYlZ 1 . : OaWar-il4 1 f ; Si 61 OaKaiTI 3 1 SA 61 OsWRKYSl 1 ... : oawap-ci 1 oaKar-r": I OaKRII:) 1 OaKRI'iI 1 OaKRIirSvl 1 OaKatlp'-Z i oaKarrii i OaKRPl'lf 1 PIGU OaKaiV49 1 PI 60 0OMRKY34 1 OaWRKYSe 1 11 IP 60 OaWKKYTS 1 OaKRKYSS 1 11 OaNRKY26 1 11 OsNRKY? i 11 OsKRKÏlO 1 11 Oa«RKY67 1 11 OaNRIOm 1 11 OaWRKieO 1 1: OaWRKYlvZ 1 :.: OaWRKYS I 11 Oa;BKI43 Î OaKR3T9 1 OaWRI-ri: 1 11 OaKKTI: 1 M PI 61 Oa«RKY27 1 v; P I 61 OaWKYZe 1 ■1 CiaKüTTl 1 M □SWRKY76 1 OaKRIlf: 1 □sWRiTif57v2 1 3) OaKRI-il' i AI OaKRKYGO 1 Pi : -Sa:-i ,l: Figure 2-2. Multiple sequence alignment of WRKY.

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Group II I ▼▼ OsBRKÏZZ [^--'-gpp ------#! OaRRKYZO 0-— □sKKOfSS | - — Æ ------AS Oa«RKr74 Tp E I ------AH OaKKYlS Innwff G ft— ——PI^ OaRRKYia # ---- € I------P iM OaBBKYiS i___r I------PAS{ OaNRKTZS P.liil-£ I ------: PFT| OeWRKYSO y:---G G G ------AAl OsMWYES G3P------AAl O3NRKY40 PZDLHHANSYNGœP: Oa«RKY64 [#)LHHAN5YKGDHF OsSRKY48 —£ iPS------0SWRKY54 ^^^glASP ------Oa«RKY46 |P?------OaHRKY55 — YS|PP------OaHRKYlG ::g- 0sSRKY21 )PAA------Oa«RKY41 ^ - S N 55------

Group IV DELLES»HIQIEr------OaMtKYSZ ------

Figure 2-2. (continued) Eighty-one OsWRKY proteins were divided into 4 groups based on the features of their WRKY domains: Group I and Group IV were further divided into subgroups (la, Ib, IVa and IVb). The names in bold font highlight the WRKY proteins that do not contain an intron within the region coding for the WRKY domains. WRKY motifs are underneath the black line; amino acid residues potentially interacting with zinc ligands are pointed to with arrows. Letters in red represent the amino acid residues whose codons are interrupted by introns.

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. have alternatively spliced ORFs, only variant 2 ORFs of these genes (OsWRKYlv2, -8v2,

-35v2, and -57v2) were included in the phylogenetic analysis because the sequences and

structures of variant 2 ORFs were more conserved than those of variant 1 ORFs. The

sequence alignment output was used to reconstruct the unrooted majority rule consensus

phylogenetic tree within the Bayesian framework (Figure 2-3). Although the basal nodes

of the tree are not well resolved, there are several patterns visible in the branches with 95

to 100% Bayesian posterior probabilities, as described in the next paragraph.

Recently, it was reported that group I WRKY genes may represent the ancestral form

of WRKY genes (Ulker and Somssich, 2004). The loss of one WRKY domain in the

origin of several group II genes (names in black. Figure 2-3), that evolved from group la

genes (names in red), is evident in the separate monophyletic clusters of all C-terminal

and all N-terminal WRKY domains. The C-terminal WRKY domain branch includes

genes that have lost the N-terminal domain, such as two group I Va genes (OsWRKY33, -

38) and a group II gene (OsWRKY80). In contrast, in the C-terminus WRKY domain

cluster, a group II gene {OsWRKY57v2) appears to be evolved from group la genes by

loss of the C-terminal domain. Of the remaining 44 group II genes, 40 cluster in five

well-supported branches that share an unresolved basal node with the group la genes,

suggesting that either group II genes evolved from the ancestral form of group la genes or

two-domain group la genes evolved from gene duplication of group II genes. Both

WRKY domains of the group Ib genes (names in purple) are imbedded within a cluster of

group III genes (names in green). Although these relationships are not as well supported

as the patterns described for group la, the N-terminal WRKY domains of group Ib genes

form a monophyletic cluster and the C-terminal WRKY domains of group Ib genes

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. connect basally to form a monophyletic cluster of all Ib genes and four group III genes

with 82% Bayesian posterior probability, suggesting a WRKY domain duplication event

of a group III gene gave rise to group Ib genes. The three group I Va WRKY genes

(OsWRKY52, -56 and -58; names in blue) are scattered throughout the tree and branch,

with low resolution, from group II and group III genes.

Intron phases and positions support the

phytogeny of OsWRKY genes

The position and phase of the intron in each region encoding the WRKY domain

provides additional support to the phytogeny in Figure 2-3. An intron position refers to a

codon into which an intron is inserted whereas an intron phase refers to where in a codon

an intron is inserted: immediately upstream (phase 0), after the 1®' nucleotide (phase 1) or

after the 2"^ nucleotide (phase 2) of a codon. About 71% (66 out of 93) of WRKY

domains found in OsWRKY genes contain an intron in a conserved position, including

both WRKY domains of group Ib genes (red boxes in Figure 2-2 and right panel in

Figure 2-3). This phase-2 intron is localized at the 11'^ codon downstream of the WRKY

motif, interrupting the codon encoding arginine (91% of 66 genes), serine (5%), lysine

(3%), or asparagine (1%; Figure 2-2). The presence of the intron in both WRKY domains

of group Ib genes and in all other gene groups suggests that its origin precedes much of

the gene duplication in this family. Of the 27 WRKY domains that do not have this

conserved intron, eight are in the monophyletic cluster of N-terminal WRKY domains of

group la genes, 11 domains are in a monophyletic cluster of group II genes {OsWRKYlv2

to OsWRKY 62, Figure 2-3), and two domains share a branch tip among group II genes

(OsWRKY25 and -44, Figure 2-3). Of the remaining domains that lack the conserved

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 8 ^5 2 2 2 2 ^ 0SWRKY43 Cm-CH=3*C=] cma .... Ç)"*'- OsWRKY?3 [=H)-CD*C3 ------CsHRKYZ? OsWRKT28 -OCMD OsWRKY?1 DCMCl OsWRKY?6 nr-m-i OCII C3 OsHRKY29 O- - d aC3—0-n—o 1.1. iML Jjimmnm —0+-C OsWRKYll U—f ""' "" U l—1 OsWRKYlE CNMH oOCt- - a —tj GSWRKY21 p ct « oo-m ^"HZZ CsUFKVlf 0 0 —Cl "irpyY" o o ti OO—O O d CHO-CCMmd cmmooc EMU DCM CO-CMmCHIDC3— D-C«CMM=3 co-chcmzia-d o—cmoo------c DCOO—"cmzico M 3D Ü Z3 r-T-rwnr-M-r-in — — 41— CMi— n a —#zz] CO—D-OCZMMC3 C3CjaDCHO I ,4»— - CM-I g - ocMi ------n ZeuF^ .1 tmmimmiWnBU v c i.c /T -: camm CSi c o o c C", -^i: = CZD9HI a-#——0 — -1 1 tzo B— -COO OMZO a g o L JiMLffffJ OO-HCIU sWRKYt EM DOCO O*—C3 CD*0 ■—n*—COOflCO ----- •CHD #-om------1 EHEO-O—C rwczzt-0—I:. ' ■ d d MMI ----- 1 t--«HH*CC> - f ~ l i ------OQ- 0 * 0 o a rz i CMCO M------C3 HMCZ3 D- "fl C O CO«}- o —#—o M------— - o □ a -—— COO CM 1 0 * 0 Figure 2-3. Phylogenetic analyses of OsWRKY

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Figure 2-3. (Continued) The majority rule consensus phylogenetic unrooted tree was reconstructed based on the WRKY domain peptide sequences by the MrBayes 3.0 program (Huelsenbeek et al., 2000). Statistical support values are shown above each node. D1 represents the N- terminal WRKY domain of group I proteins; D2 represents the C-terminal WRKY domain of group I proteins. Group la proteins, in red; group Ib proteins, in purple; group II proteins, in black, group III proteins, in green color; group I Va proteins, in yellow; group IVb proteins, in blue. The intron patterns for 81 OsWRKY genes were drawn in scale and shown beside the phylogenetic tree. Blank rectangles represent exons; filled rectangles denote WRKY domain regions. Lines drawn in red represent phase-0 introns; lines in blue represent phase-1 introns; lines in black represent phase- 2 introns.

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. intron, three cluster in group III genes (OsWRKY21, -48, and -54, Figure 2-3) and three

are scattered throughout the group II WRKY genes. If this intron is ancestral to most gene

duplication events in the WRKY gene family, only seven independent losses are required

to account for the introns distribution. The absence of this phase-2 intron from the N-

terminal WRKY domains of all group la proteins is another feature that distinguishes

group la proteins from group Ib proteins (Figure 2-2). Another type of the intron within

the WRKY domain occurs only in a group II gene cluster. This phase-0 intron is localized

between the 28*’’ and 29*’’ codons downstream of the WRKY motif, and is found only in

eight group II WRKY genes, including OsWRKYlv2, -5, -9, -32, -43, -62, -71 and -73.

The 28*’’ and 29*’’ codons were conserved, encoding glutamine or lysine and valine or

leucine respectively (Figure 2-2).

Chromosomal localization of OsWRKY genes

Forty-five WRKY genes revealed in the BAC sequences of the japonica genome were

localized on chromosomes based on the BAC information obtained from NCBl. To

investigate the chromosomal localizations of OsWRKY genes identified in the indica

genome, which draft sequence was produced by whole-genome shotgun sequencing (Yu

et al., 2002), WRKY genes containing BAC sequences were used for BLAST analyses

against the japonica genome sequence. Twenty OsWRKY genes found in the indica

genome were also identified in the japonica genome and hence localized on

chromosomes. The detailed chromosomal information of OsWRKY genes is listed in

Supplemental Table 2-5. OsWRKY genes in the current collection were distributed across

all 12 chromosomes (Figure 2-4A). Interestingly, 21 of the 81 OsWRKY genes were

found on chromosome 1, including two tandem repeats of OsWRKY15. In other words.

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. -26% of the identified OsWRKY genes are on chromosome 1, yet the length of

chromosome 1 only accounts for 11% of the rice genome. These results suggest that there

might be WRKY gene “hot spots” in the rice genome, with the highest density on

chromosome 1. Based on the sequence of chromosome 1, the physical positions of 21

OsWRKY genes were determined by BLAST analyses and are shown in Figure 2-4B.

Eighteen of the 21 OsWRKY genes were clustered into 6 regions (A-F) on chromosome 1.

Most of the OsWRKY genes within the same region are highly conserved. Furthermore,

three possible tandem gene duplication events were revealed in regions D, E and F

because those genes were clustered on the deepest branches of the tree, suggesting a close

phylogenetic relationship (Figure 2-3). It will be interesting to analyze whether these

regions with a higher density of OsWRKY genes are in genome tandem arrays or

intrachromosomally and interchromosomally duplicated areas.

Motif analyses of OsWRKY proteins

Identification of the conserved protein motifs might help elucidate protein functions.

It has been suggested that several Arabidopsis group Ilb WRKY proteins contain a

conserved leucine zipper motif (Eulgem et al., 2000), which is characterized by a region

containing several repeats of 7 hydrophobic residues with a strong preference for leucine

at every 7*’’ position, although other small hydrophobic amino acids are also acceptable

(Pu and Struhl, 1991; Acharya et al., 2002). Among 81 OsWRKY proteins, four group II

proteins (OsWRKY 1, -9, -43 and -71) contain leucine zipper motifs (Supplemental

Figure 2-1). Experimental evidence is necessary to determine whether these proteins can

indeed dimerize. Another notable motif, the HARE motif, is found in group Ild AtWRKY

proteins, although its function is still unknown (Eulgem et al., 2000). This HARE motif

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Number of WRKY Genes ® B 10 20 30 40 0Mb

5Mb

10Mb =:

ISMb

20Mb :SSBG»

. c ' ï t i r r f î v f ? / ' - • 25Mb ■ 0.îHA.'/f}7.' ko ' osim n /o J n.HTffV-’rt ■ o^iiK/iyi-i 30Mb nriKTfyi f

. fhii'R/iy:.' ■ tlfK A V fJ-JO 35Mb 0',U-KRY2i p OiWKRYX 45.2 40Mb n - OiWKRYl? 0 10 20 30 40 50 Leiigtii of Chromosome (Mb) □ 45Mb

Figure 2-4. Chromosomal distribution of OsWRKY genes. (A) The distribution of OsWRKY genes in the rice genome. The chromosomal information for OsWRKY genes identified in the japonica genome was determined based on BAC information obtained from NCBI (http://www.ncbi.nlm.nih.gov'). To determine chromosomal information for genes identified in the indica genome, the corresponding contig sequences were used for BALST search against the japonica BAC sequences in NCBI. The overlapped sequences were determined based on BLAST results, and the chromosomal information of these genes was obtained from the overlapped japonica BAC information. Detailed results were listed in Supplemental Table 2-5. The information of the length of rice chromosomes was obtained from the International Rice Genome Sequencing Project (IRGSP, http ://r gp. dna. affrc. go. i p/IRG SP/I. (B) Chromosomal locations of OsWRKY genes in rice chromosome 1. Six regions (A- F) with a higher density of OsWRKY genes were revealed. Possible duplicated OsWRKY genes are highlighted in gray.

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. OsWRKY24 OsWRKY45 m OsWRKYSl OsWRKY? 1 l i i i 777? OsWRKY72 M = ^///< OsWRKY??

I WRKY Zinc finger 0 NLS y HARF

0 LXXLL Lx 1 SUMO i LZ

Figure 2-5. Schematic diagrams of conserved motifs found in the OsWRKY Peptide Sequences. Conserved motifs of OsWRKY24, -45, -51,-71, -72 and -77 were listed above. Other OsWRKY proteins were shown in the Supplemental Figure 2-1. WRKY, the WRKY motif; Zinc finger, the zine finger motif; NLS, the putative nuclear localization motif; HARF, the conserved motif only found in a subgroup of WRKY proteins; LXXLL, the putative co-activator motif; Lx, the putative active repressor motif with the LXLXLX consensus sequences; SUMO, the putative sumoylation motif; LZ, the putative leucine-zipper motif; and HIF, hydroxylation motif.

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. was only found in a few group II OsWRKY proteins (OsWRKY25, -44, -51 and - 6 8 )

(Figure 2-3). OsWRKY27 and -80 contain a hydroxylation motif, which is present in

proteins such as HIF-la (hypoxia-inducible factor la) that is involved in sensing of

oxygen levels in cells (Huang et ah, 2002). Recently, sumoylation is shown to be

involved in both positive and negative regulations of transcription by modulating the

ability of transcription factors to interact with their partners, alter their patterns of

subcellular localization and control their stability, leading to positive or negative

regulation of transcription (for reviews, see Seeler and Dejean, 2003; Verger et ah, 2003).

The consensus sequence of the sumoylation motif is 'PKXD/E where 'F is often an

aliphatic residue, but sometimes can be basic or aromatic amino acids such as lysine and

phenylalanine respectively (Zhou et ah, 2004). We found that 35 OsWRKY peptide

sequences contained one or more sumoylation motif(s). Furthermore, four WRKY

proteins (OsWRKY 1, - 8 , -35, and -57), which have alternative ORFs, contain one or

more sumoylation motifs. It will be interesting to determine whether these proteins can be

sumoylated, and whether the function of these proteins can be altered through this

modification.

WRKY proteins can function as activators and repressors of many different biological

processes (de Pater et ah, 1996; Eulgem et ah, 1999; Asai et ah, 2002; Chen and Chen,

2002). Some can function as activators in one pathway, but as repressors in another

(Robatzek and Somssich, 2002). To predict putative activating and repressing activities

of OsWRKY proteins, the deduced peptide sequences were searched for the consensus

co-activator motif, LXXLL, where L is leucine and X is any amino acid (Savkur and

Burris, 2004) and active repressor motif (LXLXLX, Tiwari et ah, 2004). Sixteen

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. OsWRKY proteins (OsWRKY2, -11, -17, -20, -21, -36, -40, -41, -45, -48, -50, -54, -57, -

65, -73, and -75) contain the co-activator motif, and 9 proteins (OsWRKY27, -28, -29, -

32, -40, -51, -64, -71, -73) contain the active repressor motifs. Moreover, OsWRKY40

and -73 contain both co-activator and active repressor motifs. The motif structures of

OsWRKY24, -45, -51, -71, -72 and -77, whose functions were experimentally analyzed

in aleurone cells as detailed below, are shown in Figure 2-5.

Expression patterns of ( 9 5 IFRKT genes

in rice aleurone cells

To investigate WRKY genes expressed in rice aleurone cells. Northern blot analyses

were carried out using total RNA isolated from aleurone cells derived from rice

embryoless half-seeds treated with or without the hormones, G A 3, ABA or both. Steady-

state mRNA levels for several OsWRKY genes were determined and compared to those of

RAmylA (a GA-inducible a-amylase, Karrer et al., 1991), RAB21 (an ABA-inducible

gene, Mundy and Chua, 1988) and OsActinl (a constitutively expressed rice gene,

McElroy et al., 1990). As shown in Figure 2-6, the expression of RAmylA and RAB21

was strongly induced after GA3 and ABA treatments at 24- and 48-hr respectively. The

steady state mRNA levels of OsActinl, were similar in all samples, suggesting that an

equal amount of RNA was used on the blots. The steady state mRNA signals of five

WRKY genes, OsWRKY24, -45, -51, -71 and -72, were detectable in rice aleurone cells.

OsWRKY24, -51 and -71 transcripts were relatively abundant compared to those of

OsWRKY45 and -72. The low level of OsWRKY45 expression was not affected by either

ABA or G A3, but OsWRKY72 demonstrates a clear induction upon treatment with ABA

(Figure 2-6). The abundant transcripts of OsWRKY24, -51, and -71 were enhanced upon

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. ABA treatments. Furthermore, the mRNA levels of OsWRKYSl and -71 were decreased

in response to exogenous GA 3 treatments at 24- and 48-hr time points. OsWRKY24 was

slightly down-regulated by G A at 4- and 24-hr time points.

We also examined OsWRKYVV by Northern blot analysis but could not detect a

signal. The signal of OsWRKY77 transcription, however, can be detected by RT-PCR

(Zhang et ah, 2004).

Functional analyses ofOsWRKY genes

in aleurone cells

Because at least 4 out of6 OsWRKY genes (OsWRKY24, -45, -51, -71, -72 and -77)

expressed in aleurone cells, are induced by ABA, we investigated whether they are

involved in ABA signaling by transient expression of these OsWRKY genes in aleurone

cells. The genomic sequences of these six OsWRKY genes were cloned into an expression

vector driven by the maize ubiquitin promoter (Figure 2-7A). We have previously

demonstrated that the genomic coding sequences (including all exons and introns

between the start and stop codons) of several effector genes, including PKABAl and

GAMYB, function as well as their corresponding cDNA clones in the transient expression

system (Zhang et ah, 2004). The ABA inducible reporter construct, HVA22-GUS (Shen

and Ho, 1995), was used to study the function of OsWRKY proteins in ABA signaling.

The OsWRKY effector constructs, along with the HVA22-GUS reporter and UBI-LUC

internal control constructs were introduced into barley aleurone cells by particle

bombardment. The HVA22-GUS reporter is induced 31-fold in the presence of ABA

(Figure 2-7B). Transient expression of UBl-0sWRKY71 had little effect on ABA

induction of HVA22-GUS (Zhang et ah, 2004). However, OsWRKY24 and -45 repressed

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. No Hormone A B A +G A 3 Time (hr) 24 48 24 48 24 48 24 48

05iTRÀ:y7/ 05fyRxy72

RAmylA

RAB21

OsActinl

Figure 2-6. Expression patterns of OsWRKY genes in rice aleurone cells. After being imbibed for 2 days, about one tenth of rice embryoless half-seeds was harvested as a control (0 hr), and the rest was further treated without hormone (control) or with 1 pM G A3, 20 pM ABA, or 1 pM GA3 plus 20 pM ABA at 26 °C for 4-, 24- and 48-hr. Total RNA was isolated from each treated rice embryoless half-seeds. The Northern blot, containing 10 pg of total RNA per sample, was hybridized with a-^^P labeled gene specific probes. To ensure equal loading of RNA, one representative blot was subsequently stripped and rehybridized with a probe against OsActinl.

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Reporter construct HVA22 ^ Q jjs promoter I ^ HVA22-T ^ZZZZZZZZk—

Effector construct UBI r*O sW R K Y 24 ■OsWRKY45 promoter! ^ NOS-T promoter] CtSSHHSSSSSSa—

•■OsWRKYSl,

UBI UBI OsWRKY?2 £romoterJ^ NO S-1 promoter] N O S -l — C — B 9 58X 8 53X S 7

31X 30X !:c/5 § 4

1 3 MX IIX

4X l: IX IXIX 0 ABA + + + + + + + OsWRKY 24 24 45 45 51 51 71 71 72 72 77 77

Figure 2-7. Functional analyses of OsWRKY proteins in ABA signaling. (A) Schematic diagrams of the reporter and effector constructs used in the cobombardment experiments. The gene structures were drawn in scale. Shaded rectangles represented exons; lines between exons represent introns. (B) Functions of OsWRKY proteins in ABA signaling. The reporter construct, HVA22-GUS, and the internal control construct, UBI-LUC, were cobombarded into barley half-seeds either with (+) or without (-) the effector construct by using equal molar ratio of effector and reporter constructs. GUS activity was normalized in every independent transformation relative to the luciferase activity. Bars indicate GUS activities ±SE after 24 hr of incubation of the bombarded half-seeds with (4 -) or without (-) 20 pM ABA. Data are means ± SE of four replicates.

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. ABA induction of HVA22-GUS. OsWRKY24 almost completely blocked ABA induction

of HVA22-GUS while transient expression of UBI-OsWRKY45 partially inhibited ABA-

dependent induction of HVA22-GUS. In contrast, co-expression of UBI-OsWRKY72 and

UBI-OsWRKY77 induced the expression o f HVA22 to 4- and 11-fold respectively in the

absence of ABA. With the ABA treatment, the induction levels were increased to 58- and

53-fold respectively. These data suggest that OsWRKY72 and -77 synergistically interact

with ABA in activating the HVA22 promoter in aleurone cells. Finally, transient

expression of UBI-OsWRKY51 had little effect on ABA induction of HVA22-GUS.

Discussion

This work reports the identification of 81 OsWRKY genes (Supplemental Table 2-2)

by reiterative bioinformatic analyses with the Genscan program followed by (i) removing

redundant OsWRKY genes identified in the japonica and indica genome sequences

(Supplemental Table 2-1), (ii) verifications with FGENESH and manual inspections

(Supplemental Table 2-3), and (iii) searching for supporting FL-cDNA sequences

(Supplemental Tables 2-2 and 2-4). Most of the predicted OsWRKY genes are supported

by FL-cDNA sequences, as demonstrated by the vigorous analyses that also led to the

identification of OsWRKY mRNA variants resulting from alternative splicing (Figure 2-

1). Sequence alignment studies allowed the classification of OsWRKY proteins into four

groups, which differ in the number of WRKY domains in the proteins, and in the

sequences of the WRKY and zinc finger motifs (Figure 2-2). Phylogenetic analyses

revealed both loss and gain of the WRKY domain in the evolutionary history of this gene

family in rice (Figure 2-3). Although OsWRKY genes have been found on each of the 12

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. rice chromosomes, they are not evenly distributed. Instead, chromosome I contains more

than 25% of OsWRKY genes identified so far (Figure 2-4). We demonstrated that

OsWRKYSl and -71 were enhanced by ABA and suppressed by GA (Figure 2-6). Finally,

our studies identified two OsWRKY genes as negative regulators and two other OsWRKY

genes as positive regulators of ABA signaling (Figure 2-7).

The report demonstrates that the manual reannotation of genes is an essential

component of genome analysis because of the limitations inherited in automated

annotations and the complex nature of gene structures. This has been also demonstrated

in the analysis of Arabidopsis R genes (Meyers et al., 2003). Our study shows that about

36% of predicted OsWRKY genes that have cDNA support contain errors of one type or

another, assuming that all alternative forms of the cDNAs have been identified

(Supplemental Table 2-3). This assumption, of course, is likely to be an underestimation.

The most frequent error we found was the wrong annotation of start and stop codons,

which accounted for -65% of the mis-annotations. The next frequent categories were the

incorrect number of exons (-18%) and incorrect placement of intron/exon splice

boundaries (-18%). FL-cDNA sequences are essential for the reannotation process; 64%

of the predicted OsWRKY genes reported herein are supported by FL-cDNA sequences.

The OsWRKY genes encode proteins containing one or two WRKY domains.

These two classes of WRKY genes may have arisen by gene duplication of the one-

domain proteins, deletion of one WRKY domain in a two-domain protein, or a

combination of both, i.e. deletion followed by duplication. Recently, WRKY expressed

sequence tags (ESTs) have been identified from lower plants such as ferns (Ceratopteris

richardii), mosses (Physcomitrella patens) and green algae (Chlamydomonas reinhardtii),

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. and from the slime mold Dictyostelium discoideum and the unicellular protist Giardia

lamblia (Ulker and Somssich, 2004). Group-I-like WRKY genes are present in the lower

organisms, implying that the group-I-like WRKY genes may represent the ancestral form

of the WRKY family that originated -1.5-2 billion years ago in eukaryotes, before the

divergence of the plant phyla (Ulker and Somssich, 2004). However, rice group I WRKY

genes can be further classified into two subgroups (group la and Ib). Two obvious

features can distinguish group la from group Ib WRKY genes in rice. First, the zinc finger

motif in both the N-terminal and the C-terminal WRKY domain in group la genes is

C2H2-type, while the zinc finger motif in both the N-terminal and the C-terminal domain

in group Ib genes is CzHC-type. Second, the C-terminal, but not the N-terminal, domain

of group la genes contains the conserved intron in the region encoding the WRKY

domain. In contrast, both the N-terminal and the C-terminal WRKY domains of the group

Ib genes contain the conserved intron (Figure 2-2). By comparing their domain sequences,

Arabidopsis group I and the slime mold WRKY genes are more similar to rice group la

genes than to rice group Ib genes (data not shown). Hence, only group la genes, but not

group Ib genes, appear to be derived from ancestral forms of the OsWRKY genes in plants.

By referring to the domain feature (Figure 2-2), the phylogénie tree (left panel in Figure

2-3) and the intron pattern (right panel in Figure 2-3), we deduced three major steps of

OsWRKY gene evolution that involve both loss and gain of the WRKY domain (Figure 2-

8 ). Among OsWRKY genes, we find evidence of loss of the N-terminus in the evolution

of single-domain group II and group IV genes from group la genes and independent loss

of the C-terminus in the evolution of a single-domain group II gene. Other group II genes

may have evolved by this process. The domain loss scenario is also supported by studies

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. of WRKY genes in Arabidopsis and tomato. AtWRKY10ha.s only one WRKY domain, but

it is clustered with the two-domain group I AtWRKY genes (Eulgem et al., 2000).

However, its orthologue from tomato has two WRKY domains, suggesting that a recent

likely loss of the N-terminal WRKY domain occurred during evolution (Rossberg et al.,

2001). The domain duplication scenario is deduced based on the observation that the two

zinc fingers in each group I gene are either C 2H2-C2H2 or C2HC-C2HC type; no hybrid

double zinc finger structures (C2HC-C2H2 or C2H2-C2HC) have been identified. Therefore,

group Ib OsWRKY genes are likely to have evolved by intramolecular duplication of a

group III WRKY domain that had already evolved the C 2HC type zinc finger (Figure 2-8).

Further phylogenetic analyses based on WRKY domain DNA sequences is needed to

confirm the deduced evolutionary history of this gene family.

SA and H 2O2 strongly induce the expression of WRKY genes in several plant species

including rice (Kim et al., 2000; Wen et al., 2003). In Arabidopsis, 49 out of 72 tested

WRKY genes respond to SA treatment or bacterial infection (Dong et al., 2003). The

involvement of WRKY genes in abiotic stress response (Hara et al., 2000; Huang and

Duman, 2002; Pnueli et al., 2002; Rizhsky et al., 2002; Seki et al., 2002; Rizhsky et al.,

2004) suggests that some of them might be responsive to ABA. Indeed, four Arabidopsis

WRKY genes, AtWRKY25 (At2g30250), -28 (At4gl8170), -40 (Atlg80840) and -75

(At5gl3080), are ABA inducible in vegetative tissues (Seki et al., 2002). In this study,

four OsWRKY genes, OsWRKY24, -51, -71 and -72, were shown to be ABA responsive

(Figure 2-6). Multiple sequence alignment data (Z. Xie and Q.J. Shen, unpublished result)

indicate these four OsWRKY genes are unlikely to be the orthologues of those ABA

inducible Arabidopsis WRKY genes. Hence, it is likely that other WRKY genes, which

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. N-terminal C-terminal C2H2 C2H2 Group la WRKY Genes

Loss of C-terminal Loss of N-terminal WRKY domain WRKY domain

C2H2 C2H2 — Group II WRKY Genes

His to Cys change in zinc finger motif

C2HC — Group III WRKY Genes

WRKY domain duplication

N-terminal ' C-terminal C2HC C2HC — Group Ib WRKY Genes

Figure 2-8. Deduced evolutionary framework of the OsWRKY gene family. An evolutionary framework of the OsWRKY gene family was deduced based on the phylogenetic analysis and the features of the WRKY domain. Rectangles designate the N-terminal or C-terminal WRKY domains with C2H2 type or C2HC type of zinc finger motifs. Some group II WRKY genes are likely to be evolved from group la WRKY genes by losing either the N-terminal or the C-terminal WRKY domain. The replacement of the conserved histidine residue with a cystine residue in the zinc finger motif might result in the evolution of group III WRKY genes. Group Ib WRKY genes might be evolved from group III WRKY genes by duplication of the C2HC-type WRKY domain.

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. have not yet been analyzed experimentally, are also responsive to ABA. By having

different temporal and spatial expression patterns, these WRKY genes might modulate

ABA signaling in different tissues or different developmental stages.

Currently, the mechanism by which OsWRKY72 and -77 synergistically interact

with ABA to enhance the expression of HVA22-GUS (Figure 2-7) remains known. Most

of the published WRKY proteins bind to the cognate cA-acting element

(C/T)TGAC(T/C) (Ishiguro and Nakamura, 1994; Rushton et al., 1995; Eulgem et al.,

2000; Zhang et al., 2004). However, other binding sequences have been reported. For

example, the barley (Hordeum vulgare) SUSIBA2 protein binds to three other sequences

named SURE-a, SURE-b and SURE-c in addition to the W-box of the isoamylasel

promoter (Sun et al., 2003). The putative W-box has been found in the promoter regions

OÎHVA22 (Shen et al., 1993) and ABF (Choi et al., 2000). However, the 49-bp promoter

fragment in the reporter construct of this study does not include this W-box. Similarly,

this promoter does not contain the SphI element that is bound by the C-terminal B3

domain of VPl (Suzuki et al., 1997). Instead, only two elements are present in this

promoter fragment: the ABRE that is bound by ABI5 or its related bZIP proteins (Kim

and Thomas, 1998; Hobo et al., 1999; Finkelstein and Lynch, 2000; Casaretto and Ho,

2003) and CEI that is bound by a APETALA2 domain containing transcription factor

ABI4 (Finkelstein et al., 1998; Niu et al., 2002). It is suggested (Shen et al., 1996) that

the interaction of ABRE and CE binding proteins might be mediated by VP I, which also

interacts with 14-3-3, ring (CsHCs-type) finger proteins, and RNA polymerase II subunit

RPB5 (Schultz et al., 1998; Hobo et al., 1999; Jones et al., 2000; Kurup et al., 2000).

Hence, OsWRKY72 and -77 might, as a non-DNA-binding component, form a complex

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. with VPl, 14-3-3 protein, ring (CsHCs-type) finger proteins, ABI4 and ABI5 to modulate

ABA signaling in aleurone cells.

In contrast, OsWRKY24 and -45 repressed ABA induction of HVA22-GUS (Figure

2-7). If the above model proposed for the OsWRKY positive regulators described above

is correct, one possible repression mechanism would be the competition with the WRKY

positive regulators in ABA signaling. In this regard, it is interesting to note that two rice

bZIP proteins (OsZIP-2a and OsZIP-2b), which do not bind to the ABRE element by

themselves, heterodimerize via the leucine zipper with EmBP-I (another bZIP protein)

and prevent it from binding ABRE. As a result, the EmBP-1 positive regulator is

sequestered by these two negative regulators (Nantel and Quatrano, 1996). A similar

mechanism has been found with Helix-Loop-Helix proteins (HLH), for which there are

about 150 members in Arabidopsis (Toledo-Ortiz et al., 2003). Eight-nine of them are

predicted (Toledo-Ortiz et al., 2003) to bind to the G-box (CACGTG), which is similar to

ABRE. Indeed, one of the Arabidopsis HLH proteins, AtMYC2, has been shown to be a

transcriptional activator of ABA signaling (Abe et al., 2003). HLH proteins can functions

as negative regulators of basic HLH (bHLH) proteins by forming non-DNA binding

heterodimers with otherwise DNA binding bHLH proteins (Littewood and Evan, 1998).

If this mode of action also holds true for the OsWRKY regulators, a different domain

must be involved in dimerization because neither the positive nor the negative regulators

contain a leucine zipper domain (Figure 2-5 and Supplemental Figure 2-1) or a HLH

domain. Of course, there are other possible mechanisms of repression for these repressors,

as we suggested for OsWRKY71 in regulating GA signaling (Zhang et al., 2004).

