Twenty Years of Molecular Biology at the Mount Desert Island Biological Laboratory ....1

Home , Cadillac Mountain, Pugettia

THE 2009 BULLETIN EDITORIAL COMMITTEE

Editor Dr. J.B. Claiborne Managing Editor Michael P. McKernan

Dr. J.B. Claiborne, Chair

Dr. Elizabeth Crockett

Dr. David H. Evans

Dr. Raymond Henry

Dr. John Henson

Dr. Karl Karnaky

Dr. David Miller

Dr. Antonio Planchart

Dr. Robert L. Preston

Dr. Alice Villalobos

Published by the Mount Desert Island Biological Laboratory July 2009 $10.00 THE BULLETIN VOLUME 48, 2009

Mount Desert Island Biological Laboratory Salisbury Cove, Maine 04672

TABLE OF CONTENTS

Introduction ii Memorial: Franklin H. Epstein, M.D. vi Tribute: David W. Towle, Ph.D. x Report Titles xix Reports 1-121 Officers and Trustees 122 Scientific Personnel 125 Summer Fellowship Recipients 133 Seminars, Workshops, Conferences, Courses 137 Publications 149 Author Index 153 Species Index 155 Keyword Index 156 Funding Index 158 THE MOUNT DESERT ISLAND BIOLOGICAL LABORATORY

RESEARCH AND EDUCATION IN THE BIOLOGY OF MARINE ANIMALS

INTRODUCTION

The Mount Desert Island Biological Laboratory (MDIBL) is an independent, non-profit marine and biomedical research facility and international center for comparative physiology, toxicology and marine functional genomic studies. The Laboratory is located on the north shore of Mount Desert Island, overlooking the gulf of Maine about 120 miles northeast of the Portland near the mouth of the Bay of Fundy. The island, well known for Acadia National Park, provides a variety of habitats including shallow and deep saltwater, a broad intertidal zone, saltwater and freshwater marshes, freshwater lakes and streams, forests and meadows.

The Laboratory is among the oldest cold-water research facilities in the Eastern United States, and its unique site provides an outstanding environment for studying the physiology of marine and freshwater flora and fauna. During 2008, the scientific personnel included 83 doctoral level scientists (including 67 Investigators), plus 95 students, and technical staff, representing 87 institutions in 25 US states, Canada, Croatia, Germany, and The Netherlands.

HISTORY AND ORGANIZATION

MDIBL was founded in 1898 at South Harpswell, Maine by J.S. Kingsley of Tufts University. The Wild Gardens of Acadia donated its present site at Salisbury Cove, and relocation was completed in 1921. The Wild Gardens of Acadia, a land-holding group headed by George B. Dorr and John D. Rockefeller, Jr., who was instrumental in the founding of Acadia National Park.

In 1914, the Laboratory was incorporated under the laws of the State of Maine as a non-profit scientific and educational institution. Founded as a teaching laboratory, MDIBL is now a center for marine research and education that attracts investigators and students from across the U.S. and around the world. Since the pioneering work of H.W. Smith, E.K. Marshall and Roy P. Forster on various aspects of renal and osmoregulatory physiology of local fauna, the Laboratory has become known worldwide as a center for investigations in electrolyte and transport physiology, developmental biology, electrophysiology and marine molecular biology.

The Mount Desert Island Biological Laboratory is owned and operated by the Board of Trustees and Members of the Corporation; at present, there are 320 members. Officers of the Corporation - Chair, Vice-Chair, Director, Secretary, Treasurer, Clerk - and an Executive Committee are elected from among the Trustees. The Chair and Executive Committee oversee and promote long-range goals of the Laboratory. The Director, with the aid of a full-time Administrative Director, staff and a Scientific Advisory Committee is responsible for implementing the scientific, educational and public service activities of the Laboratory. NIEHS CENTER FOR COMPARATIVE TOXICOLOGY

The Center for Comparative Toxicology (CCT), formerly known as the Center for Membrane Toxicity Studies (CMTS), was established at the Mount Desert Island Biological Laboratory (MDIBL) in 1985. The purpose of this Center has been to involve a group of internationally recognized investigators, who are primarily experts in mechanisms of epithelial transport, to study the biological effects of environmental pollutants on cell and membrane transport functions. The primary emphasis of this research effort has been to elucidate the mechanisms of toxicity of environmental pollutants at the cellular and molecular level, using novel aquatic models developed at this laboratory.

The focus of the research programs of the Center has broadened in the last several years from the more narrow objective of identifying the molecular targets for the effects of heavy metals (or metal compounds) on cell functions, to include the effects of a broader range of environmental toxicants (including marine toxins) and the mechanisms by which the organism takes up and eliminates a wide range of xenobiotics and environmental pollutants. However, the concept that a "membrane lesion" accounts for the cellular toxicity of many environmental toxins still remains as a paradigm.

Research Cores: The Center consists of two highly integrated research cores or themes consisting of:

• Signal Transduction and Ion Transport • Xenobiotic Transport and Excretion

Investigators in the Signal Transduction and Ion Transport Core are examining the basic mechanisms concerning the cell's signaling response to changes in its external environment, particularly as related to environmental stress, heavy metal exposure, marine toxins and environmental estrogens. These signaling pathways often involve mechanisms of homeostasis of ion transport, pH and cell volume regulation. Investigators in the Core are interested in determining the fundamental mechanisms by which cells regulate their cell volume, maintain internal pH and secretory functions and how these processes are disturbed by environmental influences. Investigators in the Xenobiotic Transport and Excretion Core are examining the processes that are used by various epithelial tissues such as the liver and kidney to take up and excrete drugs and xenobiotics and other toxic compounds that enter from the environment and to study the effects of toxicants on this process. Investigators in this Core also interact with investigators working in the signal Transduction and Ion Transport Core.

Facilities Cores: The Center provides for five facility cores for Center investigators. These include:

• an Animal Core that is responsible for the acquisition, and maintenance of the many marine species available to investigators at this Center; • an Instrumentation and Facilities Core that maintains the basic laboratory equipment that investigators would not otherwise be able to easily bring to the laboratory (a fully equipped cell culture and molecular biology facility, Marine DNA Sequencing Center, and an electrophysiology facility); • a Cell Isolation, Culture and Organ Perfusion Core that provides isolated cells and tissues from marine species to Center investigators; • an Imaging Core that maintains and operates a confocal fluorescent microscope as well as providing other imaging technology including epifluorescence and video-enhanced microscopy; • a Bioinformatics Core that is the site of development of a national Comparative Toxicogenomics Database and webpage design. This core incorporates molecular data on marine sequences with a highly annotated database and provides comparative information with human genes of toxicologic interest.

All Center members and pilot recipients have free access to these core facilities. Non-Center members who utilize these facilities are charged appropriate fees.

Community Outreach and Education Program: The Center's outreach program involves community education on water monitoring programs. This is directed primarily at high school and college students in the immediate area of the laboratory. However, an extensive summer research educational program includes high school students from both regional and national sites, the latter emphasizing minority student education as well as college and postdoctoral fellowship training.

Pilot Projects: The Pilot Project Program provides support for investigators who are interested in pursuing a new project related to environmental toxicology in one or more of the Center's Research Cores. The purpose of these Pilot grants is to obtain preliminary data to facilitate new grant submissions. Grants are awarded competitively and successful applicants receive up to $10,000/season.

APPLICATIONS AND FELLOWSHIPS

Research space is available for the entire summer season (June 1 - September 30) or a half-season (June 1 - July 31 or August 1 - September 30). Applications for the coming summer must be submitted by February 1st each year. Investigators are invited to use the year-round facilities at other times of the year, but such plans should include prior consultation with the MDIBL office concerning available facilities and specimen supply.

A number of fellowships and scholarships are available to research scientists, undergraduate faculty and students, and high school students. These funds may be used to cover the cost of laboratory rent, housing and supplies. Stipends are granted with many of the student awards. Applicants for fellowships for the coming summer research period are generally due in January.

For further information on research fellowships, please contact:

Dr. Patricia H. Hand Administrative Director Mount Desert Island Biological Laboratory P.O. Box 35 Salisbury Cove, Maine 04672 Tel. (207) 288-3605 Fax. (207) 288-2130 [email protected]

Students should contact:

Michael McKernan Director of Education and Conferences [email protected]

ACKNOWLEDGEMENTS

The Mount Desert Island Biological Laboratory is indebted to the National Institutes of Health and National Science Foundation and for substantial support. Funds for building renovations and new construction continue to permit the Laboratory to expand and upgrade its research and teaching facilities. Individual research projects served by the Laboratory are funded by private and government agencies, and all of these projects have benefited from the NSF and NIH grants to the Laboratory. For supporting our educational initiative, MDIBL acknowledges the National Science Foundation Research Experience for Undergraduates, Maine IDeA Network for Biomedical Research Excellence (NCRR/NIH), Cserr/Grass Foundation, Milbury Fellowship Fund, Northeast Affiliate of the American Heart Association, Cystic Fibrosis Foundation, Blum/Halsey Fellowship, Stanley Bradley Fund, Stan and Judy Fund, Adrian Hogben Fund, Bodil Schmidt-Nielsen Fellowship Fund, Maine Community Foundation, the Hearst Foundation, the Betterment Fund and many local businesses and individuals.

Franklin Harold Epstein, M.D.

May 5, 1924 - November 5 2008

This year we mourn the passing of Franklin Harold Epstein, M.D, former president of the Laboratory. Over the course of the past forty years Mount Desert Island Biological Laboratory has been privileged and fortunate to have him among its investigators. He was perhaps the single major influence in the course of the scientific work at the laboratory during that time. His presence, at many different levels, enhanced the science, visibility and prestige of the laboratory. As an investigator he was interested in the many different aspects of salt and water homeostasis. He participated in the governance of the laboratory as a member of most of the consequential committees: scientific advisory committee, elected member of the executive committee, long-range planning committee, and nominating committee. He was trustee, vice president, and president of the laboratory. He was instrumental in increasing the visibility of the laboratory, not only nationally but also locally. Building on the early efforts of the laboratory to invite local participation he opened up the laboratory to the local community. He invited national participation and obtained recognition for the laboratory from private foundations. His wisdom and advice was sought and freely given to all members, young and old, in the laboratory community. His scientific interests and lines of investigation launched the scientific careers of some of the members of the laboratory and inspired many others to pursue fruitful projects.

Born in Brooklyn, New York, he attended Brooklyn College where he graduated summa cum laude in 1944. He attended Yale University School of Medicine graduating cum laude in 1947. At Yale University he came under the inspiration of John P. Peters who would become a deciding influence on his career. He trained at Yale, and was a fellow at the Department of Medicine at Boston University. During the Korean War he was Captain in the Medical Corps of the US Army, initially an Instructor at the Army Medical Service Graduate School, Walter Reed Army Medical Center, and later stationed at Fort Richardson, Alaska. After his service in the army he joined the faculty at Yale University School of Medicine where he rose in rank from Assistant Professor to Professor and succeeded Dr. Peters as Chief of the Section of Metabolism. He then became the Chairman of the 2 &4 Harvard Medical Services and Department of Medicine at the Boston City Hospital and later Hermann L. Blumgart Professor of Medicine and Chairman of the Department of Medicine at Beth Israel Hospital and Harvard Medical School. During that time, until 1993 he was also Director of the Nephrology Division at the Beth Israel Hospital. At the time of his death he was William Applebaum Professor of Medicine at Harvard Medical School. He was married to Sherrie (Spivak) Epstein, and was the father of four children: Mark, Ann, Sara and Jonathan. All of the children experienced the excitement of research at MDIBL and went on to obtain doctoral degrees inspired, no doubt, by Frank’s example.

He trained and mentored over a hundred fellows, students, and faculty. Most, if not all, of the physicians he trained went on to develop successful academic careers of their own across the country and throughout the world achieving positions as faculty members, Section or Division Chiefs, Department Chairs, Deans, and University Presidents.

He received more than seventy awards and recognitions over his long career. Among them the Francis G. Blake Award from Yale University, the John P. Peters Award from the American Society of Nephrology, the Bywaters Award from the International Society of Nephrology, and the David Hume Award from the National Kidney Foundation. He was also a Fellow of the American Association for the Advancement of Science.

He was the epitome of the physician scientist. The scope of his scientific interests was breathtaking. Early in his career he investigated the management of congestive heart failure and the management of circulatory failure in myocardial infarction. He was interested in hypertension, its management and the consequences of treatments. He had a longstanding interest in complications of pregnancy including eclampsia. He studied the effect of hormones on the kidneys. Later he studied salt and water transport, renal metabolism and the interplay between renal metabolism and function. The current underlying his investigations was the insights that they offered on the physiology of the systems and the implications for clinical care.

Observations made while seeing patients or during case presentations in rounds often led to questions that he suggested to junior faculty members, sometimes not so junior, to investigate. But more than just proposing the investigation he would indicate ways to approach it. Once the question was raised and the way to solve it decided he would pursue relentlessly the completion of the project.

He was a teacher of uncommon clarity. He presented and discussed the issues in a way that everybody could understand. He had the gift of rapidly and correctly assessing the level of complexity that was appropriate to the audience and adjusted his teaching to that. He was excellent at explaining complex issues, many times resorting to illustrative analogies. His lectures were always well attended and well received.

Lectures and presentations offered a unique opportunity to witness his capacity to address problems and offer creative insights. He would sit patiently throughout lectures, sometimes turning around his pocket knife in his hands, often looking down, bowing his head giving the impression that he was not that interested in the topic presented. When the lecture ended and opened for questions he would ask questions that revealed that he not only had paid attention to what was discussed but more often than not suggested new ways to approach the issue and occasionally exposed the flaws in the premises or reasoning of the exposition. This he never did in a confrontational way, more as a discussion, a conversation even, as if he wanted to clarify things, and when it was over the speaker would, more often than not, thank him for his insights and conclusions that many times were different from those presented.

When he wanted a member of the faculty to work on something that initially seemed unappealing, he would begin by enunciating the problem and asking for input. He would slowly build up the interest in the project by listening and discussing ways to approach it, likelihood that the different lines of inquiry would give clear results, and pro and cons of the different paths. Finally he would suggest that with all the thinking and different insights that the faculty member had expressed he or she was the natural person to address that enterprise.

Perhaps the outstanding characteristic of his career is the interest he expressed in all the problems that were presented to him. He would listen carefully, only interrupting for clarification but he would correct mistakes or misinterpretations, and ask for clear demonstration that the observations were correct. He would then offer suggestions and indicate how he would approach the questions or who to contact for further suggestions, information, or technical help. He gave his advice freely, encouraging people to pursue research avenues he suggested. He often would think of a question and then look for the person who could do investigation.

Over the course of forty years, starting in 1968, he investigated the way fish manage salt and water. Bony fish that move between fresh and salt water manage their salt by increasing the excretion of salt by the gills in salt water and cutting off its excretion in fresh water. The regulation of this phenomenon was not known. His studies in Fundulus heteroclitus and Anguilla rostrata demonstrated that cortisol induced the changes necessary for the movement from fresh to salt water and prolactin mediated those required for the return to fresh water. The activity of Na-K-ATPase in the gills increased when the fish moved to salt water and decreased when it was adapted to fresh water, suggesting that it mediated the movement of salt into the water. However, the pump was located on the blood side of the cells that secreted salt, the wrong side if sodium was to be secreted into the ocean. Sodium could not possibly leave the cell into the ocean through the apical surface of the cells and could not be the ion excreted by the secretory cells of the gills. From these experiments arose the concept of the cotransport of chloride and sodium through a transport molecule that was later characterized in the rectal gland of the Squalus acanthias and found to require also potassium. This was the sodium, potassium two chloride cotransporter, the target of furosemide and related diuretics, later cloned out of the rectal gland of the shark.

The richness of the rectal gland of the shark in Na-K-ATPase offered a singular opportunity to examine the role of this enzyme on salt balance in fish. Sharks cannot maintain salt homeostasis by excreting salt through the gill as bony fish do. The organ responsible for the excretion of salt in the shark is the rectal gland that is rich in Na-K-ATPase. Initial studies were hampered by the low rate of secretion of salt by the gland. With the realization that the rectal gland was under humoral control the organ could be studied and the nature of the secretory mechanism was found to be similar to that of the gills of bony fish. The ion transported across the cell was chloride and its secretion was mediated indirectly by Na-K-ATPase. The concept of secondary active transport, powered by Na-K-ATPase emerged from these studies.

The mechanisms regulating the secretion of chloride were found to be quite complex. The expansion of the extracellular space caused the release of a natriuretic peptide from the heart of the shark. The natriuretic peptide circulated to the rectal gland where it directly stimulated the rectal gland cells and induced the release of vasoactive intestinal peptide from nerves within the gland, that, in turn also stimulated the cells. The secretion of chloride by the rectal gland of the shark was regulated by humoro-neural mechanism.

His scientific activities in the laboratory were many more than his individual studies. One additional accomplishment, valued by all, was the organization and speaker recruitment for the Monday morning seminar. This seminar was for many years a learning activity, a source of information, and gathering place for all members of the laboratory community.

His legacy is not only that of gifted investigator, a caring physician, an inspiring teacher, a wise and thoughtful manager but for all of those who came in contact with him there is also that dimension of a kind, gentle, generous man that enriched us all. Gentle in the way he treated those who came to him for instruction, kind in the way he treated everybody around him, and generous in his freely given flow of ideas and supportive advice. Those of us who had the fortune to know him and work with him will always carry him in our hearts.

Patricio Silva, M.D. Professor of Medicine Chief, Section of Nephrology and Kidney Transplantation Medical Director, Kidney Transplant Program Temple University Genomics with Gusto: David Towle’s contributions to the Mount Desert Island Biological Laboratory

Who among them is a man like Han-rei, Who departs alone with his lady, With her hair unbound, and he his own skiffsman!

Rihaku (Li T’ai Po) translated by Ezra Pound

After being a seasonal investigator at MDIBL since 1984, and a full-time scientist and founding director of the Center for Marine Genomics since 2000, David Towle is leaving the lab for new horizons and new endeavors. His Center has become a magnet and a mecca for comparative physiologists world-wide, and it has become one of the cornerstones of the lab. A pioneer in re- shaping the field of comparative physiology and biochemistry through innovation and development of new experimental approaches and techniques, David has been responsible for re-shaping the careers of a number of colleagues as well. So it is only fitting that David be celebrated in the words of his colleagues.

“While I have had innumerable and valuable discussions with David over the thirty two years of our association that have resulted in new ideas and perspectives on my research, he has been of greatest assistance to our program by introducing us to the techniques of modern molecular biology. David mentored us, and me personally (as he has so many others), in applying PCR techniques to crustacean systems. David was one of the true pioneers in taking these molecular techniques and genomics into the realm of non-model, invertebrate systems. He painstakingly worked out all of the challenges that were peculiar to crustacean systems and graciously shared that knowledge widely among his colleagues, whether friends or strangers.” - Bob Roer

“David was one of the first comparative physiologists to include molecular techniques in his research - and he enthusiastically taught the rest of us as he learned. I had just been introduced to the idea in the summer of ~1990 through a two week course in molecular biology at the Duke Marine Lab. I think it was that same year, December 1990, when David gave a talk at SICB on the partial cDNA sequence of one of his crab transporters. In his talk, he took us all though the procedures, extracting RNA, reading sequences, etc, ending up with a slide illustrating a 2-D model of his transporter - with two of the transmembrane loops clearly configured into crab claws. His talk was designed to persuade us that molecular biology was a tool, not a profession, and that we could all use it. It worked for me – I used his example as a role model to expand my research from protein structure and function to RNA and DNA. From there, David went on to PCR, real time quantitative PCR, microarrays, genomic studies, and onwards – bringing the rest of us along with him. His talks continue to be designed not simply to present data but to share and teach.” - Nora Terwilliger

That last sentence sums up the fact that David has been a mentor and a teacher of his colleagues for his entire career. It is appropriate that someone who began his career as a biochemist would become a catalyst in the careers of so many others.

“Everything that I have learned about molecular biology has been from David.” - Cedomil Lucu

“I learned a lot about PCR, sequence analysis, and molecular biology in general while working with David, and my research benefitted greatly as a result of his help.” - Steve Gehnrich

“I had no clue about these ‘new’ methods, in which 4 letters seemed to play the most important role. In 1997 I came over to his laboratory at Lake Forest College for a three month visit. Beside PCR, semi- quantitative mRNA expression analysis, and manual DNA sequencing, I learned that David is a great mentor and friend.” - Dirk Weihrauch

“Dave taught me almost everything I know about molecular biology techniques, from RNA extraction to gene sequencing, primer design, and real-time quantitative PCR.” - Don Lovett

“His love of learning and genuine curiosity are infectious, and may help to explain the streams of collaborators running to and from his lab.” - Chris Smith

“Since my visit to David’s laboratory at MDIBL in 2002, molecular biology became an important part of my research line on ion transport across crab gills.” - Carlos Luquet

“My coming to MDIBL, working with and learning from David, was a watershed event. What I learned in David’s lab allowed me to take my research program to the level of the genome and gene regulation, and it sparked a ten year Renaissance in my work.” - Ray Henry

“We were introduced to the functional genomics studies on other crustaceans, and their potential in understanding physiological regulation through a quantitative assessment of relative gene expression.” - Petra Lenz and Dan Hartline

“David, together with Dirk Weihrauch who was doing post-doctoral studies in David’s Lab at that time, taught me all the practical skills in the field of molecular biology.” - Celine Spanings-Pierrot

“David’s assistance in this regard has allowed us to transition from protein chemistry to analyzing EST libraries ... He was directly responsible for accelerating our research by years if not decades.” - Bob Roer

During his time at MDIBL, David has been an outstanding ambassador for the lab. He has been responsible for inviting nearly a dozen new investigators to come to the lab and let their research program take root there, not only through his science but also through his boundless hospitality:

“In 1999, we were given a truly wonderful tour of MDIBL - we were given an overview of the facilities, we were shown different labs, we were told about the community, we were encouraged to apply for a New Investigator Award. It is the reason we are now MDIBL regulars. This experience will forever represent MDIBL to us. Our tour guide: David Towle.” -Petra Lenz and Dan Hartline

“As he has done for so many others, he warmly extending an invitation of ‘Why don’t you just come up and I’ll show you how to do it.’ Dave would unselfishly share with anyone his lab, his methodologies, and even the little secrets that made things work for him. But, I received a great deal more from Dave than a binder of protocols. Dave taught me how to mentor undergraduate students. I now have mentored almost 100 students in my lab. The number is not remarkable; the fact that twenty years ago I had little interest in working with undergraduates in the lab is. I have former students who have gone on to be successful research scientist and professors, while others have appropriately gone on to be salesmen. But, whenever a student thanks me for the wonderful experience that I have provided them, I smile and think, ‘I’m just doing it the way that Dave Towle showed me.’” - Don Lovett

“One of the funny things I remember with him happened on my first arrival day at MDI. David came to pick me up at the Bar Harbor airport, and on our way to the Lab, he told me how wonderful the Island was; he decided to show me immediately one of the best sights of MDI: Cadillac Mountain. We started driving up the hill but the weather had become very foggy. On our way up, David stopped on a view point area and after just a few steps, we could barely see....his truck on the parking lot! - Celine Spanings-Pierrot

“We had been at MDIBL for only a few days our first summer, and I was a new investigator’s wife with two young children alone in Cottage 3. David showed up with a hanging basket of flowers to make us feel at home.” - Laura Henry

David has never been a timid individual. Quite the contrary, he throws himself into every endeavor. Or, as David would say, “Change is good”:

“In 1998, my first year at MDIBL, I shared a lab in Smith with David. The room once housed an atomic absorption photometer, and the old metal hood and vent system was still sitting on one of the benches, stretching almost the entire length of one wall. I got there first, and not wanting to disturb anything already in the room, I carefully arranged and set up my equipment around the hood. Just about the time I got finished, David arrived. Not one to be confined, restricted, or deterred by his surroundings, he took one look at the hood, grabbed some tools, and dismantled it piece-by-piece. Gave us a lot more room and taught me a lesson about thinking and acting outside the box (or hood, as the case may be).” - Ray Henry

“Thanks to David’s enthusiasm and support, Calanus finmarchicus became a focus for functional genomics at MDIBL. A normalized gene library for C. finmarchicus was added to the MDIBL resources, and EST sequences were obtained and submitted to Genbank. Most recently, David was instrumental in getting a C. finmarchicus microarray produced and tested. Currently, we have an informal C. finmarchicus consortium.” - Dan Hartline and Petra Lenz Learning by doing has been one of the signature aspects of David’s career. And it’s not just science that he throws himself into, it’s all aspects of life.

“David built his own home. He first consulted books about site planning, wiring, framing, plumbing and all the other particulars that lead to one unified structure. Then he rolled up his sleeves and dug into the work. This successful learning-by-doing is as powerful a model in the lab as it is outside of it.” - Chris Smith His laboratory was the classic example of an “open lab”. He has invited researchers from around the world and has made all of them feel at home.

“I met David in June 2000 when I came for the first time to the Mount Desert Island Biological Laboratory to join his team to train me in molecular biology on crustaceans. I immediately loved working in David’s small, but so well equipped, lab in the Marshall building of the MDIBL, and I remember how proud I was when David taped on the door of his lab the picture of my first successful PCR amplification on gill NaK- ATPase that I got four days after I arrived at the Lab! David has always been present to answer questions and to resolve technical problems in the lab. I will remember him as someone so helpful for everybody passing by his lab....and the lab was always so crowded during summer time! But he was doing his best to be available for all of us.” - Celine Spanings-Pierrot “In the summer of 2000, David’s lab was literally packed with people, yet he made room for me to do my first attempt at measuring changes in carbonic anhydrase gene expression. I did all my work at an eighteen- inch strip of bench space; everything worked, and it was one of the most memorable professional experiences I’ve ever had.” - Ray Henry David has always made his work both a scientific and a human endeavor, and as a result, he has become both colleague and friend to those he has worked with. One of the signature characteristics of David’s career is that he mixes science with life:

“Later, lured by David’s hospitality and friendship, the exciting perspective to continue working on crabs employing a truly integrative approach, I came in 1999 to his laboratory as a Postdoc. Sure, our common passion for music, David on his accordion and fiddle, me on the guitar and harmonica, helped in the convincing process (That was quite fun). Right at the first morning after my arrival in Chicago we hopped into his Jeep Cherokee and we drove non-stop to a Cajun jam-session down to southern Louisiana. After the first hour of driving he handed the steering wheel over for having a nap, leaving me jetlagged with his new car in this big country alone. But after all, I was not alone. He was there, showing true confidence in my capabilities. He was also there when he introduced me to the “greater crab community” at meetings or at MDIBL. As a mentor he guided me but also allowed me to be independent as a Postdoc can be. For this freedom I cannot thank him enough.” - Dirk Weihrauch

“And through Dave, I met a cadre of biologists who are now close friends.” - Don Lovett

“And as David built not merely a physical structure, but a lively and vibrant home, these collaborations are spirited and enjoyable. Papers are not simply shuffled back and forth, but gumbo recipes are shared, accordion lessons are provided, and some fortunate souls even get musical accompaniment at their wedding.” - Chris Smith

“There was always time for enjoying a good meal, good wines, to laugh a lot and to listening him playing the accordion. When David visited my old lab in Buenos Aires, he discovered that the most traditional argentine dish is the “asado” something related to the barbecue but made in a particular way and with different beef cuts. David spent some time watching through the window how the cooks made the “asado” in the specialized restaurants and then, he bought the beef and made himself an excellent asado for his argentine friends.” - Carlos Luquet

“But I think the thing that struck me the most was that he always seems to be having a good time. He is interested in so many things; who else do you know that plays several instruments, sings in a choir, builds their own home, and who knows what else?! Not only does he do all these things (and he does them well), but he has a good time doing them. The one thing I remember David saying when describing just about anything he was doing was, ‘Great Fun!’” - Steve Gehnrich Science as high adventure:

“Together (with David) we organize a meeting: Transport Processes Across Surfaces of Aquatic Organisms, held in Rovinj on June 26-27, 1991. It is a city close to the Italian border where I worked for most of my career, employed at the Institute Ruder Boskovic. David was still working on the membrane vesicles, as a leader in this field, and he first discovered the electrogenic 2Na+/H+ exchanger in crustaceans. I was working at that time together with D. Siebers and Na+ and Cl- transport, and we discussed at length the amiloride-sensitive Na+ exchanger and the Na+/K+/2Cl- co-transporter in crustaceans. We also discussed the Na+/H+ electrogenic and electroneutral exchanger, and the possible integration of his work done on membrane vesicles with my work on native perfuse epithelia. The day before the meeting in Rojinj was to begin, Croatia proclaimed sovereignty, making this the first meeting held in the newly formed state of Croatia! The next day, after the meeting closed, war began in Slovenia (only a few miles from Rovinj and also a part of former Yugoslavia). David and others asked what to do. We suggested to them to run away from Croatia by speedy hydrofoil boats crossing the Adriatic to Italy. David agreed with us, but he carried out his decision in his own way. He took a car and crossed the war zone in Slovenia to get to Italy. That’s a David!” - Cedomil Lucu One of David’s characteristic traits is his virtually limitless generosity:

“David invited me and generously facilitated everything to give me the opportunity to obtain a New Investigator Award. What I had thought to be very difficult, like living in a foreign country, with my language limitations and working in a field in which I had no experience at all, suddenly became easy thanks to David’s friendship and support, and to his great teaching capacity. In my last visit to MDIBL, in 2005, I had recently moved to a small town in Patagonia, Argentina, where I was trying to equip a new laboratory form zero. This time he donated very important equipment and reagents which resulted fundamental for starting the experimental work.” - Carlos Luquet

“David is the one of the most genuine and caring people I’ve ever met. From the first time I met David, when I was a second-year graduate student presenting a talk at the ASZ meeting in Toronto in 1977, he has been a mentor, colleague and friend. He and Betty have always opened their homes and hearts to Margie and me. We’ve hiked, boated, dined, drank, and enjoyed each other’s company over the years. When David came to Wilmington for a couple of months a number of years ago, he proved that he’d “never met a stranger”. Within a week he had met and gotten to know more people than I had in 25 years, and was playing with a contradance band.” - Bob Roer

“One of the best parts of working with David is the example of generosity that he lives by, the way he shares his knowledge, resources, ideas and encouragement with everyone, students, postdocs, established researchers alike.” - Nora Terwillliger

“This past Robert Burns Day (January 25th), David tipped his hat (or his tam?) to our shared English major past and sent me the following quote, from Burns’ iconic poem, “To a Louse”: “O wad some Power the giftie gie us, To see oursels as ithers see us!” I certainly hope that this collection of tributes provides a wee bit of this power, so that David may see for himself that we see him as an unfailingly kind and generous scientist and friend.” - Chris Smith

Throughout his career, one of the constants in David’s life has been the infectious enthusiasm and genuine joy that he has shown in his scientific pursuits:

“David is able to appeal to the childlike curiosity in us all, and draws questions out from us. When the goofy crab-shaped hats come out, there is a pervasive feeling that we are in this fun adventure together. What a great atmosphere in which to learn and discover!” - Chris Smith

David has never been defined by the external circumstances in his life. Rather, he has moved fluidly between his professional and his personal worlds, blurring the lines that separate them until they are no longer visible. Now, as he prepares to expand the boundaries of his life yet again, it is perhaps fitting to close with one of his own favorite quotes:

“If you can’t make things work in the lab, then it’s time to go sailing.” - David Towle

TAKING LEAVE OF A FRIEND

Blue mountains to the north of the walls, White river winding about them; Here we must make separation And go out through a thousand miles of dead grass.

Mind like a floating white cloud, Sunset like the parting of old acquaintances Who bow over their clasped hands at a distance. Our horses neigh to each other as we are departing.

Rihaku (Li T’ai Po) translated by Ezra Pound

Compiled and edited by Raymond Henry, Department of Biological Sciences, Auburn University, Auburn, AL.

The following is a list of publications which have resulted from direct collaboration in David Towle’s lab or which are a result of techniques and concepts acquired in his lab.

1. Aller, S.G., Smith, C.M., Towle, D.W., and Forrest, J.N. Jr. Analysis of 172 expressed sequence tags from the shark (Squalus acanthias) rectal gland. Bulletin (Mt. Desert Island Biol. Lab.). 39:123-125. 2000. 2. Baehre, K., Lenz, P., Spanings-Pierrot, C., Towle, D.W. Splice variants in hsp70 cDNAs from the marine copepod Calanus finmarchicus. Bull. Mt. Desert Island Biol. Lab. 44: 34-35. 2005. 3. Beale, K.M., Towle, D.W., Jayasundara, N., Smith, C.M., Shields, J.D., Small, H.J., and Greenwood, S.J. Anti- lipopolysaccharide factors in the American lobster Homarus americanus: Molecular characterization and transcriptional response to Vibrio fluvialis challenge. Comp. Biochem. Physiol. D. Genomics and Proteomics. 3:263- 239. 2008. 4. Beale, K.M., Smith, C.M., and Towle, D.W. Amplification of 28S rRNA sequences in oligo(dT)-primed cDNA libraries from the American lobster Homarus americanus. Bulletin Mt. Desert Island Biol. Lab. 47:54-55. 2008. 5. Christie, A.E., Rus, S., Goiney, C.C., Smith, C.M., Towle, D.W., and Dickinson, P.S. Identification and characterization of a cDNA encoding a crustin-like, putative antibacterial protein from the American lobster Homarus americanus. Mol Immunol. 44:3333-3337. 2007. 6. Christie, A.E., Sousa, G.L., Rus, S., Smith, C.M., Towle, D.W., Hartline, D.K., Dickinson, P.S. Identification of A- type allatostatins possessing -YXFGI/Vamide carboxy-termini from the nervous system of the copepod crustacean Calanus finmarchicus. Gen Comp Endocrinol. 155:526-33. 2008. 7. Christie, A.E., Cashman, C.R., Stevens, J.S., Smith, C.M., Beale, K.M., Stemmler, E.A., Greenwood, S.J., Towle, D.W., and Dickinson, P.S. Identification and cardiotropic actions of brain/gut-derived tachykinin- relatedpeptides (TRP’s) from the American lobster Homarus americanus. Peptides 29: 1909-1918. 2008. 8. Coblentz, F.E., Shafer, T.H., and Roer, R.D. Cuticular proteins from the blue crab alter in vitro calcium carbonate mineralization. Comp. Biochem. Physiol. 121B: 349-360. 1998. 9. Dickinson, P.S., Stevens, J.S., Rus, S., Brennan, H.R., Goiney, C,C., Smith, C.M., Li, L., Towle, D.W., Christie, A.E. Identification and cardiotropic actions of sulfakinin peptides in the American lobster Homarus americanus. J Exp Biol. 210:2278-89. 2007. 10. Dickinson, P.S., Stemmler, E.A., Cashman,C.R., Brennan, H.R., Dennison, B., Huber, K.E., Peguero, B., Rabacal, W., Goiney, C.C., Smith, C.M., Towle, D.W., Christie, A.E. SIFamide peptides in clawed lobsters and freshwater crayfish (Crustacea, Decapoda, Astacidea): a combined molecular, mass spectrometric and electrophysiological investigation. Gen Comp Endocrinol. 156:347-60. 2008. 11. Gehnrich, S., Brooks, C., Weihrauch, D., Towle, D.W., and Henry , R.P. Carbonic anhydrase in the hypodermis of the shore crab, Carcinus maenas, and its role in the post-molt calcification of the cuticle. MDIBL Bulletin 38: 26-27. 2000. 12. Gehnrich, S., Brooks, C., Weihrauch, D., Towle, D.W., and Henry, R.P. Alterations in carbonic anhydrase gene expression during low salinity adaptation in the shore crab Carcinus maenas. MDIBL Bulletin 38: 28-29. 2000. 13. Gehnrich, S., Henry, R.P., Weihrauch, D., and Towle, D.W. Identification of carbonic anhydrase isoforms in gills of the shore crab, and changes in their expression during acclimation to low salinity. MDIBL Bulletin 40: 114-115. 2001. 14. Genovese, G., Ortiz, N., Urcola, M.R., and Luquet, C.M. Possible role of the enzymes carbonic anhydrase and V- H+-ATPase, and the Cl-/HCO3- in electrogenic ion transport across the gills of the euryhaline crab Chasmagnathus granulatus. Comparative Biochemistry and Physiology. A. 142 (3): 362-369. 2005. 15. Genovese, G., Senek, M., Ortiz, N., Towle, D.W., Urcola, M.R.,and Luquet, C.M. Dopaminergic regulation of ion uptake through the gills of the euryhaline crab Chasmagnathus granulatus. Possible interaction between D1-like and D2- like receptors. Journal of Experimental Biology. 209: 2785-2793. 2006. 16. Genovese, G., Regueira, M., Lo Nostro, F., Da Cuña, R., Maggese, C., Luquet, C., and Towle, D.W. cDNA sequencing of vitelline envelope protein and gene expression in Cichlasoma dimerus (Teleostei, Perciformes) induced by xenoestrogens. Bulletin of the Mount Desert Island Biological Laboratory. 45: 127-129. 2006. 17. Hagedorn, M., Weihrauch, D., Towle, D.W., and Ziegler, A. Molecular characterisation of the smooth endoplasmic reticulum Ca(2+)-ATPase of Porcellio scaber and its expression in sternal epithelia during the moult cycle. J. Exp. Biol. 206: 2167-75. 2003. 18. Halperin, J., Genovese, G., Tresguerres, M., and Luquet, C.M. Modulation of ion uptake across posterior gills of the crab Chasmagnathus granulatus by dopamine and cAMP. Comparative Biochemistry and Physiology. 139(1): 103- 109. 2004. 19. Henry, R.P. Functional evidence for the presence of a carbonic anhydrase repressor in the eyestalk of the euryhaline green crab Carcinus maenas. J. Exp. Biol. 209:2595-2605. 2006. 20. Henry, R.P., Garrelts, E.E., McCarty, M.M., and Towle, D.W. Differential induction of branchial carbonic anhydrase and Na+/K+ ATPase in the euryhaline crab, Carcinus maenas. J. Exp. Zool. 292:595-603. 2002. 21. Henry, R.P., Gehnrich, S., Weihrauch, D., and Towle, D.W. Salinity-mediated carbonic anhydrase induction in the gills of the euryhaline green crab, Carcinus maenas. Comp. Biochem. Physiol. 136A:243-258. 2003. 22. Jayasundara, N., Spanings-Pierrot, C., Towle, D.W. Quantitative analysis of hsp70 mRNA expression under salinity stress in the euryhaline shore crab Pachygrapsus marmoratus. Bull. Mt. Desert Island Biol. Lab. 44: 36-37. 2005. 23. Jayasundara, N., Towle, D.W., Weihrauch, D., Spanings-Pierrot, C. Gill-specific transcriptional regulation of Na++K+-ATPase !-subunit in the euryhaline shore crab Pachygrapsus marmoratus: Sequence variants and promoter structure. J. Exp. Biol., 210: 2070-2081. 2007. 24. Kotlyar, S., Weihrauch, D., Paulsen, R.S., and Towle, D. Expression of arginine kinase enzyme activity and mRNA expression in gills of the euryhaline crabs Carcinus maenas and Callinectes sapidus. J. Exp. Biol. 203: 2395-2404. 2000. 25. Lee, K.J., Watson, R.D., and Roer, R.D. Molt-inhibiting hormone (MIH) mRNA levels and ecdysteroid titer during a molt cycle of the blue crab, Callinectes sapidus. Biochem. Biophys. Res. Commun. 249: 624-627. 1998. 26. Li, T., Roer, R., Vana, M., Pate, S., and Check, J. Gill area, permeability and Na+,K+-ATPase activity as a function of size and salinity in the blue crab, Callinectes sapidus. J. Exp. Zool. 305: 233-245. 2006. 27. Lovett, D.L., Towle, D.W., and Faris, J.E. Salinity-sensitive alkaline phosphatase activity in gills of blue crab Callinectes sapidus Rathbun. Comp. Biochem. Physiol. 109B:163-173. 1994. 28. Lovett, D.L.,Tanner, C.A., Ricart, T.M., and Towle, D.W. Modulation of Na+,K+-ATPase expression during acclimation to salinity change in the blue crab Callinectes sapidus. Bull. Mount Desert Island Biol. Lab. 42:83-84. 2003. 29. Lovett, D.L., Verzi, M.P., Burgents, J.E. Tanner, C.A., Glomski, K. Lee, J.J., and Towle, D.W.. Expression profiles of Na+,K+-ATPase during acute and chronic hypo-osmotic stress in the blue crab Callinectes sapidus. Biol. Bull. 211:58-65. 2006. 30. Lovett, D.L., Colella T., Cannon, A.C., Lee, D.H., Evangelisto, A., Muller, E.M., and Towle, D.W. Effect of salinity on osmoregulatory patch epithelia in gills of the blue crab Callinectes sapidus. Biol. Bull. 210:132-139. 2006. 31. Lucu, !. and Towle, D. Introduction: Transport processes across surfaces of aquatic organisms. J. Exp. Zool. 265: 343-345. 1993. 32. Lucu, !. and Towle, D.W. Na+ ,K+-ATPase in gills of aquatic Crustacea. Comp. Biochem. Physiol. Review paper, 135A: 195-214. 2003 33. Lucu, C, and Towle, D.W. Induction of short-circuit current and Cl- transport by hypoosmotic stress in the epipodite of lobster Homarus americanus. The Bulletin MDI Biological Laboratory 46: 16-18. 2007. 34. Lucu, !. And D.W. Towle, D.W. Chloride conductance in lobster epipodite. The Bulletin MDI Biological Laboratory 47: 20- 21. 2008. 35. Luquet, C., Senek, M., and Towle, D. Na+/K+/2Cl- Cotransporter and Na+-K+-ATPase mRNA in the South American rainbow crab Chasmagnathus granulatus after acclimation to low and high salinity. Bulletin of the Mount Desert Island Biological Laboratory. 42: 63. 2003. 36. Luquet, C.M., Weihrauch, D., Senek, M., and Towle, D.W. Induction of branchial ion transporter mRNA expression during acclimation to salinity change in the euryhaline crab Chasmagnathus granulatus. Journal of Experimental Biology. 208: 3627-3636. 2005. 37. Luquet, C., Genovese, G., Towle, D.W. Hsp70 mRNA expression in the South American rainbow crab Chasmagnathus granulatus after acclimation to low and high salinity. Bulletin of the Mount Desert Island Biological Laboratory. 45: 99- 100. 2006. 38. Luquet, C.M, Towle. D.W., and Pinheiro Zanotto, F. Mechanisms of Ion Transport. In: “Frontiers in the Biology and Ecology of Estuarine Crabs: Chasmagnathus granulatus as a model system”. Editors: Luiz Eduardo M. Nery, José M. Monserrat, Euclydes A. dos Santos Filho & Adalto Bianchini. Editora FURG. Rio Grande. RS. Brasil. In press. 39. Pierce, D.C., Butler, K.D., and Roer, R.D. Effects of exogenous N-acetylhexosamindase on the structure and mineralization of the postecdysial exoskeleton of the blue crab, Callinectes sapidus. Comp. Biochem. Physiol. 128B: 691-700. 2001. 40. Roer, R.D., Halbrook, K.E., and Shafer, T.H. Glycosidase activity in the postecdysial cuticle of the blue crab, Callinectes sapidus. Comp. Biochem. Physiol. 128B: 683-690. 2001. 41. Roer, R., and Towle, D.W. Partial nucleotide sequence of a putative cuticular hexosaminidase from the blue crab, Callinectes sapidus. Bulletin Mt. Desert Island Biological Lab 43: 40-42. 2004. 42. Roer, R. and Towle, D. Partial nucleotide sequence and expression of plasma membrane Ca-ATPase in the hypodermis of the blue crab, Callinectes sapidus. MDIBL Bulletin 44: 40-43. 2005. 43. Serrano, L., Towle, D.W., Charmantier, G., Spanings-Pierrot, C. Expression of Na+/K+-ATPase !–subunit mRNA during embryonic development of the crayfish Astacus leptodactylus. Comp. Biochem. Physiol., 2D: 126-134. 2007. 44. Serrano, L., Halanych, K.M., and Henry, R.P. Salinity-stimulated changes in expression and activity of two 45. carbnonic anhydrase isoforms in the blue crab, Calllinectes sapidus. J. Exp. Biol. 210:2320-2332. 2007. 46. Serrano, L., and Henry, R.P. Differential Expression and Induction of Two Carbonic Anhydrase Isoforms in the Gills of the Euryhaline Green Crab, Carcinus maenas, in Response to Low Salinity. Comp. Biochem. Physiol. D: 186-193. 2008. 47. Spanings-Pierrot, C., Toullec, J.-Y., Towle, D.W. Identification of two different forms of crustacean hyperglycemic hormone (CHH) in sinus glands of the euryhaline crab Pachygrapsus marmoratus. Bull. Mt. Desert Island Biol. Lab., 42: 49-51. 2003. 48. Spanings-Pierrot, C., Towle, D.W. Expression of Na+,K+-ATPase mRNA in gills of the euryhaline crab Pachygrapsus marmoratus adapted to low and high salinities. Bull. Mt. Desert Island Biol. Lab., 42: 44-46. 2003. 49. Spanings-Pierrot, C., and Towle, D.W. Salinity-related mRNA expression of the Na+/K+/2Cl- cotransporter and V-type H+-ATPase in gills of the euryhaline crab Pachygrapsus marmoratus. Bull. Mt. Desert Island Biol. Lab., 43: 6-8. 2004. 50. Spanings-Pierrot, C., Bisson, L., and Towle, D.W. Expression of a Crustacean Hyperglycemic Hormone isoform in the shore crab Pachygrapsus marmoratus during adaptation to low salinity. Bull. Mt. Desert Island Biol. Lab., 44: 67-69. 2005. 51. Spanings-Pierrot, C., and Towle, D.W. Time course of crustacean hyperglycemic hormone isoforms mRNA levels in the crab, Pachygrapsus marmoratus, following salinity adaptation. Bull. Mt. Desert Island Biol. Lab., 46: 10-11. 2007. 52. Towle, D.W., and D. Weihrauch, D. Osmoregulation by gills of euryhaline crabs: Molecular analysis of transporters, Am. Zool. 44 (4): 770-780. 2001. 53. Towle, D.W, and Smith, C.M. Expressed sequence tags in a normalized cDNA library prepared from multiple tissues of the Amerian lobster Homarus americanus. Bulletin Mt. Desert Island Biol. Lab. 44:33. 2005. 54. Towle, D.W., and Smith, C.M. Gene discovery in Carcinus maenas and Homarus americanus via expressed sequence tags. Integr. Comp. Biol. 46:912-918. 2006. 55. Towle, D.W., Paulsen, R.S., Weihrauch, D., Kordylewski, M., Salvador, C., Lignot, J.-H., and Spanings-Pierrot C. Na++K+-ATPase in gills of the blue crab Callinectes sapidus: cDNA sequencing and salinity-related expression of !– subunit mRNA and protein. J. Exp. Biol., 204: 4005-4012. 2001. 56. Townsend, K., Spanings-Pierrot, C., Hartline, D.K., King, S., Henry, R.P., and Towle, D.W. Expression of crustacean hyperglycemic hormone (CHH) mRNA in neuroendocrine organs of the shore crab Carcinus maenas. Bull. Mt. Desert Island Biol. Lab., 41: 54-55. 2002. 57. Tresguerres M., Parks S.K., Sabatini S.E., Goss G.G. and Luquet C.M. 2008. Regulation of ion transport by pH and - [HCO3 ] in isolated gills of the crab Neohelice (Chasmagnathus) granulata. American Journal of Physiology Regulatory Integrative Comparative Physiology 294:1033-1043. 2008. 58. Varsamos, S., Xuereb, B., Commes, T., Flik, G., and Spanings-Pierrot, C. Pituitary hormone mRNA expression in European sea bass Dicentrarchus labrax in seawater and following acclimation to fresh water. J. Endocrinol., 191: 473- 480. 2006. 59. Voznesensky, M., Lenz, P.H., Spanings-Pierrot, C., and Towle, D.W. Genomic approaches to detecting thermal stress in Calanus finmarchicus (Copepoda: Calanoida). Journal of Experimental Marine Biology and Ecology 311:37- 46. 2004. 60. Watson, R.D., Lee, K.J., Qiu, S., Luo, M., Umphrey, H.R., Roer, R.D., and Spaziani, E. Molecular cloning, expression, and tissue distribution of crustacean molt-inhibiting hormone. Am. Zoologist 41: 407-417. 2001. 61. Weihrauch, D., Siebers, D., and Towle, D.W. Urea retention in the hemolymph of the shore crab Carcinus maenas during prolonged starvation and a first approach to identify a branchial urea transporter. MDIBL Bulletin 38:19-20. 2000. 62. Weihrauch, D., Ziegler, A., Siebers, D., and Towle, D.W. Molecular characterization of V-type H+-ATPase (B-subunit) in gills of euryhaline crabs and its physiological role in osmoregulatory ion uptake. J. Exp. Biol. 204: 25-37. 2001. 63. Weihrauch, D., Spanings-Pierrot, C., Towle, D.W .Sequence analysis and expression of arginine kinase mRNA in gills of the semi-terrestrial grapsid crab Pachygrapsus marmoratus. Bull. Mt. Desert Island Biol. Lab., 40: 33-34. 2001. 64. Weihrauch, D., Ziegler, A., Siebers, D., and Towle, D.W. Active ammonia excretion across the gills of the green shore crab Carcinus maenas: Participation of Na+/K+-ATPase, V-type H+-ATPase, and functional microtubules. J. Exp. Biol. 205: 2765-2775. 2002. 65. Weihrauch, D., Morris, S., and Towle, D.W. Ammonia excretion in aquatic and terrestrial crabs. J. Exp. Biol. 207, 4491- 4504. 2004. 66. Weihrauch, D., McNamara, J.C., Towle, D.W., and Onken, H. Ion-motive ATPases and active, transbranchial NaCl uptake in the red freshwater crab, Dilocarcinus pagei (Decapoda, Trichodactylidae). J. Exp. Biol. 207, 4623-4631. 2004. 67. Zheng, J., Nakatsuji, T. Roer, R.D., and Watson, R.D. Studies of a receptor guanylyl cyclase cloned from Y-organs of the blue crab (Callinectes sapidus), and its possible functional link to ecdysteroidogenesis. Gen. Comp. Endocrinol. 155: 780-788. 2008. 68. Ziegler, A., Weihrauch, D., Towle, D.W., and Hagedorn, M. Expression of Ca2+-ATPase and Na+/Ca2+-exchanger is up regulated during epithelial Ca2+-transport in hypodermal cells of Porcellio scaber. Cell Calcium 32 (3): 131-141. 2002. 69. Ziegler, A., Weihrauch, D., Hagedorn, M., Towle, D.W., and Bleher, R. Expression and polarity reversal of V-type H+- ATPase during the mineralization-demineralization cycle in Porcellio scaber sternal epithelial cells. J. Exp. Biol. 207, 1749-56. 2004. REPORT TITLES

Invited Review Towle, D.W. Twenty years of molecular biology at the Mount Desert Island Biological Laboratory ....1

Ionic Regulation Buchanan, P.J., Hyndman, K.A., Evans, D.H. Immunolocalization of the prostaglandin E2 receptor protein, EP3, within the gill of the spiny dogfish shark, Squalus acanthias ...... 6 Hyndman, K.A., Evans, D.H. Partial cloning of the longhorn sculpin, Myoxocephalus octodecemspinosus, anion-exchanger-1: Effects of low salinity water on gill AE1 mRNA expression ...... 7 Hyndman, K.A., Stidham, J., Evans, D. A preliminary attempt to knockdown protein expression in Fundulus heteroclitus gill using in vivo morpholinos ...... 8 Petzel, D. Effects of near-freezing temperatures on the serum osmolality and water efflux of isolated gills of the killifish (Fundulus heteroclitus) ...... 9 Lucu, !., Towle, D., Christie, A.E. Stimulation of short-circuit current across lobster (Homarus americanus) epipodite by sinus gland extract ...... 11 Blässe, A., Edwards, S.L., Towle, D.W., Weihrauch, D. Gene expression and localization of the Rhesus-related ammonium transporter in green crabs (Carcinus maenas) exposed to ammonia...... 12 Silva, P., Cronan, M., Hernandez, Y., Epstein, F.H. Mitogen activated protein kinases p38 do not play a role in the secretion of chloride by the rectal gland of Squalus acanthias ...... 14 Silva, P., Spokes, K., Cronan, M., Hernandez, Y., Epstein, F.H. Plasma concentration of common chemicals in Squalus acanthias...... 16 Epstein, F.H., Silva, P., Cronan, M., Hernandez, Y. A thiazide-inhibited transporter does not contribute to chloride secretion by the perfused rectal gland of Squalus acanthias...... 17 Silva, P., Spokes, K.C., Cronan, M., Hernandez, Y., Epstein, F.H. Rate of disposal of a salt load by Squalus acanthias and Raja erinacea...... 19 Shimoda, L.A., Fellner, S.K., Swenson, E.R. Hypoxia-induced Ca2+ responses in spiny dogfish shark (Squalus acanthias) vessels ...... 20 Monette, M.Y., Forbush, B. In vitro and in vivo phosphorylation state of Na-K-Cl cotransporter in the intestine of the euryhaline killifish, Fundulus heteroclitus, in response to varying osmolality...... 23 Flynn, E.E., Chapline, C., Francke, J.A., Swinburne, C.J., Shaw, J. R., Stanton, B. A., Sato, J. D. Molecular cloning of p38 MAP kinase cDNA from killifish (Fundulus heteroclitus) ...... 25 Tilly, B.C., Hogema, B.M., Kelley, C.A., Forrest, J.N., Jr., de Jonge, H.R. Cyclic GMP inhibition of phosphodiesterase III mediates C-type natriuretic peptide (CNP) stimulation of chloride secretion in the rectal gland of the spiny dogfish (Squalus acanthias) ...... 27 Kelley, C.A., Kufner, A., Epstein, W., Melita, A., Hart, M., Tilly, B.C., de Jonge, H.R., Forrest, J.N., Jr. Stimulation of chloride secretion by CNP is mediated by Cyclic GMP inhibition of phosphodiesterase III in the rectal gland of the spiny dogfish, Squalus acanthias: Evidence from in vitro perfusion studies...... 31

Comparative Biochemistry and Molecular Biology Henry, R.P. A carbonic anhydrase repressor acts on the level of gene expression in the euryhaline green crab, Carcinus maenas...... 35 McCall, A.S., Kraft, S., Edelhauser, H.F., Kidder, G.W., Lundquist, R.R., Bradshaw, H.E., Dedeic, Z., Chase, M.J., Clement, E., Conrad, G.W. Mechanism of action of riboflavin + ultraviolet radiation treatment in corneal strengthening: spiny dogfish sharks (Squalus acanthias) vs. rabbits (New Zealand White) ...... 37 Conrad, A.H., Conrad, G.W. Expression of sutural fiber-related genes in corneas of embryonic sharks (Squalus acanthias) ...... 39 Hyndman, K.A., Monaco, E., Evans, D.H. Partial cloning of the killifish, Fundulus heteroclitus, arginine vasotocin receptor 1a...... 42 Merson, R.R., Mattingly, C.J., Planchart, A.J. Tandem duplication of aryl hydrocarbon receptor (AHR) genes in the genome of the spiny dogfish shark (Squalus acanthias) ...... 43 Simard, M., Lage, C., Wray, C. Molecular Variation in the Mitochondrial D-loop of Squalus acanthias from the Gulf of Maine ...... 45 Lage, C., Wray, C. Microsatellite variation in Squalus acanthias from the Gulf of Maine...... 47 LaRue, K., Tarley, M., Wilbur, B., Diamanduros, A., Claiborne, J. Tissue distribution of NHE isoform transcripts in the longhorn sculpin, Myoxocephalus octodecemspinosus ...... 48 Phillips, M., Hyndman, K., Tarley, M., Diamanduros, A., Edwards, S., Claiborne, J. Quantification of RhgC1 in the marine longhorn sculpin (Myoxocephalus octodecemspinosus) ...... 50 Marquis, H.B., Bell, E.P., Miller, E.E., Gilman, M.S., Bond, S.K., Grimaldi, R.M., Ashworth, S.L. Analysis of the Danio rerio cofilin mutant...... 52 Silva, P., Spokes, K.C., Epstein, F.H. Failure to detect a thiazide-sensitive cotransporter in S. acanthias rectal gland and kidney ...... 54 Lee, L. E. J., Kawano, A., Inthavong, B., Dixon, B., Bols, N.C. Establishment of cell cultures from the gastrointestinal tract of Atlantic salmon, Salmo salar...... 55 Hamdoun, A. Reduced intracellular accumulation of calcein by overexpression of fluorescent protein fusions of the multidrug transporter Sp-ABCB1a, in sea urchin (Strongylocentrotus purpuratus) embryos ...... 59 Ho, E., Messier, C., Wang, B., Hibino, T., Rast, J.P. The sea urchin larva as a simple model for immune barrier function: Analysis of immune gene expression and associated bacteria ...... 62 Anderson, M.K. Evolutionary innovations in immunity: the Leydig and epigonal organs as potential sites of B cell development in the little skate, Raja erinacea...... 64

Comparative Physiology Simonik, E., Henry, R. Ammonia excretion and hemolymph ammonia concentrations in the intertidal green crab, Carcinus maenas during emersion ...... 65 Kajiura, S.M., Tallack, S.M.L. Pupil dilation in the spiny dogfish, Squalus acanthias...... 68 Hwang, J., Parton, A., Barnes, D. Expression of the organic solute and steroid transporter in early embryonic development of the little skate, Leucoraja erinacea ...... 69 Staggs, L., Böhme, L., Schiffer, L., Hentschel, D. M., Frowerk, L., Kirsch, T., Haller, H., Schiffer, M. Discovery of novel genes relevant for glomerular filter integrity in zebrafish (Danio rerio) ...... 71 Schiffer, L., Staggs, L., Böhme, L., Hentschel, D. M., Englert, C., Haller, H. Schiffer, M. Live imaging of the developing kidney in zebrafish (Danio rerio) ...... 73 Blair, S., Blässe, A., Weihrauch, D., Edwards, S.L. Ammonia excretion in Atlantic hagfish (Myxine glutinosa) ...... 75 Kratochvilova, H., Edwards, S., Claiborne, J. Expression of Na+/H+ exchanger paralogs in skin of the marine longhorn sculpin (Myoxocephalus octodecemspinosus) ...... 77 Grim, J.M., Crockett, E.L., Yook, H.L., Kriska, T., Hyndman, K.A., Girotti, A.W. Marine fishes are enriched in the enzymatic antioxidant GPx4 relative to mice ...... 79 Simonik, L., Henry, R., Worden, M.K. Comparative physiology of acid-base balance in Carcinus maenas and Homarus americanus acclimated to low salinity...... 81 Preston, R.L., Griffin, N.E., Gary, E.S., Fontaine, E.P., Ruensirikul, S. Effect of salinity on fertilization and development of Fundulus heteroclitus embryos ...... 83 Hartline, D.K., Kong, J.H. Axonal sheaths in two reportedly myelinated polychaete nervous systems: Asychis elongata and Capitella sp. I...... 86 Richards, E.K., Simeone, A., Theodosiou, N.A. Water absorption in the spiral intestine of Leucoraja erinacea...... 88 Swenson, E.R., Eveland, R., Freeman, T., Stone, S. Arterial blood gases at depth in the spiny dogfish (Squalus acanthias) ...... 90 Hunt von Herbing, I., Schroeder, K., Stamford, J. Environmental stress and red blood cell sickling in cold-water marine fishes...... 92

Molecular Toxicology and Xenobiotic Transport Madejczyk, M.S., Boyer, J., Ballatori, N. Hepatobiliary transport of manganese in the little skate, Leucoraja erinacea...... 93 Germ, K., Coffman, J.A., Robertson, A.J. Microarray analysis of gene expression changes induced by micromolar zinc in embryos of the sea urchin, Strongylocentrotus purpuratus ...... 96 Cai, S., Han, K., Mennone, A.t, Gaskins, H.R., Boyer, J.L. Identification of a full-length Abcb11 transporter in Ciona intestinalis...... 99 Mahringer, A., Seymour, A., Miller, D.S., Fricker, G. Aryl hydrocarbon receptor-dependent regulation of the ABC transporters in kidney tubules from killifish (Fundulus heteroclitus) ...... 102 Mattingly, C., Hampton, T., Brothers, K. M., Griffin, N. E., Planchart, A. Perturbation of defense pathways by low-dose arsenic exposure in zebrafish (Danio rerio) embryos...... 103 Planchart, A., Hampton, T., Mattingly, C. Identification of a novel target of 2,3,7,8- Tetrachlorodibenzo-p-dioxin (TCDD) involved in Zebrafish (Danio rerio) craniofacial development...... 107 Davis, A.P., Murphy, C.G., Saraceni-Richards, C. A., Rosenstein, M. C., Wiegers, T. C., Mattingly, C.J. Comparative Toxicogenomics Database (CTD): a knowledgebase and discovery tool for chemical-gene-disease networks...... 109 Computational Biology and Bioinformatics Congdon, C.B., Thete, J., Mattingly, C.J., Nava, G.M., Gaskins, H.R. Confirmation of Computationally Inferred Putative Functional Elements ...... 111 Ecological Genetics Christie, A.E., Lenz, P.H., Hassett, R.P., Smith, C.M., Lona, P.B., Ünal, E., Bucklin, A., Towle, D.W. Calanus finmarchicus cDNA library: a genomic tool for studies of zooplankton physiological ecology ...... 112 Hartline, D.K., Kong, J. Development of the giant-axon sheaths in larval lobsters, Homarus americanus...... 114 Bentivegna, C.S., Oh, J., Doan, K., DiPietro, C. Hemoglobin as a biomarker for heavy metals using aquatic midge fly larvae, Chironomidae...... 116 Colletti, S.L., Kidder, G., Disney, J. Growth rate of eelgrass (Zostera marina) in Frenchman Bay ...120 Connell, L. Selective pressure of paralytic shellfish toxins on populations of softshell clam, Mya arenaria ...... 121 PLATES

Plate 1. Blässe, et al., p. 12. Immunolocalization of RhCM in posterior gills of Carcinus maenas. A) Immunofluorescence microscopy with anti-RhCM antibody showing apical staining of the posterior gill lamellae (white arrows). B) Double immunostaining of posterior gill with anti-RhCM antibody (red) and anti-Na-K-ATPase antibody (green) showing apical staining for RhCM and basolateral (white arrows) staining for the Na-K-ATPase. C) Immunofluorescence microscopy without primary antibody (control) showed no significant staining. D) Phase contrast image showing the central stem and lamellae of posterior gills.

Plate 2. Blässe, et al., p. 13. Relative gene expression changes in posterior gills of ammonia-exposed Carcinus maenas. Posterior gills were collected after 2 h, 6 h, 24 h, 7 days and 14 days of ammonia exposure (1 mmol·l-1).