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. In summary, the annotation of the OsWRKY genes has facilitated the identification of

their gene structures and phylogénie relationships. In addition to SA (Chen and Chen,

2000; Dellagi et al., 2000; Du and Chen, 2000; Eulgem et al., 2000; Kim et al., 2000;

Asai et al., 2002), JA (Li et al., 2004) and GA (Rushton et al., 1992; Zhang et al., 2004),

WRKY genes also modulate the responses of plant cells to ABA (this work). Recently,

studies of parsley WRKY proteins using the chromatin immunoprécipitation technique

indicate that the PcPR-1 promoter is constitutively repressed by some WRKY proteins.

Elicitor treatments induce the expression of other WRKY family members and the

displacement of the WRKY repressors by WRKY activators (Turck et al., 2004). The

WRKY repressors and activators presented in the work will help test the model and

contribute to the dissection of the transcriptional complex involved in ABA signaling.

Materials and methods

Analyses of the rice genomic sequences

About 287 MB of rice jap o n ica BAC or PAC sequences were downloaded

from the International Rice Genome Sequencing Project (IRGSP,

http://rgp.dna.affrc.go.ir>/IRGSP/), which covers about 70% of the rice genome.

About 361 MB of rice indica contig sequences were downloaded from Beijing

Genomics Institute (BGI, httn://btn.genomics.org.cn/rice), which covers about

90% of the rice genome. A stand-alone version of GENSCAN (Burge and

Karlin, 1997) was used for genome annotations. We used a model file for

maize, which is also a monocot species that is close to rice on the taxonomy

lineage because a model file trained on rice genes is not publicly available for

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. GENSCAN. Rice peptide and coding region databases were constructed based

on GENSCAN output files. Rice FL-cDNA sequences were obtained from NCBI

Ihttp://www.ncbi.nlm.nih.gov). The sequence of rice chromosome I was downloaded

from Rice Genome Research Group (RGP, http ://rgp.dna.affrc. go.jp/I to determine the

locations of OsWRKY genes on chromosome 1.

HMMER software package version 2.1.1 (Sonnhammer et al., 1998) was downloaded

from http : //hmmer. wustl. edu/ and applied to identify WRKY genes in the rice peptide

database. BLAST software package (Altschul et al., 1997) was applied to compare

genomic and cDNA sequences and to determine the chromosomal locations of the

OsWRKY genes. To identify redundant sequences of the predicted WRKY genes,

CLUSTALW (Thompson et al., 1994) was used to build a maximum local alignment of

the predicted WRKY gene sequences. Then the program, IRedun, which was developed in

our lab using the PERL language, was applied to calculate the percentage of identity

between a pair of sequences. Those with 95% or greater identity are considered as

redundant sequences.

Phylogenetic analyses and display of gene structures

The maximum likelihood tree was reconstructed with the WRKY domain peptide

sequences using version 3.0 of the MrBayes program (Huelsenbeek et al., 2000) under

the ITT model of amino acid substitutions with auto-correlated rates across sites. The

Bayesian analysis was run for 200,000 generations, using four Markov chains with

default heating values. A tree was sampled every 50 generations. The Markov chains

converged rapidly, and the first 1,000 sampled trees were discarded as “bum in”. The

majority mle consensus unrooted tree was computed based on the rest of the 3,000

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. sampled trees in the program PAUP*4.0 (Swofford, 2000). The statistical support values

were shown above every node.

Intron phases were divided into 3 groups based on the position of introns within the

reading frame of a gene as described in previous studies (Sharp, I98I): phase-0 introns

interrupt between two codons; phase - 1 introns lie between the first and second bases in a

codon; phase-2 introns interrupt a codon between the second and third bases. Gene

structures were drawn in scale according to the size of exons and introns. First, exon

coordinates were computed based on the revised version of OsWRKY genes presented in

this study, and then intron phases were calculated based on exon coordinates.

HMMsearch was performed by using the revised OsWRKY peptide sequences, and

domain coordinates were fetched out from the HMMsearch output file. The exon and

domain coordinates and intron phase information were used to graphically display the

structure ofOsWRKY genes.

Plant materials and incubation conditions

Rice (Oryza sativa L. ssbsp. japonica) seeds were kindly provided by Dr. Kent

McKenzie at the California Rice Experiment Station (cultivar M202) and Mr. Jack de Wit

from De Wit Firm (cultivar Ml 04, Davis, CA). Barley {Hordeum vulgare cultivar

Himalaya) seeds (1998 harvest) were purchased from Washington State University

(Pullman, WA). The preparation and imbibition of the embryoless half-seeds were done

as described previously (Shen et al., 1993). After being imbibed for 2 days, about one

tenth of rice embryoless half-seeds were harvested as a control, and the rest of them were

further incubated in petri dishes containing 20 mM CaCli, 20 mM sodium succinate

without hormone (control) or with 1 pM G A 3, 20 pM ABA, or 1 pM GA 3 plus 20 pM

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. ABA at 26 °C for 4 hr, 24 hr and 48 hr. After harvest, rice embryoless half-seeds were

immediately frozen in liquid nitrogen, and stored at -80 °C until further analyses

RNA gel blot analyses

Total RNA was isolated from rice embryoless half-seeds using the Concert™ Plant

RNA Reagent (Invitrogen, CA). For Northern analyses, 10 gg of total RNA was loaded

into each lane, electrophoresed and transferred onto nylon membranes. Gene specific

probes for OsWRKY24, -45, -51, -71, -72, -77 and OsActinl were labeled in the presence

of a-^^P-dCTP by using the Prime-a-Gene® Labeling System (Promega, WI). Gene

specific probes for RAmylA and RAB21 were labeled with a-^^P-dCTP by PGR. The

sequences of primers used for Northern analyses were listed in Supplemental Table 2-6.

The blots were hybridized and washed according to the method of Church and Gilbert

(Church and Gilbert, 1984). The storage phosphor screens were scanned with a Typhoon

9410 phosphoimager from Amersham Biosciences (Piscataway, NJ).

Construct preparations

Genomic DNA, isolated from 10-day-old rice seedlings as described previously

(Zhang et al., 2004), was used for preparation of effector constructs. The genomic CRSs

of the tested OsWRKY genes were amplified by PCR, and cloned into the expression

vector (Zhang et al., 2004) containing the constitutive maize ubiquitin promoter. The

detailed information about primers and restriction enzyme sites used to clone the effector

constructs are listed in Supplemental Table 2-7.

Particle bombardment and transient expression assays

Three types of DNA constructs were used in the transient expression experiments:

reporter, effector and internal control. V\diSm\A HVA22-GUS (Shen et al., 1996) were used

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. as the reporter construet to study the funetion of effectors in the ABA signal transduction

pathway. Plasmid UBI-LUC, which contains the lueiferase reporter gene driven by the

maize ubiquitin promoter (Bruce et al., 1989), was used as an internal control construct to

normalize GUS activities of the reporter construct. The procedure of transient expression

experiments with the barley (Hordeum vulgare L.) aleurone system by particle

bombardment has been described previously (Lanahan et al., 1992). All experiments

consisted of 4 replicates and the entire experiment was repeated for a minimum of two

times with similar results.

Acknowledgements

We thank Mr. Everett Cook and Ms. Tracy Hall for their excellent technical

assistance. The manuscript was critically reviewed by Dr s. Andrew Andres, Frank van

Breukelen, and Deborah Hoshizaki in our department, and Dr. Imre E. Somssich at Max-

Plank-Institute for Plant Breeding Research, Koln, Germany. We appreciate their helps.

The authors are in debt to Dr. Tuan-Hua David Ho at Washington University in St. Louis

for stimulating discussions and his generosity in providing the reporter and internal

control constructs used in this study. We also thank Dr. Shoshi Kikuehi at National

Institute of Agrobiological Sciences in Japan for sharing the full-length OsWRKY cDNA

clones prior to publication.

References

Abe, H., Urao, T., Ito, T., Seki, M., Shinozaki, K., and Yamaguehi-Shinozaki, K. (2003). Arabidopsis AtMYC2 (bHLH) and AtMYB2 (MYB) funetion as transcriptional activators in abscisie acid signaling. Plant Cell 15, 63-78.

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Acharya, A., Ruvinov, SB., Gal, J., Moll, J.R., and Vinson, C. (2002). A heterodimerizing leucine zipper coiled coil system for examining the specificity of a position interactions: amino acids I, V, L, N, A, and K. Biochemistry 41, 14122- 14131.

Altschul, S.F., Madden, T.L., Schaffer, A.A., Zhang, J., Zhang, Z., Miller, W., and Lipman, D.J. (1997). Gapped BLAST and PSl-BLAST: a new generation of protein database search programs. Nucleic Acids Res 25, 3389-3402.

Asai, T., Tena, G., Plotnikova, J., Willmann, M.R., Chiu, W.L., Gomez-Gomez, L., Boiler, T., Ausubel, F.M., and Sheen, J. (2002). MAP kinase signaling cascade in Arabidopsis innate immunity. Nature 415, 977-983.

Bruce, W.B., Christensen, A.H., Klein, T., Fromm, M., and Quail, P.H. (1989). Photoregulation of a phytochrome gene promoter from oat transferred into rice by particle bombardment. Proe Natl Acad Sci USA 8 6 , 9692-9696.

Burge, C., and Karlin, S. (1997). Prediction of complete gene structures in human genomic DNA. J Mol Biol 268, 78-94.

Casaretto, J., and Ho, T.H. (2003). The transcription factors HvAB15 and HvVPl are required for the abscisie acid induction of gene expression in barley aleurone cells. Plant Cell 15, 271-284.

Chen, C., and Chen, Z. (2000). Isolation and characterization of two pathogen- and salicylic acid-induced genes encoding WRKY DNA-binding proteins from tobacco. Plant Mol Biol 42, 387-396.

Chen, C., and Chen, Z. (2002). Potentiation of developmentally regulated plant defense response by AtWRKY18, a pathogen-induced Arabidopsis transcription factor. Plant Physiol 129, 706-716.

Choi, H., Hong, J., Ha, J., Kang, J., and Kim, S.Y. (2000). ABFs, a family of ABA- responsive element binding factors. J Biol Chem 275, 1723-1730.

Church, G.M., and Gilbert, W. (1984). Genomic sequencing. Proc Natl Acad Sci USA 81, 1991-1995.

de Pater, S., Greco, V., Pham, K., Memelink, J., and Kijne, J. (1996). Characterization of a zinc-dependent transcriptional activator from Arabidopsis. Nucleic Acids Res 24, 4624-4631.

Dellagi, A., Helibronn, J., Avrova, A.O., Montesano, M., Palva, E.T., Stewart, H.E., Toth, I.K., Cooke, D.E., Lyon, G.D., and Birch, P R. (2000). A potato gene encoding a WRKY-like transcription factor is induced in interactions with Erwinia carotovora

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. subsp. atroseptica and Phytophthora infestans and is coregulated with elass I endochitinase expression. Mol Plant Microbe Interact 13, 1092-1101.

Dong, J., Chen, C., and Chen, Z. (2003). Expression profiles of the Arabidopsis WRKY gene superfamily during plant defense response. Plant Mol Biol 51, 21-37.

Du, L., and Chen, Z. (2000). Identification of genes encoding receptor-like protein kinases as possible targets of pathogen- and salicylic acid-induced WRKY DNA- binding proteins in Arabidopsis. Plant J 24, 837-847.

Eulgem, T., Rushton, P.J., Robatzek, S., and Somssich, I.E. (2000). The WRKY superfamily of plant transcription factors. Trends Plant Sei 5, 199-206.

Eulgem, T., Rushton, P.J., Sehmelzer, E., Hahlbrock, K., and Somssich, I.E. (1999). Early nuclear events in plant defence signalling: rapid gene activation by WRKY transcription factors. EMBO J 18, 4689-4699.

Finkelstein, R.R., and Lynch, T.J. (2000). The Arabidopsis abscisie acid response gene AB15 encodes a basic leucine zipper transcription factor. Plant Cell 12, 599-609.

Finkelstein, R.R., Wang, M.L., Lynch, T.J., Rao, S., and Goodman, H.M. (1998). The Arabidopsis abscisie acid response locus ABI4 encodes an APETALA 2 domain protein. Plant Cell 10, 1043-1054.

Goff, S.A., Ricke, D., Lan, T.H., Presting, G., Wang, R., Dunn, M., Glazebrook, J., Sessions, A., Oeller, P., Varma, H., Hadley, D., Hutchison, D., Martin, C., Katagiri, F., Lange, B.M., Moughamer, T., Xia, Y., Budworth, P., Zhong, J., Miguel, T., Paszkowski, U., Zhang, S., Colbert, M., Sun, W.L., Chen, L., Cooper, B., Park, S., Wood, T.C., Mao, L., Quail, P., Wing, R., Dean, R., Yu, Y., Zharkikh, A., Shen, R., Sahasrabudhe, S., Thomas, A., Cannings, R., Gutin, A., Pruss, D., Reid, J., Tavtigian, S., Mitchell, J., Eldredge, G., Scholl, T., Miller, R.M., Bhatnagar, S., Adey, N., Rubano, T., Tusneem, N., Robinson, R., Feldhaus, J., Macalma, T., Oliphant, A., and Briggs, S. (2002). A draft sequence of the rice genome {Oryza sativa L. ssp. japonicd). Science 296, 92-100.

Haas, B.J., Volfovsky, N., Town, C D., Troukhan, M., Alexandrov, N., Feldmann, K.A., Flavell, R.B., White, O., and Salzberg, S.L. (2002). Full-length messenger RNA sequences greatly improve genome annotation. Genome Biol 3, RESEARCH0029.

Hara, K., Yagi, M., Kusano, T., and Sano, H. (2000). Rapid systemic accumulation of transcripts encoding a tobacco WRKY transcription factor upon wounding. Mol Gen Genet 263, 30-37.

Hinderhofer, K., and Zentgraf, U. (2001). Identification of a transcription factor specifically expressed at the onset of leaf senescence. Planta 213, 469-473.

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Hobo, T., Kowyama, Y., and Hattori, T. (1999). A bZIP factor, TRABl, interacts with VPl and mediates abscisie acid-indueed transcription. Proe Natl Acad Sci USA 96, 15348-15353.

Huang, J., Zhao, Q., Mooney, S.M., and Lee, F.S. (2002). Sequence determinants in hypoxia-indueible factor-1 alpha for hydroxylation by the prolyl hydroxylases PHDl, PHD2, and PHD3. J Biol Chem 277, 39792-39800.

Huang, T., and Duman, J.G. (2002). Cloning and characterization of a thermal hysteresis (antifreeze) protein with DNA-binding activity from winter bittersweet nightshade. Solarium dulcamara. Plant Mol Biol 48, 339-350.

Huelsenbeck, J.P., Rannala, B., and Larget, B. (2000). A Bayesian framework for the analysis of eospeeiation. Evolution Int J Org Evolution 54, 352-364.

Ishiguro, S., and Nakamura, K. (1994). Characterization of a cDNA encoding a novel DNA-binding protein, SPFl, that recognizes SP 8 sequences in the 5' upstream regions of genes coding for sporamin and beta-amylase from sweet potato. Mol Gen Genet 244, 563-571.

Johnson, C.S., Kolevski, B., and Smyth, DR. (2002). TRANSPARENT TESTA GLABRA2, a triehome and seed coat development gene of Arabidopsis, encodes a WRKY transcription factor. Plant Cell 14, 1359-1375.

Jones, H.D., Kurup, S., Peters, N.C., and Holdsworth, M.J. (2000). Identification and analysis of proteins that interact with the Avena fatua homologue of the maize transcription factor VIVIPAROUS 1. Plant J 21, 133-142.

Karrer, E.E., Litts, J.C., and Rodriguez, R.L. (1991). Differential expression of alpha- amylase genes in germinating rice and barley seeds. Plant Mol Biol 16, 797-805.

Kikuehi, S., Satoh, K., Nagata, T., Kawagashira, N., Doi, K., Kishimoto, N., Yazaki, J., Ishikawa, M., Yamada, H., Ooka, H., Hotta, L, Kojima, K., Namiki, T., Ohneda, E., Yahagi, W., Suzuki, K., Li, C.J., Ohtsuki, K., Shishiki, T., Otomo, Y., Murakami, K., lida, Y., Sugano, S., Fujimura, T., Suzuki, Ÿ., Tsunoda, Y., Kurosaki, T., Kodama, T., Masuda, H., Kobayashi, M., Xie, Q., Lu, M., Narikawa, R., Sugiyama, A., Mizuno, K., Yokomizo, S., Niikura, J., Ikeda, R., Ishibiki, J., Kawamata, M., Yoshimura, A., Miura, J., Kusumegi, T., Oka, M., Ryu, R., Ueda, M., Matsubara, K., Kawai, J., Caminci, P., Adachi, J., Aizawa, K., Arakawa, T., Fukuda, S., Hara, A., Hashidume, W., Hayatsu, N., Imotani, K., Ishii, Y., Itoh, M., Kagawa, I., Kondo, S., Konno, H., Miyazaki, A., Osato, N., Ota, Y., Saito, R., Sasaki, D., Sato, K., Shibata, K., Shinagawa, A., Shiraki, T., Yoshino, M., and Hayashizaki, Y. (2003). Collection, mapping, and annotation of over 28,000 cDNA clones from japonica rice. Science 301, 376-379.

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Kim, C.Y., Lee, S.H., Park, H.C., Bae, C.G., Cheong, Y.H., Choi, Y.J., Han, C., Lee, S.Y., Lim, C O., and Cho, M.J. (2000). Identification of rice blast fungal elicitor- responsive genes by differential display analysis. Mol Plant Microbe Interact 13, 470- 474.

Kim, S.Y., and Thomas, T.L. (1998). A family of novel basic leucine zipper proteins binds to seed-specifieation elements in the carrot DcS gene promoter. J Plant Physiol 152,607-613.

Kurup, S., Jones, H.D., and Holdsworth, M.J. (2000). Interactions of the developmental regulator ABI3 with proteins identified from developing Arabidopsis seeds. Plant J 21, 143-155.

Lagaee, M., and Matton, D P. (2004). Characterization of a WRKY transcription factor expressed in late torpedo-stage embryos of Solanum chacoense. Planta 219, 185-189.

Lanahan, M.B., Ho, T.H.D., Rogers, S.W., and Rogers, J.C. (1992). A gibberellin response complex in cereal alpha-amylase gene promoters. Plant Cell 4, 203-211.

Li, J., Brader, G., and Palva, E.T. (2004). The WRKY70 transcription factor: a node of convergence for jasmonate-mediated and salicylate-mediated signals in plant defense. Plant Cell 16, 319-331.

Littewood, T., and Evan, G.I. (1998). Helix-Loop-Helix transcription factors. (New York: Oxford University Press).

MeElroy, D., Rothenberg, M., Reece, K.S., and Wu, R. (1990). Characterization of the rice {Oryza sativa) actin gene family. Plant Mol Biol 15, 257-268.

Meyers, B.C., Kozik, A., Griego, A., Kuang, H., and Michelmore, R.W. (2003). Genome- wide analysis of NBS-LRR-encoding genes in Arabidopsis. Plant Cell 15, 809-834.

Mundy, J., and Chua, N.-H. (1988). Abscisie acid and water-stress induce the expression of a novel rice gene. EMBO J 7, 2279-2286.

Nantel, A., and Quatrano, R.S. (1996). Characterization of three rice basie/leucine zipper factors, including two inhibitors of EmBP-1 DNA binding activity. J Biol Chem 271, 31296-31305.

Niu, X., Helentjaris, T., and Bate, N.J. (2002). Maize ABI4 binds coupling element 1 in abscisie acid and sugar response genes. Plant Cell 14, 2565-2575.

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Pu, W.T., and Struhl, K. (1991). The leueine zipper symmetrieally positions the adjacent basie regions for spécifié DNA binding. Proe Natl Acad Sei USA 8 8 , 6901-6905.

Rizhsky, L., Liang, H., and Mittler, R. (2002). The eombined effect of drought stress and heat shoek on gene expression in tobaeeo. Plant Physiol 130, 1143-1151.

Rizhsky, L., Davletova, S., Liang, H., and Mittler, R. (2004). The zine finger protein Zatl2 is required for cytosolic ascorbate peroxidase 1 expression during oxidative stress in Arabidopsis. J Biol Chem 279, 11736-11743.

Robatzek, S., and Somssieh, I.E. (2001). A new member of the Arabidopsis WRKY transcription factor family, ^tWRKY 6 , is associated with both senescence- and defence-related processes. Plant J 28, 123-133.

Robatzek, S., and Somssich, I.E. (2002). Targets of AtWRKY 6 regulation during plant senescence and pathogen defense. Genes Dev 16, 1139-1149.

Rossberg, M., Theres, K., Acarkan, A., Herrero, R., Schmitt, T., Schumacher, K., Schmitz, G., and Schmidt, R. (2001). Comparative sequence analysis reveals extensive mieroeolinearity in the lateral suppressor regions of the tomato, Arabidopsis, and Capsella genomes. Plant Cell 13, 979-988.

Rushton, P.J., Hooley, R., and Lazarus, C.M. (1992). Aleurone nuclear proteins bind to similar elements in the promoter regions of two gibberellin-regulated alpha-amylase genes. Plant Mol Biol 19, 891-901.

Rushton, P.J., Macdonald, H., Huttly, A.K., Lazarus, C.M., and Hooley, R. (1995). Members of a new family of DNA-binding proteins bind to a conserved cA-element in the promoters of alpha-Amy2 genes. Plant Mol Biol 29, 691-702.

Savkur, R.S., and Burris, T.P. (2004). The eoaetivator LXXLL nuclear receptor recognition motif. J Pept Res 63, 207-212.

Schultz, T.F., Medina, J., Hill, A., and Quatrano, R.S. (1998). 14-3-3 proteins are part of an abscisie acid-VIVIPAROUS1 (VPl) response complex in the Em promoter and interact with VPl and EmBPl. Plant Cell 10, 837-847.

Seeler, J.S., and Dejean, A. (2003). Nuclear and unclear functions of SUMO. Nat Rev Mol Cell Biol 4, 690-699.

Seki, M., Narusaka, M., Ishida, J., Nanjo, T., Fujita, M., Gono, Y., Kamiya, A., Nakajima, M., Enju, A., Sakurai, T., Satou, M., Akiyama, K., Taji, T., Yamaguehi- Shinozaki, K., Caminei, P., Kawai, J., Hayashizaki, Y., and Shinozaki, K. (2002). Monitoring the expression profiles of 7000 Arabidopsis genes under drought, cold and high-salinity stresses using a full-length cDNA mieroarray. Plant J 31, 279-292.

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Sharp, P.A. (1981). Speculations on RNA splicing. Cell 23, 643-646.

Shen, Q., and Ho, T.H.D. (1995). Functional dissection of an abscisie acid (ABA)- inducible gene reveals two independent ABA-responsive complexes each containing a G-box and a novel cA-acting element. Plant Cell 7, 295-307.

Shen, Q., Uknes, S.J., and Ho, T.H.D. (1993). Hormone response complex of a novel abscisie acid and cycloheximide inducible barley gene. J Biol Chem 268, 23652- 23660.

Shen, Q., Zhang, P., and Ho, T.H.D. (1996). Modular nature of abscisie acid (ABA) response complexes: composite promoter units that are necessary and sufficient for ABA induction of gene expression in barley. Plant Cell 8, 1107-1119.

Sonnhammer, E.L., Eddy, S R., Bimey, E., Bateman, A., and Durbin, R. (1998). Pfam: multiple sequence alignments and HMM-profiles of protein domains. Nucleic Acids Res 26, 320-322.

Sun, C., Palmqvist, S., Olsson, H., Boren, M., Ahlandsberg, S., and Jansson, C. (2003). A novel WRKY transcription factor, SUSIBA2, participates in sugar signaling in barley by binding to the sugar-responsive elements of the isol promoter. Plant Cell 15, 2076-2092.

Suzuki, M., Kao, C.Y., and McCarty, D R. (1997). The conserved B3 domain of VIVIPAROUS 1 has a cooperative DNA binding activity. Plant Cell 9, 799-807.

Swofford, D. (2000). PAUP*: Phylogenetic Analysis Using Parsimony. (Sunderland, MA: Sinauer).

Thompson, J.D., Higgins, D.G., and Gibson, T.J. (1994). CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res 22, 4673-4680.

Tiwari, S.B., Hagen, G., and Guilfoyle, T.J. (2004). Aux/IAA Proteins Contain a Potent Transcriptional Repression Domain. Plant Cell 16, 533-543.

Toledo-Ortiz, G., Huq, E., and Quail, P.H. (2003). The Arabidopsis basie/helix-loop- helix transcription factor family. Plant Cell 15, 1749-1770.

Turck, F., Zhou, A., and Somssieh, I.E. (2004). Stimulus-dependent, promoter-specific binding of transcription factor WRKY I to its native promoter and the defense-related gene PcPRl-1 in Parsley. Plant Cell 16, 2573-2585.

Ulker, B., and Somssieh, I.E. (2004). WRKY transcription factors: from DNA binding towards biological function. Curr Qpin Plant Biol 7, 491-498.

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Verger, A., Perdomo, J., and Crossley, M. (2003). Modification with SUMO. A role in transcriptional regulation. EMBO Rep 4, 137-142.

Wen, N., Chu, Z., and Wang, S. (2003). Three types of defense-responsive genes are involved in resistance to bacterial blight and fungal blast diseases in rice. Mol Genet Genomics 269, 331-339.

Xu, Y.El., Wang, J.W., Wang, S., Wang, J.Y., and Chen, X.Y. (2004). Characterization of GaWRKYl, a cotton transcription factor that regulates the sesquiterpene synthase gene (+)-delta-eadinene synthase-A. Plan Physiol 135, 507-515.

Yu, D., Chen, C., and Chen, Z. (2001). Evidence for an important role of WRKY DNA binding proteins in the regulation o f NPRl gene expression. Plant Cell 13, 1527-1540.

Yu, J., Hu, S., Wang, J., Wong, G.K., Li, S., Liu, B., Deng, Y., Dai, L., Zhou, Y., Zhang, X., Cao, M., Liu, J., Sun, J., Tang, J., Chen, Y., Huang, X., Lin, W., Ye, C., Tong, W., Cong, L., Geng, L, Han, Y., Li, L., Li, W., Hu, G., Li, J., Liu, Z., Qi, Q., Li, T., Wang, X., Lu, H., Wu, T., Zhu, M., Ni, P., Han, H., Dong, W., Ren, X., Feng, X., Cui, P., Li, X., Wang, H., Xu, X., Zhai, W., Xu, Z., Zhang, L, He, S., Xu, J., Zhang, K., Zheng, X., Dong, J., Zeng, W., Tao, L., Ye, J., Tan, J., Chen, X., He, J., Liu, D., Tian, W., Tian, C., Xia, H., Bao, Q., Li, G., Gao, H., Cao, T., Zhao, W., Li, P., Chen, W., Zhang, Y., Hu, J., Liu, S., Yang, J., Zhang, G., Xiong, Y., Li, Z., Mao, L., Zhou, C., Zhu, Z., Chen, R., Hao, B., Zheng, W., Chen, S., Guo, W., Tao, M., Zhu, L., Yuan, L., and Yang, H. (2002). A draft sequence of the rice genome (Oryza sativa L. ssp. indica). Science 296, 79-92.

Zhou W, Ryan JJ, Zhou H (2004) Global analyses of sumoylated proteins in Saccharomyces cerevisiae: induction of protein sumoylation by cellular stresses. J Biol Chem 279: 32262-32268.

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. CHAPTER 3

INTERACTIONS OF TWO ABSCISIC-ACID INDUCED IERÆE GENES IN

REPRESSING GIBBERELLIN SIGNALING IN ALEURONE CELLS

This chapter has been published in The Plant Journal and is presented in the style of that

journal. The complete citation is:

Xie, Z., Zhang, Z.L., Zou, X., Yang, G., Komatsu, S., and Shen, Q.J. (2006). Interactions

of two abseisic-aeid induced WRKY genes in repressing gibberellin signaling in aleurone

cells. Plant Journal 46, 231-242.

Summary

Gibberellins (GA) promote while abscisie acid (ABA) inhibits seed germination and

post-germination growth. To address the crosstalk of GA and ABA signaling, we studied

two rice WRKY genes (OsWRKYSl and O sW RKYll) that are ABA-indueible and GA-

repressible in embryos and aleurone cells. Qverexpression of these two genes in aleurone

cells specifically and synergistically represses the induction of the ABA-repressible and

GA-indueible Amy22b alpha-amylase promoter reporter construct (Amy32b-GUS) by GA

or the GA-indueible transcriptional activator, GAMYB. The physical interaction of

Reproduced witti permission of ttie copyrigfit owner. Furtfier reproduction profiibited witfiout permission. OsWRKY? 1 proteins themselves and that of OsWRKY? 1 and OsWRKY51 are revealed

in the nuclei of aleurone cells using bimolecular fluorescence complementation (BiFC)

assays. Although OsWRKYSl itself does not bind to the AmySlb promoter in vitro, it

interacts with the OsWRKY? 1 and enhances the binding affinity of OsWRKY? 1 to W-

boxes in the Amy32b promoter. The binding activity of OsWRKY? 1 is abolished by

deleting the C-terminus containing the WRKY domain or substituting the key amino

acids in the WRKY motif and the zine finger region. However, two of these non-DNA-

binding mutants are still able to repress GA induction by enhancing the binding affinity

of the wild type DNA-binding OsWRKY? 1 repressors. In contrast, the third non-DNA

binding mutant enhances GA-induetion of Amy32b-GUS, by interfering with the binding

of the wild-type OsWRKY? 1 or the OsWRKY? 1/OsWRKY51 repressing complex.

These data demonstrate the synergistic interaction of ABA-inducible WRKY genes in

regulating GAMYB-mediated GA signaling in aleurone cells, thereby establishing a

novel mechanism for ABA and GA signaling crosstalk.

Introduction

The aleurone layer of cereal grains serves as a convenient system of studying

gibberellic acid (GA) and abscisie acid (ABA) signal transduction pathways. During

germination of cereal grains, GA is secreted from embryos into aleurone cells to promote

the expression of hydrolytic enzymes, such as a-amylases, which are necessary to utilize

stored reserves within the endosperm for seed germination and post-germination growth

(Ritchie and Gilroy, 1998b; Lovegrove and Hooley, 2000). In contrast, ABA suppresses

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. GA induction of a-amylase gene transcription and blocks seed germination (Karssen et

a l, 1983; Koomneef and Karssen, 1994).

The GA signal is perceived by receptors such as GIDl (Ueguchi-Tanaka et al., 2005).

The activated receptor triggers signal transduction events, including degradation of

negative regulators by proteasomes (reviewed in Itoh et al., 2003; Sun and Gubler, 2004),

elevation of cGMP (Penson et al., 1996) and cytoplasmic Ca^"^ concentrations (Gilroy and

Jones, 1992), induction of transcriptional activators, and expression of genes. CA-acting

elements necessary and sufficient for GA response of high-pl and low-pl a-amylase

genes have been defined, and several transcription factors which bind to these elements

have also been isolated (Rogers and Rogers, 1992; Tanida et al., 1994). Proteins binding

to these cA-aeting elements have also been reported (Gubler et al., 1995; Rushton et al.,

1995; Lu et al., 2002; Zentella et al., 2002; Washio, 2003; Kaneko et al., 2004; Zhang et

al., 2004).

WRKY genes belong to a gene superfamily encoding transcription factors which are

involved in the regulation of various biological processes, including pathogen defense,

senescence, and development (reviewed in Eulgem et al., 2000; Ulker and Somssieh,

2004). Four of the six WRKY genes that are expressed in rice aleurone cells, OsWRKY24,

-51, -71, and -72 are ABA inducible (Xie et al., 2005). Furthermore, OsWRKY51 and

OsWRKY71 share a similar expression pattern in response to GA and ABA in rice

aleurone cells, and neither of them affects ABA induction of HVA22 transcription (Xie et

al., 2005). Here, we report the eo-expression of OsWRKY51 and OsWRKY71 in embryos

and aleurone cells of rice seeds. OsWRKY51 and OsWRKY? 1 physically interact in the

nuclei to synergistically suppress the induction of Amy32b by GA.

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Results

OsWRKYSl and OsWRKY? 1 are eo-expressed in seeds

The in situ hybridization studies were performed with husked rice seeds treated

without or with 10 pM uniconazole (a GA biosynthesis inhibitor) or 20 pM ABA for 30 h.

DIG-labeled gene-speeifie anti-sense RNA probes were used to detect OsWRKYSl and

OsWRKY? 1 mRNA in situ. In cross-seetions of rice seeds treated without hormones,

OsWRKYSl and OsWRKY? 1 signals were detected predominantly in the plumule, radicle

and scutellum of embryo, and the aleurone layer (Panels A and A’, Figure 3-1).

OsWRKYSl and OsW RKYll signals were enhanced by uniconazole (Panels B and B’)

and ABA treatments (Panels C and C’), suggesting that the expression of these two genes

in seeds is induced by ABA, but repressed by GA. This result is consistent with our

previous observation that both OsWRKYSl and OsW RKYll are up-regulated by ABA and

down-regulated in response to GA treatments in rice aleurone cells (Xie et al., 2005).

OsWRKY51 suppresses GA induction of a-amylase gene expression

OsWRKYSl encodes a group II WRKY protein which contains one WRKY domain

with a C 2H2-type zinc finger motif (Supplemental Figure 3-la). Putative orthologs of

OsWRKY51 have been found in wheat, barley, wild oat, maize and Arabidopsis

(Supplemental Figure 3-lb).

We have shown that OsWRKY? 1 suppresses GA induction of a-amylase expression

(Zhang et al., 2004). Because OsWRKYSl and OsW RKYll are co-expressed in embryos

and aleurone layers of rice seeds and they share a similar expression pattern in response

to GA and ABA treatments (Figure 3-1), we studied whether they have a similar function

in GA signaling in aleurone cells. The genomic fragment spanning from ATG to the stop

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. OsWRKYSl OsWRKYll

Water R-^ fOO mM 50 nM 500 uM 50 (i\l

Uniconazole p'^ R ^ 500 ii\l 50 )xM 500 liM

ABA / R-» 500 iiM 50 oM 500 ji\l

Sense P ^ Probe R-> R 500ii\1 50 nM 500 nM 50 nM

Figure 3-1. OsWRKYSl and OsWRKYl 1 mRNA localization in imbibed rice seeds. Data for OsWRKYSl mRNA localization in embryo and aleurone tissues are shown in Panels A through D and those for OsW RKYll mRNA are in Panels A’ through D’. Husked rice seeds were treated without (Panels A and A’), or with 10 pM uniconazole (Panels B and B’) or 20 pM ABA (Panels C and C’) for 30 h, respectively. Cross- sections of seed were hybridized to the DIG-labeled anti-sense RNA probes (Panels A through C and A’ through C’). The DIG-labeled sense RNA probes were used as the negative controls (Panels D and D’). AL, aleurone layer; P, plumule; R, radicle.

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. A Reporter constructs Figure 3-2. OsWRKYSl suppresses Amy32b ^GUS Amy32b-T GA induction of the Amy32b — i-TJ 7 promoter promoter. ^GUS HVA22-1 (A) Schematic diagrams of the HVA22------1—K promoter reporter and effector constructs used Effector constructs in the co-bombardment experiment. jjgj^^J*0sfVRKY51 NOS-T Rectangles denote exons and lines promoter designate introns. Filled rectangles Uar y*0sWRKY51tn f^oS-i ^t-n-m----- represent the WRKY domain. promoter Hatched regions represent the GUS C2 0 2 -^Stop codon reporter gene. The 3’-deletion mutant {OsWRKYSlm) encodes

10 amino acids 1 through 2 0 1 . if * (B) The effect of OsWRKYSl on T3 X 6 GA induction of Amy32b-GUS. The

4 reporter construct, and the internal 2 construct, UBI-LUC, were co bombarded into barley de-embryo 0 4- GA + + + + half-seeds without (-) or with (+) ABA - effector constructs. Bars indicate OsWRKYSl - — “ + + — OsWRKYSlm - normalized GUS activities after 24 h of incubation of the bombarded half seeds without (-) or with (+) 1 pM G A3. Data are means ±SE of four if replicates. 7 3 X (C) The dosage experiment was N performed with a constant amount of the reporter construct (Amy32b- 0 25 50 75 100 GUS) and varied amounts of UBI- Relative Amount o f OsWRKYSl (%) plus 1 pM GA; OsWRKYSl (0%~100% relative to the reporter construct) in the presence of 1 pM G A 3. D (D) The dosage experiment was if performed with a constant amount 7 3 X of the reporter construct (HVA22- it GUS) and varied amounts of UBI- o OsWRKYSI (0%~100%) in the < 100 presence of 20 pM ABA. Relative Amount o f OsWRKYSl (%) plus 20 pM ABA

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. codon of OsWRKYSl was cloned into an expression vector driven by the maize ubiquitin

promoter (Figure 3-2A). Using the GA inducible reporter construct, Amy32b-GUS

(Lanahan et ah, 1992), we showed that the exogenous GA 3 treatment resulted in a 42-fold

induction of the GUS activity over the control (Figure 3-2B). ABA completely blocked

GA induction of Amy32b-GUS. Co-expression of UBl-OsWRKYSl decreased GA

induction of Amy32b-GUS to 2-fold over the control. However, substituting a stop codon

for the 202*^ codon of OsWRKYSl in the effector construct, which produced a truncated

OsWRKYSl protein missing the WRKY domain and C-terminal end (OsWRKYSlm),

released 71% of the repression activity on GA induction (Figure 3-2B).

The repression effect of OsWRKYSl was further confirmed by a dosage experiment,

in which the amount of the reporter construct, Amy32b-GUS, was held constant, while

that of the effector construct, UBI-OsWRKYSl, varied from 0 to 100% relative to the

molar amount of the reporter construct (Figure 3-2C). Upon increasing the amount of the

effector construct, a gradual decline of expression of Amy32b-GUS was observed. Similar

dosage experiment with the ABA inducible reporter construct, HVA22-GUS (Shen and

Ho, 199S) indicated that UBI-OsWRKYSl had little effect on ABA induction of HVA22-

GUS (Figure 3-2D). These results suggest that OsWRKYSl is likely an ABA-inducible

repressor of GA signaling.

OsWRKYSl and OsWRKY71 synergistically suppress

GA induction of the Amy32b promoter

To study the combinatory effect of these two repressors, dosage experiments were

performed for OsWRKYSl alone, OsWRKY71 alone, and OsWRKYSl with

OsWRKY71 (Figure 3-3A). The results indicated that co-expression of UBI-OsWRKYSl

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. at the 1% (effector/reporter) ratio had no suppression activity on the GA induction of

Amy32b-GUS. Co-expression of 1% UBl-0sWRKY71 suppressed the GA induction of

Amy32b-GUS to 91% of the control. Interestingly, co-expression of 1% UBI-0sWRKY51

plus 1% UBI-0sWRKY71 strongly reduced the GA induction of Amy32b-GUS to 25% of

the control (Figure 3-3B). It is important to point out that this increased effect is unlikely

due to twice as much effector DNA used in the mixture. In fact, the reporter expression

level resulting from the 1% UBI-0sWRKY51 plus 1% UBI-OsWRKY71 was even lower

than 2.5%, 5%, 7.5% or 10% UBI-OsWRKY51 or UBI-OsWRKY71 alone. These results

suggest that the effect of OsWRKY51 and OsWRKY71 is not additive, but they

synergistically act to suppress the GA induction of Amy32b.

Physical interaction of WRKY proteins are

visualized in the nuclei of aleurone cells

OsWRKY71 is targeted to nuclei of aleurone cells (Zhang et al., 2004). The UBI-

GFP:OsWRKYSl fusion and the UBl-GFP control constructs were introduced,

respectively, into barley aleurone cells by bombardment. Confocal microscopic studies

indicated that GFP fluorescence was detected in the entire cells bombarded with the UBl-

GFP control (Panel I, Figure 3-4A). However, the signal was only observed in nuclei of

the aleurone cells bombarded with UBl-GFP:OsWRKYSl (Panel III). As controls,

aleurone cell nuclei were stained with the red fluorescent dye, SYT017 (Panels II and

IV). These results suggest that OsWRKY51 is also targeted to nuclei.

We next studied whether OsWRKY51 and OsWRKY71 physically interact with each

other in aleurone cells. The OsWRKYSl and OsWRKY71 coding sequences were fused in

frame with either that coding for the N-terminal fragment of YFP (YN) or that coding for

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Reporter construct Amv32b f—^GUS■*GUS Amy32b-T — L_K------promoter Effector constructs UBI ■OsWRKYSl ]\!0S-1 promoter OsWRKY? 1 NOS-1 ™ TrO - d promoter

OsWRKYSl OsWRKY? 1 OsWRKYS 1 +0sWRKY71

0% 2% 4% 6% 8% 10% Relative Amount o f Effector (%) plus 1 pM GA;

Figure 3-3. OsWRKYSl and OsWRKY? 1 synergistically suppress GA induction of the Amy32b promoter. (A) Schematic diagrams of the reporter and effector constructs used in the co bombardment experiment. The annotations are the same as in Figure 3-2. (B) The dosage experiment was carried out with the constant amount of the reporter construct {Amy32b-GUS) and varied amounts of the effector eonstruet(s) in the presence of 1 pM GA] for 24 hr. The relative amount of effector construct was indicated in percentage compared to the amount of reporter. Each data point indicates mean GUS activities ±SE of four replicates.

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. UBl-GFP ÜBI-GFP:0sWRKY51 Figure 3-4. Visualization of interactions between WRKY proteins in aleurone cells by bimolecular fluorescence complementation. (A) Barley half-seeds were bombarded with either UBl-GFP (Panels I and II) or UBl- GFP .OsWRKYSl (Panels III and IV). After incubation for 24 hr, the aleurone cells were stained with SYT017 to localize nuclei (Panels II, IV), followed by examination of GFP fluorescence (Panels I and III). B yF YN:OsW71/YC:OsW71 Arrows point to the same cell. The bars represent 2 0 mm. (B) Barley half-seeds were bombarded with either UBl-YFP or combination of constructs encoding indicated fusion proteins. YN, the fragment containing amino acid YN:OsW51/YC:OsW71 YN:OsW71/YC:OsW51 residues 1-154 of YFP; YC, the fragment containing amino acid residues 155-238 of YFP. After ( | f O a ; incubation at 24° C for 24 h, yellow fluorescence was observed through a ■SMÎJ eonfoeal microscope. YN:OsW51/YC:OsW51

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. the C-terminal fragment (YC). We tested the complementation between different

combinations of fusion proteins by introducing the corresponding constructs into barley

aleurone cells. Confocal microscopic studies showed that YFP fluorescence was detected

in the entire cells bombarded with the UBl-YFP construct (Panel I, Figure 3-4B). As

expected, no fluorescence was detected when only one of fusion constructs was

introduced into aleurone cells (data not shown). However, yellow fluorescence was

observed in the nuclei of aleurone cells bombarded with the UBl-YN:OsWRKYll and

UBl-YC:OsWRKYll constructs, suggesting that OsWRKY? 1 proteins interact in nuclei

(Panel II). Similarly, yellow fluorescence was detected in the nuclei of aleurone cells

bombarded with either UBl-YN: OsWRKY51 and UBl-YC : OsWRKYl 1 (Panel III), or UBl-

YN:OsWRKYll and UBl-YC:OsWRKYSl (Panel IV), indicating that OsWRKY? 1

interacts with OsWRKY51 in nuclei of aleurone cells. In contrast, no fluorescence was

detected in aleurone cells bombarded with UBl-YN: OsWRKY SI and UBl-YC: OsWRKYSl,

suggesting that OsWRKYSl proteins might not physically interact with each other (Panel

V).

Interaction of OsWRKYSl and OsWRKY? 1 enhances the

binding affinity of OsWRKY? 1 to the Amy32b promoter

We have previously shown that OsWRKY? 1 binds to the W-boxes in the Amy32b

promoter (Zhang et al., 2004). Because OsWRKYSl interacts with OsWRKY? 1 in nuclei

(Figure 3-4B) to repress GA induction of the Amy32b promoter (Figure 3-3), we asked

whether OsWRKYSl also binds the Amy32b promoter and whether the interaction of

OsWRKYSl and OsWRKY? 1 has any effect on individual binding affinities.

Electrophoretic mobility-shift assays (EMSAs) were performed with the C-terminal His-

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. tagged OsWRKYSl (SIH) and the N-terminal glutathione S'-transferase (GST)-tagged

OsWRKY? 1 (G?l) proteins. A DNA fragment that contains the Amy32b promoter region

from -1?6 to -1 was labeled with a-^^P-dATP (Figure 3-SA). No binding signal was

detected in reactions without protein (lane 1, Figure 3-SB) or with GST only (lane 2).

Consistent with our previous report (Zhang et ah, 2004), G?1 bound to the Amy32b

promoter specifically (lane 3). In the presence of 0.2S pM Zn^^, the binding affinity of

G?1 was significantly increased (lane 4) and an excess amount of unlabeled competitor

(a DNA fragment from -1?1 to -111 which contains W-boxes) competed with the in

vitro binding (lanes S and 6 ).

Unlike G?l, SIH alone did not bind to the Amy32b promoter without (lane ?) or with

Zn^^ (lane 8 ). In the absence of Zn^^, SIH and G?1 together did not bind to Amy32b

promoter either (lane 11). However, in the present of Zn^"^, a strong signal was detected,

and the complex was shifted higher than that obtained with G?1 alone (compare lane 12

with lane 4). In addition, the excess amount of unlabeled DNA fragments competed with

the binding of WRKY proteins (lanes 13 and 14). These results suggest that OsWRKYSl

interacts with OsWRKY? 1 to bind the Amy32b promoter in a Zn^^-dependent manner.

To further demonstrate whether the OsWRKYSl/OsWRKY? 1 complex speeifieally binds

to two W-boxes in the Amy32b promoter, a DNA fragment containing the W boxes and

Pyr box of the Amy32b promoter (from -1?1 to -111) was used as a probe, and

competition assays were carried out using the wild type and mutant DNA fragments

(Figure 3-SC). No binding signal was detected in the reactions without protein (lane 1,

Figure 3-SD), with GST (lane 2), or with SIH only (lane 3). However, G?1 bound to the

wild-type Amy32b probe (lane 4), and an excess amount of unlabeled wild-type DNA

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. fragment competed for this binding (lane 5). The fragment with only the second W-box

(M l, lane 6 ) competed for the binding of OsWRKY? 1 more efficiently than that with

only the first W-box (M2, lane ?), although both of them have a weaker competition than

the wild-type fragment (WT). However, the fragment with both W-boxes mutated (M3)

showed little competition with the binding of G?1 to the probe (lane 8 ). As a negative

control, a mutation in Pry box did not affect the binding of OsWRKY? 1 to W-boxes (lane

9). Similar results were observed for the OsWRKYS l/OsWRKY?l complex (Lanes 10

through 20). The only difference was that much stronger signals were observed for the

OsWRKYSl/OsWRKY? 1 complex than OsWRKY? 1 alone. These results indicate that

either OsWRKY? 1 only or the OsWRKYS 1/OsWRKY? 1 complex is capable of binding

to either W-box in the Amy32b promoter region with a preference to the second one, and

tandem-repeat W-boxes significantly increase the binding affinity.

OsWRKY? 1 mutant proteins regulate the expression o f Amy32b

by modulating the binding affinities of OsWRKYSl and

OsWRKY? 1 to the W-boxes of the Amy32b promoter

To map the functional domains of OsWRKY? 1, the wild type and mutant derivatives

(Figure 3-6A) of UBI-W71 (the full length cDNA of OsW RKYll driven by the ubiquitin

promoter) were prepared and introduced into aleurone cells by eo-bombardment. Co

expression of U Bl-W ll decreased GA induction of the Amy 32b promoter from 38-fold to

3-fold (Figure 3-6B). Surprisingly, mutations either in the WRKY motif (W?lmW) or in

conserved histidine residues of the zine finger motif (W?lmH) hardly affected the

inhibitory activity on the GA induction even though these motifs are the hallmarks of the

WRKY proteins. Even more surprisingly, the truncated OsWRKY? 1 that lacks of the

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. w-box 1 ® W-box2 0 Pyr O GARE □ Amy32b promoter 0Q , +79 Competitor -171.

GST 071 51H 51H+G71 Protein

- 20 200 - 20 200 20 200 X Competitor Fold + 4- 4- + + + + + + Zn^ WI

Free Probes

10 11 12 13 14 Lane Number

W-box 1 0 W-box 2 O Pyr O WT -171 —@ 0 ^ - 111

Ml -171 —^3— ^ 1 1 1 M2 -171 —#9----- 0--111 M3 -171 0 8 — 0 - - 1 1 1 M4 -i7i-@ 0-—4&--111

GST 51H G71 51H+G71 Protein WT M l M2 M3 M4 WT Ml M2 M3 M4 Competitor

200 200 200 200 200 2 0 2 0 0 2 0 2 0 0 2 0 200 2 0 2 0 0 2 0 2 0 0 XFold

Probes

1 2 6 7 9 10 11 12 13 14 15 16 17 18 19 20 Lane Number

Figure 3-5. Interaetion of OsWRKYSl and OsWRKY? 1 enhances the binding affinity of OsWRKY? 1 to the Amy32b promoter.

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Figure 3-5. (eontinued) (A) The 371-bp probe (-176 to +79 plus the first intron of AmySlb) and 61-bp competitor (-171 to -111) used in EMSA in Panel B. Circles denote W-boxes; diamond represents the pyrimidine-box; and rectangle represents GARE in the Amy32b promoter. The DNA probe was end-labeled with a-^^P-dATP. (B) EMSA with recombinant OsWRKYSl and OsWRKY? 1 proteins and the ^^P- labeled DNA probe in the absence (-) or presence (+) of 0.25 pM Zn^"^. Recombinant proteins, OsWRKYSl:HIS (SIH) and GST:OsWRKY?l (G?l) were used in EMSA without or with the excess amount of competitors (20- or 200-fold). GST indicates the control binding reaction with the GST protein only. Binding reaction mixtures were separated on a 3.5% polyacrylamide gel. The gray arrow points to the binding signal of OsWRKY? 1; the black arrow points to the signal of the complex of OsWRKYSl and OsWRKY? 1. The free probe is indicated in the bottom. (C) The wild-type DNA fragment (-171 to -111 in Amy32b promoter) was used as probe in EMSA in Panel D, with unlabeled wild-type (WT) or mutant (M1-M4) competitors. Elements with a cross through them represent the mutated cA-acting elements in the competitor fragments. (D) EMSA with recombinant OsWRKYSl and OsWRKY? 1 proteins and the ^^P- labeled wild-type DNA probe in the presence of 0.25 pM Zn^"^. Recombinant proteins, OsWRKYS THIS (SIH) and GST:OsWRKY?l (G?l) were used in EMSA without or with an excess amount of competitor (20- or 200-fold). GST indicates the binding reaction with the GST protein only. Free probe is indicated at the bottom. The binding reaction mixtures were separated on a 5% polyacrylamide gel because the probe (71- bp) is much shorter compared to that (371-bp) used in Panel B. As a result, the super shift signal for OsWRKYS l/OsWRKY?l is less obvious than that in Panel B.

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. WRKY domain and C-terminal region (W71m213) enhanced the expression of Amy32b-

GUS, leading to a 6 -fold induction in the absence of GA. In the presence of GA the

induction level increased to 55-fold. However, the truncated OsWRKY? 1, which

contains the WRKY domain but lacks of the C-terminal region (G?lm267), still had the

repression activity although it was much lower than the wild type.

To understand how these mutant proteins regulate the expression of the Amy32b

promoter, EMSA was carried out with GST-lused wild-type or mutant OsWRKY? 1

proteins. The DNA probe that contains the Amy32b promoter region from -176 to -1 was

end-labeled with a-^^P-dATP. As shown in Figure 3-6C, the wild-type OsWRKY? 1

bound to the Amy32b promoter (lane 2), and the binding was abolished in the presence of

a Zn^^ chelator (1,10-phenanthroline) at a concentration of 10 mM (lane 3). Interestingly,

although W?lmW and W?lmH retained significant levels of repression activity and

W?lm213 enhanced the expression of Amy32b-GUS, none of these proteins bound to the

Amy32b promoter (lanes 4 through 6). In contrast, the binding activity of W?lm26? to

the probe was enhanced 13-fold (lane ?). The binding is specific as the signal was

diminished by an excess amount of competitor (from -171 to - 1 1 1 of the promoter, data

not shown). These results suggest that 1) the region containing the WRKY domain

(amino acids 213-266) of OsWRKY? 1 is necessary for DNA binding; 2) the C-terminus

(amino acids 267-348) is critical for the repressing activity of OsWRKY? 1 on GA

induction of Amy32b.

The results described above raised an intriguing question: how do the mutant proteins,

W?lmW, W?lmH and W?lm213 modulate the expression oîAmy32b without binding to

its promoter region? One possible mechanism is that the mutant proteins could still bind

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. to the promoter, although at a much lower affinity. Another possibility is that mutant

proteins enhance or interfere with the binding of endogenous orthologue of OsWRKY51

and OsWRK71 in barley aleurone cells to the W-boxes of the Amy32b promoter.

The logic underlying this hypothesis is that wild type barley aleurone cells were used in

the functional assays throughout this study. Both barley and rice are cereal plants in

which the GA and ABA signaling pathways are highly conserved. We used the barley

aleurone layers because they are much easier to prepare and they provide a much higher

level of reporter gene expression (Zhang et al., 2004). Indeed, the putative barley

orthologue of OsWRKYVl has been shown to bind to the promoter of Amy32b in vitro

(Mare et al., 2004). To test this hypothesis, EMSA was carried out with the combination

of wild-type proteins and mutant proteins by using the ^^P-labeled DNA probe that

contains the -176 to -1 Amy32b promoter region (Figure 3-6D). As reported above,

OsWRKY71 alone bound to the probe (lane 1) and OsWRKYSl increased the binding of

OsWRKY71 by about 40% (lane 5). Similarly, the W71mW (lane 2) and W71mH (lane 3)

mutant proteins, which are also unable to bind to the promoter, increased the binding

activity of OsWRKY71 to the probe by 4-fold and 3-fold, respectively. A similar pattern

was observed for the OsWRKY51/OsWRKY71 complex; the W71mW (lane 6 ) and

W71mH (lane 7) mutant proteins further enhanced the binding activity of this complex to

the probe. In contrast, addition of W71 m213 decreased the binding signal by 35% for

OsWRKY71 (compare lane 4 with lane 1), and 77% for the OsWRKYSl/OsWRKY71

complex (compare lane 8 with lane 5). This reduction is unlikely due to the increased

amounts of proteins used in these two lanes. In fact, GST proteins were added in the

reactions with OsWRKY71 (lane 1) or OsWRKY71 plus OsWRKYSl (lane S) to ensure

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. A Reporter construct G71 Amy32b Amy32b-T promoter GST WT WT mW mH m213 m267 Protein + - - - - Pananthroline Effector constructs uBi r*^ NOS-T promoter UBI rW7I NOS-T promoter

UBI [-» W7ImW NOS-T promoter I8W R X Y 201 ' 19s R R A D 2 0 1

UBI ■ W7ImH NOS-T promoter 2 4 s H N H 2 5 0 2 4 8 Q N S 2 5 0

UBI [-» W7Im2I3 mS-'X promoter R213 -► Stop codon Probe

UBI W7Im267 NOS-T Lane Number promoter S267 “► Stop codon D + 51H + G71 - G71mW - G71mH + G71m213 < 00 OD T3

Z ga + + + - + + W71 + mW mH m213 m213 m267

6 Lane Number g 4

GA + + + + + 10% W5I - +

yo%iE7y - + + W 71m2I3 - + +

Figure 3-6. Mutant OsWRKYVl proteins regulate the expression of Amy32b-GUS hy modulating the binding affinity of OsWRKYSl and OsWRKY? 1 to the W-boxes.

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Figure 3-6. (continued) (A) Schematic diagrams of the reporter and effector constructs used in the co bombardment experiment. The full-length cDNA sequences of OsWRKYSl and OsWRKY? 1 were driven by the constitutive ubiquitin promoter in the effector constructs {UBI-W51 and UBI-W71). The mutations of OsW RKYll are shown below the diagrams of the mutant constructs. (B) The reporter construct, and the internal control construct, UBI-LUC, were co bombarded into barley de-embryo half-seeds without (-) or with (-I-) effector constructs. Unless indicated, equal molar amounts of effector and reporter were used. Bars indicate normalized GUS activities after 24 h of incubation of the bombarded half-seeds without (-) or with (+) G A 3. Data are means ±SE of four replicates. (C) Recombinant GST:0sWRKY71 (G71) and mutant OsWRKY? 1 proteins were used in EMSA with the ^^P-labeled DNA probe containing the promoter (-176 to -1), 5’ UTR, and the first intron of Amy32b (371-bp total). GST indicates the control binding reaction with the GST protein only; 10 pM 1,10-pananthroline was used as a chelator of the Zr7^ ions. (D) Recombinant OsWRKYSl:HIS (51H), GST:0sWRKY71 (G71) and mutant OsWRKY? 1 proteins were used in EMSA with the ^^P-labeled DNA probe containing the promoter (-176 to -1), 5’ UTR, and the first intron o f Amy32b (371-bp total). GST was added to ensure that the same total amount of protein was used in each reaction in lanes 1 through 4 and lanes 5 through 8 , respectively. Free probe is indicated in the bottom. (E) The reporter construct and the internal control construct, UBI-LUC, were co bombarded into barley de-embryo half-seeds without (-) or with (-I-) effector constructs. UBl-0sWRKY51 and UBI-OsWRKY? 1 effector constructs were used at a ratio of 1:10 without (-) or with (+) the UBI-W71m213 effector construct. Bars indicate normalized GUS activities after 24 h of incubation of the bombarded half seeds without (-) or with (-I-) G A 3. Data are means ±SE of four replicates.

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. that the total amount of protein was the same for each reaction in the left panel (lanes 1

through 4) or eaeh one in the right panel (lanes 5 through 8). These results indicate that

W71mW and W71mH suppress the GA induction of Amy32b by increasing the in vivo

binding of the barley orthologue of OsWRKYSl (Supplemental Figure 3-1) and

OsWRKY? 1 (Mare et ah, 2004) proteins to the W-boxes of the Amy32b promoter in

barley aleurone cells. In contrast, G71m213 enhances the GA induction o f Amy32b by

inhibiting the binding of the WRKY repressor proteins to the W-boxes.

To further test the hypothesis, UB1-W71m213 was introduced into aleurone cells

along with 10% UBI-W51 (the full length cDNA of OsWRKYSl driven by the ubiquitin

promoter) and 10% UB1-W71, alone or in combination. The results indicate that eo-

expression of 10% UB1-W71 or 10% UB1-W71 plus 10% UBl-WSl is sufficient to repress

GA induction of Amy32b. However, co-expression of UB1-W71m213 enhanced GA

induction to 103-fold. W71m213 also reduced the inhibitory effect of OsWRKYSl plus

OsWRKY? 1 by as much as 76% (compare column 2 with columns 4 and 7, respectively).

Therefore, these functional assay data support the hypothesis that the W71m213 mutant

protein interferes with the binding of OsWRKYSl and OsWRK? 1 to Amy32b promoter,

and therefore enhance the GA induction o f Amy 3 2b in aleurone cells.

OsWRKYSl and OsGAMYB functionally compete with

each other to regulate the expression of Amy32b

OsGAMYB regulates GA induction of Amy32b (Gubler et ah, 1997; Zhang et ah,

2004), via GARE, an element 22-bp downstream of the W-boxes. In previous studies, we

have shown that OsWRKY? 1 blocks GA signaling by functionally interfering with

OsGAMYB (Zhang et ah, 2004). Dosage experiments were performed to study whether

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. OsWRKYSl also has a similar effect on OsGAMYB induction of Amy32b. Varied

amounts of UBI-OsWRKY51 (from 0% to 100% relative to the reporter construct) were

introduced into aleurone cells along with a constant amount of UBI-OsGAMYB (100%)

and Amy32b-GUS (100%). The OsGAMYB induction of Amy32b was gradually

suppressed by increasing amounts of UBI-0sWRKY51 (Figure 3-7B). A similar dosage

experiment was carried out with a fixed amount of UBI-0sWRKY51 (10%) and Amy32b-

GUS (100%), and varied amounts of UBI-OsGAMYB (from 0% to 1S0%). As shown in

Figure 3-7B, the repression activity of OsWRKYSl was gradually overcome by

increasing amounts of UBI-OsGAMYB. These results suggest that OsWRKYSl also

regulates GA induction by interfering with the function of OsGAMYB. Thus, the ratio of

repressors (such as OsWRKYSl and OsWRKY? 1) to the activator (eg. OsGAMYB)

seems to determine the expression level of the Amy32b promoter.

Discussion

For WRKY proteins with two WRKY domains (group 1), the C-terminal domain is

responsible for DNA binding, while the N-terminal domain might participate in the

binding process by enhancing the binding affinity of the C-terminal domain (Ishiguro and

Nakamura, 1994; de Pater et al., 1996; Eulgem et al., 1999). However, computational

modeling based on the NMR solution structure of the C-terminal WRKY domain of the

AtWRKY4 protein argues that both WRKY domains could bind to DNA, although the N-

terminal one might have a much lower binding affinity (Yamasaki et al., 200S).

Nevertheless, the binding of the N-terminal domain has not been demonstrated in vivo or

in vitro. Both OsWRKYSl and OsWRKY? 1 contain a single WRKY domain. Our

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Reporter construct

A m y32b ______A m y32b-T promoter Effector constructs ■O sW RK YSl UBI NOS-J promoter

UBI O sG AM YB NOS-J promoter G 3 D —

• 100% OsGAMYB VS. OsWRKYSl Dosage • 10% OsWRKYSl VS. OsGAMYB Dosage 9 2 8 6 7 î: i; I 1 Z 0 0 20 40 60 80 100 120 140 160 Relative Amount of Effector (%)

Figure 3-7. Functional antagonism between OsWRKYSl and OsGAMYB in regulating the expression of Amy32b-GUS. (A) Schematic diagrams of the reporter and effector constructs used in the co bombardment experiment. The annotations are the same as in Figure 3-2. (B) The reporter construct {Amy32h-GUS) and the internal construct {UBI-LUC) were co-bombarded into barley de-embryo half-seeds with effector constructs {UBI- OsWRKYSl and UBl-OsGAMYB). The relative amount of effector construct is indicated as a percentage compared to the amount of the reporter. The line with filled rectangles represents the dosage effect of OsWRKYSl (0% to 100%) on induction of Amy32b-GUS by 100% OsGAMYB; the line with open rectangles represents the dosage effect of OsGAMYB (0% to 1S0%) on repression of Amy32b-GUS by 10% OsWRKYSl. Each data point indicates mean GUS activities ± SE of four replicates.

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. EMSA studies demonstrated that OsWRKY? 1 behaves more like the DNA-binding C-

terminal WRKY domain of the two WRKY domain proteins, while OsWRKYSl behaves

more like the non-DNA binding N-terminal domain of those proteins (Figure 3-S).

Therefore, it appears that this type of WRKY domain interaction eould occur

intramolecularly between two WRKY domains of the group I proteins or

intermoleeularly between a DNA-binding WRKY protein (such as OsWRKY? 1) and a

non-DNA-binding WRKY protein (e.g. OsWRKYSl).

Modulation of DNA-binding proteins by non-DNA-binding proteins has been

reported for other gene families. For instance, group D basic helix-loop-helix (bHLH)

proteins, can heterodimerize with, and hence regulate the activities of DNA-binding

bHLH proteins (Ledent and Vervoort, 2001; Toledo-Ortiz et al., 2003). However, the

group D proteins lack the DNA-binding basic domain, and heterodimerization between

group D and other bHLH proteins blocks the DNA binding and transcriptional activation

activities of the bound bHLH protein. This is different from OsWRKYSl because 1) it

contains the WRKY domain, the potential DNA-binding region of the WRKY family,

although it was unable to bind to DNA; and 2) its interaction with OsWRKY? 1 enhanced

the binding affinity (Figures 3-S and 3-6) and repressing activity (Figure 3-3) of

OsWRKY? 1. In this sense, it is more like VIVIPAROUS 1 (a B3 domain transcription

factor), which can enhance the binding affinity of a basic leucine zipper protein (EmBP-1)

to an ABA-regulated promoter and increase the activities of the EmBP-1 transcriptional

activator (Hill et al., 1996).

This work reveals another node of the ABA and GA signaling crosstalk network.

ABA downregulates many genes, especially those upregulated by GA. This effect is so

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. drastic that ABA completely blocks GA induced seed germination (reviewed in

Lovegrove and Hooley, 2000). The crosstalk of GA and ABA signaling is mediated by

secondary messengers. For example, application of PA to barley aleurone inhibits a-

amylase production and induces an ABA-inducible amylase inhibitor and RAB protein

expression, mimicking the effect of ABA (Ritchie and Gilroy, 1998a). Two regulators,

VIVIPAROUS 1 and SPINDLY, act as positive regulators of ABA signaling and negative

regulators of GA signaling (Robertson et al., 1998; Hoeeker et al., 1999). The ABA

inhibition also involves kinases. For example, the ABA inducible protein kinase

PKABAl is involved in the ABA suppression pathway (Gomez-Cadenas et al., 1999;

Gômez-Cadenas et al., 2001b). However, there is more than one pathway mediating the

suppression of GA signaling by ABA, because the RNA interference of HvPKABA1 does

not block the inhibitory effect of ABA on GA induction of the a-amylase transcription

(Zentella et al., 2002). Although it is tempting to suggest that the two ABA-inducible and

GA-repressible WRKY genes presented in this work might represent components of this

alternative suppression pathway, much work is needed to address the relationship

between PKABAl and OsWRKY51/OsWRKY71 in the ABA suppression pathway.

An intriguing question is how these two WRKY proteins modulate GA signaling. At

least five cA-acting elements are essential for a high expression level o f Amy32b: the 0 2 S

element that contains two TGAC cores, the pyrimidine box, GARE (GA response

element), the amylase box and DAE (downstream amylase element) ( Gomez- Cadenas et

al., 2001a; Lanahan et al., 1992). Repressors have been reported to bind to the 02S

element (this work, Zhang et al., 2004), pyrimidine box (Mena et al., 2002; Washio,

2003), GARE (Raventôs et al., 1998) and the amylase box (Lu et al., 2002). In addition.

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. activator proteins have been found to bind to the pyrimidine box (Isabel-LaMoneda et al.,

2003), the GARE (Gubler et al., 1995) and amylase box (Lu et al., 2002). Therefore, we

suggest that it is possible that eaeh of the five cA-aeting elements on the Amy32b

promoter eould be bound by at least a transactivator and a transrepressor, and the ratio of

the activators and repressors for individual cA-acting element or the whole promoter

complex, controls the expression level of Amy32b (Zhang et al., 2004). Indeed, we have

shown that the ratio of GAMYB activator and OsWRKYSl/OsWRKY? 1 repressors

determines the expression level of Amy32b-GUS (Figure 3-1, Zhang et al., 2004).

However, there is a difference for the two WRKY repressors; OsWRKY? 1 could bind to

the promoter directly, whereas OsWRKY51 did not. In this sense, OsWRKYSl is similar

to the non-DNA-binding repressor, KGM (kinase associated with GAMYB), which

interacts with GAMYB and specifically represses the activity of an a-amylase

promoter (Woodger et al., 2003). On the other hand, OsWRKY? 1 is like HRT

(Hordeum repressor of transcription), which binds to GARE and suppresses

gene expression (Raventôs et al., 1998). We suggest that OsWRKY 51/ OsWRKY ? 1

might block GA responses by interacting with the activation domain of GAMYB or by

competing with GAMYB to interact with components of the basal transcription

machinery. Of course, there are other possible modes. GAMYB and OsWRKY repressors

might compete for interaction with the same eo-transeription factors. Also, OsWRKY

repressors might block the expression of a-amylase genes by enforcing the repression of

KGM (Woodger et al., 2003) and HRT (Raventôs et al., 1998), or interfering with

binding of transcriptional activators to other cA-aeting elements in a-amylase promoters.