Numbers represent log2 of expression ratios (ex-posed/control); positive values represent up-regulation, negative values represent down-regulation (means ±S.E.M, N=6).

Plate 3. Hamdoun, p. 60. Equatorial view of several cells of a 12h old sea urchin embryo showing localization of Sp- ABCB1a (red) and calcein accumulation (green) in a 1 µM PSC833 treated embryo. The forming blastocoel is seen in the lower left corner of the micrograph. Sp-ABCB1a::mCherry localizes to the apical microvillar surface of sea urchin embryo blastomeres. Intracellular calcien compartmentalizes in vesicles or organelles within cells.

Plate 4. Ho, E., et al., p. 63. Pigment cells migrate to the gut epithelium and immunity genes are upregulated when feeding larvae are exposed to strains of Vibrio bacteria. A,B DIC images of guts from live larvae. Pigment cells are absent around the gut of larvae grown under normal conditions (A) but numerous red pigment cells, which appear as dark cells in this image, surround the gut of a larva exposed to a Vibrio splendidus-like bacterium isolated at MDIBL (B). C, D In situ hybridization demonstrating that a 185/333 gene marker of immune activation is expressed in blastocoelar cells (C) and a polyketide synthase is predominantly expressed in gut associated pigment cells (D) larvae exposed to Vibrio. Unexposed larvae show low or no in situ signal with these probes (not shown).

Plate 5. Hwang, J-H., et al., p. 69. In situ hybridization for Ost-alpha and OST-beta at stage 28 in the little skate embryo. (A), Top, left; embryo stained with digoxigenin (UTP)-labeled sense (control) probe for Ost-alpha; (B), Top, right; embryo stained with digoxigenin-labeled antisense probe for Ost-alpha. (C), Bottom, left; embryo labeled with sense (control) fluorescein-12 (UTP)-labeled probe for Ost-beta. (D), Bottom, right; embryo labeled with fluorescein- 12-labeled antisense probe for Ost-beta. Embryos exposed to digoxigenin were treated with anti-digoxigenin. Stains were carried out with 4-nitro blue tetrazolium chloride, 5-bromo-4-chloro-3 indolyl-phosphate (digoxigenin) or Fast Red (flourescein).

Plate 6. Staggs, L., et al., p. 71. Functional analysis of glomerular filter integrity in zebrafish after Nostrin- knockdown. (a) Images of zebrafish eyes in control and siNostrin injected embryos injected with 70kD-FITC-labelled dextrane. Fluorescent dye was injected in the cardinal-vein of anaesthetized zebrafish larvae 48-72 hours post fertilization and images were taken in individual fish 1, 24 and 48 hours post injection (hpi).

Plate 7. Schiffer, L., et al., p. 73. Expression of wt1b-eGFP in zebrafish 48 hrs post fertilization. Wt1b-eGFP labels the glomerulus (white arrowhead) as well as the proximal tubules (white double arrows) visualized by regular fluorescence microscopy.

Plate 8. Schiffer, L., et al., p. 74. Expression of wt1b-eGFP in proximal tubular cells of a zebrafish embryo 172hrs post fertilization. Single cells of the proximal tubules are clearly visible as well as the tubular lumen (white asterisk) and vesicles, presumably a hint for ongoing endocytosis activity, can be captured (double arrows).

Plate 9. Kratochvilova, H., et al., p. 78. Light and immunofluorescence micrographs of skin cross-sections of Myoxocephalus octodecemspinosus. Fish skin morphology (A) showing dermal (De) and epidermal (Ep) layer with mucous glands (MG). Immunoreactivity of NKA (green) and three isoforms of Na+/H+ exchanger (red); NHE2b (B), NHE3 (C), and NHE8 (D). Scale bar = 50 !m.

INVITED REVIEW

Twenty Years of Molecular Biology at the Mount Desert Island Biological Laboratory

David W. Towle Mount Desert Island Biological Laboratory, Salsbury Cove, ME 04672

Molecular biology at MDIBL got its start through the confluence of four important events. Beginning in August 1987 and continuing for four years, summer investigator Edward J. Benz, Jr., presented an annual seminar on molecular cloning as applied to membrane transporters, alerting his colleagues to the usefulness of the then new techniques in elucidating some of the historically interesting questions of MDIBL investigators. During the summer of 1988, Alison Morrison-Shetlar arrived from the Max-Planck-Institut für Systemphysiologie at the invitation of Rolf Kinne, bringing a suite of molecular techniques to share with colleagues and to prove that molecular biology could be accomplished successfully in the rustic laboratories of MDIBL. Dr. Morrison-Shetlar continued to encourage molecular biology approaches as a summer investigator at MDIBL for several years. The third and possibly most auspicious event occurred in 1988, when the invention of the polymerase chain reaction (PCR) was reported by Kary Mullis and colleagues 27, making it possible for even novice molecular biologists to identify and amplify specific genes and transcripts in their tissues of interest. In 1990, at the invitation of John N. Forrest, Jr., Paul Schofield and D. Stephen C. Jones of the MRC Molecular Genetics Unit in Cambridge, England, presented a seminar at MDIBL on applications of PCR; subsequently they too became summer investigators for several seasons, presenting a 3-part seminar/workshp in 1991 on molecular techniques. The outcome of these events was a steady rise in the number of articles in the Bulletin that employed molecular biological techniques, starting with two in the 1989 issue with a burst to 11 in 1992 (Figure 1).

35 30

25 Figure 1. Number of Bulletin articles 20 employing molecular biological techniques 15 by year of publication, generally representing work at MDIBL during the 10 previous year.

Number of Bulletin Articles Bulletin of Number 0 1985 1990 1995 2000 2005 2010

Among the accomplishments of the early period of molecular research at MDIBL was the cloning and sequencing of transcripts encoding a number of proteins of interest to MDIBL investigators. A C- type natriuretic peptide was identified in shark heart 29 and a synthetic peptide based on the translated cDNA sequence was subsequently shown to stimulate chloride secretion by the rectal gland 15. A Na+/H+ exchanger was identified in gills of the green crab 34-36 and several isoforms of the Na+/H+ exchanger were discovered in teleost gills 8, 16. The sodium-D-glucose cotransporter was cloned from several species and its expression analyzed in tissues of the winter flounder 21, 22, 31. Molecular studies of the yolk protein vitellogenin were initiated in skate and turtle 18, 25 and a variety of transcripts were identified in snail tissues, including atrial natriuretic peptide 9, 10.

Simultaneously with the initiation of the identification and sequencing of gene transcripts, functional studies of transporters and regulatory proteins were developed using the Xenopus oocyte as an expression system. Among the early examples of this technology, based on the ability to prepare molecular entities that could be expressed in oocytes, were the demonstrations of cAMP- or natriuretic peptide-stimulated chloride current following injection of mRNA from skate or shark 39, 40. Potassium channels in winter flounder intestine and shark heart were identified using the same technique 11, 20.

Since 1998, the number of Bulletin articles reporting the use of molecular techniques have remained generally in the 15-20 range each year (Fig. 1). Too numerous to mention individually, these studies were facilitated by the inauguration in 1999 of the Marine DNA Sequencing and Analysis Center, a core facility designed to provide in-house nucleic acid analysis services to the laboratory community as well as investigators elsewhere. With the leadership of John Forrest, MDIBL Director, and the assistance of Hermann Haller, then at Humboldt University in Berlin, the center was initially equipped with an ABI 377 DNA sequencing system. Christine Smith, a biochemistry/English graduate of Bowdoin College, was hired to staff the center and became trained in sequencing technology in Germany and at Johns Hopkins University. Summer investigator David Towle was appointed center director in 1999 and moved to MDIBL full-time in 2001 as senior scientist. With funding from the Maine Science and Technology Foundation, two ABI 3100 16-capillary sequencing systems were installed in 2000, enabling higher quality and faster sequencing service. A grant from the National Science Foundation enabled the installation of a quantitative real-time PCR system in 2001 and in 2002 a Biomedical Research Infrastructure Network (BRIN) grant in functional genomics, obtained by Administrative Director Patricia Hand, enabled the addition of microelectrophoretic analysis of nucleic acids as well as DNA microarray printing and scanning.

In 2003, three normalized cDNA libraries were produced from multiple tissues of the dogfish shark Squalus acanthias, the little skate Leucoraja erinacea, and the lobster Homarus americanus. These libraries served as the basis for the production of expressed sequence tags (ESTs) to facilitate gene identification and subsequent molecular biological studies in these species. A processing protocol was developed to streamline the EST projects, including the use of a robotic colony picker, automated plasmid purification, and Linux-based computational analysis of the resulting raw sequence data in preparation for submission to GenBank. In 2004, additional normalized cDNA libraries were produced from multiple tissues of the green shore crab Carcinus maenas and the killifish Fundulus heteroclitus, rectal gland of Squalus acanthias, liver of Leucoraja erinacea, and whole copepod Calanus finmarchicus. These EST projects were funded initially by the BRIN grant and more recently by the Maine IDeA Network of Biomedical Research Excellence (INBRE) program at MDIBL. In addition, a recent contract from the Atlantic Canada Opportunities Agency has enabled significant expansion of ESTs for lobster. As of January 13, 2009, a total of 98,991 expressed sequence tags from six marine species have been submitted to GenBank by the Marine DNA Sequencing and Analysis Center (Table 1). External sequencing services were employed to produce an additional 10,909 ESTs for shark and 10,425 ESTs for skate. The small set of ESTs for killifish were the first to be released publicly for this species but then became part of a much larger set produced for the Fundulus Genomics Consortium 2. At NCBI, 3,312 killifish sequences from the MDIBL set were grouped into 946 UniGene entries (putative genes) 38.

Expressed sequence tags have proven very useful in the identification of genes in the six species so far examined at MDIBL. Non-degenerate primers for PCR amplification are made possible, making the initial step in many molecular studies less troublesome. The ESTs will also provide a basis for annotating genomes when these become available. Bacterial clones containing each EST sequence are

Table 1. Expressed sequence tag production at MDIBL since the inception of the program in early 2004.

Normalized library Number of Number of ESTs Percent of clones sequenced submitted total ESTs Squalus acanthias Multiple tissues 21,888 15,120 15 Squalus acanthias Rectal gland 6,912 6,576 7 Leucoraja erinacea Multiple tissues 16,415 13,885 14 Leucoraja erinacea Liver 6,528 6,016 6 Fundulus heteroclitus Multiple tissues 7,200 5,663 6 Homarus americanus Multiple tissues 30,720 25,512 26 Carcinus maenas Multiple tissues 18,528 15,584 16 Calanus finmarchicus Whole organism 11,520 10,635 11 TOTALS 119,711 98,991 101 provided upon request to investigators around the world. The publicly-available EST data and the clones themselves have served as the foundation for a growing number of studies, including identification of transcripts encoding neuropeptides in crustaceans 3, 5-7, 13, 14, antimicrobial proteins in lobster 1, 4, carbonic anhydrase isoforms in two crab species 17, 30, fibroblast growth factor receptors in shark and skate 23, 28, cytochrome P450 in green crab 12, nudT16 RNA-decapping enzyme in green crab, skate, and shark 33, and many others.

One of the major goals of the expressed sequence tag projects was the development of DNA microarray capabilities for several of the non-model organisms in frequent use at MDIBL. Expressed sequence tags for a given species are clustered computationally 24 to derive a set of mostly unique sequences, which in turn are used as the basis for designing 50-mer oligonucleotides for printing arrays. Up to date, microarrays have been constructed in house for four species: killifish Fundulus heteroclitus (617 selected features), green crab Carcinus maenas (4,462 features), lobster Homarus americanus (15,678 features), and copepod Calanus finmarchicus (1,012 selected features). Most of the work using these arrays is in progress; however, a preliminary account of the application of the Carcinus array to a study of salinity adaptations has appeared 32, 37. In addition to the in-house DNA arrays, other microarray platforms designed for model species are in use at MDIBL19, 26.

Molecular biology facilities at MDIBL have received support from the following sources: Maine Science and Technology Foundation, Maine Biomedical Research Infrastructure Network and Maine IdeA Network of Biomedical Research Excellence (NIH/NCRR P20-RR016463), National Science Foundation (IBN-0114597 and IOB-0543860), and Atlantic Canada Opportunities Agency.

1. Beale KM, Towle DW, Jayasundara N, Smith CM, Shields JD, Small HJ, and Greenwood SJ. Anti- lipopolysaccharide factors in the American lobster Homarus americanus: molecular characterization and transcriptional response to Vibrio fluvialis challenge. Comp. Biochem. Physiol. D 3: 263-269, 2008. 2. Burnett KG, Bain LJ, Baldwin WS, Callard GV, Cohen S, DiGiulio RT, Evans DH, Gómez-Chiarri M, Hahn ME, Hoover CA, Karchner SI, Katoh F, MacLatchy DL, Marshall WS, Meyer JN, Nacci DE, Oleksiak MF, Rees BB, Singer TD, Stegeman JJ, Towle DW, VanVeld PA, Vogelbein WK, Whitehead A, Winn RN, and Crawford DL. Fundulus as the premier teleost model in environmental biology: Opportunities for new insights using genomics. Comp. Biochem. Physiol. D 2: 257-286, 2007. 3. Christie AE, Stemmler EA, Peguero B, Messinger DI, Provencher HL, Scheerlinck P, Hsu YW, Guiney ME, de la Iglesia HO, and Dickinson PS. Identification, physiological actions, and distribution of VYRKPPFNGSIFamide (Val1)-SIFamide) in the stomatogastric nervous system of the American lobster Homarus americanus. J. Comp. Neurol. 496: 406-421, 2006. 4. Christie AE, Rus S, Goiney CC, Smith CM, Towle DW, and Dickinson PS. Identification and characterization of a cDNA encoding a crustin-like, putative antibacterial protein from the American lobster Homarus americanus. Mol. Immunol. 44: 3333-3337, 2007. 5. Christie AE, Cashman CR, Brennan HR, Ma M, Sousa GL, Li L, Stemmler EA, and Dickinson PS. Identification of putative crustacean neuropeptides using in silico analyses of publicly accessible expressed sequence tags. Gen. Comp. Endocrinol. 156: 246-264, 2008. 6. Christie AE, Cashman CR, Stevens JS, Smith CM, Beale KM, Stemmler EA, Greenwood SJ, Towle DW, and Dickinson PS. Identification and cardiotropic actions of brain/gut-derived tachykinin-related peptides (TRPs) from the American lobster Homarus americanus. Peptides 29: 1909-1918, 2008. 7. Christie AE, Sousa GL, Rus S, Smith CM, Towle DW, Hartline DK, and Dickinson PS. Identification of A-type allatostatins possessing -YXFGI/Vamide carboxy-termini from the nervous system of the copepod crustacean Calanus finmarchicus. Gen. Comp. Endocrinol. 155: 526-533, 2008. 8. Claiborne JB, Blackston CR, Choe KP, Dawson DC, Harris SP, Mackenzie LA, and Morrison-Shetlar AI. A mechanism for branchial acid excretion in marine fish: identification of multiple Na+/H+ antiporter (NHE) isoforms in gills of two seawater teleosts. J. Exp. Biol. 202: 315-324, 1999. 9. Conrad AH, Stephens AP, Schwarting SS, and Conrad GW. Atrial natriuretic peptide (ANP) gene expression as a marker for cardiac muscle differentiation in Ilyanassa obsoleta. Bull. Mt. Desert Island Biol. Lab. 33: 15-16, 1994. 10. Conrad AH, Schwarting SS, and Conrad GW. Natriuretic peptide expression in Ilyanassa obsoleta. Bull. Mt. Desert Island Biol. Lab. 34: 103-104, 1995. 11. Cunningham SA, Morris AP, and Frizzell RA. Expression of an epithelial K+ channel from winter flounder intestine in Xenopus oocytes. Bull. Mt. Desert Island Biol. Lab. 32: 141-142, 1993. 12. Dam E, Rewitz KF, Styrishave B, and Andersen O. Cytochrome P450 expression is moult stage specific and regulated by ecdysteroids and xenobiotics in the crab Carcinus maenas. Biochem. Biophys. Res. Commun. 377: 1135- 1140, 2008. 13. Dickinson PS, Stevens JS, Rus S, Brennan HR, Goiney CC, Smith CM, Li L, Towle DW, and Christie AE. Identification and cardiotropic actions of sulfakinin peptides in the American lobster Homarus americanus. J. Exp. Biol. 210: 2278-2289, 2007. 14. Dickinson PS, Stemmler EA, Cashman CR, Brennan HR, Dennison B, Huber K, Peguero B, Rabacal W, Goiney CC, Smith CM, Towle DW, and Christie AE. SIFamide peptides in clawed lobsters and freshwater crayfish (Crustacea, Decapoda, Astacidea): a combined molecular, mass spectrometric and electrophysiological investigation. Gen. Comp. Endocrinol. 156: 347-360, 2008. 15. Forrest JN, Jr., Kelley GG, Forrest JK, Opdyke D, Schofield JP, and Aller C. Synthetic shark CNP based on the amino acid sequence of cloned pre-pro shark CNP potently stimulates chloride secretion in the perfused shark rectal gland. Bull. Mt. Desert Island Biol. Lab. 31: 71-72, 1992. 16. Harris SP, Claiborne JB, Pouyssegur J, and Dawson DC. Transcripts homologous to Na/H antiporter isoforms, NHE-1, in mRNA from the long horned sculpin (Myoxocephalus octodecimspinosus) and winter flounder (Pseudopleuronectes americanus). Bull. Mt. Desert Island Biol. Lab. 32: 128-130, 1993. 17. Henry RP, Thomason KL, and Towle DW. Quantitative changes in branchial carbonic anhydrase activity and expression in the euryhaline green crab, Carcinus maenas, in response to low salinity exposure. J. Exp. Zool. A 305: 842-850, 2006. 18. Jones DSC, Benson SJ, and Callard IP. The cloning and partial characterization of two cDNAs encoding the yolk protein vitellogenin from the painted turtle, Chrysemys picta. . Bull. Mt. Desert Island Biol. Lab. 32: 139-140, 1993. 19. Mattingly C and Planchart A. Arsenic-mediated perturbation of a developmental gene network in zebrafish (Danio rerio). Bull. Mt. Desert Island Biol. Lab. 47: 106-108, 2008. 20. Maylie J, Varnum M, and Morad M. Characterization of a voltage-gated cardiac potassium channel in Squlaus acanthias and its expression in Xenopus oocytes injected with mRNA isolated from hearts of Squalus acanthias. Bull. Mt. Desert Island Biol. Lab. 33: 29-30, 1994. 21. Morrison-Shetlar A, Moore R, Scholermann B, Kinne D, and Shetlar R. Sequence comparison of the sodium-D- glucose cotransport system in a variety of aquatic organisms. Bull. Mt. Desert Island Biol. Lab. 31: 111-112, 1992. 22. Morrison-Shetlar A and Moore R. Comparative studies on the sodium-D-glucose cotransport system in rabbits and dogfish (Squalus acanthias). . Bull. Mt. Desert Island Biol. Lab. 32: 131-132, 1993. 23. Nishikawa R, Blay E, Jr., and Sato JD. Expression of fibroblast growth factor receptors 1, 2, 3, and 4 in selected tissues of the dogfish shark, Squalus acanthias Bull. Mt. Desert Island Biol. Lab. 46: 87-89, 2007. 24. Parkinson J, Anthony A, Wasmuth J, Schmid R, Hedley A, and Blaxter M. PartiGene--constructing partial genomes. Bioinformatics 20: 1398-1404, 2004. 25. Perez LE and Callard IP. Identification of vitellogenin in the little skate (Raja erinacea). Comp. Biochem. Physiol. B 103: 699-705, 1992. 26. Robertson AJ and Coffman JA. A microarray platform for transcriptome analysis in embryos of the sea urchin, Strongylocentrotus purpuratus. Bull. Mt. Desert Island Biol. Lab. 47: 71, 2008. 27. Saiki RK, Gelfand DH, Stoffel S, Scharf SJ, Higuchi R, Horn GT, Mullis KB, and Erlich HA. Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science 239: 487-491, 1988. 28. Sato JD, Graber JH, Crow JF, Okamoto T, and Nishikawa R. Conservation of fibroblast growth factor receptor sequences in vertebrate evolution. Bull. Mt. Desert Island Biol. Lab. 46: 54-57, 2007. 29. Schofield JP, Jones DS, and Forrest JN, Jr. Identification of C-type natriuretic peptide in heart of spiny dogfish shark (Squalus acanthias). Am. J. Physiol. 261: F734-F739, 1991. 30. Serrano L, Halanych KM, and Henry RP. Salinity-stimulated changes in expression and activity of two carbonic anhydrase isoforms in the blue crab Callinectes sapidus. J. Exp. Biol. 210: 2320-2332, 2007. 31. Shetlar R and Simokat K. Effects of diet on Na+-D-glucose cotransporter mRNA expression in intestine and kidney of the winter flounder (Pseudopleuronectes americanus). Bull. Mt. Desert Island Biol. Lab. 32: 133-134, 1993. 32. Stillman JH, Colbourne JK, Lee CE, Patel NH, Phillips MR, Towle DW, Eads BD, Gelembuik GW, Henry RP, Johnson EA, Pfrender ME, and Terwilliger NB. Recent advances in crustacean genomics. Integ. Comp. Biol. 48: 852-868, 2008. 33. Taylor MJ and Peculis BA. Evolutionary conservation supports ancient origin for Nudt16, a nuclear-localized, RNA- binding, RNA-decapping enzyme. Nucleic Acids Re.s 36: 6021-6034, 2008. 34. Towle DW, Kordylewski M, Bowring SW, and Morrison-Shetlar AI. Molecular biology of the electrogenic sodium/hydrogen antiporter in gills of the green shore crab Carcinus maenas. Bull. Mt. Desert Island Biol. Lab. 31: 81, 1992. 35. Towle DW, Kordylewski M, and Bowring SW. Sequence analysis of putative Na+/H+ antiporter cDNA from the shore crab Carcinus maenas. Bull. Mt. Desert Island Biol. Lab. 32: 135-136, 1993. 36. Towle DW, Rushton ME, Heidysch D, Magnani JJ, Rose MJ, Amstutz A, Jordan MK, Shearer DW, and Wu WS. Sodium-proton antiporter in the euryhaline crab Carcinus maenas: Molecular cloning, expression and tissue distribution. J. Exp. Biol. 200: 1003-1014, 1997. 37. Towle DW and Terwilliger NB. Salinity effects on transporter gene expression patterns in gills of the green shore crab Carcinus maenas. Bull. Mt. Desert Island Biol. Lab. 47: 46-47, 2008. 38. http://www.ncbi.nlm.nih.gov/UniGene/library.cgi?ORG=Fhe&LID=17325 39. Worrell RT, Feero WF, Dawson DC, and Frizzell RA. Natriuretic peptide (CNP) stimulation of chloride conductance in Xenopus oocytes expression mRNA from rectal gland of the dogfish shark Squalus acanthias. . Bull. Mt. Desert Island Biol. Lab. 31: 75-76, 1992. 40. Worrell RT, Feero WG, Cunningham SA, Howard M, Dawson DC, and Frizzell RA. c-AMP-stimulated chloride current in Xenopus oocytes expression mRNA from the alkaline gland of the little skate Rana erinacea. Bull. Mt. Desert Island Biol. Lab. 31: 73-74, 1992.

Immunolocalization of the prostaglandin E2 receptor protein, EP3, within the gill of the spiny dogfish shark, Squalus acanthias

Patrick J. Buchanan, Kelly A. Hyndman and David H. Evans Department of Zoology, University of Florida, Gainesville, FL 32611

5 Prostaglandins are synthesized ubiquitously in every cell . In fishes, prostaglandin E2 (PGE2) is hypothesized to play an important osmoregulatory role because it inhibits net chloride transport in the 4 killifish operculum . PGE2 binds to one of four different receptors, EP1, EP2, EP3 and EP4, and Evans 4 et al. hypothesized that the EP3 receptor may regulate local ion transport in the fish gill. Since the EP3 receptor was recently sequenced from the gill of the spiny dogfish shark, Squalus acanthias2, the purpose of this study was to determine the cellular localization of the EP3 receptor (protein) in the gill of this species.

Sections of spiny dogfish shark gill were prepared as previously described1 and double-labeled using anti-EP3 (Santa Cruz Biotenchologies, 1/100) with 3, 3’-diaminobenzidine tetrahydrochloride (DAB, brown chromagen) and anti-Na+, K+-ATPase (!5, a marker for the mitochondrion rich cell (MRC)) (1/100) with Vector SG (blue chromagen). As seen in figure 1, cells expressing the EP3 receptor (# cells) were found in the interlamellar region along the filament. A few cells on the lamellae were also immunopositive for the EP3 receptor. These cells were not immunoreactive for !5 (* cells). The immunolocalization of the EP3 receptor to a cell adjacent to the ion-transporting cell of the gill (the MRC) is consistent with the localization found in the gill of the killifish, Fundulus heteroclitus1.

!"#$%&'()*' !"#$%&'+)*'

Figure 1: Immunolocalization of EP3 and !5 on sequential spiny dogfish shark gill sections. The * indicates cells immunopositive for !5 (the mitochondrion-rich cells) and # indicates cells immunopositive for the EP3 receptor.

This project was supported by NSF IOB-0519579 to DHE.

1. Buchanan, PJ, Hyndman, KA and DH Evans. Immunolocalization of the prostaglandin E3 receptor in the gill of the killifish (Fundulus heteroclitus). Bull Mt Desert Isl Biol Lab 47: 45, 2008. 2. Buchanan, PJ, Hyndman, KA and DH Evans. Prostaglandin E3 receptor from the spiny dogfish shark, Squalus acanthias. Bull Mt Desert Isl Biol Lab 47: 44, 2008. 3. Evans, DH, Piermarini, PM and KP Choe. The multifunctional fish gill: dominant site of gas exchange, osmoregulation, acid-base regulation, and excretion of nitrogenous waste. Physiol Rev 86: 86-177, 2005. 4. Evans, DH, Rose, RE, Roeser, JM and JD Stidham. NaCl transport across the opercular epithelium of Fundulus heteroclitus is inhibited by an endothelin to NO, superoxide, and prostanoid signaling axis. Am J Physiol Regul Integr Comp Physiol 286: R560-R568, 2004. 5. Knight, J, Holland, JW, Bowden, LA, Halliday, K. and AF Rowley. Eicosanoid generating capacities of different tissues from the rainbow trout, Oncorhynchus mykiss. Lipids 30: 451-458, 1995. Partial cloning of the longhorn sculpin, Myoxocephalus octodecemspinosus, anion-exchanger-1: Effects of low salinity water on gill AE1 mRNA expression.

Kelly A. Hyndman and David H. Evans Department of Zoology, University of Florida, Gainesville, FL 32611

The anion exchanger-1 (AE1 aka BAND3 or SLC4A1) exchanges chloride for bicarbonate across plasma membranes and plays a central role in carbon dioxide respiration. However, it may also be an important mechanism for fishes to absorb chloride across the gills in dilute environments. Recently, Tang and Lee3 reported that fresh water-acclimated Tetraodon nigroviridis had a 23-fold higher expression of gill AE1 than seawater T. nigroviridis. We previously determined that the longhorn sculpin (Myoxocephalus octodecemspinosus) can tolerate short term exposure to dilute environments2. The purpose of this study was first to confirm that AE1 is expressed in the longhorn sculpin gill and second to determine what effect acclimation to low salinity water has on gill AE1 mRNA expression.

Longhorn sculpin were purchased from local Table 1: Primers used in the study. Degen=degenerate fisherman on MDI. After being kept in 100% seawater (SW) for several days, the sculpin were randomly assigned to the following treatments: 100% SW, 20% SW or 10% SW for 24 h or 100% SW, 20% SW or 10% SW for 72 h (as previously described2). Half of the second gill arch from the right side was snap frozen, and total RNA extracted using Tri-reagent. Gill cDNA was made using Invitrogen’s Superscript III cDNA kit. A portion of the cDNA was probed with degenerate primers designed against homologous regions of the vertebrate AE1 (Table 1). We cloned a product of 975 bp and it was Figure 1. Sculpin gill AE1 mRNA sequenced at the Marine DNA Sequencing Center at MDIBL. levels in fish acclimated to different BLAST searches confirmed this was the sculpin AE1 ortholog. salinities for 24 or 72 hours. Next, specific primers were designed to amplify a product of 99 bp across a predicted exon/exon boundary to inhibit any genomic amplification in our quantitative Real-Time PCR (qPCR, Table 1). Using Invitrogen’s Platinum SYBR Green mastermix and the primers, qPCR reactions were run with 1/10 (in sterile water) diluted cDNA. In addition, a cDNA 10-fold dilution curve was run on each plate. All values were normalized to L8 mRNA levels as previously described2.

As shown in Figure 1, after 24 and 72 hours in 20% SW there was a decrease in AE1 mRNA level, although it was not statistically significant. The current model of acclimation to FW predicts there would be an increase in AE1 expression3; however the marine sculpin cannot survive in salinities below 20%1,2, and it may be this inability to up regulate AE1 and other transporters that leads to mortality in dilute environments. This work was funded by NSF IOB-0519579 to DHE. 1. Claiborne JB, Walton J and Compton-McCullough, D. Acid-base regulation, branchial transfers and renal output in a marine teleost fish (the long-horn sculpin Myoxocephalus octodecemspinosus) during exposure to low salinities. J Exp Biol 193: 79-95, 1994. 2. Hyndman, KA and Evans, DH. Short-term low-salinity tolerance by the longhorn sculpin, Myoxocephalus octodecispinosus. J Exp Zool 311A, 45-56, 2008. 3. Tang, CH and Lee, TH. The effect of environmental salinity on the protein expression of Na+/K+-ATPase, Na+/K+/2Cl- cotransporter, cystic fibrosis transmembrane conductance regulator, anion exchanger 1, and chloride channel 3 in the gills of a euryhaline teleost, Tetraodon nigroviridis. Comp Biochem Physiol 147: 521-528, 2007. A preliminary attempt to knockdown protein expression in Fundulus heteroclitus gill using in vivo morpholinos

Kelly A. Hyndman1, James Stidham2 and David H. Evans1 1Department of Zoology, University of Florida, Gainesville, FL 32611 2Department of Biology, Presbyterian College, Clinton, SC 29325

The ability to inhibit protein expression in tissues and cells is an integral method in determining protein functions. Previously, we attempted to knockdown protein expression in an ex vivo preparation using Gene Tools (Philomath, OR) endo-porter system and morpholinos1. In this study, we have attempted to use Gene Tools new delivery system, the in vivo morpholino, to knock down cystic fibrosis transmembrane conductance regulator (CFTR) expression in killifish acclimated to seawater. CFTR was the target because the complete CFTR genomic sequence is available in GenBank for F. heteroclitus, an antibody that recognizes CFTR in F. heteroclitus is commercially available3, and CFTR is highly expressed in F. heteroclitus during acclimation to SW, with very low expression during acclimation to FW2. The CFTR morpholino was designed against exon 7 and intron 6 of F. heteroclitus CFTR (accession AY028275), in order to block the pre-mRNA splice site between intron 6 and exon 7, resulting in exon 7 being excised from the mature mRNA. This smaller mRNA (114 bp smaller) could then be detected using RT-PCR. We designed primer pairs around this region to amplify a product of 800 bp in control animals and 686 bp in morpholino animals. Killifish (n=1 per dose) were injected intraperitoneally with either 15µg/g body mass, 20µg/g, 30µg/g or saline (control) once a day, for three days, then sacrificed on day 4. Gills and intestine were excised, and total RNA extracted using TRI Reagent and cDNA made using Invitrogen’s Superscript III cDNA synthesis kit. Standard RT-PCR was run using these samples and aforementioned primers. As seen in Figure 1, we only observed the control band of 800 bp, suggesting that we did not knock down CFTR in the morpholino animals. We speculate that the in vivo delivery system Figure 1. RT-PCR of F. heteroclitus gill and intestine from saline has not been optimized for ectothermic (control) or morpholino injected fish. The expected morpholino animals, and thus the morpholino was not induced mRNA band is depicted. taken up by our fish tissues; alternatively, the morpholino must be injected during salinity transfer when CFTR mRNA is being made (Stanton, pers.obs). We are confident that the dose and 3 day injection of the morpholino used was sufficient to elicit an exon-skipping response, as the maximum dose advised to be used is 20 µg/g. This work was funded by NSF IOB-0519579 to DHE.

1. Choe KP, Stidham J and Evans DH. Progress towards a method of targeted protein knockdown in Fundulus heteroclitus. MDIBL Bulletin 45: 44. 2. Katoh F and Kaneko T. Short-term transformation and long-term replacement of branchial chloride cells in killifish transferred from seawater to freshwater, revealed by morphofunctional observations and a newly established ‘timer differential double fluorescent staining’ technique. J Exp Biol 206: 4113-23, 2003. 3. Singer TD, Tucker SJ, Marshall WS and Higgins CF. A divergent CFTR homologue: highly regulated salt transport in the euryhaline teleost F. heteroclitus. Am J Physiol 274: C715-23, 1998. Effects of near-freezing temperatures on the serum osmolality and water efflux of isolated gills of the killifish (Fundulus heteroclitus)

David Petzel DepartmentEffects ofof Biomedicalnear-freezing Sciences, temperatures Creighton on the serum University osmolality Schoo andl of water Medicine, efflux of Omaha, isolated NE,gills 68178of the killifish (Fundulus heteroclitus) In marine! teleosts serum osmolality is determined by the rate of salt influx and water efflux across "#$%&!'()*(+! the surface of the fish. Studies have shown that the gill surface area amounts to about 70% of the "(,#-).(/)!01!2%0.(&%3#+!43%(/3(56!7-(%89)0/!3 :/%$(-5%);!43900+!01!<(&%3%/(6!=.#9#6!>?6!@ABCA! surface! area for exchange of salt and water . The water efflux across isolated gills of fishes has been 4 shown!!!!!!!!D/!.#-%/(!)(+(05)5!5(-E to be sensitive to acclimation.!05.0+#+%);!%5!&()(-.%/(&!F;!)9(!-#)(!01!5#+)!%/1+EG!#/&!H#)(-!(11+EG!#3-055!)9(! temperature . The effects of near-freezing temperature on serum osmolality5E-1#3(!01!)9(!1%59I!!4)E&%(5!9#$(!590H/!)9#)!)9(! has previously been reported for the8%++!5E-1#3(!#-(#!#.0E/)5!)0!#F0E)!CJK!01!)9(!5E-1#3(!#-(#! eurythermal killifish6, however, how temperature 10-!(G39#/8(!01!5#+)!#/ &!H#)(- LI!M9(!H#)(-!(11+EG!#3-0 55!%50+#)(&!8%++5 !01!1%59(5!9#5!F((/!590H/!)0!F(! affects rates of water efflux has not beenN previously report. 5(/5%)%$(!)0!#33+%. #)%0/!)(.,(-#)E-( I!M9(!(11(3)5!01!/(#-O1-((*%/8!)(. ,(-#)E-(!0/!5 (-E.!05.0+#+%);!9#5! ,-($%0E5+;!F((/!-(,0-)(&!10-!)9(!(E- ;)9(-.#+!P%++%1%59@6!90H($(-6!90H!)(. ,(-#)E-(!#11(3)5!-#)(5!01!H#)(- ! Killifish(11+EG!9#5!/0)!F((/!,-($%0E5+;!-(,0-)I!! were collected from Northeast Creek during the months of August and September and maintained! at least one week in a 640 liter tank with a continuous supply of seawater from Salisbury Cove. !!!!!!!!Q%++%1%59!The two exper H(-(!imental 30++(3)(&! groups 1-0.! included >0-)9(#5)!7 the -((P!&E-%/8 environmental !)9(!. 0/)95!01!RE8E5)!#/&!4(,)(.F(-!#/&!control group of killifish at ambient MDIBL.#%/)#%/(&!#)!+(#5)!0/(!H((P!%/! aquarium tank temperatures#!@NJ!+%)(-!)#/P!H%)9!#!30/)%/E0E5!5E,,+;! of +13°C and an experimental group01!5(#H#)(-!1-0.!4#+%5FE-;!70$(I! acclimated to 0°C all at once for 10M9(!)H0!(G,(-%. days. Blood was (/)#+!8-0E,5!%/3+E&( sampled from &!)9(!(/$%-0/. a caudal vessel (/)#+!30/)-0+!8-0E,! and allowed 01!P%++%1%59!#)!#. to clot at +4°C F%(/)!<"D2S! prior to serum osmolality#TE#-%E.!)#/P!)(.,(-#)E-(5!01!UBLV determination with a Wescor7!#/&!#/!(G,(-%.(/)#+!8-0E,!#33+%.#) vapor pressure osmometer. Water(&!)0!JV7!#++!#)!0/3(!10-!BJ!&#;5I! efflux was measured from 2+00&!H#5!5# .,+(&!1-0.!#!3#E&#+!$(55(+!#/&!#++0H(&!)0!3+0)!#)!UNV7!,-%0-!)0!5(-E.!05.1 0+#+%);! the change&()(-.%/#)%0/!H%)9!#!W(530-!$#,0-!,-(55E-(!05.0. in wet weight of the four gill arches after ()( 60-I!W#)(-!(11+EG!H#5!. minutes of incubation (#5E-(&!1-0.!)9(!39#/8(!%/ in 100 ml of seawater ! at +13 andH()!H(%89) 0°C. TheB!01!)9(!10E-!8%++!#-39(5!#1)(-!@J!.%/E)(5!01!%/3 wet weight of the gills was determinedEF#)%0/!%/!BJJ before and !.+!01!5(#H#)(-!# after the incubation )!UBL!#/&!JV7I! in seawater by blottingM9(!H()!H(%89)!01!)9(!8%++5!H#5!&()(-.%/(&!F(10-(!#/&! the gills on kimwipes and weighing to the#1)(-!)9(!%/3EF#)%0/!%/!5(#H nearest milligram. The#)(-!F;!F+0))%/8!)9(!8%++5! dry weight of the gills was determined0/!P%.H%,(5!#/&!H(%89%/8!)0!)9(!/(#-(5)!.%++%8-#.I!M9(!&-;!H(%89)!01!)9(!8%++5!H#5!&()(-.%/(&!#1)(-!F(%/8! after being dried at 120°C for 24 hours. Water efflux was determined by the change in wet weight&-%(&!#)!BXJV7!10-!XN!90E-5I!W after the 60 min incubation #)(-!(11+EG!H#5!&()(-. period expressed %/(&!F;!)9(!39#/8(!%/!H()! per gm weight of the H(%89)!#1)(-!)9(!@J!.gills after drying. %/! %/3EF#)%0/!,(-%0&!(G,-(55(&!,(-!8.!H(%89)!01!)9(!8%++5!#1)(-!&-;%/8I!! ! The effect of near-freezing seawater temperatures for osmolality

!!!!!!!!M9(!(11(3)!01!/(#-O1-((*%/8!5(#H#)(-!)(.,(-#)E-(5!10-!BJ! wt dry mg/h/gm efflux, water water efflux 10 days&#;5!0/!1%59!5(-E.!05.0+#+%);! on fish serum osmolality#/&!8%++!H#)(-!(11+EG!#-(!590H/! and gill water efflux are 410 900 shown%/!1%8E-(!BI!!M9(!F#5#+!5(-E. in figure 1. The basal !05 serum.0+#+%);!#/&!)9 osmolality (!%/3-(#5(!%/! and the 400 * 800 390 increase5(-E.!05.0+#+%);!%/!-(5,0/5(!)0 in serum osmolality in response!/(#-O1-((*%/8!)(. to near ,(-#)E-(!%5!-freezing 700 5%.%+#-!)0!)905(!-(,0-)(&!,-($%0E5+;!10-!P%++%1%59@I!!Y%++!H#)(-! 380 temperature is similar to those reported previously for 600 (11+EG!.(#5E-(.(/)5!%/!5(#H#)(-!#&#,)(&!((+5!9#$(!%/3+E&6 (&! mOsm/kg 370 * killifish . Gill water efflux measurements in seawater 500 B Z X serum osmolality, 360 ZB@ 6!ABA #/&![@J !. 8\9\8.!&-;!H)I!H9%39!#-(!5%.1 5 2 %+#-! )0! adapted)905(!-(,0-)(&!%/!1%8E-(!BI!!M9(! eels have included 516 , &(3-(#5(!%/!8%++!H#)(-!(11+EG 818 and 960 mg/h/gm ! 350 400 dry wt. which are similar to those reported in figure 1. The 13!C 0!C E,0/!#3E)(!(G,05E-(!)0!JV7!10-!BJ!&#;5!. #;! -(,-(5(/)! #! acclimation and incubation temperature ! decrease39#/8(!%/!)9(!,(-.(#F%+%);!01!)9(!8%++!)0!H#)(-I!!R!&(3-(#5(!%/! in gill water efflux upon acute exposure to 0°C for ]%8E-(!BI!?11(3)5!01!1%59!#33+%.#)%0/!)(.,(-#)E-(!#/&!8%++Figure 1. Effects of fish acclimation %/3EF#)%0/!)(.,(-#)E-(!0/!5(-E.!05.0+#+%);!#/&!8%++!H#)(- 10 daysH#)(-!(11+EG!9#5!F((/!-(,0-)(&! may represent a change in 10-!the 1-(59H#)(-!permeability )-0E)! of E,0/! the (11+EGI!^/_A!1%59!10-!(#39!)(.,(-#)E-(6!$#+E(5!#-(!.(#/5U4?<6temperature and gill incubation temperature N gill to 300+%/8water. I!M9(!%/3-(#5(!%/!5(-E.!05.0+#+%);!#330.,#/%(&!F;!#!A decrease in water efflux has been reported `,aJIJZbIon serum osmolality and gill water efflux. for freshwater&(3-(#5(!%/ trout !8%++!H#)(- upon !(1 co 1+EG!5E88(5)5!)9#oling4. The increase )!)9(!H#)(-!+0 in serum 55! (n=8 fish for each temperature, values are #3-055!)9 (!8%++5!%5!&%. %/%59(&!%/!-(5,0/5(!)0!#/! #3E)(!&(3-(#5means+SEM,*p<0.05). (!%/!(/$%-0/. (/)#+!)(. ,(-#)E-(I!!M9( ! osmolality,055%F%+%);!)9#)!#!39#/8(!%/!)9(!#TE#-,0-%/!(G,-(55%0/!.#;!E/&(-+%(!)9(! accompanied by a decrease in gill water efflux 39#/8(5!%/!H#)(-!(11+EG!%5!3E--(/)+;! suggestsF(%/8!%/$(5)%8#)(&!%/!30++#F0-#)%0/!H that the water loss across the %)9!"-I!79-%5)0,9(-!7E)+(-!01!<"D2SI!gills is diminished in response! to an acute decrease in environmental temperature. The possibility that a change in the aquarpor4E,,0-)(&!F;!#!>(H!D/$(5)%8#)0-!RH#-&!,-0$%in expression may underlie the changes&(&!F;!)9(!<#%/(!D>2c?!^'XJOccOJB@N@Lb!#/&!F;!>4]! in water efflux is currently being investigated in collaboration=''JXX[N@XI! with Dr. Christopher Cutler of MDIBL. ! BI!! Bellamy, D. <0$(.(/)5!01!,0)#55%E.6!50&%E.!#/&!39+0-%&(!%/!%/3EF#)(&!8%++5!1-0.!)9(!5%+$(-!((+I!!"#$%&'"()*#%+),-'".! Supported!L dBXZOBLZ6!B[@BIby a New Investigator! Award provided by the Maine INBRE (P20-RR-016463) and by NSF OPP0229462.XI! Kamiya, M.!79#/8(5!%/!%0/!#/&!H#)(-!)-#/5,0-)!%/!%50+#)(&!8%++5!01!)9(!3E+)E-(&!((+!&E-%/8!)9(!30E-5(!01!5#+)!#&#,)#)%0/I! ! /00%1"".%23$!NJdBXLOBX[6!B[@CI! 1. Bellamy, D. Movements of potassium, sodium and chloride in incubated gills from the silver eel. Comp Biochem Physiol 3:125-135, 1961. 2. Kamiya, M. Changes in ion and water transport in isolated gills of the cultured eel during the course of salt adaptation. Ann Zool Jap 40:123-129, 1967. 3. Ogasawara, T., Hirano, T. Changes in osmotic water permeability of the eel gills during seawater and freshwater adaptation. J Comp Physiol 154:3-11, 1984. 4. Robertson, J., Hazel, J. Influence of temperature and membrane lipid composition on the osmotic water permeability of teleost gills. Physiol Biochem Zool 72:623-632, 1999. 5. Shuttleworth, T., Freeman, R. Net fluxes of water in the isolated gills of Anguilla diffenbachii. J Exp Biol 60:769- 781, 1974. 6. Umminger, B. Physiological studies on supercooled killifish (Fundulus heteroclitus). I. Serum inorganic constituents in relation to osmotic and ionic regulation at subzero temperatures. J Exp Zool 72:283-302, 1969. Stimulation of short-circuit current across lobster (Homarus americanus) epipodite by sinus gland extract

!edomil Lucu1,2, David W. Towle2, and Andrew E. Christie2 1University of Dubrovnik, ". Cari#a 4, 20000 Dubrovnik, Croatia 2Mount Desert Island Biological Laboratory, Old Bar Harbor Road, Salsbury Cove, ME 04672, USA

The branchial chamber of American lobsters includes three distinct tissues that have direct contact with the aquatic environment: gills, branchiostegite, and epipodites. The epipodite, consisting of a cuticular envelope lined with epithelial cells and enclosing a hemolymph space, can be split by careful dissection and each side, composed of cuticle and a single epithelial layer, can then be mounted in an Ussing chamber. The electrophysiological properties of the lobster hemi-epipodite are similar to those of split gill lamellae of hyperregulating crabs acclimated to dilute seawater. When perfused on both sides with identical salines, the hemi-epipodite is capable of establishing a basolaterally negative transepithelial potential (TEP) and negative current (apical to bsolateral side)4,5. The epipodite is particularly rich in Na++K+-ATPase activity and appears to play an important role in the osmoregulatory capacity of the lobster1,4. However, the neurohormonal control of osmoregulatory mechanisms in this tissue (or other tissues of the branchial chamber) is not well understood. Previous evidence suggests involvement of neurohormonal factor(s) produced by the x-organ/sinus gland complex located in the eyestalk2. A variety of peptides have been isolated from x-organ/sinus gland3, including members of the crustacean hyperglycemic hormone superfamily, and many new candidate peptides have been identified via expressed sequence tags.3candidate peptides have been identified via

In hemi-epipodite preparations isolated from lobsters Minutes 0 50 100 150 acclimated to dilute seawater, short-circuit current (Isc) was -75 measured before and after basolateral application of sinus -95 gland extract (SGE) prepared by homogenizing two ) -2 homologous sinus glands in cold saline and diluting to 6 ml. -115 A cm A

Isc was significantly stimulated by SGE from -91.6! 6.2 "A " -2 cm to -143.9!6.4 (P<0.01; Figure 1), with no lag period. ( Isc -135 Following removal of SGE, Isc approached control values -155 within 50 minutes, indicating that the effect of SGE is reversible. The degree of stimulation was shown to be dose- saline before saline after dependent. Pretreatment of SGE with proteinase K blocked the saline+ sinus stimulatory effect, leading to our conclusion that the active gland extract factor is proteinaceous. Supported by NIAs to !.L. and Fig. 1. Effect of sinus gland extract on short- A.E.C. and NSF grant IOB-0543860 to D.W.T. circuit current across lobster epipodite.

1. Charmantier, G, Charmantier-Duares, M, and Towle, D. Osmotic and ionic regulation in aquatic arthropods. In: Osmotic and Ionic Regulation: Cells and Animals (Evans, DH, ed.), pp. 165-230, CRC Press, Boca Raton, 2008. 2. Charmantier-Daures, M, Charmantier, G, Janssen, KPC, Aiken, DS, and VanHerp, F. Involvement of eyestalk factors in the endocrine control of osmoregulation in adult American lobster Homarus americanus. Gen. Comp. Endocrinol. 94: 281-292, 1994. 3. Ma, M, Chen, R, Sousa, GL, Bors, EK, Kwiatkowski, M, Goiney, CC, Goy, MF, Christie, AE, Li, L. Mass spectral characterization of peptide transmitters/hormones in the nervous system and neuroendocrine organs of the American lobster Homarus americanus. Gen. Comp. Endocrinol. 156:395-409, 2008. 4. Lucu, !, and Devescovi, M. Osmoregulation and branchial Na+,K+-ATPase in the lobster Homarus gammarus acclimated to dilute seawater. J. Exp. Mar. Biol. Ecol. 234: 291-304, 1999. 5. Lucu, !, and Towle, DW. Chloride conductance in lobster epipodite. Bulletin Mt. Desert Isl. Biol. Lab. 47: 20-21, 2008. Gene expression and localization of the Rhesus-related ammonium transporter in green crabs (Carcinus maenas) exposed to ammonia Anne-Kathrin Blässe1, Susan L. Edwards2, David W. Towle3, and Dirk Weihrauch4 1 Department of Biology, University of Osnabrück, Osnabrück, Germany; 2Department of Biology, Appalachian State University, Boone, NC, USA; 3Mount Desert Island Biological Laboratory, Salsbury Cove, ME, USA and 4Department of Biological Science, University of Manitoba, Winnipeg, MB, Canada Studies on isolated perfused gills of several aquatic crabs, including Carcinus maenas, have shown that ammonia can be excreted actively against a 4-to-8-fold inwardly-directed ammonia gradient4,6. Molecular studies have identified a Rhesus-related protein (RhCM) from Carcinus maenas gills5 and, since mammalian Rhesus proteins have been shown to mediate transport of ammonium ions, it has been suggested that RhCM may participate in the active excretion of ammonia excretion across the crab gill7. To determine the localization of the Rhesus protein in the gills of Carcinus maenas we used an antibody raised against the C-terminus of RhCM. Immunolocalization studies showed dot-like apical signals in the gill lamellae of posterior gills of the green crab (Fig. 1A). Double staining using the anti-RhCM antibody and an anti-Na+-K+-ATPase antibody clearly showed the basolateral localization of the Na+-K+-ATPase, in agreement with earlier studies3, in comparison to the apical signal of the anti-RhCM antibody (Fig. 1B). The negative control without the primary antibody showed a light autofluorescence of the cuticule of the gill lamellae but no bright dot-like apical signals (Fig. 1C).!!!RhCM is thus poised to mediate flux of ammonium ions across the apical membrane of gill epithelial cells. In excretory mode, the direction of flux would be cytosol-to-external milieu.

Fig. 1: Immunolocalization of RhCM in posterior gills of Carcinus maenas. A) Immuno- fluorescence microscopy with anti -RhCM antibody showing apical staining of the posterior gill lamellae (white arrows). B) Double immuno-staining of posterior gill with anti-RhCM antibody (red) and anti-Na-K- ATPase antibody (green) showing apical staining for RhCM and basolateral (white arrows) staining for the Na-K-ATPase. C) Immuno-fluorescence microscopy without primary antibody (control) showed no significant staining. D) Phase contrast image showing the central stem and lamellae of posterior gills. To investigate whether gene expression of RhCM and other transport proteins might respond to ammonia challenge, we exposed green crabs to low-salinity (10ppt) seawater containing 1 mmol·l-1 ammonium chloride for two hours to 14 days, mimicking conditions encountered by this species in nature4. Changes in gene expression in posterior gills were monitored using a newly developed 4,462-feature oligonucleotide microarray2. The microarray assays revealed 2.0- to 2.8-fold down-regulation of RhCM over the entire time of ammonia exposure compared to control ! animals without ammonia exposure (Fig. Fig. 2: Relative gene expression changes in posterior gills of 2). In contrast, transcript levels for an ammonia-exposed Carcinus maenas. Posterior gills were collected aquaporin showed 3.5- to 4.6-fold up- after 2 h, 6 h, 24 h, 7 days and 14 days of ammonia exposure (1 2+ - -1 regulation and a Ca -activated Cl - mmol·l ). Numbers represent log2 of expression ratios (ex- channel showed even higher up-regula- posed/control); positive values represent up-regulation, negative tion by 6.5- to 14-fold (Fig. 2). values represent down-regulation (means ±S.E.M, N=6). The noted apparent decrease in RhCM transcript levels in ammonia-exposed crabs does not necessarily negate the importance of RhCM in ammonia movements across the gill but implies that other compensatory mechanisms are induced to accomplish active ammonia transport following exposure to environmental ammonia. Among these mechanisms may be up-regulation of aquaporin, one form of which has been implicated in mediating ammonia transport in other systems1. Of particular interest is the noted up-regulation of a Ca2+-activated chloride channel. At present, it is not at all clear how this transporter might be involved in the response to ammonia exposure. Supported by MDIBL’s Stanley Bradley Fellowship (A.-K.B.), an MDIBL New Investigator Award (S.L.E.), NSF grant IOB-0543860 (D.W.T.), and an NSERC Discovery grant (D.W.).

1. Saparov, SM, Liu, K, Agre, P, and Pohl, P. Fast and selective ammonia transport by aquaporin-8. J. Biol. Chem. 282: 5296-5301, 2007. 2. Stillman, JH, Colbourne, JK, Lee, CE, Patel, NH, Phillips, MR, Towle, DW, Eads, BD, Gelembuik, GW, Henry, RP, Johnson, EA, Pfrender, ME, and Terwilliger, NB. Recent advances in crustacean genomics. Integ. Comp. Biol. 48: 852-868, 2008. 3. Towle, DW, and Kays, WT. Basolateral localization of Na++K+-ATPase in gill epithelium of two osmoregulating crabs, Callinectes sapidus and Carcinus maenas. J. Exp. Zool. 239, 311-318, 1986. 4. Weihrauch, D, Becker, W, Postel, U, Riestenpatt, S, Siebers, D. Active excretion of ammonia across the gills of the shore crab Carcinus maenas and its relation to osmoregulatory ion uptake. J. Comp. Physiol. B 168, 364-376, 1998. 5. Weihrauch, D, Marini, A-M, Towle, DW. Cloning and expression of a putative Rh-like ammonium transporter from gills of the shore crab Carcinus maenas. Am. Zool. 41, 1621, 2001. 6. Weihrauch, D, Ziegler, A, Siebers, D, and Towle, DW. Active ammonia excretion across the gills of the green shore crab Carcinus maenas: participation of Na+/K+-ATPase, V-type H+-ATPase and functional microtubules. J. Exp. Biol. 205, 2765-2775, 2002. 7. Weihrauch, D, Morris, S, and Towle, DW. Ammonia excretion in aquatic and terrestrial crabs. J. Exp. Biol. 207: 4491-4504, 2004. ! Mitogen activated protein kinases p38 do not play a role in the secretion of chloride by the rectal gland of Squalus acanthias

P. Silva,1 M. Cronan,2 and Y. Hernandez.3 F. H. Epstein.4

1Department of Medicine Temple University School of Medicine, Philadelphia, PA 19140 2University of Maine, Orono, ME 3High School of Mathematics, Science and Engineering, New York, NY 4Department of Medicine Beth Israel Deaconess Medical Center and Harvard Medical School, Boston, MA 02215

Mitogen-activated protein kinases p38 (p38MAPK) appear to participate in the intracellular pathways activated by natriuretic peptides.1 It has also been suggested that p38MAPK may have a negative effect on the intracellular accumulation of cGMP,2 an intracellular mediator of natriuretic peptides. In the rectal gland of Squalus acanthias, natriuretic peptides exert their effect, at least in part, through the activation of guanylate cyclase and the generation of cGMP. In the present series of experiments we investigated the possibility that p38MAPK participates in the intracellular signaling pathway of natriuretic peptides in the isolated perfused rectal gland of S. acanthias. We used SB202190 to inhibit p38MAPK. SB202190 (4-[4-(4-Fluorophenyl)-5-(4-pyridinyl)-1H-imidazol-2- yl]phenol) is a highly selective, potent and cell permeable inhibitor of p38 MAP kinases.3

The rectal gland artery, vein and duct were catheterized with PE-90 tubing, placed in a glass perfusion chamber maintained at 15oC with running seawater, and perfused by gravity at a pressure of 40 mm Hg with oxygenated shark Ringer’s solution containing (in mM) 280 Na+, 290 Cl-, 5 K+, 8 - ++ ++ = HCO3 1 phosphate, 2.5 Ca , 3Mg , 0.5 SO4 , 350 urea and 5 glucose; pH 7.6 when gassed with 99% 02 / 1% CO2. Rectal gland secretion was collected at 10 minute intervals in 1.5 ml tared conical plastic centrifuge tubes and the secreted volume estimated by weighing. Vasoactive intestinal peptide (VIP) and C-type natriuretic peptide (CNP) were used to stimulate the secretion of chloride. They were injected directly into the arterial catheter, in close proximity to the gland, over an interval of 1 min. in an amount calculated to provide the desired final concentration after dilution by the arterial flow of perfusion fluid. After the infusion of VIP or CNP, collections were continued for thirty minutes until secretion returned to basal levels. SB202190 was given ten minutes before the infusion of VIP or CNP and continued for another thirty minutes. When CNP was used to stimulate secretion, procaine 10-2M was always added to the perfusate to prevent release of VIP from nerves within the rectal gland.

2000 VIP 1800 VIP + SB202190 Figure 1. Lack of effect of SB202190 on the secretion of 1600 chloride stimulated by VIP. Rectal glands were perfused 1400 Eq/h/g)

-7 ! with shark Ringers. VIP 10 M was infused into the rectal 1200 gland artery at 30 and 70 minutes. In the experiments with 1000 SB202190 a control stimulation with VIP was done at 30 minutes, and at 60 minutes the perfusate was changed to a 800 solution containing SB202190 at a concentration of 150 600 nM. VIP was added ten minutes later. Values are mean ± 400 SEM, n=8. Chloride secretion ( 200 0 10 20 30 40 50 60 70 80 90 100 Time (minutes)

700 CNP CNP + SB202190 600 Figure 2. Lack of effect of SB202190 on the secretion of chloride stimulated by CNP. Rectal glands were perfused 500 -7 Eq/h/g)

with shark Ringers. CNP 5 x 10 M was infused into the ! rectal gland artery at 30 and 70 minutes. In the 400

experiments with SB202190 a control stimulation with 300 CNP was done at 30 minutes, and at 60 minutes the perfusate was changed to a solution containing SB202190 200 at a concentration of 150 nM. CNP was added ten Chloride secretion ( minutes later. Values are mean ± SEM, n=7. 100

0 10 20 30 40 50 60 70 80 90 100 Time (minutes)

SB202190 had no effect on the secretion of chloride stimulated by either VIP or CNP. It did not inhibit their effect nor did it potentiate the effect. Although these results suggest that p38MAPK play no role in the intracellular signaling cascades initiated by VIP or CNP that result in the stimulation of the secretion of chloride, their presence in the rectal gland cells cannot be excluded.

1. Baldini, P.M., De Vito, P., Vismara, D., Bagni, C., Zalfa, F., Minieri, M., and Di Nardo, P. Atrial natriuretic peptide effects on intracellular pH changes and ROS production in HEPG2 cells: role of p38 MAPK and phospholipase D. Cell Physiol Biochem 15:77-88, 2005. 2. Ho, A.K., Price, L., Mackova, M., and Chik, C.L. Potentiation of cyclic AMP and cyclic GMP accumulation by p38 mitogen-activated protein kinase (p38MAPK) inhibitors in rat pinealocytes. Biochem Pharmacol 62:1605-1611, 2001 3. Davies, S.P., Reddy, H., Caivano, M., and Cohen, P. Specificity and mechanism of action of some commonly used protein kinase inhibitors. Biochem J 351:95-105, 2000.

Plasma concentration of common chemicals in Squalus acanthias

P. Silva,1 K. C. Spokes,2 M. Cronan,3 and Y. Hernandez.4 F. H. Epstein.2

1Department of Medicine Temple University School of Medicine, Philadelphia, PA 19140 2Department of Medicine Beth Israel Deaconess Medical Center and Harvard Medical School, Boston, MA 02215 3University of Maine, Orono, ME 4High School of Mathematics, Science and Engineering, New York, NY

We recently reported the plasma concentration of calcium and phosphorus in Squalus acanthias. 1 The values observed for calcium were significantly different from those of other vertebrates. We wondered whether the values of other chemicals previously used by us and others in our experiments, and commonly believed to be the average levels found in the specimens of S. acanthias obtained for the laboratory, accurately reflected the actual condition in the fish.

Blood samples were obtained in heparinized syringes from 12 specimens of S. acanthias, prior to their use for other experiments. The samples were centrifuged to separate plasma from the formed blood elements. The plasma was then removed, frozen and analyzed in automated analytical instruments at the Clinical Laboratories of the Beth Israel Deaconess Medical Center and Temple University Hospital.

The results are reported in Table 1. Notable findings Table 1 are the glucose level of 55, significantly lower than that Mean SEM Units seen mammals. The value for BUN is the same as that Glucose 55 6.0 mg/dl widely used in this laboratory, namely 350 mM. Creatinine 0 0.0 mg/dl Surprising are the values for sodium and chloride, both BUN 980 22.5 mg/dl significantly lower than the values of 280 commonly Na 249 3.4 mEq/l accepted as normal for the shark. The level of bicarbonate K 3 0.1 mEq/l is very close to that currently in use. Creatinine could not Cl 235 5.3 mEq/l be measured in the plasma of the shark representing a Bicarb 7 0.3 mEq/l U/L significant difference from mammalian physiology and ALT 16 5.2 AST 31 7.0 U/L suggesting a difference in its metabolism in the shark. AlkPhos 10 0.9 U/L The absence of albumin is interesting. It could represent a Bili 0 0.1 mg/dl difference in the molecule that is not picked up by the Tot Prot 2 0.1 g/dl analyzer or a real absence. Albumin is necessary for the Albumin 0 0.0 g/dl maintenance of intravascular volume in terrestrial Ca 14 0.4 mg/dl animals, but in fish, where the pressure in the tissues Phos 3 0.3 mg/dl favors the movement of fluid into the capillaries, albumin may not be necessary. The absence of albumin makes the Chol 123 12.3 mg/dl high levels of calcium even more striking than what we HDLD 19 3.4 mg/dl had previously thought. Albumin binds calcium reducing TG 154 26.0 mg/dl LDLC 39 3.5 mg/dl the ionized component in proportion to the concentration of albumin. In the absence of albumin all the calcium is ionized. The absence of bilirrubin is also notable. The levels of ALT, AST, and alkaline phosphatase are similar to those found in mammals. The lipid profile is quite different from that seen in humans.