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. In summary, OsWRKYSl and OsWRKY? 1 appear to mediate the crosstalk of GA

and ABA signaling. ABA induces the expression of OsWRKYSl and OsWRKYJl,

increases the ratio of OsWRKY51/OsWRKY? 1 repressors to GAMYB activator. The

repressors bind the W-boxes, thus exerting its antagonistic effect against GA induction of

Amy32b. In contrast, GA induces GAMYB, but suppresses OsWRKY51 and

OsWRKY? 1. The ratio of OsWRKYSl/OsWRKY? I to GAMYB is low so that GAMYB

competes against the inhibitory effect of OsWRKYSl and OsWRKY? 1, leading to a high

level of the a-amylase gene expression. Obviously, this is an over-simplified model

because it does not consider other activators such as OsDOF3 (Washio, 2003), RAMY

(Peng et al., 2004) and 0sMYBSl/0sMYBS2 (Lu et al., 2002), and other repressors such

as KGM (Woodger et al., 2003) and HRT (Raventôs et al., 1998). Nevertheless, this

model gives us new insights about how multiple transcription factors coordinate to fine

tune the Amy32b expression that is triggered by different signals. Much work needs to be

done regarding the relationships among OsWRKYSl/OsWRKY? 1, other repressors and

activators mentioned above, and other components of GA and ABA signaling networks.

Experimental procedures

Plant materials and incubation conditions

Rice {Oryza sativa L. cv Nipponbare) seeds were used in this study. For mRNA in

situ hybridization, husked rice seeds were treated in water, 10 pM uniconazole (Wako,

Osaka, Japan) or 20 pM ABA (Sigma, St Louis, MO, USA) for 30 h respectively. Barley

{Hordeum vulgare cv Himalaya) seeds (1998 harvest) were purchased from Washington

State University (Pullman, WA).

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. In situ hybridization

The gene specific OsWRKYSl fragment was amplified by PCR using primers (5’-

CAGCAGCAGCAGGTGGAC-3’ and 5’-GCCGCTGCCACTGCTCCAA-3’) and the

plasmid UBl-WSl as the template. For the OsWRKYJl fragment, PCR was performed

with primers (5’-AGAACAGCGACGGCTCCGGCAAG-3’ and 5’-

GATCGATCGAACTCCGCCATGG-3’) and the genomic DNA isolated from seedlings.

The procedure to prepare RNA probes is as following: the PCR fragments were cloned

into the pBluescript SK(+) plasmid, and the clones were confirmed by sequencing. The

plasmids were either treated with BamHI and transcribed with TV RNA polymerase

(Stratagene, Cedar Creek, TX, USA) to prepare sense probes or digested with Sail and

transcribed with T3 RNA polymerase (Stratagene) to prepare anti-sense probes. The

procedure of in situ hybridization was performed as described (Kouehi and Hata, 1993).

Effector construct preparations

The coding region sequences that contain exons and introns from the start codon to

the stop codon of OsWRKYSl, OsWRKYJl and OsGAMYB were amplified by PCR, and

cloned into the expression vector UBIpromoter-linker-Nos Terminator, respectively. The

full-length cDNA of OsWRKYSl and OsWRKYJl were amplified from total RNA of rice

aleurone cells by RT-PCR, and cloned into the Asel site of the expression vector using

the following primers: 5 -ATCCGGCGCGCCTTGATGATTACCATGGATC-3' and 5'-

TTGGCGCGCCGGGGTATCTCATGCGAGCG-3' for preparation of UBl-WST, 5'-

TTGGCGCGCCATGGATCCGTGGATTAGC-3’ and 5-ATAGGCGCGCCTCAATCC

TTGGTCGGCGAG-3' for preparation of UBl-WJl. Oligonucleotide-directed mutations

(Kunkel et al., 1987) for UBl-OsWRKYSl and UBl-WJl were performed with the

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. following primers: 5'-GGAGTGCGCGTGGTGAATTCACTTGCTCTTGTGGCCG-3'

for UBl-0sWRKY51m; 5'-GGTGACCTTCTGACCATCGGCGCGCCTTTGGTACCCA

TCTTTCAC-3' for UBl-W71mW; 5'-CGGCTGGCCGGAATTCTGCTCCCCCTCGTA

CGTCGC-3' for UBI-W71mH. The 3’-deletion mutants of UBI-W71 were amplified by

PCR using the following primers: 5 -TTGGCGCGCCATGGATCCGTGGATTAGC-3'

and 5-TATAGGCGCGCCTCATGGGCAGGGGTTGTCCTTG-3' for UBI-W71m213;

5 -TTGGCGCGCCATGGATCCGTGGATTAGC-3' and 5 -TATAGGCGCGCCTCAGC

CGTCGCTGTTCTGCG-3' for UBI-W71m267. The PCR produets were then eloned into

the AscI site of the UBI promoter-linker-Nos Terminator construet.

Particle bombardment and transient expression assays

The procedure of transient expression experiments with the barley aleurone system by

particle bombardment was performed as described (Lanahan et al., 1992). The amount of

the effector construct used in the transient expression experiments was indicated as a

percentage. For example, 10% of the effector indicates that the molar ratio of the effector

construct to the reporter construet was 10%. Unless otherwise indicated, the molar ratio

of the effector construct to the reporter construct was 1 0 0 % in transient expression

experiments. After bombardment, 4 half-seeds were incubated in 4 mL of the imbibing

solution containing 50 pg/mL of chloramphenicol without or with 1 pM G A 3, or 20 pM

ABA in small (6 cm diameter) Petri dishes at 24°C for 24 h. All experiments consisted of

4 replicates and each experiment was repeated for a minimum of two times with similar

results. GUS activity was normalized in every independent transformation relative to the

lueiferase activity.

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Subcellular localization and bimolecular

fluorescence eomplementation

OsWRKYSl coding region in UBI-OsWRKYSl was amplified by PCR using primers

5'-ATCCGGCGCGCCTTGATGATTACCATGGATC-3' and 5-TTGGCGCGCCGAC

A AGCT A A ATT CT C ACTC-3 ' and inserted into the AscI site of UBI-GFP (Zhang et al.,

2004) to generate UBl-GFP:OsWRKYS 1. The YFP coding region was amplified by PCR

using the primers 5-TGGTACCATGGTGAGCAAGGGCG-3' and 5-ACGGT

ACCGTACAGCTCGTCCATG-3' and inserted to the Kpnl site of UBI promoter-linker-

Nos Terminator, to generate the UBI-YFP eonstruet. The sequences encoding amino acid

residues 1-154 (YN) and 155-238 (YC) of YFP were amplified from pQE80I-YN and

pQE80-bFosYC (Tsuehisaka and Theologis, 2004) and eloned into the Kpnl site in UBI

promoter-linker-Nos Terminator using the following primers; 5-ATGGTAC

CATGGTGAGCAAGGGCG-3' and 5-CTAGGTACCTAGAGCATGCTTAAGAGA

TC-3' for UBI-YN, 5-ATGGTACCATGGACAAGCAGAAGAACG-3' and 5-TCCGG

TACCGGATCCAGATCCAC-3’ for UBI-YC. The OsWRKYSl coding region was

isolated from UBI-OsWRKYSI and inserted into the Asel site in UBI-YN and UBI-YC to

product UBI-YN:OsWRKYSl and UBI-YC:OsWRKYSl. The OsWRKYJl eDNA was

isolated from UBI-W7I and inserted into the AscI site in UBI-YN and UBI-YC to product

UBI-YN:OsWRKYJl and UBI-YC:0sWRKY7I.

After incubation at 24°C for 24 h, the aleurone layers were peeled from the

bombarded barley half-seeds. Confocal microscopic observations of the GFP

fluorescence and nucleus staining with SYT017 were performed as described previously

(Zhang et al., 2004). The yellow fluorescence was observed through Laser Scanning

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Microscope LSM 510 with 514 nm excitation and a LP530 filter (Carl Zeiss, Ine.

Gottingen Germany). The acquired images were processed using Paint Shop Pro 7 (Jasc

Software, Eden Prairie, MN, USA).

Production of recombinant proteins in Escherichia coli

The full-length eDNA sequence of OsWRKYJl was cloned into the AscI site of the

modified pGEX-KG (Zhang et al., 2004) to generate GST:W71. For mutant protein

production, derivatives of OsWRKYJl were subeloned into the AscI site of the modified

pGEX-KG. The fusion constructs were then introduced into BL-21 (DE3) pLysS E. coli

(Novagen, Madison, WI, USA). The GST fusion proteins were purified using

glutathione-agarose beads (Zhang et al., 2004).

The full-length cDNA sequence of OsWRKYSl was amplified from UBI-WSl and

cloned into the EcoRI site of the pET21b vector (Novagen) by using the following

primers: 5'-TCGAATTCGATGATTACCATGGATCTGATG-3' and 5'-

GCGAATTCGCGAGCGGCAGCG-3'. E. coli strain Origami B DE3 (Novagen) was

transformed with this expression plasmid. A fresh colony was inoculated in 2x yeast

tryptone (YT) liquid medium containing 100 pg/mL carbenicillin and was grown at 37°C

till the middle log phase. Expression of His-tagged OsWRKY51 proteins was induced by

the addition of 1 mM isopropyl (3-D-thiogalaetoside at 25 °C for 5 h. The recombinant

protein was purified using Ni-agarose affinity chromatography (Qiagen, Valencia, GA,

USA) under native conditions by following the manufacturer’s instructions.

Electrophoretic mobility shift assay

After digestion with Neol, a 371-bp DNA fragment that contains Amy32b promoter

region from -176 to -1 and its first intron was isolated from the Amy32b-GUS (Lanahan

100

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. et al., 1992). The DNA probe was labeled with a-^^P-dATP by Klenow fill-in reactions.

The sequences of synthetic oligonucleotides used as competitors were described

previously (Zhang et al., 2004). Unless otherwise indicated, binding reactions contained

1.5 ng of probe, 1 pg of poly-(dldC), 10 mM Tris-HCl (pH7.6), 50 mM KCl, 0.25 pM

ZnCb, 10% glycerol. Equal amounts of recombinant proteins (0.5 pg for each) were

added into reactions and incubated at room temperature for 30 min with labeled DNA

probes in the absence or presence of competitors. After incubation, reactions described in

Figure 3-5D were analyzed by electrophoresis on a 5% polyacrylamide gel for 5 h, while

all other reactions were resolved on 3.5% polyacrylamide gels in 0.5x TBE (45 mM Tris,

45 mM boric acid, and 1 mM EDTA) buffer for 5 h. The signals were scanned with a

Typhoon 9400 phosphorimager (Amersham Biosciences, NJ, USA) and quantified with

the ImageQuant software (version 5.2, Amersham Biosciences).

Acknowledgements

We thank Dr s. Andrew Andres, Jose Casaretto, Allen Gibbs, David Ho, Eduardo

Robleto, Athanasios Theologis, Kenji Washio and Helen Wing for advice or

contributions to the improvement of this paper. This work is supported by UNLV PIA,

NIH BRIN (P20 RR16464) and a NSF EPSCoR to Q.J. Shen, Z.L. Zhang, and Z. Xie. G.

Yang was supported by a Japanese BRAIN Postdoctoral Fellowship.

References

de Pater, S., Greco, V., Pham, K., Memelink, J., and Kijne, J. (1996). Characterization of a zinc-dependent transcriptional activator from Arabidopsis. Nucleic Acids Res 24, 4624-4631.

101

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Eulgem, T., Rushton, P.J., Robatzek, S., and Somssich, LE. (2000). The WRKY superfamily of plant transcription factors. Trends Plant Sci 5, 199-206.

Eulgem, T., Rushton, P.J., Schmelzer, E., Hahlbrock, K., and Somssich, LE. (1999). Early nuclear events in plant defence signalling: rapid gene activation by WRKY transcription factors. EMBO J 18, 4689-4699.

Gilroy, S., and Jones, R.L. (1992). Gibberellie acid and abseisic acid eoordinately regulate cytoplasmic calcium and secretory activity in barley aleurone protoplasts. PNAS USA 89,3591-3595.

Gomez-Cadenas, A., Zentella, R., Sutliff, T.D.H., and Ho, T.H.D. (2001a). Involvement of multiple cA-elements in the regulation of GA responsive promoters: Definition of a new cA-element in the Amy32b gene promoter of barley {Hordeum vulgare). Physiol Plant 112,211-216.

Gomez-Cadenas, A., Zentella, R., Walker-Simmons, M.K., and Ho, T.H.D. (2001b). Gibberellin/abscisic acid antagonism in barley aleurone cells: site of action of the protein kinase PKABAl in relation to gibberellin signaling molecules. Plant Cell 13, 667-679.

Gomez-Cadenas, A., Verhey, S.D., Holappa, E D., Shen, Q., Ho, T.H.D., and Walker- Simmons, M.K. (1999). An abseisic acid-induced protein kinase, PKABAl, mediates abscisie acid-suppressed gene expression in barley aleurone layers. PNAS USA 96, 1767-1772.

Gubler, F., Kalla, R., Roberts, J.K., and Jacobsen, J.V. (1995). Gibberellin-regulated expression of a myb gene in barley aleurone cells: evidence for Myb transaetivation of a high-pl alpha-amylase gene promoter. Plant Cell 7, 1879-1891.

Gubler, F., Watts, R.J., Kalla, R., Matthews, P., Keys, M., and Jacobsen, J.V. (1997). Cloning of a rice cDNA encoding a transcription factor homologous to barley GAMyb. Plant Cell Physiol 38, 362-365.

Hill, A., Nantel, A., Rock, C D., and Quatrano, R.S. (1996). A conserved domain of the Viviparous-1 gene product enhances the DNA binding activity of the bZIP protein EmBP-1 and other transcription factors. J Biol Chem 271, 3366-3374.

Hoeeker, U., Vasil, I.K., and McCarty, D.R. (1999). Signaling from the embryo conditions Vpl-mediated repression of alpha-amylase genes in the aleurone of developing maize seeds. Plant J 19, 371-377.

Isabel-LaMoneda, L, Diaz, L, Martinez, M., Mena, M., and Carbonero, P. (2003). SAD: a new DOE protein from barley that activates transcription of a eathepsin B-like thiol protease gene in the aleurone of germinating seeds. Plant J 33, 329-340.

102

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Ishiguro, S., and Nakamura, K. (1994). Characterization of a eDNA encoding a novel DNA-binding protein, SPFl, that recognizes SP 8 sequences in the 5' upstream regions of genes coding for sporamin and beta-amylase from sweet potato. Mol Gen Genet 244, 563-571.

Itoh, H., Matsuoka, M., and Steber, C M. (2003). A role for the ubiquitin-26S-proteasome pathway in gibberellin signaling. Trends Plant Sei 8 , 492-497.

Kaneko, M., Inukai, Y., Ueguchi-Tanaka, M., Itoh, H., Izawa, T., Kobayashi, Y., Hattori, T., Miyao, A., Hiroehika, H., Ashikari, M., and Matsuoka, M. (2004). Loss-of- function mutations of the rice GAMYB gene impair alpha-amylase expression in aleurone and flower development. Plant Cell 16, 33-44.

Karssen, C M., Brinkhorst-van der Swan, D.L.C., Breekland, A.E., and Koomneef, M. (1983). Induction of dormancy during seed development by endogenous abseisic acid: studies on abscisie acid deficient genotypes of Arabidopsis thaliana L. Heynh. Planta 157, 158-165.

Koomneef, M., and Karssen, C M. (1994). Seed dormancy and germination in Arabidopsis. In Arabidopsis, E.M. Meyerowitz and C.R. Somerville, eds (Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press), pp. 313-334.

Kouchi, H., and Hata, S. (1993). Isolation and characterization of novel nodulin eDNAs representing genes expressed at early stages of soybean nodule development. Mol Gen Genet 238, 106-119.

Kunkel, T.A., Roberts, J.D., and Zakour, R.A. (1987). Rapid and efficient site-specific mutagenesis without phenotypic selection. Methods Enzymol 154, 367-382.

Lanahan, MB., Ho, T.H.D., Rogers, S.W., and Rogers, J.C. (1992). A gibberellin response complex in cereal alpha-amylase gene promoters. Plant Cell 4, 203-211.

Ledent, V., and Vervoort, M. (2001). The basic helix-loop-helix protein family: comparative genomics and phylogenetic analysis. Genome Research 11, 754-770.

Lovegrove, A., and Hooley, R. (2000). Gibberellin and abseisic acid signalling in aleurone. Trends Plant Sci 5, 102-110.

103

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Mena, M., Cejudo, F.J., Isabel-Lamoneda, L, and Carbonero, P. (2002). A role for the DOF transcription factor BPBF in the regulation of gibberellin-responsive genes in barley aleurone. Plant Physiol 130, 111-119.

Peng, R., Yao, Q., Xiong, A., Fan, H., Li, X., Peng, Y., Cheng, Z.M., and Li, Y. (2004). A new rice zine-finger protein binds to the 02S box of the alpha-amylase gene promoter. Eur J Biochem 271, 2949-2955.

Penson, S.P., Sehuurink, R.C., Fath, A., Gubler, F., Jacobsen, J.V., and Jones, R.L. (1996). eGMP Is Required for Gibberellie Aeid-nduced gene expression in barley aleurone. Plant Cell 8 , 2325-2333.

Raventôs, D., Skriver, K., Sehlein, M., Kamahl, K., Rogers, S.W., Rogers, J.C., and Mundy, J. (1998). HRT, a novel zinc finger, transcriptional repressor from barley. J Biol Chem 273, 23313-23320.

Ritehie, S., and Gilroy, S. (1998a). Abscisie aeid signal transduction in the barley aleurone is mediated by phospholipase D activity. PNAS USA 95, 2697-2702.

Ritehie, S., and Gilroy, S. (1998b). Gibberellins: regulating genes and germination. New Phytol 140, 363-383.

Robertson, M., Swain, S.M., Chandler, P.M., and Olszewski, N.E. (1998). Identification of a negative regulator of gibberellin action, HvSPY, in barley. Plant Cell 10, 995- 1007.

Rogers, J.C., and Rogers, S.W. (1992). Definition and functional implications of gibberellin and abseisic acid cA-acting hormone response complexes. Plant Cell 4, 1443-1451.

Shen, Q., and Ho, T.H.D. (1995). Functional dissection of an abscisie aeid (ABA)- inducible gene reveals two independent ABA-responsive complexes each containing a G-box and a novel cA-aeting element. Plant Cell 7, 295-307.

Sun, T.P., and Gubler, F. (2004). Molecular Mechanism of Gibberellin Signaling in Plants. Annu Rev Plant Physiol Plant Mol Biol 55, 197-223.

Tanida, I., Kim, J.K., and Wu, R. (1994). Functional dissection of a rice high-pl alpha- amylase gene promoter. Mol Gen Genet 244, 127-134.

Toledo-Ortiz, G., Huq, E., and Quail, P H. (2003). The Arabidopsis basic/helix-loop- helix transcription factor family. Plant Cell 15, 1749-1770.

104

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Tsuehisaka, A., and Theologis, A. (2004). Heterodimeric interactions among the 1- amino-cyclopropane-1 -carboxylate synthase polypeptides encoded by the Arabidopsis gene family. PNAS USA 101, 2275-2280.

Ueguchi-Tanaka, M., Ashikari, M., Nakajima, M., Itoh, H., Katoh, E., Kobayashi, M., Chow, T.Y., Using, Y.I., Kitano, H., Yamaguehi, I., and Matsuoka, M. (2005). GIBBERELLIN INSENSITIVE DWARF I encodes a soluble receptor for gibberellin. Nature 437, 693-698.

Ulker, B., and Somssich, I.E. (2004). WRKY transcription factors: from DNA binding towards biological function. Curr Opin Plant Biol 7, 491-498.

Woodger, F.J., Gubler, F., Pogson, B.J., and Jacobsen, J.V. (2003). A Mak-like kinase is a repressor of GAMYB in barley aleurone. Plant J 33, 707-717.

Xie, Z., Zhang, Z.L., Zou, X., Huang, J., Ruas, P., Thompson, D., and Shen, Q.J. (2005). Annotations and functional analyses of the rice WRKY gene superfamily reveal positive and negative regulators of abscisie aeid signaling in aleurone cells. Plant Physiol 137, 176-189.

Yamasaki, K., Kigawa, T., Inoue, M., Tateno, M., Yamasaki, T., Yabuki, T., Aoki, M., Seki, E., Matsuda, T., Tomo, Y., Hayami, N., Terada, T., Shirouzu, M., Tanaka, A., Seki, M., Shinozaki, K., and Yokoyama, S. (2005). Solution structure of an Arabidopsis WRKY DNA binding domain. Plant Cell 17, 944-956.

105

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. CHAPTER 4

SALICYLIC ACID INHIBITS GIBBERELLIN-INDUCED ALPHA-AMYLASE

EXPRESSION AND SEED GERMINATION VIA A PATHWAY INVOLVING

AN ABSCISIC-ACID-INDUCIBLE IFRXTGENE

Abstract

It is well known that abseisie aeid (ABA) antagonizes gibberellin (GA)-promoted

seed germination. Recent circumstantial evidence suggests that salieylie aeid (SA) also

inhibits seed germination in maize and Arabidopsis. Our study shows that SA blocks

barley seed germination in a dosage dependent manner. As an initial effort to addressing

the mechanism controlling the crosstalk of SA, GA and ABA signaling in barley, we

studied the regulation of a-amylases by SA and a WRKY gene whose expression is

modulated by these hormones. Assays of a-amylase activity reveal that GA-induced a-

amylase production in aleurone cells is inhibited by bioactive SA, but not its analogs, 3-

hydroxybenzoic aeid and 4-hydroxybenzoic acid. This inhibitory effect unlikely results

from the block of a-amylase secretion or inhibition of a-amylase enzyme activities.

Northern blot analyses indicate that SA suppresses GA-indueed expression of a barley

low pi a-amylase gene (Amy32b). Because our previous data indicate that ABA-inducible

and GA-suppressible WRKY genes inhibit the expression of a-amylase genes in rice, we

106

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. studied the steady state mRNA levels of a barley WRKY gene, HvWRKY38. The

expression of HvWRKY38 in barley aleurone cells is down-regulated by GA, but up-

regulated by SA and ABA. However, the regulation of HvWRKY38 by SA appears to be

different from that of ABA in term of the kinetics and levels of induction. Over

expression of HvWRKY38 in aleurone cells by particle bombardment blocks GA

induction of the Amy32b promoter reporter eonstruet {Amy32b-GUS). Therefore,

HvWRKY38 might serve as a converging node of SA and ABA signal pathways

involved in suppressing GA-induced seed germination.

Introduction

The production of a-amylases in aleurone layers is believed to be essential for seed

germination in cereal grains, which is tightly regulated by gibberellie aeid (GA) and

abseisic acid (ABA) (Bethke et al., 1997; Sun and Gubler, 2004). During seed

germination, GA is synthesized in embryos and secreted into aleurone layers, where it is

perceived by receptors such as GIDl, resulting in degradation of negative regulators,

increased cytoplasmic Ca^^ and cGMP levels, and induction of transactivators that

promote the expression of a-amylases (Gubler et al., 1995; Penson et al., 1996;

Lovegrove and Hooley, 2000; Silverstone et al., 2001; Itoh et al., 2002; Lu et al., 2002;

Zentella et al., 2002; McGinnis et al., 2003; Sasaki et al., 2003; Washio, 2003; Dill et al.,

2004; Tyler et al., 2004; Zhang et al., 2004; Ueguchi-Tanaka et al., 2005; Verslues and

Zhu, 2005; Nakajima et al., 2006). On the contrary, ABA blocks the production of a-

amylases and suppresses seed germination (Karssen et al., 1983; Koomneef and Karssen,

1994; Lovegrove and Hooley, 2000). An ABA inducible protein kinase, PKABAl

107

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. suppresses the GA signaling by preventing the induction of GAMYB (Gomez-Cadenas et

al., 1999; Gomez-Cadenas et al., 2001). However, a PKABAl-independent suppression

pathway might exist because RNA inference of PKABAl does not block ABA

suppression on GA-indueed a-amylase expression (Zentella et al., 2002). Two ABA-

inducible WRKY proteins (OsWRKYSl and OsWRKY? 1) synergistieally suppress GA-

induced a-amylase expression by functionally competing with GAMYB, suggesting that

the ratio of repressors and activators controlled by multiple signals regulates a-amylase

expression, thereby modulating seed germination (Zhang et al., 2004; Xie et al., 2006).

WRKY genes belong to a super gene family which has 77 members in Arabidopsis

and over 90 members in rice (Eulgem et al., 2000; Ulker and Somssich, 2004; Xie et al.,

2005b). Each WRKY protein contains one or two conserved WRKY domain(s) with a

WRKY motif in its N-terminus and a zinc finger motif in its C-terminus. WRKY proteins

bind to a cw-acting element called W-box, (T/C)TGAC(C/T) (Ulker and Somssich, 2004).

WRKY genes are involved in a variety of physiological processes, such as pathogen

defense, leaf senescence, abiotic stresses, trichome development and seed germination

(Eulgem et al., 1999; Chen and Chen, 2000; Johnson et al., 2002; Rizhsky et al., 2002;

Robatzek and Somssich, 2002; Zhang et al., 2004). In a survey of expression of WRKY

genes in Arabidopsis, 49 of 72 tested WRKY genes were shown to be inducible by

salicylic acid (SA) or Pseudomonas syringae (Dong et al., 2003).

SA is a plant hormone functioning as a key signaling molecule in response to biotic

stresses (Dempsey and Klessig, 1994; Kunkel and Brooks, 2002). Infection of biotrophic

pathogens causes a rapid increase of endogenous SA level that triggers the expression of

genes encoding the pathogenesis-related (PR) proteins and the activation of disease

108

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. resistance (Shah, 2003). Cumulative evidence suggest that the crosstalk between SA and

ABA is important for adaptation of plants to combinations of abiotic and biotic stresses

(Kunkel and Brooks, 2002; Mauch-Mani and Mauch, 2005). The interactions between SA

and ABA, either antagonistic or agonistic, also regulate other physiological processes. SA

inhibits ABA-induced stomatal closure (Rai et al., 1986) and leaf abscission in kidney

beans (Apte and Laloraya, 1982), and antagonizes the ABA inhibitory effects on seedling

growth of radish and tassel flower (Amaranthus caudatus ) (Ray and Laloraya, 1984; Ray,

1986). However, it is reported that SA also inhibits seed germination in maize (Guan and

Seandalios, 1995) and triangle orache {A. triangularis) (Khan and Ungar, 1986).

Furthermore, mutation of a poly(A)-specific ribonuclease (AtPARN) in Arabidopsis

increases the expression of ABA- and SA-inducible genes, and causes a hypersensitive

phenotype to both ABA and SA in seed germination, suggesting the mRNA-destabilizing

activity of AtPARN is important for proper ABA and SA responses (Nishimura et al.,

2005).

The antagonistic interaction between ABA and GA is well known (Bethke et al., 1997;

Xie et al., 2005a). Recently, an antagonistic effect between SA and GA in trichome

development in Arabidopsis was also reported. GA caused an increase of 72% in

trichome number in the absence of SA, while SA blocked GA induction to 29.6% (Traw

and Bergelson, 2003). In addition, the inhibitory effect of SA on trichome development

might not be dependent on N prl/Nim l gene (Traw and Bergelson, 2003).

In this study, we investigated the interaction between SA and GA in regulating seed

germination. We observed that SA inhibited barley seed germination and post

germination growth, as well as GA-induced amylase production. This suppression effect

109

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. was unlikely due to inhibition of amylase secretion or enzyme activity, but partly due to

decrease of a-amylase mRNA levels. We hypothesized that SA might exert its

suppressing activity on seed germination through induction of a WRKY repressor

(HvWRKY38) which blocks G A induction of a-amylase expression.

Results

SA inhibits barley seed germination

To investigate the role of SA on seed germination, barley seeds were treated with

different hormones and their combinations, including GA, ABA, SA, GA plus ABA and

GA plus different concentrations of SA. The results indicated that barley seeds started

germinating after 24 hr of incubation, and 78% of seeds were germinated after 72 hr of

incubation at 24 °C in the imbibing solution (Figure 4-1). About 90% of seeds treated

with 1 pM GA] were germinated, which confirms the concept that GA stimulates seed

germination. As expected, only 20% of seeds treated with 20 pM ABA were germinated

after 72 hr of incubation, suggesting that ABA strongly suppresses barley seed

germination. In the presence of 1 pM G A 3, ABA still strongly inhibited germination,

with only 55% of seeds germinated at 72 hr. Similar to ABA, SA also inhibits seed

germination. SA started to show an inhibitory effect on GA induction of seed germination

when it was applied at 250 pM (Figure 4-IB). With increased amounts of SA, this

inhibitory effect was gradually enhanced. Only 53% seeds were germinated at 72 hr when

seeds were treated with 1 mM of SA plus 1 pM G A3.

110

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. A

GAaCl.O iL\I) — 4 " — "4 4 - 4 - ABA (20 4 _ 4- — — — — SA I - 1000 250 500 1000 Germination 78 87 20 55 42 85 77 53 rate

100 1 GA; GA3+SA250 Control GA3+SA500 GAj+ABA GAa+SAlOOO SAIOOO

ABA

24 48 72 Incubation Time (hr)

F igure 4- 1. SA inhibits barley seed germination. Sterilized barley seeds were incubated at 24 "C in media without or with indicated hormones. A, picture of tested seeds and germination rates of each treatment at 72 hr. The germination rates were means of three replicates. B, germination rates of each treatment in Panel A at 24 hr, 48 hr and 72 hr. Data are means ± SE of three replicates.

I ll

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. K

COOH COOH

2-H ydroxy- 3-H ydroxy- 4-H ydroxy- benzoic Acid benzoic Acid benzoic Acid

Figure 4-2. SA suppresses GA induction of a-amylases. Barley half-seeds without embryos were incubated at 24 °C on 2% agar mixed with potato starch for 36 hr in the presence of indicated hormones or SA analogs. A, No hormone; B, 1 pM G A 3; C, 1 pM GA 3 plus 20 pM ABA; D, 1 pM GA 3 plus 1 mM SA; E, 1 pM G A 3 plus 1 mM 3-HyB; F, 1 pM GA 3 plus 1 mM 4-HyB. The structures of SA (2-HyB), 3-HyB and 4-HyB are shown in the bottom panel.

112

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. SA represses GA induction of a-amylase

production in barley aleurone cells

To assess the interaction between SA and GA in barley seeds, a-amylase production

and secretion were tested on starch-agar plates. Barley seeds were cut transversely to

remove embryos, the site of GA production in seeds. The half-seeds were then incubated

at 24 °C for 36 hr on 2% agar plates containing 0.2% soluble potato starch, 20 mM CaCl 2,

20 mM sodium succinate (pH 5.0) and various combinations of hormones or SA analogs.

After incubation, plates were flooded with H/KI solution. As shown in Figure 4-2, half-

seeds capable of synthesizing and secreting a-amylase produce transparent halos around

the seeds due to the digestion of starch by a-amylase. Seeds incubated in the absence of

hormone treatments produced little a-amylase after incubation. In contrast, application of

1 pM GA 3 caused a drastic increase in starch degradation by a-amylase, as indicated by

the large halos surrounding each seed (Figure 4-2B). ABA completely suppressed GA

induction of a-amylase on starch agar (Figure 4-2C). As shown in Figure 4-2D, addition

of 1 mM SA was able to completely inhibit GA-indueed a-amylase production.

Comparison of the ABA and SA treated plates, in Figures 4-2C and 2D respectively,

suggests a similar level of suppression of a-amylase production by two hormones at the

indicated concentrations. Analogs of SA, 3-hydroxybenzoic acid (3-HyB) and 4-

hydroxybenzoie acid (4-HyB), lacked this inhibitory activity (Figures 4-2E and 2F).

These two analogs are identical in structure to SA except for the location of the hydroxyl

group on the benzene ring, which is at the C2 position in SA and the C3 or C4 position

for the analogs (bottom panel. Figure 4-2). These small structural changes eliminated the

113

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. inhibitory effect, indicating that only bioaetive SA is capable of suppressing GA

induction of the a-amylase production.

SA suppresses GA induction of a-amylases in vitro

To quantify the suppression effect of SA on GA induction of a-amylases, barley half

seeds were incubated at 24 °C for 28 hr in imbibing solution with different hormones.

After 28 hr of incubation, the medium from each hormone treatment was collected and

tested for the a-amylase activity using a spectrophotometer. As shown in Figure 4-3A, a

basal level of a-amylase activity was detected without hormone treatment. GA treatment

resulted in a 203-fold induction of a-amylases. As expected, ABA greatly suppressed GA

induction of a-amylase activity to 22-fold. Application of 1 mM SA completely

suppressed GA induction of a-amylases, while its analogs, 3-HyB and 4-HyB, had little

suppressing activity (Figure 4-3A). An SA-dosage experiment was performed to identify

the minimal amount of SA needed to suppress GA-induced a-amylase production. As

shown in Figure 4-3B, SA suppression is noticeable at 125 pM, resulting in about 30%

suppression compared to the GA treatment (Figure 4-3B). Treatment with 250 pM SA

led to an over 20-fold suppression of a-amylase activity. Increasing the concentration to

500 pM resulted in a complete block of GA induction. The data show that application of

250 pM SA is able to suppress GA-induced a-amylases as efficiently as application of

about 20 pM ABA.

SA unlikely blocks a-amylase secretion or

inhibits a-amylase enzyme activities

It is possible that SA prevents the secretion of a-amylases from aleurone cells,

resulting in low a-amylase activity in the medium used in the above experiments. To test

114

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. A

203X 192X

129X

I 2 i 22X ÎÔ IXIX GA] ++ + + + ABA SA 3-HyB 4-HyB B

200 400 600 800 1000 SA Concentration (pM) + 1 GA,

Figure 4-3. SA treatments decrease a-amylase activity in the medium. A, Barley half-seeds were incubated at 24 °C for 28 hr in the imbibing solution containing indicated hormones or SA analogs. The medium containing secreted a- amylases was tested for a-amylase activity. Data are means ±SE of three replicates. B, Barley half-seeds were incubated at 24 °C for 28 hr in imbibing solution containing 1 pM GA] and various amounts of SA (250 pM, 500 pM and 1000 pM, respectively). The medium containing secreted a-amylases was tested for a-amylase activity. Data are means ±SE of three replicates.

115

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. A

1.5X

4-HyB — — — — — -f

-B 1 •I

- SA + SA Figure 4-4. SA unlikely blocks a-amylase secretion or directly binds and thus inhibits a-amylases. A, Barley half-seeds were incubated at 24 °C for 28 hr in imbibing solution containing indicated hormones or SA analogs, then homogenized to test a-amylase activities in aleurone cells. Data represent means ±SE of three replicates. B, Barley half-seeds were incubated at 24 °C for 28 hr in 1 pM GA] to produce a high level of a-amylases in medium. The resulting medium was then split equally into two aliquots. - SA, without hormones; + SA, with 1 mM SA. The medium was incubated at 24 °C for 28 hr before a-amylase activity assays were performed. Data are means ±SE of three replicates.

116

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. this hypothesis, half-seeds were prepared and incubated as above, and then homogenized

after 28-hr incubation at 24 °G. The resulting homogenate was then centrifuged and the

supernatant was tested for a-amylase activity. If SA only inhibits a-amylase secretion to

the medium, a much higher a-amylase activity would be observed in the homogenate of

SA-treated aleurone cells than that of GA-treated samples. The result showed that the

difference of a-amylase activity among treatments was within 0.5-fold (Figure 4-4A). SA

treatment resulted in a 0.6-fold a-amylase activity over the control, and about 40% of a-

amylase activity produced in GA-treated samples. These results suggest that the observed

SA suppression (over 200-fold) is unlikely due to inhibition of a-amylase secretion.

Another possibility is that SA may interfere with a-amylase activity by destabilizing

or binding to a-amylases, thus inactivating the enzymes. Support for this hypothesis

comes from a study showing that SA can directly bind to and inhibit a catalase in vitro

(Chen et ah, 1995). To test this hypothesis, half-seeds were incubated in 1 pM GA] for

28 hr to produce a-amylases. The resulting medium, high in a-amylase content, was then

split into two aliquots. SA was added to one aliquot to a final concentration of 1 mM, and

an equal volume of water was applied to the other aliquot. The enzyme activity was then

measured after 28-hr incubation at 24 °G. As shown in Figure 4-4B, SA clearly had no

detectable effect on the enzyme activity in vitro.

SA inhibits GA induction of Amy32b expression

After showing that SA does not appear to block the a-amylase secretion or enzyme

activity in vitro, we reasoned that SA may exert its effect at the transcriptional/post-

transcriptional or translational/post-translational level. Northern blot analysis was carried

out to detect the effect of SA on the steady state mRNA level of a barley low pi a-

117

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 0 hr 24 hr

N N G A S H G+A G+S G+H

Amy32b

rRNA

Figure 4-5. SA inhibits GA-'màncQé Amy32b expression in aleurone cells. After being imbibed for 2 days, about one-tenth of barley half-seeds were harvested as a control (0 hr), and the rest were further treated without or with indicated hormones or 3-FIyB for 24 hr. Ten pg of total RNA isolated from aleurone layers was loaded for Northern blot analyses. A gene-specific fragment was labeled with a-^^P-dCTP to detect the mRNA levels of Amy32b. Ethidium bromide stained rRNA was shown to ensure equal loading of RNA samples. N, no hormone; G, G A 3; A, ABA; S, SA; H, 3- HyB; G+A, GA3+ABA; G+S, GA3+SA; G+H, GA]+3-HyB.

118

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. amylase gene, Amy32b. Barley half-seeds were treated without or with different

hormones or 3-HyB for 24 hr before total RNA was extracted from aleurone cells. As

shown in Figure 4-5, the mRNA level of Amy32b in barley aleurone cells was low at 0 hr

(lane 1), and slightly increased after 24 hr of incubation without hormone treatment (lane

2). As expected, the mRNA level of Amy32b was significantly increased by GA treatment

(lane 3) over the control (lane 2), and decreased by ABA treatment (lane 4). Interestingly,

the hasal mRNA level of Amy32b at 24 hr time point was also strongly down-regulated

by SA treatment (lane 5), while the analog of SA, 3-HyB had little effect on Amy32b

expression (lane 6 ). GA induction of Amy32b expression was significantly inhibited by

ABA (lane 7). Furthermore, SA showed a similar repression activity on GA induction of

Amy32b expression (lane 8 ), whereas 3-HyB lacked obvious inhibitory effect on GA-

induced Amy32b expression (lane 9). These results indicate that similar to ABA, SA has

an inhibitory effect of GA-induced Amy32b mRNA accumulation.

Expression of HvWRKY38 is up-regulated

by SA and ABA

Previous studies showed that the ABA-inducible WRKY gene, OsWRKY71 (a

putative rice ortholog of the barley HvWRKY38) can suppress GA induction of Amy32b

expression by binding to W-boxes in the Amy32b promoter (Zhang et ah, 2004; Mare et

ah, 2004). To investigate whether the expression of HvWRKY38 can be induced by SA,

total RNA was isolated from barley aleurone layers treated without or with different

hormones for 2 hr, 6 hr and 24 hr. In the absence of hormones, the mRNA levels of

HvWRKY38 were low at all four time points (Figure 4-6, lanes 1 ~ 4). However, the

mRNA levels of HvWRKY38 were increased over 2-fold only at 2 hr and 6 hr in the

119

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. presence of 1 mM SA (compare lane 5 with lane 2, and lane 6 with lane 3). At 24 hr, the

mRNA level of HvWRKY38 was similar to the background level (compare lane 7 with

lane 4). These data suggest that HvWRKY38 can be induced by SA at early time points

and a feedback regulation might exist to down-regulate the mRNA level of HvWRKY38

at late time points when the level of Amy32b mRNA is low. Like OsWRKY71, the

mRNA levels of HvWRKY38 were decreased by about 10-fold and 3-fold at 6 hr and 24

hr over the controls when aleurone cells were treated with 1 pM GA 3 (compare lane 9

with lane 3 and lane 10 with lane 4). The mRNA level of HvWRKY38 was also increased

in the presence of 1 mM SA plus 1 pM G A 3 (lanes 11 ~ 13) than those treated with SA

only (lanes 5 ~ 7). Like OsWRKY71 (Xie et ah, 2005b), the mRNA levels of HvWRKY38

were up-regulated by ABA treatment at 2 hr, 6 hr (data not shown) and 24 hr (Figure 4-6,

lane 14). The same blot was stripped and then hybridized with an Amy32b gene specific

probe (Figure 4-6). The results showed a reverse correlation between the mRNA levels of

Amy32b and HvWRKY38, suggesting that the ABA- and SA-inducible HvWRKY38 might

mediate the repression effect of SA on GA induction o f Amy32b.

HvWRKY38 represses GA induction o f Amy 3 2b

expression in aleurone cells

It is shown that HvWRKY38 is capable of binding to W-boxes/Box2 in Amy32b

promoter although its function in regulating Amy32b expression has not been tested

(Mare et ah, 2004). To answer this question, we made an effector construct which

contains the HvWRKY38 cDNA driven by the constitutive ubiquitin {UBI) promoter

(Figure 4-7A). The effector construct, together with the reporter construct Amy32b-GUS

(Lanahan et ah, 1992), were co-bombarded into barley aleurone cells. As shown in Figure

120

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. No hormone SA GA, SA+GA, ABA Time (hr) 0 2 6 24 2 6 24 2 6 24 2 6 24 24 //vfKRATng 4* ^ w #&

Amy32b - * * ' » " ■ ...... rRNA EtiiaiEEimititaiik ' '■ X ' 3 T ...% ' X & it.I 1 8 9 10 11 12 13 14

Figure 4-6. The expression of the HvWRKY38 gene is induced by SA and ABA but suppressed by GA. After being imbibed for 2 days, total RNA was isolated from aleurone layers treated without or with 1 mM SA, 1 pM G A3, 1 mM SA plus 1 pM GA3 and 20 pM ABA for 2 hr, 6 hr and 24 hr. The RNA blot, containing 10 pg of total RNA per sample, was hybridized with the a-^^P-dCTP labeled gene-specific probe of HvWRKY38 or Amy32b, respectively. Ethidium bromide stained rRNA was shown to ensure equal loading of RNA samples.

121

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. A Reporter construct

Amy32b Promoter QU;^ AmyS2b-l

Effector constructs UBI Promoter HvWRKY38 NOS-1

16 X I:O O 2 I. 1 X

GA, Control GA, HvWRKY38

Figure 4-7. HvWRKY38 represses GA induction of \hQAmy32b expression in aleurone cells. A Schematic diagram of the reporter and effector constructs used in the co bombardment experiment. The reporter construct was driven by GA-induced Amy32b promoter. The effector construct was driven by constitutive maize UBI promoter. B The reporter construct, Amy32b-GUS, and the internal construct, UBI-Luciferase, were co-bombarded into barley half-seeds either with or without effector construct UBI-HvWRKY38 by using the same molar ratio of effector and reporter eonstructs. GUS activity was normalized in every independent transformation relative to the luciferase activity. Bars indicate GUS activity ±SE after 24 hr of incubation of the bombarded half-seeds with or without 1 pM of GA3. Data are means ±SE of four replicates.

122

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 7B, the exogenous GA treatment led to a 16-fold induction of the Amy32b-GUS

expression over the control. Co-expression of HvWRKY38 completely suppressed GA

induction of Amy32b-GUS expression. These data support the hypothesis that

HvWRKY38 represses GA induction of a-amylase expression in aleurone cells.

Therefore, SA inhibits GA induction of a-amylase expression probably by inducing the

expression of HvWRKY38 and then HvWRKY38 blocks GA induction of a-amylase gene

expression.

Discussion

The antagonism between ABA and GA on seed germination has been well-studied for

decades (Bethke et ah, 1997; Sun and Gubler, 2004), whereas how SA inhibits seed

germination is largely unknown. In this paper, we studied the possible molecular

mechanism of the signaling crosstalk between SA and GA in barley aleurone layers. Our

results showed that SA is capable of blocking barley seed germination by suppressing

GA induction of a-amylase production (Figures 4-1 and 4-2). SA does not appear to exert

this effect through blocking a-amylase secretion or by altering the stability and activity of

a-amylases (Figures 4-3 and 4-4). It more likely inhibits the expression of a-amylases

(Figure 4-5). We found that the SA-inducible HvWRKY38 functions as a repressor in

GA induction of a-amylase expression in barley aleurone cells (Figures 4-6 and 4-7),

suggesting that HvWRKY38 might be involved in the signaling crosstalk of SA and GA

in regulating seed germination.

Endogenous SA has been found in leaves and reproductive organs in more than 34

plant species, indicating the ubiquitous distribution of this compound in plants (Raskin,

123

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 1992). Among plants tested, rice has the highest endogenous SA levels (Raskin, 1992).

The levels of SA in rice leaves are 50-fold higher than those observed in tobacco

(Silverman et al., 1995). Furthermore, these biosynthesized SA in rice remain as free

acids for a long time, which can be translocated rapidly from the point of de novo

synthesis or initial application to distant tissues (Raskin, 1992; Silverman et al., 1995). In

contrast, endogenously produced SA in tobacco is quickly converted to conjugated forms

such as P-O-D-glucosylsalicylic acid (GSA) (Raskin, 1992; Silverman et ah, 1995).

Several studies suggest that SA inhibits seed germination in maize (Guan and Scandalios,

1995), A. triangularis (Khan and Ungar, 1986) and Arabidopsis (Nishimura et ah, 2005).

However a quite high dosage of SA is required for this effect. For example, germination

process of Arabidopsis seeds is dramatically blocked by 1 mM SA, but is not

significantly affected by application of SA at concentrations lower than 1 mM (Rajjou et

ah, 2006). Similarly, high dosages of SA (in the range of 3 to 5 mM) completely inhibited

germination of maize embryos. In this study, SA sufficiently impeded GA induction of

barley seed germination at a concentration of 1 mM after 72 hr of incubation (Figure 4-1).

However, the GA induction of a-amylase production was completely inhibited by SA

treatment with a concentration as low as 250 pM SA (Figure 4-3). One possible reason to

explain this dosage discrepancy is that SA might be taken up by barley half seeds used in

Figure 4-3, much faster than by barley whole seeds used in Figure 4-1.

An intriguing question is how SA exerts its inhibitory effect on seed germination. It is

reported that SA promotes de novo synthesis of proteins which are normally increased in

response to the ABA treatment during early time of imbibition, such as 12S globulin

subunits, late embryogenesis abundant (LEA) proteins, dehydrins and heat shock proteins

124

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. (Rajjou et al., 2006). Here, we found that like ABA, SA also inhibits GA induction of a-

amylase production in aleurone cells (Figures 4-2, 4-3 and 4-5). HvWRKYSS can be up-

regulated by either ABA or SA to suppress GA induction of a-amylase expression

(Figures 4-6 and 4-7). These results suggest that SA signaling shares similar nodes with

ABA signaling in suppressing GA-induced seed germination. However, there are still

differences between SA and ABA signal pathways in regulating seed germination. It has

been shown that although ahg2-l, which is caused by a mutation in a poly(A)-specific

ribonuclease gene (AtPARN), is hypersensitive to ABA as well as SA in seed germination,

AtPARN might function in a different response pathway that is not dependent on ABIl,

ABI2, ABI3, ABI4 and ABI5 (Nishimura et ah, 2005). In this study, we showed that the

mRNA level of HvWRKY38 reaches the maximum at 6 hr and drops to the basal level at

24 hr in response to SA (Figure 4-6), suggesting that a feedback regulation might exist to

control the expression of HvWRKY38 at late time points. In contrast, the expression of

HvWRKY38 in aleurone cells remains at a high level when samples were treated by ABA

for 24 hr (Figure 4-6). These results indicate that the expression of HvWRKY38 is

regulated differently by SA and ABA. Interestingly, the mRNA levels of HvWRKY38 in

response to SA plus GAg was even higher than that in response to SA alone (Figure 4-6).

One of the explanations is that the feedback regulation of HvWRKY38 expression by SA

might be partially blocked by the GA signaling. The antagonism between SA and GA is

also reported in regulation of trichome development. SA inhibits GA-induced trichome

development through a pathway that is independent on Nprl/Niml (Traw and Bergelson,

2003). It will be interesting to study whether HvWRKY38 is involved in SA suppressing

pathway on GA-induced trichome development.

125

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. In summary, our study suggests that SA appears to have an antagonistic effect on

GA-induced biosynthesis of a-amylases in aleurone eells and seed germination (Figure 4-

8). ABA and SA signals enhance the mRNA level of HvWRKY38, whieh in turn

suppresses GA induction of a-amylase expression. Therefore, HvWRKY38 might serve

as a converging node of SA and ABA signal pathways involved in suppressing GA-

induced seed germination.

Materials and methods

Chemicals and enzymes

Restriction enzymes, T4 DNA ligase, Taq DNA polymerase, ImProm-II™ reverse

transcriptase and Prime-a-Gene® Labeling System were purchased from Promega

(Madison, WI, USA). Luciferin was acquired from BD Pharmingen (San Diego, CA,

USA). KlenTaq LA DNA polymerase and all other reagents including 4-

methylumbelliferyl-P-D-glucuronide trihydrate (MUG) and 4-methylumbelliferone (4-

MU) were purchased from Sigma Chemical Co. (St. Louis, MO, USA).

Plant materials and germination assay

Barley (Hordeum vulgare cv Himalaya) seeds were purchased from Washington

State University (Pullman, WA, USA). Seeds were sterilized in 10% chlorox for 20 min.

The seeds were then rinsed 5 times in sterile water for 5 min each time. After sterilization,

barley seeds were put on two layers of filter paper in a Petri dish that contains autoclaved

vermiculate. The vermiculate was soaked in the imbibing solution (20 mM CaCL, 20 mM

sodium succinate pH 5.0) that contains different plant hormones. The seeds were

126

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. ABA SA

HvWRKY38

a-Amylase Seed germination and GA 1 (Amy32b) post-germination growth

Figure 4-8. The hypothetic model for the crosstalk between GA and SA signaling. SA and ABA induce the expression of the HvWRKY38 gene, which in turn represses the GA induction of a-amylase {Amy32b) expression, hence inhibiting seed germination.

127

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. incubated at 24 °C in a growth ehamber with 16 hr /8 hr light and dark cycles.

Germination rates were counted at 24 hr, 48 hr and 72 hr.

Starch plate assays

To qualitatively assess hormone interactions on a-amylase activity, we used a stareh

plate test described previously (Ho et ah, 1980). Barley seeds were cut transversely to

remove embryo portions, resulting in half-seeds without embryos. Half-seeds were then

sterilized in 10% Chlorox for 20 min and then washed 5 times with sterile water. These

half-seeds were then plaeed on 2% agar in 10-cm Petri dishes with the cut edge on the

agar. The agar plates included 0.2% soluble potato starch, 20 mM CaCL, 20 mM sodium

succinate pH 5.0, and various hormones or SA analogs: 1 pM G A 3, 1 mM SA, 20 pM

ABA, 1 mM 3-HyB and 1 mM 4-HyB. The dishes were then incubated at 24 °C for 36 hr.

After incubation, the plates were flooded with I 2/KI solution (2.8 mM I2 plus 43.4 mM KI

in 0.2 N HCl) that formed a purple color upon reacting with starch present in the agar.

Seeds producing a-amylases were indicated by a clear halo surrounding the seed where

starch had been degraded.

Assays of a-amylase activity

a-Amylase assays were done as described previously (Ho et ah, 1980). After

sterilization, four barley half-seeds were placed in 10 mL of imbibing solution (20 mM

sodium succinate, pH 5.0 and 20 mM CaCL) in Petri dishes with various hormones or SA

analogs. Hormone concentrations were the same as those used in the starch plate tests.

The seeds were incubated at 24 °C for 28 hr. After incubation, the medium was extracted

and tested for the a-amylase activity using a spectrophotometer. Briefly, 75 mg potato

starch (Sigma) was added to 50 mL of imbibing solution. The solution was boiled for 1

128

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. min, and then centrifuged at 9500 g for 15 min at 4 °C. Next, 150 pL of starch solution

were mixed with water to create a stock solution that gives an A 620 reading of 1.00 when

reacted with 1 mL of L/KI solution (0.36 M KI plus 23.6 mM 12 in 0.1 N HCl). To test

secreted a-amylase activity, various amounts of extracts were added to 500 pL of the

starch solution in a 2.5-mL cuvette and then water was added to reach a total volume of

1.5 mL. The reaction was allowed to take place for 2 ~ 200 min, and then reacted with 1

mL of I2/KI. Iodine is able to react with starch and thus any starch degradation gives a

lower A620 than the baseline 1.00 reading. The a-amylase activity was calculated based

on the following formula: ( 1 0 0 0 / volume of extract) x (1 / reaction time) x (initial A 620 -

final A62o)- Activity was then compared to a control sample of no hormone treatment to

calculate induction and suppression values.

To test for a-amylase activity within aleurone cells (not secreted), seeds were

collected after incubation and homogenized with 1 mL of imbibing solution. The

homogenate was centrifuged at 10,000 g for 5 min. The supernatant was then tested for a-

amylase activity as described above.

Assay of a-amylase enzyme stability in vitro

After sterilized as above, four half-seeds were treated with 1 pM GA 3 and incubated

at 24 °C for 28 hr. This medium was divided equally into two Petri dishes (5 mL each).

SA was added to one dish to the final concentration of 1 mM, and an equal volume of

water was applied to the other aliquot. The two medium aliquots were then incubated at

24 °C for 28 hr before a-amylase activities were assayed.

129

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. RNA isolation and northern blot analysis

Total RNA was isolated from barley aleurone cells with the LiCl precipitation

method. After being imbibed for 2 days, barley half-seeds were incubated at 24 °C for 24

hr in Petri dishes containing 20 mM CaCL, 20 mM sodium succinate pH 5.0 without or

with hormones or 3-HyB as following; 1 pM GA3, 20 pM ABA, 1 mM SA, 1 mM 3-HyB,

1 pM G A3 plus 20 pM ABA, 1 pM GA3 plus 1 mM SA, 1 pM GA3 plus 1 mM 3-HyB.

After incubation, aleurone layers were peeled from 50 half-seeds, frozen in liquid

nitrogen, and homogenized to a fine powder in a mortar and pestle. The powder was

added to 5 mL of RNA grinding buffer (0.1 M Tris pH 9.0, 1% SDS, 10 mM EDTA pH

8.0, 50 mM (3-mercaptoethanol). After centrifuging, the supernatant was extracted with

an equal volume of phenol : chloroform : isoamyl alchol (25:24:1, v/v). Nucleic acids were

precipitated with 1/9 volume of sodium acetate (pH 5.2) and 2.5 volume of ethanol. The

pellets were resuspended in DEPC-treated water and then preeipitated with an equal

volume of 4 M LiCl twice. After washing the RNA pellet with 70% (v/v) ethanol, the

pellet was dissolved in water and stored at -80°C.

Ten pg of total RNA from each sample was used for Northern blot analyses. Gene

specific probes were amplified by PGR using the following primers: Amy32b, 5’-

GACACTACAACGGAGCTGAAG -3 ' and 5’-CTTATACCTCTTCATATCCTCAG-3’;

HvWRKY38, 5’-AGAACAGCGACGGCTCCGGCAAG-3’ and 5 -GATCGATCGAACT

CCGCCATGG-3’. The amplified probe was purified and then labeled with a-^^P-dCTP

by using the Prime-a-Gene® Labeling System. The blot was hybridized and washed as

described previously (Church and Gilbert, 1984). The storage phosphor screens were

scanned with a Typhoon 9410 phosphor imager from Amersham Biosciences (Piscataway,

130

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. NJ, USA) and quantified with ImageQuant software (version 5.2, Amersham

Biosciences).

Preparation of the effeetor constructs

Plasmid pMBL022 (Amy32b-GUS) was used as the reporter construct in the transient

expression assay (Lanahan et ah, 1992). Plasmid pAHClS {UBI-Luciferase), which

contains the luciferase reporter gene driven by the eonstitutive maize ubiquitin promoter

(Bruce et ah, 1989), was used as an internal control construct to normalize GUS activities

of the reporter construct. The cDNA of HvWRKY38 was amplified using primers 5’-

AATTGGCGCGCCATGGATCCATGGATGGGCAGCCAGCC-3’ (sense primer) and

5’-TAAGGCGCGCCTTAATTGATGTCCCTGGTCGGCGAGAG-3’ (antisense primer)

by RT-PCR, and inserted into the AscI site of UBI-linker-NOS (Zhang et ah, 2004)

driven by the constitutive maize ubiquitin promoter, giving rise to UBI-HvWRKY38

effector construct.

Transient expression assays

The detailed description of transient expression procedure with barley half-seeds has

been published before (Shen et ah, 1993). Briefly, barley half-seeds were imbibed for 2.5

to 3 days, and then the pericarp and testa were removed. The DNA mixture (in 1:1 molar

ratio) of the reporter construct {Amy32b-GUS) and the internal control construct {UBI-

Luciferase), along with or without the effector construct, were bombarded into barley

half-seeds (four replicates per test construct). For each bombardment, 8 prepared half

seeds were arranged in a small circle (about 1.8 cm in diameter) to maximize the

bombarded surface area. After bombardment, GUS assay and luciferase assay were done

as described (Shen et ah, 1996).

131

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Acknowledgements

We would like to express our gratitude to people in the Shen lab for their

eontributions to the improvement of this paper. The project described was supported in

part by NIH Grant Number 2 P20 RRO16463 from the INBRE Program of the National

Center for Researeh Resourees to the state of Nevada.

References

Apte, P., and Laloraya, M. (1982). Inhibitory action of phenolic compounds on abscisic acid-induced abscission. J. Exp Bot 33, 826-830.

Bethke, P.C., Schuurink, R., Jones, R.J., and Hooley, R. (1997). Hormonal signalling in cereal aleurone. J Exp Bot 48, 1337-1356.

Bruce, W.B., Christensen, A.H., Klein, T., Fromm, M., and Quail, P.H. (1989). Photoregulation of a phytochrome gene promoter from oat transferred into riee by particle bombardment. PNAS USA 86, 9692-9696.

Chen, C., and Chen, Z. (2000). Isolation and characterization of two pathogen- and salicylic acid-induced genes encoding WRKY DNA-hinding proteins from tobacco. Plant Mol Biol 42, 387-396.

Chen, Z., Malamy, J., Henning, J., Conrath, U., Sanchez-Casas, P., Silva, H., Ricigliano, J., and Klessig, D.K. (1995). Induction, modification, and transduction of the salieylic acid signal in plant defense responses. PNAS USA 92, 4134-4137.

Church, G.M., and Gilbert, W. (1984). Genomic sequencing. PNAS USA 81, 1991-1995.

Dempsey, D.A., and Klessig, D.F. (1994). Salicylic acid, active oxygen species and systemic acquired resistance in plants. Trends Cell Biol 4, 334-338.

Dill, A., Thomas, S.G., Hu, J., Steber, C.M., and Sun, T.P. (2004). The Arabidopsis F- box protein SLEEPY 1 targets gibberellin signaling repressors for gibberellin-induced degradation. Plant Cell 16, 1392-1405.

Dong, J., Chen, C., and Chen, Z. (2003). Expression profiles of the Arabidopsis WRKY gene superfamily during plant defense response. Plant Mol Biol 51, 21-37.

Eulgem, T., Rushton, P.J., Robatzek, S., and Somssich, I.E. (2000). The WRKY superfamily of plant transcription factors. Trends Plant Sci 5, 199-206.

132

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Eulgem, T., Rushton, P.J., Schmelzer, E., Hahlbrock, K., and Somssich, LE. (1999). Early nuclear events in plant defence signalling: rapid gene activation by WRKY transcription factors. EMBO J 18, 4689-4699.

Guan, L., and Scandalios, J.G. (1995). Developmentally related responses of maize catalase genes to salicylic acid. PNAS USA 92, 5930-5934.

Ho, T.-H.D., Shih, S.C., and Shute, D.E. (1980). Sereening for barley mutants with altered hormone sensitivity in their aleurone layers. Plant Physiol 66, 153-157.

Itoh, H., Ueguchi-Tanaka, M., Sato, Y., Ashikari, M., and Matsuoka, M. (2002). The gibberellin signaling pathway is regulated by the appearance and disappearance of SLENDER RICEl in nuclei. Plant Cell 14, 57-70.

Karssen, C.M., Brinkhorst-van der Swan, D.L.C., Breekland, A.E., and Koomneef, M. (1983). Induction of dormancy during seed development by endogenous abscisic acid: Studies on abscisic acid deficient genotypes of Arabidopsis thaliana L. Heynh. Planta 157, 158-165.

Khan, M., and Ungar, I. (1986). Inhibition of germination in Atriplex triangularis seeds by application of phenols and reversal of inhibition by growth regulators. Botanical Gazette 147, 148-151.

Koomneef, M., and Karssen, C.M. (1994). Seed dormancy and germination in Arabidopsis. In Arabidopsis, E.M. Meyerowitz and C.R. Somerville, eds (Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press), pp. 313-334.

133

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Kunkel, B.N., and Brooks, D.M. (2002). Crosstalk between signaling pathways in pathogen defense. Curr Opin Plant Biol 5, 325-331.

Lanahan, M.B., Ho, T.H.D., Rogers, S.W., and Rogers, J.C. (1992). A gibberellin response complex in cereal alpha-amylase gene promoters. Plant Cell 4, 203-211.

Lovegrove, A., and Hooley, R. (2000). Gibberellin and abscisic acid signalling in aleurone. Trends Plant Sci 5, 102-110.

Mare, C., Mazzucotelli, E., Crosatti, C., Francia, E., Stanca, A.M., and Cattivelli, L. (2004). HV-WRKY38: a new transcription factor involved in cold- and drought- response in barley. Plant Mol Biol 55, 399-416.

Mauch-Mani, B., and Mauch, E. (2005). The role of abscisic acid in plant-pathogen interactions. Curr Opin Plant Biol 8, 409-414.

McGinnis, K.M., Thomas, S.G., Soule, J.D., Strader, L.C., Zale, J.M., Sun, T.P., and Steber, C.M. (2003). The Arabidopsis SLEEPYl gene encodes a putative F-Box subunit of an SCF E3 ubiquitin ligase. Plant Cell 15, 1120-1130.

Nishimura, N., Kitahata, N., Seki, M., Narusaka, Y., Narusaka, M., Kuromori, T., Asami, T., Shinozaki, K., and Hirayama, T. (2005). Analysis of ABA hypersensitive germination2 revealed the pivotal functions of PARN in stress response in Arabidopsis. Plant J 44, 972-984.

Penson, S.P., Schuurink, R.C., Fath, A., Gubler, F., Jacobsen, J.V., and Jones, R.L. (1996). cGMP is required for gibberellic acid-induced gene expression in barley aleurone. Plant Cell 8, 2325-2333.

Rai, V., Sharma, S., and Sharma, S. (1986). Reversal of ABA-induced stomatal closure by phenolic compounds. J Exp Bot 37, 129-134.

134

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Raskin, I. (1992). Role of salicylic acid in plants. Annu Rev Plant Physiol Plant Mol. Biol. 43,439^63.

Ray, S. (1986). GA, ABA, phenol interaction and control of growth: phenolic compounds as effective modulators of GA-ABA interaction in radish seedlings. Biol Plant 28, 361-369.

Ray, S., and Laloraya, M. (1984). Interaction of gibberellic acid, abscisic acid, and phenolic compounds in the control of hypocotyl growth of Amaranthus caudatus seedlings. Can J Bot 62, 2047-2052.

Rizhsky, L., Liang, H., and Mittler, R. (2002). The combined effect of drought stress and heat shock on gene expression in tobacco. Plant Physiol 130, 1143-1151.

Robatzek, S., and Somssich, I.E. (2002). Targets of AtWRKY6 regulation during plant senescence and pathogen defense. Genes Dev 16, 1139-1149.

Shah, J. (2003). The salicylic acid loop in plant defense. Curr Opin Plant Biol 6, 365-371.

Shen, Q., Uknes, S.J., and Ho, T.H.D. (1993). Hormone response complex of a novel abscisic acid and cycloheximide inducible barley gene. J Biol Chem 268, 23652- 23660.

Silverman, P., Seskar, M., Kanter, D., Schweizer, P., Metraux, J.P., and Raskin, 1. (1995). Salicylic acid in rice (biosynthesis, conjugation, and possible role). Plant Physiol 108, 633-639.

Silverstone, A.L., Jung, H.S., Dill, A., Kawaide, H., Kamiya, Y., and Sun, T.P. (2001). Repressing a repressor: gibberellin-induced rapid reduction of the RGA protein in Arabidopsis. Plant Cell 13, 1555-1566.

Sun, T.P., and Gubler, F. (2004). Molecular mechanism of gibberellin signaling in plants. Annu Rev Plant Physiol Plant Mol Biol 55, 197-223.

Traw, M.B., and Bergelson, J. (2003). Interactive effects of jasmonic acid, salicylic acid, and gibberellin on induction of trichomes in Arabidopsis. Plant Physiol 133, 1367- 1375.

135

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Tyler, L , Thomas, S.G., Hu, J., Dill, A., Alonso, J.M., Ecker, J R., and Sun, T.P. (2004). DELLA proteins and gibberellin-regulated seed germination and floral development in Arabidopsis. Plant Physiol 135, 1008-1019.

Ueguehi-Tanaka, M., Ashikari, M., Nakajima, M., Itoh, H., Katoh, E., Kobayashi, M., Chow, T.Y., Hsing, Y.I., Kitano, H., Yamaguchi, I., and Matsuoka, M. (2005). GIBBERELLIN INSENSITIVE DWARF 1 encodes a soluble receptor for gibberellin. Nature 437, 693-698.

Ulker, B., and Somssich, I.E. (2004). WRKY transcription factors: from DNA binding towards biological function. Curr Opin Plant Biol 7, 491-498.

Verslues, P.E., and Zhu, J.K. (2005). Before and beyond ABA: upstream sensing and internal signals that determine ABA accumulation and response under abiotic stress. Biochem Soc Trans 33, 375-379.

Xie, Z., Zhang, Z.L., Zou, X., Yang, G., Komatsu, S., and Shen, Q.J. (2006). Interactions of two abscisic-acid induced WRKY genes in repressing gibberellin signaling in aleurone cells. Plant J 46, 231-242.

Xie, Z., Ruas, P., and Shen, Q.J. (2005a). Regulatory networks of the phytohormone abscisic acid. Vitam Horm 72, 235-269.

136

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. CHAPTER 5

GENERAL DISCUSSION

Rice is one of the most important crops for human consumption, providing the staple

food for over three billion people in the world (Yu et al., 2002). Sinee the "green

revolution" improved the yield of rice in the 1960s, genetie improvement has been a

major focus of plant breeding efforts. Riee has a relatively short life eyele and a small

genome, whieh faeilitate genetie manipulation and fundamental researeh. Therefore, rice

is widely used as a model plant for harnessing of genes for disease prevention, drought

resistanee, nutritional improvement, and many other possible modifiable features of

eereal erops. For my dissertation researeh, I took a bioinformatics-bridged approaeh to

addressing GA, ABA and SA signaling in rice. Our long-term goal is to improve the yield

and quality of rice and other eereals.