1. Epstein, F., Ndzana, I., Spokes, K., and Silva, P. Effect of ingesting seawater on serum calcium and chloride in Squalus acanthias. The Bulletin, MDI Biological Laboratory 47:11-12, 2008. A thiazide-inhibited transporter does not contribute to chloride secretion by the perfused rectal gland of Squalus acanthias

F. H. Epstein,1 P. Silva,2 M. Cronan,3 and Y. Hernandez.4

1Department of Medicine Beth Israel Deaconess Medical Center and Harvard Medical School, Boston, MA 02215 2Department of Medicine Temple University School of Medicine, Philadelphia, PA 19140 3University of Maine, Orono, ME 4High School of Matnematics, Science and Engineering, New York, NY

The electroneutral cotransport of chloride with sodium into the secretory cells, across their basolateral cell border, powered by the downhill entry of sodium and against the electrochemical gradient for Cl-, is an essential feature of chloride secretion by the elasmobranch rectal gland, teleost gill, and mammalian respiratory epithelia and intestinal mucosa. Two forms of sodium-linked cotransport of chloride have been identified in vertebrates. The first, inhibited by furosemide, bumetanide, and their derivatives, and requiring the cotransport of potassium is termed the NaK 2Cl transporter. The second, identified in teleost urinary bladder and mammalian distal convoluted tubules of the kidney, is inhibited by chlorothiazide and its derivatives, does not require the cotransport of K+, and is termed NaCl co-transporter. The present experiments were undertaken to see whether a thiazide- inhibitable co-transporter, in addition to a furosemide-inhibitable co-transporter, might contribute to active chloride secretion by the perfused rectal gland of Squalus acanthias, the spiny dogfish shark.

Isolated rectal glands of S. acanthias were perfused through their single artery by gravity at 16°C and 40 mm Hg pressure with oxygenated shark Ringer’s solution containing 5 mM glucose in a single pass perfusion.1 Venous effluent and duct fluid were collected separately from PE-90 catheters placed in the vein and duct of the gland. Collections were made every ten minutes. After thirty minutes of perfusion during which a stable basal secretory rate was established, a bolus of vasoactive intestinal peptide (VIP, 10-7M or 5 x 10-8M) was given over one minute, directly into the the artery, without altering the rate of perfusion. Collections were then continued for another forty minutes, at ten-minute intervals. A second stimulatory bolus of VIP, identical to the first, was given intra-arterially, and ten minute collections continued for another thirty minutes. In experiments on the effect of thiazides, 3 x 10-4M hydrochlorothiazide was added to the shark Ringer’s perfusate ten minutes before the second bolus of VIP was given. In experiments to assess the inhibitory effect of hydrochlorothiazide in the presence of furosemide or bumetanide, 10-4M furosemide or 10-4 M bumetanide were added to the shark Ringer’s perfusate from the beginning of the experiment. Reagents were purchased from Sigma- Aldrich. The results were analyzed by calculating the ratio of the quantity of chloride secreted by the gland in response to the second stimulation of VIP to that elicited by the first in jection of VIP. Chloride secretion (in ! Eq/ gram of gland/ hour) was calculated at 10 and 30 minutes after the intrarterial injection of VIP.

Chloride secretion by the shark rectal gland in response to two different concentrations of VIP (10- 7m or 5 x 10-8M) was not significantly diminished by hydrochlorothiazide (10-4M), when measured over 10 or 30 minutes after the bolus intrarterial injection of VIP (Figure 1 and 2).

Effect of hydrochlorothiazide on VIP stimulation Figure 1. Effect of hydrochlorothiazide on the 1.2 secretion of chloride stimulated by VIP. Rectal glands were perfused with shark Ringers containing 1.0 -4 hydrochlorothiazide 3 x 10 M for ten minutes after 0.8 which VIP 10-7M or 5 x 10-8M was infused into the rectal gland artery. The secretion of chloride induced 0.6 by VIP was compared with that induced in the absence 0.4 of hydrochlorothiazide in the same gland (control) Values are for the first ten minutes of collection after 0.2 the infusion of VIP. Columns are mean ± SEM, n=10. 0.0

Fraction of initial response to VIP at 10 min Control Hydrochlorothiazide

Effect of Hydrochlorothiazide on the stimulation of Figure 1. Effect of hydrochlorothiazide on the VIP secretion of chloride stimulated by VIP. Rectal glands 1.2 were perfused with shark Ringers containing hydrochlorothiazide 3 x 10-4M for ten minutes after 1.0 -7 -8 which VIP 10 M or 5 x 10 M was infused into the 0.8 rectal gland artery. The secretion of chloride induced by VIP was compared with that induced in the absence 0.6 minutes of hydrochlorothiazide in the same gland (control) 0.4 Values are for thirty minutes of collection after the infusion of VIP. Columns are mean ± SEM, n=10. 0.2

0.0 Fraction of initial response to VIP over 30 Control Hydrochlorothiazide

As noted in an earlier publication,2 10-4M furosemide inhibits secretion by the rectal gland only partially, by about 50%, whereas 10-4M bumetanide generally produced complete inhibition. The addition of 3 x 10-4M hydrochlorothiazide to these co-transport inhibitors did not significantly alter the gland’s secretory response to 10-4M VIP.

These data do not support a role for a Na-Cl, thiazide-inhibited co-transporter in the stimulated secretion of Cl- by shark rectal gland.

1. Silva, P., Solomon, R.J., and Epstein, F.H. Shark rectal gland. Methods Enzymol 192:754-766, 1990. 2. Silva, P., Stoff, J., Field, M., Fine, L., Forrest, J.N., and Epstein, F.H. Mechanism of active chloride secretion by shark rectal gland: role of Na-K-ATPase in chloride transport. Am J Physiol 233:F298-306, 1977.

Rate of disposal of a salt load by Squalus acanthias and Raja erinacea

P. Silva,1 K. C. Spokes,2 M. Cronan,3 and Y. Hernandez,4 F. H. Epstein.2

We previously reported that the rate of secretion of chloride by the rectal gland of the little skate R. erinacea was similar to that of the rectal gland of S. acanthias.1 While the stimulated chloride secretion expressed as µEq per hour per gram wet weight is similar in the two species, the rectal gland of the little skate is much smaller in relation to body weight, 0.042%, than in the spiny dogfish, 0.084%, suggesting that the two species may differ in their requirements for salt excretion on behalf of homeostasis. We asked the question whether both species were equally capable of disposing of a similar load of salt.

S. acanthias, and R. erinacea were loaded with an intraperitoneal injection of a 5% w/w volume of shark Ringer’s. The fish were weighed prior to the injection, the time noted, given the injections and reweighed, the time again noted and reweighed at one hour intervals until they had regained their prior unloaded weight. Care was taken to avoid injecting outside the peritoneal cavity or into a hollow organ.

110.0

105.0 Figure 1. Time course of the change in weight of R. erinacea and S. acanthias after a salt load. Both R. 100.0 erinacea and S. acanthias fish were loaded with an intraperitoneal injection of shark Ringer’s calculated 95.0 to increase the weight of the fish by 5%. The fish were weighed at hourly intervals until they reached 90.0

their initial weight. Values are mean ± SEM. N = 8 Percent initial body weight 85.0 for S. acanthias, 9 for R. erinacea. R. erinacea S. acanthias 80.0 -5 0 5 10 15 20 25 30 Hours

The results are shown in Figure 1. There was a very significant difference in the time required to excrete the salt load between S. acanthias and R. erinacea. Whereas S. acanthias were able to dispose of the load in about eight hours R. erinacea specimens required longer than 20 hours to do so. We conclude from these data that the larger size of the rectal gland of S. acanthias provides the fish with a lager capacity for the excretion of salt than that of R. erinacea. The requirements for salt excretion may differ substantially in both species, such that the normally ingested load of salt in S. acanthias may be larger that that in R. erinacea.

1. Fletcher, L., Silva, P., Epstein, F.H. Rectal gland function in the little skate Raja erinacea. Bull MDIBL. 1983;23:12-13. Hypoxia-induced Ca2+ responses in spiny dogfish shark (Squalus acanthias) vessels

Larissa A. Shimoda1, Susan K. Fellner2 and Erik R. Swenson3 1Division of Pulmonary and Critical Care Medicine, Johns Hopkins University, Baltimore, MD; 2Department of Cell and Molecular Physiology, University of North Carolina-Chapel Hill, Chapel Hill, NC and 3Division of Pulmonary/Critical Care Medicine, University of Washington, Seattle, WA.

All organisms rely on the ability to sense and respond to changes in oxygen for survival. The effect of hypoxia on the pulmonary and systemic circulations of mammals has been studied extensively, with most species exhibiting pulmonary vasoconstriction and systemic vasodilation in response to hypoxia. Rapid oxygen consumption coupled with the slow production and diffusion rate of oxygen in water suggests that aquatic animals have a higher likelihood of encountering environmental hypoxia than their terrestrial counterparts1. Indeed, some elasmobranchs are highly hypoxia-tolerant, maintaining physiological function even in the face of ambient anoxia2. However, little is known regarding the mechanisms by which tissue oxygen delivery might be maintained under such extreme conditions. In mammals, systemic vasodilation in response to hypoxia is believed to allow maximal oxygen delivery to tissues, whereas pulmonary vasoconstriction is thought to shunt perfusion away from poorly ventilated areas. There is some evidence that similar changes in vasoreactivity may occur in elasmobranch systemic and respiratory vessels. For example, in Epaulette sharks (Hemiscyllium ocellatum Bonnaterre), blood pressure decreased in dorsal and ventral aorta in response to hypoxia3, suggesting vasorelaxation. These elasmobranchs also exhibited a reduction in gill blood flow velocity, suggesting hypoxia-induced contraction in this vascular bed3. This is similar to studies in teleosts, where hypoxia has been shown to contract the gill vessels4. With respect to the spiny dogfish shark (Squalus acanthias), in vivo studies demonstrated that aortic blood pressure fell with exposure to hypoxia, suggesting that hypoxia induced systemic vasodilation5. Similarly, acute exposure to hypoxia depressed rhythmic spontaneous contraction in isolated hepatic portal vein6. During the exposure, oscillatory contractions recovered, but the basal level of tone remained below control levels until the arteries were returned to normoxia6. The suppression of basal tone and rhymthic contractions is suggestive of hypoxic relaxation of smooth muscle and dilation of the systemic vasculature. The effect of hypoxia on respiratory vessels from Squalus acanthias has not been studied.

In most mammals, hypoxic pulmonary vasoconstriction requires Ca2+ influx into pulmonary arterial smooth muscle cells via both voltage-gated Ca2+ channels and nonselective cation channels, which are activated following Ca2+ release from the sarcoplamsic reticulum7. Conversely, hypoxic vasorelaxation in systemic smooth muscle is typically accompanied by a reduction in cytoplasmic Ca2+ levels8. However, in some cases, hypoxia-induced changes in vasomotor tone have also been found to 2+ 9 10 occur absent a change in intracellular calcium concentration ([Ca ]i), via increased or decreased Ca2+-sensitivity of the contractile apparatus. As noted above, very little work has been done characterizing the effects of hypoxia on elasmobranch vessels, and there is currently no information 2+ regarding whether hypoxia alters [Ca ]i in smooth muscle from any of these vascular beds. Thus, the 2+ goal of this study was to determine the effect of hypoxia on smooth muscle cell [Ca ]i in respiratory and systemic arteries from Squalus acanthias.

Squalus acanthias of either sex were euthanized via pithing along the spinal column in accordance with protocols approved by the MDIBL Animal Care and Use Committee. Anterior mesenteric arteries (MA) and distal branchial arteries (BA) were isolated and placed in ice-cold shark Ringers11 until use. The arteries were minced and loaded with the Ca2+-sensitive fluorescent dye, Fura-2 AM, in shark Ringers containing 5% albumin at 13!C for 30 min. After loading, tissue was washed in Ca2+-free Ringers and a drop of solution containing 6-8 tissue pieces was placed on a poly-L-lysine-coated glass coverslip mounted in a perfusion chamber. Once tissue pieces were sufficiently adherent, the chamber was filled with Ca2+-containing shark Ringers and the top coverslip of the chamber mounted in place to create a closed system with single inlet and outlet ports. The chamber was placed on the stage of an inverted microscope with fluorescence attachments. Perfusion of the chamber was initiated at 2-3 ml/min and a field of study chosen that contained smooth muscle cells. Tissue was perfused with 2+ normoxic shark Ringers gassed with 16% O2; 5% CO2 at 13ºC and [Ca ]i measured for 2-5 minutes until a stable baseline was achieved. Perfusion was then switched to shark Ringers in which NaCl was + 2+ substituted with KCl, increasing extracellular K to 80 mM and inducing depolarization, and [Ca ]i was monitored for an additional 10 minutes. Smooth muscle cells were identified by elongated 2+ + morphology and increased [Ca ]i in response to high K . Hypoxia was induced by perfusion with 2+ shark Ringers bubbled with 1% O2. In a subset of experiments, Ca was omitted from the Ringers. In a second set of experiments, uptake into the sarcoplasmic reticulum (SR) was blocked with 2+ cyclopiazonic acid (CPA; 1 "M). [Ca ]i was estimated from fura-2 fluorescence ratios (F340/F380) using linear regression between adjacent points on a calibration curve generated using calibration 2+ 2+ solutions with [Ca ] between 0 and 610 nM. Differences between baseline [Ca ]i (average value from 2+ 1 min of recording) and [Ca ]i after treatment were compared using paired Student’s t-test. To 2+ determine whether the change in [Ca ]i induced by KCl or hypoxia was significant, a one-sample t- test was used. Values were accepted as statically significant when p<0.05 (*).

We found that inducing smooth muscle cell depolarization by exposure to high K+ caused a 2+ 2+ significant increase in [Ca ]i in both vessel types (Figure 1). The KCl-induced increase in [Ca ]i was sustained for the duration of the exposure, and reversible upon return to normal K+ concentrations. In 2+ contrast, exposure to hypoxia (1% O2) caused a statistically significant decrease in [Ca ]i in both MA 2+ and BA (Figure 2). In order to test whether the hypoxia-induced decrease in [Ca ]i might result from decreased influx through plasmalemmal channels, we pretreated tissue with Ca2+-free shark Ringers. 2+ 2+ Removal of extracellular Ca caused an immediate decrease in [Ca ]i in both MA (from 203.1#19.6 to 183.7#15.9; n=4) and BA (from 137.6#12.2 to 116.3#11.9; n=4). Challenge with hypoxia in the 2+ 2+ absence of extracellular Ca still resulted in a significant decrease in [Ca ]i in MA and BA. Next, we tested whether the hypoxia-induced reduction in cytosolic Ca2+ might be due to increased uptake into the SR. Tissue was pretreated with CPA, which inhibits sarcoplasmic-endoplasmic reticulum Ca2+- ATPase-dependent uptake into the SR and, in most preparations, induces depletion of Ca2+ stores due 2+ to passive leak from the SR. Surprisingly, a CPA-induced transient increase in basal [Ca ]i (indicating

A KCl B 220 250 KCl A B 200 120 1% O2 1% O2 180 230 (nM)

(nM) 180 i (nM) i 100 (nM) ] ] i i ] ] 2+

210 2+ 2+ 140 160 2+ [Ca [Ca 80 [Ca 190 [Ca 100 140 2 min 5 min 60 Figure 1. Representative traces C Figure 2. Representative traces 30 * C MABA showing effect of high K+ (KCl) * showing effect of hypoxia (1% 0 2+ 2+ on intracellular [Ca ]i in (A) (nM) 20 O2) on intracellular [Ca ]i in (A) -5 i (nM) ] i ] mesenteric artery (MA) and (B) 2+ mesenteric artery (MA) and (B) 10 2+ -10 branchial artery (BA) smooth [Ca branchial artery (BA) smooth

$ * [Ca muscle cells. (C) Mean change in muscle cells. (C) Mean change $ -15 0 [Ca2+] ($Ca2+] ) in MA (n=4) and MA BA in [Ca2+] ($Ca2+] ) in MA (n=4) i i i i -20 * BA (n=5). and BA (n=5). Ca2+-free Ringers 2+ A B Ca -free Ringers A B CPA 240 120 CPA 170 1% O2 1% O 210 1% O 2 1% O2 2

220 100 (nM) 150 (nM) 190 (nM) i (nM) i ] i ] i ] ] 2+ 2+ 2+ 2+ 200 80 170 130 [Ca [Ca [Ca [Ca 110 180 60 150 2 min 2 min Figure 3. Representative traces Figure 4. Representative traces C MA BA showing effect of hypoxia (1% O ) showing effect of hypoxia (1% 0 2 C MA BA 2+ 0 O ) on [Ca2+] in (A) mesenteric -5 on [Ca ]i in (A) mesenteric artery 2 i

artery (MA) and (B) branchial (nM) -10 (MA) and (B) branchial artery (BA) -5 i ] (nM) smooth muscle cells in the absence artery (BA) smooth muscle cells 2+ -15 i

] -10

2+ [Ca of extracellular Ca . (C) Mean 2+ in the presence of cyclopiazonic -20 $ 2+ 2+ -15 change in [Ca ]i ($Ca ]i) in MA [Ca * acid (CPA). (C) Mean change in -25 * $ * 2+ 2+ (n=5) and BA (n=3) after removal of -20 [Ca ]i ($Ca ]i) in MA (n=5) and extracellular Ca2+. BA (n=3). store depletion) was not evident in either vessel type (data not shown). The hypoxia-induced decrease 2+ in [Ca ]i was prevented in MA treated with CPA (Figure 4). In contrast, CPA had no effect on the reduction in Ca2+ in response to hypoxia in BA.

2+ Based on these observations, we conclude that hypoxia reduces smooth muscle cell [Ca ]i in both respiratory and systemic arteries of Squalus acanthias. Although sustained Ca2+ influx is required for maintenance of basal Ca2+ in both MA and BA, the mechanism by which hypoxia regulates cytosolic Ca2+ during hypoxia does not appear to be due to reduced Ca2+ influx. Results from experiments using CPA revealed that the reduction in cytosolic Ca2+ during hypoxia might be due to increased uptake into the SR in MA, but not BA. Our results suggest that, in contrast to mammals, hypoxia causes dilation of both the respiratory and systemic vasculature in elasmobranchs, although the mechanisms by which this occurs might differ between vascular beds.

This work was supported by a MDIBL New Investigator Award to L. A. Shimoda.

1. Diaz RJ, Rosenberg R. Spreading dead zones and consequences for marine ecosystems. Science. 321: 926-9, 2008. 2. Nilsson GE, Ostlund-Nilsson S. Hypoxia in paradise: widespread hypoxia tolerance in coral reef fishes. Proc Biol Sci. 271: S30-3, 2004. 3. Stenslokken KO, Sundin L, Renshaw GM, Nilsson GE. Adenosinergic and cholinergic control mechanisms during hypoxia in the epaulette shark (Hemiscyllium ocellatum), with emphasis on branchial circulation. J Exp Biol. 207: 4451-61, 2004. 4. Pettersson K, Johanson K. Hypoxic vasoconstriction and the effects of adrenaline on gas exchange efficiency in fish gills. J Exp Biol. 97: 263-272, 1982. 5. Swenson KE, Eveland RL, Gladwin MT, Swenson ER. Nitric oxide (NO) in normal and hypoxic vascular regulation of the spiny dogfish, Squalus acanthias. J Exp Zoolog A Comp Exp Biol. 303: 154-60, 2005. 6. Olson KR, Forster ME, Bushnell PG, Duff DW. Spontaneous contractions in elasmobranch vessels in vitro. J Exp Zool. 286: 606-14, 2000. 7. Wang J, Shimoda LA, Weigand L, Wang W, Sun D, Sylvester JT. Acute hypoxia increases intracellular [Ca2+] in pulmonary arterial smooth muscle by enhancing capacitative Ca2+ entry. Am J Physiol Lung Cell Mol Physiol. 288: L1059-69, 2005. 8. Lopez-Barneo J, Pardal R, Montoro RJ, Smani T, Garcia-Hirschfeld J, Urena J. K+ and Ca2+ channel activity and cytosolic [Ca2+] in oxygen-sensing tissues. Respir Physiol. 115: 215-27, 1999. 9. Robertson TP, Aaronson PI, Ward JP. Hypoxic vasoconstriction and intracellular Ca2+ in pulmonary arteries: evidence for PKC-independent Ca2+ sensitization. Am J Physiol. 268: H301-7, 1995. 10. Gu M, Thorne GD, Wardle RL, Ishida Y, Paul RJ. Ca2+-independent hypoxic vasorelaxation in porcine coronary artery. J Physiol. 562: 839-46, 2005. 11. Fellner SK, Parker L. Endothelin-1, superoxide and adeninediphosphate ribose cyclase in shark vascular smooth muscle. J Exp Biol. 208: 1045-52, 2005. In vitro and in vivo phosphorylation state of Na-K-Cl cotransporter in the intestine of the euryhaline killifish, Fundulus heteroclitus, in response to varying osmolality

Michelle Y. Monette and Biff Forbush Department of Cellular and Molecular Physiology, Yale School of Medicine, New Haven, CT 06520

Marine teleosts are hypotonic to their environment and must combat the passive loss of water across the gills. To do this teleosts drink seawater, absorb NaCl and water across the intestine, and excrete excess ions via the gill. In the current model for ion transport in the intestine, NaCl is actively absorbed via the electroneutral, Na-K-Cl cotransporter (NKCC) present in the apical brushborder membrane1. A putative NKCC-absorptive isoform, NKCC2, homologous to that found in the thick ascending limb (TAL) of the loop of Henle in mammals, has been localized to the apical membrane of the intestine in several euryhaline species2,3,4. During long-term acclimation to FW and SW, mRNA and protein levels of NKCC2 in the killifish intestine decrease and increase, respectively, demonstrating a role for this transporter in ion/osmoregulation5. As an estuarine species, killifish face hourly fluctuations in environmental salinity, and are likely to need a mechanism for rapidly regulating NaCl absorption in the intestine. In mammalian epithelial cells and in the shark rectal gland, NKCC activity is regulated by protein phosphorylation6. Studies have suggested that NKCC activity may be regulated by protein phosphorylation in the intestine of teleosts during acute exposure to changing salinity7, however this remains to be determined.

To examine the effect of osmolality on the in vitro phosphorylation state of NKCC2, intestines were dissected from FW- and SW-acclimated killifish, cut into 0.5 cm pieces, incubated in teleost Ringer’s with varying osmolality and sampled after 30 min. To examine in vivo effects, SW- acclimated killifish were transferred to either FW, SW, or 2x SW and intestines were collected after various time-points. All samples were analyzed for total and phosphorylated NKCC2 protein using dot blot detection with T4 and R5 (phospho-specific) antibodies, respectively. In short, intestines were homogenized, centrifuged and supernatants collected for protein determination and for dilution into sample buffer. Proteins were blotted (2.5 g dots) in duplicate onto nitrocellulose membranes. Membranes were then probed with primary (T4 and R5) and secondary (HRP-conjugated) antibodies and developed using chemiluminescence and X-ray film. Developed film was digitized using a scanner and dot intensity was determined using Biorad’s Quantity One software.

Exposure of isolated intestines of FW-acclimated killifish to increasing osmolality had no effect on total NKCC protein (Fig. 1A), but led to substantial decreases in the ratio of phosphorylated NKCC (P-NKCC) to total NKCC (Fig. 1B). In isolated intestines of SW-acclimated killifish, increasing osmolality led to reduced total NKCC (Fig. 1A), but had no effect on NKCC phosphorylation state (Fig. 1B). This apparent decrease in total NKCC is puzzling and suggests proteolytic events under

Fig. 1. Dot blot quantification of total and phosphorylated NKCC (P-NKCC) in the isolated intestines of FW- and SW- acclimated killifish exposed to increasing osmolality. (A) Total NKCC detected with the T4 antibody, (B) P-NKCC (R5)/total NKCC (T4). Data are mean ± S.E. (n=6). An * indicates a significant difference (P<0.05) from the 300 mosmol kg-1 control within a group (FW and SW). these in vitro conditions (which has not been previously reported for NKCC). Exposure of isolated intestines of FW- and SW-acclimated killifish to decreasing osmolality, low extracellular chloride, and 10 M forskolin had no significant effect on either total NKCC or phosphorylation state (data not shown).

Transfer of killifish from SW to FW and 2x SW led to alterations in total NKCC protein in the intestine after several days. Eight days post-transfer, total NKCC was greater in the intestine of killifish in the 2x SW group as compared to SW controls, and 14 d post-transfer, total NKCC was greater in the 2x SW group and lower in the FW group as compared to SW controls (Fig. 2A). We did not observe any change in the phosphorylation state of NKCC upon short-term exposure to lower or higher salinity (< 2 d) (Fig. 2B).

The data presented here clearly demonstrate that alterations in NKCC2 protein expression, but not phosphorylation state, play a role in the regulatory processes of the killifish intestine during salinity acclimation. Interestingly, this is in contrast to the NKCC1 isoform in the killifish gill which exhibits rapid alterations in phosphorylation state upon exposure to changing environmental salinity8. Our in vitro studies indicate that NKCC2 activity can be decreased but not increased upon exposure to changing osmolality, suggesting that NKCC2 Fig. 2. Dot blot quantification of total and phosphorylated NKCC (P-NKCC) present in the apical membrane of the intestine may be in the intestine of killifish after maximally phosphorylated, consistent with the active state of transfer to water of varying salinity. NKCC2 in the TAL. Our results support the idea that (A) Total NKCC detected with the T4 different molecular and biochemical mechanisms may antibody, (B) P-NKCC (R5)/total underlie the plasticity of osmoregulatory organs (gill and NKCC (T4).Data are mean ± S.E. (n=6). An * indicates a significant intestine) in response to acute changes in environmental difference (P<0.05) from SW control salinity. This research was funded by NIH R01 DK47661 to within a time-point. BF.

1. Marshall, W.S. and Grosell, M. Ion transport, osmoregulation and acid-base balance. In: Physiology of Fishes (ed. D.H. Evans and J.B. Claiborne), CRC Press, Boca Raton, FL, p.177-230, 2005. 2. O’Grady, S.M., Musch, M.W., and Field, M. Stoichiometry and ion affinities of the Na-K-Cl cotransport system in the intestine of the winter flounder (Pseudopleuronectes americanus). J. Membr. Bio. 91:33-41, 1986. 3. Djurisic, M., Isenring, P. and Forbush, B.. Cloning, tissue distribution and changes during salt adaptation of three Na-K-Cl cotransporter isoforms from killifish, Fundulus heteroclitus. Bull. MDIBL 42: 89-90, 2003. 4. Cutler, C.P. and Cramb, G. Differential expression of absorptive cation-chloride-cotransporters in the intestinal and renal tissues of the European eel, Anguilla anguilla. Comp. Biochem. Physiol. B 149:63-73, 2008. 5. Djurisic, M. and Forbush, B. Regulation of NKCC2 expression in the gut of Fundulus heteroclitus on change in salinity. Bulletin MDIBL 45:15-15, 2006. 6. Haas, M. and Forbush, B. The Na-K-Cl cotransporter of secretory epithelia. Annu. Rev. Physiol. 62:515-534, 2000. 7. Lionetto, M.G. and Schettino, T. The Na+-K+-2Cl- cotransporter and the osmotic stress response in a model salt transport epithelium. Acta Physiol 187:115-124, 2006. 8. Flemmer, A.W., Behnke, R., and Forbush, B. Changes in phosphorylation state in the Na-K-Cl cotransporter (NKCC) in chloride cells of the gill of Fundulus heteroclitus (killifish) during salt adaptation. Bulletin MDIBL 38: 80-80, 1999. Molecular cloning of p38 MAP kinase cDNA from killifish (Fundulus heteroclitus)

Erin E. Flynn1,2, M. Christine Chapline1, Jordan A. Francke1,3, Cecily J. Swinburne1,4, Joseph R. Shaw1,5, Bruce A. Stanton1,6, and J. Denry Sato1 1MDI Biological Laboratory, Salsbury Cove, ME; 2John Bapst HS, Bangor, ME; 3Presque Isle HS, Presque Isle, ME; 4College of the Atlantic, Bar Harbor, ME; 5Indiana University, Bloomington, IN; 6Dartmouth Medical School, Hanover, NH

Serum- and glucocorticoid-inducible kinase (SGK) regulates the cystic fibrosis transmembrane regulator (CFTR) chloride ion channel in the adaptation of killifish, a euryhaline teleost, to increased environmental salinity1,2. SGK function is regulated at the levels of transcription, kinase activation, and protein degradation. The stress-responsive kinase p38 MAP kinase (p38 MAPK/MAPK 14) regulates mammalian SGK gene transcription3. Our working hypothesis is that in response to increased salinity p38 MAPK increases CFTR activity in killifish gill tissue through its stimulation of SGK activity. We are cloning killifish p38 MAPK cDNA to design anti-sense morpholino oligonucleotides to test our hypothesis by knocking down p38 MAPK expression in killifish transferred from fresh water to sea water and measuring survival and SGK levels in the gills of treated fish.

Using p38 MAPK cDNA sequences from salmon, carp and zebrafish we designed forward and reverse synthetic p38 MAPK oligonucleotide primers for polymerase chain reaction (PCR) experiments (Fig. 1). First strand cDNA was synthesized from killifish liver total RNA, and putative p38 MAPK cDNA fragments were amplified with paired primers based on areas of homology between carp, salmon, and zebrafish p38 MAPK sequences.

Figure 1. Locations of synthetic oligonucleotide primers used to amplify killifish p38 MAP kinase cDNA fragments.

Several cDNA fragments were cloned, purified and sequenced. Nested p38 MAPK cDNA fragments of 400 bp, 700 bp and 1 kb were identified. The 1 kb fragment was generated by primers F4 and R3 from two independent cDNA preparations (Fig. 2). The DNA sequence of this fragment corresponded to approximately 90% of the coding region of p38 MAPK in human, carp and zebrafish (Fig. 3). Over a span of 330 amino acid residues p38 MAPK proteins from these four species were more than 92% similar. By sequencing multiple cDNA fragments, we have detected putative allelic polymorphisms in killifish p38 MAPK. 5’-RACE experiments have been done to obtain the nucleotide sequence spanning the p38 MAPK cDNA translation start site, which will be targeted with anti-sense morpholino oligonucleotides.

Figure 2. Two independent 1 kb killifish p38 MAPK cDNA fragments resolved by electrophoresis in a 1.2% agarose gel. These fragments were amplified by RT-PCR with primers F4 and R3, purified, cloned, and sequenced.

We thank Christine Smith of the MDIBL Marine DNA Sequencing Center for DNA sequencing. This research was supported by INBRE grant P20-RR016463 from the NCRR, grant RO1- DK45881 from NIDDK to BAS, a Cystic Fibrosis Foundation research development program grant to BAS, and by NIEHS grant P30-ES03828. CJS was supported by INBRE grant P20-RR016463 from the NCRR. EEF and JAF were supported by STEER grant 1-R25-ES016254.

We dedicate this manu- script to the memory of Dr. Frank Epstein - a scientist, a mentor and a colleague.

Figure 3. Alignment of the deduced amino acid sequences of p38 MAPK from carp, zebrafish, human and killifish. Asterisks denote identical residues, and colons denote similar residues.

1. Sato, J.D., Chapline, M.C., Thibodeau, R., Frizzell, R.A. and Stanton, B.A. Regulation of human cystic fibrosis transmembrane conductance regulator (CFTR) by serum- and glucocorticoid-inducible kinase (SGK1). Cell. Physiol. Biochem. 20: 91-98, 2007. 2. Shaw, J.R., Sato, J.D., VanderHeide, J., LaCasse, T., Stanton, C.R., Lankowski, A., Stanton, S.E., Chapline, M.C., Coutermarsh, B., Barnaby, R., Karlson, K., and Stanton, B.A. The role of SGK and CFTR in acute adaptation to seawater in Fundulus heteroclitus. Cell. Physiol. Biochem., 22: 69-78, 2008. 3. Firestone, G.L., Giampaolo, J.R. and O’Keeffe, B.A. Stimulus-dependent regulation of serum and glucocorticoid- inducible protein kinase (SGK) transcription, subcellular localization and enzymatic activity. Cell. Physiol. Biochem. 13: 1-12, 2003.

Cyclic GMP inhibition of phosphodiesterase III mediates C-type natriuretic peptide (CNP) stimulation of chloride secretion in the rectal gland of the spiny dogfish (Squalus acanthias)

Ben C. Tilly1,2, Boris M. Hogema1,2, Catherine A. Kelley2,3, John N. Forrest Jr.2,3, and Hugo R. de Jonge1,2 1Department of Biochemistry, Erasmus University Medical Center, 3000CA Rotterdam, The Netherlands 2Mount Desert Island Biological Laboratory, Salisbury Cove, ME 04672 3Department of Medicine, Yale University School of Medicine, New Haven, CT 06510

The C-type natriuretic peptide CNP, a cardiac hormone released into the circulation in response to volume load, functions as a major physiological activator of CFTR-mediated Cl- secretion in the shark rectal gland (SRG) by activating a CNP-selective receptor guanylyl cyclase at the basolateral membrane of the epithelial cells (designated NPR-B)1. Release of VIP from nerves in the gland has also been proposed2. The mechanism by which intracellular cyclic GMP (cGMP) activates chloride secretion in SRGs is ill-defined. In analogy with cGMP signalling in mammalian enterocytes, several mechanisms can be proposed, including (i) cGMP activation of a specific membrane-bound isoform of cGMP-dependent protein kinase (cGKII) that has been purified, cloned and characterized in the de Jonge lab. This isoenzyme serves as the major cGMP receptor in small intestinal epithelium and as a prime target for anti-diarrheal pharmacotherapy3-6; (ii) cGMP inhibition of type III phosphodiesterase (PDE-3), raising local cAMP levels4; (iii) cGMP cross-activation of cAMP-dependent protein kinase (PK-A)5; (iv) direct interaction of cGMP with a cyclic nucleotide-binding domain in CFTR7; and (v) cGMP activation of cyclic nucleotide-gated channels (CNGs)8.

In an attempt to identify the cGMP target protein(s) linking cGMP signalling to the ion transporters in the SRG we first searched for the expression of a dogfish ortholog of cGKII in the rectal gland through a combination of molecular cloning and protein purification experiments.

In order to clone a putative cGK encoding gene, various degenerate primer sets were designed to promote amplification of part of the cGKII gene present in all 15 species known to express a cGKII sequence, including two species of teleosts (Danio rerio and Tetraodon nigroviridis). However, using these primers no cGKII homolog was detected after RT-PCR amplification of cDNA isolated from the rectal gland. Degenerate primers were also designed that bind to the most conserved sequences in both cGKI and cGKII, i.e. the cGMP binding sites and part of the kinase domain consensus sequence. Using these primers, fragments from two different cGKI isoforms were amplified from the rectal gland. Again, no cGKII homolog could be detected. Attempts to amplify the 5’ end of these genes using degenerate primers specific for cGKI! or cGKI" failed, suggesting that the N-terminal part of these proteins differs strongly from those in mammals. Deviation in the N-terminal part of the protein has also been observed in zebrafish, which has three cGKI encoding genes, only one of which has a N- terminus highly homologous to cGKI! from many species including human.

Using various degenerate primers to amplify the 5’ end (starting at exon 2 from the human gene), larger fragments of both S. acanthias cGKI isoforms were obtained. The sequences of the final amplification products of 1448 and 1654 bp were deposited in the GenBank (accession numbers FJ624866 and FJ624865, respectively). One of the two isoforms, which is partially identical to a previously identified EST clone (GenBank accession ES 452242) was shown to contain a stop codon at position aa 173 (relative to human cGKI!), which lies outside the part of the EST clone sequenced previously. The other cGKI gene was highly homologous to cGKI from various species (93% identical

to human cGKI, 89% identical to zebrafish). In particular the cGMP binding domains and the catalytic domain are highly conserved, suggesting that this gene encodes an active cGMP-dependent protein kinase. However, mRNA expression levels of this kinase as determined by RT-PCR were >10-fold higher in intact whole rectal gland as compared to freshly isolated epithelial cells, suggesting that most if not all cGKI is confined to neuronal or smooth muscle cells rather than epithelial tissue.

In parallel we tried to detect cGK protein in lysates of cultured SRG epithelial cells by cGMP- or cAMP-agarose affinity-chromatography followed by cGMP-triggered autophosphorylation in the presence of [#-32P]ATP6, SDS-PAGE, and autoradiography or Western blotting using cGKII-or cGKI- specific antibodies. Whereas trace amounts of recombinant cGKII mixed with the SRG cell extracts were readily detected, endogenous shark cGK could not be identified by this approach. In conclusion, both molecular cloning and protein isolation approaches were unable to provide evidence for the expression of a type I or type II ortholog of mammalian cGKs in SRG epithelial cells, arguing strongly against a key role of cGKs as a regulator of CNP/cGMP-activated chloride secretion in this cell type.

To further pursue the mechanism of CNP-induced secretion we performed electrical measurements of transepithelial chloride transport in primary cultures of shark rectal gland epithelial cells in Ussing chambers. SRG tubular epithelial cells were isolated and cultured on CoStar Transwell filters for 10-25 days as previously described9. Confluent monolayers were mounted in a modified Ussing chamber and bathed with a solution containing 270 mM NaCl, 6 mM KCl, 3 mM MgCl2, 5 mM CaCl2, 20 mM NaHCO3, 350 mM urea, 5 mM glucose at pH = 7.5. The chamber was kept at 20 °C and was constantly gassed with 95% O2/5% CO2. The voltage clamp and data acquisition equipment was designed and constructed by W. Van Driessche (Catholic University, Louvain, Belgium) and has been described in detail previously10. Hormones and (ant-) agonists were added to both the mucosal and the serosal side. - Data shown are short-circuit current (Isc) tracings (reflecting CFTR-mediated Cl secretion) and are representative of 3-8 identical experiments.

Fig. 1: Both the cGMP agonist CNP and the cAMP agonist forskolin stimulate electrogenic Cl- secretion in filter-grown SRG epithelial cells.

As shown in Fig. 1, CNP provoked a large increase in transepithelial chloride transport that was further enhanced by the adenylyl cyclase activator forskolin, triggering cAMP/PKA-mediated phosphorylation and activation of CFTR11. Surprisingly, CNP-induced Cl- secretion could not be mimicked by any of the membrane-permeant and phosphodiesterase (PDE)-resistant cGMP analogs, including the cGKII-specific analog 8-pCPT-cGMP and the cGKI-specific analog 8-Br-PET-cGMP (Fig. 2). In contrast, the PKA-specific analog 6-MB-cAMP caused a partial activation of chloride secretion (Fig. 2).

Fig. 2: cGMP analogs (tested at 100 µM concentrations) fail to activate electrogenic Cl- secretion in filter-grown monolayers of SRG epithelial cells.

The protein kinase inhibition experiments pointed to a role for PKA rather than cGK in CNP- provoked chloride secretion in SRG epithelial cells (Fig. 3). The relatively selective cGK inhibitor H-8, tested within a concentration range that caused inhibition of cGMP-, but not of cAMP-provoked chloride secretion in intestinal epithelium3, was unable to block the CNP-induced Isc response in SRG epithelial cells (Fig. 3, upper tracing). In contrast, H-89, a selective inhibitor of PKA, but a poor inhibitor of PKC and of many other protein kinases, as well as the broad spectrum kinase inhibitor staurosporine, almost completely inhibited both CNP-provoked and forskolin/cAMP-provoked chloride secretion in the rectal gland (Fig. 3). These findings strongly suggest that CNP acts through a PKA rather than a cGK or PKC dependent pathway, and are in apparent conflict with a previous model postulated on the basis of SRG perfusion studies2.

Fig. 3: The PKA inhibitors H-89 and staurosporine, but not the specific cGK inhibitor H-8, almost fully inhibit the Isc response to CNP in filter-grown monolayers of SRG epithelial cells.

Two potential mechanisms could explain how CNP, following activation of guanylyl cyclase and cGMP generation, could activate PKA, i.e. cGMP cross-activation of PKA, or cGMP inhibition of PDE3 resulting in a reduced breakdown of cAMP and a local increase in cAMP levels. In support of the second mechanism, both the specific PDE3 inhibitor amrinone and the more potent inhibitor milrinone were found to fully mimic the effect of CNP on epithelial chloride secretion, and to prevent a further increase in Isc after subsequent addition of CNP (Fig. 4). This finding is consistent with previously published data showing that exposure of SRGs to CNP not only resulted in a strong increase in cGMP levels, but also in a more modest but significant increase in cAMP levels2.

Fig. 4: The PDE3 inhibitors amrinone and milrinone, but not the PDE5 inhibitor zaprinast, are able to mimic the Cl- secretory response to CNP in filter-grown monolayers of SRG epithelial cells.

These data provide strong functional evidence for the expression of a shark ortholog of PDE3 in SRG epithelia, and, in conjunction with the results from perfusion studies reported in this Bulletin (see Kelley et al), support a model in which CNP elicits SRG chloride secretion through cGMP-inhibition of PDE3 and activation of PKA, rather than through activation of cGK. In this light the failure of PDE- resistant cGMP analogs to mimic CNP action (Fig. 2) can be explained by their inability to interact with PDE3, in contrast to cGMP itself. A similar mechanism has been postulated previously for the action of the cGMP agonist Escherichia coli heat-stable enterotoxin (STa) in mouse proximal colon, showing residual STa stimulation of CFTR-mediated chloride secretion in cGKII -/- mice (mimicked by amrinone) under conditions in which 8-Br-cGMP had completely lost its effect4.

Supported by an MDIBL New Investigator Award to H.d.J. and by NIH grants DK 34208 and NIEHS 5 P30 ES03828 (Center for Membrane Toxicity Studies) to J.N.F.

1. Aller SG, Lombardo ID, Bhanot S, Forrest JN, Jr. Cloning, characterization, and functional expression of a CNP receptor regulating CFTR in the shark rectal gland. Am. J. Physiol. 276: 442-449, 1999. 2 Silva P, Solomon RJ, Epstein FH. Mode of activation of salt secretion by C-type natriuretic peptide in the shark rectal gland. Am.J. Physiol. 277: R1725-R1732, 1999. 3. Vaandrager AB, Bot AGM, De Jonge HR. Guanosine 3',5'-cyclic monophosphate-dependent protein kinase II mediates heat-stable enterotoxin-provoked chloride secretion in rat intestine. Gastroenterology 112: 437-443, 1997. 4. Vaandrager AB, Bot AGM, Ruth P, Pfeifer A, Hofmann F, De Jonge HR. Differential role of cyclic GMP-dependent protein kinase II in ion transport in murine small intestine and colon. Gastroenterology 118: 108-114, 2000. 5. Vaandrager AB, Hogema BM, De Jonge HR. Molecular properties and biological functions of cGMP-dependent protein kinase II. Front. Biosci. 10:2150-2164, 2005. 6. Vaandrager AB, Hogema BM, Edixhoven M, Van den Burg C, Ruth P,Hofmann F, Vandekerckhove J, De Jonge HR. Autophosphorylation of cGMP-dependent protein kinase type II. J. Biol. Chem.278: 28651-28658, 2003 7. Sullivan SK, Agellon LB, Schick R. Identification and partial characterization of a domain in CFTR that may bind cyclic nucleotides directly. Curr. Biol.5: 1159-1167, 1995. 8. Pitari GM, Zinman LV, Hodgson DM, Alekseev AE, Kazerounian S, Bienengraeber M, Hajnoczky G, Terzic A, Waldman SA. Bacterial enterotoxins are associated with resistance to colon cancer. Proc. Natl. Acad. Sci. USA 100: 2695-2699, 2003. 9. Valentich JD, Forrest JN Jr. Cl- secretion by cultured shark rectal gland cells. I. Transepithelial transport. Am. J. Physiol. 260: C813-823, 1991. 10. Butterworth MB, Edinger RS, Johnson JP, Frizzell RA. Acute ENaC stimulation by cAMP in a kidney cell line is mediated by exocytic insertion from a recycling channel pool. J. Gen. Physiol.125: 81-101, 2005. 11. Lehrich RW, Aller SG, Webster P, Marino CR, Forrest JN, Jr. Vasoactive intestinal peptide, forskolin, and genistein increase apical CFTR trafficking in the rectal gland of the spiny dogfish, Squalus acanthias. J. Clin. Invest. 101: 737-745, 1998.

Stimulation of chloride secretion by CNP is mediated by Cyclic GMP inhibition of phosphodiesterase III in the rectal gland of the spiny dogfish, Squalus acanthias: Evidence from in vitro perfusion studies

Catherine A. Kelley1,5, Anna Kufner2,5, Will S. W. Epstein3,5, August M. Melita2,5, Michael L. Hart5, Ben C. Tilly 4,5, Hugo R. de Jonge4,5 and John N. Forrest Jr1,5. 1Department of Internal Medicine, Yale University School of Medicine, New Haven, CT 06510 2University of Vermont, Burlington, VT 05405 3Brown University, Providence, RI 02912 4Department of Biochemistry, Erasmus University Medical Center, 3000CA Rotterdam, The Netherlands 5Mount Desert Island Biological Laboratory, Salisbury Cove, ME 04672

C-type natriuretic peptide (CNP) is the dominant cardiac peptide in the shark heart and is a major physiological activator of CFTR-mediated chloride (Cl-) secretion in the shark rectal gland (SRG)1. CNP activates a CNP-selective receptor guanylyl cyclase, designated NPR-B, at the basolateral membrane of rectal gland epithelial cells. The Forrest lab has cloned this receptor from shark rectal gland and shown that CNP activates Cl- conductance when CFTR and shark NPR-B are co-expressed in Xenopus oocytes2. The mechanism by which cyclic GMP (cGMP) activates Cl- secretion in SRGs is ill-defined although several mechanisms have proposed, including (i) cGMP activation of a specific membrane-bound isoform of cGMP-dependent protein kinase (cGKII) 3, (ii) cGMP inhibition of type III phosphodiesterase (PDE-3), raising cAMP levels4; (iii) cGMP cross-activation of cAMP-dependent protein kinase (PK-A)5; (iv) direct interaction of cGMP with a cyclic nucleotide-binding domain in CFTR6; and (v) cGMP activation of cyclic nucleotide-gated channels7.

To better define the pathway linking NPR-B-cGMP signalling to chloride secretion in the SRG, we carried our perfusion studies in the intact rectal gland under multiple conditions with measurements of tissue cGMP content. The following reagents were added to the perfusate as described below: shark CNP; 8- Br-cGMP; PMA, an activator of protein kinase C; zaprinast, an inhibitor of phosphodiesterase V and VI; amrinone, a type III phosphodiesterase inhibitor. PMA was also perfused with 8-Br-cGMP and zaprinast because previous experiments had suggested that this combination modestly stimulated rectal gland secretion8.

Freshly excised rectal glands were perfused in vitro using methods previously described9. Glands were first perfused to basal levels with shark Ringer’s for 30 min and then various drugs were added to the solution for an additional 15 min. Cl- secretion was measured at 10 min intervals for the first 30 min and at 1 min intervals thereafter. At the end of the experiments rectal glands were snap frozen in liquid nitrogen and stored at -80°C. To extract cyclic cGMP from tissues, a small portion of the gland was homogenized in a 6% TCA solution. The protein pellet was separated from the solution by centrifugation and saved for protein assay. The TCA solution was then extracted with 1,2,2- trichlorofloroethane and the aqueous layer was saved for the cGMP assay. A cGMP EIA assay kit was used from biomedical technologies (BT-740). The non-acetylated protocol was followed using an incubation period of about 20 to 22 hours. The protein pellet was dissolved in sodium hydroxide overnight in a 37°C. water bath. Protein concentration was determined using a Lowry type protein assay from BioRad (500-0111). All values are expressed as mean ± SEM.

Figure 1. Cl- secretion in perfused glands comparing the response to 8-Br-cGMP (100 µM), vs. 8-Br-cGMP + PMA (100 µM) vs. zaprinast (100 µM) vs. zaprinast + PMA vs. 8-Br cGMP + zaprinast + PMA. After 30 min of perfusion with basal shark Ringer’s solution, glands were perfused for 15 min with these compounds. n=3-5 perfused glands per condition.

8-Br-cGMP alone, or in combination with the phorbol ester PMA, failed to stimulate Cl- secretion above basal levels (Figure 1). Zaprinast, an inhibitor of type V and VI phosphodiesterase that is resistant to inhibition by cGMP had no effect on Cl- secretion in the absence or presence of PMA. The combination of 8-Br-CGMP +PMA + zaprinast also did not stimulate Cl- secretion above basal values.

Figure 2. Cl- secretion in perfused rectal glands comparing the response to CNP vs amronone, vs CNP + Amrinone. Following 30 min of perfusion with basal shark Ringer’s solution, glands were perfused for 15 minutes with either CNP (10 nM), amrinone (200 µM), amrinone (200 µM + CNP (10 nM) or basal Ringer’s. n=3-5 per condition. In contrast, perfusion with shark CNP (10 nM) resulted in marked stimulation of Cl-secretion to values of 1808 ± 398 µEqCl/h/g (Figure 2). Amrinone, a type III phosphodiesterase inhibitor stimulated Cl- secretion to comparable values (1401 ± 274 µEqCl/h/g). The combination of CNP + amrinone resulted in Cl- secretion that was identical to CNP alone (1809 ±49 µEqCl/h/g). Thus, the effects of a specific type III phosphodiesterase inhibitor were nearly identical to CNP and the addition of this inhibitor to CNP did not result in further Cl- secretion.

600 Figure 3 depicts the cGMP tissue 500 content at the end of the experiments. Zaprinast, a type V and VI PDE inhibitor, 400 did not increase tissue cGMP content above basal values (3.63 ± 0.98 pmol/mg 300 protein vs 1.94 ± 0.22). 8-Br-cGMP alone

200 resulted in marked stimulation of tissue cGMP to values of 319 ± 59 pmol/mg 100 protein, as did the combination of zaprinast, PMA and 8-Br-cGMP (470 ±61

Tissue cGMP content (pmol/mg protien) 0 pmol/mg protein). Despite these marked Basal Zaprinast (100!M) 8- Br-cGMP Zaprinast (100!M) (100!M) + PMA (100!M) + stimulations in cGMP content, chloride 8-Br-cGMP (100!M) secretion was not stimulated by these agents (Figure 1).

Figure 3. Tissue cGMP content in rectal glands perfused for 15 min with zaprinast, with 8-Br-cGMP and with the combination of zaprinast+PMA+ 8-Br-cGMP. n=3-5 per condition (p<0.001 for both 8-Br-cGMP alone and 8-Br-cGMP + PMA + Zaprinast compared to basal). In contrast, CNP both markedly stimulated chloride secretion (Figure 2) and increased tissue cGMP (Figure 4). Nearly identical results, ie, both stimulation of chloride secretion (Figure 2) and cGMP content (Figure 4) were observed with amrinone + CNP. The effects of amrinone on chloride secretion (Figure 1) and tissue cyclic nucleotide content (Figure 4) were not additive to CNP.

Figure 4. Tissue cGMP content in rectal glands perfused for 15 min with CNP, amrinone, and CNP + amrinone. n=3-5 glands per condition. (p<0.01 for CNP alone and amrinone +CNP compared to basal).

These data, taken together with other studies (see abstract in this Bulletin by Tilly et al10) provide strong functional and biochemical evidence that CNP elicits SRG chloride secretion in the shark rectal gland by elevating intracellular cGMP which then inhibits a type III phosphodiesterase. This cGMP inhibition of type III phosphodiesterase results in a local increase in cAMP and subsequent activation of PKA.

Data supporting this conclusion from both studies include: (1) 8-Br-cGMP does not increase chloride secretion alone or in combination with PMA despite large increases in tissue cGMP; (2) Amrinone, an inhibitor of type III phosphodiesterase, stimulates Cl- secretion to comparable levels as CNP in both the perfused gland and in monolayers of cultured SRG epithelial cells; (3) Other PDE- resistant cGMP analogs fail to stimulate Cl- secretion in cultured rectal gland epithelial monolayers; (4) The PKA inhibitors H-89 and staurosporine, but not the specific cGK inhibitor H-8, inhibit the Isc response to CNP in monlayers of SRG epithelial cells; (5) molecular cloning and protein purification experiments fail to demonstrate a dogfish ortholog of cGKII in the rectal gland.

This work was supported by NIH grants DK 34208, NIEHS 5 P30 ES03828 (Center for Membrane Toxicity Studies) to J.N.F., an NSF grant DBI-0139190 (REU site at MDIBL) and an MDIBL New Investigator Award to H. d. J.

1. Schofield, J. P., D. S. Jones, and J. N. Forrest, Jr. Identification of C-type natriuretic peptide in heart of spiny dogfish shark (Squalus acanthias). Am. J. Physiol. 261 (Renal Fluid Electrolyte Physiol. 30): F734-F739, 1991 2. Aller, S.G., I.D. Lombardo, S. Bhanot S. JN Forrest Jr. Cloning, characterization, and functional expression of a CNP receptor regulating CFTR in the shark rectal gland. Am. J. Physiol. 276:C442-9, 1999. 3. Vaandrager AB, Bot AGM, De Jonge HR. Guanosine 3',5'-cyclic monophosphate-dependent protein kinase II mediates heat-stable enterotoxin-provoked chloride secretion in rat intestine. Gastroenterology 112: 437-443, 1997. 4. Vaandrager AB, Bot AGM, Ruth P, Pfeifer A, Hofmann F, De Jonge HR. Differential role of cyclic GMP-dependent protein kinase II in ion transport in murine small intestine and colon. Gastroenterology 118: 108-114, 2000. 5. Vaandrager AB, Hogema BM, De Jonge HR. Molecular properties and biological functions of cGMP-dependent protein kinase II. Front. Biosci. 10:2150-2164, 2005. 6. Sullivan SK, Agellon LB, Schick R. Identification and partial characterization of a domain in CFTR that may bind cyclic nucleotides directly. Curr. Biol.5: 1159-1167, 1995. 7. Pitari GM, Zinman LV, Hodgson DM, Alekseev AE, Kazerounian S, Bienengraeber M, Hajnoczky G, Terzic A, Waldman SA. Bacterial enterotoxins are associated with resistance to colon cancer. Proc. Natl. Acad. Sci. USA 100: 2695-2699, 2003. 8. Silva, P., R.J. Solomon, F.H. Epstein Mode of activation of salt secretion by C-type natriuretic peptide in the shark rectal gland. Am. J. Physiol. 277 (46): R1725- R1732,1999. 9. Kelley, GG, EM Poeschla, HV Barron, JN Forrest Jr. A1 adenosine receptors inhibit chloride transport in the shark rectal gland. Dissociation of inhibition and cyclic AMP. J. Clin. Invest. 85 (5): 1629-36,1990. 10. Tilly, BC, Hogema, BM, Kelley, CA, Forrest, JN, and HR de Jonge. Cyclic GMP inhibition of phosphodiesterase III mediates C-type natriuretic peptide (CNP) stimulation of chloride secretion in the rectal gland of the spiny dogfish (Squalus acanthias), Bull. of the MDIBL. 48:27-30, 2009.

A carbonic anhydrase repressor acts on the level of gene expression in the euryhaline green crab, Carcinus maenas

Raymond P. Henry Department of Biological Sciences Auburn University, Auburn, AL 36849

Euryhaline crustaceans, such as the green crab, can survive large reductions in environmental salinity, primarily because they can regulate the osmotic concentrations in their hemolymph above those in low salinity waters. This is accomplished through the active uptake of salts (e.g., Na+- and Cl ), specifically by the posterior three pairs of ion-transporting gills. The enzyme carbonic anhydrase (CA) has been shown to be a central component of the molecular mechanism of low salinity adaptation in these species. High levels of CA activity are found in the posterior gills, and that activity is induced up to 10 fold during acclimation to low salinity1.

CA induction is believed to be under transcriptional regulation, with CA mRNA increasing initially after low salinity exposure, and CA activity following thereafter, presumably as a result of the synthesis of new CA protein3. Furthermore, it is believed that CA expression is under inhibitory regulation by a repressor that is present in the eyestalk of the crab at high salinity2. Injections of eyestalk extract inhibit normal salinity-stimulated CA induction by up to 70%. The eyestalk contains the major endocrine complex of the crab, the X-organ/sinus gland complex. The sinus gland is also known to contain a family of inhibitory peptides known as the crustacean hyperglycemic hormone (CHH) family. The CA repressor appears to have some functional similarity to these inhibitory peptides, and so it is tempting to suggest that it is a related member of this group that is also stored in the sinus gland. It is also believed that the repressor is transported to the gills via the hemolymph, as injections of hemolymph from high salinity acclimated crabs have also been shown to inhibit CA induction.5 This report represents the initial direct testing of the hypothesis that the CA repressor works directly at the level of gene expression.

Adult, intermolt green crabs were collected locally from the shoreline around MDIBL. Crabs were maintained in running seawater at 31 ppt salinity and 12oC. They were transferred directly to 15 ppt for a period of 6 hr. Crabs were either untreated or given hourly injections of either sinus gland extract or hemolymph, both taken from crabs acclimated to 31 ppt. For the eystalk dissections, crabs were chilled on ice and the eyestalks were removed at their base with dissecting scissors. The eyestalks were kept on ice, and the interior tissue was removed intact with a dissecting needle. The sinus gland was then separated out from the remaining medullary tissue under a dissecting microscope. For each injection, individual crabs were given the equivalent of two sinus glands homogenized in 500 ìL of filtered seawater. For hemolymph, crabs were given hourly injections of 1 mL. After 6 hr, anterior (G4) and posterior (G8) gills were dissected out of the crabs, total RNA was isolated and quantitatively assayed. RNA was reverse transcribed, and isoform-specific primers were used to amplify the cytoplasmic CA isoform (CAc) via real- time quantitative PCR4.

For crabs acclimated to 32 ppt, CAc mRNA levels were uniformly low in anterior and posterior gills. Transfer to 15 ppt for 6 hr resulted in an approximate five-fold induction of CAc mRNA expression in posterior gills only. Hourly injections of sinus gland extract inhibited this CA induction by approximately 40% (Fig. 1). Injections of hemolyph were more effective, inhibiting the increase in CAc gene expression by nearly 90% (Fig. 1). These results strongly suggest that the previously reported effectiveness of whole eyestalk extracts and sinus gland extracts on inhibiting low salinity mediated induction of CA activity has its basis in the inhibition of CA gene expression. It appears that the putative CA repressor functions by maintaining CAc mRNA expression at low, baseline levels when crabs are acclimated to high salinity, and this, in turn, results in low levels of the CA protein and low protein-specific CA activity.

Figure 1. Relative mRNA abunance of the cytoplasmic carbonic anhydrase isoform (CAc) in anterior (G4, black bars) and posterior (G8, gray bars) gills of green crabs acclimated to 32 ppt and transferred to 15 ppt for 6 hr. Con = controls; SG-inj = crabs injected with sinus gland extract; H- inj = crabs injected with hemolymph. Mean + SEM (N=6). Letters over the bars indicate significant differences in G8 across the treatments.

These results will aid in the identification of the CA repressor. Sinus gland contents will be fractionated via HPLC, and inhibition of CAc gene expression will be used as a rapid bioassay for identification of the peak with CA repressor activity.

Supported by NSF IBN 02-30005 and by funds from the Thomas H. Maren Foundation.

1. Henry, R.P., Garrelts, E.E., McCarty, M.M., and Towle, D.W. Differential induction of branchial carbonic anhydrase and Na++/K ATPase in the euryhaline crab, Carcinus maenas. J. Exp. Zool. 292:595-603. 2002. 2. H enry, R.P. Functional evidence for the presence of a carbonic anhydrase repressor in the eyestalk of the euryhaline green crab Carcinus maenas. J. Exp. Biol. 209:2595-2605. 2006. 3. Serrano, L., Halanych, K.M., and Henry, R.P. Salinity-stimulated chanage sin expression and activity of two carbnonic anhydrase isoforms in the blue crab, Calllinectes sapidus. J. Exp. Biol. 210:2320-2332. 2007. 4. Serrano, L., and Henry, R.P. Differential Expression and Induction of Two Carbonic Anhydrase Isoforms in the Gills of the Euryhaline Green Crab, Carcinus maenas, in Response to Low Salinity. Comp. Biochem. Physiol. D: 186-193. 2008. 5. Smith, C., and Henry, R.P. A carbonic anhydrase repressor is found in the hemolymph of the euryhaline green crab, Carcinus maenas. Bull. Mt. Desert Island Biol. Lab. 43:108-109. 2004. Mechanism of action of riboflavin + ultraviolet radiation treatment in corneal strengthening: spiny dogfish sharks (Squalus acanthias) vs. rabbits (New Zealand White)

A.S. McCall1A,2, S. Kraft1B, H.F. Edelhauser3, G.W. Kidder2, R.R. Lundquist4, H.E. Bradshaw5, Z. Dedeic6, M.J. Chase7, E. Clement8, and G.W. Conrad1A,2 ADivision of Biology, BDepartment of Chemistry, 1Kansas State University, Manhattan, KS; 2Mount Desert Island Biological Laboratory, Salisbury Cove, ME; 3Department of Ophthalmology, Emory University School of Medicine, Atlanta, GA; 4G-R Manufacturing, Manhattan, KS; 5MDI High School, Mt.Desert Island, ME; 6College of the Atlantic, Bar Harbor, ME; 7University of New England, Biddeford, ME; 8Sheridan High School, Sheridan, AR.

Chronic degenerative central cornea thinning, keratoconus, is halted by application of 0.1 wt% 2 2 Riboflavin (2.65 mM Vitamin B2) (RF) solution + Ultraviolet Radiation: 365 nm, 3 mW/cm (UVA) . This treatment may increase corneal component cross-linking1, but the fundamental mechanism of the (RF+UVA) effect is not understood.

1 Mechanistic studies were conducted to determine if singlet oxygen ( O2) is a reactive intermediate 1 and to identify reactive cross-linking moieties in corneas. ( O2) was modulated via addition of sodium azide to clinical solutions or preparation of RF solutions in deuterium oxide (D2O). Modulation of reactive groups in corneas was accomplished via whole cornea pretreatment with ethyl acetimidate, hydroxylamine, 2,4-dinitrophenylhydrazone (DNPH), or acetic anyhydride. Experiments were performed on corneas of Spiny Dogfish sharks (Squalus acanthias) and rabbits (New Zealand White) to quantitatively compare the effects of the (RF+UVA) protocol across species.

Azide severely limited corneal strengthening at concentrations as low as 1.325 mM. Conversely, RF solutions made in D2O produced strengthening equivalent to control clinical treatment at 1/10th the clinical RF concentration, whereas clinical RF concentrations in D2O produced corneas 3-fold stronger 1 than clinically treated controls, positively indicating involvement of ( O2). Acetic anhydride and ethyl acetimidate selectively react with free amino groups, yet pretreatment with either chemical alone still allowed statistically significant increases in corneal strength to occur in response to subsequent clinical (RF+UVA) treatment, strongly indicating that the cross-linking reaction is independent of free amine availability. In contrast, pretreatment with hydroxylamine or DNPH arrested subsequent (RF+UVA) cross-linking in both species, indicating endogenous aldehydes are necessary for the strengthening reaction.

1 Strong evidence for ( O2) as a rate-limiting reactive intermediate and aldehyde availability as a cross-linking target was experimentally verified in whole corneas. This understanding of the underlying reaction requirements should allow optimization of this protocol to make it more effective clinically.