An approaeh integrating bioinformatics

and experimental biology

Through the annotation of the riee genome sequenees, we have identified 210

transcription factor families, insulting in identification of 4862 putative rice transcription

factors (Supplemental Table 5-1). With a foeus on the WRKY gene super-family, I have

developed bioinformatic tools and the experimental strategy to identify transeription

137

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. factors involved in hormonal signaling (Chapter 2). Through functional analyses of the

riee WRKY transeription factors in aleurone cells, two negative regulators and two

positive regulators have been identified to be involved in ABA signaling (Chapter 2).

This eost-effieient and time-saving approach consists of gene annotation by

automated prediction, identification of transcription factors by using statistical models,

manual evaluation of predicted gene models, selection or screening for target genes, and

functional studies of target genes by transient expression analyses in aleurone cells.

Nevertheless, this approach can be further improved in the following aspects. First, the

suecess of this approaeh relies on the quality of gene annotation. However, over one-third

of genes identified through the automated predictions contain annotation errors (Chapter

2; Haas et ah, 2002; Meyers et ah, 2003). Hence, full-length eDNAs are sequeneed in a

large seale to support gene prediction (Kikuchi et ah, 2003). Only gene models that are

supported by full-length eDNA are eonsidered as eorreet annotations. However, the rest

of gene models might not represent pseudo genes beeause it is unlikely that the full-

length eDNA databases used in this study contain all possible transeripts. The aecuraey of

predieted gene models without experimental evidenee ean be improved by using multiple

gene finder programs. In this study, 4 out of 33 gene models without full-length eDNA

support have been improved by using FGENESH (Chapter 2). Therefore, better

algorithms ean be developed by ineorporating the strengths of several programs. The

common gene finder programs were summarized in Supplemental Table 5-2. Second, it is

challenging to ehoose target genes from a large number of candidates for experimental

studies. Searehing for key cA-acting elements in promoter regions ean greatly improve

the effieiency of this process. For example, responses of HVAl and HVA22 to ABA rely

138

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. on two properly oriented and spaced cA-aeting elements, ABA response element (ABRE)

and coupling element (CE) in their promoters. By sereening rice promoter databases, 280

non-transposon genes eontaining HVAl-like, ABA response complex (ABRC) are

identified, and 9 out of 18 tested genes are ABA-inducible by quantitative reverse

transcription PCR (qRT-PCR) (Ross and Shen, 2006). Similarly, four properly spaeed

and oriented cA-aeting elements are essential for GA induetion of AmyS2b gene

expression. Thus, searching for genes with this GA response eomplex (GARC) in their

promoters will help us to reveal novel GA-response genes. Alternatively, high-throughput

experimental analyses sueh as DNA microarray and proteomics studies can be applied to

identify candidates with altered gene expression patterns or protein profiles in response to

hormone treatments, as well as to diseover novel motifs in promoters of ABA/GA

regulated genes (Yazaki et ah, 2003; Tanaka et al., 2004; Yazaki et al., 2004; Komatsu

and Konishi, 2005). Third, transient expression analysis is a useful tool to quiekly study

gene funetions in aleurone cells. However, making stable-transgenic plants is still

necessary to study morphologieal phenotypes in a whole plant. For a superfamily like the

WRKY family, this approach could be ehallenging because highly-homologous members

may be funetionally redundant. Henee, it might be neeessary to knoek out more than one

redundant gene in order to see an obvious phenotype. For instanee, in a screening of 16

Arabidopsis WRKY T-DNA insertion lines, only three lines display subtle ABA-

oversensitive phenotypes (Xie and Shen, unpublished). In another study, although no

obvious phenotype was observed for wrky40 or wrkyôO single mutant, wrkylS wrky40

and wrkylS wrkyôO double mutants and the wrkylS wrky40 wrkyôO triple mutant

displayed significant phenotypes in response to pathogen infections (Xu et al., 2006).

139

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Therefore, for a super gene family, it is neeessary to study the function of its members by

over-expressing eaeh individual gene or knoeking out multiple elose-related genes.

WRKY proteins in GA and ABA signaling

Chapter 3 deseribes the interaction of two distinct WRKY proteins (OsWRKYSl and

OsWRKY71), whieh results in a synergistic suppression on GA signaling. It will be

interesting to study whether or not OsWRKYSI and OsWRKY71 represent PKABAl-

dependent ABA suppression pathway (Chapter I). Although both of them eontain the

eonserved WRKY domain, OsWRKY71 but not OsWRKY51 binds to DNA in vitro.

Furthermore, OsWRKY71 is also eapable of forming a homodimer but OsWRKYSl is

not. Sequenees outside WRKY domains of these two proteins are highly diverse, whieh

likely eontribute to their unique eharacteristics. For instanee, a putative leueine-zipper

motif is present in the N-terminus of OsWRKY71. Bimolecular fluoreseenee

complementation (BiFC) assays show that deletion of this motif abolishes interaetion of

OsWRKY71 in aleurone eells, indieating that OsWRKY71 might dimerize through the

leueine-zipper motif (Zou and Shen, unpublished). Future studies are needed to address

the following questions: I) is the same domain required for OsWRKY71

homodimerization and OsWRKY71 /OsWRKY51 heterodimerization; 2) whieh domain

of OsWRKYSl is neeessary for its interaetion with OsWRKY71; 3) are the homo- and

hetero-dimerization essential for their activities to suppress GA-induced a-amylase

expression? Another intriguing question is how GA removes the repression of

OsWRKYSl and OsWRKY71 to induee a-amylase expression and seed germination?

We showed that GA might promote degradation of GFP:0sWRKY71 but not

140

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. GFP:0sWRXY51 in barley aleurone cells by the semi-quantitative eonfoeol mieroseopy

(Zhang et ah, 2004; Xie and Shen, unpublished). It is necessary to confirm this result by

studying the endogenous protein levels of OsWRKYSl and OsWRKY? 1 in response to

GA, ABA and proteasome inhibitors. Furthermore, a ealmodulin-binding domain

(CaMBD) is present in a subgroup of Arabidopsis WRKY proteins (Park et ah, 200S), as

well as OsWRKYSl (Shen, unpublished). A split-ubiquitin yeast assay and an in vitro

eompetition assay demonstrate that OsWRKYSl interacts with a calmodulin (CaM)

specifically through its CaMBD (Shen, unpublished). The eytoplasmie Ca^^ changes

regulate the secretion of a-amylase, although it is uneertain whether it mediates

hormonal-regulated a-amylase gene expression in aleurone cells (Deikman and Jones,

I98S; Gilroy, 1996). This finding might link Ca^^ sensing direetly to transeriptional

eontrol in GA signaling. Reeently, it has been reported that the specific CaM isoform

GmCaM4 enhances the DNA binding aetivity of the AtMYB2, whereas a elosely related

CaM isoform (GmCaMl) inhibits it (Yoo et al., 2005). Furthermore, overexpression of

GmCaM4 in Arabidopsis inereases the expression of AtMYB2-regulated genes (Yoo et

al., 2005). Therefore, I propose that elevation of eytoplasmie Ca^^ aetivates CaM, which

binds to OsWRKY51, sequesters the interaetion of OsWRKY51 and OsWRKY? 1,

inhibits the binding of 0sWRKY51/0sWRKY?l to W-boxes, and henee relieves the

repression of OsWRKY51 on a-amylase expression. Further experiments are neeessary to

demonstrate whether interaetion of CaM and OsWRKY51 ean interfere with the DNA

binding aetivity of OsWRKY51/OsWRKY? 1, and release the inhibitory effect of

OsWRKY51 in GA-induced a-amylase expression.

141

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. In summary, roles of OsWRKYSl and OsWRKY? 1 in GA and ABA signaling are

proposed (Figure 5-1). ABA is pereeived by a reeeptor ABAPl on plasma membrane

(Razem et al., 2004) and induees the expression of OsWRKYSl and OsWRKYJl.

Interaction of OsWRKYSl and OsWRKY?I suppresses GAMYB-induced a-amylase

expression. At the GA induction state, GA inereases the concentration of Ca^^ in

cytoplasm and decreases the expression level of OsWRKYSl and OsWRKY? 1 (Gilroy,

1996). GA might also eause the interaction of CaM and OsWRKYSl to release

OsWRKYSl repression aetivity, and promote the degradation of OsWRKY?I. Thereby,

GA-indueed trans-aetivators sueh as GAMYB enhanee the expression of a-amylases,

resulting in seed germination.

Transeriptional regulation of a-amylase expression

Another foeus of my research is to understand how WRKY proteins cooperate with

other transeription faetors to fine-tune a-amylase expression in aleurone eells. Four cis-

aeting elements in the promoter of the Amy32b low pi a-amylase gene have been

identified to be essential for its high-level expression. Each of these elements ean be

hound by one or more trans-activator(s) and trans-repressor(s) (Figure 5, Chapter 1).

Therefore, I hypothesize that trans-activators and repressors eompete for binding to the

same set of cA-acting elements in the a-amylase promoter, and the ratio of aetivators and

repressors that are regulated by multiple hormone signals eontrols the expression of a-

amylases. For instance, besides being bound by WRKY repressors (OsWRKY? 1 or

OsWRKY? 1/OsWRKYSl), the W-box/02S cA-aeting element is also bound by an

unusual zinc finger protein named RAMY (Peng et ah, 2004). Both RAMY and Amy2

142

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Extracellular Receptor ABAPl Cytoplasm

cGMP & [Ca" changes I GIDl )

Nucleus

SLNl GIDl degradation ^ ► W71 degradation SLNl

Seed G AM YB) ► (a-amylases germination

Figure 5-1. Proposed roles of OsWRKYSl and OsWRKY? 1 in the erosstalk of GA and ABA signaling in aleurone cells. Detailed GA signaling cascade is deseribed in Chapter 1. Briefly, GA is perceived by soluble receptor GIDl, which leads to the degradation of DELLA proteins sueh as SLNl and induetion of trans-aetivators such as GAMYB. ABA is perceived by a reeeptor ABAPl on plasma membrane and induces OsWRKYSl and OsWRKYJl, which block GAMYB -induced a-amylase expression. At the GA induction state, GA inereases the concentration of Ca^^ in eytoplasm and deereases the expression level of OsWRKYSl and OsWRKY71. GA might also cause the interaction of CaM and OsWRKYSl to release OsWRKYSl repression aetivity, and promote the degradation of OsWRKY? 1. Thereby, GA-induced trans-aetivators such as GAMYB enhance the expression of a-amylases, resulting in seed germination.

143

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. gene are GA-indueible, but the increase in the RAMY mRNA level occurs prior to that of

the Amy2 mRNA level in the GA-treated aleurone tissues, suggesting that RAMY might

be a trans-aetivator in GA signaling. It is neeessary to study whether RAMY is a trans

activator in GA-induced a-amylase expression in aleurone eells by transient over

expression analyses and whether RAMY competes with OsWRKY?I/0sWRKY51 for

binding to W-boxes in the a-amylase promoter region by EMSA (eleetrophoretie

mobility-shift assay). Besides competing for binding to the same set of cA-aeting

elements, trans-aetivators and trans-repressors also interact to modulate a-amylase

expression. For example, DOF proteins (OsDof3, SAD, BPBF) interact with GAMYB,

synergistically activating the expression of a-amylases during seed germination or

endosperm-specific genes during seed development (Washio, 2003; Diaz et ah, 2005). In

addition, 0sWRKY5I/0sWRKY?l and GAMYB functionally antagonize with eaeh

other in regulating Amy32b expression (Chapter 3). Further experiments are needed to

address whether these WRKY proteins ean physically interact with GAMYB or DOF

proteins to interfere with their binding activities to GARE and Pyr box, respectively. A

potential problem for the binding assay in vitro is that the concentrations of tested

transeription faetors may significantly exceed those found under native conditions,

resulting in a false-positive binding signal. The chromatin immuno-preeipitation (ChIP)

assay (Turek et ah, 2004) can be used to monitor the in vivo binding of OsWRKY? 1,

GAMYB to W-boxes and GARE, respectively in aleurone eells treated without or with

ABA, GA, or ABA plus GA. Moreover, immuno-preeipitation with antibodies against

WRKY proteins and GAMYB can be applied to study the in vivo eomplex in regulating

a-amylase expression.

144

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. A hypothetical model of transeriptional eontrol of Amy32b expression is shown in

Figure 5-2. At the ABA repression state, repressors bind to the corresponding cA-aeting

elements in the Amy32b promoter, and suppress GA induetion of Amy32b expression:

OsWRKY51/OsWRKY71 bind to W-boxes (Chapter 3); BPBF binds to Pyr boxes (Diaz

et al., 2005); HRT or HvMCBl binds to GARE (Raventos et ah, 1998; Rubio-Somoza et

ah, 2006); OsMYBS2 or OsMYBS3 binds to Amy box (Lu et ah, 2002). At the GA

induction state, GA induees the expression of trans-aetivators and down-regulates the

level of repressors in aleurone cells. The ratio of trans-aetivators to repressors is high

enough to compete for binding to cA-acting elements: RAMY binds to W-boxes (Peng et

ah, 2004); SAD or OsDofB binds to Pyr box (Washio, 2003; Diaz et ah, 2005); GAMYB

binds to GARE (Gubler et ah, 1995); OsMYBSl binds to Amy box (Lu et ah, 2002).

Binding of these trans-aetivators to the promoter region leads to a high level of Amy32b

expression.

Antagonism of ABA and SA against GA

In addition to dissecting the molecular mechanism of GA and ABA signaling, I am

also interested in understanding the crosstalk of GA and SA signaling in regulating seed

germination. It has been shown that applications of high dosages of SA (in the range of 1

to 5 mM) completely inhibited seed germination for several plant species, sueh as maize,

A. triangularis and Arabidopsis (Khan and Ungar, 1986; Guan and Seandalios, 1995;

Nishimura et ah, 2005). In my researeh, I found that similar to ABA, SA is also eapable

of antagonizing GA induetion of barley seed germination by blocking a-amylase

production in a dosage dependent manner. SA appears to he ubiquitously present in plant

145

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. ABA Repression State GA

GAMYB ABA OsDoD , /SAD RAMY] V 'SlYSl

Low level o f the Amy32b expression

GA Induction State

OsDofi ^ A M ^ /SAD /GAMYB SI SI GÂRË High level o f the - t%Hw Amy32b expression

Figure 5-2. A proposed model of transeriptional control of a-amylase expression. At the ABA repression state, ABA increases the level of repressors but decreases the level of activators in aleurone cells, causing a low level expression of the low pi a- amylase, Amy32b. At the GA induetion state, GA induces the expression of trans- aetivators and down-regulates the level of repressors in aleurone eells, resulting in a high level Amy32b expression. Rectangles represent cA-acting elements: W, W-box; Pyr, pyrimidine box; GARE, GA response element; Amy, amylase box. Filled circles represent repressors: W51, OsWRKYSl; W71, OsWRKY? 1; BPBF; HRT; MCBl, HvMCBl; S2, OsMYBS2; S3, OsMYBSB. Open circles represent activators: RAMY; OsDoO; SAD; GAMYB; SI, OsMYBSl.

146

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. leaves, reproductive structures, and tissues infected with pathogens (Raskin, 1992).

Nevertheless, the SA content in seed has not been reported. It is necessary to measure the

level of endogenous SA in seeds under different treatments such as pathogen or

environmental stress treatments, and to study the role of endogenous SA in seed

germination by testing SA deficient mutants. In an effort to elucidate the mechanism of

GA and SA signaling crosstalk, an SA- and ABA-inducible WRKY gene, HvWRKY38 (a

putative ortholog of OsWRKY? 1 in barley) was identified (Chapter 4). HvWRKY38 is

capable of suppressing GA-induced a-amylase expression in barley aleurone cells,

suggesting that HvWRKY38 might be a converging node mediating the SA/ABA

repressing signal pathway on GA-induced seed germination. However, ABA and SA

appear to regulate HvWRKY38 expression with different kinetics. Unlike ABA, SA

induces HvWRKY38 expression only during the early incubation time (Chapter 4). Hence,

it is likely that a feedback regulation maintains its expression at a background level

during the late incubation time. It has been shown that a feedback regulation controls the

expression of several WRKY genes, such as PcWRKYl, AtWRKYô and AtWRKY18,

perhaps contributing to avoiding damaging effect on plant growth (Chen and Chen, 2002;

Robatzek and Somssich, 2002; Turck et al., 2004; Xu et al., 2006). Furthermore, four W-

boxes are identified in the promoter of OsWRKY? 1 suggesting that this feedback control

might be exerted by SA-induced WRKY genes. Future research is necessary to study

which WRKY proteins bind to W-boxes in the OsWRKY?l/HvWRKY38 promoters to

suppress their expression. Interestingly, OsWRKY71/HvWRKY38 might be an important

node in other signaling networks because the expression of OsWRKY?! and HvWRKY38

are also up-regulated by dehydration, freezing, wounding and pathogens (Mare et al..

147

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 2004; Liu et al, 2006). Therefore, the following experiments are needed to study the

function of OsWRKY? 1 in other physiological processes: 1) produce OsWRKY? 1-

overexpression transgenic rice plant and screen for phenotypes; 2) knocking out the

expression of several close-related homologs or interacted WRKY genes (like OsWRKYSl)

to study their functions; 3) a pull-down assay can be applied to seareh for downstream-

binding targets of OsWRKY? 1. The detailed protocols of pull-down assay and yeast one-

hybrid have been described previously (Miao et al., 2004). Briefly, HIS-tagged fused

OsWRKY?! (HIS:OsWRKY?l) will be incubated with rice genomic DNA and DNA

fragments bound by HIS:OsWRKY?l will be immunoprecipitated with an anti-HIS

antibody. These DNA fragments will be cloned and sequenced. Yeast one-hybrid assay

will be applied to confirm OsWRKY?! transcriptional activities on these down-stream

binding targets.

A proposed model of GA, ABA and SA signaling is shown in Figure 5-3. ABA and

SA enhance the mRNA level of HvWRKY38/OsWRKY? 1, which in turn suppresses GA-

induced a-amylase expression, blocking seed germination and post-germination growth.

HvWRKY38/OsWRKY?l might positively regulate plant pathogen defense and

tolerance to environmental stresses. An SA-induced feedback regulation might exist to

control the level of HvWRKY3 8/OsWRKY? 1, avoiding damaging effect on plant growth.

Therefore, HvWRKY 3 9/Os WRK Y ? 1 might serve as a converging node of SA and ABA

signaling in suppressing GA-induced seed germination, as well as mediating plant

pathogen defense and tolerance to environmental stresses.

148

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. ABA SA l ^ ' Feedback f I J control \ \ HvWRKY38/ ^ Pathogen defense and OsWRKY? 1 stress tolerance

1 ^ a-Amylase ^ Seed germination and {Amy32b) post-germination growth

Figure 5-3. A hypothetical model of GA, SA and ABA signaling. ABA and SA signals enhance the mRNA level of HvWRKY38/OsWRKY71, which in turn suppresses GA induction of a-amylase expression, blocking seed germination and post-germination growth. HvWRKY 38/0 s WRKY ? 1 might positively regulate plant pathogen defense and tolerance to environmental stresses. An SA-induced feedbaek regulation might exist to control the level of HvWRKY 38/0 s WRK Y ? 1, avoiding damaging effect on plant growth.

149

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Significance

Seeds comprise about 70% of the human diet, while cereals such as rice and wheat

comprise 52.5% of the world diet (http://www.fao.org/docrep/GG5/x8147e/x8147eGG.htm).

To meet the needs in food of the rapidly growing world population, erop breeders have

put a tremendous amount of effort to improve the yield and quality of crops. However

drastic yield losses of cereal crops still result from abiotic stresses such as drought, cold

and high salinity, and biotic stresses. Losses due to preharvest sprouting are also valued

in billions of dollars each year. Preharvest sprouting is due to lacking of developmental

dormancy, a developmental process that is tightly regulated by GA and ABA. In addition,

plant responses to abiotic and biotic stresses are also tightly regulated by plant hormones,

such as ABA and SA. Hence, understanding the signaling network of GA, ABA and SA

signaling in plants will provide us a solid foundation for bioengineering crops to increase

the resistance of crops to biotic and abiotic stresses, and prevent seeds from preharvestly

sprouting.

In this dissertation research, I developed an approach integrating bioinformatics and

experimental biology to identify novel transcription factors mediating GA and ABA and

SA signaling. Among these transcription factors, several of them are involved in

regulating seed germination, which could be great targets to facilitate improvement of

crop yields by biotechnology and bioengineering. For example, because OsWRKY51 and

OsWRKY71 /HvWRKY3 8 can block GA-induced a-amylase expression and inhibit seed

germination (Chapters 3 and 4), the temporal and spatial overexpression of OsWRKYSl

or OsWRKY?l/HvWRKY38 in seeds during seed development might repress the

preharvest sprouting and maintain seed dormancy. In addition, plant responses to

15G

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. environmental stresses through both ABA-dependent and ABA-independent pathways.

Hence, identification of activators in the ABA signaling, such as OsWRKY72 and

OsWRKY77 (Chapter 2), could help cultivate stress-tolerant crops. In this context, it is

interesting to note that the expression of HvWRKY38/OsWRKY71 is induced by freezing

and dehydration treatments (Mare et al., 2004), suggesting that overexpression of

OsWRKY? 1 or HvWRKY38 might be able to increase plant resistanees to eold and

drought stresses. Lastly, HvWRKY38/OsWRKY71 is also involved in the SA signaling,

suggesting its role in regulating plant responses to pathogens (Chapter 4). Indeed, a

recent study has shown that overexpression of OsWRKY?! in rice results in enhanced

resistanee to virulent bacterial pathogens (Liu et al., 2006). Therefore, the finding derived

from this research provides insights into understanding the eomplex hormonal signaling

networks in plants, which helps advance towards achieving our long-term goal: to

improve the yield and quality of riee and other eereals.

Referenees

Allen, J.L., and Salzberg, S.L. (2005). JIGSAW: integration of multiple sources of evidenee for gene prediction. Bioinformatics 21, 3596-3603.

Burge, C., and Karlin, S. (1997). Prediction of complete gene structures in human genomic DNA. J Mol Biol 268, 78-94.

Chen, C., and Chen, Z. (2002). Potentiation of developmentally regulated plant defense response by AtWRKY18, a pathogen-indueed Arabidopsis transcription factor. Plant Physiol 129, 706-716.

Deikman, J., and Jones, R.L. (1985). Control of a-amylase mRNA aceumulation by gibberellic acid and calcium in barley aleurone layers. Plant Physiol 78, 192-198.

Diaz, I., Martinez, M., Isabel-LaMoneda, I., Rubio-Somoza, I., and Carbonero, P. (2005). The DOF protein, SAD, internets with GAMYB in plant nuelei and aetivates

151

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. transcription of endosperm-specific genes during barley seed development. Plant J 42, 652-662.

Foissac, S., Bardou, P., Moisan, A., Cros, M.J., and Schiex, T. (2003). EUGENE'HOM: A generie similarity-based gene finder using multiple homologous sequences. Nucleic Acids Res 31, 3742-3745.

Gilroy, S. (1996). Calcium-dependent and -independent signal transduetion in the barley aleurone. Plant Cell 8, 2193-2209.

Guan, L., and Seandalios, J.G. (1995). Developmentally related responses of maize eatalase genes to salieylie acid. PNAS USA 92, 5930-5934.Gubler, F., Kalla, R., Roberts, J.K., and Jacobsen, J.V. (1995).

Gibberellin-regulated expression of a myb gene in barley aleurone eells: evidence for Myb transactivation of a high-pl alpha-amylase gene promoter. Plant Cell 7, 1879- 1891.

Haas, B.J., Volfovsky, N., Town, C D., Troukhan, M., Alexandrov, N., Feldmann, K.A., Flavell, R.B., White, O., and Salzberg, S.L. (2002). Full-length messenger RNA sequenees greatly improve genome annotation. Genome Biol 3, RLSLARCH0029.

Khan, M., and Ungar, I. (1986). Inhibition of germination in Atriplex triangularis seeds by application of phenols and reversal of inhibition by growth regulators. Botanical Gazette 147, 148-151.

Kikuchi, S., Satoh, K., Nagata, T., Kawagashira, N., Doi, K., Kishimoto, N., Yazaki, J., Ishikawa, M., Yamada, H., Ooka, H., Hotta, I., Kojima, K., Namiki, T., Ohneda, L., Yahagi, W., Suzuki, K., Li, C.J., Ohtsuki, K., Shishiki, T., Otomo, Y., Murakami, K., lida, Y., Sugano, S., Fujimura, T., Suzuki, Y., Tsunoda, Y., Kurosaki, T., Kodama, T., Masuda, H., Kobayashi, M., Xie, Q., Lu, M., Narikawa, R., Sugiyama, A., Mizuno, K., Yokomizo, S., Niikura, J., Ikeda, R., Ishibiki, J., Kawamata, M., Yoshimura, A., Miura, J., Kusumegi, T., Oka, M., Ryu, R., Ueda, M., Matsubara, K., Kawai, J., Caminei, P., Adachi, J., Aizawa, K., Arakawa, T., Fukuda, S., Hara, A., Hashidume, W., Hayatsu, N., Imotani, K., Ishii, Y., Itoh, M., Kagawa, I., Kondo, S., Konno, H., Miyazaki, A., Osato, N., Ota, Y., Saito, R., Sasaki, D., Sato, K., Shibata, K., Shinagawa, A., Shiraki, T., Yoshino, M., and Hayashizaki, Y. (2003). Collection, mapping, and annotation of over 28,000 eDNA clones from japonica riee. Seience 301,376-379.

Komatsu, S., and Konishi, H. (2005). Proteome analysis of rice root proteins regulated by gibberellin. Genomics Proteomics Bioinformatics 3, 132-142.

Korf, I., Flicek, P., Duan, D., and Brent, M.R. (2001). Integrating genomic homology into gene strueture predietion. Bioinformaties 17 Suppl 1, S140-148.

152

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Liu, X., Bai, X., Wang, X,, and Chu, C. (2006). OsWRKY? 1, a rice transcription factor, is involved in rice defense response. J Plant Physiol, doi; 10.1016/ j.jplph.2006.1007.1006.

Lukashin, A.V., and Borodovsky, M. (1998). GeneMark.hmm: new solutions for gene finding. Nucleic Acids Res 26, 1107-1115.

Majoros, W.H., Pertea, M., Deleher, A.L., and Salzberg, S.L. (2005). Efficient decoding algorithms for generalized hidden Markov model gene finders. BMC Bioinformaties 6, 16.

Makalowska, I., Ryan, J.F., and Baxevanis, A.D. (2001). GeneMachine: gene predietion and sequenee annotation. Bioinformaties 17, 843-844.

Mare, C., Mazzucotelli, L., Crosatti, C., Francia, L., Stanca, A.M., and Cattivelli, L. (2004). HV-WRKY38: a new transcription factor involved in cold- and drought- response in barley. Plant Mol Biol 55, 399-416.

Meyers, B.C., Kozik, A., Griego, A., Kuang, H., and Miehelmore, R.W. (2003). Genome- wide analysis of NBS-LRR-eneoding genes in Arabidopsis. Plant Cell 15, 809-834.

Miao, Y., Laun, T., Zimmermann, P., and Zentgraf, U. (2004). Targets of the WRKY53 transcription factor and its role during leaf senescence in Arabidopsis. Plant Mol Biol 55,853-867.

Murakami, K., and Takagi, T. (1998). Gene reeognition by combination of several gene- finding programs. Bioinformaties 14, 665-675.

Nishimura, N., Kitahata, N., Seki, M., Narusaka, Y., Narusaka, M., Kuromori, T., Asami, T., Shinozaki, K., and Hirayama, T. (2005). Analysis of ABA hypersensitive germination2 revealed the pivotal functions of PARN in stress response in Arabidopsis. Plant J 44, 972-984.

Peng, R., Yao, Q., Xiong, A., Fan, H., Li, X., Peng, Y., Cheng, Z.M., and Li, Y. (2004). A new rice zine-finger protein binds to the 02 S box of the alpha-amylase gene promoter. Lur J Biochem 271, 2949-2955.Raskin, I. (1992). Role of salicylic acid in plants. Annu Rev Plant Physiol Plant Mol Biol 43, 439-463.

153

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Raventos, D., Skriver, K., Schlein, M., Kamahl, K., Rogers, S.W., Rogers, J.C., and Mundy, J. (1998). HRT, a novel zinc finger, transeriptional repressor from barley. J Biol Chem 273, 23313-23320.

Razem, F.A., Luo, M., Liu, J.H., Abrams, S.R., and Hill, R.D. (2004). Purification and characterization of a barley aleurone abscisic acid-binding protein. J Biol Chem 279, 9922-9929.

Robatzek, S., and Somssich, I.L. (2002). Targets of AtWRKYô regulation during plant senescence and pathogen defense. Genes Dev 16, 1139-1149.

Ross, C., and Shen, Q.J. (2006). Computational prediction and experimental verifieation of HVAl-like abscisic acid responsive promoters in rice (Oryza sativd). Plant Mol Biol 62, 233-246.

Rubio-Somoza, I., Martinez, M., Diaz, I., and Carbonero, P. (2006). HvMCBl, a RIMYB transcription factor from barley with antagonistic regulatory functions during seed development and germination. Plant J 45, 17-30.

Sakata, K., Nagamura, Y., Numa, H., Antonio, B.A., Nagasaki, H., Idonuma, A., Watanabe, W., Shimizu, Y., Horiuchi, I., Matsumoto, T., Sasaki, T., and Higo, K. (2002). RiceGAAS: an automated annotation system and database for rice genome sequence. Nucleic Acids Res 30, 98-102.

Tanaka, N., Konishi, H., Khan, M.M., and Komatsu, S. (2004). Proteome analysis of rice tissues by two-dimensional electrophoresis: an approach to the investigation of gibberellin regulated proteins. Mol Genet Genomics 270, 485-496.

Turck, F., Zhou, A., and Somssich, I.L. (2004). Stimulus-dependent, promoter-specific binding of transcription factor WRKY 1 to its native promoter and the defense-related gene PcPRl-1 in Parsley. Plant Cell 16, 2573-2585.

Xu, X., Chen, C., Fan, B., and Chen, Z. (2006). Physical and functional interactions between pathogen-induced Arabidopsis WRKY 18, WRKY40, and WRKY60 transcription factors. Plant Cell 18, 1310-1326.

Xu, Y., and Uberbacher, L.C. (1997). Automated gene identification in large-scale genomic sequences. J Comput Biol 4, 325-338.

Yao, H., Guo, L., Fu, Y., Borsuk, L.A., Wen, T.J., Skibbe, D.S., Cui, X., Scheffler, B.L., Cao, J., Lmrich, S.J., Ashlock, D.A., and Schnable, P.S. (2005). Evaluation of five ab

154

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. initio gene predietion programs for the diseovery of maize genes. Plant Mol Biol 57, 445-460.

Yazaki, J., Shimatani, Z., Hashimoto, A., Nagata, Y., Fujii, F., Kojima, K., Suzuki, K., Taya, T., Tonouchi, M., Nelson, C., Nakagawa, A., Otomo, Y., Murakami, K., Matsubara, K., Kawai, J., Caminei, P., Hayashizaki, Y., and Kikuehi, S. (2004). Transcriptional profiling of genes responsive to abscisie aeid and gibberellin in riee: phenotyping and comparative analysis between rice and Arabidopsis. Physiol Genomics 17, 87-100.

Yazaki, J., Kishimoto, N., Nagata, Y., Ishikawa, M., Fujii, F., Hashimoto, A., Shimbo, K., Shimatani, Z., Kojima, K., Suzuki, K., Yamamoto, M., Honda, S., Endo, A., Yoshida, Y., Sato, Y., Takeuchi, K., Toyoshima, K., Miyamoto, C., Wu, J., Sasaki, T., Sakata, K., Yamamoto, K., Iba, K., Oda, T., Otomo, Y., Murakami, K., Matsubara, K., Kawai, J., Caminei, P., Hayashizaki, Y., and Kikuchi, S. (2003). Genomics approach to abscisic acid- and gibberellin-responsive genes in riee. DNA Res 10, 249-261.

Yeh, R.F., Lim, L.P., and Burge, C.B. (2001). Computational inferenee of homologous gene stmetures in the human genome. Genome Res 11, 803-816.

Yoo, J.H., Park, C.Y., Kim, J.C., Heo, W.D., Cheong, M.S., Park, H.C., Kim, M.C., Moon, B.C., Choi, M.S., Kang, Y.H., Lee, J.H., Kim, H.S., Lee, S.M., Yoon, H.W., Lim, C.O., Yun, D.J., Lee, S.Y., Chung, W.S., and Cho, M.J. (2005). Direet interaction of a divergent CaM isoform and the transcription factor, MYB2, enhances salt tolerance in arabidopsis. J Biol Chem 280, 3697-3706.

Yu, J., Hu, S., Wang, J., Wong, G.K., Li, S., Liu, B., Deng, Y., Dai, L., Zhou, Y., Zhang, X., Cao, M., Liu, J., Sun, J., Tang, J., Chen, Y., Huang, X., Lin, W., Ye, C., Tong, W., Cong, L., Geng, J., Han, Y., Li, L., Li, W., Hu, G., Li, J., Liu, Z., Qi, Q., Li, T., Wang, X., Lu, H., Wu, T., Zhu, M., Ni, P., Han, H., Dong, W., Ren, X., Feng, X., Cui, P., Li, X., Wang, H., Xu, X., Zhai, W., Xu, Z., Zhang, J., He, S., Xu, J., Zhang, K., Zheng, X., Dong, J., Zeng, W., Tao, L., Ye, J., Tan, J., Chen, X., He, J., Liu, D., Tian, W., Tian, C., Xia, H., Bao, Q., Li, G., Gao, H., Cao, T., Zhao, W., Li, P., Chen, W., Zhang, Y., Hu, J., Liu, S., Yang, J., Zhang, G., Xiong, Y., Li, Z., Mao, L., Zhou, C., Zhu, Z., Chen, R., Hao, B., Zheng, W., Chen, S., Guo, W., Tao, M., Zhu, L., Yuan, L., and Yang, H. (2002). A draft sequence of the riee genome {Oryza sativa L. ssp. indica). Seience 296, 79-92.

Yuan, Q., Quaekenbush, J., Sultana, R., Pertea, M., Salzberg, S.L., and Buell, C.R. (2001). Rice bioinformaties. analysis of rice sequence data and leveraging the data to other plant speeies. Plant Physiol 125, 1166-1174.

Zhang, Z.L., Xie, Z., Zou, X., Casaretto, J., Ho, T.H., and Shen, Q.J. (2004). A rice WRKY gene eneodes a transcriptional repressor of the gibberellin signaling pathway in aleurone cells. Plant Physiol 134, 1500-1513.

155

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. APPENDIX I

CHAPTER 1 SUPPLEMENTAL TABLE

156

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. CD ■ D O Q. C g Q.

■D CD

WC/) o' Supplemental Table I-l. The summary of published WRKY genes 3 Gene Accession number Species Induced-by Binding T ar^t Function Reference O ASF], ABF2 S61413,S61414 Avena fatua a-Amy2 [Willmott et al., 1998) AtmSÎ/SLHÏ/A NM_123895 Arabidopsis tkaliana pathogen and SA pathogen defense, sensitivity to low humidity (Deslandes et al., 2002; Noutoshi et al., 2005) tWRKY52 AtWRKYîS AF224698 Arabidopsis ihaliana salicylic acid, pathogen NPRL RLK4 developmentally regulated pathogen defense 'Chen and Chen, 2002) 8 A1WRK722 At4g01250 Arabidopsis thaUana ng22 AtWRKY22, FRKF RD2P GST6 pathogen defense (Asai et al,, 2002) AtWRKY25 ÎSIM_128578 Arabidopsis ihaliana oxidative stress, heat shock, and wounding oxidative stress, interact with MKSl 'Rizhsky et al., 2004; Andreasson et al., 2005) c i' AtWRKY29 At4g23550 Arabidopsis tkaliana flg22 AtJVRKY29, FRKl, RD29, GSTd pathogen defense (Asai et al., 2002) AtWRKY33 NM_129404 Arabidopsis tkaliana pathogen defense, interact with MKSl (Andreasson et al., 2005) AtWRKYAO NM_106732 Arabidopsis tkaliana pathogen and SA pathogen defense (Xu et al., 2006) AtWRKY53. AtWRKY6.AiWRKY62, AiWRKY53 NM_] 18512 Arabidopsis ihaliana leaf senescence (Miao et a l, 2004) CAT!, CAT2, CATS AÎWRKY6 AF224702 Arabidopsis tkaliana pathogen,senescence AtWRKYô, PRl, SIRK pathogen defense (Robatzek and Somssich, 2001, 2002) 3 AtWRKYÔO NM_128058 Arabidopsis tkaliana pathogen and SA pathogen defense (Xu et a l, 2006) 3" AtWRKYJ NM_118557 Arabidopsis tkaliana bind to CaM in the present of C a^ (Park é ta l, 2005) CD AtWRKYJO NM_115498 Arabidopsis tkaliana SA the crosstalk of SA and JA signaling (Li et a l, 2004) ■DCD CaWRKY2 DQ180348 Capsicum annuum pathogen, wounding and ethephon (Oh et a l, 2006) O CaWRKY-a AY391747 Capsicum annuum SA,ethephon and wounding pathogen defense (Park et a l, 2006) Q. GaWRKY! AY507929 Gossypium arboreum sepal, stigma, anther, and developing seeds CADl-A sesquiterpene biosynthesis C a HvWRKY38 AY541586 Hordeum vulgare cold and drought stresses (Mare et a l, 2004) O LÎWRKY2! AY792618 Larrea tridentata ABA inducible HVA22 ABA signaling (Zou et a l, 2004) 3 Lh ■D McWRKYi AB035271 Matricaria ckamomilla geraniol in shoot primordia (Ashida é t a l , 2002) O MINIS/AîWRKY NM_104436 Arabidopsis tkaliana pollen and developing endosperm seed size and growth of the endosperm (Luo et a l, 2005) 10

CD NtWRKYJ, AB022693, Q. MWRKY2, AB020590, Mcotiana tabacum elicitor CHN48 pathogen defense (Yamamoto et a l, 2004) NtWRKYA AB026890 NîWRKYS API 93 770 Nicotiana tabacum pathogen and SA (Chen and Chen, 2000) NtWRKYA AF193771 OsWRKY03 AY676924 Oryza sattva SA, JA and light dependent pathogen defense (Liu é t a l , 2005) ■D OsW RKYli BK005074 Oryza sativa SA, MeJA, ACC, wounding and pathogen pathogen defense (Liuetal.,2006) CD PcWRKYl U48831 Petroseliftum crispum elicitor PcWRKYl, PcWRKY3, PcPRl-l pathogen defense (Turck et a l, 2004) (Pnueli é t a l , 2002) C/) RrWRKY AF439274 Retamaraetam drought C/) ScWRKYl AY366389 Solanum ckacoense fertilized ovules (Lagace and Matlon, 2004) SdSm P -64 AP313452 Solanum dulcamara cold (Huang and Duman, 2002) SPFl D30038 Ipomoea batatas (Tshiguro and Nakamura, 1994) STHP-64 AF313452 Solanum dulcamara cold acclimation ZAP-1 C (Huar^ and Duman, 2002) SU SSA2 AY323206 Hordeum vulgare sugar isol, sbellh sugar signalling (Sun et a l, 2003; Sun et a l, 2005) TTG2/AtWRKY4 trichome development, tannin and mucilage NM_129282 Arabidopsis tkaliana trichomes, seed coat, and roots (Johnson et a l, 2002) 4 production in the seed coat WIZZ BAA870S8 Nicotiana tabacum wounding (Hara et a l, 2000) ZAP! X92976 Arabidopsis tkaliana root and flower (de Pater et a l, 1996) APPENDIX II

CHAPTER 2 SUPPLEMENTAL TABLES AND FIGURES

158

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Suüülemental Table 2-1. Redundancy Information of PredictedO^'ÎTRÂ^T Genes Gene Nam es WRKY Gene Identifier m%" 1st Redundant Sequence m%' 2nd Redundant Sequence ID%* 3rd Redundant Sequence O sW RK YI AC007789_peptide_13 100 AP002865_peptide_l 100 AP003074_peptide_21 99.9 Contig4518_peptide_2 OsW RKY2 AC018727_peptide_10 99.8 Contigl715_peptide_4 O sW RKY4 AC079887_peptide_2 100 AC084282_peptide„3 99,9 Conti g22715_peptide_l OsW RKYS AC093 490_peptide_l 6 99.5 Contig7294_peptide_l O sW RKYô AC093713_peptide_2 96.4 ACl 0432 l_peptide_l 5 99.7 Contig2136_peptide_5 O sW RK Y? AC097112_peptide_28 99,5 C ontig69 7_pepti de_7 O sW RKYS AC134929_peptide_12 100 AC098573_peptide_25 99.4 Contig4948_peptide_5 OsWRKYÇ IBAA96574.1 100 AP002480_peptide_27 98.7 Contig53I0_peptide_l O sW R K Y Il AP002744_peptide_23 100 AP002839_peptide_4 99.4 Contigl 4984_peptide_2 O sW R K Y U AP002744_peptide_5 99.9 Contigl7150_peptide_2 O sW R K Y n AP003076_peptide_36 99.6 Conti g20908_peptide_l O sW R K Y U BAB63527.1 100 AP0Û3142_peptide_25 99.6 Contigl 147 l_peptide_2 O sW R K Y U AP003294_peptide_7 100 AP003212_peptide_36 99,7 Contigl3488_peptide_l O sW R K Y U AP003222_peptide_20 99.6 Contigl206_peptide_3 O sW R K Y I? AP003277_peptide_36 100 AP003298_peptide_9 O sW RKY20 AP003302_peptide_12 100 AP0033 48_peptide_3 99.6 Contig784_peptide_4 OsW RKY21 AP003 302_pe plide_2 5 100 AP003348_peptide_l 6 98.2 Contig53076_peptide_l ÛSW RKY23 AP003 3 09_pe ptide_l 6 100 AP003560_peptide_10 99,5 Contigl 5778_peptide_2 O sW RKY24 AP003315 peptide 25 99.7 Contig8779_peptide_2 O sW RKY27 AP003 492_peptide_31 100 AP003300„peptide_8 OsW RKY28 APÛ03 517_pe ptide_9 99,6 Contig2720_peptide_2 O sW RKY29 AP003 746 peptide_17 100 C ontig23 571 _pe ptide_l O sW RKYS] AP003951_peptide_16 99,6 C ontig23 344_pe ptide_l OsW RKY32 AP004058_peptide_l 6 100 AP004080_peptide_3 99,5 Contigl 8743_peptide_2 OsW RKY34 AP002 485_pe p tide_2 5 98.1 Conti g5706_pep ti de_2 98,6 OSA307662_peptide_6 98,7 AP004175_peptide_25 OsW RKY33 OSJN00012_peptide_20 99.2 Contig23879_peptide_l 98,9 Contig2296_peptide„4 O sW RKYSô OSJN00102_peptide_12 98.5 C ontig774_pepti de_l O sW RKYS? OSJN00129_peptide_32 100 OSIN00129_peptide_22 99.8 Contigl 1265_peptide_l OsW RKY39 Contigl0199_peptide_l 99,8 AP004683_peptide_l 8 O sW RKY4? Contigl67_peptide_4 99,8 AP005099_peptide_24 OsW RKYSS Contig21307_peptide_2 99.1 Conti g21307_peptide_l OsW RKY55 Contigl0909_peptide_2 99,9 A C l 18674_peptide_25 OsW RKYSô AP003240 peptide_14 99.9 C ontigl 621 _pep tide„4 100 Contigl 62 l_peptide_5 O sW RKYS? Contig23837_peptide„32 100 Contig23 837_peptide_l OsW RKYSS Contig26722_peptide_3 98,9 AC 108499_peptide_l 7 OsW RKYôS AC 13 5 644_pe ptide_9 82,2 C ontig3 9 733_pe ptide_ 1 OsW RKYôô Contig4070_peptide_] 99,1 AP004778_peptide_22 O sW RKYô? Contig4910_peplide„l 96.1 C ontig793 8_pep tide_3 O sW RKY68 Contig5554_peptide_4 99,9 OSJNOOl 98_peptide_l 5 OsWRKYôÇ Contig5766_peptide_3 99,8 AP004689_peptide_l 7 OsW RK Y?! Contig7377„peptide_3* 80,4 AP004087_peptide_l 8* 100 Scaffold009127_pe ptide„2 OsW RKY?3 Contig843_peptide_2 99,8 AP003767_peptide_22 OsW RKY?4 Contig866_peptide_3 99,5 AP005128„peptide_l 7 O sW RKY?? BA B6Î842.1 100 AP0033 41 _pep ti de_21 100 Contig780S_peptide_2 100 AP003492_peptide_9 OsW RKY?9 AP002484_peptide_4 100 AP003047_peptide_30 OsWRKYSO A P005392_peptide_l 9 97.3 Contig332_peptide_l

a Percentage of identity between predicted genes which contain exon(s), intron(s) and 100 bp sequences uptream/downstream of start codon/stop codon. * Sequences were manually verified to be redundant with each other if Identity% is lower than 95%.

159

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Supplemental Table 2-2. Summary of Information on OsWRKY Genes DNA AA Name Accession® Len’’ Intron Protein ID® Len’’ BAC/Contig® Chr® cDNA" OsWRKYJvl* BK005004 2434 4 N/A 413 AC007789.1 1 AK105509 OsWRKrJv2* BK005004 3175 6 DAA05066 635 AC0077S9.1 1 NM 188767 ÜSWRKY2 BK005005 976 1 DAA05067 299 AC018727.10 10 N/A OsJFRKYJ BK005006 3406 2 DAA05068 314 AC079887.17 3 AY341859 OsWRKY4 BK005007 3220 3 DAA05069 439 AC079887.17 3 AY341848 OsWRKYS BK005008 5379 5 DAA05070 502 AC093490.2 5 N/A OsWRKYô BK005009 1552 2 DAA05071 380 AC093713.6 3 NM_185053 OsWRKY? BK005010 1020 2 DAA05072 221 AC097112.2 5 N/A OsWRKYSvl BK005011 1757 2 N/A 337 AC134929.1 5 AK109568 OsWRKY8v2 BK005011 3698 6 DAA05073 504 ACl 34929.1 5 AY341857 OsWRKYÇ BK005012 8241 5 DAA05074 594 AP002480.1 1 N/A OsWRKYlO* BK005013 660 0 DAA05075 219 AP002486.1 1 AY341854 OsWRKYU BK005014 2223 2 DAA05076 379 AP002744.2 1 AY341856 OsWRKYI2* BK005015 1596 2 DAA05077 348 AP002744.2 1 AK111416 OsW RKYB BK005016 1195 2 DAA05078 316 AP003076.3 1 AK 067329 OsWRKY14 BK005017 1093 1 DAA05079 319 AP003142.2 1 AK109770 OsWRKYlS BK005018 1198 3 DAA05080 314 AP003294.2 1 N/A OsWRKYlô BK005019 4090 , 4 DAA05081 565 AP003222.3 1 AY341844 OsWRKYI? BK005Û20 1805 2 DAA05082 406 AP003277.2 1 AY341842 OsWRKYlS BK005021 7394 2 DAA05083 276 AC099774.6 10 N/A OsWRKYIÇ* BK005022 1047 2 DAA05084 277 AC104284.1 5 AKl 08389 OsWRKY20 BK005023 2233 2 DAA05085 375 AP003302.2 1 N/A OsWRKY21 BK005024 1057 1 DAA05086 280 AP003302.2 1 AK108657 OsWRKY22 BK005025 3980 2 DAA05087 265 AP003302.2 1 N/A OsWRKY23 BK005Û26 3393 1 DAA05088 254 AP003309.3 1 AY341845 OsWRKY24 BK005027 2175 4 DAA05089 555 AP003315.1 1 AK107199 OsWRKY25 BK005028 1902 1 DAA05090 337 AP004648.3 8 N/A OsWRKY26* BK005029 1688 2 DAA05091 245 AP003408.3 1 AK108555 OsWRKY2? BK005030 2308 2 DAA05092 310 AP003492.2 1 N/A OsWRKY28* BK005031 1202 2 DAA05093 337 AP003517.1 6 AKl 06282 OsWRKY29 BK005032 3368 2 DAA05094 288 AP003746.2 7 AY341858 OsWRKYlO* BK005033 2749 4 DAA05095 674 AP003873.2 8 AK 065518 OsWRKYU BK005034 1161 1 DAA05096 346 AP003951.1 6 N/A OsWRKY32 BK005035 6048 5 DAA05097 604 AP004058.1 2 N/A OsW RKYU* BK005036 727 2 DAA05098 168 AC090056.2 9 N/A OsWRKY34* BK005037 3277 3 DAA05099 212 AP002485.1 2 AK072906 OsW RKYlSvl BK005038 3290 4 DAA05100 777 AL606441.3 4 AY341851 OsWRKY35v2 BK005038 3290 4 N/A 759 AL606441.3 4 AY341843 OsWRKY36 BK005039 6261 3 DAA05101 246 AL606728.3 4 AK073695 OsWRKYS?* BK005040 3091 3 DAA05102 406 AL607004.3 4 AKl 10912 OsWRKYlS BK005041 590 2 DAA05103 134 AAAAOIOIISI?.! 9 N/A OsWRKYlÇvJ BK005042 474 0 N/A 157 AAAA0100?990.1 2 AKl 19593 OsWRKY39v2 BK005042 1303 2 DAA05104 361 AAAA0100?990.1 2 AK066775 OsWRKY40 BK005043 4222 3 DAA05105 272 AAAAOl 004459.1 N/AN/A OsWRKY41* BK005044 6789 8 DAA05106 1132 AAAAOl 006099.1 N/AN/A OsWRKY42 BK005045 946 2 DAA05107 253 AAAAOl 001114.1 2 AKl 10587 OsWRKY43* BK005046 2463 5 DAA05108 618 AAAAOl 004053.1 5 N/A OsWRKY44* BK005047 918 0 DAA05109 305 AAAAOl 014145.1 N/A N/A OsWRKY45* BK005048 1161 2 DAA05110 322 AAAAOl 015643.1 5 AK066255 OsWRKY46 BK005049 3349 2 DAA05111 224 AC123514.2, BX000500.4 11, 12 AK073243 OsWRKY4? BK005050 1927 2 DAA05112 334 AAAAOl 00112&1 7 AKl 10900

160

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Supplemental Table 2-2. (continued) DNA AA Name Accession* Len” Intron Protein ID* Len” BAC/Contig* Chr® cDNA" OsWRKY48 BK005051 1077 1 DAA05113 331 AAAAOl 01Ô9S1.1 N/A N/A OsWRKY49 BK005052 2920 2 DAA05114 418 AAAA01007SS1.1 5 N/A OsWRKYSO BK005053 2152 2 DAA05115 278 AAAA0101Ô997.1 N/A N/A OsWRKYSl BK005054 1141 2 DAA05116 330 AAAA01014S1S.1 N/A AK100954 OsWRKY52 BK005055 1735 2 DAA05117 175 AAAAOl OOô S 59.1 N/A N/A OsWRKYSl BK005056 1871 4 DAA05118 487 AAAAOl 005 720.1 N/A AK121190 OsWRKYS4 BK005057 1106 1 DAA05119 328 AAAA01004784.1 N/A N/A OsWRKYSS* BK005058 1043 2 DAA05120 210 AAAA01012194.1 N/A AKl 01653 OsWRKYSô* BK005059 981 2 DAA05121 211 AP003240.2 1 N M J 90559 OsWRKYS 7 y 1 * BK005060 720 0 N/A 239 AAAA01020189.1 12 AK061799 OsWRKYS7v2* BK005060 2948 2 DAA05122 456 AAAA01020189.1 12 AY341860 OsWRKYSS BK005061 856 1 DAA05123 180 AAAA0102207S.1 5 N/A OsWRKYS9 BK005062 1422 2 DAA05124 234 AAAA01002711.1 1 N/A OsWRKYôO BK005063 518 1 DAA05125 142 AAAA01001Ô9Ô.1 N/A N/A OsWRKYôJ BK005064 986 2 DAA05126 238 AAAAOl 02Ô 198.1 N/A N/A OsWRKYô2* BK005065 1713 3 DAA05127 318 AAAA0100Ô9Ô1.1 9 AK067834 OsWRKYôl BK005 066 6659 4 DAA05128 399 AC135644.2 11 N/A OsWRKY64 BK005067 1239 2 DAA05129 321 AAAA010067Ô7.1 N/A N/A OsWRKYôS BK005068 2229 2 DAA05130 341 AAAA0100Ô7Ô7.1 N/A N/A OsWRKYôô* BK005069 4057 2 DAA05131 511 AAAA0100Ô94Ô.1 2 AK073100 OsWRKYô? BK005070 1112 2 DAA05132 194 AAAAOlOOlOlO.l N/A AK066252 OsWRKYôS BK005071 1132 2 DAA05133 309 AAAA01004959.1 4 AK061266 OsWRKYô9 BK005072 1054 1 DAA05134 319 AAAA0100S55S.1 8 AKl 11606 OsWRKY70 BK005073 2422 3 DAA05135 572 AAAA010003S7.1 N/A AKl 19867 OsWRKY?] BK005074 1393 3 DAA05136 348 AAAA01009127.1 2 AY541677 OsWRKY?2 BK005075 3001 1 DAA05137 245 AAAAOlOlOlôS.l 11 AKl 08860 OsWRKY? 1 BK005076 3115 2 DAA05138 527 AAAA010012Ô1.1 6 N/A OsWRKY?4 BK005077 1624 2 DAA05139 361 AAAA010011Ô2.1 9 AK065265 OsWRKY?S BK005078 4697 2 DAA05140 428 AAAAOl000815.1 5 N/A OsWRKY?ô BK005079 1087 1 DAA05141 327 AAAAOlOlOSôl.l 9 AK059966 OsWRKY?? BK005080 945 2 DAA05142 246 AP003341.4 1 AY341846 OsWRKY78 BK005212 5003 5 N/A 618 AP003747.4 7 AY341850 OsWRKY?9* BK005213 8893 2 N/A 271 AP002484.1 1 AKl 08755 OsWRKYSO BK005214 2649 4 N/A 623 AP005392.1 9 AKl 03745 OsWRKYS] BK005215 2705 3 N/A 201 AC135644.2 11 N/A

*. These genes contain annotation errors; corrected sequences have been submitted to GenBank®. a. GenBank® accession numbers for genomic DNA sequences, peptide sequences, primary BAC/contig sequences. BAG sequences obtained from the International Rice Genome Sequencing Project (IRGSP, http://rgp.dna.affrc.go.jp/IRGSP/) are in regular font; contig sequences obtained from Beijing Genomics Institute (BGI, http://btn.genomics.org.cn/rice) are italicized. b. The length of CRS and deduced peptide sequences. c. Chromosomal localization of OsWRKY genes. See Supplemental Table 5 for detailed Information. N/A, not available. d. Significantly matched FL-cDNA sequences of OsWRKY genes. See Supplemental Table 4 for detailed information.

161

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Annotation Error Name Correction' OsWRKYl2,OsWRKY19, Incorrect intron/exon mRNA splice boundaries OsWRKY55,

Incorrect number of OsWRKY37, OsWRKY57, mRNA exons OsWRKY79

OsWRKY41, OsWRKY43, FGENESH OsWRKY44 Wrong start/stop OsWRKYI, OsWRKYlO, codon OsWRKY26, OsWRKY28, OsWRKY30, OsWRKY33, mRNA OsWRKY34, OsWRKY45, OsWRKY56, OsWRKY62, OsWRKY66

a. mRNA, genes have been manually corrected by referring to the mRNA sequences; FGENESH, genes have been re-annotated using the FGENESH software (http://www.softberry.com/).

162

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. a@ gagagag

& & ^2^2: '2#22#2:

*,( : : I I I I : : I I I I : : : I : I I : : I I I : 1 ( I I I ; : T I I I : : I ( I I I I I ; 1 1

_Tx5??RSeR5:8E%?R3?p?a?KS?R?P»S??^%RBR;§579s^3 . X , ^ ( I 1^1 I I : 1*1 I 4 I R I r . I 14*41 ' I 4 4 p . I I I I I I 121 I 4 * — — -a- ^ vjS N5 v% <>«> v% — rî 35 — V© ^ ^ '© în Tt Vi H «a- -i?»- f ' t- ‘f NS '© Vh ^

j î nm: m m itnBîiriînuiU îm riiuîîiîîm U î , i n iî5 5S85SÎJSs855=5i55sS5âSa5=SaESîESës55=*ESâ3=

: u u : M û M 0nm!;uu;O:imuHH!niUj «?yiâ5sl'5ï«55ïS«lslS5lis55li^siS5NS53ï5Éi i'i p % i? =

T#5# = 3 = gM:gTTS#«M g%g = = SRg#§H5: = 5?^& = S = S^s^S lîïl

'§- _ R* R S - § a ^ I % % ', T : S ë I B * m k s : 4 @ a P i @ a 5 @':Q?»@S 7 ^ ? @ A ^ % 3 ' i ' § i \ À $2 . ' Igi 15 à n' '!;;' ' I:'B|' I 11=1 I I 'M191 I ...... 1 1 1 - I-. r« 8£5 J- m r~ r- o~ ■■£! 'i l .£} -o f~ « O •* '-Jü s* -i£j ■«? <* ><3 \û T- Sû I' I- <6 \Ù r~^ '■£, t- ^ yü r -

8|îiïifîlî«êilîîîllM I{*»îis«iiî«8îliii£{iïHî

î|e8r!i!IEi!S5§îîii-}îa.8i!!iilsg!ïsâsi§»iîlS5? 3#ggS53g;g;ssgg§§gsgg3sgRG#gg#s§#s=3S^g§e§33^a§

< rj

)Q gÿ % RM R » F: S # o •;• o g c ^ -r^ ^ «■ «■ ÿ 0 ^ a s

il ...... aaaaaaaaaaaaaaaaagaaaaaaaaaaaggaaaaaaaaaaaôaaaa

163

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. g. a a ffi a a a a g a f i S a îS {£ aggi 1 3 3 1 o o o 1 o o i îi i S !ê â 6 & B 1 1 1 1 1 a 31 a a

a 5 1 k g g3 g R %»- 8 ^ 8 2 # § S § s § 11111111111:11:i I os 4 J. 4 ^ >S f:? T ^ ^ a 5 a •O tri r-* R s 2 5 2 k s X 6 n £ Si

g £8 2 9 S 5S2a%%'^'S3PS!P^ I I I g I I I I I ^ 4 2 4 4 "",: g 4 ri à 4 #g g •«iî / i«f / R % »%e 1 &R %S S g

t- SC; vj -=1 ^ *n ^ *0 •■; *n * '"l *' ; "-, n =: "<2 •"; <% n n '

% Vi — P" S> @» "9- f! ^ @»**gggggggggg ÿgPRKRRPgR p = =

'O ' :l @ m gg§p5%;3R% ARAmk*@R«WRe%

*- p", Os C? G*, w-, 0\ so ■<«? |N5 I8%gpa8«338 S§3Ê%gggg##ss I « % R 'Æl- r—O'ïÔw: êf'-JOC'’"'.s «4C s— 2 ‘'Ô'^Ô^'—Sûr-OOt-.r- — I— • ^ ^ ^ ^ ^ ^ ^ 3«W ^T- 0 0 ^2

ncéààcàoé" I g g H g g g *4 N -Tf «ê N

S S B ■sû O b. '<5 Os ?r-3gg#L=3#3g: : ; : : I I : s6 a — .- '— aC- sO m siji> ,54i^sô r»S: Cs : s£i : 4 cO »-< ! 4I" y 5 5-S3sa»r93!$i33p % g 9 S-! w ü R 3 !5 a "

^ % * r * g § % c> % S rv « — -o Tf o, I I % j 'i' : 2 %" %3222&iR;L#r! 4 ; i : : I 6 I .? S sô I % g \0 <1 -o 'O ’>0 ‘■O 'C

iiîî

«! f g * àô1a 1gpy1in1« «"i ^ % ^ ^ 1" S:SSs R R g. & R -<1 v^ so -• » O •

B 3 § Vj9 2»-• % rf g:! *'- 0Oi R«Mg|g

g 3 9 % 0 3 % s« «8 & 2 g = = 352 = = asn:*aa2"i5 # 3= =*2:«as%*X g a k % $= = 32n«3:sax22 = û: p u g Ûl < XX < Z X XX<

s 8 s

~~'^%$sa@3%%S@3PPRRP >■ '^ >*>>> '^ 1^ >> >*>>>. >* K R P R & 5 _ e>ïs.is.S5.^üè^;è:èî^5^ïà:î4^îS:^^^!âtïï”^^_____ ôôôôôôôôB6Ôê6ëB''~‘ ô ô ô aaaaaagaaa~~

~~164~~

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Supplemental Table 2-5. Chromosomal Localizations of O sW RKYGenes Name BAC/Contig' Chr*’ BLAST Result' OsW RKYI AC007789 1 ÛSWRKY2 AGO 18727 10 O sW RKYi AC079887 3 OsWRKY4 AC079887 3 OsWRKY5 AC093490 5 OsWRKYô AC093713 3 OsWRKY? AC097112 5 OsWRKYS AC134929 ' 5 OsWRKYÇ AP002480 1 OsWRKYlO AP002486 1 O sW R K Yll AP002744 1 OsWRKYI 2 AP002744 1 OsWRKYIS AP003076 1 O sW R K YN AP003142 1 OsWRKYIS AP003294 1 OsW RKYIS AP003222 1 OsW RKYI? AP003277 1 OsW RKYIS AC099774 10 OsWRKYlO AC104284 OsWRKY20 AP003302 1 OsWRKY2I AP003302 1 OsWRKY22 AP003302 1 OsWRKY23 AP003309 1 OsWRKY24 AP003315 1 OsWRKY25 AP004648 OsWRKY26 AP003408 1 OsWRKY27 AP003492 1 OsW RKYIS AP003517 6 OsWRKY29 AP003746 7 OsWRKYSO AP003873 8 OsWRKY3I AP003951 6 OsWRKY32 AP004058 2 OsWRKY33 AC090056 9 OsWRKY34 A f 002485 2 OsWRKY35 AL606441 4 OsWRKY36 AL606728 4 AL607004 4 OsWRKY38 ContigI0I96 9 AC090056 Oryza saliva chromosome 9 clone PAC0663H05, complete se... 1.173e+04 OsWRKY39 ContigI0I99 2 AP004683 Oryza sativa (japonica cultivar-group) chromosome 2 do... 1.249e+04 OsWRKY40 ContigI0270 N/A dbjjAP003867.1| Oryza sativa (japonica cultivar-group) chro... 4611 OsWRKY4I ContigI03IS N/A gb|AQ689869.1jAQ689869 nbxb0080B22fCUGl Rice BAG Library 0... 858 OsWRKY42 ContigI3I 2 dbj|AP005514.2| Oryza sativa (japonica cultivar-group) geno... 2.813e+04 OsWRKY43 ContigI33 7 5 gb|AC120986.1| Oryza sativa (japonica cultivar-group) chrom... 9033 OsWRKY44 ContigI36I0 N/A emb|AL732354.1|OSlG00048 Oryza sativa (indica cultivar-grou... 1519 OsWRKY45 ContigIS97I 5 gb|AC136227.1| Oryza sativa (japonica cultivar-group) chrom... 7574 AC123514, 11, OsWRKY46 BX000500 12 OsWRKY47 ContigI67 7 AP005099 Oryza sativa (japonica crrltivar-group) chromosome 7 d o... 2.995e-t04 QftKRAiyyg ContigISI62 N/A dbj|AP005446.1| Oryza sativa (japonica cultivar-group) chro... 810 ContigI S6 70 5 gb|AC120986.1| Oryza sativa (japonica crrltivar-group) chrom... 7247 GktKRAlKO ContigI9520 N/A emb|AL732351.1|OSlG00052 Oryza sativa (indica cultivar-grou... 531 e-148 OsWRKYS I Contig20249 N/A gb|AC084406.7|AC084406 Oryza sativa chromosome 3 BAG OSJNBa... 825 OsWRKYS2 ContigI I OSS N/A gb|AC090484.4| Genomic sequence for Oryza sativa, Nipponbar... 717 OsWRKYS 3 Contig2I307 N/A gb|AC137748.1| Oryza sativa (japonica cultivar-group) chrom... 698

~~165~~

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Supplemental Table 2-5. (continued) OsWRKY54 Contig2234 N/A gb|AC090441.3| Oryza sativa chromosome 10 clone OSJNBb0052C... 3432 OsWRKYS 5 Contigl0909 N/A gb|ACl 19748.1] Genomic sequence for Oryza sativa, Nipponbar... 3588 OsWRKYSS AP003240 1 OsWRKYS? 12 emb|BX000503.2|CNS08CDT Oryza sativa chromosome 12,. BAC 0... 7891 OsWRKYSS Contig26722 5 gb|AC 108499.1] Oryza sativa (japonica cultivar-group) chrom 5... 6174 OsWRKYS9 Contig3128 1 AP003408 Oryza sativa (japonica cultivar-group) genomic DNA, chr... 7113 OsWRKYSO ContigSSSS N/A dbj|AP003706.3| Oryza sativa (japonica cultivar-group) geno... 2411 OsWRKYSl Contig34696 N/A dbj|AP003294.2| Oryza sativa (japonica cultivar-group) geno... 66 le-08 OsWRKY62 ContigS946 9 dbj|AP005417.1] Oryza saliva (japonica cultivar-group) chro... 2.489e+04 OsWRKY63 AC135644 11 OsWRKY64 Contig4010 N/A dbj]AP003381.3| Oryza sativa (japonica cultivar-group) geno... 2790 OsWRKYSS Contig4010 N/A dbj]AP003381.3| Oryza sativa (japonica cultivar-group) geno... 2790 AP004778 Oryza sativa (japonica cultivar-group) chromosome 2 do... OsWRKY66 Contig4070 2 1.750e+04 OsWRKYS? Contig4910 N/A dbj]AP006460.3| Oryza sativa (japonica cultivar-group) geno... 1104 OSJN00198 Oryza sativa chromosome 4 clone OSJNBb0015N08, *** SEQ... OsWRKYSS ContigSSS4 4 1.260e+04 OsWRKY69 ContigS766 8 AP004689 Oryza sativa (japonica cultivar-group) chromosome 8 do... 9256 OsWRKY70 ContigS4?l N/A gb|AC087797.5| Oiyza sativa chromosome 3 BAC OSJNBb0022E02 ... 3503 OsWRKY7J Contig?37? 2 AP004087 Oryza sativa (japonica cultivar-group) chromosome 2 do... 4847 Contig?91S 11 gb|AC136787.3| Oryza sativa (japonica cultivar-group) chrom... 4022 AP003767 Oryza sativa (japonica cultivar-group) chromosome 6 do... OsWRKY73 ContigS43 6 1.800e+04 ContigSSS 9 AP005128 Oryza sativa (japonica cultivar-group) chromosome 9 do... 9934 OsWRKY7S ContigSS3S 5 gb|AC136227.1| Oryza sativa (japonica cultivar-group) chrom... 1.731e+04 OsWRKY7S ContigSS44 9 dbj]AP005417.1| Oryza sativa (japonica cultivar-group) chro... 8018 OsWRKY?? AP003341 1 AP003747 7 OsWRKY79 AP002484 1 OsWRKYSO AP005392 9 AC135644 11 a. Primary BAC or contig ID. BAC sequences obtained from the International Rice Genome Sequencing Project (IRGSP, http://rgp.dna.affrc.go.ip/IR G SP/) are in regular font; contig sequences obtained from Beijing Genomics Institute (BGI, h ttp://b tn .gen om ics.org.cn /rice) are italic. b. Chromosomal locations o f O s W E K Y N/A, not available. c. The chromosomal information for OsWRKY genes identified in the japonica gemone were determined based on BAC information obtained from NCBI (htq)://www.ncbi.nlm.nih.gov). To determine chromosomal information for genes identified in the indica genome, the corresponding contig sequences were used for BALST search against the japonica sequences. The accession number and description, followed by the bit score of the best hit in each BLAST results were listed in order. If a bit score o f a BLAST search result was higher than 7000, that indica sequence was considered to be overlapped wifii the japonica BAC sequence. Those with a bit score from 4000 to 7000 were manually checked to determine whether fiiey are overlapped. The chromosomal locations o f these genes were obtained from the overlappedjaponica BAC information.