Work presented here involving rabbit corneas was supported by NIH grants (EY000952 (GWC), EY000933 (HFE)). Work involving shark corneas was supported by the Division of Biology, Kansas State University, by a grant from the Higuchi Foundation of the University of Kansas to GWC, by a High School Research Fellowship Program at MDIBL (HB, EC), by Maine NCRR/IDeA Network of Biomedical Research Excellence (2-P20-RR016463)(ZD, MC), by NSF Research Experience for Undergraduates Site at MDIBL (DBI-0453391)(ASM), and by a grant to Kansas State University (P20 RR016475 from the National Center for Research Resources (NCRR), a component of the National Institutes of Health (NIH)) (ASM,GWC). The Aspirnaut Initiative is funded through private donations to the Grapevine Historical Society, as well as by Vanderbilt University (EC).

1. Wollensak G, Redl B. Gel electrophoretic analysis of corneal collagen after photodynamic cross-linking treatment. Cornea 27: 353-356, 2008. 2. Wollensak G, Spoerl E, Seiler T. Riboflavin/Ultraviolet-A-induced collagen crosslinking for the treatment of keratoconus. Am J Ophthalmol. 135: 620-627, 2003.

Expression of sutural fiber-related genes in corneas of embryonic sharks (Squalus acanthias)

Abigail H. Conrad and Gary W. Conrad Division of Biology, Kansas State University, Manhattan, KS 55606

LASIK surgery is a popular vision correction in which an horizontal cut is made through the epithelial surface into the anterior stroma of the cornea, creating a corneal flap with a hinge region that connects the flap to the remaining cornea. The corneal flap is folded back, laser beams remove some stromal matrix and cells to reshape the cornea, and the flap is laid back down over the eye surface. Vision is usually improved, but the flap never heals back onto the stromal matrix7, so a bump to the head can cause the flap to open again at any time. Previous study of elasmobranch cornea development, such as the skate, has revealed vertical sutural fibers that extend from the epithelial basement membrane of the cornea deep into the corneal stroma3. These sutural fibers hold the collagen layers of the elasmobranch corneal stroma together, so, for example, it is resistant to swelling in changing osmotic environments. In contrast, avian and mammalian corneas make only a few thin vertical fibers that extend from their epithelial basement membranes into their stromas1, and these fibers are not sufficient to prevent corneal swelling. If corneal sutural-like fibers could be induced in corneas of adult humans after LASIK surgery to develop more robustly into elsmobranch-like corneal sutural fibers, they might stabilize the LASIK flap and prevent its coming loose again in post-operative trauma.

In embryonic chicks, fibers strongly resembling elasmobranch corneal sutural fibers do form beneath scleral papillae that grow transiently around the developing cornea, and in developing feather germs in embryonic chicks 4,6. In both embryonic scleral papillae and feather germs, two tissues in which epithelium overlies mesenchyme as it does in the cornea, Sonic Hedgehog (SHH), and SHH-induced GLI1 and WSB1 genes are expressed as they are forming their sutural-like fibers6. Because of the strong conservation of molecular mechanisms for inducing homolgous structures across a wide species range, it is possible that SHH, PTC1 (PTC is a SHH protein receptor), and GLI1 and WSB1 (transcriptional activators for the SHH pathway) may be involved in inducing elasmobranch corneal sutural fiber formation. Other possible corneal-sutural-fiber-related candidate genes may include Claudins (CLDN), a 23+ member family of tetraspanin transmembrane proteins, some of which are expressed in corneal suprabasal epithelial cell tight junctions and influence cell-cell communications5. In addition, Tenascins (TN) are extracellular matrix glycoproteins that form vertical fibers under developing conjunctival papillae4. In a previous study of corneas isolated from shark embryos of undetermined developmental age2, SHH expression was the least highly expressed gene in the survey, GLI1 100-fold more highly expressed than SHH, WSB1 expressed at a level intermediate between SHH and GLI1, CLDN3 200-fold more highly expressed than all other CLDNs and 2000-fold more highly expressed than SHH, and TNN 10-fold more highly expressed than other TNs tested and 100-fold more highly expressed than SHH. These results suggested that SHH was not active in embryonic shark corneas. However, gene expressions in developing tissues change over time, and important inducing factors may be expressed transiently at the earliest stages of a structure’s formation. Therefore, we examined expressions of the SHH pathway genes in corneas of embryonic sharks of several different ages.

Corneas were dissected from shark embryos, aged according to the length of the embryo at the time of dissection, pooled in age groups of 1 cm, 2-4 cm, 11 cm, 21 cm, and 24 cm, and stored at - 80oC in RNAlater (Ambion). For embryos 1 cm or less in length the entire head, including developing eyes, was isolated, and for embryos 2-4 cm in length the anterior eye front was used. Relevant sequences for shark homologues of these candidate genes were obtained from the MDIBL database or from Genbank, and PCR primers for each gene were identified using Primer 3 software (http://frodo.wi.mit.edu/). Whole RNA was isolated with RNeasy for fibrous tissues, cDNA was synthesized using Qiagen Quantitect including removal of genomic DNA, and Real-Time PCR was performed according to Stratgene’s QPCR protocol on their Mx3000P machine. Results were normalized to GAPDH expression, and are summarized in Table 1.

SHH expression was highest in head, then eye front, tissue from the youngest embryos, but declined markedly in isolated corneas from older embryos. In contrast PTC1 expression decreased from head to eye front to corneas from 11 cm embryos, but then rose as cornea development continued, and GLI1 and WSB1 expressions rose from lows in whole heads to highs in corneas from 24 cm embryos. Expressions of CLDNs 1, 4, and 27 were low in whole heads, eye fronts, and corneas from 11 cm embryos, peaked in corneas from 21 cm embryos, and then declined again as corneas developed further, whereas expression of CLDN 3 was high in whole heads and eye fronts and rose further in isolated corneas as development proceeded. Although expression of TN 200 declined as development progressed, expressions of TNs C and TN were low in whole heads and eye fronts, then rose in isolated corneas as they developed. Thus several corneal CLDN and TN expressions rose sharply as cornea development progressed from 11 cm to 24 cm embryos.

These results are consistent with the possibility that SHH may be involved in the earliest stages of shark corneal sutural fiber development, and support the idea that CLDNs and TNs are important components of developing shark corneas. However, since RNA was isolated from non-corneal as well as corneal tissue from 1 cm and 2-4 cm embryos, in situ hybridization will be necessary to determine whether SHH and its downstream genes are expressed in the corneas of the youngest embryos.

Research supported by the Division of Biology, Kansas State University, and by an Higuchi Research Achievement Award to GWC from the University of Kansas Endowment Association.

1. Bee JA, Kuhl U, Edgar D, von der Mark K. Avian corneal nerves: co-distribution with collagen type IV and acquisition of substance P immunoreactivity. Invest. Ophthalmol.Vis. Sci. 29:101-107, 1988. 2. Conrad AH, Chase MJ, Dedeic Z, Conrad GW. Attempts to produce adhesion of the LASIK corneal flap using sharks (Squalus acanthias), skates (Leucoraja erinacea), and embryonic chicks (Gallus domesticus) and Japanese quail (Coturnix japonica). Bull. Mt Desert Isl. Biol. Lab 47: 61-64, 2008. 3. Conrad GW, Paulsen AQ, Luer CA. Embryonic development of the cornea in the eye of the clearnose skate, Raja eglanteria: I. Stromal development in the absence of an endothelium. J. Exp. Zool. 269: 263-276, 1994. 4. Fyfe DM, Ferguson MW, Chiquet-Ehrismann R. Immunocytochemical localisation of tenascin during the development of scleral papillae and scleral ossicles in the embryonic chick. J Anat. 159:117-27, 1988. 5. Sosnová-Netuková M, Kuchynka P, Forrester JV. The suprabasal layer of corneal epithelial cells represents the major barrier site to the passive movement of small molecules and trafficking leukocytes. Br J Ophthalmol. 91:372- 8, 2007. 6. Vasiliauskas D, Hancock S, Stern CD. SWiP-1: novel SOCS box containing WD-protein regulated by signaling centres and by Shh during development. Mech Dev. 82:79-94, 1999. 7. Zhang Y, Schmack I, Dawson DG, Grossniklaus HE, Conrad AH, Kariya Y, Suzuki K, Edelhauser HF, Conrad GW. Keratan sulfate and chondroitin/dermatan sulfate in maximally recovered hypocellular stromal interface scars of postmortem human LASIK corneas. Invest. Ophthalmol. Vis. Sci. 47: 2390-2396, 2006.

Partial cloning of the killifish, Fundulus heteroclitus, arginine vasotocin receptor 1a

Kelly A. Hyndman, Eric Monaco, and David H. Evans Department of Zoology, University of Florida, Gainesville, FL 32611

Arginine vasotocin (AVT) functions in a variety of physiological processes in fishes, including metabolism, cardiovascular function, and osmoregulation1. This hormone’s actions are mediated by binding to the AVT receptors: V1a, V1b and/or V2. The teleost fish gill is the main site of ion and acid/base balance, nitrogen excretion and gas exchange4, and preliminary evidence suggests that AVT receptors are present in the fish gill epithelium1,3. The purpose of this study was to determine if AVT receptors are present in the euryhaline killifish (Fundulus heteroclitus) gill. Killifish were trapped in Northeast Creek on Mount Desert Island, and maintained at MDIBL in free-flowing seawater. Killifish were decapitated and the gills removed and snap frozen. Total gill RNA was extracted using Tri-reagent and gill cDNA was made using Invitrogen’s Superscript III cDNA kit3. This killifish cDNA was probed with degenerate primers designed against highly conserved regions of the vertebrate AVT receptors: F1 5'-GAAGCATA AGACTCCGATGCAYBWNTTYAT-3'; R1 5’-TCTTGAAATACATGTCCAGAAAAGATCV WRTADATCCA-3'; nested with R2 5'-CCTTCGTCATCGTCCTAGTATATATTATATGYTG GDSNCC- 3'. From this, we found a product of about 600 nucleotides. This product was cloned and sequenced at the Marine DNA Sequencing Center at MDIBL. The sequence was confirmed to be a partial AVT1a sequence through NCBI’s BLAST, and alignment with other vertebrate AVT receptors.

! Figure 1: Tissue distribution of the killifish arginine vasotocin receptor 1a (upper band) and internal control gene 18S (lower band) Next, we determined the distribution of this receptor in the killifish, by using multi-tissue, duplexing PCR as previously described2. In the killifish, the V1a receptor is highly expressed in the gill, brain and kidney, and is not expressed in the heart (Fig. 1). From this study, we conclude that AVT may be active in the fish gill, possibly as a regulator of gill ion transport. Studies are currently underway to determine if other AVT receptors are expressed in the killifish gill, to which cells they localize, and whether AVT affects gill active transport or merely perfusion. This project was supported by NSF IOB-0519579 to DHE. 1. Balmet RJ, Lu W, Weybourne E, Warne JM. Arginine vasotocin a key hormone in fish physiology and behavior: A review with insights from mammalian models. Gen Comp Endocrin 147: 9-16, 2006. 2. Choe KP, Kato A, Hirose S, Plata C, Sindic A, Romero MF, Claiborne JB, and Evans DH. COX2 in a euryhaline teleost, Fundulus heteroclitus: primary sequence, distribution, localization, and potential function in gills during salinity acclimation. J Exp Biol 209: 1696-1708, 2006. 3. Evans, DH. Cell signaling and ion transport across the fish gill epithelium. J Exp Zool 293: 336-347, 2002. 4. Evans DH, Choe KP, Piermarini PM. The multifunctional fish gill: dominant site of gas exchange, osmoregulation, acid-base regulation, and excretion of nitrogenous waste. Physiol Rev 85:97-177, 2005. Tandem duplication of aryl hydrocarbon receptor (AHR) genes in the genome of the spiny dogfish shark (Squalus acanthias)

Rebeka R. Merson1, Carolyn J. Mattingly2, and Antonio J. Planchart2 1Department of Biology, Rhode Island College, Providence, RI 02908 2Mount Desert Island Biological Laboratory, Salisbury Cove, ME 04672

Expansion and diversification of gene families occurs by DNA duplication events (whole genome or chromosomal segment duplication) followed by subsequent degeneration of coding or regulatory regions. Gene duplicates that are retained can evolve new functions (neofunctionalization) or the ancestral gene functions can be partitioned among the paralogous genes (subfunctionalization)1. Duplication events account for extensive diversity of the vertebrate aryl hydrocarbon receptor (AHR) gene family2. Humans and other eutherian mammals possess one AHR gene that in addition to mediating responses to xenobiotic ligands and regulating genes encoding biotransformation enzymes, appears to play numerous distinct roles in cell physiology5, 8. In contrast, multiple copies of AHR genes are expressed in nearly all other vertebrate classes examined to date2. We study AHR structure and function in Chondrichthyes, an early diverging vertebrate class that includes sharks, skates, rays and chimaeras. This group is an excellent model to examine evolution of the AHR family. Divergence from the vertebrate lineage prior to the bony fish radiation permits study of the origin of extant AHR genes and eliminates complications of ancestry arising from the tetraploidization of ray-finned fishes. Sharks express several AHR genes that diverge in sequence2. Investigating these AHRs can reveal both conserved and novel regulatory functions and aid to determine whether the many physiological roles and toxic-response pathways of the single mammal AHR are partitioned among the multiple AHR paralogs. To assess gene structure and identify conserved synteny among vertebrate AHR loci, we used the spiny dogfish (Squalus acanthias) bacterial artificial chromosome (BAC) library. This library was constructed with pIndigoBac536 and HindIII-digested genomic DNA isolated from the testis of a single shark. Inserts average 135 kb with approximately a 4-fold coverage among 180096 clones arrayed on 10 filters. Hybridization probes incorporating [32P]-dCTP were synthesized with 50 ng of template for each AHR (Fig. 1A). BAC filters were hybridized overnight, washed, and exposed to X- ray film for 4 days at -80 °C. Positive BAC clones were propagated and DNA purified with a commercially available mini-prep kit. Primers designed to amplify fragments of AHR1 and AHR2 (Fig. 1A) were used to confirm the presence of each AHR in the insert. Two PCR products were sub-cloned and sequenced. Hybridization results for 9 BAC filters (A-I) yielded 16 positive clones. All PCR products were consistent with the expected length for each amplicon (Fig. 1B). Sequences from two clones were identical to Squalus AHR2 (data not shown). Taken together, our results indicate that both AHR1 and AHR2 are contained in the inserts of all BAC clones identified by hybridization, thus supporting the hypothesis that AHR1 and AHR2 genes are closely linked.

Our results corroborate the notion that a tandem duplication occurred to produce AHR1 and AHR2 in cartilaginous fish and that synteny is conserved among bony fishes, zebrafish2, 3 and Takifugu2, 4, and birds2, 9, which all possess tandemly-arranged AHR orthologs to Squalus AHR1 and AHR2 (Fig. 2). Our next step is to determine whether additional AHR paralogs in sharks are also linked. This would support the hypothesis that the tandem duplication of AHR genes occurred prior to at least one whole genome duplication event7 that occurred before the divergence of cartilaginous fishes6. We are in the process of sequencing BAC inserts to determine gene structure, identify other genes in close proximity to this AHR locus, and clarify orthology among AHR gene family members. Thanks go to the Merson Lab team at Rhode Island College for their contributions to these experiments and Dr. Mark Hahn at the Woods Hole Oceanographic Institution for comments on drafts of this paper. This research was made possible through a MDIBL New Investigator Award to RRM funded by ME-INBRE (P20RR-016463) and the Center for Membrane Toxicity Studies (P30ES- 00382820), and a Faculty Development Grant to RRM through RI-INBRE (P20RR-016457) from the National Institutes of Health National Center for Research Resources (NCRR). Its contents are solely the responsibility of the authors and do not necessarily represent the official views of NCRR or NIH.

1. Force A, Lynch M, Pickett FB, Amores A, Yan YL, and Postlethwait J. Preservation of duplicate genes by complementary, degenerative mutations. Genetics 151: 1531-1545, 1999. 2. Hahn ME, Karchner SI, Evans BR, Franks DG, Merson RR, and Lapseritis JM. Unexpected diversity of aryl hydrocarbon receptors in non-mammalian vertebrates: insights from comparative genomics. J Exp Zoolog A Comp Exp Biol 305: 693-706, 2006. 3. Karchner SI, Franks DG, and Hahn ME. AHR1B, a new functional aryl hydrocarbon receptor in zebrafish: tandem arrangement of ahr1b and ahr2 genes. Biochem J 392: 153-161, 2005. 4. Karchner SI and Hahn ME. Pufferfish (Fugu rubripes) aryl hydrocarbon receptors: Unusually high diversity in a compact genome. Marine Environ Res 58: 139-140, 2004. 5. Kimura A, Naka T, Nohara K, Fujii-Kuriyama Y, and Kishimoto T. Aryl hydrocarbon receptor regulates Stat1 activation and participates in the development of Th17 cells. Proc Natl Acad Sci U S A 105: 9721-9726, 2008. 6. Kuraku S, Meyer A, and Kuratani S. Timing of Genome Duplications Relative to the Origin of the Vertebrates: Did Cyclostomes Diverge before, or after? Mol Biol Evol, 2008. 7. Ohno S. Evolution by gene duplication. Germany: Springer-Verlag, 1970. 8. Ohtake F, Baba A, Takada I, Okada M, Iwasaki K, Miki H, Takahashi S, Kouzmenko A, Nohara K, Chiba T, Fujii-Kuriyama Y, and Kato S. Dioxin receptor is a ligand-dependent E3 ubiquitin ligase. Nature 446: 562-566, 2007. 9. Yasui T, Kim EY, Iwata H, Franks DG, Karchner SI, Hahn ME, and Tanabe S. Functional characterization and evolutionary history of two aryl hydrocarbon receptor isoforms (AhR1 and AhR2) from avian species. Toxicol Sci 99: 101-117, 2007.

Molecular Variation in the Mitochondrial D-loop of Squalus acanthias from the Gulf of Maine

Maxwell Simard 1, Chris Lage1, and Charles Wray2 1Department of Natural and Social Sciences, University of Maine at Augusta, Augusta, ME, 04330 2 Mount Desert Island Biological Laboratory, Salisbury Cove, ME 04672

The spiny dogfish, Squalus acanthias, is a highly migratory, small demersal shark species found globally in temperate continental shelf seas. In the Northwest Atlantic, spiny dogfish are found from Labrador to the Florida Keys, migrating to the Gulf of Maine and Canadian waters in the summer and returning southward in the winter 1. Commercially harvested as a food resource and as a vertebrate model for biological education and research, the spiny dogfish is listed as vulnerable by the IUCN Red List of Threatened Species (http://iucnredlist.org/details/39326). Although historically abundant worldwide, many stocks from around the globe are in significant decline and most large-scale fisheries are currently depleted or collapsed 2. In the north-west Atlantic, a 75% decline in the biomass of mature females recently occurred over a period of c. a decade 3. Proper management of the spiny dogfish is especially critical because its unique life history makes it particularly vulnerable to overexploitation.

The highly variable mtDNA D-loop locus is being used in this study to gain insight into the stock structure of spiny dogfish caught in the Gulf of Maine. Genomic DNA was extracted from 94 dogfish sharks caught in 2004 and 2007. The mitochondrial D-loop was amplified via PCR and sequenced. Alignment of all 94 samples revealed 41 polymorphic sites and 53 haplotypes. Of the 41 polymorphic sites 23 were transversions, 15 were transitions, two sites displayed both transitional and transversional mutations, and three of the 94 dogfish samples exhibited a thymine insertion at the 504bp position of the 904bp nucleotide sequence being examined.

Table 1. Nucleotide Sequence diversity in Squalus acanthias. Total number of individuals analyzed (n), the number of haplotypes revealed, haplotype diversity (h), and percent nucleotide sequence diversity (% !) for each sample set

Sample Set n No. haplotypes h %! 2004 44 32 0.982 0.5 2007 50 31 0.964 0.3 Combined 94 53 0.978 0.4

This initial study demonstrates a high degree of molecular diversity within the D-loop region of the mitochondrial genome of spiny dogfish caught in the Gulf of Maine (Table 1). Despite a high degree of haplotype diversity the data do not show any divergent maternal genetic lineages and suggests that the population is panmictic. From 2004 to 2007 a slight decrease in molecular diversity ( 2004 (h) 0.982 > 2007 (h) 0.964; 2004 (%!) 0.5 > 2007 (%!) 0.3) suggests a decline in the number of reproducing females in the population; however significantly more data are required prior to confirming any trend. As more data are accumulated additional statistical tests will be conducted. mtDNA sequence from international and California dogfish samples and microsatellite data (discussed elsewhere in the 2008 MDIBL Bulletin) from all 2004, 2007 and international and California samples will be combined to further investigate population genetics of spiny dogfish.

This work was supported by the Maine IDeA Network of Biomedical Research Excellence grant (Maine INBRE P20 RR-016463), through a 2008 MDIBL New Investigator Award to C. Lage, and a 2008 MDIBL INBRE Undergraduate Fellowship to M. Simard.

1. Jensen, A. C. (1966). Life history of the spiny dogfish. Fishery Bulletin 65, 527–554. 2. Fordham, S. (1996). Conservation and Management Status of Spiny Dogfish Sharks (Squalus acanthias). Tenth Conference of the Parties to the Convention on International Trade in Endangered Species Doc. AC20 Inf. 22. 3. NEFSC. (2006). Northeast Fisheries Science Center Reference Document 06-14. Microsatellite variation in Squalus acanthias from the Gulf of Maine

Chris Lage1 and Charles Wray2 1Department of Natural and Social Sciences, University of Maine at Augusta, Augusta, ME, 04330 2 Mount Desert Island Biological Laboratory, Salisbury Cove, ME 04672

The spiny dogfish Squalus acanthias L. is a highly migratory, small demersal shark species found globally in temperate shelf seas. In the north-west Atlantic, spiny dogfish are found from Labrador to the Florida Keys, migrating to the Gulf of Maine and Canadian waters in the summer and returning southward in the winter 1. Historically abundant worldwide, many stocks from around the globe are currently in significant decline prompting the species to be listed as vulnerable by the IUCN Red List of Threatened Species (http://iucnredlist.org/details/39326). In the north-west Atlantic, a 75% decline in the biomass of mature females recently occurred over a period of a decade 4. Proper management of the spiny dogfish is especially critical because its unique life history makes it particularly vulnerable to overexploitation. An understanding of a species’ mating system and genetic stock structure is a fundamental requirement for any long-term, effective management strategy and was highlighted as a research priority by the most recent stock assessment on spiny dogfish in US territorial waters 4.

Genomic DNA was extracted from 111 dogfish sharks caught in 2004 and 2007, as well as from 10 pregnant females and their litters. Seven microsatellite loci were amplified via PCR 3. Diversity statistics were calculated at all loci combined across temporal Gulf of Maine samples (Table 1) and at each locus among all samples (Table 2). Litters were analyzed for evidence of multiple paternity.

Table 1. Diversity statistics for all loci combined across Table 2. Diversity statistics for each locus including temporal Gulf of Maine samples including sample size (n), allelic size range in basepairs, observed number of mean observed number of alleles (NO), mean observed alleles (NO), and observed heterozygosity (HO). heterozygosity (HO), and mean Nei's diversity (DN).

Locus Size range (bp) NO HO U285 215-250 13 0.752 Year n N H D O O N V296 190-268 18 0.771 2004 58 12.86 0.708 0.752 T289 181-206 9 0.427 2007 53 13.00 0.693 0.725 U273 91-134 18 0.706 2004-2007 111 15.43 0.701 0.740 J451 185-205 8 0.642 J445 252-317 13 0.688 H434 189-227 29 0.917

Gulf of Maine dogfish show a high degree of microsatellite variation. Analysis of dogfish litters showed evidence of 30% multiple paternity 2. Diversity statistics are generally similar across temporally separated samples, however measures of HO and DN suggest a slight reduction from 2004- 2007 potentially due to mechanisms of genetic drift. Analysis of additional temporal samples will elucidate whether this trend continues. Analysis of spatially separated samples are necessary to determine whether Gulf of Maine dogfish represent a localized, genetically divergent stock.

This work was supported by the Maine IDeA Network of Biomedical Research Excellence grant (Maine INBRE P20 RR-016463) and a 2008 MDIBL New Investigator Award.

1. Jensen, AC. Life history of the spiny dogfish. Fishery Bulletin 65, 527–554, 1966. 2. Lage, CR, Petersen, CW, Forest, D, Barnes, D, Kornfield, I, & Wray, C. Evidence of multiple paternity in spiny dogfish (Squalus acanthias) broods based on microsatellite analysis. Jour. Fish Biology 73, 2068–2074, 2008. 3. McCauley, L, Goecker, C, Parker, P, Dudolph, T, Goetz, F & Gerlach, G Characterization and isolation of DNA microsatellite primers in the spiny dogfish (Squalus acanthias). Molecular Ecology Notes 4, 494–496, 2004. 4. NEFSC. Northeast Fisheries Science Center Reference Document 06-14, 2006. Tissue distribution of NHE isoform transcripts in the longhorn sculpin, Myoxocephalus octodecemspinosus

Kelly LaRue 1, Mia Tarley 2, Bradley Wilbur 3, Andrew Diamanduros 3 and James Claiborne 3 1Dickinson College, Carlisle, PA 17013 2Macaulay Honors College, CUNY, New York, NY 10023 3Georgia Southern University, Statesboro, GA 30460

In fishes, the gill epithelium is the site for gas exchange, nitrogenous base excretion, ion balance, and acid-base regulation7 between the tissue and the surrounding aqueous environment. Two distinct models have been proposed for the excretion of H+, a detrimental byproduct of respiration, in freshwater and seawater fishes. In the freshwater model, synergy between an H+-ATPase and a Na+ channel has been postulated 6. The active pumping of protons out of gill tissue creates a negative membrane potential within branchial cells, thus allowing for the passive transport of Na+ into the cell from the water according to its electrochemical gradient. Conversely, in the marine teleost, the Na+/H+ exchangers (NHEs) bridge ion balance and acid-base regulation. Electroneutral transmembrane NHEs are thought to import Na+ while simultaneously exporting H+ 5. To date, ten isoforms of NHE have been described in mammals 1. Due to evolutionary duplication of the fish genome, teleosts may have multiple versions of the isoforms, each potentially having different physiological purposes. The goal of this study was to characterize the distribution of mRNA for five NHE paralogues (NHE2a, 2b, 2c, 3, and 8) in the longhorn sculpin, Myoxocephalus octodecimspinosus. We have previously shown that that NHE2b and NHE3, are localized to mitochondrial rich cells in the branchial epithelium 2,4, and may be involved with acid-base transfers across the gills. NHE8 is typically intracellular in mammal tissues but may also play a role in apical Na+ uptake in the mammalian proximal tubule 10.

RNA was isolated from thirteen homogenized tissues from the same sculpin using Tri-Reagent (Sigma), 1-bromo, 3-choloropropane (Sigma), isopropanol and ethanol. Approximately 2.0 µg of mRNA was selectively amplified into cDNA through the process of reverse transcriptase PCR using oligo dT primers. cDNA was amplified for analysis using PCR. The base pair size of amplicons was determined using a Kodak Gel Imager and Molecular Imaging Software after being separated on a 1% agarose gel. The identity of amplicons for gill, kidney and skin were determined by sequencing; products were prepared through !-agarase digestion or Topoisomerase-TA cloning (Sigma). Primers were designed based on the genome of three-spined stickleback, Gasterosteus aculeatus8 and were first tested for the distribution study on mRNA from stickleback caught locally by trapping. During the primer design/testing phase, a new variation, NHE2c, was found in the genome of the stickleback using Ensembl. Once the presence of NHE2c mRNA was confirmed in both stickleback and sculpin gill by PCR, this isoform was included in the analysis in all sculpin tissues.

Expression of NHE2a, b, c, 3, and 8 mRNA were determined by the appearance of a band resolved at the desired molecular weight and further sequencing of the PCR product of selected tissues. Results were compiled into Table 1. We found that the tissue distribution of NHE2 sub-types was not identical across tissue types, suggesting diversity of function. NHE2b (which has been the most studied NHE2 in sculpin to date2) was detected in the gill but not in the kidney. Gill NHE2a was only weakly detected in preliminary experiments and not at all in the sculpin for which the simultaneous measurements were made. NHE2c was strongly expressed in the gill at levels similar to NHE2b. NHE8 was detected ubiquitously in all sampled tissues, supporting the assumption that the protein is generally localized within intracellular vesicle membranes. Also, all five NHE isoforms were present in intestine, the only tissue to include NHE2a.

These preliminary qualitative results indicate that mRNA for the NHE paralogues are widely distributed in transporting tissues. Immunological detection of NHE protein expression in sculpin skin epithelium using specific antibodies against NHE2b, NHE3, and NHE8 also support the present findings 9. In mammals, NHE3 is primarily found in the renal tubule and intestine 10 and is apically expressed (as it is in the gill MRC’s 3). Surprisingly, NHE3 transcription was also present in a variety of non-epithelial tissues. Further quantitative experiments using qPCR and immunological detection will shed more light on the relative functional expression of the NHE subtypes.

This research was funded by the REU Site at MDIBL (NSF DBI-0453391) and NSF IOB-0616187 to JBC.

Table 1. Expression of mRNA for NHE isoforms in Myoxocephalus octodecemspinosus tissues as detected with sculpin specific primers and RT-PCR. + indicates presence of transcript.

NHE2a NHE2b NHE2c NHE3 NHE8 Gill - + + + + Intestine + + + + + Spleen - + + + + Stomach - + + + + Muscle - + + + + Eye - + + + + Skin - + + + + Ovary - + + + + Testes - + + + + Kidney - - + + + Heart - - + + + Liver - - - + + Brain - - - - +

1. Brett, CL, Donowitz, M and Rao, R. Evolutionary origins of eukaryotic sodium/proton exchangers. Am J Physiol Cell Physiol 288: C223-39, 2005. 2. Catches, JS, Burns, JM, Edwards, SL and Claiborne, JB. Na+/H+ antiporter (NHE2), V-H+-ATPase, and Na+/K+- ATPase immunolocalization in a marine teleost (Myoxocephalus octodecimspinosus). J. Exp. Biol. 209: 3440-3447, 2006. 3. Choe, K, Edwards, S, Claiborne, J and David Evans, D. The putative mechanism of Na(+) absorption in euryhaline elasmobranchs exists in the gills of a stenohaline marine elasmobranch, Squalus acanthias. Comp Biochem Physiol, Part A Mol Integr Physiol 146: 155-62, 2007. 4. Claiborne, J, Edwards, S, Kratochvilova, H, Diamanduros, A, Lanier, C, Hyndman, K, Evans, D, Cutler, C and Foster, M. Molecular and immunological characterization of Na+/H+ antiporter (NHE3) in the gills of a marine teleost (Myoxocephalus octodecemspinosus). Abstract - Experimental Biology, San Diego, CA USA, 2008. 5. Claiborne, J, Edwards, S and Morrison-Shetlar, A. Acid-base regulation in fishes: cellular and molecular mechanisms. J Exp Zool 293: 302-19, 2002. 6. Evans, DH and Claiborne, JB. Osmotic and ionic regulation in fishes. In: Osmotic and Ionic Regulation, edited by Evans, DH. Boca Raton: Taylor and Francis Group, 2009, p. 295-366. 7. Evans, DH, Piermarini, PM and Choe, KP. The multifunctional fish gill: dominant site of gas exchange, osmoregulation, acid-base regulation, and excretion of nitrogenous waste. Physiol Rev 85: 97-177, 2005. 8. Hubbard, TJ, Aken, BL, Beal, K, Ballester, B, et al.. Ensembl 2007. Nucleic Acids Res 35: D610-7, 2007. 9. Kratochvilova, H, Edwards, S and Claiborne, JB. Expression of Na+/H+ exchanger paralogs in skin of the marine longhorn sculpin (Myoxocephalus octodecemspinosus). Bull. Mt. Desert Is. Biol. Lab. 48: this volume, 2009. 10. Orlowski, J and Grinstein, S. Diversity of the mammalian sodium/proton exchanger SLC9 gene family. Pflugers Arch 447: 549-65, 2004.

Quantification of RhgC1 in the marine longhorn sculpin (Myoxocephalus octodecemspinosus)

Matt Phillips1, Kelly Hyndman2, Mia Tarley3, Andrew Diamanduros1, Sue Edwards4 and James Claiborne1

1Department of Biology, Georgia southern University, Statesboro, GA 30460 2Vascular Biology Center, Medical College of Georgia, Augusta, GA 30912 3 Macaulay Honors College, City University of New York, New York, NY 10023 4Department of Biology, Appalachian State University, Boone, NC 28608

+ 5 Teleostean fish are known to excrete nitrogenous waste as NH3 and NH4 across the gill . It is known that in mammals the Rh glycoproteins are used as an ammonia transporter and are expressed in + 8,9 the renal cells to drive net ammonia secretion by NH3/NH4 transport . There are four known Rhg paralogues (A, B, C1, and C2) found in the gills of fishes 7. We have shown that RhgC1 mRNA is present in gill 2 and that RhgC1 is localized on the apical side of mitochondrion-rich cells (MRCs) and along the pavement cells 3. It is currently unknown whether RhgC1 is specific to gill tissue. In this study we have measured the changes in RhgC1 mRNA and protein expression in response to a physiological ammonia stress.

Longhorn sculpin (Myoxocephalus octodecemspinosus) were caught by local fishermen in Frenchman Bay, ME, and were maintained in free-flowing seawater at MDIBL. Sculpin were anesthetized in MS-222 (1:10,000 dilution, 7-10 minutes), and then using an 18-gauge needle a PE50 cannula was inserted into the peritoneal region (as per previous methods 4). The cannula was filled with teleost ringer solution and sutured in then plugged with occluded 23-gauge needle. The fish were then weighed and placed into an open circuit (allowing fresh seawater to constantly flow) 2.4 l (±5%) container for at least 20 hours to acclimate. Fish were then infused with NH4HCO3 or equivalent volume of distilled H2O. In the first series, fish (after closing the water circuit) were infused once (acute load) with 5mM/kg of 200 mM NH4HCO3 and sacrificed four hours later for protein and mRNA work (N=6 per treatment). In the second series, the animals were infused every two hours (chronic load) with 5mM/kg of 400 mM NH4HCO3 for a total of four infusions equaling 20 mM/kg, and were sacrificed two hours after the final infusion (N=3 per treatment). Dot blots and quantitative PCR were done according to methods described by Hyndman and Evans 6. The internal control used to standardize the results was ribosomal protein L8 (NCBI: DQ066926). An Invitrogen Platinum SYBR Green qPCR SuperMix-UDG kit was used on the Strategene mx4000 machine at MDIBL. Fish specific polyclonal RhgC1 antibody (developed against homologous epitopes in the marine puffer fish, Takifugu rubripes 7 and used successfully for immunohistochemical localization in the sculpin 3) was utilized to measure protein expression levels in dot blots. Western blots with these antibodies confirm a single band product (Edwards and Claiborne unpublished).

A B

Figure 1. mRNA levels measured after (A) acute ammonia stress p = 0.28, and after (B) chronic ammonia stress p = 0.52. Students two tailed unpaired t-test, mean ± SE with N=6 for each treatment. A B

Figure 2. Protein levels measured after (A) normal ammonia stress p=0.07, and after (B) chronic ammonia stress p=0.02. Mean ± SE; N=3 for each treatment.

Mean relative mRNA levels appeared to increase following ammonia loading, but the changes were not significantly different between the experimental and control levels of mRNA in either the acute or chronic ammonia load groups. RhgC1 protein level following the acute ammonia load appeared to increase (by ~30%) when compared to controls (p=0.07). In contrast, the chronic ammonia group exhibited dramatically higher C1 expression (~7x higher; p=0.02) over the control fish. A preliminary qualitative RT-PCR screening of a majority of the tissues indicated that RhgC1 was only transcribed in the gill tissues (N=1).

The variation in qPCR relative mRNA levels measured between animals was high, so this may have masked changes due to the ammonia loads. The large increase in RhgC1 protein expression (presumably a gill specific isoform) following the acute load (with little parallel increase observed in mRNA) may also imply that the regulation of this system is accomplished by post-transcription changes such as alterations in translation rates, membrane shuttling, and/or adjustments to protein channel half-life 1. We postulate that apical RhgC1 in gill MRCs 3 is upregulated to allow the rapid excretion of ammonia across the gills.

Funded by NSF IOB-061687 to JBC and MDIBL NIA award to SE.

1. Cavet, M, Akhter, S, de Medina, F, Donowitz, M and Tse, C. Na+/H+ exchangers (NHE1-3) have similar turnover numbers but different percentages on the cell surface. Am J Physiol 277: C1111-21, 1999. 2. Claiborne, J, Foster, MC and Diamanduros, AW. Detection of mRNA for Rh glycoprotein ammonia transporters in the gill of the longhorn sculpin (Myoxocephalus octodecemspinosus). Bull. Mt. Desert Is. Biol. Lab. 46: 78, 2007. 3. Claiborne, J, Kratochvilova, H, Diamanduros, AW, Hall, C, Phillips, J, Miller, E, Hirose, S and Edwards, S. Expression of branchial Rh glycoprotein ammonia transporters in the marine longhorn sculpin (Myoxocephalus octodecemspinosus). Bull. Mt. Desert Is. Biol. Lab. 47: 67-68, 2008. 4. Claiborne, JB, Perry, E, Bellows, S and Campbell, J. Mechanisms of acid excretion across the gills of a marine fish. J. Exp. Zool. 279: 509-520, 1997. 5. Evans, DH, Piermarini, PM and Choe, KP. The multifunctional fish gill: dominant site of gas exchange, osmoregulation, acid-base regulation, and excretion of nitrogenous waste. Physiol Rev 85: 97-177, 2005. 6. Hyndman, KA and Evans, DH. Short-term low-salinity tolerance by the longhorn sculpin, Myoxocephalus octodecimspinosus. J Exp Zool Part A Ecol Genet Physiol 311A: 45-56, 2009. 7. Nakada, T, Westhoff, CM, Kato, A and Hirose, S. Ammonia secretion from fish gill depends on a set of Rh glycoproteins. Faseb J 21: 1067-74, 2007. 8. Planelles, G. Ammonium homeostasis and human Rhesus glycoproteins. Nephron Physiology 105: p11-7, 2007. 9. Seshadri, RM, Klein, JD, Kozlowski, S, Sands, JM, Kim, YH, Han, KH, Handlogten, ME, Verlander, JW and Weiner, ID. Renal expression of the ammonia transporters, Rhbg and Rhcg, in response to chronic metabolic acidosis. Am J Physiol Renal Physiol 290: F397-408, 2006. Analysis of the Danio rerio cofilin mutant

Hannah B. Marquis1, Emilynne P. Bell4, Emily E. Miller2, Morgan S. Gilman2, Samantha K. Bond3, Regina M.Grimaldi1, and Sharon L. Ashworth1,2 1School of Biology and Ecology, 2Department of Biochemistry, Microbiology and Molecular Biology, and 3School of Marine Sciences, University of Maine, Orono, Maine 04469, 4University of New England, Biddeford, Maine 04005

One of the earliest observable signs of proximal tubule cell (PTC) injury in response to renal 5 ischemia is reorganization of the actin cytoskeleton . The bundled actin filaments in the apical microvilli are severed and depolymerized with degeneration of the apical membrane. Actin-dependent cellular polarization is lost as well as cell-to-cell and cell-to-substrate adhesion. The extent of damage to these cellular structures depends on the severity and duration of the ischemic event. Previous studies in rat kidney cells suggest two competing actin-binding proteins, cofilin (an actin-severing and depolymerizing protein) and tropomyosin (an actin-stabilizing protein), play integral roles in ischemia induced actin cytoskeleton reorganization1,2. The fundamental mechanisms responsible for this breakdown remain unknown. Although the rat model system offers many advantages to studying kidney cell injury, it also has many limitations such as: large size, longer gestation time, smaller litters, slower maturation rate, and higher cost of maintenance. Alternatively, the zebrafish system offers distinct experimental benefits such as: small size, pronephros accessibility, large number of offspring, short generation time, and ease of genetic manipulation4. Although several functions of the zebrafish pronephros have been studied, actin organization during pronephric development has not been investigated.

To localize the early zebrafish kidney or pronephros, forty- eight hour post-fertilization (hpf) wildtype embryos were fixed, Pronephric permeabilized and blocked. The pronephros (Fig. 1) was probed Tubule with the mouse monoclonal antibody, !6F, raised against the Pronephric chicken alpha-1 subunit of the basal lateral membrane protein, Duct Na+K+-ATPase and the FITC-labeled goat anti-mouse secondary antibody4. Image stacks were collected on the Olympus FV1000 confocal microscope. The optical stacks were reconstructed with Metamorph Software (Molecular Devices, Downingtown, PA). Fig. 1. Visualization of zebrafish pronephros. The pronephric tubules and The unique depolymerizing and severing properties of cofilin ducts of 48 hpf zebrafish embryos were play a significant role in actin dynamics in the kidney. The probed with the primary antibody !6F. zebrafish genome contains three cofilin isoforms: muscle cofilin Images were acquired on the Olympus FV- 1 (Cfl1), non-muscle cofilin 1-like (Cfl1l), and muscle cofilin 2 1000 confocal microscope.

Q6NZW3- 1 MASGVTVSDE V I K VFNDMK VRK SSSSDEVK- KRK K A V L FCLSDDK K K IIVEEGRQILVGD 59 Q6TH32- 1 MASGVTVEET V L T VFNEMK VRK AHCNEEEKS KRK K A V M FCLSDDK K H IIMEQGQEILQGD 60 Q7ZWD8- 1 MASGVAISDD V I A HYELIR VRL QGTDEKER---F K L V V MRLSDDL K N IIVDEKNCLKVKD 57

Q6NZW3- 1 IGDSV D D PYA CFVKLLPLNDCRYG LYDATY ETKESKKEDLVFIFW APE G APLKSKMI YAS 119 Q6TH32- 1 EGD----PYL KFVKMLPPNDCRYA LYDATY ETKETKKEDLVFIFW APE S APLKSKMI YAS 116 Q7ZWD8- 1 VENE- K D VFK KIISMLPPKECRYA LYDCKY TNKESVKEDLVFIFS APD D APMRSKML YAS 116

Q6NZW3- 1 SKD A I K K K FTG I K H EWQV N G L D DIQ D RSTL A EKLGG- NVV V SLEGR P L -- 167 Q6TH32- 1 SKD A I K K K FTG I K H EWQV N G M D DIK D RKTL A EKLGG- ASV V SLEGK P L TD 165 Q7ZWD8- 1 SKN A L K A K LPG M K F EWQI N D N A D - K D ASSL V EKLGGSKIV T SLEGK P V -- 164

Fig. 2. Sequence Comparison of Zebrafish Cofilin Isoforms. Cofilin isoforms were aligned using the ClustalW Multiple Sequence Alignment software through the Universal Protein Resource. Q6NZW3-1 = Muscle cofilin 2 (Cfl2); Q6TH32-1 = Muscle cofilin 1 (Cfl1); Q7ZWD8-1 = Non-muscle cofilin 1 (Cfl1l). Key: FullyConserved Partially Conserved

(Cfl2). There is 78.4% sequence identity between the two muscle cofilin isoforms, but only 49.7% identity between the Cfl1 muscle and Cfl1l non-muscle isoforms (Fig. 2). All cofilin isoforms contain the critical amino terminal serine that determines the state of cofilin activation3.

5’ 3’ To better understand how cofilin affects actin dynamics, Cfl1 we obtained zebrafish embryos containing a transgenic viral 350bp insertion (hi3736aTg) in the cofilin 1 gene from the Zebrafish International Resource Center (ZIRC) (Eugene, Oregon). 5’ 3 Cfl1 hi3736aTg Cfl1 ’ These embryos resulted from fertilization of sperm from males heterozygous for the viral insertion in the cofilin gene and 250bp wildtype AB eggs. A mixed population of wild-type and 200bp heterozygous cofilin mutant fish were produced in this spawn. Fig. 3. PCR strategy for Cfl1 mutant No obvious phenotype was observed for the heterozygous identification. PCR primers were designed mutant embryos, therefore it was necessary to genotype the to amplify a 350bp sequence of the Cfl1 embryos. To identify heterozygous mutant embryos, fin clips gene, a 200bp sequence of the hi3736aTg were obtained and their genotypes determined using PCR viral insertion and a 200bp sequence of the Cfl1-virus intersection. primers designed to amplify the cofilin gene, the hi3736aTg virus insertion and the cofilin-virus intersection sequences (Fig. 3). Of the thirty-nine zebrafish tested, only eleven (3 A B males and 8 females) were heterozygous for the mutation

1kb- (Fig. 4). The heterozygous zebrafish will be mated to produce homozygous cofilin mutant fish. Preliminary studies 100bp- by the Zebrafish Model Organism Database suggest the homozygous cofilin mutant zebrafish embryos can be M a b c d M M a b c d e f g h M identified by their phenotype. These mutants have smaller Fig. 4. Analysis of zebrafish PCR products. eyes, smaller, rounder and necrotic heads, and edema around Genomic DNA extracted from four zebrafish the heart, head, and yolk. Future studies will investigate renal fin clips was amplified and the genotype of structure and function of the cofilin 1 mutant embryos to each fish determined. In A, the 350bp determine the role this protein plays in maintaining the PTC amplified Cfl1 sequence was observed in all actin cytoskeleton under control and ischemic conditions. A four samples. In B, wildtype zebrafish (a,b) had no Cfl1-virus sequence or virus better understanding of how ischemic insults affect the sequence, but heterozygous zebrafish (c-h) cellular integrity of the kidney PTCs will potentially lead to contained both amplified Cfl1-virus and virus better treatment of kidney failure. sequences. M=100bp molecular marker. This research was supported by a MDIBL New Investigators Award and the University of Maine Research Faculty Award to SLA and an INBRE Student–Maine IDeA Network of Biomedical Research Excellence (2-P20-RR016463) to EPB.

1. Ashworth SL, Sandoval RM, Hosford M, Bamburg JR, Molitoris BA. Ischemic injury induces ADF relocalization to the apical domain of rat proximal tubule cells. Am J Physiol Renal Physiol 280: F886-F894, 2001. 2. Ashworth SL, Wean SE, Campos SB, Temm-Grove CJ, Southgate EL, Vrhovski B, Gunning P, Weinberger RP and Molitoris BA. Renal ischemia induces tropomyosin dissociation-destabilizing microvilli microfilaments. Am. J Physiol Renal Physiol 286: F988-F996, 2004. 3. Bamburg JR. Proteins of the ADF/cofilin family: essential regulators of actin dynamics. Annu Rev Cell Dev Bio 15: 185-230, 1999. 4. Drummond I. Making a zebrafish kidney: a tale of two tubes. Trends in Cell Biol 13: 357-365, 2003. 5. Kellerman PS, Clark RA, Hoilien CA, Linas SL, Molitoris BA. Role of microfilaments in maintenance of proximal tubule structural and functional integrity. Am J Physiol 259: F279-285, 1990. Failure to detect a thiazide-sensitive cotransporter in S. acanthias rectal gland and kidney

P. Silva,1 K. C. Spokes,2 F. H. Epstein.2

1Department of Medicine Temple University School of Medicine, Philadelphia, PA 19140 2Department of Medicine Beth Israel Deaconess Medical Center and Harvard Medical School, Boston, MA 02215

The transepithelial cotransport of chloride and sodium is mediated by two different types of transporters, the sodium, potassium, two chloride cotransporter, inhibited by furosemide and congeners; and the sodium chloride cotransporter that is the target of thiazide and derivatives. A pharmacological approach to identify the latter trasnporter in the rectal gland is reported elsewhere in the Bulletin. In these series of experiments we elected to use PCR techniques to try to identify it in the rectal gland of the shark. Such a cotransporter has been identified outside of the kidney in mammalian intestine.1

A rectal gland and a portion of kidney of S. acanthias were harvested and placed in RNA Later. The RNA was extracted using a QIAGEN RNAeasy kit. The concentration of the RNA obtained was measured in a nanodrop spectrophotometer and adjusted as necessary. Single stranded cDNA was then prepared using Invitrogen SuperScript III First-Strand Synthesis SuperMix for qRT-PCR. Primers were then prepared for the thiazide-sensitive cotransporter, the sodium + potassium + two chloride cotransporter, and Na+-K+-ATPase. Primers for the thiazide-sensitive cotransporter were obtained from the literature(1) or prepared from the published sequence of the molecule.2 Primers for Na+-K+-ATPase were prepared from published reports and known to work in the shark rectal gland.3 Primers for the sodium + potassium + two chloride cotransporter were prepared from the published sequence of the molecule.4 The products of the PCR reaction were separated using 2% agarose gels using DNA markers to identify the size of the products.

Primers for 200 and 399 base pairs sequences for sodium + potassium + two chloride cotransporter consistently and repeatedly resulted in the products of the expected length in shark rectal gland and kidney. Primers for 800 base pair sequences for Na+-K+-ATPase also consistently resulted in products of the expected length. The primers for the thiazide-sensitive cotransporter failed to produce any results in either shark rectal gland or kidney. Although the failure to identify a thiazide-sensitive cotransporter by using PCR suggests that such a molecule is not present in the rectal gland of the shark there is still the possibility that the primers selected were not adequate.

1. Bazzini, C., Vezzoli, V., Sironi, C., Dossena, S., Ravasio, A., De Biasi, S., Garavaglia, M., Rodighiero, S., Meyer, G., Fascio, U., et al. Thiazide-sensitive NaCl-cotransporter in the intestine: possible role of hydrochlorothiazide in the intestinal Ca2+ uptake. J Biol Chem 280:19902-19910, 2005. 2. Merino, A., Vera, F., Hebert, S.C., and Gamba, G. Identification of a Thiazide-sensitive Na+:Cl- Cotransporter Gene Isoform in Teleosts. GenBank ACCESSION AF333795, 2001. 3. Mahmmoud, Y.A., Vorum, H., and Cornelius, F. Interaction of FXYD10 (PLMS) with Na,K-ATPase from shark rectal glands. Close proximity of Cys74 of FXYD10 to Cys254 in the a domain of the alpha-subunit revealed by intermolecular thiol cross-linking. J Biol Chem 280:27776-27782, 2005. 4. Lytle, C., Xu, J.C., Biemesderfer, D., Haas, M., and Forbush, B.I. The Na-K-Cl cotransport protein of shark rectal gland. I. Development of monoclonal antibodies, immunoaffinity purification, and partial biochemical characterization. J. Biol. Chem. 267:25428-25437, 1992. Establishment of cell cultures from the gastrointestinal tract of Atlantic salmon, Salmo salar

Lucy E.J. Lee1, Atsushi Kawano2, Bounmy Inthavong1, Brian Dixon2 and Niels C. Bols2 1Department of Biology, Wilfrid Laurier University, Waterloo, ON, Canada N2L 3C5 2Department of Biology, University of Waterloo, Waterloo, ON Canada N2L 3G1

The physiology of the gastrointestinal tract (GI) of fish is of interest in both basic and applied research. One applied interest is in the development of new fish feeds for aquaculture. The current practice of using fish meal in fish feed is not sustainable in the long run, and there is an interest in using plant meals as a replacement. However, for one of the most lucrative aquaculture species, the Atlantic salmon (Fig. 1), the most attractive plant substitute, soybean meal, causes enteritis2,17. Enteritis is inflammation of the intestine and ultimately impairs growth. Identifying the causative agents in soybean meal for enteritis could lead to ways of eliminating them and making soybean meal an alternative to fish meal. One way of rapidly screening soybean meal components for their potential to cause inflammation is to use cell cultures from the fish GI tract, especially cell lines that can be grown continuously and thus be a stable source of cells for experimentation. Greater availability of fish GI cell cultures also would enhance the study of drug interactions, toxicants and gut pathogens with intestinal enterocytes.

Figure 1. Sample Atlantic salmon (above) (female 3.45 Kg) and dissected gut (inset). The intestine was severed just posterior to the pyloric caeca (arrow) and is shown below the ruler: anterior gut (AG) and posterior gut (PG). The esophagus, stomach, pyloric caeca (PC), ovaries, liver and spleen are also shown.

For mammals, cell lines have been established from most of the anatomical regions of the gastrointestinal tract (GI): esophagus, stomach, small intestine, and colon/rectum. The majority of these cell lines are from human GI tract tumors. These include epithelial cell lines from esophageal adenocarcinoma and squamous cell carcinoma4, gastric adenocarcinoma8 and colorectal carcinoma13. Cell lines from the human small intestine have been harder to come by. However, conditionally immortalized cell lines have been developed from the fetal small intestine14. As well, cell lines, such as CaCo-2 and HT-29 from human colon adenocarinomas, can be made to differentiate into enterocytes by manipulating the in vitro culture conditions16. Rodents, primarily mice and rats, have been the other major source of GI tract cell lines12. For rodents, cell lines from the small intestine and other segments of the GI tract have been developed. Several of these cell lines were immortalized through the use of SV40 ts-T-antigen transgenic mice and rats as the source of cultures8, but other cell lines appear to have been immortalized spontaneously, such as IEC-614. Intestinal cell culture models also have been widely used in toxicology and pharmacology15.

For fish, cell lines have been prepared from most tissues and organs, but not from the GI tract3. Nearly all fish cell lines appear to have immortalized spontaneously. The first step in obtaining a cell line is the preparation of primary cultures, which are cultures initiated directly from the cells, tissues or organs of fish. Primary cell cultures have been prepared from the spotted sand bass intestine7, but few other species have been tried. Therefore, we have initiated primary cell cultures from the Atlantic salmon GI tract (Fig. 1) with the long term aim of developing these into continuous cell lines.

For cell cultures, a total of 21 adult Atlantic salmon (Salmo salar) were obtained from the National Cold Water Marine Aquaculture Center at Franklin, ME. Fish had been kept in circular recirculating tanks with brackish water (15 ppt) at constant temperature (15 ± 2°C), under natural light conditions, and were fed a commercial fish diet six times daily by a robotic feeder. The fish used for cell cultures were healthy females culled from a broodstock ranging in age from 2 to 3 yrs old with a weight range of 1.1-3.8 Kg. The animals were euthanized with a blunt force trauma to the head according to established animal care protocols.

Several cell culture attempts were made with 2 to 4 specimens at any one time. Euthanized fish were brought to Mount Desert Island Biological Laboratory (MDIBL) on ice (travel time 20-30 min), and the animal surfaces were cleaned with 70% ethanol before ventral excision and removal of the intestine from the end of the gastric region (after the pyloric caeca) to the rectal end. The gut contents were washed with cold tap water under constant flow for approximately 5 min. The anterior and posterior gut (Fig. 1) were separated and each tube rinsed 3x with cold sterile Hank’s Buffered Salt Solution (HBSS) with added Penicillin/Streptomycin/Amphotericin. The guts were everted using long sterile plastic transfer pipettes and further rinsed in HBSS with antibiotics/antimycotic. Various dispersion protocols for various time points were followed: incubation with 1 mg/ml Collagenase type IA (Sigma C2674) in HBSS at 4°C; incubation with 0.5 mg/ml Collagenase type IV (Sigma C5138) in HBSS at 18°C and at 4°C; incubation with TryplE, a recombinant form of Trypsin marketed by InVitrogen, at 18°C; or without any enzymatic digestion: incubation with 2% EDTA in HBSS at 18°C; or in Ca/Mg free HBSS followed by mechanical dispersion using fine scissors and cutting the tissues into 2-4 mm cubes. For the enzymatic digestions, following a 5 min incubation (for TryplE) and 15 min (room temperature) to overnight incubation (4°C), cells were shaken loose and culture medium added (Leibovitz’s 15 media with 10% added fetal bovine serum). Cells were pelleted by centrifugation and plated on various substrates: tissue culture treated plates (Nunc, Falcon), Cell bind plates (Corning) and 12.5 and 25 cm2 flasks (Falcon) with or without overnight coatings of 100 µl of fibronectin (10 µg/ml), laminin (10 µg/ml) or collagen type IV (100 µg/ml). Mechanically dispersed tissue pieces were also plated on similar plates or flasks. These tissues, were placed epithelial side down and covered with a minimal amount of growth media to allow for cell attachment and spreading.

Adherent cells could be observed within 24 to 48 h after plating. Best attachment was observed after TryplE treatment and fibronectin coating, as well as from explants, but all treatments yielded viable cells. The culture media was changed after 24 or 48 h and unattached cells or tissue pieces removed after each media change which was done every other day for the first seven days. Individual adherent cells did not survive past seven days, but clusters of adherent cells remained and proliferated past seven days at which time, media changes were performed once weekly. Large clusters of cells were dispersed and passaged after 3 weeks post isolation. Thereafter, cells were allowed to reach confluency and passaged 1:2 once per month. Cultures from the initial trials (17 fish) succumbed to temperature malfunction in the tissue culture lab at MDIBL, although those shipped to Waterloo survived. Four more fish were tried that gave rise to the present cell cultures (AS18 to AS21).

An inverted phase contrast microscope was used for cell observations. Micrographs were taken of live cell cultures and cellular measurements calibrated with a micrometer slide. Viability was monitored using the trypan blue dye exclusion test and cell enumeration was done using an hemocytometer.

Primary cultures of epithelial-like cells were consistently obtained from both anterior and posterior intestinal segments (Fig. 2a). In some cultures, cells proliferated slowly to ultimately completely cover the growth surface, although fibroblastic cells proliferated over the epithelial cells (Fig. 2b). The epithelial morphology predominated, if cells were maintained in 5% FBS media, while 10% FBS allowed the fibroblastic phenotype to predominate. These confluent cultures have been subcultivated to two new flasks and grown to confuency again. To date, this cycle of subcultivation and growth to confluency has been repeated five times. Therefore, early passage cultures of Atlantic salmon intestinal epithelial cells are possible.

Figure 2. Phase contrast micrographs of early cultures of Atlantic salmon gut cells. (a) Adherent AS18 cells after 6h plating. (b) Fibroblastic monolayer of proliferating cells after third passage. Bar = 50 µm

The early passage cultures provide a large population of Atlantic salmon intestinal epithelial cells for potential experimentation and for immortalization into cell lines. Once developed into cell line(s), these cells could have numerous research applications in the areas of nutrition, toxicology, pharmacology and parasitology. The mammalian GI tract epithelial cell lines have been used for many purposes. The list of uses for just one cell line, CaCo-2, is long. Examples include studies of nutrition6, drug transport1, and toxicology5. This cell line also has been used to investigate soybean components9-11. Thus, the Atlantic salmon intestinal epithelial cell lines currently under development could become valuable research resources, especially for feed development and control of disease.

We thank Dr. William R. Wolters from the USDA, ARS National Cold Water Marine Aquaculture Center, Franklin, ME, for supplying the fish used in this research study. This research was supported by a New Investigator Award from MDIBL to LEJL and by the Natural Sciences and Engineering Research Council (NSERC) of Canada with Discovery and Strategic grants to LEJL, BD and NCB. !

1. Artursson P, Palm K, Lutham K. Caco-2 monolayers in experimental and theoretical predictions of drug transport. Adv. Drug Deliv. Rev. 46: 27-43, 2001. 2. Bakke-McKellep AM, Press CM, Baeverfjord G, Krogdahl A, Landsverk T. Changes in immune and enzyme histochemical phenotypes of cells in the intestinal mucosa of Atlantic salmon, Salmo salar L., with soybean meal- induced enteritis. J. Fish Dis. 23: 115-127, 2000. 3. Bols NC, Lee LEJ. Technology and uses of cell cultures from the tissues and organs of bony fish. Cytotechnol. 6: 163-187, 1991. 4. Boonstra JJ, van der Velden AW, Beerens ECW, van Marion R, Morita-Fujimura Y, Matsui Y, Nishihira T, Tselepis C, Haninaut P, Lowe AW, Beverloo BH, van Dekken H, Tilanus HW, Dinjens WNM. Mistaken identity of widely used esophageal adenocarcinoma cell line TE-7. Cancer Res. 67: 7996-8001, 2007. 5. Ekmekcioglu C, Strauss-Blasche G. Toxicological and biochemical effects of different beverages on human intestinal cells. Food Res. Int. 32: 421-427, 1999. 6. Etcheverry P, Wissler J, Wortley G, Glahn R. CaCo-2 cell iron uptake from human milk and infant formula. Nutrition Res. 24: 573-579, 2004. 7. Guzman-Murillo MA, Merino-Contreras M, Ascenio F. Interaction between Aeromonas veronii and epithelial cells of spotted sand bass (Paralabrax maculatofasciatus) in culture. J. Appl. Microbiol. 88: 897-906, 2000. 8. Ji Y, Chen X, Leung SY, Chi JTA, Chu KM, Yuen ST, Li R, Chan ASY, Li J, Dunphy N, So S. Comprehensive analysis of the gene expression profiles in human gastric cancer cell lines. Oncogene 21: 6549-6556, 2002. 9. Ly Y, Bao XL, Yang BC, Ren CG, Guo ST. Effect of soybean protein hydrolysate-calcium complexes on calcium uptake by CaCo-2 cells. J. Food Sci. 73: H168-H173, 2008. 10. Martin CDS, Garri C, Pizarro F, Walter T, Theil EC, Nunez MT. CaCo-2 intestinal epithelial cells absorb soybean ferritin by mu (2) (AP2)-dependent endocytosis. J. Nutrition 138: 659-666, 2008. 11. Murota K, Shimizu S, Miyamoto S, Izumi T, Obata A, Kikuchi M, Tera J. Unique uptake and transport of isoflavone aglycones by human intestinal Caco-2 cells: comparison of isoflavonoids and flavonoids. J. Nutrition 132: 1956-1961, 2002. 12. Obinata M. The immortalized cell lines with differentiation potentials: their establishment and possible application. Cancer Sci. 98: 275-283, 2007. 13. Oh JH, Ku JL, Yoon KA, Kwon HJ, Kim WH, Park HS, Yeo KS, Song SY, Chung JK, Park JG Establishment and characterization of 12 human colorectal-carcinoma cell lines. Int. J. Cancer 81: 902-910, 1999. 14. Quaroni A, Wands J, Trelstad Rl, Isselbacher, KJ. Epithelioid cell-cultures from Rat Small-Intestine - Characterization By Morphologic And Immunological Criteria. J. Cell Biol. 80: 248-265, 1979. 15. Sambruy Y, Ferruza S, Ranaldi G, De Angelis I. Intestinal cell culture models. Cell Biol. Toxicol. 17: 301-317, 2001. 16. Simon-Assmann P, Turck N, Sidhoum-Jenny M, Gradwohl G, Kedinger M. In vitro models of intestinal cell differentiation. Cell Biol. Toxicol. 23:241-256, 2007. 17. van den Ingh T, Olli J, Krogdahl A. Alcohol-soluble components in soybeans cause morphological changes in the distal intestine of Atlantic salmon, Salmo salar L. J. Fish Dis. 19: 47-53, 1996.

Reduced intracellular accumulation of calcein by overexpression of fluorescent protein fusions of the multidrug transporter Sp-ABCB1a, in sea urchin (Strongylocentrotus purpuratus) embryos.