~~166~~

~~Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Supplemental Table 2-6. Primers for the Preparation o f Gene Specific Probes~~

~~For Gene 5' Primer 3' Primer Size o f Probe~~

~~OsWRKY24 ACGCCAGGGGCTCGTACATGAG GCTGTGTATCCTACAGGAGTACATCC 341 bp~~

~~OsWRKY45 CATCACCAGCTGAGCTGCGAG GTGACCTCGCTCTGCACCTC 333 bp~~

~~Os WRKY5I TGGCTTAGCCAGCAGCAGCAGGTGGAC AAGCTAAGCTTGGAGCAGTGGCAGCGGC 510 bp~~

~~OsWRKY?I AGAACAGCGACGGCTCCGGCAAG GATCGATCGAACTCCGCCATGG 420 bp~~

~~OsWRKY?2 CCAACGACAACTTCGAGCACATCC CTAGCTAGTTTTCTCTTACACTGCACC 320 bp~~

~~OsWRKY?? CACCTCAGGCCGCAGCTGC CGACCTACTATATATCGATGGGCCG 300 bp~~

~~RAmylA GGGAGAAAATCTGAGCGCACG GGATCAGGGACATACATTTGTATGG 188 bp~~

~~RAB21 GCACTGAGCTCGACACACC CAGTACGGACCGTGTCTGCGTG 176 bp~~

~~OsActinl GACTCTGGTGATGGTGTCAGCCACAC CTGCTGGAATGTGCTGAGAGATGCCAAG 603 bp~~

~~167~~

~~Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Supplemental Table 2-7. Primers for the Preparation o f Effector Constructs~~

~~Restriction~~

~~Construct Name 5' Primer 3' Primer Enzyme~~

~~ACCGGATCCGATGACAACCCGGGATCCAGTCAGTAGAGCG UBI-OsWRKY24 BamHI TCGTCG AGTTCTG~~

~~TAATGGCGCGCCAGGATGATAAGGCGCGCCTCAAAAGCTC UBI-OsWRKY45 Ascl CGTCATCGATGTCGAAACCCATAATGTCG~~

~~TTGGCGCGCCOATGATTACC TTGGCGCGCCGACAAGCTAAA UBI-OsWRKYSI Ascl ATGGATCTG TTCTCACTC~~

~~TTGGCGCGCCATGGATCCGATAGGCGCGCCTCAATCCTTG UBI-OsWRKY7I Ascl TGGATTAGCGTCGGCGAG~~

~~ATAGGCGCGCCATGGAGAATTAGGCGCGCCCTACTGGAAC UBl-OsWRKY72 Ascl CTTCCCGATA ATGTGGGA~~

~~AATTGGCGCGCCATGTCGT TTAAGGCGCGCCTCAAGGAA UBI-OsWRKY77 Ascl CGCTGTACCCGTCGCAGCAGCGAGGTG~~

~~168~~

~~Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 1 WRKY 1 Zinc finger NLS 1 HARF I LXXLL I Lx SUMO S LZ I HIF~~

~~OsWRKYI V1~~

~~OsWRKYI V2~~

~~0SWRKY2~~

~~0SWRKY3 0SWRKY4 i l OsWRKYS~~

~~OsWRKYG~~

~~OsWRKY?~~

~~OsWRKYBvl~~

~~OsWRKY8v2~~

~~OsWRKYS i “ i i n i'i iiJiiiliiJiliiiiiiii ' OsWRKYI 0 i ffl~~

~~OsWRKY11 1 I I~~

~~OsWRKYI 2 1 1~~

~~OsWRKYI 3 II~~

~~OsWRKYI 4 II~~

~~OsWRKYI 5 II OsWRKYI 6~~

~~OsWRKYI 7 I I 1 OsWRKYI 8~~

Supplemental Figure 2-1. Conserved motifs in OsWRKY peptide sequences. WRKY (red), WRKY motif; Zinc finger (pink), zinc linger motif; NLS (orange), nuclear localization signal; HARF (blue), the conserved motif only found in a subgroup of WRKY proteins; LXXLL (green), co-activator motif; Lx (black), active repressor motif with the LXLXLX consensus sequences; SUMO (cyan), sumoylation motif; LZ (yellow), leucine-zipper motif; HIF (purple), hydroxylation motif.

~~169~~

~~Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. OsWRKYI 9~~

~~OSWRKY20~~

~~0SWRKY21~~

~~0SWRKY22~~

~~0SWRKY23~~

~~0SWRKY24~~

~~0SWRKY25~~

~~0SWRKY26~~

~~0SWRKY27 11 0SWRKY28 I~~

~~0SWRKY29~~

~~OSWRKY30~~

~~0SWRKY31~~

~~0SWRKY32~~

~~0SWRKY33~~

~~0SWRKY34~~

~~OsWRKY35v1~~

~~OsWRKY35v2~~

~~0SWRKY36~~

~~0SWRKY37~~

~~Supplemental Figure 2-1. (continued)~~

~~170~~

~~Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 0SWRKY38~~

~~0SWRKY39 OSWRKY40 I ' 0SWRKY41~~

~~0SW R K Y 42~~

~~0SWRKY43 i 0~~

~~OSVVRKY44 [ ' y~~

~~0SWRKY45 I I 0~~

~~0SW R K Y 46~~

~~0SW R K Y 47~~

~~0SWRKY48 I : 0~~

~~0SW R K Y 49~~

~~OsWRKYSO~~

~~0SWRKY51 I ! I~~

~~0SWRKYS2~~

~~0SW R K Y 53~~

~~0SW RK Y54~~

~~OsWRKYSS j [[~~

~~OsWRKYSS~~

~~0SWRKY57YI I Supplemental Figure 2-1. (continued)~~

~~171~~

~~Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. OsWRKY57v2~~

~~OsWRKYSS~~

~~OsWRKYGO~~

~~OsWRKYGI~~

~~0SWRKYG2~~

~~0SWRKY63~~

~~0SWRKYG4~~

~~OsWRKYGS~~

~~OsWRKYGG~~

~~0SWRKY67~~

~~OsWRKYGS~~

~~OsWRKYGS ^~~

~~OSWRKY70~~

~~0SWRKY71 I~~

~~0SWRKY72~~

~~0SWRKY73 I~~

~~0SWRKY74 I H~~

~~0SWRKY7S~~

~~0SWRKY7G~~

~~0SWRKY77 I 0~~

~~0SWRKY78~~

~~0SWRKY7S~~

~~OsWRKYSO I~~

~~0SWRKY81 } I I~~

~~Supplemental Figure 2-1. (continued)~~

~~172~~

~~Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. APPENDIX III~~

~~CHAPTER 3 SUPPLEMENTAL FIGURE~~

~~173~~

~~Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. L Ca H M w Zn~~

B T a W R K ï S l E A A A A G L R G m L H L 1 L U l I a ggsg PVG#SE ------AP# 6 0 H v W R K ï S l 1 ASWRKY3 raCTGlfflsJ LACgSEPAA 7 0 O s W R K Y S l «« B @Bg PAEfPAQE- 6 3 Z n i W R K Y S l 1 A t H R K Y l l -gAigR-F PKigcgiB KsBNs: ------Fgm gg 4 7 CaMBD HARF —ASS

~~—ASS O s W R K Y S l~~

~~gHglgSAAS QKLQSQIVKN TQEfAPlHf TTNHPQIVPP~~

~~^ - g c ^ g ------g g g -BBMIMMBIffia BWBSiiBiAffi ÏÜ Ë:Ü 11- :S Hi ÜÜ iü PSS\@|gS@ PSIFGTKAKS #LE|gKENF SV SL I^^ S A ljB Œ ESlPI® A^LCgvpfs~~

~~A t W R K Y l l T a W P K Y S l iPffinnPGYYKCS'. P.GYYKCS7 PGYYKCST PGYYKCST m —AGQDHP PGYYKCST |iGQDPgpp| PGYYKCST SA—t^ENli~~

TaWRKYSl 307 3 1 3 HvWRKïSl 99 1 0 5 ASWRKY3 312 IH K L — 3 2 1 OsWRKYSl 319 Ia L P l a 3 3 0 ZnMBKYSl 129 jPSH — 138 AtWRKYll 313 S jvFA S A 3 2 4 Supplemental Figure 3-1. OsWRKYSl gene structure and its homologues in other plant species. (A) The schematic diagram of OsWRKYSl gene structure. Rectangles denote exons and lines designate introns. Labeled rectangles represent the conserved motifs: L, putative repression motif (LXLXLX); Ca, calmodulin binding domain; H, HARF motif; W, WRKY motif; Zn, zinc finger motif. Rectangles in shade represent the nucleus localization signal (NLS) that spans the first intron. (B) Alignment of deduced amino acid sequences of the OsWRKYSl (330 amino acid residues) and its homologs in other plant species. The mRNA sequences of OsWRKYSl (accession number BK005053), AsWRKYS (AF140553), TaWRKYSl (BT009449) and AtW RKYll (AAK96194) contain entire open reading frames; the mRNA sequences of HvWRKYSl (AJ475819) and ZmWRKYSl (BG267149) are short in the 5’ end. The conserved putative repression domain, calmodulin binding domain, HARF, NLS, and WRKY domain are shown in the indicated boxes. Open arrows point to the conserved Cys/His residues of the zinc finger motif.

~~174~~

~~Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. APPENDIX IV~~

~~CHAPTER 5 SUPPLEMENTAL TABLES~~

~~175~~

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Supplemental Table 5-1. The summary o f rice transcription factor (TF) families TF family name Pfam acc* TF family description Number o f TFs zf-CCHC PF00098 Zinc knuckle 408 PHD PF00628 PHD-finger 349 AT_hook PF02178 AT hook motif 237 AP2-domam PF00847 AP2 domain 213 myb_DNA-binding PF00249 Myb-like DNA-binding domain 213 HLH PFOOOlO Helix-loop-helix DNA-binding domain 136 bZlP PF00170 bZlP transcription factor 135 KE2 PF01920 KE2 family protein 104 zf-C2H2 PF00096 Zinc finger, C2H2 type 103 bZlP_Maf PF03131 bZlP Maf transcription factor 100 GATA PF00320 GATA zinc finger 94 Histone-like transcription factor (CBF/NF-Y) and CBFD_NFYB_HMF PF00808 88 archaeal histone BTB PF00651 BTB/POZ domain 87 BTAD PF03704 Bacterial transcriptional activator domain 83 WRKY PF03106 WRKY DNA -binding domain 81 TF_Otx PF03529 Otxl transcription factor 80 SRF-type transcription factor (DNA-binding and SRF-TF PF00319 77 dimérisation domain) HALZ PF02183 Homeobox associated leucine zipper 75 GRAS PF03514 GRAS family transcription factor 63 HRDC PF00570 HRDC domain 61 HABP4_PA1-RBP1 PF04774 Hyaluronan / mRNA binding family 60 homeobox PF00046 Homeobox domain 59 HD-Z1P_N PF04618 HD-ZIP protein N terminus 57 B3 PF02362 B3 DNA binding domain 51 zf-B_box PF00643 B-box zinc finger 50

~~REV PF00424 REV protein (anti-repression trans-activator protein) 48~~

~~zf-CGCH PF00642 Zinc finger C-x8-C-x5-C-x3-H type (and similar) 43~~

~~zf-MYND PF01753 MYND finger 43~~

~~GATA-N PF05349 GATA-type transcription activator, N-terminal 37~~

K-box PF01486 K-box region 36 TSC22 PF01166 TSC-22/dip/bun family 35 DUF296 PF03479 Domain o f unknown function (DUF296) 34 TFIIS PF01096 Transcription factor S-11 (TFllS) 33 X PF00739 Trans-activation protein X 33 HHH PF00633 Helix-hairpin-helix motif 32 IBB PF01749 Importin beta binding domain 32 DM-domain PF00751 DM DNA binding domain 31 TCP PF03634 TCP family transcription factor 31 AUX_IAA PF02309 AUX/IAA family 29 HSF_DNA-bind PF00447 HSF-type DNA-binding 29 SBP PF03110 SBP domain 29 zf-Dof PF02701 D of domain, zinc finger 28 transcript_fac2 PF00382 Transcription factor TFllB repeat 27 ANTAR PF03861 ANTAR domain 26 CaudaLact PF04731 Caudal like protein activation region 25

~~176~~

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Supplemental Table 5-1. (Continued) TF family name Pfam acc* TF family description Number of TFs Hox9_act PF04617 Hox9 activation region 25 trans_reg^C PF00486 Transcriptional regulatory protein, C terminal 25 DUF185 PF02636 Uncharacterized ACR, COG 1565 24 KOW PF00467 KOW motif 24 sigma70_r2 PF04542 Sigma-70 region 2 24 zf-A20 PF01754 A20-like zinc finger 24 Whib PF02467 Transcription factor WhiB 23 CAFl PF04857 CAFl family ribonuclease 21 CITED PF04487 CITED 21 Adeno_ElA PF02703 Early El A protein 20 zf-BED PF02892 BED zinc finger 20 zf-C4 PF00105 Zinc finger, C4 type (two domains) 20 CENP-B_N PF04218 CENP-B N-terminal DNA-binding domain 19 N-terminal HTH domain o f molybdenum-binding HTH_9 PF02573 19 protein mTERF PF02536 mTERF 18 Bac_DNA_binding PF00216 Bacterial DNA-binding protein 16 NusB PF01029 NusB family 16 PspC PF04024 PspC domain 16 ZF-HD_dimer PF04770 ZF-HD protein dimérisation region 16 CSD PF00313 'Cold-shock' DNA-binding domain 15 HTH_psq PF05225 helix-tum-helix, Psq domain 15 DGPF PF04946 DGPF domain 14 E1N3 PF04873 Ethylene insensitive 3 14 Myc-LZ PF02344 Myc leucine zipper domain 14 RFXl_trans_act PF04589 RFXl transcription activation region 14 Rrf2 PF02082 Transcriptional regulator 14

~~tetR_C PF02909 Tetracyclin repressor, C-tenninal all-alpha domain 14~~

~~HMG__box PF00505 HMG (high mobility group) box 13 sigma 54_DBD PF04552 Sigma-54, DNA binding domain 13 zf-XS PF03470 XS zinc finger domain 13 Mov34 PF01398 Mov34/MPN/PAD-l family 12~~

~~TAP PF02969 TATA box binding protein associated factor (TAF) 12~~

Tat PF00539 Transactivating regulatory protein (Tat) 12 dsDNA_bind PF01984 Double-stranded DNA-binding domain 11 Prokaryotic transcription elongation factor, GreA_GreB_N PF03449 11 GreA/GreB, N-terminal domain Tax PF02959 HTLV Tax 11 tetR PF00440 Bacterial regulatory proteins, tetR family 11 ARID PF01388 ARID/BRIGHT DNA binding domain 10 CCAAT-binding transcription factor (CBF-B/NF- CBFB_NFYA PF02045 10 YA) subunit B TF_AP-2 PF03299 Transcription factor AP-2 10 Zn_clus PF00172 Fungal Zn(2)-Cys(6) binuclear cluster domain 10 BSD PF03909 BSD domain 9 sigma 54_CBD PF04963 Sigma-54 factor, core binding domain 9 Sugar-bind PF04198 Putative sugar-binding domain 9 SWIM PF04434 SWIM zinc finger 9 zf-C2HC PF01530 Zinc fmger, C2HC type 9

~~177~~

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Supplemental Table 5-1. (Continued) TF family name Pfam acc* TF family description Number o f TFs FUiC PF05280 Flagellar transcriptional activator (FlhC) 8 HTH_4 PF01402 Ribbon-helix-helix protein, copG family 8 merR PF00376 MerR family regulatory protein 8 NusG PF02357 Transcription termination factor nusG 8 OAR PF03826 OAR domain 8 Transcription initiation factor TFllD component TAF4 PF05236 8 TAF4 family zf-NF-Xl PF01422 NF-Xl type zinc fmger 8 zf-TAZ PF02135 TAZ zinc finger 8 Alpha_TlF PF02232 Alpha trans-inducing protein (Alpha-TIF) 7 Arg_repressor_C PF02863 Arginine repressor, C-terminal domain 7 Cauli_DNA-bind PF03310 Caulimovirus DNA-binding protein 7 FlgM PF04316 Anti-sigma-28 factor, FlgM 7 jmjC PF02373 jmjC domain 7 jmjN PF02375 jmjN domain 7 Myc_N_term PF01056 Myc amino-terminal region 7 NCD2 PF04905 NAB conserved region 2 (NCD2) 7 SWIB PF02201 SWIB/MDM2 domain 7 Copper-fist PF00649 Copper fist DNA binding domain 6 PEA3 subfamily ETS-domain transcription factor N ETS_PEA3_N PF04621 6 terminus HTH_8 PF02954 Bacterial regulatory protein, Fis family 6 IclR PF01614 Bacterial transcriptional regulator 6 LexA_DNA_bind PF01726 LexA DNA binding domain 6

~~TF11D_A PF03847 Transcription initiation factor TFllD subunit A 6~~

~~TFllE_alpha PF02002 TFilE alpha subunit 6 zf-MlZ PF02891 MIZ zinc fmger 6 Arc PF03869 Arc-like DNA binding domain 5~~

~~Bvg_acc_factor PF03309 Bordetella pertussis Bvg accessory factor family 5~~

~~Carla_C4 PF01623 Carlavirus putative nucleic acid binding protein 5~~

CUT PF02376 CUT domain 5 HTH_3 PF01381 Helix-turn-helix 5 STAT PF01017 STAT protein, all-alpha domain 5 Vir__DNA_binding PF02236 Viral DNA-binding protein, all alpha domain 5 Anti-silence PF04729 Anti-silencing protein, ASF 1-like 4 Autoind_bind PF03472 Autoinducer binding domain 4 DDT PF02791 DDT domain 4

~~E2F_TDP PF02319 Transcription factor E2F/dimerisation partner (TDP) 4~~

ELM2 PF01448 ELM2 domain 4 Iron dependent repressor, N-terminal DNA binding Fe_dep_repress PF01325 4 domain Bacterial regulatory helix-tum-helix protein, lysR HTH_1 PF00126 4 family HTH_6 PF01418 Helix-turn-helix domain, rpiR family 4

~~IRF PF00605 Interferon regulatory factor transcription factor 4~~

~~Jun PF03957 Jun-like transcription factor 4~~

~~178~~

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Supplemental Table 5-1. (Continued) TF family name Pfam acc* TF family description Number o f TFs MarR PF01047 MarR family 4 NCDl PF04904 NAB conserved region 1 (NCDl) 4 PadR PF03551 Transcriptional regulator PadR-like family 4 RNA_pol_Rpb 1 _4 PF05000 RNA polymerase Rpb 1, domain 4 4 RNA_pol_Rpb5_N PF03871 RNA polymerase Rpb5, N-terminal domain 4 Regulator o f RNA polymerase sigma(70) subunit, Rsd_AlgQ PF04353 4 Rsd/AlgQ Runt PF00853 Runt domain 4

~~sigma54_AlD PF00309 Sigma-54 factor, Activator interacting domain (AID) 4~~

~~TAF1128 PF04719 hTAF1128-like protein conserved region 4 Transcription factor TFllD (or TATA-binding TBP PF00352 4 protein, TBP) TFllA PF03153 Transcription factor 11 A, alpha/beta subunit 4~~

~~TFllD-18 PF02269 Transcription initiation factor 11D, 18kD subunit 4~~

zf-C5HC2 PF02928 C5HC2 zinc finger 4 Adeno_52K PF03052 Adenoviral protein 52K 3 APSES PF02292 APSES domain 3 Arg^repressor PF01316 Arginine repressor, DNA binding domain 3 Basic PF01586 Myogenic Basic domain 3 BESS PF02944 BESS motif 3 CarD_TRCF PF02559 CarD-like/TRCF domain 3 CTF_NF1 PF00859 CTF/NF-I family 3 DUF348 PF03990 Domain of unknown function (DUF348) 3 EAP30 PF04157 EAP30 3 Fungal_trans PF04082 Fungal specific transcription factor domain 3 HTH_10 PF04967 HTH DNA binding domain 3 HTH_5 PF01022 Bacterial regulatory protein, arsR family 3 KIX PF02172 KIX domain 3 lad PF00356 Bacterial regulatory proteins, lad family 3 PC4 PF02229 Transcriptional Coactivator pi 5 (PC4) 3 PRD PF00874 PRD domain 3 SAND PF01342 SAND domain 3 SeqA PF03925 SeqA protein 3 Transcription initiation factor 11 A, gamma subunit, TFllA_gamma PF02268 3 helical domain Transcription initiation factor 11 A, gamma subunit, TFllA_gamma_C PF02751 3 beta-barrel domain Transcription initiation factor TFllD 23-30kDa TFllD_30kD PF03540 3 subunit 7kD_DNA_binding PF02294 7kD DNA-binding domain 2 ASNC_trans_reg PF01037 AsnC family 2 CAT_RBD PF03123 CAT RNA binding domain 2 CG-1 PF03859 CG-1 domain 2 CsrA PF02599 Global regulator protein family 2 Flagl_repress PF03614 Repressor of phase-1 flagellin 2 FUR PF01475 Ferric uptake regulator family 2 gntR PF00392 Bacterial regulatory proteins, gntR family 2 Prokaryotic transcription elongation factor, GreA„GreB PF01272 2 GreA/GreB, C-terminal domain

~~179~~

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Supplemental Table 5-1. (Continued) TF family name Pfam acc* TF family description Number o f TFs Leol PF04004 Leol-like protein 2 PurA PF04845 PurA ssDNA and RNA-binding protein 2 Repjrans PF02486 Replication initiation factor 2 RFX_DNA_binding PF02257 RFX DNA-binding domain 2 SCAN PF02023 SCAN domain 2 Ssll PF04056 Ssll-like 2 Ssu72 PF04722 Ssu72-like protein 2 TAFI155_N PF04658 TAF1155 protein conserved region 2

~~TFllD-31 PF02291 Transcription initiation factor IID, 31kD subunit 2~~

TFllE_beta PF02186 TFllE beta subunit core domain 2 YEATS PF03366 YEATS family 2 AraC_binding PF02311 Arabinose operon regulatory protein 1 B-block_TFlIlC PF04182 B-block binding subunit of TFlllC 1 CBF_beta PF02312 Core binding factor beta subunit 1 DUF723 PF05265 Protein o f unknown function (DUF723) 1 Ets PF00178 Ets-domain 1 FaeA PF04703 FaeA-like protein 1 FlhD PF05247 Flagellar transcriptional activator (FlhD) 1 GCM PF03615 GCM motif protein 1 GerE PF00196 Bacterial regulatory proteins, luxR family 1 GTF21 PF02946 GTF2I-like repeat 1 HrcA PF01628 HrcA protein C terminal domain 1 LIM_bind PF01803 LIM-domain binding protein 1 LytTR PF04397 LytTr DNA-binding domain 1 Nabl PF04902 Conserved region in Nabl Ogr_Delta PF04606 Phage transcriptional activator, Ogr/Delta 1 Plus-3 PF03126 Plus-3 domain 1 RHD PF00554 Rel homology domain (RHD) 1 RNA polymerase 1 specific transcription initiation RRN3 PF05327 1 factor RRN3 SART-1 PF03343 SART-1 family 1 T-box PF00907 T-box 1 Tfb2 PF03849 Transcription factor Tfb2 1 UAF_RrnlO PF05234 UAF complex subunit Rrnl 0 1

~~UPF0122 PF04297 Putative helix-turn-helix protein, YbcM / p i3 like 1~~

~~Pfam acc* Pfam accession number (http://pfam.wustl.edu/)~~

~~180~~

~~Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. "OCD O Q. C g Q.~~

~~"O CD~~

~~C/) C/)~~

Supplemental Table 5-2. The summary o f gene finder programs Gene prediction approaches Programs and references Pros Cons 3. Instrinsic {ab initio ): adopt a rigorous probabilistic GENSCAN (Burge and Karlin, 1997) Fast and efficient; Approximately less than 50% accuracy at 3" CD model of sequence structure and choose the most FGENESH (Salamov and Solovyev, 2000) remarkable the gene level probable parse according to that probabilistic model accuracy at the CD GeneMarkhmm (Lukashin and Borodovsky, 1998) "O nucleotide level O GlimmerR (Yuan et al., 2001) Q. C Grail (Xu and Uberbacher, 1997) a o 3 00 Extrinsic (similarity-based): prediction based on GenomeScan (Yeh et al., 2001) High accuracy Unavailability or incompleteness of "O sequence identity or similarity between a genomic transcript sequence data; extra computation o EuGene'HOM (Foissac et al., 2003) query sequence and cDNA, EST, protein or genomic Twins can (Korf et al., 2001 ) to generate alignments; prediction acciuacy sequences o f a gene from the same or another species TWAIN (Majoros et a l, 2005) depend on sequence quality CD Q. Combined: integrated with both instrinstic and GeneScope (Murakami and Takagi, 1998) Allows for a Performance is dependent on the diversity extrinsic methods GeneMachine (Makalowska et al., 2001) reasonable balance o f accuracy in the underlying annotation "O JIGSAW (Allen and Salzberg, 2005) between sensitivity pipeline CD RiceGAAS (Sakata et al., 2002) and specificity

~~CO C/) APPENDIX V~~

~~Permission to Use Copyrighted Material~~

~~University of Nevada, Las Vegas~~

~~I, i > m i o /u[^muL£y^ PUEUCi97?oM^ n5Sism A ir /)spff holder~~

of copyrighted material entitled /9A/AJt177f77(7A>S FUAJ077C)AI/4L /lAJ/fLVses OF Tm R(C€ uiRKY G eN e^up^FFm iLV PRZFRi. PÛZm\îE AND AinRRTli/R ReGÜLP17)RS /9g9::V8/(2. W ^ , authored by xt^y.^.tlâKRF^.Z.OU^ fiW NG-, T7HâmPS6h{ SPpR

~~and originally published in VLPlTr VHV'R/P f jOOrY l.S R ^ l~7('o~ CQ û C S ^~~

~~hereby give permission for the author to use the above described material in total or in part~~

~~for inclusion in a master’s thesis/doctoral dissertation at the University of Nevada, Las~~

~~Vegas.~~

1 also agree that the author may execute the standard contract with University Microfilms, Inc. for microform reproduction of the completed dissertation, including the materials to which I hold copyright.

~~$'^r.(Yc^_. ______Signature D ale~~

~~g//»A /F 4 A O C A U Œ V g PUBUdfrvOM-; RffltSmAIT Name (typed) Title~~

~~m a p (c m rsùr’jfTY' o f v m a i t m oLoe/sr.s Representing~~

~~182~~

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. From; [email protected] To: JoumalsRights Subject: permission for reprints Date: 8/22/2006 10:55:20 PM

Permission request for the following article: Xie, Z., Zhang, Z.L., Zou, X., Yang, G., Komatsu, S., and Shen, Q.J. (2006). Interactions of two abscisic-acid induced WRKY genes in repressing gibberellin signaling in aleurone cells. Plant J. 46, 231-242.

~~Zhen Xie School of Life Sciences University of Nevada, Las Vegas Las Vegas, NV, 89154~~

~~From: Journals Rights To: [email protected] Subject: Re: permission request Date: 8/25/2006 2:00:37 AM~~

~~Dear Zhen Xie~~

Thank you for your request. Permission is granted for you to use the material you specify below subject to the usual acknowledgements (author, title of material, title of book/journal, ourselves as publisher) and on the understanding that nowhere in the original text do we acknowledge another source for the requested material. Non-exclusive World English Language, one edition, print and electronic version of publication only.

~~This permission is granted on the condition that you contact the author for consent should you wish to adapt/modify the material. This is not the responsibility of Blackwell Publishing.~~

~~Best wishes,~~

~~Ali Walker Temporary Permissions Assistant, Permissions Dept Blackwell Publishing, 9600 Garsington Road, Oxford, 0X4 2DQ, United Kingdom~~

~~Fax: 00 44 1865 471150/00 44 1865 471149~~

~~183~~

~~Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. VITA~~

~~Graduate College University of Nevada, Las Vegas~~

~~Zhen Xie~~

~~Local Address: 1600 East University Ave, 208 Las Vegas, Nevada, 89119~~

~~Degrees: Bachelor of Sciences, Horticulture, 1998 Shandong Agricultural University~~

~~Minor, Application of Computer, 1998 Shandong Agricultural University~~

~~Master of Sciences, Horticulture, 2001 Shandong Agricultural University~~

~~Awards and Grants: NSF EPSCoR ACES Summer Award: Development of bioinformatics infrastructure of UNLV and identification of “drought-resistance” genes. Nevada State Funding, 2005($6800)~~

~~Travel grant for the TIGR 2005 Rice Genome Annotation Workshop. 2005 (-$2000)~~

~~GPSA (Graduate & Professional Student Association) Research Grant: Identify putative ABA responsive genes in rice. UNLV Funding, 2005 ($500)~~

~~GPSA (Graduate & Professional Student Association) Travel Grant, UNLV, 2002 ($300)~~

~~Summer Research Grant, Department of Biological Sciences, UNLV, 2002 ($200)~~

~~184~~

~~Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. First Place in oral presentation at BIOS symposium, UNLV, 2005~~

~~Third Place in poster presentation at the Graduate & Professional Student Research Forum, UNLV, 2003~~

Publications: Zhen Xie, Zhong-lin Zhang, Shane Hanzlik, Everett Cook and Qingxi J. Shen. Salicylic acid inhibits gibberellin-induced alpha-amylase expression and seed germination via a pathway involving an abscisic-acid-inducible WRKY gene. (In preparation)

Zhen Xie, Zhong-Lin Zhang, Xiaolu Zou, Guangxiao Yang, Setsuko Komatsu and Qingxi J. Shen. (2006). Interactions of two abscisic-acid induced WRKY genes in repressing gibberellin signaling in aleurone cells. Plant Journal 46, 231 -242.

~~Zhen Xie, Paul Ruas and Qingxi J. Shen. (2005). Regulatory networks of phytohormone abscisic acid. Vitamins and Hormones 72, 235-269.~~

Zhen Xie, Zhong-Lin Zhang, Xiaolu Zou, lie Huang, Paul Ruas, Daniel Thompson and Qingxi J. Shen. (2005). Annotations and functional analyses of the rice WRKY gene superfamily reveal positive and negative regulators of abscisic acid signaling in aleurone cells. Plant Physiology 137, 176-189.

Zhong-lin Zhang, Zhen Xie, Xiaolu Zou, Jose Casaretto, Tuan-hua David Ho and Qingxi Jeffery Shen. (2004). A rice WRKY gene encodes a transcriptional repressor of the gibberellin signaling pathway in aleurone cells. Plant Physiology 134, 1500-1513.

Shupeng Gai, Zhen Xie, Mei Wang and Xiangdong Meng. (2001). Phylogenetic relationship among cultivated zf//mm species from RAPD analysis of the chloroplast genome. Acta Horticulture (In Chinese) 26, 560-561.

~~Zhen Xie. (2001). Indentification of a RAPD marker linked to the monoecious gene in Cucumis melo L. Thesis Collection o f Shandong Agricultural University.~~

~~Professional Presentations: Zhen Xie, Qingxi J. Shen. (2005). Functional analysis of Arabidopsis WRKY genes in ABA signaling. BIOS Symposium at UNLV. (Oral)~~

~~185~~

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Zhen Xie, Qingxi J. Shen. (2004). OsWRKYSl, associated with OsWRKY? 1, mediates the crosstalk between gibberellin and abscisie acid signaling in aleurone cells. BIOS Symposium at UNLV. (Oral)

Zhen Xie, Polet Tchakarski, and Jeff Shen. (2003) Database-mediated identifications of putative gibberellins and abscisic acid responsive genes in rices, Oryza sativa. NSF EPSCoR Research Symposium at Las Vegas. (Poster)

~~Zhen Xie, Zhonglin Zhang, Tracy Hall, Xiaolu Zou, Qingxi J. Shen. (2003). Genome-wide analysis of WRKY gene family in rice, Oryza sativa. BIOS Symposium at UNLV (Oral)~~

~~Zhen Xie and Qingxi J. Shen. (2002). Database-mediated promoter analyses of putative gibberellins and abscisic acid regulated genes in rice, Oryza sativa. Plant Biology at Denver. (Poster)~~

Zhen Xie, Zhonglin Zhang, Xiaolu Zou, Huy Truong, Polet Tchakarski, Everret Cook, Joe Roach, and Jeff Shen. (2002). Applying computer sciences in biology; analyses of rice genome and functional genomics studies of the WRKY gene family. BIOS Symposium. (Oral)

~~Dissertation Title: Roles of WRKY proteins in mediating the crosstalk of hormone signaling pathways: an approach integrating bioinformatics and experimental biology~~

Dissertation Examination Committee: Chairperson, Dr. Jeffery Qingxi Shen, Ph.D. Committee Member, Dr. Andrew Andres, Ph.D. Committee Member, Dr. Steven de Belle, Ph.D. Committee Member, Dr. Dawn Neuman, Ph.D. Committee Member, Dr. Frank van Breukelen, Ph.D. Graduate Faculty Representative, Dr. Chih-Hsiang Ho, Ph.D.

~~186~~

~~Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.~~