Amro Hamdoun1 1Scripps Institution of Oceanography, La Jolla, CA 92037 [email protected]

Multidrug efflux transporters limit intracellular accumulation of hydrophobic compounds in many different types of cells. In embryos they can protect from xenobiotics and transport morphogenetic signals. Their activities in development are highly dynamic, changing with reorganization of embryo surfaces and specialization of embryonic cells. The recent publication of the sea urchin genome revealed that sea urchins have an expanded repertoire of these, and other chemoprotective genes, as compared to other deuterostome genomes. Moreover, greater than 80% of the corresponding mRNAs from these protective genes are expressed in embryos within the first several days of development(3). Our previous studies indicated that fertilization of sea urchin eggs results in dramatic up-regulation of outwardly-directed multidrug transport activity(5). One of the up-regulated activities is pharmacologically similar to mammalian P-gp activity (aka MDR1 or ABCB1) and its increase in activity at fertilization involves rapid delivery of proteins/vesicles stored in the subcortical actin meshwork of the egg, to the apical surface of the newly fertilized embryo.

The objective of this study was to develop tools to simultaneously characterize the in vivo activity and localization dynamics of specific multidrug efflux transporter gene products in sea urchin embryos. The efflux activity is measured by incubating embryos in the non-fluorescent, membrane- permeant, transporter substrate calcein-AM (C-AM). When any extracellular C-AM enters the cell it is rapidly hydrolyzed by esterases to form fluorescent, membrane-impermeant calcein, which is detected as intracellular fluorescence. The level of intracellular fluorescence is then inversely proportional to the level of efflux activity (2) . Pharmacological inhibitors of C-AM transport provide an approximation of the transporters at work in the embryo, but they do not directly link efflux activities with specific gene products. The approach examined here, was to overexpress fluorescent protein (FP) fusions of the candidate sea urchin P-gp transporter Sp-ABCB1a, and then to determine its location and C-AM efflux activity by confocal microscopy.

Over-expression of GFP fusions in sea urchins, by microinjection of mRNA, has been previously used in a variety of studies including the characterization of intracellular organelles and localization of developmental polarity proteins(8, 9). The backbone for generating constructs in this work is a vector used in one of these previous studies PCS2+GFP (9), and it produces carboxy terminus fusions of GFP to the protein of interest. Although this construct was originally developed for expression of proteins in Xenopus oocytes, it produces mRNAs that are also rapidly translated by sea urchin embryos (9). Nonetheless, two modifications of PCS2+GFP were necessary for this study; first, to accommodate the full-length cDNA of the Sp-ABCB1a gene (3987bp), the vector was to modified by in-frame insertion of a unique SpeI site at position 85 of the polylinker. Second, to facilitate simultaneous visualization of transporter expression and efflux activity (via the accumulation of the green fluorescent calcein), the GFP moiety was removed (ClaI-EcorI) and replaced with the dsRed-derived, mCherry (7).

Full length Sp-ABCB1a was amplified from egg cDNA and ligated into PCS2+mCherry using the new SpeI insertion site. Sp-ABCB1a:mCherry constructs were NotI linearized and capped mRNA was transcribed from these templates in vitro, using SP6 RNA polymerase. The resulting mRNA was resuspended in nuclease free water and its quality confirmed by agarose electrophoresis and spectrophotometry. Fertilized sea urchin zygotes were injected with the mRNA at 2 mg/ml in water, and expression of the protein monitored using a Zeiss LSM 510META using a 20x, Plan-Apo objective. I found that Sp-ABCB1a::mCherry could be detected by epifluoresence microscopy, 3-5 hours after injection with mRNA; at this time a significant fraction of the protein is still seen in small cytoplasmic spots resembling the golgi (8). By 9-12h post- fertilization, signal intensity is adequate for imaging by point scanning laser confocal microscopy with most of the protein localized to the upper 2-3 !M of the cortex, and the transporter coating the apical microvilli (Figure 1). Little or no Sp- ABCB1a is detected on the basloateral or basal (facing the blastocoel) surfaces of these embryos, indicating regulated trafficking of this protein to apical surfaces. 9-12h old embryos overexpressing Sp- ABCB1a had a 5-fold reduction in intracellular calcein accumulation, (Figure 2) relative to un-injected controls. The activity of the over-expressed protein was Figure 1: Equatorial view of several cells of a 12h old sea urchin embryo showing localization of Sp-ABCB1a (red) and inhibited by PSC-833 and Cyclosporin-A calcein accumulation (green) in a 1 !M PSC833 treated (Cs-A) in a dose dependent fashion. I have embryo. The forming blastocoel is seen in the lower left corner subsequently found that overexpression of of the micrograph. Sp-ABCB1a::mCherry localizes to the mCherry fusions of another ABC transporter, apical microvillar surface of sea urchin embryo blastomeres. Sp-ABCC9a::mCherry does not reduce Intracellular calcien compartmentalizes in vesicles or organelles within cells. intracellular calcein accumulation. These results indicate that Sp- ABCB1a::mCherry fusions appear to retain PSC833/Cs-A-sensitive C-AM efflux activity. Previous studies have shown that the multidrug transporters P-gp and MRP1 retain efflux activity and normal trafficking patterns when tagged with GFP at their carboxy termini and transiently transected into HeLa cells (1, 6). However, other studies have suggested that carboxy fusions of the ABC transporter, CFTR, can subtly increase the mobility of the protein at the plasma membrane by interfering with its tethering to the actin cytoskeleton (4). Further experiments with Sp-ABCB1a antibodies and amino terminus fusions will determine if these FP fusions could have subtly altered location or activity. This study presents a potential alternative approach to antibodies and pharmacology as the major tools to study location and function of the major ABC transporters expressed in development. Although further adaptations of this approach will be required to visualize the dynamics of transporter movement after sea urchin fertilization, the current expression rates are certainly adequate for characterization of transporters in morula and blastula stage embryos. The broader significance of this approach will be in providing direct evidence for protective or developmental activity of transporters and in probing the association of transporters with the cortical structures that underpin their activity.

Figure 2: Accumulation of calcein in Sp-ABCB1a::mCherry overexpressing embryos and controls (the scale for both graphs is 0-1200 fluorescence units). To ensure that the calcein fluorescence of controls and PSC833/Cyclosporin A were imaged within the linear range of the 12-bit detector, changes in basal accumulation were compared in the same embryos using both independent acquisition settings (A) and under identical settings to inhibitor treated controls (B). Bars represent the mean (+/- s.d.) of 3-4 individual embryos from two experiments. *P<0.1, **P<0.05, ***P<0.01 by t- test of injected means relative to relevant un-injected control. P=0.14 for 1 !M CSA and P=0.10 for 3 !M PSC833.

I thank Drs. Kevin Uhlinger and. James Coffman for their expert assistance with embryo manipulations. I also thank Drs. Roger Tsien and Chuck Ettensohn for their respective gifts of mCherry and PCS2+GFP. This work was supported by NIH K99 HD058070 and by a MDIBL New Investigator Award.

1. Chen Y and Simon SM. In situ biochemical demonstration that P-glycoprotein is a drug efflux pump with broad specificity. J Cell Biol 148: 863-870, 2000. 2. Essodaigui M, Broxterman HJ, and A.Garnier-Suillerot. Kinetic analysis of calcein and calcein- acetoxymethylester efflux mediated by the multidrug resistance protein and P-glycoprotein. Biochemistry 37: 2243- 2250, 1998. 3. Goldstone JV, Hamdoun A, Cole BJ, Howard-Ashby M, Nebert DW, Scally M, Dean M, Epel D, Hahn ME, and Stegeman JJ. The chemical defensome: environmental sensing and response genes in the Strongylocentrotus purpuratus genome. Dev Biol 300: 366-384, 2006. 4. Haggie PM, Stanton BA, and Verkman AS. Increased diffusional mobility of CFTR at the plasma membrane after deletion of its C-terminal PDZ binding motif. J Biol Chem 279: 5494-5500, 2004. 5. Hamdoun AM, Cherr GN, Roepke TA, and Epel D. Activation of multidrug efflux transporter activity at fertilization in sea urchin embryos (Strongylocentrotus purpuratus). Dev Biol 276: 452-462, 2004. 6. Rajagopal A, Pant AC, Simon SM, and Chen Y. In vivo analysis of human multidrug resistance protein 1 (MRP1) activity using transient expression of fluorescently tagged MRP1. Cancer Res 62: 391-396, 2002. 7. Shaner NC, Campbell RE, Steinbach PA, Giepmans BN, Palmer AE, and Tsien RY. Improved monomeric red, orange and yellow fluorescent proteins derived from Discosoma sp. red fluorescent protein. Nat Biotechnol 22: 1567- 1572, 2004. 8. Terasaki M. Dynamics of the endoplasmic reticulum and golgi apparatus during early sea urchin development. Mol Biol Cell 11: 897-914, 2000. 9. Weitzel HE, Illies MR, Byrum CA, Xu R, Wikramanayake AH, and Ettensohn CA. Differential stability of {beta}-catenin along the animal-vegetal axis of the sea urchin embryo mediated by dishevelled. Development 131: 2947-2956, 2004. The sea urchin larva as a simple model for immune barrier function: Analysis of immune gene expression and associated bacteria

Eric Ho, Cynthia Messier, Guizhi Wang, Taku Hibino and Jonathan P. Rast Department of Medical Biophysics and Department of Immunology, University of Toronto Sunnybrook Research Institute, Toronto ON M4N 3M5 Canada

Simple marine invertebrates have much to offer as models systems for immunity particularly as increasing emphasis is placed on understanding mechanisms of innate protection. The sea urchin embryo is an outstanding model for investigating gene regulatory networks in development1 and similar approaches can be applied to immune questions using the larval stage as a model. Genomic analysis of the purple sea urchin (Strongylocentrotus purpuratus) indicates that homologs of nearly all important vertebrate immune transcription regulators are present and expressed in the development of the larva2,3. In order to develop this model it is first necessary to more fully characterize immune function in the larva and to establish simple infection models on which to map regulatory networks. We have refined our techniques to characterize immune gene activation in response to complex natural environments and have further characterized the microbial community associated with larvae grown in natural seawater. These conditions more closely resemble the natural habitat of the larva relative to those that are available in an artificial laboratory setting. To initiate these investigations we cultured larvae in daily changes of freshly collected 25 !m- filtered seawater. This provided a source of food and microbiota. Embryos and larvae were raised from fertilization to 8 days under these conditions (3 days past the onset of feeding). After extensive washing in sterile seawater, aliquots of larvae were fixed for subsequent in situ hybridization analysis, prepared for RNA/DNA extraction or used to inoculate marine agar plates. RNA from these samples was used as template for 16S ribosomal RNA sequence analysis employing universal eubacterial primers5. We generated 65 16S sequences (39 directly from larval RNA and 26 from cultured larval microbiota). A breakdown of the taxa identified in this sequencing project is shown in Table 1.

Table 1. 16S ribosomal sequence analysis of larva-associated bacteria from summer 2008. Phylum Class sub-category* number Proteobacteria "-Proteobacteria Pseudoalteromonas 20 (+23†) Vibrio 3† Alteromonas 4 Alteromonadales 4 Oleispira 3 Oceanospirillales 1 #-Proteobacteria Acidovorax 1 $-Proteobacteria Erythrobacter 1 unknown 1 Actinobacteria Propionibacterium 2 Bacteroidetes Flavobacteriales 1 Sphingobacteriales 1 * lowest identifiable taxonomic category; † identified as culturable isolates.

The bacteria identified in this survey differ from those isolated in the previous summer though there are overlaps. Similar bacterial types to those identified here have been sequenced in surveys of microbes associated with adult sea urchins. In order to more fully characterize sample variability sequencing depth will be increased and environmental samples that were concurrently isolated will be analyzed. We have successfully imaged bacteria in the guts of larvae using fluorescently labeled universal eubacterial 16S probes. We will now use the larvae that we prepared for in situ hybridization in parallel to those used for sequence analysis to localize associated bacteria types within the larva. To more specifically investigate larva-bacterial interactions, a Vibrio splendidus-like, culturable strain isolated from larval samples taken in the summer of 2007 and 2008 at MDIBL was used in immune challenge experiments with laboratory raised larval cultures. When feeding larvae are exposed to relatively high levels of this Vibrio and other Vibrio isolates (e.g., V. diazotrophicus but less so to E. coli strains) pigment cells migrate from their normal position near the aboral ectoderm to a position closely apposed to the blastocoelar wall of the gut epithelium (Fig. 1A, B). In situ hybridization with probes for specific immune markers show upregulation of a gene family called 185/333 throughout blastocoelar cells (Fig 1C). This gene responds strongly to immune challenge in adult coelomocytes4. A polyketide synthase gene which is necessary for pigment synthesis is upregulated in pigment cells (Fig. 1D). While the Vibrio splendidus-like isolate may not be truly pathogenic, it can now be used to elicit an immune response which can then be investigated at the gene regulatory network level.

Fig. 1. Pigment cells migrate to the gut epithelium and immunity genes are upregulated when feeding larvae are exposed to strains of Vibrio bacteria. A,B DIC images of guts from live larvae. Pigment cells are absent around the gut of larvae grown under normal conditions (A) but numerous red pigment cells, which appear as dark cells in this image, surround the gut of a larva exposed to a Vibrio splendidus-like bacterium isolated at MDIBL (B). C, D In situ hybridization demonstrating that a 185/333 gene marker of immune activation is expressed in blastocoelar cells (C) and a polyketide synthase is predominantly expressed in gut associated pigment cells (D) larvae exposed to Vibrio. Unexposed larvae show low or no in situ signal with these probes (not shown).

Studies at MDIBL over the past two summers have given us a refined sense of how to characterize larva-bacteria associations. Isolated bacteria provide a simple infection model for studying immune response coordination in the larva and a set of culturable bacteria for further experiments.

Supported by a MDIBL New Investigator Award, the Sunnybrook Research Institute and a grant from the National Sciences and Engineering Research Council of Canada (NSERC) to JPR.

1. Davidson EH, Rast JP, Oliveri P, Ransick A, Calestani C, Yuh CH, Minokawa T, Amore G, Hinman V, Arenas- Mena C, Otim O, Brown CT, Livi CB, Lee PY, Revilla R, Rust AG, Pan Z, Schilstra MJ, Clarke PJ, Arnone MI, Rowen L, Cameron RA, McClay DR, Hood L, Bolouri H. A genomic regulatory network for development. Science 295:1669-1678, 2002. 2. Hibino, T., Loza-Coll, M., Messier, C., Majeske, A. J., Cohen, A. H., Terwilliger, D. P., Buckley, K. M., Brockton, V., Nair, S. V., Berney, K., Fugmann, S. D., Anderson, M. K., Pancer, Z., Cameron, R. A., Smith, L. C., and Rast, J. P. The immune gene repertoire encoded in the purple sea urchin genome. Dev. Biol. 300: 349-365, 2006. 3. Rast, J. P., Smith, L. C., Loza-Coll, M., Hibino, T., and Litman, G. W. Genomic insights into the immune system of the sea urchin. Science 314: 952-956, 2006. 4. Terwilliger DP, Buckley KM, Brockton V, Ritter NJ, Smith LC. Distinctive expression patterns of 185/333 genes in the purple sea urchin, Strongylocentrotus purpuratus: an unexpectedly diverse family of transcripts in response to LPS, beta-1,3-glucan, and dsRNA. BMC Mol Biol. 8:16, 2007. 5. Weisburg, W.G., Barns, S.M., Pelletier, D.A., and Lane, D.J. 16S ribosomal DNA amplification for phylogenetic study. J. Bacteriol. 173:697-703, 1991.

Evolutionary innovations in immunity: the Leydig and epigonal organs as potential sites of B cell development in the little skate, Raja erinacea

Michele K. Anderson Department of Immunology, University of Toronto, Toronto, ON M5S 1A8 Division of Molecular and Cellular Biology, Sunnybrook Research Centre, Toronto ON M4N 3M5

Our research interests focus on discovering novel immune mechanisms that have arisen during evolution. Cartilaginous fishes are uniquely positioned for these studies, because they are the most ancient vertebrate that possess an adaptive immune system1. The little skate, Raja erinacea, is an excellent model organism for studying immunity, because the developing embryo is exposed in the egg case to the same marine bacteria and viruses that they will later be exposed to as adults.

Mechanisms of B cell development and antibody diversification are diverse among the vertebrates. In some animals such as mice, B cells develop throughout life in the bone marrow, but in other animals such as chicken and sheep, B cell development occurs only during embryogenesis in other specialized organs. Very little is known about immune cell development in cartilaginous fishes. Therefore, we set out to determine when and where B cells develop in the skate. Our previous studies showed that the skate Leydig and epigonal organs have high concentrations of B cells and myeloid cells, similar in composition to the mammalian bone marrow2. However, additional markers that distinguish between developing immune cells and mature immune cells were required to identify sites of B cell development. We have identified a new genetic marker of immature B cells called HEBAlt. Our goal was therefore to clone the skate HEBAlt gene and to use it to determine sites of B cell development during embryogenesis and/or adult life.

After developing methods for isolating immune cells from skate epigonal and Leydig organs during the first summer at MDIBL, we attempted to clone HEBAlt from four different immune tissues (spleen, thymus, epigonal organ, and Ledig organ) by degenerate PCR, but did not succeed. Fortunately, new sequence databases subsequently became available that permitted us to identify HEBAlt sequences from several species of cartilaginous fish (Fig. 1). Using these sequences, we made gene-specific primers for HEBAlt and assessed its expression in immune tissues. We were able to amplify beta-actin from these tissues, confirming the quality of the cDNA. However, HEBAlt was not detected. It is possible that the numbers of immature B cells contained within these tissues are too rare to be detected. However, it is also possible that B cell development does not occur in adult immune tissues. Future studies will be designed to test this possibility by examining the expression of HEBAlt in embryonic tissues.

Figure 1. Nucleotide sequence identity (*) between mouse, dogfish shark, and elephant shark HEBAlt

Dogfish shark ATGTATTGTGCTTACACAGTGCCTGGTATGGGCAGCAATTCACTTATGTATTACTACAATAGGAAAA Elephant shark ATGTATTGTGCTTACACAGTGCCTGGTATGGGAGGTAATTCTCTTATGTATTACTACAATAGGAAAA Mouse ATGTACTGTGCTTATCCTGTCCCTGGAATGGGCAACAATTCTTTGATGTATTACTACAATGGGAAAA ***** ******** * ** ***** ***** ***** * *************** ******

Supported by a New Investigator Award from MDIBL and a Canadian Institutes for Health Research grant to MKA.

1. Litman, GW, Anderson, MK, and Rast, JP. Evolution of antigen binding receptors. Annual Review of Immunology 17:109-147, 1999. 2. Anderson, MK, Pant, R, Miracle, AL, Sun, X, Luer, CA, Walsh, CJ, Telfer, JC, Litman, GW, and Rothenberg, EV. Evolutionary Origins of Lymphocytes: Ensembles of T-cell and B-cell transcriptional regulators in a cartilaginous fish. Journal of Immunology 172(10):5851-60, 2004. Ammonia excretion and hemolymph ammonia concentrations in the intertidal green crab, Carcinus maenas during emersion

Elizabeth Simonik12 and Raymond P. Henry Department of Biological Sciences 1Ohio University, Athens, OH 45701 2Department of Biological Sciences Auburn University, Auburn, AL 36849

The commonly known green crab, Carcinus maenas (also known as the shore crab), is an invasive species that lives in the intertidal zone during the warm months of the summer. Depending on the tidal cycle, C. maenas may be emersed in air for up to six hours twice a day. This period of emersion represents a significant stress to the crab, because not only must it somehow exist in a different medium, air as opposed to water, but the physical properties of air vs water are also very different1. Specifically, temperature increases, which presumably would increase the crab’s metabolic rate, would place added demands on the respiratory system to increase both oxygen uptake and the excretion of metabolic wastes4. o3 For example, O2 uptake doubles in blue crabs for a ten degree increase in temperature (15 - 25 C). At the same time, the primary organs of respiratory and metabolic exchange, the gills, which are supported by the buoyancy of water, collapse in air, reducing the surface area for exchange.

Decapod crustaceans have a primarily protein-based metabolism, and they produce and excrete ammonia as their major form of nitrogenous waste. If metabolism is increased during emersion at the same time that excretion is compromised, it is possible that ammonia levels in the hemolymph could increase to potentially toxic levels. We examined this in green crabs exposed to a six-hour period of emersion.

Green crabs were collected by trap from the waters of the Maine coast and were held in troughs of running seawater (31 ppt and 11oC). Crabs were fed shrimp and squid on a daily basis but were starved for 48 hr prior to use in an experiment. The crabs used in this experiment were all approximaately the same size (95-110 gm). Hemolymph ammonia (NH33) concentrations and NH excretion were measured in both water and air. A hemolymph sample (1 mL) was taken from each crab from the infrabranchial sinus at the base of the walking legs. Crabs were placed in individual plastic tubs containing 2 L of aerated seawater. Water samples (5 mL) were taken immediately before the crab was placed in the tub (T0) and again after one hour of excretion by the crab (T60). At that point the water was removed from the tub, and the crabs were covered with seaweed and left emersed for 6 hr to simulate a typical intertidal emersion period. A second hemolymph sample was then taken, and the crabs were placed back into 2 L of seawater. A final water sample was taken after 60 min of re-immersion. Hemolymph samples were deproteinized in 80% ETOH, and ammonia concentrations in hemolymph and water were measured by the phenolhypochlorite method2.

In order to measure NH3 excretion in air during the emersion period, chambers were constructed out of clear PVC pipes that were sealed on both sides with rubber stoppers. The crabs were then emersed in the chambers for a period of six hours, and air was pumped through the chambers and bubbled for 1 hr periods into 5 ml of water, which served as an NH3 trap. The water was analyzed as above.

-1 -1 The rate of resting NH3 excretion in water was 0.2 ìmol gm hr , and this rate did not change significantly over the time course of emersion and re-immersion (p > 0.05, ANOVA; Fig. 1). There was a slight increase after 5 hr of emersion, and no compensatory increase in NH3 excretion when the crabs were re-immersed.

Figure 1. Ammonia excretion in green crabs immersed in seawater (I0), during six hours of emersion (E1-E5), and after one hour of re- immersion (R1). Mean + SEM (N=8). T=11ooC (water) and 22 C (air). There were no significant changes in ammonia excretion in water vs air (P > 0.10, ANOVA).

Interestingly, hemolymph NH3 concentrations, which were in the range of 100-250 ìM in resting, immersed crabs, showed no consistent pattern of increase during emersion: there were increases in 5 of the 8 crabs measured, a decrease in 1, and in 2 crabs the values were unchanged (Fig. 2). In most cases, hemolymph NH3 concentrations went back down upon re-immersion.

Figure 2. Hemolymph ammonia concentrations in each of 8 individual green crabs immersed at rest (black bars), after 6 hr of emersion (light gray bars), and after 1 hr of re-immersion (dark gray bars). T=11ooC (water) and 22 C (air).

These results are interesting because they indicate that green crabs have the ability to volatilize hemolymph ammonia and excrete it as NH3 gas across the gills into air during periods of emersion, an adaption found more commonly in crustaceans that occupy a more terrestrial habitat. As a result, hemolymph ammonia concentrations do not become elevated, and ammonia toxicity most likely does not become a problem for the crab, even after 6 hr of being cut off from the aqueous environment. We believe this ability is part of an integrated suite of physiological adaptations to intertidal life, which include sustained branchial ventilation in air, aerial O22 uptake and CO excretion, and water conservation. Supported by NSF IBN 02-30005 and NSF REU site award to MDIBL (NSF DBI-0453391).

1. Dejours, P. Principles of Comparative Respiratory Physiology. North Holland, 252 pp. 1975. 2. Solorzano, L. Determination of ammonia in natural waters by the phenol-hypochlorite method. Limnol. Oceanogr. 14: 799-801. 1969. 3. Towle, D.W. and Burnette, L.E. Osmoregulatory, digestive,and respiratory physiology. In: The Blue Crab, Callinectes sapidus (Kennedy, V.S., and Cronin, L.E., eds). Maryland Sea Grant, College Park, Md. Pp. 419-483. 2007. 4. Truchot, J.-P. Changes in the hemolymph acid-base state of the shore crab, Carcinus maenas, exposed to simulated tidepool conditions. Biol. Bull. 170: 506-518. 1986. Pupil dilation in the spiny dogfish, Squalus acanthias

Stephen M. Kajiura1 and Shelly M.L. Tallack2 1Department of Biological Sciences, Florida Atlantic University, Boca Raton, FL 33431 2Gulf of Maine Research Institute, Portland, ME 04101

The spiny dogfish, Squalus acanthias, spans a large depth range from the surface to 600m regularly and maximally to 1460m1. Because this species spans such a large depth range, it is subjected to a wide range of light intensities from bright surface waters to the aphotic zone. Therefore, we predicted that S. acanthias would demonstrate a correspondingly large range of pupillary apertures to facilitate visual function across the wide range of light intensities that the shark could encounter.

To quantify pupil dilation, a total of 6 sharks were anaesthetized, secured to a stage in a glass aquarium and ventilated through the mouth with aerated seawater. A digital camera mounted on a tripod was focused upon the eye. The eye was illuminated for 5 minutes with a 75W incandescent bulb and photographed under these light conditions then all lights were extinguished. A dim red LED torch briefly illuminated the eye to permit photographing at 1, 2, 3, 5, 10, 20 and 30 minutes as the shark was dark-adapted. After 30 minutes, the lights were switched on and the eye was photographed at 1, 2, 3 and 5 minutes as the shark readapted to the bright light. The pupil and total eye areas were quantified using ImageJ software and the pupil area expressed as a percentage of the total eye area.

The light-adapted pupil was 22.9% ±2.23 (SEM) of the total eye area (Figure 1). The pupils gradually dilated in the dark to 35.3% ±1.61 (SEM) of the total eye area after 30 minutes. Upon light exposure, the pupils rapidly constricted to an area of 24.1% ±2.45 (SEM) within 5 minutes at which point the pupil area approached, but was still greater than, the pre-dark-adapted state (paired t-test, p = 0.003).

Fig. 1. Pupil dilation in the spiny dogfish, Squalus acanthias. The pupil area, expressed as a percentage of the total eye area, is plotted against time for dark adaptation (0-30 minutes) and light adaptation (30-35 minutes). The pupil area increased by 12.4% over 30 minutes of dark- adaptation and constricted dramatically within the first minute of light exposure eventually returning to near the light adapted size within 5 minutes of light exposure. Insets show photographs of the eye at time 0 (light), 5 (dark), 30 (dark), and 35 (light) minutes.

Unlike most fishes, elasmobranchs are characterized by a highly mobile pupil. At the end of 30 minutes, the pupil of S. acanthias had expanded dramatically and the dilation rate was approaching an asymptote, although a longer period of dark adaptation would have likely yielded a slightly greater maximum pupil area. Other studies have expressed pupil size in various ways confounding direct comparison and precluding determination of whether the 12.4% increase in dark-adapted pupil area differs from exclusively shallow water species. Applying the same methodology to other species will resolve whether the dilation range of S. acanthias is exceptional. This work was supported by a MDIBL New Investigator Award to SMK and SMLT and by NSF IOS-0639949 to SMK.

1. Compagno, LJV, Dando, M, and Fowler, S. Sharks of the World. Princeton, Princeton University Press, 2005. Expression of the organic solute and steroid transporter in early embryonic development of the little skate, Leucoraja erinacea

Jae-Ho Hwang, Angela Parton and David Barnes Mount Desert Island Biological Laboratory, Salisbury Cove, Maine, 04672

The organic solute and steroid transporter (Ost) was first identified in the liver of the little skate, Leucoraja erinacea4. In mammals, Ost mediates ileal basolateral reabsorption of bile acids and conjugated steroids2. Ost also mediates transport of eicosanoids and may be involved transport of cell signaling molecules, such as steroids and prostaglandins. Ost is a heterodimer composed of a seven- transmembrane protein subunit (Ost-alpha) and a smaller, single transmembrane protein subunit (Ost- beta). In collaboration with Dr. N. Ballatori, we showed previously that Ost is expressed in LEE-1, a cell line derived from a stage 28 skate embryo, and that Ost-beta is induced by arachidonic acid3. It has been reported that Ost subunits can be induced through the activated farnesoid X receptor (FXR)1, and FXR may be involved in the induction process we have observed. We have established by PCR that LEE-1 cells express FXR receptor mRNA.

At stage 28 in the developing skate embryo, neither eye pigmentation nor external gill filaments have developed. Kidney and heart development has been initiated, but liver development has not begun. We carried out in situ hybridization for Ost-alpha and Ost-beta in stage 28 skate embryos to determine the sites of early expression of these proteins (Fig. 1). The messages for both proteins colocalized in the diencephalon and myelencephalon. Although staining in these areas is prone to artifact in some cases, the absence of staining in the control (sense) probes indicated that the identification of localization was correct. Staining for Ost-alpha also was detected in the anterior dorsal portion of the embryo.

Figure 1. In situ hybridization for Ost-alpha and OST-beta at stage 28 in the little skate embryo. (A), Top, left; embryo stained with digoxigenin (UTP)-labeled sense (control) probe for Ost-alpha; (B), Top, right; embryo stained with digoxigenin-labeled antisense probe for Ost-alpha. (C), Bottom, left; embryo labeled with sense (control) fluorescein-12 (UTP)-labeled probe for Ost-beta. (D), Bottom, right; embryo labeled with fluorescein-12-labeled antisense probe for Ost- beta. Embryos exposed to digoxigenin were treated with anti-digoxigenin. Stains were carried out with 4-nitro blue tetrazolium chloride, 5-bromo-4-chloro-3 indolyl-phosphate (digoxigenin) or Fast Red (flourescein).

No evidence of expression of either Ost-alpha or Ost-beta was detected in less developed (stage 19) embryos. The results suggest that additional functions of the Ost transport complex may exist in early (stage 28) embryonic development. Further work is necessary to establish the functionality of stage 28-expressed Ost-alpha and Ost-beta, and embryonic stage and developmental pattern of the complex as it begins to appear in other areas of the embryo.

Supported by R01 RR019732, P20 RR016463, P30 ES03828 and a grant from the Irving A. Hansen Memorial Foundation. The authors thank Drs. N. Ballatori and N. Theodosiou for useful discussions.

1. Boyer, JL., Trauner, M, Mennone, A, Soroka, CJ, Cai, SY, Moustafa, T, Zollner, G, Lee, JY and Ballatori, N. Up-regulation of a basolateral FXR-dependent bile acid efflux transporter, OST-alpha/OST-beta, in cholestasis in humans and rodents. Am J Physiol 290: G1124–G1130, 2006. 2. Dawson, PA, Hubbert, M, Haywood, J, Craddock, AL, Zerangue, N, Christian, WV and Ballatori, N. The heteromeric organic solute transporter alpha-beta, Ost-alpha/Ost-beta, is an ileal basolateral bile acid transporter. J Biol Chem 280: 6960–6968, 2005. 3. Hwang, JH, Parton, A, Czenchanski, A, Ballatori, N and Barnes, D. Arachidonic acid-induced expression of the organic solute and steroid transporter-beta (Ost-beta) in a cartilaginous fish cell line. Comparative Biochemistry and Physiology, Toxicolology and Pharmacology 148: 39-47, 2008. 4. Wang, W, Seward, D, Li, L, Boyer, JL and Ballatori, N. Expression cloning of two genes that together mediate organic solute and steroid transport in the liver of a marine vertebrate. Proc Nat Acad Sci USA 98: 9431–9436, 2001.

Discovery of novel genes relevant for glomerular filter integrity in zebrafish (Danio rerio)

Lynne Staggs1, Lisa Böhme1, Lena Schiffer1, Dirk M. Hentschel2, Lena-Sophie Frowerk1, Torsten Kirsch1, Hermann Haller1 and Mario Schiffer1 1Division of Nephrology, Hannover Medical School, 30625 Hannover, Germany 2Brigham and Women’s Hospital, Renal Division, Harvard Medical School, Boston, MA 02115

Zebrafish are translucent during early development, which makes them uniquely suitable for in vivo studies using fluorescent markers. In addition, larval zebrafish can be injected with morpholinos (modified RNA molecules), to knock-down protein expression, or with mRNA and cDNA constructs to express proteins of interest. Their size, high fecundity, and ease of handling allows large scale experiments at moderate costs. We have developed a large-scale screening system for glomerular filter integrity in zebrafish, that allows us not only to observe specific effects of genetic modification in the fish during development and morphological analysis, but gives us also functional data on the integrity of the filter in a short period of time1.

Fig. 1. Functional analysis of glomerular filter integrity in zebrafish after Nostrin-knockdown. (a) Images of zebrafish eyes in control and siNostrin injected embryos injected with 70kD-FITC-labelled dextrane. Fluorescent dye was injected in the cardinal-vein of anaesthetized zebrafish lavae 48-72 hours post fertilization and images were taken in individual fish 1, 24 and 48 hours post injection (hpi). (b) Graphical summary of fluorescence intensity measured in the retinal blood vessels in individual zebrafish over time. 24hpi fluorescence intensity measured in the retinal blood vessels was considered 100%. 48hpi we could detect a dramatic difference in fluorescence intensity in the siNostrin fish indicating a defect in the filtration barrier for high molecular weight molecules in the absence of Nostrin.

We have chosen the zebrafish orthologue of Nostrin for our experiments, since there was preliminary evidence that Nostrin expression is not only detectable in kidney endothelial cells but also in glomerular podocytes (T. Kirsch, unpublished results). In addition, Nostrin was identified as glomerulus specific expressed gene in microarray experiments2. Nostrin was initially described as regulator of endothelial nitric-oxide synthase (eNos). In endothelial cells, Nostrin drives eNOS away from the plasma membrane and induces eNOS trafficking towards intracellular compartments. However, a role for Nostrin in glomerular function especially in podocytes has not been defined yet.

Therefore, we performed knockdown experiments and silenced Nostrin in zebrafish embryos using specific ATG-blocking morpholinos for the described zebrafish orthologue of Nostrin. Compared to scrambled controls we detected a typical phenotype of glomerular dysfunction in the siNostrin injected animals with pericardial effusion and yolk sac edema as early as 48 hour post fertilization (data not shown). Over the past years at MDIBL we have developed a functional screening assay to further characterize this phenotype and demonstrate a defect in glomerular barrier function using injections of a 70kD-fluorescent-dextran in the cardinal-vein of these fish1. After that we monitor the amount of intravascular fluorescence intensity in the retinal vessels of these fish (Fig. 1a). When we compared the amount of intravascular fluorescence intensity over time in individual fish we could detect a significant reduction of fluorescence intensity in siNostrin injected fish, indicating a loss of high-molecular weight molecules in the morpholino injected animals (Fig. 1b).

We conclude that Nostrin has an important function in the maintenance of an intact glomerular filtration barrier. With accompanying ultrastructural analysis we will be able to determine which compartment of the glomerular filter (the podocytes or the glomerular endothelial cells) is predominantly affected by the Nostrin-knockdown. This work will lead to further elucidation of a former unknown candidate gene in glomerular biology. Supported by an MDIBL New Investigator Award to MS.

1. Hentschel, D and Schiffer, M. Rapid screening of glomerular slit diaphragm integrity in larval zebrafish. Am J Phys renal Phys.293: 1746-1750, 2007. 2. Takemoto, M. Large-scale identification of genes implicated in kidney glomerulus development and function. EMBO J. 25:1160-1174, 2006. 3. Icking, A. Nostrin functions as a homotrimeric adaptor protein facilitating internalization of eNOS. J Cell Sci 118:5059-5069, 2005.

Live imaging of the developing kidney in zebrafish (Danio rerio)

Lena Schiffer1, Lynne Staggs1, Lisa Böhme1, Dirk M. Hentschel2, Christoph Englert3, Hermann Haller1 and Mario Schiffer1 1Division of Nephrology, Hannover Medical School, 30625 Hannover, Germany 2Brigham and Women’s Hospital, Renal Division, Harvard Medical School, Boston, MA 02115 3Leibniz-Institute for Aging Research, 07745 Jena, Germany

The zebrafish model is a unique system in which to study kidney development. In teleost fish and amphibians, the pronephros serves as kidney for the developing larvae. The zebrafish pronephros consists of three components: the glomerulus, the tubules and the nephric duct. This primitive kidney unit is structurally very similar to the mammalian counterparts and the pronephros is fully functional 3.5days post fertilization 1. Here we report on the use of wt1b-eGFP zebrafish embryos as a model system to monitor kidney development in the developing embryo.

Wt-1 stands for Wilms tumor suppressor, which is a key regulator of kidney development. Mutations of the Wt-1 gene in humans lead to syndromic phenotypes (Denys-Drash- and Frasier- Syndrome) with diffuse mesangial sclerosis (DMS), focal-segmental glomerulosclerosis (FSGS), genitourinary malformations and Wilms tumors, a pediatric kidney cancer 2. In zebrafish the gene is duplicated and two different genes wt1a and wt1b have been reported and both genes seem to be involved in the formation of the functioning zebrafish pronephros 3. While wt1a-driven eGFP- expression is restricted only to glomerular podocytes, wt1b-eGFP expression can be monitored in the glomerulus as well as in the proximal tubular parts of the pronephros 3.

We raised wt1b-eGFP fish (which we had obtained from C. Englert, Leibniz Institute for Aging Research, Jena, Germany) and monitored formation of the pronephros over a time course of 96hrs in life zebrafish embryos using regular fluorescence and confocal microscopy. We can clearly monitor pronephros development and formation of the proximal tubules on a cellular level over time. At 48hrs post fertilization the pronephros can be detected with regular flurescence microscopy at the level of the 3rd somite (Fig. 1).

Fig. 1. Expression of wt1b-eGFP in zebrafish 48 hrs post fertilization. Wt1b-eGFP labels the glomerulus (white arrowhead) as well as the proximal tubules (white double arrows) visualized by regular fluorescence microscopy.

The next step will be genetic manipulations in the fish model to monitor effects of knock-down or the use of mRNA as well as cDNA constructs to capture effects on pronephros formation in the life animal.

Moreover, using confocal microscopy techniques we were able to visualize single cells of the proximal tubules displaying endocytosis vesicles (Fig. 2).

Fig. 2. Expression of wt1b-eGFP in proximal tubular cells of a zebrafish embryo 172hrs post fertilization. Single cells of the proximal tubules are clearly visible as well as the tubular lumen (white asterisk) and vesicles, presumably a hint for ongoing endocytosis activity, can be captured (double arrows).

In conclusion the wt1-eGFP zebrafish is a promising tool to study effects of genetic manipulations as well as toxic effects on glomerular and tubular development in a live animal. Based on this model system we will be able to develop novel innovative techniques to capture cytotoxicity, apoptosis and proteinuria assays on a high-throughput level as a helpful screening tool for genetic and pharmacological research. Supported by an MDIBL New Investigator Award to MS.

1. Drummond, I. Kidney development and disease in zebrafish. J Am Soc Nephrol. 16:299-304, 2005. 2. Rivera , M and Haber, D. Wilms’tumor: connecting tumorigenesis and organ development in the kidney. Nat Rev Cancer. 5: 699-712, 2005. 3. Bollig, F. Identification and comparative expression analysis of a second wt1 gene in zebrafish. Dev Dyn. 235:554- 561, 2006.

Ammonia Excretion in Atlantic hagfish (Myxine glutinosa)

Salvatore Blair1, Anne-Kathrin Blasse2, Dirk Weihrauch3, Susan L. Edwards1 1Department of Biology, Appalachian State University, Boone, NC 28607. 2Mt Desert Island Biological Laboratory, Salisbury Cove, ME. 3 Department of Biological Sciences, University of Manitoba, Winnipeg, MB, R3T 2N2 Canada

In higher vertebrates ammonia is a nitrogenous waste produced by amino acid metabolism, and in mammals it is detoxified in the liver to urea and is excreted via the urine. Teleost fish on the other hand excrete ammonia directly into the surrounding water. The Atlantic hagfish (M. glutinosa), are agnathan fishes abundant in the Gulf of Maine, living in an ecological habitat composed of soft bottom substrata in water over 50m in depth3. The central diet of the hagfish includes the flesh of dead fish, with animals often opportunely entering a carcass through an orifice and eating their way out. As a result of their feeding habits we hypothesize that these animals would possibly experience an increase in environmental ammonia concentrations due to the decomposition of organic matter in their immediate environment7. In theory, animals living in such an environment would require some form of regulation of the high concentrations of ammonia taken in by these primitive fish. Early work by Evans1, demonstrated that ammonia excretion in the hagfish did not appear to be Na+ dependant + + suggesting there must be an alternate route other than Na /NH4 exchange for the excretion of ammonia.

Recent studies have identified members of the Rh glycoprotein family in the gills of a number of teleost species. In the pufferfish Takifugu rubripes, gill Rh glycoproteins have been shown to mediate the transport of an ammonia analogue (methylammoinum) in oocyte expression systems. These results suggest that gill Rh glycoproteins may be the site of ammonia transport across the branchial epithelium, from the vascular space to the environmental water4. Very little is known about the ability of the more primitive fishes, in particular the hagfishes to regulate nitrogenous wastes. The aim of this study was to utilize molecular, biochemical and physiological techniques to identify members of the Rh glycoprotein family as possible mechanism for branchial ammonia excretion in the Atlantic hagfish Myxine glutinosa

Hagfish, were obtained through and housed at MDIBL in running seawater tanks. Individual control hagfish (n=6) were weighed and injected with hagfish ringers and test hagfish (n=5) were injected with ammonium bicarbonate (1.5mmol/kg). The hagfish were then placed individually into 5 gallon buckets containing 2L aerated seawater and buckets were immersed in a circulating water bath to maintain water temperature. Water samples (1ml) were taken from each bucket at time 0 before the hagfish was placed into each bucket, and then during hagfish occupancy periodically at 0.5hr, 1hr, 2hr, 8hr, 12hr, and 24hr. At the end of the 24hr period hagfish were sacrificed and gills and blood samples were taken and homogenized and RNA isolation performed. Water samples were analyzed, in triplicate, to determine the total ammonia concentration with a micro-plate modification of the 5 + phenolhypochlorite method . The determination of total ammonia describes both NH4 and NH3 released from the animal to the ambient water. The assay was read with a Bio-Tek Powerwave reader (Fisher Scientific). Data analysis was performed with Microsoft Excel 2003.

Degenerate primers were used in conjunction with reverse transcriptase polymerase chain reactions (RT-PCR). PCR products were visualized by ethidium bromide staining in a 1% agarose gel. The resulting products were ligated into pCR 4-TOPO vectors and transformed into TOP-10 chemically competent cells using a TOPO-TA cloning kit (Invitrogen, Carlsbad, CA) and sequenced. Following sequencing of the initial fragment further Rh cDNA was amplified using hagfish RhAG gene specific primers and 3! and 5! RACE technologies. Related sequences were detected by searching the GeneBank database using standard BLAST algorithms, National Center for Biotechnology (NCBI). Consensus sequence was constructed using Assembly Align (Oxford Molecular Group). Sequence alignments were performed using Clustal W 6.

We have preliminary evidence to suggest that hagfish when infused with ammonium bicarbonate (1.5mmol kg-1) demonstrate a significant increase in ammonia excretion over a 24 hour period (Fig1). As the urinary output of hagfish has been documented as being extremely small (4-40µl 100g-1h-1) 2 it is unlikely that ammonia excretion is occurring via renal transport. Therefore we suggest that the site of ammonia excretion is the branchial epithelium. To support this hypothesis we have identified from the gills of the hagfish partial cDNA sequences from 3 members of the Rh glycoprotein family; RhAG, RhBG and RhCG ranging from 420 amino acids to 155 amino acids in length, all of which share a high identity to other vertebrate Rh sequences.

Figure 1. Average ammonia excretion vs. time. This figure shows the relationship of the average control and test hagfish ammonia excretion over the 24 hour time period. Error bars represent standard error of the mean. * Indicates significance between control and test at time intervals (p=<0.008)

Further experiments are required to determine the functional significance the Rh glycoproteins play in the regulation of nitrogenous waste excretion in the hagfishes. This research was supported by NSF REU site at MDIBL (DBI0453391) to SB, ASU IRB & MDIBL NIA to SLE, MDIBL graduate student support to A-KB and NSERC Discovery grant to DW. 1. Evans DH. Gill Na+/H+ and Cl+/HCO3+ exchange systems evolved before the vertebrates entered fresh water. J.Exp.Biol 113: 464-469, 1984. 2. Hardisty MW. Biology of the Cyclostomes. London: Chapman and Hall., 1979, p. 429pp. 3. Martini F, Lesser M, and Heiser JB. Ecology of the hagfish, Myxine glutinosa L., in the gulf of Maine:II Potential impact on benthic communities and commercial fisheries. J Exp Mar Biol Ecol 214: 97-106, 1997. 4. Nakada T, Westhoff CM, Kato A, and Hirose S. Ammonia secretion from fish gill depends on a set of Rh glycoproteins. FASEB 21: 1067-1074, 2007. 5. Solorzano L. Determination of ammonia in natural waters by the phenohypochlorite method. Limnol Oceanogr 14: 799-801, 1969. 6. Thompson JD, Higgins DG, and Gibson TJ. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acid Res 22: 4673-4680, 1994. 7. Wilkie MP. Ammonia excretion and urea handling by fish gills: present understanding and future research challenges. J Exp Zool 293: 284-301, 2002

Expression of Na+/H+ exchanger paralogs in skin of the marine longhorn sculpin (Myoxocephalus octodecemspinosus)

Hana Kratochvilova1, Susan Edwards2, and James Claiborne3 1University of South Bohemia, Czech Republic, 2Appalachian State University, Boone, NC, 28608, 3Georgia Southern University, Statesboro, GA 30460

Seawater teleosts must compensate for passive water loss and ion uptake, by active regulation. Although the gills are the primary osmoregulatory organ in teleost fishes, other tissues such as the kidney, skin, and intestine may also play a role 5. Ionocytes in the skin of zebrafish express H+-ATPase and Na+/H+ transporters and are thought to drive Na+ uptake from freshwater by H+ excretion 6. Little is known about the osmoregulatory activity of fish skin in seawater fish and whether postulated ion transporters are present in this epithelial tissue. Initial studies in our laboratory demonstrated that the mRNA for several paralogs of the Na+/H+ exchanger (NHE2b, NHE3, and NHE8) are expressed in the skin of the marine longhorn sculpin (Myoxocephalus octodecemspinosus) 7. Here, we have used sculpin specific antibodies against 3 NHE isoforms in a initial attempt to localize these proteins within the sculpin skin.

Sculpin were maintained at MDIBL in running seawater and handled as described by Phillips et al 8. Ventral skin sections from chronic ammonia loaded and control animals were collected, and a skin sample from a control fish (water infused) 8 was used for this initial immunohistochemical screening for NHEs. Sections for fluorescence immunohistochemistry were prepared as described previously 2. Antibodies used in this study were monoclonal anti-Na+/K+ ATPase (a5 1:500 dilution 1), polyclonal affinity purified anti-NHE3 (A99; 1:500; against sculpin epitope TDSSHDSGNGDTDHES derived from genbank: EU909191), anti-NHE2b (A94-APS; 1:250; as previously described 1) and anti-NHE8 (newly developed against sculpin NHE8 epitope MDIEESQSRRKSK, Claiborne, unpublished). Immunoflourescence images were taken on the Axiovert fluorescence microscope (Zeiss). Skin morphology was noted on hematoxylin and eosin stained sections via light microscopy (Leica CME, Leica EC3).

All three NHE isoforms were localized in the epidermal layer of the fish skin and appeared to be expressed throughout the tissue (Fig. 1 B, C, D, red). Reactivity of NHE3 isoform (Fig. 1 C) appears to be strongest at the edges of immunopositive cells, whereas NHE8 isoform is more diffusely expressed throughout the whole cell. This corresponds to our results from sculpin gill sections, where NHE3 is primarily apical in mitochondrial rich cells and NHE8 reactivity is detected throughout the cytoplasm and found in a wide range of gill cell types (unpublished). Areas of Na+/K+ ATPase (NKA) reactivity near the external edge of the epidermis were also detected (Fig. 1 B, C, D, green), and was colocalized with some NHE (primarily NHE2b) expressing cells. Sporadic long thin cells (presumably neurons) were also rich in NKA.

In previous work, we have postulated that NHE isoforms within the branchial epithelium may drive acid-base regulation in the marine fish 2,4. If exposed to hypoosmotic salinities, sculpin may also require ion uptake mechanisms as they can adapt to dilutions down to at least 20% of full strength seawater for many weeks 3. The present data show that the epidermal layers of the skin adjacent to the seawater also express several NHE paralogs and Na+/K+-ATPase. It remains to be seen if these transporters are involved with transepithelial ion exchanges as in the freshwater zebrafish 6, thus the mRNA7 and protein expression deserves further investigation.

Funded by NSF IOB-0616187 to JBC, and MDIBL NIA to SE.

Figure 1. Light and immunofluorescence micrographs of skin cross-sections of Myoxocephalus octodecemspinosus. Fish skin morphology (A) showing dermal (De) and epidermal (Ep) layer with mucous glands (MG). Immunoreactivity of NKA (green) and three isoforms of Na+/H+ exchanger (red); NHE2b (B), NHE3 (C), and NHE8 (D). Scale bar = 50 !m.

1. Catches, JS, Burns, JM, Edwards, SL and Claiborne, JB. Na+/H+ antiporter (NHE2), V-H+-ATPase, and Na+/K+- ATPase immunolocalization in a marine teleost (Myoxocephalus octodecimspinosus). J. Exp. Biol. 209: 3440-3447, 2006. 2. Claiborne, JB, Choe, KP, Morrison-Shetlar, AI, Weakley, JC, Havird, J, Freiji, A, Evans, DH and Edwards, SL. Molecular detection and immunological localization of gill Na+/H+ exchanger in the dogfish (Squalus acanthias). Am J Physiol Regul Integr Comp Physiol 294: R1092-1102, 2008. 3. Claiborne, JB, Walton, JS and Compton-McCullough, D. Acid-base regulation, branchial transfers and renal output in a marine teleost fish (the long-horned sculpin; Myoxocephalus octodecimspinosus) during exposure to low salinities. J. Exp. Biol. 193: 79-95, 1994. 4. Edwards, SL, Wall, BP, Morrison-Shetlar, A, Sligh, S, Weakley, JC and Claiborne, JB. The effect of environmental hypercapnia and salinity on the expression of NHE-like isoforms in the gills of a euryhaline fish (Fundulus heteroclitus). J. Exp. Zool. 303: 464–475, 2005. 5. Evans, DH, Piermarini, PM and Choe, KP. The multifunctional fish gill: dominant site of gas exchange, osmoregulation, acid-base regulation, and excretion of nitrogenous waste. Physiol Rev 85: 97-177, 2005. 6. Hwang, PP and Lee, TH. New insights into fish ion regulation and mitochondrion-rich cells. Comp Biochem Physiol A Mol Integr Physiol, 2007. 7. LaRue, K, Tarley, M, Wilbur, B, Diamanduros, A and Claiborne, J. Tissue distribution of NHE isoform transcripts in the longhorn sculpin, Myoxocephalus octodecimspinosus. Bull. Mt. Desert Is. Biol. Lab. 48: this volume, 2009. 8. Phillips, M, Hyndman, K, Tarley, M, Diamanduros, A, Edwards, S and Claiborne, J. Quantification of RhgC1 in the marine longhorn sculpin (Myoxocephalus octodecemspinosus). Bull. Mt. Desert Is. Biol. Lab. 48: this volume, 2009.

Marine fishes are enriched in the enzymatic antioxidant GPx4 relative to mice

Jeffrey M. Grim1, Elizabeth L. Crockett1, Hae Lim Yook2, Tamas Kriska3, Kelly A. Hyndman4, and Albert W. Girotti3 1Department of Biological Sciences, Ohio University, Athens, OH 45701 2Fryeburg Academy, Fryeburg, ME 04037 3Biochemistry Department, Medical College of Wisconsin, Milwaukee, WI 53226 4Vascular Biology Center, Medical College of Georgia, Augusta, GA 30912

Most animals require a constant supply of oxygen and, as byproducts of metabolism, their cells regularly produce reactive oxygen species (ROS). ROS can damage the lipids that make up the matrix of biological membranes by a process known as lipid peroxidation (LPO). LPO is self-propagating because ROS-damaged lipids can themselves damage other lipids. LPO threatens membrane stability6, which may ultimately result in decreased function of membrane-associated proteins and, if unbalanced by cellular antioxidants, even expedited cell death1. Interestingly, lipids are not equally susceptible to LPO; polyunsaturated fatty acids (PUFA) are at an elevated risk of LPO compared to fatty acids with lower degrees of unsaturation2.

Animals are protected from ROS-induced damage by enzymatic antioxidants including catalase and various glutathione-dependent peroxidases. Catalase and all glutathione peroxidases detoxify hydroperoxides however, glutathione peroxidase 4 (GPx4) is unique, because it can also directly repair lipids in biological membranes which have been damaged by ROS8. As a result, GPx4 represents a primary mechanism for protecting the integrity of biological membranes. Not surprisingly, GPx4 has been characterized in tissues and cells of mammals4 and chicken5, yet neither GPx4 activities nor protein levels have been examined in other non-mammalian vertebrates. We hypothesize that GPx4 activity and protein levels are highest in fishes, because they contain significant amounts of highly oxidizable PUFA7.

Livers of vertebrate species were collected from on-going research at MDIBL and Ohio University including Atlantic hagfish (Myxine glutinosa), sea lamprey (Petromyzon marinus), dogfish shark (Squalus acanthias), killifish (Fundulus heteroclitus), longhorn sculpin (Myoxocephalus octodecemspinosus), red-spotted newt (Notophthalmus viridescens), and mouse (Mus musculus). Livers were homogenized 10% (w/v) in Chelex-treated PBS with 0.3% Triton-X 100 (pH 7.5). Subsequently, liver homogenates were centrifuged at 6,600 x g for 10 min (GPx4 activity) or 600 x g for 10 min followed by 100,000 x g for 1 hr (GPx4 protein). GPx4 enzymatic activity was quantified in supernatants using a coupled spectrophotometric method(modified from 3) at 25°C with phosphatidylcholine hydroperoxide as the reaction substrate. GPx4 protein levels were quantified in the cytosolic protein fractions of liver homogenates by immunoblot analysis. Protein fractions were separated by SDS- PAGE and transferred to PVDF membranes that were then probed with Abcam GPx4 polyclonal rabbit antibody (ab16800) in a dilution of 1/1000 followed by incubation with a chemiluminescent secondary (1/3000). Chemiluminescent signal was detected by exposing membranes to film for 2 min, and signal strength was quantified directly from the film by scanning the films with a flatbed scanner and analyzing them using Quantity One software (Biorad). Purified GPx4 was run as a positive control for all GPx4 protein blots.

In all groups basal to mammals, GPx4 activity was greater than or equal to the mammal (p < 0.0001; Fig. 1A), with 9-fold higher activity in killifish (relative to the mouse) being the largest difference measured. Cross-reactivity of the mammalian GPx4 antibody in non-mammalian vertebrates confirmed the presence of GPx4 orthologs in these species. Quantification of GPx4 protein levels indicated that four out of five basal marine vertebrates tested possessed GPx4 levels greater than or equal to the mouse (p < 0.001; Fig. 1B), and again, killifish showed the largest difference (4.5-fold) relative to the mouse. Linear-regression analysis (Fig. 1C) revealed a significant positive relationship between GPx4 activity and GPx4 protein among vertebrates (p < 0.0001).

0.06 0.04 0.06 (A) (B) (C) y = 6.64e-3 + 1.023x R2 = 0.47 p < 0.0001 0.04 0.02 0.04

0.01 7e-3 0.02 0.02 · purified purified · GPx4 protein) GPx4 GPx4 Activity (units/mg protein) GPx4protein)activity (units/mg GPx4 proteinprotein (units/mg

Undetectable 0.00 0.00 0.00 O 0.00 0.01 0.02 0.03 0.04 FH SA A G V O MG NV PM MM M FH S M PM M M N M GPx4 protein (units/!g · purified GPx4 protein) Figure 1. GPx4 activity (A), GPx4 protein (B), and the relationship between GPx4 activity and protein (C) across the vertebrate lineage. Killifish (FH), dogfish shark (SA), Atlantic hagfish (MG), red-spotted newt (NV), sea lamprey (PM), mouse (MM), and longhorn sculpin (MO). Means ± SEM plotted (minimum n = 4 per species). Bars not connected by horizontal lines in 1(A) and 1(B) are significantly different as determined by Tukey post-hoc analysis (p < 0.05).

This report provides evidence that GPx4 orthologs are expressed in vertebrates, basal to mammals. Elevated GPx4 activities and protein levels in the marine fishes tested indicate that these organisms may fortify levels of this enzymatic antioxidant, a condition which is not typical of other antioxidant enzymes (Simonik, Grim, and Crockett, unpublished). It seems reasonable that the high PUFA content in marine vertebrate livers plays a role in the enhancement of GPx4 as an antioxidant defense. Future work will quantify and compare lipid composition in the study organisms and examine potential correlates between lipid unsaturation and GPx4.

This work was supported by an Ohio University SEA (SEA-08-39) and MDIBL’s Stan and Judy Fund via Graduate Fellowship (JMG), by MDIBL’s NIEHS Center for Membrane Toxicity Studies (P30 ES003828-20) (ELC), and the Kathryn A. Davis Foundation (HLY).

1. Choudhary, S., W. Zhang, F. Zhou, G.A. Campbell, L.L. Chan, E.B. Thompson and N.H. Ansari. Cellular lipid peroxidation end-products induce apoptosis in human lens epithelial. Free Rad Bio Med. 32:360-369, 2002. 2. Cosgrove, J.P., D.F. Church, and W.A. Pryor. The kinetics of the autoxidation of polyunsaturated fatty acids. Lipids. 22:299-304, 1987. 3. Flohé, L. and A. Günzler. Assays of glutathione peroxidase. Methods Enzym. 105:114-121, 1984. 4. Hirotaka, I. and Y. Nakagawa. Biological significance of phospholipid hydroperoxide glutathione peroxidase (PHGPx, GPx4) in mammalian cells. Free Rad Bio Med. 34:145-169, 2003. 5. Kong, B., K. Hyunggee, and D. Foster. Cloning and expression analysis of chicken phospoholipid-hydroperoxide glutathione peroxidase. Animal Biotech. 14:19-29, 2003. 6. Kühn, H. and A. Borchert. Regulation of enzymatic lipid peroxidation: the interplay of peroxidizing and peroxide reducing enzymes. Free Rad Bio Med. 33:154-172, 2002. 7. Logue, J., A. De Vries, E. Fodor, and A. Cossins. Lipid compositional correlates of the temperature-adaptive interspecific differences in membrane physical structure. J Exp Biol. 203:2105-2115, 2000. 8. Thomas, J.P., M. Maiorino, F. Ursini and A.W. Girotti. Protective action of phospholipid hydroperoxide glutathione peroxidase against membrane-damaging lipid peroxidation. J Biological Chem. 265:454-461, 1990.

Comparative physiology of acid-base balance in Carcinus maenas and Homarus americanus acclimated to low salinity

Liz Simonic1, Ray Henry2, and Mary Kate Worden3 1Ohio University, Athens, OH 45701 2Dept. of Biology, Auburn University, Auburn, AL 36849 3Dept. of Neuroscience, University of Virginia, Charlottesville, VA 22908

Seawater temperature and salinity are environmental parameters that can vary as a function of the season, the winds, the tides, and storms, especially in the near shore, estuarine and intertidal zones. Although Truchot predicted that the lobster H. americanus and the green crab Carcinus maenas should show similar physiological responses to thermal change3 we have observed that lobsters, unlike crabs, are relatively tolerant of large (18 deg C) acute changes in temperature1,2. Furthermore, these two species exhibit different forms of acid-base regulation when exposed to a ten degree increase in water temperature4. To explore how the parameter of salinity (with which temperature often co-varies in nature) might influence the physiological responses of these two species to thermal change we compared the physiology of acid-base balance in crabs and lobsters acclimated to low salinity seawater.

Both lobsters and green crabs were acclimated to seawater at a temperature for 12 deg C and a salinity of 15 ppt for two weeks. Hemolymph levels of pH and CO2 were then measured as a function of an abrupt increase in temperature from 12 deg C to 20 deg C by transfer of animals to another aquarium. Prior to the temperature increase, values for hemolymph pH were very similar in both species whereas total CO2 values in crabs were twice those of lobsters (Table 1). Within the first 15 minutes after the increase in temperature hemolymph pH decreased in both species. Lobster pH values recovered substantially within the 90 minutes and had returned to baseline within 6 hours. In contrast, crab pH values remained relatively acidic for 6 hours and recovered after 24 hours. In lobsters total

CO2 increased over the first 6 hours and remained significantly above baseline at 24 hours. However, in crabs total CO2 decreased progressively over the 24 hour period following temperature change.

Table 1. Hemolymph pH and total CO2 in in H. americanus and Carcinus maenas acclimated for two weeks to 15 ppt (at 12 deg C) seawater and subsequently exposed to 20 deg C for 24 hours. Values are mean +/-SE. (*p<0.05) Lobsters (n=5) Crabs (n=6) 12 deg C 20 deg C 12 deg C 20 deg C

Time (hours) pH Total CO2 (mmol) pH Total CO2 (mmol) 0 7.90 +/- 0.04 7.16 +/- 0.82 7.90 +/- 0.02 14.03 +/- 0.68 0.25 7.59 +/- 0.05* 8.94 +/- 0.65* 7.83 +/- 0.02* 13.62 +/- 0.83 1.5 7.82 +/- 0.01* 11.46 +/- 0.66* 7.68 +/- 0.02* 11.06 +/- 0.56* 6 7.92 +/- 0.02 13.29 +/- 1.49* 7.73 +/- 0.03* 10.84 +/- 0.37* 24 7.92 +/- 0.04 11.5 +/- 1.32* 7.87 +/- 0.03 9.75 +/- 0.77*

In agreement with our earlier findings4, these data suggest that acid-base regulation differs in these two species and that different physiological mechnisms may mediate thermal tolerance in Carcinus and Homarus. However, the differences between results of the present and those obtained previously at normal seawater salinity1,2,4 (32 ppt) suggest that the salinity to which the animals are acclimated affects the physiological response to thermal change. These findings indicate that decapod crustaceans show plasticity in acid-base regulation.

This work was funded by a New Investigator Award from the Mount Desert Island Biological Lab, the Thomas and Kate Jeffress Memorial Trust, the Maine IDeA Network of Biomedical Research Excellence (2-P20-RR016463) and NSF IBN 02-30005.

1. Cassin, J and Worden, MK Acute thermal change rapidly alters acid-base balance in Homarus americanus and Cancer meanas. Bull. Mt. Desert Isl. Biol. Lab. 46:153-155, 2007. 2. Qadri, SA, Camacho, JA, Wang, H, Taylor, JR, Grosell, M and Worden, MK Temperature and acid–base balance in the American lobster Homarus americanus. J. Exp. Biol. 210:1245-1254, 2007. 3. Truchot, JP Regulation of acid-base balance. In: The Biology of Crustacea, vol 5, edited by Mantel, L. New York: Academic Press, 1983, p. 431-457. 4. Young, K, Henry, R, and Worden, MK Comparative physiology of acid-base balance in Carcinus maenas and Homarus americanus. Bull. Mt Desert Isl. Biol. Lab. 47:92-93, 2008

Effect of salinity on fertilization and development of Fundulus heteroclitus embryos

Robert L. Preston1,5, Nina E. Griffin2,5, Elizabeth S. Gary3, Edal P. Fontaine4 and Sirilak Ruensirikul1 1School of Biological Sciences, Illinois State University, Normal, IL 61790, 2 University of Maine at Farmington, Farmington, ME 04938 3 Bowdoin College, Brunswick ME 04011, 4Rockland District High School, Rockland, ME 04841 5Mount Desert Island Biological Laboratory, Salisbury Cove, ME 04672

Euryhaline northern killifish, Fundulus heteroclitus macrolepidotus, spawn in estuaries and are exposed to salinities ranging from full strength seawater (SW) to freshwater (FW). The embryos develop aerially or in shallow water for ~14 days before hatching. Aerial incubation is thought to be advantageous because of the higher concentrations of oxygen available in air as compared to water and aerially incubated embryos tend to have greater viability and hatching success2. However, because of this environmental preference embryos are also exposed to high levels of desiccation stress7,8. Although killifish may prefer areas of intermediate salinity as spawning sites (about 10 ppt SW)9, it is nonetheless likely that the gametes are exposed to water of variable salinity and this could affect fertilization success, and survival until hatching in immersed or aerially incubated embryos. In aerially incubated embryos, flooding with seawater at spring tides after 14 days triggers hatching and it has been suggested that the relatively anoxic seawater is the signal that initiates hatching4. In these experiments we are testing the hypothesis that the salinity of the medium (osmotic stress) affects the viability of killifish eggs and sperm as measured by hatching success in aerially incubated embryos. Further it is predicted that the optimal conditions favoring gamete viability would be SW at about 10 ppt which is nearly isotonic with killifish body fluids5,6.

Killifish were collected from Northeast Creek, Mount Desert Island, ME, and held in aquaria with running natural SW (about 30 ppt). In typical control conditions, eggs and milt were expressed manually into separate vials containing 10 ppt artificial seawater (Instant Ocean; ASW) and then combined. The embryos were placed on filter paper moistened with 10 ppt ASW for aerial incubation at 20˚C1,2 in a closed chamber whose vapor phase was in equilibrium with 10 ppt ASW. Under these conditions the embryos developed normally over 14 days and hatch after flooding with 10 ppt ASW.

Sperm viability experiments: Milt from one male was placed in six wells (1.5 cm diameter), of a 24 well culture dish that were filled with a different salinity ASWs (0, 1, 5, 10, 20, 30 ppt). Four replicates (using four different males) were done for each condition. The sperm were incubated in the ASW media for various times (immediate, 30min, 1 hour, 2 hours, 3 hours). After this incubation period, 10 eggs were added to each well for an additional 30 minute “fertilization period”. The medium was then removed and the wells gently rinsed with 10ppt ASW. Trays were then allowed to incubate aerially at 20˚C for 14 days in a chamber whose humidity was in equilibrium with 10ppt ASW. Embryo viability was monitored throughout this developmental period. After 14 days, wells were flooded with 2ml of 10ppt ASW and hatching success was recorded after 48 hours.

Egg viability experiments: Ten eggs from a large mixed batch expressed from four to twelve females were placed in each of six wells (1.5 cm diameter) of a 24 well culture dish that were each filled with a different salinity ASWs (0, 1, 5, 10, 20, 30ppt). Four replicates were done for each condition. The eggs were incubated in the ASW media for various times (immediate, 30min, 1 hour, 2 hours, 3 hours). After this incubation period, milt (from a batch expressed from four to ten males in a small volume of 10 ppt ASW) was added to each well for an additional 30 minute “fertilization period”. The medium was then removed and the wells gently rinsed with 10ppt ASW. Trays were then allowed to incubate aerially at 20˚C for 14 days in a chamber whose humidity was in equilibrium with 10ppt ASW. Embryo viability was monitored throughout this developmental period. After 14 days, wells were flooded with 2ml of 10ppt ASW and the number of hatchlings was recorded after 48 hours.

Figure 1. Sperm viability as measured by embryo hatching success. Milt was incubated in the ASW media for various times (immediate, 30min, 1 hour, 2 hours, Figure 1 shows the 3 hours) in 24 well culture plates. Ten eggs were added to each well for an results for the sperm additional 30 minute fertilization period and then the medium was removed and the viability experiments. If wells rinsed with 10 ppt ASW. Trays were then incubated aerially at 20˚C for 14 milt was applied days in a chamber. After 14 days, wells were flooded with 10ppt ASW and hatching success was recorded after 48 hours. The data shown are mean number of immediately, without a hatchlings ± S.E. (n = 4). The control shown is sperm without eggs present. The 5 waiting period in media of ppt, 0 time embryos were lost during handling. The lowest values shown (control, various salinities, some 0.5 hrs, 1 hr, etc.) are simply place holders for no hatching. (See text for details) fertilization occurred in salinities ranging from FW (0 ppt) to 20 ppt ASW, with an apparent peak at about 10 ppt. This type of data is inherently variable, the only peak significantly different from the others was the 0 ppt compared with the 1 ppt or 10 ppt medium (t-test, p < 0.05). More importantly, exposure of milt for 30 min or more to the medium of any salinity prior to addition of the Figure 2. Egg viability as measured by embryo hatching success. Ten eggs per well eggs failed to cause were incubated in the ASW media for various times (immediate, 30min, 1 hour, 2 fertilization. These data hours, 3 hours) in 24 well culture plates. Milt was then added to each well for an are consistent with the additional 30 minute fertilization period and then the medium was removed and the observations of Salinas et wells rinsed with 10 ppt ASW. The control had eggs with no milt. Trays were then 3,9 incubated aerially at 20˚C for 14 days in a chamber. After 14 days, wells were al. that showed that F. flooded with 10ppt ASW and hatching success was recorded after 48 hours. The heteroclitus sperm data shown are mean number of hatchlings ± S.E. (n = 4). (See text for details) remained motile for a median time of about 640 seconds in salinities ranging from 5 to 25 ppt. These data also support the notion that group spawning that provides a supply of active sperm and the selection of spawning sites at intermediate salinities in this species favors successful fertilization3,9.

Figure 2 shows the complementary experiment in which killifish eggs were exposed to media of various salinities for various times prior to the addition of milt. These data show that some eggs can tolerate a wide range of salinities ( 0 – 30 ppt ASW) for up to 30 minutes, and perhaps longer and remain viable. The most striking finding is that those eggs maintained in 10 ppt ASW for up to 3 hours may remain fertilizable. The 10 ppt one hour time point had a low hatching rate, which we attribute to technical problems. The optimum time in these experiments was about 30 minutes in which about 70% of the embryos were fertilized and developed to hatching. The capacity of these eggs to remain viable for extended periods of time, helps improve the probability of fertilization success, particularly in light of the likelihood that the availability of viable sperm may be the rate limiting step in the fertilization process.

These data are consistent with our hypothesis that the ASW incubation medium at about 10 ppt which is close to isotonicity with typical killifish body fluid osmolarities5, should be optimal for gamete viability. Although this has been an important assumption for our lab as well as others, it is helpful to have reliable data that supports this fundamental physiological concept.

R. Preston was supported in part by a Research Award from MDIBL and the CMTS program. E. Fontaine was supported by a High School Research Fellowship funded by the Short Term Educational Experience for Research (STEER) program through NIEHS 1-R25-ES016254-01. E. Gary was supported by NSF- REU (DBI-0453391). N. Griffin was supported by NIH Grant 2P20 RR-016463 from the INBRE Program of the National Center for Research Resources.

1. Baldwin, J.L., C.E. Goldsmith, C. W. Petersen, R. L. Preston and G. W. Kidder. Synchronous hatching in Fundulus heteroclitus embryos: Production and properties. Bull. Mount Desert Island Biological Laboratory. 43: 110- 111, 2004. 2. Baldwin, J.L., C. W. Petersen, R. L. Preston and G. W. Kidder. Aerobic and submerged development of embryos of Fundulus heteroclitus. Bull. Mount Desert Island Biological Laboratory. 45: 45-46, 2006. 3. Bradley, M.E., E.M. Maltz, J.M. Childers, M.P. DeBerge, R. L. Preston, G. W. Kidder and C. W. Petersen. The effects of ion concentration on sperm motility in the estuarine fish, Fundulus heteroclitus. Bull. Mount Desert Island Biological Laboratory. 45: 12-14, 2006. 4. DiMichele, L. and M. H. Taylor. The environmental control of hatching in Fundulus heteroclitus. J. Exp. Zool. 214:181-187, 1980. 5. Kidder, G.W. III, Plasma osmolarity in the killifish, Fundulus heteroclitus. Bull. Mount Desert Island Biological Laboratory. 37: 79, 1998. 6. Preston, R. L., R. J. Clifford, A. K. Guy, N. B. Richards, C. W. Petersen and G. W. Kidder, III. 2003. Preliminary studies of salinity adaptation in Fundulus heteroclitus and apparent CFTR mRNA expression in gill tissue and oocytes. Bull. Mount Desert Island Biological Laboratory 42: 68-70, 2003 7. Preston, R. L., A.E. Flowers, B.C. Lahey, S.R. McBride, C. W. Petersen and G. W. Kidder. Measurement of the desiccation of Fundulus heteroclitus embryos in controlled humidities. Bull. Mount Desert Island Biological Laboratory 45: 101-103, 2006. 8. Preston, R. L., B.R. Edwards, P.E. Baumhardt, J. Lantigua, S. Ruensirikul and G.W. Kidder. Desiccation resistance by mid-stage Fundulus heteroclitus embryos. Bull. Mount Desert Island Biological Laboratory 47: 94-96, 2008. 9. Salinas, S., Y. Brandvain, R. Anderson, J. Marty, R. L. Preston, G. W. Kidder III and C. W. Petersen. Reproductive ecology of Fundulus heteroclitus and Fundulus diaphanus in a New England watershed. Bull. Mount Desert Island Biological Laboratory 43: 115-117, 2004.

Axonal sheaths in two reportedly myelinated polychaete nervous systems: Asychis elongata and Capitella sp. I.

Daniel K. Hartline 1,2 and Jennifer H. Kong 1 1Pacific Biosciences Research Center, University of Hawaii at Manoa, Honolulu, HI 96822 2Mt. Desert Island Biological Laboratory, Old Bar Harbor Road, Salisbury Cove, ME 04672

Myelin has evolved independently in three invertebrate groups: copepods (Crustacea), malacostracans (Crustacea) and oligochaetes (Annelida) 2,4. Described over 100 years ago in malacostracans and oligochaetes based on staining and other properties of the sheath, it has since been confirmed in all three groups by electron microscopy. In 1889, Friedländer also described myelin in a capitellid polychaete 1. In a 1948 review, Nicol identified myelinated giant axons in three polychaete families: Maldanidae (“bamboo worms”), Capitellidae and Spionidae 3. To verify these light- microscopic reports, we examined the large axons of the ventral nerve cord (VNC) of specimens from the Maldanidae and Capitellidae using modern transmission electron microscopy (TEM).

Capitella sp. I (Capitellidae), were obtained from a culture maintained by Dr. Elaine Seaver of the Kewalo Marine Laboratory, PBRC, University of Hawaii. Pieces of body wall containing the VNC were fixed overnight at 4ºC in 4% glutaraldehyde in 0.1M sodium cacodylate buffer, pH 7.4, with 0.24M sucrose and 2mM CaCl2. The tissues were then rinsed in 0.1M sodium cacodylate buffer with 0.31M sucrose, postfixed in buffered 1% OsO4 for 1 hour, dehydrated in a graded ethanol series and propylene oxide, and then embedded in LX-112 epoxy resin. After resin polymerization, ultrathin (75- 90 nm) sections were taken, double-stained with uranyl acetate and lead citrate, and photographed in a LEO912 EF transmission electron microscope at 100 kV. Asychis elongata (Maldanidae) were collected from mud flats at Mt. Desert Narrows, Frenchman Bay, Hancock Co., ME. Tissues were fixed using the same protocol; however, after fixation in glutaraldehyde and prior to postfixation in OsO4, the tissues were transferred to 0.2M phosphate buffer (Sorensen’s) and shipped cold to Hawaii.

Figure 1A1 is a light micrograph of a section from the anterior end of the Asychis VNC. In this region, a single dorsal medial giant axon (gax) is present. It is surrounded by a thick sheath consisting of multiple layers of spindle-shaped overlapping cellular profiles. Many sheath cells contained elongate fibrous bodies (possible sources of birefringence) and dark granules ranging upward in size from 6 nm (Fig. 1A2, 3). Adjacent cells were separated by spaces of 13 nm, measured between midpoints of the membranes. An example of partially-overlapping margins of sheath cells, with close apposition between, is shown in Figure 1A3. No extracellular material was noted in the sheath. Adjacent small axons were not ensheathed (Fig. 1A2). While the spacing between sheath cells was narrow and might contribute to insulating properties, there was no evidence of the membrane condensation or attachment structures typical of oligochaete, crustacean or vertebrate myelins.

An optimal fixation protocol for the Capitella VNC was never resolved. Although we adjusted the osmolarity of the fixative, membranes appeared more disordered than those of Asychis (Fig. 1B). Nevertheless, even among the larger axons (ax), we observed no evidence of multilamellar membranous ensheathments resembling the myelin of myelinate groups (Fig. 1B2).

We failed to verify with TEM the occurrence of myelin in axonal sheaths of two genera (Asychis and Capitella) from the same families reported to possess myelin, based on light microscopy (genera Clymenella and Mastobranchus, respectively 1,3). While this calls into question the light microscopic conclusions, possibilities still exist for inter-generic differences in myelination patterns or myelin presence in other regions within the nervous systems of these organisms.

Fig. 1. Micrographs from the ventral nerve cord (VNC) of (A) Asychis elongata and (B) Capitella sp. I. A1, B1. Light micrographs (LM) of cross sections from the anterior VNC. A2, A3 two different TEM magnifications of the portion of sheath bordering the giant axon of A1. B2. Oblique TEM cross-section of two VNC axons in Capitella.

We are grateful to Dr. Elaine Seaver for supplying Capitella; to Dr. Bob Preston for showing us how to locate and identify Asychis; also to the PBRC Biological Electron Microscope Facility, Tina Weatherby and Dr. Caroline Wilson for expertise and training in TEM techniques (supported by NSF grant OCE-0451376 and a grant from the Cades Foundation, Honolulu).

1. Friedländer, B. Über die markhaltigen Nervenfasern und Neurochorde der Crustaceen und Anneliden. Mitt. Zool. Sta. Neapel, 9: 205-265, 1889. 2. Lenz PH, Hartline DK, and Davis AD. The need for speed. I. Fast reactions and myelinated axons in copepods. J. comp. Physiol. A 186: 337-345. 2000. 3 Nicol JAC. The giant axons of annelids. Quart. Rev. Biol. 23: 291-323, 1948. 4. Schweigreiter R, Roots BI, Bandtlow CE, and Gould RM. Understanding myelination through studying its evolution. Int. Rev. Neurobiol. 73: 219-273, 2006.

Water absorption in the spiral intestine of Leucoraja erinacea

Elizabeth K. Richards1, Alyssa Simeone2 and Nicole A. Theodosiou2 1Bowdoin College, Brunswick, ME 04110 2Department of Biological Sciences, Union College, Schenectady, NY 12308

The emergence of aquatic animals onto land 370 million years ago presented immense challenges for adapting to terrestrial life. Life on land required novel mechanisms for the absorption and retention of water. Terrestrial vertebrates retain body water through the kidneys and absorb water through the colon. In contrast, Chondrichthyes do not absorb water from ingested food as they are nearly iso- osmotic with their ocean environment 3. Thus, the development of a water-absorbing colon in the digestive tract was essential for the adaptation of animals to a terrestrial niche. The general aim of my work is to understand the origin of the terrestrial vertebrate colon taking both morphological and genetic approaches.

Previously we characterized the water-absorption potential of the little skate, Leucoraja erinacea, digestive tracts by analyzing the distribution of acid mucins contained in discreet regions along the gut tube 7. The presence of acid mucins in the large intestine of mammals has been linked to the water absorptive property of this organ 4,5,6. We found the concentration of acid mucins in the distal-most region of the little skate spiral intestine at levels comparable to those found in the terrestrial vertebrate colon 7. The presence of acid mucins in the spiral intestine presents the possibility that the posterior region of the spiral intestine may itself be an organ that reabsorbs water that expanded over time to become the terrestrial colon. We have made initial efforts to verify that the distal spiral intestine of L. erinacea has the ability to absorb water.

To determine whether the distal spiral intestine is a region of water absorption, we are taking two approaches. First, molecular tools are used to characterize aquaporin gene and protein expression. This will confirm our previous results that the distal spiral intestine expresses water channel proteins necessary to absorb water. Second, we are developing physiological methods to measure water uptake in the little skate digestive tract. Briefly, the little skate digestive tract is filled with Elasmobranch

Ringer’s solution (in mM, 270 NaCl, 4 KCl, 1 KH2PO4, 8 NaHCO3, 350 Urea, 0.5 Na2SO4, 3

MgCl2·6H2O, 2.5 CaCl2·2H2O, 5 Glucose, 5 HEPES/Tris pH 7.5) to a hydrostatic pressure of 1.0 kPa. The intestinal sac is tied at both ends and incubated for 3 hours in Ringer’s and weighed every 30 minutes. The amount of water absorbed by the intestine is calculated as a decrease in mass per cm of intestine. Similar methods have been used to measure water absorption in the digestive tract of the Japanese eel, Anguilla japonica, and European eel, A. anguilla 1.

For molecular studies, fresh digestive tract tissue was harvested from L. erinacea adult animals. Regions were removed from stomach, proximal and distal spiral intestine, rectal gland and sphincter, and flash frozen for protein or RNA extraction. Total RNA was isolated from each isolated region and single-stranded cDNA was synthesized with qScript cDNA Supermix (Quanta Biosciences) for 5 minutes at 22oC, 30 minutes at 42oC and 5 minutes at 85oC, for later use in amplifying aquaporin family members using degenerative primers. Protein was extracted from the tissues by homogenizing in TG lysis buffer (20 mM HEPES pH 7.2, 1% Triton-X, 10% glycerol, 1 µg/ml aprotinin, 100 µg/ml PMSF, 1 µg/ml pepstatin and 1:100 dilution of phosphatase inhibitor cocktail II) for immunoblot analysis. In addition, tissues from L. erinacea were fixed in 4% paraformaldehyde, dehydrated in an ethanol series and prepared for paraffin embedding. Paraffin was removed from 6 µm sections by washing in xylene and hydrated in an ethanol series to PBS. Sections were blocked in 10% goat serum and stained with a polyclonal antibody against rat AQP4 (Millipore AB2218). AQP4 was detected in the basolateral membrane of the distal spiral intestine epithelium in L. erinacea (Fig. 1). AQP4 has been shown to regulate water permeability of the proximal colon in mice 2. Thus, the expression of AQP4 in the distal spiral intestine is the first indication that this organ has the capacity to absorb water. Further investigation of the initial experiments outlined here will help elucidate the origin of a water uptake organ (colon) in the vertebrate lineage.

Fig. 1. AQP4 is expressed in the distal spiral intestine. (A) AQP4 is localized to the epithelium (arrows) in the distal spiral intestine. (B) Expression of AQP4 is confined to the basolateral epithelium (arrowheads), and is absent from the submucosa. Sm, submucosa, e, epithelium.

We thank David Barnes, Angela Parton and Denry Sato for sharing elasmobranch molecular protocols, and George Kidder and Robert Preston for advice and guidance on physiological studies. NAT was supported by a New Investigator Award.

1. Aoki, M, Kaneko, T, Katoh, F, Hasegawa, S, Tsutsui, N and Katsumi, A. Intestinal water absorption through aquaporin 1 expressed in the apical membrane of mucosal epithelial cells in seawater-adapted Japanese eel. J of Exp Biol 206:3495-3505, 2003. 2. Matsuzaki, T, Tajika, Y, Ablimit, A, Aoki, T, Hagiwara, H and Takatam, K. Aquaporins in the digestive system. Med Electron Microsc 37:71-80, 2004. 3. Randall, D, Burgren, W and French, K. Eckert Animal Physiology: Mechanisms and Adaptations. New York: W. H. Freeman and Company. 1997. 4. Reifel, CW and Travill, AA. Structure and carbohydrate histochemistry of the intestine in ten teleostean species. J Morphology 162(3):343-360, 1979. 5. Roberts, D, Smith, D, Goff, D and Tabin, C. Epithelial-mesenchymal signaling during the regionalization of the chick gut. Development 125:2791-2801, 1998. 6. Roussel, P and Delmotte, P. The Diversity of Epithelial Secreted Mucins. Current Organic Chemistry 8:431-437, 2004. 7. Theodosiou, NA, Hall, D and Jowdry, A. Comparison of acid mucin goblet cell distribution and hox13 expression patterns in the developing vertebrate digestive tract. J Exp Zool (Mol Dev Evol) 308B:442-453, 2007.

Arterial blood gases at depth in the spiny dogfish (Squalus acanthias)

Erik R. Swenson1, Randy Eveland1, Tim Freeman1, and Susanna Stone2 1Department of Medicine, University of Washington, Seattle, WA 98108 2Bates College, Lewiston, ME 04240

Ventilation, branchial blood flow, gas exchange, and acid-base status have only been measured in fish at or near the surface. Yet arterial blood gases taken at the surface may not adequately assess gas exchange and acid-base status at depths where fish normally reside. The critical differences between surface and deep waters relevant to arterial oxygenation are barometric pressure and oxygen content. The former rises predictably with depth at a constant rate of one atmosphere pressure (ATA) every 33 feet or 10 meters. Oxygen content is greatest at the surface due to wave action and diffusion of oxygen from the atmosphere. However, depending upon mixing by vertical turnover and tidal currents, and photosynthetic and oxidative metabolism by algae and plankton, oxygen content may vary considerably and unpredictably over both depth and time in any locale. The rise in pressure with increasing depth will, in the absence of total oxygen content differences, lead to higher partial pressure of oxygen (PO2) in proportion to the change in barometric pressure. Countering this rise in PO2 with increasing depth will be the effect of the variable decreasing oxygen content. Thus arterial oxygenation of fish in their normal environmental niche may range from hyperoxic to hypoxic. Both extremes are dangerous; the former leading to radical oxygen tissue damage, and the latter to failure of normal aerobic metabolism and energy production. For some fish the range of recorded depths extend from shallow water to more than 1000 meters, as has been documented for the spiny dogfish, Squalus acanthias 3. Most fish have left-shifted hemoglobin oxygen dissociation curves, a characteristic typical of terrestrial mammals and birds that are native to high altitude. This adaptive strategy aids in oxygen uptake by blood in the face of a lower partial pressure driving gradient. The spiny dogfish has 4 a P50 (PO2 at 50 % hemoglobin oxygen saturation) of roughly 17 mmHg , a value typical of many high altitude terrestrial creatures 5, suggesting that these fish and others may spend considerable time in more hypoxic waters. The assumption that oxygenation status at the surface is representative of free swimming fish and thus appropriate and normal for physiological studies may be highly problematic.

We have made the first measurements of arterial blood gases at depth in the shark to explore this question. We placed an arterial catheter via percutaneous cannulation of dorsal artery as previously described in four 2.5 kg male dogfish 2. Individual fish were then transferred to a small plexiglass box and the catheter led out to a multiple sampling port mounted on the box. The fish was taken out into Frenchman Bay and lowered into the water along a weighted line attached to the boat. A diver with scuba gear descended with the fish stopping first at 66 feet for 10 minutes then ascended to 33 feet and waited 10 minutes. At each depth a 2-ml arterial blood sample was collected with a heparinized syringe and an ambient seawater sample was also collected. Temperature and water O2 content were measured at 50 feet by a submersible oxygen and temperature probe (Yellow Springs Instruments, Yellow Springs, OH). Upon surfacing the blood samples were placed on ice, returned to the lab, and within 20-30 minutes arterial PO2 and pH were measured in a blood gas analyzer (Cameron Instruments, Port Aransas, TX) whose electrodes (Microelectrodes, Berlin, NH) were maintained and calibrated at 14 degrees C. PCO2 was calculated from the total CO2 content of plasma using the Henderson-Hasselbalch equation. We previously tested the gas tightness of our syringes to undergo a 5 ATA change and a thirty minute delay in measurement and found that human blood equilibrated at 5 ATA room air in a hyperbaric chamber measured 721 + 24 mmHg (n = 3) against a predicted value of 750 mmHg when measured at 1 ATA outside the chamber.

Table 1 lists arterial PO2 values at three depths in relation to the ambient water PO2. At a depth down to 66 feet (3 ATA), which was the lowest depth to which we could dive owing to turbulent water deeper in the bay at the dive site, there is a modest but statistically significant fall in arterial P02 from that measured at the surface (p < 0.01) . The values are corrected for the fall in water temperature from 14 at the surface to 12 degrees C at 66 feet. Over this depth range elasmobranch hemoglobin however would remain 100% saturated. There was no statistically significant change in PCO2 (2-3 mmHg) or pH (7.67-7.75). Thus, it appears that the effect of increasing pressure on the PO2 of water and arterial blood is more than offset by the reduction in O2 content of respired water at least as a fish descends to 3 ATA. As this pressure change only represents a small fraction of the depth and pressure range of dogfish, it remains unknown how far arterial oxygenation might fall further or indeed possibly rise (and how acid-base status would change) from what is measured at the surface and shallow waters. Although it would be possible for a diver using conventional scuba gear to descend to depths as low as 160 feet (~ 6 ATA) to continue this work in a similar fashion, definitive studies will require use of intravascular electrodes capable of transmitting data to remote recorders or to recording devices carried by the fish in a manner already utilized in the study of diving birds and mammals 1.

Table 1: Ambient water and arterial oxygen partial pressures for the dogfish shark at various depths Depth (feet) 0 33 66 ------

Seawater PO2 161 + 11 141 + 8 129 + 10 (mmHg)

Arterial PO2 124 + 11 109 + 9 98 + 8 ------Values are mean + SD, n = 4

This study was supported by a MDIBL New Investigator Award to ERS funded by the NIEHS Center for Membrane Toxicity Studies to MDIBL (P30-ES03828).

1. Ponganis, PJ, Stockard, TK, Meir, JU, Williams, CL, Ponganis, KV and Howard, R. Returning on empty:

extreme blood O2 depletion underlies dive capacity of emperor penguins. J Exp Biol. 210:4279-4285, 2007. 2. Swenson, ER and Maren, TH. Roles of gill and red cell carbonic anhydrase in elasmobranch HCO3- and CO2 excretion. Am J Physiol. 253:R450-458, 1987. 3. Treberg, JR and Driedzic, WR. Elevated levels of trimethylamine oxide in deep-sea fish: evidence for synthesis and intertissue physiological importance. J Exp Zool. 293:39-45, 2002. 4. Wells, RM and Weber, RE. Oxygenation properties and phosphorylated metabolic intermediates in blood and erythrocytes of the dogfish, Squalus acanthias..J Exp Biol. 103:95-108, 2003. 5. Winslow, RM. The role of hemoglobin oxygen affinity in oxygen transport at high altitude. Respir Physiol Neurobiol. 158:121-127, 2007. Environmental stress and red blood cell sickling in cold-water marine fishes

EnEvinrvionIonermon eHuntmntealnt svonaltr set sHerbingrse anss dan rde , d rKaitlyn ebdlood blood cSche lcl esroederlilc ksilcikn gl,i nanding ci nJenniferol cdol-wdat-w eSamfordatr emrar miarn ei nfies hfiessh. es. BiologicalIoneI oneSciences Hunt Hunt von Department,von He Hrbierngbi ng, K University,a Kitlaynitl ynSc hrS ofcoehr Northdeoerde , ar ndTexas,, a ndJenni J eDenton,nniferf Sera mS TXafmorf d.76203o r d. BiolBogiiologicalc Sacl iSecncieencs Dese Dpaerpatmretmnte, ntU,ni Uvenirvesitrys iotyf Nofo Nrthor Tthe xaTesxa, Ds,e Dnteon,nton, TX T 76203X 76203 The phenomenon of hemoglobin (Hb) polymerization/sickling in the red blood cells of cold-water marine The Tfishes hephe phenom hasnome nonbeenenon of previously ofhe mheoglmoglobi identifiedobin (nH b)(H b)pol1 , polymbutyme ritsize arphysiologicalitzion/ation/sicklsicingkli ng incharacteristics tihen t hered r ebldood bl oodand ce l climportancese lofls ofcol cdol-wd a-towte ar ter fishma mr physiologyineari nefis hefisshe ha s and sha bes survivaleben eprn eprvi eou isvi soul stillys liyde largelyintdeifntieidf i1e unknown., dbut1, but its iphysts Thisphysiol ogii studyologicalc ca sethal c rha outacrtae cr toitse tri samplicssti casnd ea ndi andm porim testportanc ta theenc teo to occurrencefishfi sphysh physi olofogyi oltheogy afrequencynd a ndsur sviurva vioflva Hbisl i sspolymerization/sicklingt ilsl tillal rgelarlgey luny knowunknown. n.T in hiT sthehi sst udyredstudy bloodse t seoutt cellsout to tundersoa msaplm econditionspl aend a ndte ste ofsthet t he environmentaloccocurcrurencreenc ofe stressofthe t hefr e (hypoxiafquerequencync of yand ofH b lowH polb polympH)yme rofizear iastzioa n/tmanyiosn/icklsi cimarinengkli ngin it nhefish t here dspecies,r ebld oodblood cfrome lclse l undelass undemanyr crondi cdifferentonditionstions of of coldenvie-nviwaterronmronm eenvironmentsnteantl satlr esstrse s(hypoxis (andhypoxi oceanica aand a ndl owzone low pHs pH)as o )possible.f oafs ams amny aPrevious nym amrineari neevidencefis hfi sshpe scpe iofecs i, Hbefsr,om fpolymerizationrom as ams amnya nydi f difwasefrfeent re nt observedcolcdol-wda- wte inar t e rednvir e nvir cellonmronm freshentesnt a snd from a ndoc eoc whitinganieacni zcone z (oneMerlanguss as apos sposibl ss merlanguseibl. Pe.r ePvireousvi, ous ae vi related edevincdeenc speciesofe ofHb H pol b to polym Atlanticymerizearitzi ona cod),ti onwa ws as caughtobsobserve ewithrdve id nhook irne dr eandcde lcl elineflrle sf2rh.e sEffectsfhr omfrom w of hiw tipHhingti ngon(M RBCs(eMrlanguserlangus were m estudiedmrlanguserlangus by, a , exposing rae lareteladt es dfreshpe scpeie csredi etso cellstAo tlAa nttotlai cntsa iclinecod c)od , ), valuescaughtcaught from wi twh 6.9 ihookth tohook 7.9and a in ndli nesealed li ne2. 2E . microcentrifugef fEecfftes cofts ofpH pH on on RtubesB RCBs Catws e 15wree °srC.teudi sAftertudied eby deach byexpos eexperiment,xposingi ngfre fsrhe s rcellshed r ecde were lclse ltlos fixedstoa lsinea li ne inva 4%lvaue lsgluteraldehydeue frsom from 6.9 6. to9 7.to 9 for7. in9 furthersinea sleadl emanalysisdi cmrocicreocnt anderntifuger icountingfuge tube tusbe a atts 15 athet °15C University.° CA.f tAerf tear ce hofa ce hxpeNorth experim rTexas.eimnte, ntce, lclPreliminaryse lwlse wree friex feid x ed resultsin 4%in 4% showedglut gleutrae lthatderalhydede fishes,hyde for f whichorfur fturhet rheexhibited anar alnaysliyss aHbisnd a ndpolymerization/sicklingcou cntouingnti ngat tahet t heUni Uvenirves inhabititrys iofty ofN aor Nwidetorh tTh e rangexaTesxa. P sof.r eP lmarineirmelinamirnay ry environmentsresrulestsul sthos swho e including,wd ethad ttha fits hef is theshe, w s Arctic,,hi wchih cehxhi borealexhibitebid t andeHdb H pol temperateb polymymerize ar marineitzion/ation/sic kls environmentsicingkli nginha inhabit bia t andw ai dew rangedi derange range of in ofm deptha mrinea ri ne fromenvie nvirtheonmr onmcoastalentesnt i ncsto i lnctheudiludi ng,peng,lagic the t he Azones. rcAtircc, t iAborc, combinationboreale alnd a ndtem t eofpem rinpeat ersitua tme alightmrineari -nemicroscopy,envi environrmonemnt estransmissionnt asnd a ndra ngeranged electronidn iden ptdeh pt h microscopyfromfrom the t hec (TEM)oa csoatals ta totechniquesl ttohe t hepe lpea gi(Fig.lacgi zcone 1)zone sdetermined. s .A Acom combi thatnabitnai onredti on ofblood of i n icellsni tus iwholetluight light--mmounts-icmrosicrcosopy, ofcopy, 13 tr aofnstr amthensism s33iionss i on specieseleeclteronc t ofr onm marinei cmrosicrcoso py teleostsco py(T E(TM E sampled,)M te)c thniechnique sickledques (Fs i(g.F or i1)g. formed1)de tdeermte rine polymersmidne thad ttha r et ofd r e bld Hbood bl ood tetramers ce lcl ewllhol w whenhole-me-ountm exposedounts ofs of13 to 13of of environmentalthet he33 33spe scpeiecs istresseofs ofma mr (hypoxiaineari netel eteos le andtoss st as or msa pl lowmepld, e pH)sd,ic klsi ce (Huntkld eord or for von fmor em Herbingd epold polymym e etrs e al.,ofrs ofH unpub.b H tebt rtae mtr data).aemrse wr sh w Ofenh ee thenxpo e xpo 13sed s ed speciesto teonvi e nvir inonm r whichonmentea ntl hemoglobinsatlr esstrse s(hypoxis (hypoxi polymerized,a aand a ndor orlow 100%low pH pH) ( ofH) unt( theHunt von red von H bloode Hrbierng bi cells nget ae becamelt. ,a lu.,npub. unpub. crystallized da tdaa).t a )O. f O whenthef t he13 13 exposedspescpeiecs ie environmentalins iwn hiwchih cheh mhe oglm stress.oglobiobin Datapoln polym providedymerizeerid,ze d, 100 by 100 % purification %of ofthe t here dr aendbld ood bl subsequentood ce lclse lbels cbe polymerizationamcaem cer yscrtysalltiazlel id ofz ew d the hewn he n hemoglobinexposexposed eednvi e extractednvironmronment eant froml astlr es st wholerse. sDs. aDt a blooda tpra ovipr ovide showeddde byd by pur that purif ici theafitcion at polymerization/sicklingi onand a ndsubs subsequeequent ntpol polym ym iser ize anarit ziona intrinsicti onof ofthe t he propertyhemheoglmogl obiofobi nthe en xt hemoglobin,erxtacrtaecdt efdr omfr omnot w holdependentwhole ble oodblood onsho theswho esurroundingwd etdha ttha tthe t he polintracellular polymymerizearitzi on/amatrixtion/sicskli ciand,ngkli ng islikely iasn a inoccursnt rintinsrins c ic underpropepr opeconditionsrtyr tofy ofthe t hehethat mhe oglaremoglobi foundobin, notn, in not vivo.de pedende peProposedndent nton ont hemodels t hesur sruroundi ofroundi Atlanticng ngint ri ntacodcreal clHbulelalul rconstructed amr amtriaxtr iaxnd, a bynd, li kehomology lilkey locy cocurc sur s modelingundeunder condir ofcondi thetionst iprimaryons tha ttha art e Hba frounde sequencefound in viinvo vifound.vo Pr. oposP thatropose dat em dleastode model sthree ofls ofA aminot lAanttlaicnt acidcicod c od Hsubstitutionsb H cbons constructrtuce havedt ebyd byhomoccurred homoloolgy o gy inm theomdeo l Hbdeingl i ng betaof ofthe chainst hepr iprm aim (Huntrya rHyb H vonsbe ques e Herbing,quencenc founde found Unpub. tha ttha a tt Data) laeta lset a.t shr Twot tehre ea e ofm ai nom thesei noac i ad substitutionsc sidubs substituttiitonsut ions result ha veha ve inoc c extraourccrured r ed cysteinesin itnhe t heH b thatH beb t maybea tcaha inducecihansi ns(H unt( polymerizationHunt von von H eHrbierng,bi byng, U forming npub.Unpub. D interchainaDtaa).t aT).w Tow disulphideofo ofthe tshee sseubs bonds.substituttiit onsut Theseions re sr disulphideulest ulint ienxt er xta ra bondscysctyse imayneteisne tservehas ttha mt anamy aantioxidantiynduc induce pole polym roleymer iinzear itthezionat i protectiononby byfor fmoringm againsti ngint eintrc ereactivehracihna idin s diuloxygensphiulphide despecies,bonds bonds. T often.he Tshee sproduceddie sdiulsphiulphide de duringbondsbonds amerobica my asye rmetabolismsveer vean aannt aioxint inioxida environmentsntda rntol reol ine tihen tcharacterized hepr otpreotcteioncti onaga by aigans fluctitns retuatinga rcetaivecti veoxygenvironmental oxygen esnp escpiecs conditionsi, eofs, tofent eprn oducpr3. oduced ed dur duringi ngae raobierobic mce mtaeboltabolismis imn einnvi environmronmentesnt chas crhaacrtaecritzeeridz ebyd byfluc fltucuattuaingti ngenvi environmronmenteantl caondil conditionstions 3. 3. FiguFrige u1r.e ( 1a). (TaE) MTE oMf osifl v seirl vheark hea (kMe e(rMcleurcccluiucsc ibuisli bnielainreisa)r is) Figure 1. (a) TEM of silver hake (Mercluccius bilinearis) red cell red rceedl lc sehllo swhionwg iHngb Hpobl ypmoleyrmizeartiizoant iionn t hine tchyet ocpyltaospmla.s Smc.a Slec ale showing Hb polymerization in the cytoplasm. Scale bar = 2 µm bar b=a r2 =µ m2 m (b) TEM of longhornµ sculpin (Myoxocephalus octodecemspinosus) (b) TEM of longhorn sculpin (Myoxocephalus red ce(llb )showing TEM of no lo Hbngh polymerization.orn sculpin (My oScalexocep barhal u=s 2 µm! octoodcetocdemecsepminsopsinuos)s ures)d rceedl lc sehllo swhionwg inog Hnob Hpobl ypmoleyrmizeartiizoant ion (a)(a)( a) (b) ( b ) ( b) ScaSlec ablaer b=a r2 µ=m 2µ m

FundiFundingFunding ngwa wasws prasovi providedprovidedde byd bybya 2008 aa 20082008 M DMDIBLMIBDLIB NLe NewNwe Iwnv InvestigatorIenvstiegastitgaort Aorw AwardAawrda ardnd anda ndfrom fromfrom the thet heUS USDAUDSAD-NA-a-NationalNtionaational l ResearchResReeasrecah Initiativer cInih Itiniattiivea tCompetitivei veCom Competpeititvei tGranti veGr aGnt rno.a nont .2003no 2003. 2003-35206-35-20635-2061364-13643-136433 to to IHvH ItHo vHIH vH RefRereefnecrens:c es: 1 1 1 . HHarosi,a rHosair,o Fs.i ,F., HF.u ,Hunt nHt uvnotn vonv Hone rHHerbing,bienrgb,i nIg., , aI n.I.,,d a Vnandda nV KVanane uKr aeKeuran,nu,r aJn. ,S Jic. k SJ.liicn kSicklinggl ionfg a onfo axofnico anoxicxreicd rbeldo redobdlo cobloodedl lcse..l.l scells...B..i.o Bloigo ilBiologicalcoagli cBaul lBleutil nlBulletin,e, t1in9,5 1: 955- :1195: 51-. 11 . (195(91-811.9)9. 8 (1998).). 2 2 2 . KoKoldjaer,lKdjoaledrj,a Per. ,a PP.n.d a andBnde rB eBerenbrink,nebrerninbkr,i nMk,. MIn . M.v Iinv ovIn irv evivood rbeld ored obdlo cobloodedl lc seilc lcell ksliicnk gsicklingl ianngd a mnde candmheacn hmechanismisamni somf r oefc ore vofceor yvrecovery eirny w inh iwti hninigt iMwnghitinge rMlaenrgl aMerlangusunsg us mermerlangusmlaenrglaunsg. uJos..u JournalJronualr noafl E ofoxf pExperimentalEexripmereinmtaeln Btailo BiologyBloigoylo 2g1y 0 210,2, 1304, 5 3451314-5314--63460.304. 6(200. (2007)(0270)0 7) 3 3 3R.e iRsReischl,cehisl,c Ehl., DE a.E. fDr eaDafre fAre.L A.,. LFA.L.,r.,a nFcr aoFranco,n, cJo.L, .J .aLn .d J.L.a Fnidl hFandoi,l hDo .Filho,,W D.. WDi. s D.W.Dtribsturti ibDistribution,ount,i oand,a apdtaatpiota nadaptationt iaonnd a pnhdy pshi oandylsoigo ilphysiologicalcoagli cmael amneinagn ion meaningfg tohfio tlhsi ofr loofs mf rthiols om verfromtveebrrtae tbvertebrateer ahteem hoegmlo hemoglobins.bgilnosb.i nCso. mCpoamr apComparativetairvaet iBveio Bchioecm hBiocheiesmtryis tarnymistryd a Pnhdy P sandhioylso iPhysiology,goylo, gPya,r Pt Car t1 C4Part6 1, 42 62C,- 25146,23- (523 220 (02-7053)0. 7 (2007).).

Hepatobiliary transport of manganese in the little skate, Leucoraja erinacea

Michael S. Madejczyk1, James L. Boyer2 and Ned Ballatori1 1Dept. of Environmental Medicine, Univ. of Rochester School of Medicine, Rochester, NY 14642 2Dept. of Medicine and Liver Center, Yale Univ. School of Medicine, New Haven, CT 06520

Manganese (Mn) is an essential trace metal that is utilized by nearly all forms of life 1. However, when exposed to excess Mn, this metal can be toxic. Exposures to high levels of Mn can produce severe neurological damage, which manifests as a Parkinsonian-like disease known as manganism, and may also play a role in the development of Idiopathic Parkinson’s Disease itself 7. In addition, high Mn levels has been associated with fatigue due to liver cholestasis 5, and has recently been described in a new metabolic disorder with clinical features consisting of hypermanganesaemia, liver cirrhosis, an extrapyrimidal motor disorder and polycythaemia 13. Mn toxicity only appears when the homeostatic mechanisms that maintain optimal Mn levels are overwhelmed, impaired, or somehow bypassed. The liver is the major organ responsible for maintaining proper Mn levels in the body. In the liver, excess Mn is removed from the circulation and is excreted into the bile, the body’s main route for Mn elimination. Both free and protein bound Mn are efficiently taken up in the liver, although, the protein or proteins that are responsible for this uptake are not well defined.

In the present studies, Mn transport was characterized in isolated perfused livers and isolated primary hepatocytes from the skate Leucoraja erinacea. Livers from the skate express evolutionarily primitive forms of many of the same transporters as human livers, are relatively large and easy to handle during surgery, and can be easily maintained in a perfusion system with minimal reagents due to their lower metabolic rate and temperature requirements. Skate hepatocyte primary cultures are also known to maintain their polarity in culture, and are relatively easy to isolate and culture.

Our initial studies examined the biliary excretion of radiolabeled MnCl2 in the isolated perfused 10-11 54 skate liver. Male skate livers were isolated and perfused as previously described . MnCl2 was added to the recirculating perfusate at concentrations ranging from tracer (i.e., essentially carrier free) to 1 mM, with an activity of 1 µCi per 100 ml of perfusate. Bile was collected into tared tubes at 60- minute intervals. The 54Mn content of perfusate and bile was determined by liquid scintillation counting. The results demonstrate that Mn was efficiently removed from the recirculating perfusate, but that only a small fraction of the Mn removed by the skate liver was excreted into bile over a 6-h period 8. Of significance, the percent of the dose excreted into bile increased up to a perfusate concentration of 1 µM, and then declined at higher concentrations, suggesting that biliary Mn transport is saturable 8.

In addition to the liver perfusions, uptake and efflux of radiolabeled MnCl2 was characterized in 12 54 isolated skate hepatocytes. Skate hepatocytes were isolated as previously described . MnCl2 was added to the cell suspensions at different concentrations, and in the presence or absence of 200 µM cobalt. Samples (300 µl) were taken at the indicated times and the cells spun down. Cell pellets and supernatant were analyzed by liquid scintillation counting to determine 54Mn content. For the efflux 54 experiments, hepatocytes were loaded with Mn by incubation in 50 µM radiolabeled MnCl2 for 1.5-2 hours. Samples were processed as described above.

Previous analysis of the time-course of uptake demonstrated that Mn was quickly taken up by the hepatocytes in culture, with uptake approaching a steady state in about 15 minutes, supporting observations made in the isolated perfused skate livers 9. The addition of 200 µM cobalt was also able to nearly completely inhibit Mn uptake in this experiment. Initial rates of Mn uptake were inhibited by all divalent metals tested, but not by Cs, a monovalent cation (Figure 1). This is consistent with the hypothesis that a divalent cation transporter is at least partially responsible for Mn uptake into hepatocytes. Concentration dependence analysis revealed a saturable, and potential two-component carrier-mediated uptake system (apparent Km values of approximately 1.1 ± 0.1 µM and 112 ± 29 µM; data not shown). No statistically significant effect on Mn uptake was observed when Mg alone, or Ca and Mg, were removed from the Ringers solution 9. In contrast, Mn uptake was reduced by nearly half when bicarbonate was removed, suggesting that bicarbonate is somehow required for uptake; however, this is not due to a pH effect 9. Incubation in elasmobranch Ringers in which Li or K replaced Na had no significant effect on Mn uptake, indicating that a Na-dependent or membrane potential-sensitive transport process does not mediate uptake 9.

Figure 2. Partial inhibition of Mn efflux by 2,4- 54 Figure 1. Inhibition of manganese uptake by divalent dinitrophenol in isolated skate hepatocytes. MnCl2 54 metals in isolated skate hepatocytes. MnCl2 was added was preloaded into isolated hepatocytes for 1.5-2 at a concentration of 0.1 µM in the presence or absence of hours. Cells were washed and resuspended in fresh 10 µM metals in normal elasmobranch Ringer solution for elasmobranch Ringers in the presence (square) or 1 minute. Values are means ± SE, n=4. * p < 0.05. absence (triangle) of 500 µM 2,4-DNP. Values are means ± SE, n=3-4. * p < 0.05.

In the effux experiments, Mn was quickly released from the cells, which reached a steady state at about one hour. Mn efflux was enhanced in the presence of extracellular Co2+ (data not shown). This effect is most likely a result of inhibiting reuptake 10 rather than a stimulation of efflux. The potential ATP requirement for Mn efflux from hepatocytes was examined using 0.5 mM 2,4-dinitrophenol. Treatment with 0.5 mM 2,4-dinitrophenol was previously shown to reduce skate hepatocyte ATP levels to around 40-50% of controls 3. The addition of 0.5 mM 2,4-dinitrophenol (dissolved in DMSO) led to a reduction in Mn efflux, starting at 15 minutes, which was sustained for the duration of the experiment (Figure 2). This suggests that efflux from hepatocytes may be partially due to an ATP- sensitive mechanism.

Overall, these results in the skate are consistent with those seen in both in vivo and in vitro models of mammalian hepatic Mn transport 2,4,6. The results indicate that Mn is efficiently cleared from the sinusoidal circulation of the isolated perfused skate liver, but that only a small amount appears in bile. Skate hepatocyte Mn efflux was inhibited when ATP was depleted via the addition of 2,4-DNP, suggesting that Mn efflux is at least partially ATP- sensitive. However, additional studies are needed to identify and characterize this ATP requirement for Mn efflux, and to establish if this ATP-sensitive transporter is responsible for biliary Mn secretion.

This work was supported by NIH/NIEHS ES03828, ES01247, and ES07026, and NIH/NIDDK DK34989, DK25636, DK48823, and DK067214.

1. Aschner J.L., Aschner M. Nutritional aspects of manganese homeostasis. Mol. Aspects Med. 26:353-362, 2005. 2. Ballatori N., Miles E., Clarkson T.W. Homeostatic control of manganese excretion in the neonatal rat. Am. J. Physiol. 252: R842-R847, 1987. 3. Ballatori N., Truong A.T., Jackson P.S., Strange K., Boyer J.L. ATP depletion and inactivation of an ATP- sensitive taurine channel by classic ion channel blockers. Mol. Pharmacol. 48:472-476, 1995. 4. Finley J.W. Manganese uptake and release by cultured human hepato-carcinoma (Hep-G2) cells. Biol Trace Elem Res. 64:101-118, 1998. 5. Forton D.M., Patel N., Prince M., Oatridge A., Hamilton G., Goldblatt J., Allsop J.M., Hajnal J.V., Thomas H.C., Bassendine M., Jones D.E., Taylor-Robinson S.D. Fatigue and primary biliary cirrhosis: association of globus pallidus magnetisation transfer ratio measurements with fatigue severity and blood manganese levels. Gut 53:587-592, 2004. 6. Klaassen C.D. Biliary excretion of manganese in rats, rabbits, and dogs. Toxicol Appl Pharhacol. 29:458-468, 1974. 7. Martin C.J. Manganese neurotoxicity: Connecting the dots along the continuum of dysfunction. Neurotoxicol 27:347-349, 2006. 8. Madejczyk M.S., Notenboom S., Boyer J.L., and Ballatori N. Liver of the little skate, Leucoraja erinacea, as a model for studying the mechanism of hepatobiliary manganese excretion. Mt Desert Island Biol Lab Bull 46:159- 160, 2007. 9. Madejczyk M.S., Smith V., Boyer J.L., and Ballatori N. Characterization of manganese uptake in isolated hepatocytes of the little skate, Leucoraja erinacea. Mt Desert Island Biol Lab Bull 47:116-117, 2008. 10. Reed, J.S., Smith N.D., Boyer J.L. Hemodynamic effects on oxygen consumption and bile flow in isolated skate liver. Am. J. Physiol. Gastro-intest. Liver Physiol. 242: G313-G318, 1982. 11. Simmons, T.W., Hinchman, C.A., and Ballatori N. Polarity of hepatic glutathione and glutathione S-conjugate efflux, and intraorgan mercapturic acid formation in the skate. Biochem Pharmacol 42: 2221-2228, 1991. 12. Smith, D.J., Grossbard M., Gordon E.R., Boyer J.L. Isolation and characterization of a polarized isolated hepatocyte preparation in the skate (Raja erinacea). J Exp Zool 241:291-296, 1987. 13. Tuschi K., Mills P.B., Parsons H., Malone M., Fowler D., Bitner-Glindzicz M., Clayton P.T. Hepatic cirrhosis, dystonia, polycythaemia and hypermanganesaemia—A new metabolic disorder. J Inherit Metab Dis. 31:151-163, 2008.

Microarray analysis of gene expression changes induced by micromolar zinc in embryos of the sea urchin, Strongylocentrotus purpuratus

Kaylyn Germ1, James A. Coffman2 and Anthony J. Robertson2 1Texas A&M University, Galveston, TX 77553 2Mount Desert Island Biological Laboratory, Salisbury Cove, ME 04672

Normal development of the sea urchin embryo produces a bilaterally symmetric pluteus larva. Differentiation of ectoderm along the secondary (oral-aboral) axis of the embryo is required for patterning of the larval skeleton and nervous system2,3,6. Exposure of embryos to micromolar zinc perturbs ectoderm development, producing radialized larvae with defective skeletal and neuronal patterning. To elucidate the molecular-genetic basis for this teratogenic effect, a CombiMatrix oligonucleotide microarray representing ~6,000 genes5 was interrogated by hybridization with mRNA extracted from blastula stage control and zinc-treated embryos. Following normalization, the data were statistically filtered to identify the genes that were significantly affected by zinc exposure, and this gene set was then profiled bioinformatically to identify affected physiological functions.

Approximately two million sea urchin (S. purpuratus) embryos were cultured using standard procedures. Half of the embryos were exposed to 1 micromolar zinc chloride beginning at early blastula stage (11 hours post-fertilization, hpf). The embryos were harvested at mesenchyme blastula stage (24 hpf), and mRNA from one million (~500 mg) embryos from each culture (untreated control and zinc-treated) was isolated using a two step process (Ambion RNAqueous® followed by Ambion Poly(A) Purist™). Aliquots of purified mRNA were heated to 100º C and labeled directly with biotin using the Kreatech Universal Labeling System (ULS). Following removal of unincorporated label by centrifugation the labeled mRNA was fragmented to 60-200 nucleotide lengths with an Ambion fragmentation kit (Ambion AM8740) following the manufacturer’s protocol.

The labeled mRNA was hybridized to a CombiMatrix microarray containing 12,544 antisense oligonucleotides (35mers) representing approximately 6,000 different genes (i.e., with two different oligonucleotides for each gene). Hybridization conditions (temperature and probe concentrations) were empirically optimized to obtain the highest signal to noise ratio. A total of eight microarray hybridizations were performed: four mRNA samples were from zinc-treated embryos, and four were from control embryos. Following hybridization and washing, the microarrays were incubated with avidin-horseradish peroxidase (HRP), developed in H2O2 substrate, and the resulting HRP-generated electrochemical signals measured using a CombiMatrix ElectraSense™ reader. The hybridization signals for each oligonucleotide were recorded in a desktop computer, and translated into pixel intensities on images representing each microarray.

The first two microarrays were hybridized with one microgram of mRNA at 41.5º and 42.5ºC (trials 1 and 2, respectively). Under these conditions the microarray developed substantial background, so the goal for subsequent trials was to decrease that noise. Trials 3 and 4 (Figure 1) were performed using a modified pre-hybridization and hybridization solution which included a blocking reagent (KREABlock), and less mRNA in the hybridization reaction (0.36 micrograms), resulting in substantial background reduction without the diminishing the signal strength.

Trial 3 Trial 4

Control Zinc Control Zinc

Figure 1: ElectraSense™ microarray images from the third and fourth hybridization trials. Each of two trials consisted of hybridization of mRNA from control embryos followed by stripping of the microarray and hybridization of mRNA from zinc- treated embryos. Each individual spot is the signal from one of the 12,544 oligonucleotides on the microarray. The intensity of the spot is proportional to the relative abundance of hybridized mRNA as measured by the ElectraSense™ reader.

The data from all four trials were compiled into one document and subjected to quantile normalization using Blist software (CombiMatrix Blist version 6.2 Java JVM 1.4.2_07-b05). This type of normalization uses the mean of a given dataset and adjusts the signal intensities in each dataset in order to obtain comparable (i.e., superimposable) distributions1.

After normalization, the data were imported into Microsoft Excel for further analysis. Statistical filters were applied to determine which genes were significantly up- or down- regulated. The first filter was a t-test applied to the difference between the means of a given group over the variance of that given group. The difference in intensity for each microarray signal between control and zinc- treated samples was assigned a significance (P) value based on the t-test. Signal differences with a P value greater than 0.25 were considered insignificant and not analyzed further.

The second statistical filter was based on the average of the control trials and the average of the zinc treated trials, which were calculated for each individual oligonucleotide feature. The average of the signal obtained from zinc-treated samples was then divided by the average of the controls to get an M value, or fold-difference between treatment and control for each signal. M values between .5 and 1.4 were considered insignificant.

By these statistical criteria, the expression of approximately 600 genes was found to be significantly affected by zinc exposure These genes were profiled on g:profiler (http://biit.cs.ut.ee/gprofiler/)4, a web-based software utility that correlates gene names with functional categories (e.g., Gene Ontology or KEGG). Because g:profiler does not yet support S. purpuratus gene names, it was necessary to assign each S. purpuratus gene the name of its closest mouse homolog, and use these to interrogate g:profiler. The resulting analysis suggested that genes that are down-regulated by zinc treatment are predominately related to growth (ribosomal production and protein synthesis), whereas the up-regulated genes tend to function in cofactor transport, metabolism, and central nervous system development.

As an additional test of significance, the microarray signals obtained for the two independent oligonucleotides representing each gene were compared to determine if their M values displayed the same polarity (less than or greater than 1) and were of similar magnitude. Similar M values obtained from two different oligonucleotides representing the same gene provide strong evidence that the measurement represents a real change in gene expression for that respective gene. Several genes, including that encoding the Na/K ATPase, had significant, large and double oligonucleotide changes in expression. These will be the subject of further analysis, beginning with independent confirmation by RT-PCR.

This work was supported by MDIBL REU Fellowship (NSF DBI-0453391) awarded to K.G., and by grants from the NIH (R01 ES016722 to J.A.C., and Pilot Project funding from NIH-NIEHS Center Grant P30 ES003828-20).

1. Bolstad BM, Irizarry RA, Astrand M, and Speed TP. A comparison of normalization methods for high density oligonucleotide array data based on variance and bias. Bioinformatics 19: 185-193, 2003. 2. Di Bernardo M, Castagnetti S, Bellomonte D, Oliveri P, Melfi R, Palla F, and Spinelli G. Spatially restricted expression of PlOtp, a Paracentrotus lividus orthopedia-related homeobox gene, is correlated with oral ectodermal patterning and skeletal morphogenesis in late-cleavage sea urchin embryos. Development 126: 2171-2179., 1999. 3. Hardin J, Coffman JA, Black SD, and McClay DR. Commitment along the dorsoventral axis of the sea urchin embryo is altered in response to NiCl2. Development 116: 671-685, 1992. 4. Reimand J, Kull M, Peterson H, Hansen J, and Vilo J. g:Profiler--a web-based toolset for functional profiling of gene lists from large-scale experiments. Nucleic Acids Res 35: W193-200, 2007. 5. Robertson AJ and Coffman JA. A microarray platform for transcriptome analysis in embryos of the sea urchin, Strongylocentrotus purpuratus. . MDIBL Bulletin 47: 71, 2008. 6. Yaguchi S, Yaguchi J, and Burke RD. Specification of ectoderm restricts the size of the animal plate and patterns neurogenesis in sea urchin embryos. Development 133: 2337-2346, 2006.

Identification of a full-length Abcb11 transporter in Ciona intestinalis

Shi-Ying Cai1, Katherine Han2, Albert Mennone1, H. Rex Gaskins3, and James L. Boyer1 1 The Liver Center, Yale University, New Haven, CT 06520 2Cheshire High School, Cheshire, CT 06410 3 Inst. for Genomic Biology, University of Illinois, Urbana, IL 61801

The ATP binding cassette (ABC) transporter member B11 (ABCB11, also known as the bile salt export pump (BSEP) in vertebrates, plays an important role in maintaining bile salt homeostasis by transporting bile salts from the hepatocyte to the canalicular lumen. Mutational deficiencies of ABCB11 in man result in various cholestatic liver diseases, including progressive familial intrahepatic cholestasis type II (PFIC-II), benign recurrent intrahepatic cholestasis 2 (BRIC-2), and intrahepatic cholestasis of pregnancy (ICP)4,7. Polymorphisms in ABCB11 have also been identified6, but it is not known if these variants are functionally important. Thus questions remain as to the main functional determinants of ABCB11. Because structural studies of ABC transporters have been limited due to technical challenges in crystallizing multiple trans-membrane proteins, a comparative genomic approach remains a potentially powerful tool to understand structure/function relationships of these transporters.

We have previously characterized an Abcb11 from a marine primitive vertebrate, the little skate (Leukoraja erinacea), and found that most human disease mutations are in regions conserved with the skate sequence. Mutations in selected residues from the skate gene impair ABCB11/Abcb11 stability and/or trafficking3. Of note, the human and skate gene share about 68% identity.

The sea squirt Ciona intestinalis (hereafter, Ciona) is a member of the chordate clade Urochordata (tunicates), and is believed to be the closest extant invertebrate relative of vertebrates5. Genome annotation suggests the presence of an Abcb11 gene in Ciona1. The predicted partial sequence of this gene shares ! 55% identity in amino acid sequence to the human ortholog, whereas human ABCB11 and multidrug resistant p-glycoprotein 1 (ABCB1) share ! 50% identity. However, Ciona does not have a liver, and it is not known if this organism contains bile salts or bile salt analogs. Preliminary studies indicate that the Abcb11 mRNA is expressed in the branchial sac and gastrointestinal tract of Ciona, but the full-length sequence of this gene and its anatomical location remain to be determined2.

To identify the full-length sequence of Abcb11 from Ciona, we designed six pairs of primers based on the annotated genome sequence. Most of these primers target the predicted consensus regions in ABCB11/Abcb11. However, for the 5' and 3' untranslated regions, extra primers were designed that cover different portions of the genome. After reverse transcription of mRNA from the Ciona gastrointestinal tract, four fragments were amplified by PCR that were presumed to cover the entire coding region and some of the 5' and 3' untranslated sequences. These fragments were subsequently cloned into a pCR2 vector and sequenced. A 4.3 kb sequence was found to encode 1395 amino acid residues and represents the entire coding region for the Ciona Abcb11 gene. This gene product is slightly larger than ABCB11/Abcb11 in human (1321AA) and skate (1348AA), respectively. The computer program (http://www.enzim.hu/hmmtop/server/hmmtop.cgi) predicts 12 transmembrane domains in Ciona Abcb11 with 2 N-glycosylation sites in the first outside loop, similar to ABCB11/Abcb11 in human, rodents and skate. Sequence alignment indicates that Ciona and human share 52% identity at the amino acid level. The additional sequences in Ciona are located right before the first and the seventh transmembrane domains. Phylogenetic analysis indicates that Ciona Abcb11 is the most primitive member in the ABCB11 subfamily (Figure 1). When the human and Ciona sequences were aligned, 50/53 missense mutations identified in severe BSEP deficiency patients8 (including PFIC2 and BRIC2) were conserved in the Ciona Abcb11. Among the three non-conserved mutants, two of them were substituted only conservatively. Intriguingly, 2 ICP mutations and all polymorphism variants were not conserved.

Figure 1. Phylogenetic analysis of ABCB/Abcb transporters, including Ciona Abcb11.

To examine the tissue localization of Ciona Abcb11, we used a C219 monoclonal antibody. This antibody is directed to a VQXALD sequence that is present in most members of ABCB family. Ciona Abcb11 contains a sequence of VQDALD in its C-terminal region. Immunofluorescent staining demonstrated a strong positive signal in epithelial cells of the branchial sac (Figure 2), whereas the staining of gastrointestinal tract was inconclusive due to the quality of the tissue. These findings indicate that Abcb11 expression may be restricted to epithelial cells lining the brachial sac where it might function as a defense barrier to toxicants in the aqueous environment.

Figure 2. Immunofluoresent staining of Ciona branchial sac using C219 antibody suggests Abcb11 may be localized in the epithelial cells. A, phase contrast; B, C219 staining; C, TO-PRO-3 staining of nuclei. Bar = 10!m.

In summary, we have identified a full-length Abcb11 gene from the sea squirt, Ciona intestinalis and determined its tissue localization. Future functional characterization of Ciona Abcb11 should provide insights into the structural determinants of the ABCB11 in humans. These studies were supported by National Institutes of Health Grants DK34989, DK25636, and the NIEHS Center for Membrane Toxicity Studies (ES03828).

1. Annilo T, Chen ZQ, Shulenin S, Costantino J, Thomas L, Lou H, Stefanov S and Dean M. Evolution of the vertebrate ABC gene family: analysis of gene birth and death. Genomics 88: 1-11, 2006. 2. Cai SY, Nava GM, Gaskins HR, Boyer JL. Identification of ABC transporters and nuclear receptors in Ciona intestinalis. The Bulletin, MDIBL 47:75-77, 2008. 3. Cai SY, Wang L, Ballatori N, Boyer JL. Bile salt export pump is highly conserved during vertebrate evolution and its expression is inhibited by PFIC type II mutations. Am J Physiol Gastrointest Liver Physiol. 281:G316-22, 2001. 4. Cavestro GM, Frulloni L, Cerati E, Ribeiro LA, Corrente V, Sianesi M, Franzè A, Di Mario F. Progressive familial intrahepatic cholestasis. Acta Biomed 73:53-6, 2002. 5. Dehal P, Satou Y, Campbell RK, Chapman J, Degnan B, De Tomaso A, Davidson B, Di Gregorio A, Gelpke M, Goodstein DM, Harafuji N, Hastings KE, Ho I, Hotta K, Huang W, Kawashima T, Lemaire P, Martinez D, Meinertzhagen IA, Necula S, Nonaka M, Putnam N, Rash S, Saiga H, Satake M, Terry A, Yamada L, Wang HG, Awazu S, Azumi K, Boore J, Branno M, Chin-Bow S, DeSantis R, Doyle S, Francino P, Keys DN, Haga S, Hayashi H, Hino K, Imai KS, Inaba K, Kano S, Kobayashi K, Kobayashi M, Lee BI, Makabe KW, Manohar C, Matassi G, Medina M, Mochizuki Y, Mount S, Morishita T, Miura S, Nakayama A, Nishizaka S, Nomoto H, Ohta F, Oishi K, Rigoutsos I, Sano M, Sasaki A, Sasakura Y, Shoguchi E, Shin-i T, Spagnuolo A, Stainier D, Suzuki MM, Tassy O, Takatori N, Tokuoka M, Yagi K, Yoshizaki F, Wada S, Zhang C, Hyatt PD, Larimer F, Detter C, Doggett N, Glavina T, Hawkins T, Richardson P, Lucas S, Kohara Y, Levine M, Satoh N and Rokhsar DS. The draft genome of Ciona intestinalis: insights into chordate and vertebrate origins. Science 298: 2157-2167, 2002. 6. Lang T, Haberl M, Jung D, Drescher A, Schlagenhaufer R, Keil A, Mornhinweg E, Stieger B, Kullak-Ublick GA, Kerb R. Genetic variability, haplotype structures, and ethnic diversity of hepatic transporters MDR3 (ABCB4) and bile salt export pump (ABCB11). Drug Metab Dispos 34:1582-99, 2006. 7. Strautnieks SS, Bull LN, Knisely AS, Kocoshis SA, Dahl N, Arnell H, Sokal E, Dahan K, Childs S, Ling V, Tanner MS, Kagalwalla AF, Németh A, Pawlowska J, Baker A, Mieli-Vergani G, Freimer NB, Gardiner RM, Thompson RJ. A gene encoding a liver-specific ABC transporter is mutated in progressive familial intrahepatic cholestasis. Nat Genet 20:233-8, 1998. 8. Strautnieks SS, Byrne JA, Pawlikowska L, Cebecauerová D, Rayner A, Dutton L, Meier Y, Antoniou A, Stieger B, Arnell H, Ozçay F, Al-Hussaini HF, Bassas AF, Verkade HJ, Fischler B, Németh A, Kotalová R, Shneider BL, Cielecka-Kuszyk J, McClean P, Whitington PF, Sokal E, Jirsa M, Wali SH, Jankowska I, Paw!owska J, Mieli- Vergani G, Knisely AS, Bull LN, Thompson RJ. Severe bile salt export pump deficiency: 82 different ABCB11 mutations in 109 families. Gastroenterology 134:1203-14, 2008.

Aryl hydrocarbon receptor-dependent regulation of the ABC transporters in kidney tubules from killifish (Fundulus heteroclitus)

Anne Mahringer1,2, Amy Seymour2, David S. Miller2,3, and Gert Fricker1,2 1Institute of Pharmacy and Molecular Biotechnology, University of Heidelberg, 69120 Heidelberg, Germany 2Mount Desert Island Biological Laboratory, Salsbury Cove, ME 04672 3 Laboratory of Pharmacology, NIH/National Institute of Environmental Health Sciences, Research Triangle Park, NC 27709

Humans are increasingly exposed to environmental pollutants from herbicides, plastic materials, adhesives or toxic food contaminants from charbroiled meat or cigarette smoke. Halogenated and polycyclic aromatic hydrocarbons are classical ligands of the aryl hydrocarbon (Ah) receptor, which plays a pivotal role in the induction of xenobiotic metabolizing enzymes, like cytochrome 1a1, 1a2 and 1b1, and hence, enhances protective detoxification mechanisms. However, involvement of the Ah receptor in regulation of the efflux transporter expression, e.g., Breast Cancer Resistance Protein (BCRP), Multidrug Resistance Protein 2 (MRP2) and Pglycoprotein (P-gp), is still not clear. These transporters are highly expressed in barrier and excretory tissues, such as, intestine, liver, blood-brain barrier and renal proximal tubule and are responsible for the excretion of potentially toxic xenobiotics.

Previous studies showed that killifish (Fundulus heteroclitus) renal proximal tubules express luminal membrane transporters that are functionally and immunologically analogous to the mammalian export proteins1,2. Here, we show for the first time the Ah receptor-dependent regulation of BCRP, MRP2 and P-gp function and protein expression in kidney tubules from killifish. Incubation of freshly isolated intact tubules for 3h with 0.5!M "-naphthoflavone (BNF), a typical Ah receptor agonist, resulted in an increased efflux transport of the fluorescent substrates mitoxantrone (for BCRP), fluorescein-methotrexate (for MRP2) and NBD-Cyclosporine A (for P-gp). BNF also increased transporter protein expression, as determined by quantitative analysis of immunostainings. These effects were reversed by the Ah receptor antagonist resveratrol. BNF did not stimulate Oat-mediated transport of fluorescein. The insecticide, 2,4’-DDT (2,4’-dichloro-diphenylchlorethane), also induced ABC transporter function. This effect was abolished by incubation with resveratrol indicating action through the Ah receptor.

The present report is the first to demonstrate upregulation of multiple ABC transporters (activity and expression) in renal proximal tubule. Finally, it remains to be determined whether Ah receptor acts through direct interactions with the promoter regions of the transporter genes or whether these effects are indirect, perhaps involving another nuclear receptor. If action is indeed direct then we would want to know whether PKA, MAPK, JNK or ERK might be involved in Ah receptor-dependent signalling.

Funded by: Boehringer Ingelheim Funds, DFG grants GF1211/14-1, and NIH-grant MDIBL-CMTS (ES 03828).

1. Reichel V, Masereeuw R, van den Heuvel JJ, Miller DS, Fricker G. Transport of a fluorescent cAMP analog in teleost proximal tubules. Am J Physiol 2007, 293:R2382-2389. 2. Terlouw SA, Graeff C, Smeets PH, Fricker G, Russel FG, Masereeuw R, Miller DS. Short- and long-term influences of heavy metals on anionic drug efflux from renal proximal tubule. J Pharmacol Exp Ther. 2002, 301:578- 85. Perturbation of defense pathways by low-dose arsenic exposure in zebrafish (Danio rerio) embryos

Carolyn J. Mattingly1, Thomas H. Hampton2, Kimberly M. Brothers3, Nina E. Griffin1, and Antonio Planchart1 1Mount Desert Island Biological Laboratory, Salisbury Cove, ME 04672, USA; 2Center for Environmental Health Sciences, Dartmouth Medical School, Hanover, NH 03755, USA; 3University of Maine, Graduate School of Biomedical Sciences, Orono, ME 04469, USA

Exposure to chemicals is a critical risk factor in the complex interplay between genetics, the environment and human disease. Arsenic represents a major global environmental health threat, is a known carcinogen and is estimated to affect over 500 million people in India and Bangladesh and more than 100,000 individuals in New England (U.S. Geological Survey) via drinking water9. Although the United States Environmental Protection Agency (US EPA) recently lowered the maximum allowable exposure limits in drinking water from 50 parts-per billion (ppb) to 10 ppb (US EPA 2006), the mechanisms of arsenic action and the effects of low-level exposures on fetal development and disease susceptibility are virtually unknown. Increasing evidence suggests that arsenic may impact important biological processes by altering expression of gene networks during development.

Adverse developmental consequences of exposure to low levels of arsenic in humans are largely unknown despite the potential for in utero exposure worldwide and results from studies suggesting that there is cause for concern. Mouse studies demonstrated that arsenic can affect placental vasculogenesis and increase the rate of spontaneous abortions2,7, cause epigenetic modifications that interfere with gene expression in mice transplacentally exposed13, induce neural tube defects, cause axial skeletal abnormalities and reduce mean fetal weight without evidence of maternal toxicity8. In addition, there is a growing body of evidence that immune the response is significantly compromised by low levels of arsenic and likely reflects functional disruption of critical genes and networks but details are lacking1,3,12,13. This study aimed to identify genes and networks targeted by low levels of arsenic during vertebrate embryonic development using zebrafish (Danio rerio) as a model organism.

Microarray analysis was used to assess the global transcriptional response to low levels of arsenic during zebrafish development. Briefly, zebrafish embryos were procured from the zebrafish facility at the University of Maine-Orono and exposed in triplicate (n=50 each) to control conditions (water), 10 3+ parts-per-billion (ppb) or 100 ppb sodium meta arsenite (NaAsO2; As ; Fluka) from 1-48 hours post- fertilization. Sodium meta arsenite was chosen because arsenite (As3+) is the prevalent form of toxic arsenic found in drinking water10. RNA was isolated and sent to the Affymetrix Core Facility of the Oregon Health and Sciences University (Portland, OR) wherein microarray analyses were performed in triplicate on a fee-for service basis. A statistical process similar to the one reported in Gosse et. al.6 was implemented and yielded 99 genes that were hierarchically clustered.

These genes were analyzed using Ingenuity Pathway Analysis software (IPA; Ingenuity Systems, Inc.), which predicted a highly significant gene network (p < 10-41) containing 19 of the 99 genes identified as arsenic-responsive by microarray analysis and several “bridging” genes inserted by the software to combine smaller networks (Figure 1). This network was significantly associated with immune response, cancer and gastrointestinal disease (p ! 0.02). Genes within this network are involved in specific immune functions such as complement activation (p ! 2.8E-06), migration of immune response cells (e.g., monocytes, macrophages; p < 9.2E-03) and respiratory burst (p < 1.2E- 02). IPA results were corroborated by a gene ontology enrichment analysis, which determined that the immune response biological process (GO:0006955) was the most significantly overrepresented (p < 1 0.05) process among the 99 genes. Curated arsenic-gene interactions in CTD also corroborated microarray and IPA results, supporting arsenic interactions and enrichment with immune functions4,5.

Quantitative reverse-transcriptase polymerase chain reaction was used to validate an arsenic response for 10 of the genes in this network - six were derived from the microarray study (C3, Fn1, Foxo5, Notch1a, Notch1b and Plg); two were derived from the microarray study and corroborated by CTD (Ass1, Pik3r1), and two were bridging genes inserted by IPA and corroborated by CTD (Akt2, Nfkb2).

Figure 1: Arsenic-responsive genes identified by microarray analysis function in a common gene network involved in immune response. Genes identified from microarray analysis and corroborated by CTD are circled; bridging genes inserted by IPA and corroborated by CTD are boxed.

3+ As seen in figure 2, the genes selected for this analysis were down-.regulated by As . Remarkably, this gene set exhibited a more robust and significant response to the lowest levels of As3+ (10 ppb) when compared to responses to 10-fold higher levels of As3+ (9/11 genes vs. 6/11). In addition, only 4 of the 11 genes tested showed similar responses to As3+ at both concentrations—Fn1, Notch1a, Notch1b and Pik3r1. Only one gene, Plg, had no expression change in control versus treated embryos.

Figure 2: QPCR validation of arsenic-mediated down-regulation of genes identified by microarray and pathway analysis. Asterisks identify statistically significant results (p ! 0.05). Black bars, 10 ppb; grey bars, 100 ppb; all others, 0 ppb. Error bars are SEM.

This study demonstrates that arsenic significantly down-regulates expression levels of multiple genes potentially critical for regulating the establishment of an immune response. These data also provide molecular evidence consistent with phenotypic observations reported in other model systems. Additional mechanistic studies will help explain molecular events regulating early stages of the immune system and long-term consequences of arsenic-mediated perturbation of this system during development.

This research was supported by NIH grants P30ES003828 (AP), P20RR-016463 from the Maine INBRE Program of NCRR (AP, CJM, NG) and P42ES007373 (THH). This work would not have been possible without the generosity of Drs. C. Henry and C. Kim who provided us with ad libitum access to the University of Maine—Orono Zebrafish Core Facility.

Nota bene: Since the submission of this abstract, an expanded version was accepted for publication and is in press in the journal Environmental Health Perspectives. For more details, Google doi:10.1289/ehp.0900555.

1. Aggarwal M, Naraharisetti SB, Dandapat S, Degen GH, and Malik JK. Perturbations in immune responses induced by concurrent subchronic exposure to arsenic and endosulfan. Toxicology 251: 51-60, 2008. 2. Andrew AS, Burgess JL, Meza MM, Demidenko E, Waugh MG, Hamilton JW, and Karagas MR. Arsenic exposure is associated with decreased DNA repair in vitro and in individuals exposed to drinking water arsenic. Environ Health Perspect 114: 1193-1198, 2006. 3. Andrew AS, Jewell DA, Mason RA, Whitfield ML, Moore JH, and Karagas MR. Drinking-water arsenic exposure modulates gene expression in human lymphocytes from a u.S. Population. Environ Health Perspect 116: 524-531, 2008. 4. Davis AP, Murphy CG, Rosenstein MC, Wiegers TC, and Mattingly CJ. The comparative toxicogenomics database facilitates identification and understanding of chemical-gene-disease associations: Arsenic as a case study. BMC Med Genomics 1: 48, 2008. 5. Davis AP, Murphy CG, Saraceni-Richards CA, Rosenstein MC, Wiegers TC, and Mattingly CJ. Comparative toxicogenomics database: A knowledgebase and discovery tool for chemical-gene-disease networks. Nucleic Acids Res 37: D786-792, 2009.

3 6. Gosse JA, Hampton TH, Davey JC, and Hamilton JW. A new approach to analysis and interpretation of toxicogenomic gene expression data and its importance in examining biological responses to low, environmentally-relevant doses of toxicants. In: Toxicogenomics: A powerful good for toxicity assessment, edited by Sahu SC: John Wiley & Sons Ltd., 2008, p. 27-57. 7. He W, Greenwell RJ, Brooks DM, Calderon-Garciduenas L, Beall HD, and Coffin JD. Arsenic exposure in pregnant mice disrupts placental vasculogenesis and causes spontaneous abortion. Toxicol Sci 99: 244-253, 2007. 8. Hill DS, Wlodarczyk BJ, and Finnell RH. Reproductive consequences of oral arsenate exposure during pregnancy in a mouse model. Birth Defects Res B Dev Reprod Toxicol 83: 40-47, 2008. 9. Mead MN. Arsenic: In search of an antidote to a global poison. Environ Health Perspect 113: A378-386, 2005. 10. National Research Council. Arsenic the drinking water. Washington (DC): National Academy Press; 1999. pp.1-310. 11. Nayak AS, Lage CR, and Kim CH. Effects of low concentrations of arsenic on the innate immune system of the zebrafish (danio rerio). Toxicol Sci 98: 118-124, 2007. 12. Xie Y, Liu J, Benbrahim-Tallaa L, Ward JM, Logsdon D, Diwan BA, and Waalkes MP. Aberrant DNA methylation and gene expression in livers of newborn mice transplacentally exposed to a hepatocarcinogenic dose of inorganic arsenic. Toxicology 236: 7-15, 2007. 13. Yu X, Robinson JF, Gribble E, Hong SW, Sidhu JS, and Faustman EM. Gene expression profiling analysis reveals arsenic-induced cell cycle arrest and apoptosis in p53-proficient and p53-deficient cells through differential gene pathways. Toxicol Appl Pharmacol 233: 389-403, 2008.

4 Identification of a novel target of 2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD) involved in Zebrafish (Danio rerio) craniofacial development

Antonio Planchart1, Thomas Hampton2 and Carolyn J. Mattingly1 1Mount Desert Island Biological Laboratory, Salisbury Cove, ME 2Dartmouth College, Hanover, NH

The etiology of many birth defects involves interactions between environmental factors and genes that modulate important physiological processes. Identification of the gene and protein targets of environmental chemicals is critical to predicting and preventing their toxic consequences. The environmental contaminant 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) is found ubiquitously in the environment and is a known carcinogen and teratogen. TCDD also induces hepatotoxic and reproductive toxicity responses in laboratory animals. Studies in evolutionarily divergent organisms showed that embryonic exposure to TCDD results in severe craniofacial abnormalities, suggesting a conserved mechanism regulating development of these structures that is disrupted by TCDD. Exposure to TCDD has been associated with cleft palate in humans and mice 1,3-5,8, beak malformations representative of severe cleft palate in chicken 10, and significant malformation of jaw precursors, particularly Meckel’s and palatoquadrate cartilage in zebrafish 9. This study used zebrafish (Danio rerio) as a model organism to identify a novel target of TCDD that is involved in jaw development

TCDD mediates its toxic effects via the aryl hydrocarbon receptor (AHR). Upon ligand binding, AHR dimerizes with the Aryl hydrocarbon receptor nuclear translocator and translocates to the nucleus where it regulates gene expression by binding to enhancer elements referred to as AHREs. Although AHR is important in a number of developmental processes. For example, inactivation of Ahr in mice results in severe immunological impairment, hepatic fibrosis, cardiotoxicity and perinatal lethality in 50% of affected mice 6. However, the mechanism by which TCDD-activated AHR leads to craniofacial abnormalities is unknown 2,9. This study aimed to identify targets of TCDD that mediate exposure- related craniofacial defects.

The effect of TCDD exposure on embryo survival was determined by conducting a dose-response experiment. Embryos were exposed in triplicate (n = 40) from one to 24 hours post-fertilization (hpf) to increasing concentrations of TCDD (0, 0.1, 1, 10, 100 and 1000 nM). By 7 days post-fertilization (dpf), 100% of embryos exposed to 10-1000 nM TCDD died. Embryos exposed to 1 nM survived until 11 dpf. TCDD produced craniofacial abnormalities and edema in all post-hatch embryos .

Microarray studies were conducted to identify genes that were differentially expressed in response to TCDD. Embryos (n=50) were exposed in duplicate to either vehicle control (0.1% DMSO) or 1 nM TCDD for one to 24 hpf. RNA was purified at 24 hpf and sent to a microarray facility at the University of Wisconsin-Madison where labeling, hybridization and processing of an Agilent zebrafish array was performed. Microarray analysis identified a set of 70 differentially expressed genes with an average fold-change ! |2|. Notably, a member of the forkhead box family of genes was induced 16-fold by TCDD and is involved in jaw development in mice 7. Alcian blue staining of zebrafish fry indicated that TCDD disrupts development of jaw structures within the mandibular and hyoid arches, structures that are regulated, at least in part, by this novel TCDD target.

Quantitative RT-PCR confirmed TCDD-mediated upregulation of this Fox gene. QPCR was also used to evaluate a baseline pattern of expression for this Fox gene during the first 48 hpf. Expression was detected at most of the 14 time points evaluated, peaking at 17.5 hpf and 48 hpf (Fig. 1). These data identify and characterize an entirely novel target of TCDD may mediate exposure-related craniofacial defects.

Further characterization of TCDD- mediated perturbation of this gene is underway. Specifically, induction of this Fox gene is being assessed by QPCR and in situ hybridization in control vs. TCDD-exposed embryos over a timecourse from 1-36 hpf. Injecting morpholinos designed to knock down its expression will help to clarify the role of this gene in jaw development.

Figure 1. Temporal expression pattern of a zebrafish Fox gene. Semi-quantitative PCR was performed on cDNA at different stages of development. Fox gene expression was normalized to glyceraldehyde-3-phosphate dehydrogenase. Expression levels are in arbitrary units.

This research was supported by NIH grants P30ES003828 (CJM), P20RR-016463 from the Maine INBRE Program of NCRR (AP, CJM) and P42ES007373 (THH). We thank Dr. C. Henry, C. Kim and the University of Maine—Orono Zebrafish Core Facility for their generosity.

1. Abbott, BD and Birnbaum, LS. Tcdd alters medial epithelial cell differentiation during palatogenesis. Toxicol Appl Pharmacol 99: 276-286, 1989. 2. Abbott, BD, Schmid, JE, Brown, JG, Wood, CR, White, RD, Buckalew, AR, and Held, GA. Rt-pcr quantification of ahr, arnt, gr, and cyp1a1 mrna in craniofacial tissues of embryonic mice exposed to 2,3,7,8-tetrachlorodibenzo-p- dioxin and hydrocortisone. Toxicol Sci 47: 76-85, 1999. 3. Bertazzi, A, Pesatori, AC, Consonni, D, Tironi, A, Landi, MT, and Zocchetti, C. Cancer incidence in a population accidentally exposed to 2,3,7,8-tetrachlorodibenzo-para-dioxin. Epidemiology 4: 398-406, 1993. 4. Bertazzi, PA, Consonni, D, Bachetti, S, Rubagotti, M, Baccarelli, A, Zocchetti, C, and Pesatori, AC. Health effects of dioxin exposure: A 20-year mortality study. Am J Epidemiol 153: 1031-1044, 2001. 5. Courtney, KD and Moore, JA. Teratology studies with 2,4,5-trichlorophenoxyacetic acid and 2,3,7,8- tetrachlorodibenzo-p-dioxin. Toxicol Appl Pharmacol 20, 1971. 6. Fernandez-Salguero, P, Pineau, T, Hilbert, DM, McPhail, T, Lee, SS, Kimura, S, Nebert, DW, Rudikoff, S, Ward, JM, and Gonzalez, FJ. Immune system impairment and hepatic fibrosis in mice lacking the dioxin-binding ah receptor. Science (New York, NY 268: 722-726, 1995. 7. Goering, W, Adham, IM, Psche, B, Manner, J, Ochs, M, EEngel, W, Zoll, B. Impairment of gastric acid secretion and increase of embryonic lethality in Foxq1-deficient mice. Cytogenet Genome Res 121;88-95, 2008. 8. Mimura, J, Yamashita, K, Nakamura, K, Morita, M, Takagi, TN, Nakao, K, Ema, M, Sogawa, K, Yasuda, M, Katsuki, M, and Fujii-Kuriyama, Y. Loss of teratogenic response to 2,3,7,8-tetrachlorodibenzo-p-dioxin (tcdd) in mice lacking the ah (dioxin) receptor. Genes Cells 2: 645-654, 1997. 9. Xiong, KM, Peterson, RE, and Heideman, W. Aryl hydrocarbon receptor-mediated down-regulation of sox9b causes jaw malformation in zebrafish embryos. Mol Pharmacol 74: 1544-1553, 2008. 10. Yeager, RL, Oleske, DA, Millsap, DS, and Henshel, DS. Severe craniofacial malformations resulting from developmental exposure to dioxin. Reprod Toxicol 22: 811-812, 2006.

Comparative Toxicogenomics Database (CTD): a knowledgebase and discovery tool for chemical-gene-disease networks

Allan Peter Davis, Cynthia G. Murphy, Cynthia A. Saraceni-Richards, Michael C. Rosenstein, Thomas C. Wiegers, and Carolyn J. Mattingly

The Mount Desert Island Biological Laboratory, Salisbury Cove, Maine 04672

Environmental agents are postulated to play a critical role in the etiology of many human diseases1, 2, 5, 11. To promote understanding about the impact of environmental chemicals on human health, we developed the Comparative Toxicogenomics Database (CTD; http://ctd.mdibl.org)4. CTD is a publicly available resource that presents integrated and manually curated data describing the complex interactions between chemicals, genes/proteins, and human diseases (Fig. 1). Currently CTD contains over 147,000 manually curated interactions involving more than 4,300 chemicals and 15,000 genes from 271 species and more than 7,400 gene-disease and 4,000 chemical-disease relationships. CTD also integrates additional data for: over 59,000 chemicals and 6,000 human diseases; Gene Ontology (GO) annotations; KEGG pathway data; and taxonomic information. Together these data provide insight into the mechanisms of chemical actions and provide a basis for developing novel hypotheses about the etiologies of environmental diseases3, 6, 8.

Several other valuable databases exist that include varying degrees of chemical, gene and disease data9. Some examples include PharmGKB7, ChemBank12, Chemical Effects in Biological Systems (CEBS)14, ArrayExpress10, Gene Expression Omnibus (GEO)15, PubChem15, and Reactome13. CTD is distinct from these databases in several ways: a) it focuses on environmental chemicals; b) it integrates curated and robust external data that allow users to explore complex connections between chemicals, genes, and diseases; c) curated data in CTD is captured manually by expert Scientific Curators; and d) it is more than just a repository for information as it also functions as a powerful tool for generating novel hypotheses about environmental diseases and chemical actions.

Figure 1. CTD manually curates chemical-gene/protein interactions and chemical- and gene-disease relationships from the published literature. These data are integrated so that users may develop hypotheses about the relationships between these entities and the etiologies underlying environmental diseases.

CTD continues to evolve to meet the needs of the research community. Major modifications to the database and its public access since our last report include: • Substantial additions to the manually curated data set in CTD; • Updates to data query and presentation options (e.g., searching by directionality of interactions); • Integration of pathways from the Kyoto Encyclopedia of Genes and Genomes (KEGG) database; • Integration of links to CTD from external databases (e.g., PubChem, DrugBank); • Development of a frequently asked questions site to orient new users; • Development of a “Tools” section of the CTD website that includes the following features/functions: a) VennViewer - compare associated data sets for up to three chemicals, genes or diseases; b) Batch Query - download data associated with a list of chemicals, diseases or genes; and c) Data download - download large curated data sets for further analysis.

Future development of CTD will further expand the depth of curated data and enhance data query and visualization capabilities. Specifically, text-mining tools are being developed to increase the efficiency of manual data curation and expand the scope of data in CTD. Additional tools will be developed and incorporated to allow for more sophisticated analysis and interpretation of the data. For example, several “profiler” tools will be developed to allow users to identify chemicals or genes with similar profiles of associated data sets (e.g., chemicals with similar target genes or diseases with similar associated genes) and a variant of the VennViewer tool that will allow users to compare their high throughput data sets of genes or proteins to manually curated data sets in CTD. CTD will continue to be freely available and the community is encouraged to contact us with comments and suggestions so that we may continue to enhance its value.

This project was supported by NIH grant R01 ES014065 from the National Institute of Environmental Health Sciences and P20 RR-016463 from the INBRE program of the National Center for Research Resources.

1. Brody JG, Moysich KB, Humblet O, Attfield KR, Beehler GP, and Rudel RA. Environmental pollutants and breast cancer: Epidemiologic studies. Cancer 109: 2667-2711, 2007. 2. Clavel J. Progress in the epidemiological understanding of gene-environment interactions in major diseases: Cancer. C R Biol 330: 306-317, 2007. 3. Davis AP, Murphy CG, Rosenstein MC, Wiegers TC, and Mattingly CJ. The comparative toxicogenomics database facilitates identification and understanding of chemical-gene-disease associations: Arsenic as a case study. BMC Med Genomics 1: 48, 2008. 4. Davis AP, Murphy CG, Saraceni-Richards CA, Rosenstein MC, Wiegers TC, and Mattingly CJ. Comparative toxicogenomics database: A knowledgebase and discovery tool for chemical-gene-disease networks. Nucleic Acids Res 37: D786-792, 2009. 5. Dolinoy DC and Jirtle RL. Environmental epigenomics in human health and disease. Environ Mol Mutagen 49: 4-8, 2008. 6. Gohlke J, Thomas R, Zhang Y, Rosenstein MD, Davis AP, Murphy C, Mattingly CJ, Becker KG, and Portier CJ. The genetic and environmental pathways to complex diseases. Submitted., 2008. 7. Klein TE and Altman RB. Pharmgkb: The pharmacogenetics and pharmacogenomics knowledge base. Pharmacogenomics J 4: 1, 2004. 8. Mattingly C, Hampton T, Brothers K, Griffin NE, and Planchart A. Perturbation of defense pathways by low-dose arsenic exposure in zebrafish embryos. Environ Health Perspect Submitted., 2009. 9. Mattingly CJ. Chemical databases for environmental health and clinical research. Toxicol Lett, 2008. 10. Parkinson H, Kapushesky M, Shojatalab M, Abeygunawardena N, Coulson R, Farne A, Holloway E, Kolesnykov N, Lilja P, Lukk M, Mani R, Rayner T, Sharma A, William E, Sarkans U, and Brazma A. Arrayexpress--a public database of microarray experiments and gene expression profiles. Nucleic Acids Res 35: D747- 750, 2007. 11. Schwartz D and Collins F. Medicine. Environmental biology and human disease. Science 316: 695-696, 2007. 12. Seiler KP, George GA, Happ MP, Bodycombe NE, Carrinski HA, Norton S, Brudz S, Sullivan JP, Muhlich J, Serrano M, Ferraiolo P, Tolliday NJ, Schreiber SL, and Clemons PA. Chembank: A small-molecule screening and cheminformatics resource database. Nucleic Acids Res 36: D351-359, 2008. 13. Vastrik I, D'Eustachio P, Schmidt E, Joshi-Tope G, Gopinath G, Croft D, de Bono B, Gillespie M, Jassal B, Lewis S, Matthews L, Wu G, Birney E, and Stein L. Reactome: A knowledge base of biologic pathways and processes. Genome Biol 8: R39, 2007. 14. Waters M, Stasiewicz S, Merrick BA, Tomer K, Bushel P, Paules R, Stegman N, Nehls G, Yost KJ, Johnson CH, Gustafson SF, Xirasagar S, Xiao N, Huang CC, Boyer P, Chan DD, Pan Q, Gong H, Taylor J, Choi D, Rashid A, Ahmed A, Howle R, Selkirk J, Tennant R, and Fostel J. Cebs--chemical effects in biological systems: A public data repository integrating study design and toxicity data with microarray and proteomics data. Nucleic Acids Res 36: D892- 900, 2008. 15. Wheeler DL, Barrett T, Benson DA, Bryant SH, Canese K, Chetvernin V, Church DM, Dicuccio M, Edgar R, Maglott DR, Miller V, Ostell J, Pruitt KD, Schuler GD, Shumway M, Sequeira E, Sherry ST, Sirotkin K, Souvorov A, Starchenko G, Tatusov RL, Tatusova TA, Wagner L, and Yaschenko E. Database resources of the national center for biotechnology information. Nucleic Acids Res 36: D13-21, 2008.

Confirmation of Computationally Inferred Putative Functional Elements

Clare Bates Congdon1, Junes Thete1, Rachael Teo2, Carolyn Mattingly3, Gerardo M. Nava4, and H. Rex Gaskins4 1Department of Computer Science, University of Southern Maine, Portland ME 04104 2Department of Computer Science, University of British Columbia, Vancouver, BC Canada V6T 1Z4 3Mount Desert Island Biological Laboratory, Salisbury Cove, ME 04672 4University of Illinois at Urbana-Champaign, Urbana, IL 61801

Computational tools for the inference of putative regulatory elements are an essential method for learning about regulatory regions in non-coding sequence, as they are able to expediently sift through a sea of possibilities to identify specific compelling elements for benchwork. In previous work1,2, we developed GAMI, an approach to motif inference using a genetic algorithms search. Specifically, we are looking for putative conserved regulatory regions in noncoding sequence; studies suggest that comparative analysis of evolutionarily diverse organisms will help to predict functionally important noncoding regions3. We have been working with several genes studied by MDIBL researchers, including the cystic fibrosis transmembrane conductance regulator (CFTR) and genes relating to glutathione homeostasis, and have demonstrated that GAMI is an effective tool for searching large data sets (long sequence lengths and many sequences) of divergent species.

In the past year, there have been increasing verification and documentation of transcription factor binding sites (TFBS) in the TRANSFAC database3 for many of the genes we have been studying, allowing us to further assess GAMI’s ability to identify actual functional elements. For example, we have curated 4 kb from the upstream region for the glutamate-cysteine ligase catalytic subunit (GCLC), an environmentally responsive gene, for 12 divergent species spanning from human to Ciona intestinalis. In this data, GAMI identified the motif GCTGAGTCAC as a putative functional element that is 93.3% conserved across the 12 species. New comparisons of GAMI results to TRANSFAC found that this element corresponds exactly to the core region of the ARE4 element in humans (TRANSFAC identifier HS$GCLC_08; accession number R22708), which binds to the Nrf2 and small Maf transcription factors. Figure 1 illustrates the motif found.

Fig. 1. Example of the TFBS found by GAMI in the upstream region of the GCLC gene that binds to the Nrf2 and small Maf transcription factors in humans.

We are also working on creating a web-based version of GAMI, to enable other researchers to be able to use this computational tool.

This project was supported by P20 RR-016463 NIH/NCRR as well as New Investigator Awards from the MDIBL Center for Membrane Toxicity Studies ES03828 NIEHS/NIH.

1. Congdon CB, Fizer CW, Smith NW, Gaskins HR, Aman J, Nava G, Mattingly C. Preliminary Results for GAMI: A Genetic Algorithms Approach to Motif Inference. IEEE Symposium on Computational Intelligence in Bioinformatics and Computational Biology, IEEE Press: 97-104, 2005. 2. Congdon, CB, Aman J, Nava GM, Gaskins HR, Mattingly C. An evaluation of information content as a metric for the inference of putative conserved non-coding regions in DNA sequence using a genetic algorithms approach, IEEE/ACM Transactions on Computational Biology and Bioinformatics, 5:1-14, 2008. 3. Matys V, E Fricke, R Geffers, E Gossling, M Haubrock, R Hehl, K Hornischer, D Karas, AE Kel, OV Kel- Morgoulis, DU Kloos, S Land, B Lewicki-Potapov, H Michael, R Munch, I Reuter, S Rotert, H Saxel, M Scheer, S Thiele, and E Wingender, “Transfac: Transcriptional regulation, from patterns to profiles,” Nucleic Acids Res, vol. 31, pp. 374–378, 2003. Calanus finmarchicus cDNA library: a genomic tool for studies of zooplankton physiological ecology

A.E. Christie1, 2, P.H. Lenz2, R.P. Hassett3, C.M. Smith1, P. Batta Lona4, E. Ünal4, A. Bucklin4, and D.W. Towle1 1 Mt. Desert Island Biological Laboratory, Salsbury Cove, ME 04672 2 Pacific Biosciences Research Center, U. Hawaii at Manoa, Honolulu, HI 96822 3 Biological Sciences, Ohio U., Athens, OH 45701 4 Marine Sciences, U. Connecticut, Groton, CT 06340

Zooplankton ecologists have long sought the underlying drivers of physiological condition/life history stages of copepods. For example, Calanus finmarchicus populations undergo pronounced seasonal changes that include dramatic swings in energy allocation for reproduction, growth and lipid storage. These physiological states are regulated by multiple biological processes, and are undoubtedly under environmental control. Currently, the underlying regulators of these processes are unknown for C. finmarchicus, but are being sought at the molecular level. As a first step towards this goal, we created a normalized, whole organism cDNA library and generated approximately 10,000 expressed sequence tags (ESTs) from the library clones (Table 1). These sequences were submitted to NCBI and currently, there are 10,982 ESTs and partial sequences available for C. finmarchicus in Genbank (http://www.ncbi.nlm.nih.gov, December 15, 2008).

The program “Partigene” (http://xyala.cap.ed.ac.uk/bioinformatics/PartiGene/) was used to cluster the sequences into contigs, which were subsequently annotated by obtaining the ten best hits for each contig using the Tera-Blast P algorithm on a local Decypher processor (http://decypher.mdibl.org). Clustering analysis of these sequences indicates that of the 7,287 clusters there are 5,324 unique sequences and 1,963 clusters with > 1 EST per cluster. The majority of these (1140 clusters) were composed of two sequences. Fifteen contigs contained 10 or more sequences per cluster. These included two unknown proteins, including one with no hits. The maximum number of ESTs in a contig was 22. Further analysis identified 87 superclusters containing 2 to 10 contigs, most of which were comprised of either 2 (57%) or 3 (31%) contigs.

Annotation of the unique clusters gave putative functional identifications to 65% of the contigs (4,745), the remaining 2,542 contigs did not match known sequences, presumably representing unknown transcripts or highly modified sequences. Putative identifications of the contigs with the largest number of ESTs included a chitin deacetylase (E-value: 7.70e-59), a core protein of the ubiquinol-cytochrome c reductase complex (E-value: 1.20e-35) and citrate synthase (E-value: 1.60e- 37), which is an enzyme involved in the Krebs cycle. Functional analysis was done to sort the ESTs by putative physiological function and to identify transcripts that encode proteins involved in the generation/regulation of population dynamics. The extant ESTs include ones involved in metabolism, development, biological regulation, growth, reproduction, rhythmic activities and locomotion.

With these data, we initiated environmental genomic studies of C. finmarchicus. Microarray oligomer probes were designed and commercially synthesized for a subset of 1000 contigs and spotted onto microarray slides. In the Gulf of Maine, the summer population is characterized by an abundance of C. finmarchicus immature stages (CV), and can be separated into “fat” or “thin” based on the size of their lipid storage sac1 (Figure 1). While intermediate stages of lipid storage will also be observed, the extreme “fat” and “thin” morphotypes are visually distinctive and have significant differences in enzyme activities1. A comparison between “fat” and “thin” field-caught immature C. finmarchicus indicated that these two types show significantly different physiology, based on differences in relative gene expression. Specifically, growth and developmental genes were upregulated in the “fat” individuals (Table 1). Supported by INBRE P20 RR-016463, NSF OCE 04-51376 to PHL, New Investigator Awards to AEC and L. Crockett, Ohio University Research Council Award to RPH.

Table 1. Examples of Calanus finmarchicus contigs and their corresponding ESTs with putative identifications in the Genbank database. * Denotes cDNAs that were upregulated in the lipid rich “fat” C. finmarchicus.

Biological Function Contig EST Accession # Putative Identification

Wax ester biosynthesis CFX03858 EL966085 Fatty acid elongase Triacylglycerol biosynthesis CFX02970 EL773723 Diacylglycerol kinase family Lipid catabolism CFX04698 FK040823, FK040871 Palmitoyltransferase ZCHHC2 Digestion: carbohydrase CFX00070 ES237387, FG985316, FK041439, Alpha-amylase FK041624, FK868145, FG342405, FG342718, EH666339, EH666830, EL773784 CFX02125 EL696827 Maltase Digestion: protease CFX04358 EL696908, EL666670 Trypsin* CFX02951 EH666726 Chymotrypsin* Chaperones CFX00426 EH666705, FG632535, FG985451 Heat shock factor (hsp70) CFX03522 EL965576 Oxygen regulation CFX05090 FG985341 Hypoxia inducible factor (HIF) pH regulation CFX04127 FG633205, ES237532 Carbonic anhydrase CFX04031 ES237390 Biological rhythms CFX04266 ES237746 Timeless* CFX02748 EL773419 Ebony CFX03856 FG985765, EL966083, FK041536 Cryptochrome CFX06051 FK670430 Cryptochrome

Fig. 1. Pictures of “thin” (top) and “fat” (bottom) immature Calanus finmarchicus (stage CV). Note difference in lipid sac. Total length of a C. finmarchicus CVs ca. 3 mm. Micrographs taken through an Olympus dissecting microscope (SZ40). Scale bar: 0.5 mm .

1. Hassett, R.P. Physiological characteristics of lipid-rich “fat” and lipid-poor “thin” morphotypes of individual Calanus finmarchicus C5 copepodites in nearshore Gulf of Maine. Limnol. Oceanogr. 51:997-1003, 2006.

Development of the giant-axon sheaths in larval lobsters, Homarus americanus

Daniel K. Hartline 1,2 and Jennifer Kong 1 1 Pacific Biosciences Research Center, University of Hawaii at Manoa, Honolulu, HI 96822 2Mt. Desert Island Biological Laboratory, Old Bar Harbor Road, Salisbury Cove, ME 04672

Survival in many animals depends on short reaction times to predatory attack. Decapod crustaceans have evolved two axonal modifications that decrease response times: axonal gigantism and axonal myelination 2. Gigantism operates by reducing the internal resistance of the axoplasm, while myelination reduces trans-fiber capacitance and leak conductance. Both increase the length constant and decrease the charging time of axonal membrane and hence increase conduction speed. Benthic-living adult lobsters utilize axonal gigantism but not myelination as a mechanism for increasing conduction speed 1. On the other hand, adults of the more pelagic decapod shrimp utilize a combination of axonal gigantism and myelination 4,5. The more exposed life-style of pelagic organisms may favor the evolution or retention of conduction-speed-enhancing features. Lobsters undergo a planktonic larval phase in which they are especially susceptible to predation. We thus wondered whether lobster larvae would exhibit more pronounced conduction-speed-enhancing features than the adults. We approached this problem using transmission electron microscopy (TEM) of the axons of the ventral nerve cord of lobsters.

Larval lobsters (Homarus americanus) were obtained from the Zone C Lobster Hatchery (Stonington, ME). Cuticles of specimens were breached with iridectomy scissors in shrimp saline to facilitate penetration of reagents, then transferred to cold fixative composed of 4% glutaraldedhyde in 0.1M sodium cacodylate buffer, pH 7.4, with 2 mM CaCl2 and 0.24M sucrose. They were fixed for 3+ hrs at room temperature or overnight at 4ºC, transferred to 0.2M phosphate buffer (Sorensen’s), shipped cold to Hawaii where they were post-fixed in buffered 1% OsO4 for 1 – 2 hrs, dehydrated in a graded ethanol series and propylene oxide, and then embedded in LX-112 epoxy resin. After resin polymerization, ultrathin (75-90 nm) sections were taken, double-stained with uranyl acetate and lead citrate, and photographed in a LEO912 EF transmission electron microscope at 100 kV.

The ventral nerve cord (VNC) from the abdomen of adult lobsters is characterized by two pairs of giant axons, heavily-ensheathed by many alternating layers of glia and electron-dense extracellular matrix (dm: Fig. 1A). In contrast, the Stage I lobsters (<1 day old; Fig. 1B) had only a single pair of medial giants (mg), with a relatively simple glial enseathment (gc). Several mitochondria (mt) were located near the interior face of the axolemma, as they are in adults. Flattened sub-axolemmal cisternae were also noted. The axon was surrounded by just a few (~3-4) layers of glial cytoplasm, sometimes with extracellular matrix between layers. Glial cytoplasm was more electron dense than the extracellular material, the reverse of the situation in the adult. Numerous ribosomes, 15-20 nm in diameter, bordered the glial endoplasmic reticulum. In older stages, the sheath thickened and generated more extracellular matrix, becoming progressively more complex by Stage III (pre-settling: Fig. 1C). Glial cells with light cytoplasm occurred along side those with dark cytoplasm. Fewer ribosomes were evident in the glial sheath. There was still only a single pair of giant axons in the anterior abdomen of Stage III lobsters. There were no signs of the features that characterize shrimp myelin in any of the stages examined (condensed membranes, seams, radial attachment zones 3).

We conclude that larval lobsters appear to rely on axonal gigantism and not myelination as their primary mechanism for rapid conduction of impulses in escape responses from predators.

Fig. 1. Transmission electron micrographs of the medial giant axons in the ventral nerve cord of lobsters of different stages. (A) adult; (B) stage I (C) stage III. Rectangles in the images in the left column are enlarged in the right column. Note the absence of features that are characteristic of myelin sheaths in decapod shrimp in any stage.

We are deeply grateful to Rich Crowley and the Zone C Lobster Hatchery of Stonington, ME. for providing the larval lobsters used in this study; also to the PBRC Biological Electron Microscope Facility, Tina Weatherby and Dr. Caroline Wilson for their TEM expertise and training (supported by NSF grant OCE-0451376 and a grant from the Cades Foundation, Honolulu).

1. Bullock TH, and Horridge GA. Structure and Function in the Nervous System of Invertebrates, Vol. I. W. H. Freeman, San Francisco. 798 pp. 1965. 2. Hartline DK, and Colman DR. Rapid conduction and the evolution of giant axons and myelinated fibers. Curr. Biol. 17: R29-R36, 2007. 3. Heuser JE, and Doggenweiler CF. The fine structural organization of nerve fibers, sheaths and glial cells in the prawn, Palaemonetes vulgaris. J. Cell Biol. 30: 381-403, 1966. 4. Holmes W. The giant myelinated nerve fibers of the prawn. Phil. Trans. Roy. Soc. Lond. B. 231: 293-314, 1942. 5. Kusano K. Electrical activity and structural correlates of giant nerve fibers in Kuruma shrimp (Penaeus japonicus). J. Cell. Physiol. 68: 361-384, 1966. Hemoglobin as a biomarker for heavy metals using aquatic midge fly larvae, Chironomidae

Carolyn S. Bentivegna, Juntaek Oh, Khuyen Doan, and Christopher DiPietro Department of Biological Sciences, Seton Hall University, South Orange, NJ 07079

In order to protect and/or restore ecosystems, one must be able to evaluate the environmental health of a particular area. This can be done using sublethal measures of biological integrity known as biomarkers. Biomarkers can be used to monitor wild organisms that continue to survive in a given ecosystem. The condition of these organisms is indicative of environmental quality, and any changes in the biomarkers can represent a decline or improvement in the ecosystem. Our laboratory is developing a new biomarker that detects environmental stressors at the population level. The overall goal is to provide a field monitoring tool for freshwater and oligohaline ecosystems that can be used to assess their environmental health as well as the effectiveness of restoration strategies.

The biomarker of interest is hemoglobin protein in the aquatic larvae of midge fly, commonly known as chironomids (Family, Chironomidae). Chironomids are numerous, globally distributed, benthic macroinvertebrates (BMI) that live in close association with sediments. Many species are red in color, which is indicative of the abundant levels of hemoglobin in their blood. The hemoglobin gives chironomid an evolutionary advantage over other BMI in that it allows them to survive in highly organic and sometimes anaerobic sediments. Researchers have found that chironomids have multiple forms of hemoglobin, that is, the genes are polymorphic.3 Work in our laboratory and others has shown that cadmium (Cd) selectively reduces levels of low molecular weight hemoglobin proteins.2 Therefore, it is likely that exposure of wild chironomids to environmental contaminants will be detected by changes in particular hemoglobin proteins.

Our laboratory has been investigating the utility of chironomid hemoglobin in identifying wild chironomid species and in detecting environmental change. This work has been conducted in Kearny marsh (KM), a large freshwater wetland in the NJ Meadowlands. The marsh has been historically polluted with landfills, automobile exhaust, and urban runoff. Severe effect levels of heavy metals have been detected in sediments, particularly Cu, Hg and Pb (142±57, 2.6±2.8, and 584±70 mg/kg, respectively). The objectives of the project at Mount Desert Island Biological Laboratory was to 1) further our studies on the use of hemoglobin to identify chironomid species and 2) to conduct preliminary studies on the response of hemoglobin to heavy metals in reference populations of chironomids.

Surface waters around MDI were selected based on similarity of their water quality characteristics to KM as well as the presence of sufficient numbers of chironomids for toxicity tests. Two sites were chosen: North East Creek (NEC), where it crosses RT 3, and upstream of Bass Harbor (BH), where it crosses RT 102 south of Long Hill Rd. Water parameters were collected just above sediments and included temperature (°C), salinity (ppt), dissolved oxygen (DO, mg/L), pH and oxidationreduction potential (redox, eH) (Table 1). MDI data were collected threefour times at the same locations between August 5th and 29th, 2008. Results showed that NEC and BH parameters for temperature, DO, pH and redox were similar (Table 1). Salinity was lower at NEC (0.450.94 ppt) than at BH (2.103.70 ppt).

For toxicity tests, chironomids were collected by hand from submerged vegetation. Cd concentrations were 0, 0.3, 3 and 30 µM Cd. Test conditions were 200 ml site water and 60 g acid washed play sand in 1 L polypropylene containers. Cd was added to site water and each solution was aerated throughout the experiment. Approximately 80 % of the water in test containers was changed daily. Each concentration was tested in two replicates with 10 chironomids each: the number of replicates was limited by the number of chironomids found. Chironomids were fed daily 1 ml of a 0.04 mg/ml solution of ground fishfood (TetraChichlid sticks). Cd exposure was for 96 h. Temperature and lighting were ambient, ranging for 2024 C. Levels of DO in water from each container were tested at 96 h using LaMott testing kits (Carolina Science and Math, Burlington, NC). DO levels were in an acceptable range of 4.3 to 7.6 mg/L. There was no increased observable toxicity in larvae exposed to Cd compared to control.

Table 1. Water quality characteristics of the three sites from which chironomids were collected. Locations in MDI, ME included North East Creek (NEC) and upstream of Bass Harbor (BH).

Location Temp (°C) Salinity (ppt) DO (mg/L) pH Redox (eH)

NEC 19.4 21.0 0.45 0.84 5.57 6.60 5.92 6.86 106 to 114

BH 18.4 21.7 2.10 3.7 6.02 6.28 6.16 6.49 45 to 142

At the end of each experiment, individuals were decapitated and their head capsule preserved in 70 % ethanol. Mounting was done according to Epler.1 Hemolymph from the decapitated bodies was mixed with 18 µl buffer (14 µl lithium dodecyl sulfate, 2 µl 8 M urea and 2 µl of mercaptoethanol). Proteins were separated by polyacrylamide gel electrophoresis (PAGE) using 16 % Trisglycine SDS gels (BioRad Laboratories, Hercules, CA). Gels were stained in Gel Code Blue (Pierce Inc., Rockford, IL). Band size was determined by comparing to SeeBlue MW standard (Invitrogen, Carlsbad, CA).

Gels showed multiple dark bands between 16 and < 4 kd. The bands were determined to be hemoglobin because of their size and high concentration.3 Bands were defined as band 1 18 based on their relative size to one another. Their intensity was graded as high (3), moderate (2), light (1) or absent (0). The relative intensity of bands within a sample was determined as opposed to comparing bands from one individual with those of another on the same or different gels. This reduced variability due to gel loading. Results showed that bands 816 were most sensitive to Cd; therefore, chironomid responses were evaluated by combining data for certain bands. Data were evaluated by summing intensities of large bands (17 plus 17) or small bands (816) for each individual. Individuals were then averaged (SD) by group 030 µM Cd. It was unlikely that small bands were degradation products of larger hemoglobin bands. Samples from other studies, with and without small bands, have been re-run as much as two years later and have shown band patterns highly similar to the original run.

Chironomids were identified to genus using head capsule morphology.1 The head capsule for a particular individual was then associated with its hemoglobin profile from the PAGE gel. For each genus, a number of hemoglobin profiles were found. These profiles were characteristic of the genus even though they shared some common bands with other genera. By comparing head capsules and hemoglobin profiles, it was determined that NEC had only one genus identified as Dicrotendipes (Fig. 1) and that BH had two genera, Dicrotendipes and Chironomus (Fig. 2). Using head capsules alone to identify chironomids was sometimes ambiguous; however, their hemoglobin patterns were distinct allowing the genera to be distinguished from one another using both parameters.

Concentrationresponse experiments showed that the hemoglobin bands could be modulated by Cd (Table 2 and Fig. 3). The smaller bands were more sensitive than the larger ones. They decreased in intensity for both genera. Dicrotendipes was the more sensitive of the two genera. Small bands actually increased in intensity at 0.3 µM Cd and then lost intensity at 3 and 30 µM. Chironomus in BH showed a similar concentrationresponse trend; however, only the response at 30 µM Cd was statistically different from the 96 h control, p < 0.05. Dicrotendipes was the only genera for which large bands significantly decreased in intensity (Table 2). Given the limited nature of the current data set, it is not yet possible to determine if sensitivity is species related. The overall trend was a loss of small hemoglobin bands at 3 µM Cd.

Fig. 1. Head capsule and corresponding hemoglobin protein bands in one chironomid species from North East Creek, ME. The genus was identified as Dicrotendipes. Each profile represents one individual exposed to 0, 0.3, 3 or 30 µM Cd for 96 h. Not all profiles found are shown. L = ladder, top to bottom 16, 11 and 4 kd.

Fig. 2. Head capsules and corresponding hemoglobin protein bands in two chironomid species from Bass Harbor, ME. Top row = Dicrotendipes species, bottom row = Chironomus species. Hemoglobin bands were from individual larvae exposed to 0, 0.3, 3 or 30 µM Cd for 96 h. The two species were mixed together in the same test containers. No Dicrotendipes was found in 0.3 or 3 µM. Not all hemoglobin profiles found are shown. L = ladder, top to bottom 16, 11 and 4 kd.

Table 2. Comparison of hemoglobin band intensity in chironomid species exposed to Cd (µM) for 96 h. Chironomids were collected from two sites at ME North East Creek (NEC) and Bass Harbor (BH). Statistical analysis = MannWhitney U, nonparametric means test, asymmetric 2tailed. N = number of individuals per group.

Site Cd Chironomus Dicrotendipes (µM) N Bands17,17 Bands 816 N Bands17,17 Bands 816 NEC 0 7 9.1 (1.9) 4.1 (2.0) 0.3 12 9.6 (1.4) 5.8 (1.4)* 3 13 8.1 (1.6) 1.7 (1.7)* 30 13 6.6 (1.6)* 0.9 (0.8)* BH 0 7 10.7 (0.8) 4.7 (2.1) 4 10 (0) 6.3 (2.6) 0.3 6 11.2 (2.0) 6.2 (2.0) 3 10 10.9 (1.7) 2.7 (2.9) 30 8 10.0 (1.3) 0.8 (1.2)* 7 6.4 (1.0)* 1.4 (1.0)* * Statistically different from 0 µM Cd, p≤0.05

Fig. 3. Comparison of low weight bands from chironomid genera collected from North East Creek (NEC) and Bass Harbor (BH), ME. Lower bands were defined as ranging from 84 kd. The two genera found were Chironomus (C) and Dicrotendipes (D). See text for a description of how protein bands were analyzed and values were generated. Statistical analyses = MannWhitney U, nonparametric means test, asymmetric 2tailed. Statistical difference is between treatment and control (0 µM Cd).

The data presented here supports our previous findings that each genus has characteristic hemoglobin profiles. This is likely due to a unique genetic history. These profiles could be used for molecular taxonomy and field identification. The toxicity tests were preliminary: they showed that Cd modulates hemoglobin protein and that some proteins appeared more sensitive than others. Regardless of species, the smaller proteins lost intensity with 3 µM Cd or higher. Other researchers have found a similar loss in small hemoglobin proteins while mRNA levels were uneffected.2 Hemoglobin levels might be reduced by elimination of hemoglobinCd complexes acting as a detoxification mechanism.

Funding was provided by NIEHS Center for Comparative Toxicology (P30ES03828) and 2008 University Research Council Award from Seton Hall University, CSB PI.

1. Epler JH. Identification Manual for the Larval Chironomidae (Diptera) of North and South Carolina. A Guide to the Taxonomy of the Midges of the Southeastern United States, including Florida. Special Publication SJ2001SP13. North Carolina Department of Environment and Natural Resources, Raleigh, NC, and St. Johns River Water Management District, Palatka, FL. 2001, 526 pp. 2. Lee, SM, Lee, SB, Park CH and Choi, J. Expression of heat shock protein and hemoglobin genes in Chironomus tentans (Diptera, chironomidae) larvae exposed to various environmental pollutants: A potential biomarker of freshwater monitoring. Chemosphere 65:10741081, 2006. 3. Tichy, H. Nature, Genetic Basis and Evolution of the Haemoglobin Polymorphism in Chironomus. Journal of Molecular Evolution, 6:3950, 1975. Growth rate of eelgrass (Zostera marina) in Frenchman Bay

Sarah L. Colletti1, George Kidder2 and Jane Disney2 1 College of the Atlantic, Bar Harbor, ME, 2 Mt. Desert Island Biological Laboratory, Salisbury Cove, ME

Eelgrass (Zostera marina) is a sub-tidal marine angiosperm once abundant in Frenchman Bay. We here report measurements of growth rate of natural and re-introduced plants, and compare these to aquarium plants. Five sites were studied. Two grids were placed in the eelgrass tank at Myers Marine Aquarium. One grid (#1) received more natural sunlight than the other (#2) as it was closer to the edge of the roof. Three other plots were established at Hadley point in Frenchman bay. Plot A consisted of plants that were introduced to the area through restoration the previous summer. Plot B contained plants that appeared to be young sprouts that had detached from a grid and seeded the small area. Plot C consisted of plants that were growing naturally and primarily undisturbed. At each site 5-8 plants were chosen randomly and a colored rubber elastic band was placed around the bottom of each plant for identification. In Z. marina, the third youngest blade stops growing once a new blade emerges2, which serves as the reference for measurement of younger blade elongation.3 We modified the method of Zieman and Wetzel4, poking a threaded needle through the youngest blade and an older blade that had stopped growing; the thread was then cut in the middle between these two blades to establish the marks. The distance between these two thread-halves was measured nearly every day. Three trials were performed at each site, with the exception of Plot A which was only done twice.

Condition Mean SE N Mean SE N Notes growth, light cm/day (fc) Restored patch (Plot A) 3.04 0.116 16 4950 1465 4 Measured on dock as Detached from restored (Plot B) 1.65 0.097 27 “ “ “ simulaculum for Naturally-growing (Plot C) 3.31 0.106 26 “ “ “ natural conditions Tank near light (Grid 1) 1.50 0.081 76 527 218 20 Measured at side of tank In tank, darker (Grid 2) 0.96 0.077 62 37 5.57 17 Measured at top of tank

Table. Growth rate of youngest eelgrass fronds and light intensities in various conditions. Plots A – C are in the wild, not attached to a grid; Grids 1 and 2 are in a tank in the Meyers Aquarium. Light intensities (Gossen “Panlux” meter) are variable with weather and time of day, but give some indication of relative intensity.

The growth of last summer’s transplanted patch (Plot A) is not different from a natural stand of eelgrass (Plot C) (P<0.05, 40 DF); suggesting that restored plants are fully competent. Small sprouts (Plot B) grew more slowly, perhaps due to a reduced root system due to recent disturbance. Plants in aquarium tanks were healthy but slower growing, probably due to lower light intensity1. Since 30% of growth rate remains in 1% of natural light, sediment seems unlikely to account for die-off in the wild.

(SLC was supported by EPA NE 97169501 – 0)

1. Dennison, W. C. and R. S. Alberte. 1982. Photosynthetic reponses of Zostera marina L. (eelgrass) to in situ manipulations of light intensity. Oecologia 55: 137-144. 2. Hamburg, S.P. and P.S. Homann. 1986. Utilization of growth parameters of eelgrass, Zostera marina, for productivity estimation under laboratory and in situ conditions. Marine Biology 93: 299-303. 3. Kowalski, J.L. H.R Deyoe, T.C. Allison, J.E. Kaldy. 2001. Productivity estimation in Halodale wrightii: comparison of leaf-clipping and leaf-marking techniques, and the importance of clip height. Mar. Eco. Prog. Ser. 220: 131-136. 4. Zieman, J. C., and R. G. Wetzel. 1980. Productivity in seagrasses: Methods and rates. In: R. C. Phillips and C. P. McRoy (eds.) Handbook of Seagrass Biology. Garland Press, New York. Pp 87 – 116. Selective pressure of paralytic shellfish toxins on populations of softshell clam, Mya arenaria

Laurie Connell School of Marine Sciences, University of Maine, Orono, ME 04469

The softshell clam, Mya arenaria, is a commercially important bivalve with wide latitudinal distribution in North America. Populations of clams with a history of repeated exposure to toxic Alexandrium spp. have developed a natural resistance to the paralytic shellfish toxins (PSTs) produced by these algae during paralytic shellfish poisoning (PSP) blooms 3. A single mutation in the pore region of Na+ channel gene (Domain II) has been previously identified as diagnostic for PSP resistance in the softshell clam, Mya arenaria 1, 2. We have used this information to explore the impact of the mutation on clam population structure when challenged by blooms of Alexandrium species. Environmental selective pressures that are put upon the Na+ channel gene have not been well explored, yet PSTs appear to be a major driver of this gene’s evolution in softshell clam populations. The potential spread of PST resistant clams into new areas may impact trophic transfer of these toxins as well as shellfish management strategies. Understanding the selective pressure that naturally occurring blooms of Alexandrium spp. have on the population structure of M. arenaria are crucial to assess fully the ecological impacts of harmful algal blooms (HABs). Eastern Maine (ME) and the Bay of Fundy. New Brunswick (NB) have a history of repeated, seasonal exposure to Alexandrium blooms thus provide an excellent natural laboratory for exposure experiments.

Genotyped broodstock were used to produce controlled crosses of sensitive (homozygote) progeny (SxS), and resistant homozygote (RxR) clams. Progeny from the crosses were mass reared until they attained ~10 mm in shell length (in May 2008), i.e. a size ready for field planting. Subsample genotyping revealed that 100% of each genotype was as predicted. The spat produced were used for field deployment in the intertidal during early June 2008 at four sites in ME and one site in NB. The ME locations were two control sites that typically do not experience red tide closures (Naskeag Harbor and Lowe’s Cove), and two sites generally affected by PSP outbreaks (Gleason Cove and Prince’s Cove). An additional planting was conducted in Deadman’s Harbor, NB, an area that experiences high PSP levels. Forty pots of each genotype (n=10 spat per pot) were established in a 9x9m grid at each site using a complete randomized design. Several of the field sites had significant numbers of wild spat. Therefore, clams were color coded individually as R or S to allow unequivocal identification of laboratory-produced clams and discrimination from local recruits. Additionally adult clams were deployed in pots for periodic sampling for PSP toxicity (may-September 2008). Individual clams were measured (maximum length), photographed for future image analysis, shucked and dried 24 hr. at 80oC. Shell length and dried meat weight will be used to establish growth for each population. For clams that did not survive the red tide challenge, only shell length will be determined. Survival and growth will thus be determined at each site.

This work was supported in part by NOAA ECOHAB NA06NOS4780247 and by a MDIBL NIA.

1. Bricelj, VM, Connell, LB, Konoki, K, MacQuarrie, SP, Scheuer, T, Catterall, WA, and Trainer, VL. Na+ channel mutation leading to saxitoxin resistance in clams increases risk of PSP. Nature 434: 763-767, 2005. 2. Connell, LB, MacQuarrie, SP, Twarog, BM, Iszard, M, and Bricelj, VM. Population differences in nerve resistance to paralytic shellfish toxins in softshell clam, Mya arenaria, associated with sodium channel mutations. Marine Biology 150: 1227-1236, 2006. 3. MacQuarrie, SP and Bricelj, VM. Does the history of toxin exposure influence bivalve population responses in Mya arenaria?: II) feeding, survival and toxin accumulation. Journal of Shellfish Research 19: 636, 2000.

MDIBL REGISTER

PAST PRESIDENTS/CHAIRMEN PAST DIRECTORS

Dr. John S. Kingsley 1910-1922 Dr. Ulrich Dahlgren 1920-1926 Dr. Harold D. Senior 1922-1926 Dr. Herbert V. Neal 1926-1931 Dr. William Proctor 1926-1927 Dr. William H. Cole 1931-1940 Dr. Hermon C. Bumpus 1927-1932 Dr. Roy P. Forster 1940-1947 Dr. Warren H. Lewis 1932-1937 Dr. J. Wendell Burger 1947-1950 Dr. Ulrich Dahlgren 1937-1946 Dr. Warner F. Sheldon 1950-1956 Dr. Dwight Minnich 1946-1950 Dr. Raymond Rappaport 1956-1959 Dr. William C. Cole 1950-1951 Dr. Alvin F. Rieck 1959-1964 Dr. Homer W. Smith 1951-1960 Dr. William L. Doyle 1964-1967 Dr. Eli K. Marshall 1960-1964 Dr. Charles E. Wilde 1967-1970 Dr. Roy P. Forster 1964-1970 Dr. H. Victor Murdaugh 1970-1975 Dr. William L. Doyle 1970-1975 Dr. Richard M. Hays 1975-1983 Dr. Jack D. Myers 1975-1978 Dr. Leon Goldstein 1979-1983 Dr. Charles E. Wilde 1978-1979 Dr. David H. Evans 1983-1992 Dr. Raymond Rappaport 1979-1981 Dr. David C. Dawson 1992-1998 Dr. Bodil Schmidt-Nielson 1981-1985 Dr. Franklin H. Epstein 1985-1995 Dr. James L. Boyer 1995-2003

2008-2009 OFFICERS

Chair, Board of Trustees Mr. Terence C. Boylan Vice Chair Dr. Edward J. Benz, Jr. Director Dr. John N. Forrest, Jr. Secretary Dr. John H. Henson Treasurer Mr. Maximiliaan J. Brenninkmeyer Clerk Nathaniel I. Fenton, Esq.

EXECUTIVE COMMITTEE DIRECTOR’S ADVISORY COMMITTEE Mr. Terence Boylan, Chair Dr. John N. Forrest, Jr., Chair Dr. James L. Boyer Dr. Ned Ballatori Dr. Edward J. Benz, Jr. Dr. David W. Barnes Dr. John N. Forrest, Jr., Ex Officio Dr. Edward J. Benz, Jr. Dr. Bruce Stanton, Ph.D. Ms. Jerilyn Bowers Dr. John H. Henson Dr. James L. Boyer Mr. Terence C. Boylan Dr. James B. Claiborne Dr. David H. Evans Dr. Biff Forbush Dr. Raymond A. Frizzell Dr. Patricia H. Hand Mr. Michael McKernan Dr. J. Larry Renfro Dr. Bruce Stanton Dr. David Towle Dr. Charles Wray

Administrative Director Patricia H. Hand, Ph.D. TRUSTEES

Class of 2008

James B. Claiborne, Ph.D. John H. Henson, Ph.D. Professor Professor Dept. of Biology Department of Biology Georgia Southern University Dickinson College

Biff Forbush, Ph.D. Barbara Kent, Ph.D. Professor and Director of Graduate Studies Hancock Point, ME Dept. of Cellular and Molecular Physiology Yale University School of Medicine Steen L. Meryweather Salisbury Cove, ME

John Blair Overton, Esq. Honolulu, HI

Class of 2009

Terence C. Boylan Spencer Ervin, Esq. Rhinebeck, NY Bass Harbor, ME

Maximiliaan J. Brenninkmeyer I. Wistar Morris, III Surry, ME West Conshohocken, PA

Franklin H. Epstein, M.D. Clare Stone William Applebaum Professor Purchase, NY Department of Medicine Beth Israel Deaconess Medical Center

Class of 2010

James L. Boyer, M.D. John N. Forrest, Jr., M.D. Ensign Professor of Medicine Professor, Dept. of Internal Medicine Chief, Division of Digestive Diseases Yale University School of Medicine Yale University School of Medicine John A. Hays Marisa Driscoll New York, NY New York, NY Alan B. Miller, Esq. David Evans, Ph.D. New York, NY Chair, Department of Zoology University of Florida Class of 2011

Edward J. Benz, Jr., M.D. Richard M. Hays, M.D. President Investigator and Professor of Medicine Dana Farber Cancer Institute Department of Medicine Albert Einstein College of Medicine Sally Bowles Charles and Helen B. Schwab Foundation Emily Leeser New York, NY New York, NY

Phoebe C. Boyer Edith T. Rudolf Tiger Foundation New York, NY New York, NY Bruce Stanton, Ph.D. Professor of Physiology Dartmouth School of Medicine

SCIENTIFIC PERSONNEL

Principal Investigators Associates

William Aird, M.D. Associate Professor of Medicine Beth Israel Deaconess Medical Center

Michele Anderson, Ph.D. Assistant Professor Sunnybrook Research Institute University of Toronto

Sharon Ashworth, Ph.D. Emilynne P. Bell Assistant Research Professor Samantha Bond Department of Biochemistry, Microbiology, and Molecular Biology Hannah Marquis The University of Maine Emily E. Miller

Ned Ballatori, Ph.D. Michael Madejczyk Professor of Toxicology Department of Environmental Medicine University of Rochester School of Medicine

David W. Barnes, Ph.D. Christopher Durkin Investigator and Director Jae-Ho Hwang, Ph.D. Marine Cell Lines and Stem Cell Program Angela Parton Mount Desert Island Biological Laboratory

Barbara Beltz, Ph.D. Jeannie L. Benton Professor Department of Biological Sciences Wellesley College

Carolyn Bentivegna, Ph.D. Christopher DiPietro Associate Professor and Chair Khuyen Doan Department of Biological Sciences Jun-taek Oh Seton Hall University

Edward J. Benz, Jr., M.D. President Professor of Medicine Dana Farber Cancer Institute

Nancy Berliner, M.D. Professor of Medicine and Genetics Department of Internal Medicine/Hematology Yale University School of Medicine

James L. Boyer, M.D. Shi-Ying Cai, Ph.D. Ensign Professor of Medicine H. Rex Gaskins, Ph.D. Director, Liver Center Yale University School of Medicine

Jon Chorover, Ph.D. Professor of Environmental Chemistry Department of Soil, Water, and Environmental Science University of Arizona

Andrew E. Christie, Ph.D. Naveed Davoodian Investigator Evelyn S. Dickinson Mount Desert Island Biological Laboratory Ashley L. Gard Molly A. Kwiatkowski

James B. Claiborne, Ph.D. Andrew W. Diamanduros Professor of Biology Hana Kratochvilova Georgia Southern University Kelley M. LaRue Matt Phillips Mia Tarley

Lars Cleemann, Ph.D. Associate Professor of Pharmacology Georgetown University Medical Center

James Coffman, Ph.D. Alison Coluccio Investigator Kaylyn E. Germ Mount Desert Island Biological Laboratory Peter B. Knowlton Chris McCarty, Ph.D. Anthony Robertson, Ph.D.

Clare Bates Congdon, Ph.D. Rachel Hwee-Jia Teo Assistant Research Professor Junes Thete University of Southern Maine

Laurie Connell, Ph.D. Scott A. Hamilton Research Assistant Professor School of Marine Sciences The University of Maine

Abigail Conrad, Ph.D. Research Associate Professor Division of Biology Kansas State University Gary W. Conrad, Ph.D. A. Scott McCall University Distinguished Professor Ethan Clement Division of Biology Kansas State University

Elizabeth Crockett, Ph.D. Jeffrey M. Grim Associate Professor Hae Lim Yook Department of Biological Sciences Ohio University

Christopher Cutler, Ph.D. Kia E. Burch Assistant Professor Sheena M. Harmon Department of Biology Debra L. Murray Georgia Southern University

Hugo de Jonge, Ph.D. Boris Hogema Professor Ben Tilly Erasmus Medical Center

Douglas DeSimone, Ph.D. Professor of Cell Biology Department of Developmental Biology University of Virginia

Jane Disney, Ph.D. Kavita Balkaran Director Eliza Childs Community Environmental Health Laboratory Sarah L. Colletti Mount Desert Island Biological Laboratory Jay Garnett Casie Reed Crista L. Straub

Susan L. Edwards, Ph.D. Salvatore D. Blair Assistant Professor Department of Biology Appalachian State University

Franklin H. Epstein, M.D. Matthew Cronan William Applebaum Professor of Medicine Yubelka Hernandez Beth Israel Deaconess Medical Center Kate Spokes Harvard Medical School

David H. Evans, Ph.D. Patrick J. Buchanan Professor Kelly A. Hyndman, Ph.D. Department of Zoology Eric S. Monaco University of Florida James Stidham, Ph.D. Susan K. Fellner, M.D. Research Professor Department of Cellular and Molecular Physiology University of North Carolina at Chapel Hill

Biff Forbush, Ph.D. Michelle Monette, Ph.D. Professor Jessica Tannis Department of Cellular and Molecular Physiology Yale University School of Medicine

John N. Forrest, Jr., M.D. Will Epstein Professor of Medicine Michael L. Hart Director of Student Research Catherine Kelley Department of Internal Medicine Anna E. Kufner Yale University School of Medicine August Melita

Gert Fricker, Ph.D. Professor Institute for Pharmacology and Molecular Biotechnology University of Heidelberg

Leon Goldstein, Ph.D. Mark Musch, Ph.D. Professor and Vice Chair Maria Urso Department of Molecular Pharmacology Physiology and Biotechnology Brown University

Hermann Haller, M.D. Professor and Chair Internal Medicine Hannover Medical School

Amro Hamdoun, Ph.D. Brian Cole Hopkins Marine Station David Epel, Ph.D. Stanford University Kevin Uhlinger

Daniel K. Hartline, Ph.D. Research Professor and Director Bekesy Laboratory for Neurobiology Pacific Biosciences Research Center University of Hawaii, Manoa

R. Patrick Hassett, Ph.D. Assistant Professor Dept. of Biological Sciences Ohio University Raymond P. Henry, Ph.D. Laura Henry Professor Elizabeth A. Simonik Dept. of Biological Sciences Auburn University

Ione Hunt von Herbing, Ph.D. Jennifer Samford Professor of Biology Kaitlyn Schroeder Department of Biological Sciences The University of North Texas

Stephen Kajiura, Ph.D. Assistant Professor Department of Biological Sciences Florida International University

George W. Kidder, III, Ph.D. Instrumentation Officer Senior Scientist Mount Desert Island Biological Laboratory

Rolf K.H. Kinne, M.D., Ph.D. Director Emeritus, Max-Planck Institute of Mol. Physiology Director, Con Ruhr Academic Exchange Office

Christopher Lage, Ph.D. Maxwell R. Simard Assistant Professor of Biology The University of Maine - Augusta

Lucy Lee, Ph.D. Mary Rose Bufalino Professor Bounmy Inthavong Wilfrid Laurier University Atsushi Kawano Richelle Monaghan

Petra H. Lenz, Ph.D. Associate Research Professor Bekesy Laboratory of Neurobiology Pacific Biomedical Research Center University of Hawaii at Manoa

Cedomil Lucu, Ph.D. Professor University of Dubrovnik

Heimo Mairbaurl, Ph.D. Emel Baloglu Professor Department of Sports Medicine University of Heidelberg

Carolyn Mattingly, Ph.D. Allan P. Davis, Ph.D. Director of Bioinformatics Anisa K. Khadraoui Comparative Toxicogenomic Database Cynthia Murphy, Ph.D. Mount Desert Island Biological Laboratory Cynthia A. Saraceni-Richards Michael Rosenstein, J.D. Thomas C. Wiegers

Rebeka Merson, Ph.D. Amanda R. Albanese Assistant Professor Sean P. Hersey Biology Department Michael Schmidt Rhode Island College

David S. Miller, Ph.D. Anne Mahringer, Ph.D. Research Physiologist Abby Seymour Laboratory of Pharmacology and Chemistry Alice R.A. Villalobos, Ph.D. NIH/NIEHS

Martin Morad, Ph.D. Ronnie Dahlsgaard Professor of Pharmacology and Medicine Mei Ding Dept. of Physiology Sarah S. Haviland Georgetown University Emil Kromann Line Waring

David Petzel, Ph.D. Professor of Biomedical Sciences Creighton University School of Medicine

Antonio Planchart, Ph.D. Nina E. Griffin Investigator Mount Desert Island Biological Laboratory

Robert L. Preston, Ph.D. Edal Fontaine Professor of Physiology Elizabeth S. Gary Department of Biological Sciences Sirilak Ruensirikul-Arrington Illinois State University

Jonathan Rast, Ph.D. Eric Ho Assistant Professor Cynthia Messier Sunnybrook Research Institute University of Toronto

Jack Riordan, Ph.D. Tim Jensen Distinguished Professor Department of Biochemistry and Biophysics University of North Carolina School of Medicine David Sandeman, Ph.D. Professor Department of Biological Sciences Wellesley College

J. Denry Sato, D. Phil. Christine Chapline Investigator and Associate Director Erin E. Flynn Marine Cell Lines and Stem Cell Program Ryuhei Nishikawa, Ph.D. Mount Desert Island Biological Laboratory

Mario Schiffer, M.D. Lisa Bohme Assistant Professor Lena Schiffer Nephrology Lynne Beverly-Staggs Hannover Medical School

Joseph Shaw, Ph.D. Jordan A. Francke Assistant Professor School of Public and Environmental Affairs Indiana University

Larissa Shimoda, Ph.D. Associate Professor of Medicine Department of Medicine Johns Hopkins University

Patricio Silva, M.D. Professor of Medicine Section Nephrology and Kidney Transplant Temple University Health Science Center

Bruce A. Stanton, Ph.D. Caitlin Stanton Professor of Physiology Sara Stanton Dartmouth Medical School Cecily J. Swinburne

James D. Stidham, Ph.D. Professor of Biology Presbyterian College

Erik Swenson, M.D. Jacqueline Anderson Professor Allan Doctor, M.D. University of Washington Timothy C. Freeman VA Puget Sound Health Care Susannah L. Stone

Shelly Tallack, Ph.D. Associate Research Scientist Gulf of Maine Research Institute Nicole Theodosiou, Ph.D. Elizabeth M. Richards Assistant Professor Department of Biology Union College

David W. Towle, Ph.D. Kristen Beale Senior Research Scientist Anne-Kathrin Blaesse Director, Marine DNA Sequencing Center Nathaniel Jillette Mount Desert Island Biological Laboratory Christine Smith

Mary Kate Worden, Ph.D. Assistant Professor Department of Neuroscience University of Virginia Health Sciences Center

Charles Wray, Ph.D. Alison W. Kieffer Associate Administrative Director Susannah L. Stone Mount Desert Island Biological Laboratory 2008 FELLOWSHIP RECIPIENTS

HIGH SCHOOL FELLOWSHIP RECIPIENTS

High School Research Fellowship: Mentors: Eliza Childs, The Thatcher School Jane Disney, Ph.D. Will Epstein, Packer Collegiate Institute John N. Forrest, Jr., M.D. Mike Hart, Taylor Allderdice High School John N. Forrest, Jr., M.D. Yubelka Hernandez, High School of Math, Science, Engineering Franklin Epstein, M.D.

NIEHS Short Term Educational Experiences for Research (STEER): Evelyn Dickinson, Mt. Ararat High School Andrew Christie, Ph.D. Erin Flynn, John Bapst Memorial High School J. Denry Sato, D.Phil. Edal Fontaine, Rockland District High School Robert Preston, Ph.D. Jordan Francke, Presque Isle High School Joseph Shaw, Ph.D. Bruce Stanton, Ph.D. Anisa Khadraoui, Waynflete School Carolyn Mattingly, Ph.D.

UNDERGRADUATE FELLOWSHIP RECIPIENTS

NSF Research Experience for Undergraduates (REU):

Kavita Balkaran, University of the Virgin Islands Jane Disney, Ph.D. Kia Burch, Georgia Southern University Christopher Cutler, Ph.D. Salvatore Blair, Appalachian State University Susan Edwards, Ph.D. Matthew Cronan, The University of Maine Franklin Epstein, M.D. Elizabeth Gary, Bowdoin College Robert Preston, Ph.D. Kaylyn Germ, Texas A&M University, Galveston James Coffman, Ph.D. Sheena Harmon, Georgia Southern University Christopher Cutler, Ph.D. Anna Kufner, University of Vermont John N. Forrest, Jr., M.D. Kelly LaRue, Dickinson College James Claiborne, Ph.D. A. Scott McCall, Kansas State University Gary Conrad, Ph.D. Casie Reed, College of the Atlantic Jane Disney, Ph.D. George Kidder, Ph.D. Elizabeth Simonik, Ohio University Raymond Henry, Ph.D.

NIH/NCRR Maine IDeA Network of Biomedical Research Excellence (INBRE-ME):

Emilynne Bell, University of New England Sharon Ashworth, Ph.D. The University of Maine Naveed Davoodian, College of the Atlantic Andrew Christie, Ph.D. MDI Biological Laboratory Christopher Durkin, University of Maine – Farmington David Barnes, Ph.D. MDI Biological Laboratory Ashley Gard, The University of Maine Andrew Christie, Ph.D. MDI Biological Laboratory Nina Griffin, University of Maine – Farmington Robert Preston, Ph.D. Illinois State University Nathaniel Jillette, University of Maine – Machias David Towle, Ph.D. MDI Biological Laboratory Alison Kieffer, University of Maine – Presque Isle Charles Wray, Ph.D. MDI Biological Laboratory Maxwell Simard, University of Maine – Augusta Christopher Lage, Ph.D. UMaine – Augusta Susannah Stone, Bates College Charles Wray, Ph.D. MDI Biological Laboratory Erik Swenson, M.D. University of Washington Cecily Swinburne, College of the Atlantic Bruce Stanton, Ph.D. Dartmouth Medical School

GRADUATE STUDENT FELLOWSHIP RECIPIENTS

Stanley Bradley Fellowship: Kathrin-Ann Blaesse, University of Osnabrueck David Towle, Ph.D.

Adrian Hogben Fellowship: Sarah Haviland, Georgetown Medical School Martin Morad, Ph.D.

Stan and Judy Fellowship: Jeffrey Grim, Ohio University Elizabeth Crockett, Ph.D.

OTHER FELLOWSHIP RECIPIENTS

US Environmental Protection Agency Environmental Education Program:

Sarah Colletti, College of the Atlantic George Kidder, Ph.D. Crista Straub, The University of Maine Michael McKernan

Kathryn W. Davis Foundation:

Hae Lim Yook, Fryeburg Academy Lisa Crockett, Ph.D. Peter Knowlton, Duke University James Coffman, Ph.D. August Melita, University of Vermont John N. Forrest, Jr., M.D. NEW INVESTIGATOR AWARDS

Salisbury Cove Research Fund:

Michelle Anderson, Ph.D., Sunnybrook Research Institute, University of Toronto Andrew Christie, Ph.D., Mount Desert Island Biological Laboratory Hugo de Jonge, Ph.D., Eramus University Medical Center Susan Edwards, Ph.D., Appalachian State University Stephen Kajiura, Ph.D., Florida Atlantic University Lucy Lee, Ph.D., Wilfrid Laurier University Heimo Mairbaurl, Ph.D., University of Heidelberg Jonathan P. Rast, Ph.D., Sunnybrook Research Institute, University of Toronto Mario Schiffer, M.D., Hannover Medical School Shelly Tallack, Ph.D., Gulf of Maine Research Institute Nicole Theodosiou, Ph.D., Union College Ione Hunt von Herbing, Ph.D., The University of North Texas Mary Kate Worden, Ph.D., University of Virginia

MDIBL Named Fellowships:

Andrew Christie, Ph.D., Mount Desert Island Biological Laboratory, Dahlgren Fellowship Elizabeth L. Crockett, Ph.D., Ohio University, Blum-Halsey Fellowship Susan Edwards, Ph.D., Appalachian State University, Schmidt-Nielsen Fellowship, F.H. Epstein Investigatorship Chris Lage, Ph.D., University of Maine Augusta, Forster Fellowship Cedomil Lucu, Ph.D., University of Dubrovnik, Forster Fellowship Jonathan Rast, Ph.D., University of Toronto, Milbury Fellowship Larissa Shimoda, Ph.D., John Hopkins University, Milbury Fellowship Nicole Theodosiou, Ph.D., Union College, Blum-Halsey Fellowship, Schmidt-Nielsen Fellowship Ione Hunt von Herbing, Ph.D., The University of North Texas, Blum-Halsey Fellowship Mary Kate Worden, Ph.D., University of Virginia, Forster Fellowship

MDIBL NIEHS Center for Comparative Toxicology:

Carolyn Bentivegna, Ph.D., Seton Hall University James Coffman, Mount Desert Island Biological Laboratory Clare Bates Congdon, Ph.D., University of Southern Maine Laurie Connell, Ph.D., The University of Maine Elizabeth L. Crockett, Ph.D., Ohio University Amro Hamdoun, Ph.D., Stanford University Carolyn Mattingly, Ph.D., Mount Desert Island Biological Laboratory Rebeka Merson, Ph.D., Rhode Island College Antonio Planchart, Ph.D., Mount Desert Island Biological Laboratory Erik Swenson, M.D., University of Washington

NIH/NCRR Maine IDeA Network of Biomedical Research Excellence (INBRE-ME):

Sharon Ashworth, Ph.D., The University of Maine Clare Bates Congdon, Ph.D., University of Southern Maine Laurie Connell, Ph.D., The University of Maine Chris Lage, Ph.D., University of Maine - Augusta Rebeka Merson, Ph.D., Rhode Island College David Petzel, Ph.D., Creighton University

NIH/NCRR Maine IDeA Network of Biomedical Research Excellence Junior Faculty:

Ryan Bavis, Ph.D., Bates College Clare Bates Congdon, Ph.D., Colby College Lynn Hannum, Ph.D., Colby College Hadley Horch, Ph.D., Bowdoin College Carolyn Mattingly, Ph.D., Mount Desert Island Biological Laboratory Antonio Planchart, Ph.D., College of the Atlantic/Mount Desert Island Biological Laboratory J. Denry Sato, D.Phil., Mount Desert Island Biological Laboratory Lindsay Shopland, Ph.D., The Jackson Laboratory Rebecca Sommer, Ph.D., Bates College Andrea Tilden, Ph.D., Colby College 2008 SEMINARS

Seminars preceded by an asterisk were presented by investigators supported by the NIEHS Center for Comparative Toxicology at the Mount Desert Island Biological Laboratory.

Monday Morning Science Seminars July 7 “NHE, H+-ATPase and RhG in the multipurpose fish gill epithelium.” J.B. Claiborne, Ph.D., Professor of Biology, Department of Biology, Georgia Southern University

July 14 “Chick eye development, shark/skate corneas, and how to repair human keratoconus and LASIK corneas.” Gary Conrad, Ph.D., Distinguished Professor of Biology, Division of Biology, Kansas State University

July 21 “Osmoregulation and desiccation resistance in Fundulus embryos.” Robert Preston, Ph.D., Professor of Physiology, Department of Biological Sciences, Illinois State University

July 28 “CFTR: Do disease-causing mutations render a broken transporter temperature sensitive?” David C. Dawson, Ph.D., Professor and Chair, Department of Physiology and Pharmacology, Oregon Health and Science University

August 4 “The Na-K-Cl cotransporter: Regulatory excitement in the C-terminus.” Biff Forbush, Ph.D., Professor, Department of Cellular and Molecular Physiology, Yale University School of Medicine

August 11 “Functional significance of Ost!-" for organic solute transport in epithelia.” Jim Boyer, M.D., Professor of Medicine, Yale University School of Medicine

August 18 “Deuterosome epigenesis via the nodal-lefty system.” Jim Coffman, Ph.D., Senior Investigator, Mount Desert Island Biological Laboratory

August 25 “Is buffering capacity of synaptic cleft the determinant of synaptic plasticity?” Martin Morad, Ph.D., Professor of Pharmacology and Medicine, Department of Pharmacology, Georgetown University

Friday Noon Brown Bag Seminars June 27 Introductory five-minute talks by Mount Desert Island Biological Laboratory Principal Investigators to summarize summer research projects

July 11 Introductory five-minute talks by Mount Desert Island Biological Laboratory Principal Investigators to summarize summer research projects

July 18 “In vivo imaging of podocyte apoptosis in larval zebrafish and the balance of CD2AP/Cin85.” Mario Schiffer, M.D., Assistant Professor, Department of Medicine/ Nephrology, Hannover Medical School

July 25 “Identification and characterization of shrimp neuropeptides.” Andrew Christie, Ph.D., Research Scientist/Lecturer, Department of Biology, University of Washington

August 1 Introductory five-minute talks by Mount Desert Island Biological Laboratory Principal Investigators to summarize summer research projects

August 8 Research Summary. Carolyn Bentivegna, Ph.D., Associate Professor/Chair of Biological Sciences, Department of Biological Sciences, Seton Hall University

August 15 Research Summary. Erik Swenson, Ph.D., Professor, Department of Medicine and Physiology, University of Washington

Research Summary. David Petzel, Ph.D., Professor, Biomedical Sciences Department, Creighton University School of Medicine

August 22 “Shark and human noncoding mRNA.” David W. Barnes, Ph.D., Senior Investigator, Associate Director, Center for Marine Functional Genomic Studies and Director, Marine Cell Lines & Stem Cell Program, Mount Desert Island Biological Laboratory

“Measurement of oxygen uptake in biological systems.” George W. Kidder, III, Ph.D., Professor Emeritus, Illinois State University; Principal Investigator, Mount Desert Island Biological Laboratory

August 29 “Ah receptor modulation of ABC transporters in killifish kidney and brain capillaries.” David Miller, Ph.D., Senior Investigator, Laboratory of Pharmacology, NIH/NIEHS

“Population genetics of sharks and skates.” Charles Wray, Ph.D., Associate Administrative Director, Mount Desert Island Biological Laboratory

Wednesday Evening Seminars June 25 THE FOURTEENTH HELEN F. CSERR MEMORIAL LECTURE – “A Two-Way Dialogue Between Neurons and Glia During Olfactory Development.” Leslie P. Tolbert, Ph.D., Regents' Professor and Vice President for Research, Graduate Studies, and Economic Development at the University of Arizona

July 2 “Teleost fish osmoregulation: What have we learned since August Krogh, Homer Smith, and Ancel Keys?” David Evans, Ph.D., Emeritus Professor, Department of Zoology, University of Florida

*July 9 THE TWENTY-FIFTH WILLIAM B. KINTER MEMORIAL LECTURESHIP – “The National Environmental Genome Project.” Deborah A. Nickerson, Ph.D., Professor, Department of Genome Sciences, University of Washington, Seattle, and Program Director of the NIEHS.

July 21 THE EIGHTEENTH THOMAS H. MAREN MEMORIAL LECTURE – “Drug discovery: past, present, and future.” Philip A. Cole, M.D., Ph.D., E.K. Marshall and Thomas H. Maren Professor of Pharmacology, John Hopkins University

August 6 THE SIXTEENTH ANNUAL JOHN W. BOYLAN MEMORIAL LECTURE – “Broadcasting’s Impact on International Affairs.” Kevin Klose, President and CEO, National Public Radio

August 13 “Chaperoning CFTR and escorting ENaC.” Ron Rubenstein, M.D., Ph.D., Associate Professor, Department of Pediatrics, University of Pennsylvania School of Medicine

Special Seminars and Presentations June 20 “An innovative therapy for oral cancer: research-based clinical application of cell therapy and photo-dynamic therapy.” Tetsuji Okamoto, Ph.D., Head, Department of Molecular Oral Medicine and Maxillofacial Surgery Division of Frontier Medical Science, and Dean, Graduate School of Biomedical Sciences Hiroshima University, Hiroshima, Japan

June 23 "Serum and glucocorticoid inducible kinase (SGK) and acute adaptation to seawater in Fundulus heteroclitus." Bruce A. Stanton, Ph.D., Professor and Director of the Lung Biology Center, Dartmouth Medical School.

June 24 "Structure and function of type IV collagen in kidney basement membranes." Billy Hudson, Ph.D., Elliot V. Newman Professor of Medicine and Biochemistry at Vanderbilt University Medical Center

June 24 “The Aspirnaut Program: an initiative to bring science into the school bus in rural Arkansas." Julie Hudson, M.D., Associate Professor of Clinical Anesthesiology, Vanderbilt University Medical Center

June 30 “Cell volume and CLC anion channels: new insights from a non-mammalian model organism.” Kevin Strange, Ph.D., Director, Anesthesiology Research Division, Laboratories of Cellular and Molecular Physiology, Vanderbilt University School of Medicine

July 1 “Heat shock proteins, hormones and hierarchies: Integrated responses to environmental stress in fish.” Suzanne Currie, Ph.D., Associate Professor, Department of Biology, Mount Allison University, New Brunswick, Canada

July 14 “What’s out there? – Images from here to the edge of the universe.” Michael Soluri, Author and freelance photographer

July 22 “Chemical approaches to sorting out epigenetics.” Philip A. Cole, M.D., Ph.D., E.K. Marshall and Thomas H. Maren Professor of Pharmacology, John Hopkins University

August 7 “Cis-regulatory module evolution in sea urchin genomes.” Andy Cameron, Ph.D., Senior Research Associate in Biology, California Institute of Technology

August 11 THE NINTH ANNUAL LEWIS SCIENCE LECTURE – “Brawn versus brain in human evolution.” Daniel E. Lieberman, Ph.D., Professor of Biological Anthropology, Harvard University

August 14 “Superresolution Light Microscopy of Cellular Nanostructures.” Christoph Cremer, Ph.D., Adjunct Senior Scientist, The Jackson Laboratory

August 14 “Research in the Park.” Thomas Huntington, Ph.D., U.S. Geological Survey

2008 CONFERENCES, SYMPOSIA, AND WORKSHOPS

*July 9-10 15th Annual Environmental Health Sciences Symposium – “Comparative toxicogenomic strategies for unraveling mechanisms of environmentally-related diseases,” sponsored by the National Institute of Environmental Health Sciences (NIEHS) Center at MDIBL, the Kinter Memorial Lectureship Fund, the Yale University Liver Center, the Dartmouth Environmental Health Sciences Center, and the Mount Desert Island Biological Laboratory.

Wednesday, July 10 SESSION I: 26th Annual Kinter Memorial Lecture

“SNPing in the Environmental Genome Project.” Deborah A. Nickerson, Ph.D., Professor, Department of Genome Sciences, University of Washington, Seattle, and Program Director of the NIEHS Environmental Genome Project

Thursday, July 10 SESSION II: Comparative Toxicogenomic Resources (Ned Ballatori, Ph.D., Chair)

“The Comparative Toxicogenomics Database: Promoting understanding of chemical-gene and protein interaction networks,” Carolyn Mattingly, Ph.D., MDI Biological Laboratory

“EDGE: a centralized resource for the comparison, analysis, and distribution of toxicogenomic information.” Chris Bradfield, Ph.D., University of Wisconsin

“MouseCyc: Deriving pathways underlying tumor biology.” Carol Bult, Ph.D., The Jackson Laboratory

“Chemical Effects in Biological Systems (CEBS) Database.” Jennifer Fostel, Ph.D., NIEHS/NIH

SESSION III: Comparative Toxicogenomics and Translational Applications (Carolyn Mattingly, Ph.D., Chair)

“Integrative genomics and disease phenotypes.” Phillip Antczak, Ph.D., University of Birmingham, UK

“Genetic and environmental pathways to complex diseases.” Reuben Thomas, Ph.D., NIEHS/NIH

“Intuitive and effective microarray analysis strategies for low dose toxicology.” Thomas Hampton, M.S., Dartmouth Medical School

“Arsenic is an endocrine disruptor.” Julie Gosse, Ph.D., The University of Maine

“Arsenic modification of the epigenome and developmental gene expression.” Antonio Planchart, Ph.D., MDI Biological Laboratory

“Identifying biomarkers of developmental exposure to arsenic.” Rebecca Fry, Ph.D., University of North Carolina

“Arsenic disruption of neuron growth.” Douglas Currie, Ph.D., University of Southern Maine

“Coupling genomes and populations to uncouple acclimation and adaptation.” Joseph Shaw, Ph.D., Indiana University

“The sea urchin embryo: a model for investigating environmental effects on animal development.” James Coffman, Ph.D., MDI Biological Laboratory

July 28 2008 Frenchman Crustacean Association Research Syposium – Sponsored by the Mount Desert Island Biological Laboratory

July 29 2008 Student Symposium – Sponsored by Maine INBRE and the Mount Desert Island Biological Laboratory.

Tuesday, July 29 SESSION 1: Marine Ecology (George Kidder, Ph.D., Chair)

“A comparison of species diversity in eelgrass beds and nearby unvegetated sediments in Frenchman Bay.” Casie Reed, College of the Atlantic, and Kavita Balkaran, University of U.S. Virgin Islands. Mentors: Jane Disney, Ph.D., George Kidder, Ph.D., MDIBL

“A study of the growth rate of eelgrass (Z. marina) at different locations and conditions.” Sarah Colletti, College of the Atlantic. Mentor: George Kidder, Ph.D., MDIBL

“Environmental education and outreach at the MDI Biological Laboratory.” Crista Straub, The University of Maine

SESSION 2: Comparative Functional Genomics (INBRE Students) (Charles Wray, Ph.D., Chair)

“Quest for advanced molt inducing signal Homarus americanus.” Nate Jillette, University of Maine at Machias. Mentor: David Towle, Ph.D., MDIBL

“Gene expression changes in ammonia exposed green crabs Carcinus maenas: Are Rhesus proteins involved?” Anne-Kathrin Blaesse, Undergraduate Student, Germany. Mentor: David Towle, Ph.D., MDIBL

“Putative targets of D-Pax2 in Drosophila melanogaster.” Katherine Harmon, Colby College. Mentor: Joshua Kavaler, Ph.D., Colby College

“Muscle Integrin Binding Protein regulates skeletal muscle morphogenesis and differentiation in vivo.” Judi Azevedo, The University of Maine. Mentor: Clarissa Henry, Ph.D., The University of Maine

“Molecular variation in spiny dogfish.” Maxwell Simard, University of Maine at Augusta. Mentor: Christoper Lage, Ph.D., University of Maine at Augusta

“Cellular mechanisms of melatonin-induced neurite growth in crustacean X-organ cells.” Escar Kusema, Colby College. Mentor: Andrea Tilden, Ph.D., Colby College

“Development of a myosuppressin-specific antibody.” Molly Kwiatkowski, Bowdoin College and Evelyn Dickinson, Mt. Ararat High School. Mentor: Andrew Christie, Ph.D., MDIBL

“Neuropeptide discovery in the water flea Daphia pulex using functional genomics, immunohistochemistry and biological mass spectrometry.” Ashley Gard, The University of Maine, and Naveed Davoodian, College of the Atlantic. Mentor: Andrew Christie, Ph.D., MDIBL

“Comparing the effects of two related neuropeptides on the stomatogastric nervous system.” Emily Grabanski, Bowdoin College. Mentor: Patsy Dickinson, Ph.D., Bowdoin College

“The role of p38 MAPK in SGK regulation of CFTR.” Cecily Swinburne, College of the Atlantic. Mentor: Bruce Stanton, Ph.D., Dartmouth School of Medicine

SESSION 3: Environmental Physiology (Joseph Shaw, Ph.D., Chair)

“SGK Morpholino microinjection and the oocytic developmental response.” Jordan Francke, Presque Isle High School. Mentor: Joseph Shaw, Ph.D., Indiana University

“Arsenic effects on zebrafish development.” Anisa Khadraoui, Waynflete School. Mentor: Carolyn Mattingly, Ph.D., MDIBL

“What do you zinc? Providing some details about zinc induced radialization using microarray.” Kaylyn Germ, Texas A&M University. Mentor: James Coffman, Ph.D., MDIBL

“Mechanisms of signal transduction in the shark rectal gland.” Will Epstein, Brown University, and Ana Kufner, University of Vermont. Mentor: John N. Forrest, Jr., M.D., Yale University School of Medicine

SESSION 4: Comparative physiology (Sharon Ashworth, Ph.D., Chair)

“The effect of the inhibitor hydroclorothizide on the rectal gland of the spiny dogfish shark.” Matthew Cronan, The University of Maine. Mentors: Franklin H. Epstein, M.D., Harvard Medical School; Patricio Silva, M.D., Temple University School of Medicine

“Physiological responses to emersion in the intertidal green crab Carcinus maenas.” Elizabeth Simonik, Ohio University. Mentor: Raymond Henry, Ph.D., Auburn University

“Mechanistic elucidation of photodynamic corneal cross-linking.” Scott McCall, Kansas State University. Mentors: Gary Conrad, Ph.D. and Abigail Conrad, Ph.D., Kansas State University

“Tissue distribution of NHE and Rh transcripts in Myoxochphalus octodecimspinosus.” Mia Tarley, Hunter College, and Kelly LaRue, Dickinson College. Mentor: J.B. Claiborne, Ph.D., Georgia Southern University

“Characterization of the actin cytoskeleton in the zebrafish Pronephros tubule cells.” Hannah Marquis, The University of Maine. Mentor: Sharon Ashworth, Ph.D., The University of Maine

POSTER PRESENTATIONS:

Emilynne Bell, University of New England, and Samantha Bond, The University of Maine Identification of zebrafish cofilin null mutants Mentor: Sharon Ashworth, Ph.D., The University of Maine

Eliza Childs, Thatcher School Monitoring Red Tide off the Maine coast Mentor: Jane Disney, Ph.D., MDIBL

Chris Durkin, University of Maine at Farmington Functional analysis of highly conserved ancient 3’ UTR sequences Mentor: David Barnes, Ph.D., MDIBL

Edal Fountaine, Rockland District High School, Elizabeth Gary, Bowdoin College, Nina Griffin, University of Maine at Farmington Killfish egg, sperm and embryo viability under various environmental stresses Mentor: Robert L. Preston, Ph.D., Illinois State University

Erin Flynn, John Bapst High School Molecular cloning of P38 MAPkinase cDNA from killfish (Fundulus heterolitus) Mentor: Denry Sato, Ph.D., MDIBL

Sarah Haviland, Georgetown University + + Regulation of mammalian myocardial function by insertion of cardiac specific shark Na -Ca2 Exchanger. Mentors: Martin Morad, Ph.D., Lars Cleemann, Ph.D., Georgetown University

Yubelka Hernandez, High School for Math, Science, and Engineering The effect of the inhibitor hydroclorothizide on the rectal gland of the spiny dogfish shark Mentors: Franklin H. Epstein, M.D., Harvard Medical School; Patricio Silva, M.D., Temple University School of Medicine

Alison Kieffer, University of Maine at Presque Isle Functional genomics of calcium regulation in brook trout Mentor: Charles Wray, Ph.D., MDIBL

Emily Miller, The University of Maine Expression and purification of recombinant Tropomyosin I Mentor: Sharon Ashworth, Ph.D., The University of Maine

Lauren Okano, Bates College Mentor: Pamela Baker, Ph.D., Bates College

Kaitlyn Schroeder, Univ. North Texas, and Jennifer Samford, Univ. North Texas Experimental design for studying the phenomenon of sickling in marine fish red blood cells Mentor: Ione Hunt von Herbing, University of North Texas

Susannah Stone, Bates College Investigating cryptic skate species at MDIBL Mentors: Charles Wray, Ph.D., MDIBL; Eric Swensen, M.D., University of Washington School of Medicine

Rachel Teo, University of British Columbia, and Junes Thete, University of Southern Maine New results with GAMI: Genetic algorithms for motif inference Mentor: Clare Congdon, Ph.D., University of Southern Maine

Hae Lim Yook, Fryeburg Academy The protective enzymes in the liver of vertebrates: Glutathione peroxidase and catalase Mentor: Lisa Crockett, Ph.D., Ohio University

August 8-9 7th Annual Mount Desert Island Stem Cell Symposium – “Epigenetic Regulation of Stem Cells.” Co-hosted by The Mount Desert Island Biological Laboratory and The Jackson Laboratory with support from the National Institute of Diabetes and Digestive and Kidney Diseases.

Friday, August 8 SESSION I: RNAs and microRNAs (Alex Schier, Ph.D., Harvard University, Chair)

“Transcriptional circuitry and epigenetic reprogramming in stem cells.” Keynote Address: Richard Young, Ph.D., Whitehead Institute, MIT

“Epigenetics, imprinting and disease susceptibility.” Randy Jirtle, Ph.D., Duke University Medical Center

“Multilevel regulation of gene expression by microRNAs.” Tom Maniatis, Ph.D., Harvard University

“Epigenetic crossroads in embryonic stem cells.” Louise Laurent, M.D., Ph.D., The Scripps Research Institute

“MicroRNA regulation of hematopoietic stem cells.” David Scadden, M.D., Massachusetts General Hospital

“MicroRNAs and morphogens.” Alex Schier, Ph.D., Harvard University

“MicroRNA-mediated control of hematopoietic lineage specification.” Jun Lu, Ph.D., The Broad Institute

“Zebrafish oogonial stem cells.” Bruce Draper, Ph.D., University of California, Davis

“Normal and neoplastic stem cells.” Irving Weissman, M.D., Stanford University School of Medicine

Saturday, August 9

SESSION II: Nuclear Reprogramming (Kyuson Yun, Ph.D., The Jackson Laboratory, Chair)

“Stem cells, pluripotency and nuclear reprogramming.” Rudolph Jaenisch, M.D., Whitehead Institute

“Dissecting the mechanism of direct reprogramming.” Alex Meissner, Ph.D., Harvard University

“Mechanism of transcription factor-induced reprogramming.” Kathrin Plath, Ph.D., UCLA School of Medicine

“Tissue-specific monitoring of transcriptional silencing in vivo.” Mary Goll, Ph.D., The Carnegie Institute

“Using zinc finger nucleases to modify the genome.” Nathan Lawson, Ph.D., Univ. Massachusetts Medical School

“Defining a role for telomeres and telomerase in adult stem cell biology and reprogramming.” Shawn Holt, Ph.D., Medical College of Virginia at Virginia Commonwealth University

“Transcription and nuclear organization of the genome.” Peter Fraser, Ph.D., Babraham Institute

SESSION III: Chromatin and Post-translational factors in epigenetics (Leonard Zon, M.D., HHMI / The Children’s Hospital, Chair)

“Epigenetics, chromatin remodeling and mammalian development.” Terry Magnuson, Ph.D., University of North Carolina

“Chromatin factors and zebrafish.” Leonard Zon, M.D., HHMI, The Children's Hospital

“Role of PRC2 in ES and other stem cells.” Stuart Orkin, M.D., HHMI, Dana Farber Cancer Institute

“Purification and expansion of hematopoietic stem cells based on proteins expressed by a novel fetal liver stromal cell population.” Harvey Lodish, Ph.D., Whitehead Institute

“Polycomb repressors controlling stem cell fate: Implications for cancer and development.” Maarten Van Lohuizen Ph.D., Netherlands Cancer Institute

SESSION IV: DNA and Protein Methylation (Leonard Zon. M.D., HHMI / The Children’s Hospital – Chair)

“Role of histone methylation in stem cell self-renewal.” Yi Zhang, Ph.D., HHMI, University of North Carolina-Chapel Hill

“DNA methyltransferase Dnmt3a antagonizes polycomb binding to poised differentiation genes.” Yi Sun, Ph.D., UCLA School of Medicine

August 13 Mini-Symposium on Trafficking and Regulation of ABC Transporters

“Introduction to ABC Transporters.” Gert Fricker, Ph.D., Professor, Institute of Pharmacology and Molecular Biotechnology, University of Heidelberg

“A new paradigm for explaining bio-accumulation: it’s as simple as ABC.” David Epel, Ph.D.,

“SGK Regulates CFTR Trafficking and Function.” Bruce A. Stanton, Ph.D., Professor and Director of the Lung Biology Center, Dartmouth Medical School

“ABC transporters and channel.” Jack R. Riordan, Ph.D., Professor, Biochemistry and Biophysics and Cystic Fibrosis Center, UNC at Chapel Hill

“Regulation of ABC transporter activity in blood-brain barrier.” David Miller, Ph.D., Senior Investigator, Laboratory of Pharmacology, NIH/NIEHS

“Cell surface reorganization.” Amro Hamdoun, Ph.D., Postdoctoral Research Fellow, Hopkins Marine Station, Stanford University 2008 COURSES

January 13 – 25 Imaging and Molecular Biology of the Brain Colby College INBRE course Andrea Tilden, Ph.D., Colby College

February 18 – 22 Molecular Biology Research Techniques: Functional Genomics of Calcium Deficiency University of Maine: Farmington and Machias INBRE course Charles Wray, Ph.D., MDIBL

March 3 – 14 Functional Genomics of Membrane Transport: Toxicogenomics of Arsenic University of Maine INBRE course Denry Sato, D.Phil., MDIBL Bruce Stanton, Ph.D., Dartmouth Medical School Jennifer Bomberger, Ph.D., Dartmouth Medical School Criss Hartzell, Ph.D., Emory School of Medicine Keith Hutchison, Ph.D., The University of Maine Carol Kim, Ph.D., The University of Maine Carolyn Mattingly, Ph.D., MDI Biological Laboratory Antonio Planchart, Ph.D., MDI Biological Laboratory

March 8 – 14 Environmental Toxicogenomics Bowdoin College INBRE course Carolyn Mattingly, Ph.D., MDI Biological Laboratory Antonio Planchart, Ph.D., MDI Biological Laboratory

March 17 – 28 Evolutionary Molecular Genetics College of the Atlantic INBRE course Charles Wray, Ph.D., MDIBL Chris Lage, Ph.D., UMaine – Augusta Chris Petersen, Ph.D., College of the Atlantic

May 5 – 16 Experimental Biology Bates College INBRE course Pam Baker, Ph.D., Bates College J. Denry Sato, Ph.D., Bates College

May 19 – 30 Community Ecology of Coastal Maine Washington College Martin Connaughton, Ph.D., Washington College

May 24 – 31 Structure and Function of Polarized Epithelial Cells University of Pittsburgh School of Medicine Ray Frizzell, Ph.D., University of Pittsburgh School of Medicine

May 31 – June 7 Tenth Annual Intensive Course in Quantitative Fluorescent Microscopy Simon Watkins, Ph.D., University of Pittsburg School of Medicine

June 7 – 14 Structure and Function of Polarized Epithelial Cells Yale University School of Medicine John N. Forrest, Jr., M.D., Yale University School of Medicine

August 25 – 29 Health and Colony Management of Laboratory Fish Paul Bowser, Ph.D., Cornell University Michael Kent, Ph.D., Oregon State University Jan Spitsbergen, Ph.D., Oregon State University

September 6 – 13 Course in Comparative Physiology Beth Israel Deaconess Medical Center, Harvard Medical School Mark Zeidel, M.D., Beth Israel Deaconess Medical Center

September 13 – 19 Origins of Renal Physiology Course for Renal Fellows Mark Zeidel, M.D., Beth Israel Deaconess Medical Center

PUBLICATIONS

Ballatori, N., Fang F., Christian, W.V., Li, N., Hammond, C.L. (2008). Ost!-Ost"; is required for bile acid and conjugated steroid disposition in the intestine, kidney, and liver. Am. J. Physiol. 295:G179- G186.

Barnes, D. W., Parton, A., Tomana, M., Hwang, J-H., Czenchanski, A., Fan, L., Collodi, P. (2008). Stem cells from cartilaginous and bony fish. Methods In Cell Biology. 86:343-67.

Beale, K.M., Towle, D.W., Jayasundara, N., Smith, C.M., Shields, J.D., Small, H.J., Greenwood, S.J. (2008). Anti-lipopolysaccharide factors in the American lobster Homarus americanus: Molecular characterization and transcriptional response to Vibrio fluvialis challenge. Comp. Biochem. Physiol. D3:263-269.

Blitz, D.M., White, R.S., Saideman, S.R., Christie, A.E., Nadim, F., Nusbaum, M.P. (2008). A newly identified extrinsic input triggers a distinct gastric mill rhythm via activation of modulatory projection neurons. J. Exp. Biol. 211:1000-1011.

Charmantier, G., Charmantier-Daures, M., Towle, D.W. (2008). Osmotic and ionic regulation in aquatic arthropods. In: Osmotic and Ionic Regulation: Cells and Animals (D.H. Evans, ed.), pp. 165- 230, CRC Press, Boca Raton.

Christie, A.E. (2008). In silico analyses of peptide paracrines/hormones in Aphidoidea. Gen. Comp. Endocrinol. 159:67-79.

Christie, A.E. (2008). Neuropeptide discovery in Ixodoidea: an in silico investigation using publicly accessible expressed sequence tags. Gen. Comp. Endocrinol. 157:174-185.

Christie, A.E, Cashman, C.R., Brennan, H.R., Ma, M., Sousa, G.L., Li, L., Stemmler, E.A., Dickinson, P.S. (2008). Identification of putative crustacean neuropeptides using in silico analyses of publicly accessible expressed sequence tags. Gen. Comp. Endocrinol. 156:246-264.

Christie, A.E., Cashman, C.R., Stevens, C.R., Smith, C.M., Beale, K.M., Stemmler, E.A., Greenwood, S.J., Towle, D.W., Dickinson, P.S. (2008). Identification and cardiotropic actions of brain/gut-derived tachykinin-related peptides (TRPs) from the American lobster Homarus americanus. Peptides 29: 1909-1918.

Christie, A.E., Sousa, G.L., Rus, S., Smith, C.M., Towle, D.W., Hartline, D.K., and Dickinson, P.S. (2008). Identification of A-type allatostatins possessing -YXFGI/Vamide carboxy-termini from the nervous system of the copepod crustacean Calanus finmarchicus. Gen. Comp. Endocrinol. 155: 526- 533.

Claiborne, J.B., Choe, K.P., Morrison-Shetlar, A.I., Weakley, J.C., Havird, J., Freiji, A., Evans, D.H., Edwards, S.L. (2008). Molecular detection and immunological localization of gill Na+/H+ exchanger in the dogfish (Squalus acanthias). Am. J. Physiol. 294: R1092-R1102.

Coffman, J.A. (2009). Mitochondria and metazoan epigenesis. Sem. Cell Dev. Biol. 20(3):321-9.

Davis, A.P., Murphy, C.G., Rosenstein, M.C., Wiegers, T., Boyer, J.L. and Mattingly, C.J. (2008). Using the Comparative Toxicogenomics Database to explore integrated chemical-gene disease relationships: Arsenic as a case study. BMC Medical Genomics, 1:48.

Davis A.P., Murphy, C., Saraceni-Richards, C.A., Rosenstein, M.C., Wiegers, T.C., and Mattingly, C.J. (2009). Comparative Toxicogenomics Database (CTD): a knowledgebase and discovery tool for chemical-gene-disease networks. Nucleic Acids Research. 37(Database issue):D786-92.

Dickinson, P.S., Stemmler, E.A., Cashman, C.R., Brennan, H.R., Dennison, B., Huber, K.E., Peguero, B., Rabacal, W., Goiney, C.C., Smith, C.M., Towle, D.W., and Christie, A.E. (2008). SIFamide peptides in clawed lobsters and freshwater crayfish (Crustacea, Decapoda, Astacidea): A combined molecular, mass spectrometric and electrophysiological investigation. Gen. Comp. Endocrinol. 156: 347-360.

Dickinson P.S., Stemmler, E.A., Christie, A.E. (2008). The pyloric neural circuit of the herbivorous crab Pugettia producta shows limited sensitivity to several neuromodulators that elicit robust effects in more opportunistically feeding decapods. J. Exp. Biol. 211:1434-1447.

Congdon C.B., Aman, J., Nava, G.M., Gaskins, H.R., Mattingly, C.J. (2008). An Evaluation of Information Content as a Metric of the Inference of Putative Conserved Noncoding Regions in DNA Sequence Using a Genetic Algorithms Approach, IEEE Transactions on Computational Biology and Bioinformatics. January.

Evans, D.H. (2008). Teleost fish osmoregulation: what have we learned since August Krogh, Homer Smith, and Ancel Keys? Am. J. Physiol. Reg. Comp. Integr. Physiol. 295: R704-713.

Evans, D.H., Claiborne, J.B. (2008). Osmotic and Ionic Regulation in Fishes. In: Osmotic and Ionic Regulation: Cells and Animals, ed. Evans, D.H., CRC Press, Boca Raton, pp. 295-366.

Gohlke, J., Thomas, R., Zhang, Y., Rosenstein, M.C., Davis, A.P., Murphy, C., Mattingly, C.J., Becker, K.G., Portier, C.J. (2009). The Genetic And Environmental Pathways to Complex Diseases. BMC Syst Biol. May 5;3:46.

Goth, T., Tsai, C-T., Chiang, F-T., Congdon, C.B. (2008). EpiSwarm, A Swarm-based System for Investigating Genetic Epistasis, in Chen, Y.-P., & Lim, M.-H. (Eds.) Linkage in Evolutionary Computation, V. 157 of Studies in Computational Intelligence. Springer.

Havird, J.C., Miyamoto, M.M., Choe, K.P., Evans, D.H. (2008). Gene duplications and losses within the cyclooxygenase family of teleosts and other chordates. Mol. Biol. Evol. 25: 2349-2359.

Hentschel, D., Schiffer, M. (2007). Rapid screening of glomerular slit diaphragm integrity in larval zebrafish. Am J Phys renal Phys.293: 1746-1750.

Hsu, Y.W., Stemmler, E.A., Messinger, D.I., Dickinson, P.S., Christie, A.E., de la Iglesia, H.O. (2008). Cloning and differential expression of two beta-pigment-dispersing hormone (beta-PDH) isoforms in the crab Cancer productus: Evidence for authentic beta-PDH as a local neurotransmitter and beta-PDH II as a humoral factor. J Comp Neurol. 508(2):197-211.

Hsu, Y.W., Weller, J.R., Christie, A.E, de la Iglesia, H.O. (2008). Molecular cloning of four cDNAs encoding prepro-crustacean hyperglycemic hormone (CHH) from the eyestalk of the red rock crab Cancer productus: identification of two genetically encoded CHH isoforms and two putative post- translationally derived CHH variants. Gen. Comp. Endocrinol. 155:517-525.

Hwang, J.-H., Parton, A., Czechanski, A., Ballatori, N., Barnes, D. (2008). Arachidonic acid-induced expression of the organic solute and steroid transporter-beta, Ost", in a cartilaginous fish cell line. Comparative Biochem. Physiol. 148:39-47.

Hyndman, K.A., Evans, D.H. (2008). Effects of environmental salinity on gill endothelin receptor expression in the killifish, Fundulus heteroclitus. Comp. Biochem. Physiol. A 152: 58-65.

Hyndman, K.A., Evans, D.H. (2008). Short term low-salinity tolerance by the longhorn sculpin, Myoxocephalus octodecimspinosus. J. Exp. Zool. 311A:45-56.

Kajiura, SM. Pupil dilation and visual field in the piked dogfish, Squalus acanthias. Env Biol Fish, in review.

Kusumoto, K., Parton, A., Barnes, D. (2009). Mitogen Limitation and Bone Morphogenetic Protein-4 Promote Neurogenesis in SFME cells, an EGF-Dependent Neural Stem Cell Line, In Vitro Cell and Developmental Biology. 45(1-2):55-61.

Lage, C.R., Petersen, C.W., Forest, D., Barnes, D., Kornfield, I., Wray, C. (2008). Evidence of multiple paternity in spiny dogfish (Squalus acanthias) broods based on microsatellite analysis. Journal of Fish Biology, 73:2068-2074.

Lee, L.E.J., Dayeh, V.R., Schirmer K., Bols N.C. (2009). Applications and potential uses of fish gill cell lines: examples with RTgill-W1. In Vitro Cellular & Developmental Biology – Animal. 45(3- 4):127-34.

Ma, M., Chen, R., Sousa, G., Bors, E.K., Kwiatkowski, M., Goiney, C.C., Goy, M.F., Christie, A.E., Li, L. (2008). Mass spectral characterization of peptide transmitters/hormones in the nervous system and neuroendocrine organs of the American lobster Homarus americanus. Gen. Comp. Endocrinol. 156:395-409.

Mattingly, C.J. (2009). Chemical databases for environmental health and clinical research. Toxicological Letters. 186(1):62-5.

Preston, R.L. (2009) Osmoregulation in Annelids. In, Osmotic and Ionic Regulation in Animals. Ed. by D. H. Evans), Taylor and Francis, LLC. pp 135-164.

Rast, J.P., Messier-Solek, C. (2008). Marine invertebrate genome sequences and our evolving understanding of animal immunity. Biol Bull. 214(3):274-83.

Reichel, V., Miller, D.S., Fricker, G. (2008). Texas Red transport across rat and dogfish shark (Squalus acanthias) choroid plexus. Am J Physiol Regul Integr Comp Physiol. 295:R1311-9.

Robertson, A.J., Coluccio, A., Knowlton, P., Dickey-Sims, C., and Coffman, J.A. (2008). Runx expression is mitogenic and mutually linked to wnt activity in blastula-stage sea urchin embryos. PLoS One. 3:11.

Schmidt J.J., McIlwain S., Page D., Christie A.E., Li, L. (2008). Combining MALDI-FTMS and bioinformatics for rapid peptidomic comparisons. J. Proteome Res. 7:887-896.

Serrano, L., Henry, R.P. (2008). Differential expression and induction of two carbonic anhydrase isoforms in the gills of the euryhaline green crab, Carcinus maenas, in response to low salinity. Comp. Biochem. Physiol. D:186-193.

Servili A., Bufalino M.R., Nishikawa R., Sanchez de Melo I., Munoz-Cueto J.A., Lee L.E.J. (2009). Establishment of long term cultures of neural stem cells from adult sea bass, Dicentrarchus labrax. Comparative Biochemistry and Physiology, Part A 152: 245-254

Shaw, J.R., Sato, J.D., VanderHeide, J., LaCasse, T., Stanton, C.R. Lankowski, A., Stanton, S.E., Chapline, C., Coutermarsh, B., Barnaby, R., Karlson, K., and Stanton, B.A. (2008). The role of SGK and CFTR in acute adaptation to seawater in Fundulus heteroclitus. Cell. Physiol. Biochem. 22: 69-78.

Sousa, G.L., Lenz, P.H., Hartline, D.K., Christie, A.E. (2008). Distribution of pigment dispersing hormone- and tachykinin-related peptides in the central nervous system of the copepod crustacean Calanus finmarchicus. Gen. Comp. Endocrinol. 156:454-459.

Stillman, J.H., Colbourne, J.K., Lee, C.E., Patel, N.H., Phillips, M.R., Towle, D.W., Eads, B.D., Gelembuik, G.W., Henry, R.P., Johnson, E.A., Pfrender, M.E., Terwilliger, N.B. (2008). Recent advances in crustacean genomics. Integ. Comp. Biol. 48: 852-868.

Tomana, M., Parton, A., Barnes, D. (2008), Improved methods for separation from peripheral blood and flow cytometric analysis of leukocytes from the little skate (Leucoraja erinacea). Fish and Shellfish Immunology 25:188-190. AUTHORS

Anderson, Michele K. 64 Eveland, Randy 90 Ashworth, Sharon L. 52 Fellner, Susan 20 Ballatori, Ned 93 Flynn, Erin E. 25 Barnes, David 69 Fontaine, Edal P. 83 Batta Lona, Paola 112 Forbush, Biff 23 Bell, Emilynne P. 52 Forrest, John N., Jr. 27, 31 Bentivegna, Carolyn S. 116 Francke, Jordan A. 25 Blasse, Anne-Kathrin 12, 75 Freeman, Tim 90 Blair, Salvatore 75 Fricker, Gert 102 Bohme, Lisa 71, 73 Frowerk, Lena-Sophie 71 Bols, Niels C. 55 Gary, Elizabeth S. 83 Bond, Samantha K. 52 Gaskins, H. Rex 99, 111 Boyer, James L. 93, 99 Germ, Kaylyn 96 Bradshaw, Helen E. 37 Gilman, Morgan S. 52 Brothers, Kimberly M. 103 Girotti, Albert 79 Buchanan, Patrick J. 6 Griffin, Nina E. 83, 103 Bucklin, Ann 112 Grim, Jeffrey M. 79 Cai, Shi-Ying 99 Grimaldi, Regina M. 52 Chapline, Christine M. 25 Haller, Hermann 71, 73 Chase, Megan J. 37 Hamdoun, Amro 59 Christie, Andrew 11, 112 Hampton, Thomas A. 103, 107 Claiborne, James 48, 50, 77 Han, Katherine 99 Clement, Ethan 37 Hart, Michael 31 Coffman, James A. 96 Hartline, Daniel K. 86, 114 Colletti, Sarah L. 120 Hassett, R. Patrick 112 Congdon, Clare Bates 111 Henry, Raymond 35, 65, 81 Connell, Laurie 121 Hentschel, Dirk 71, 73 Conrad, Abigail H. 39 Hernandez, Yubelka 14, 16, 17, 19 Conrad, Gary W. 37, 39 Hibino, Taku 62 Crockett, Elizabeth L. 79 Ho, Eric 62 Cronan, Matt 14, 16, 17, 19 Hogema, Boris M. 27 Davis, Allan Peter 109 Hunt von Herbing, Ione 92 de Jonge, Hugo R. 27, 31 Hwang, Jae-Ho 69 Dedeic, Zinaida 37 Hyndman, Kelly A. 6, 7, 8, 42, 50, Diamanduros, Andrew 48, 50 79 DiPietro, Christopher 116 Inthavong, Bounmy 55 Disney, Jane 120 Kajiura, Stephen M. 68 Dixon, Brian 55 Kawano, Atsushi 55 Doan, Khuyen 116 Kelley, Catherine A. 27, 31 Edelhauser, Henry F. 37 Kidder, George 37, 120 Edwards, Susan L. 12, 50, 75, 77 Kirsch, Torsten 71 Englert, Christoph 73 Kong, Jennifer H. 86, 114 Epstein, Franklin H. 14, 16, 17, 19, Kraft, Stefan 37 54 Kratochvilova, Hana 77 Epstein, Will 31 Kriska, Tamas 79 Evans, David H. 6, 7, 8, 42, Kufner, Anna 31 Lage, Chris 45, 47 Smith, Chris 112 LaRue, Kelly 48 Spokes, Katherine C. 16, 19, 54 Lee, Lucy E. J. 55 Staggs, Lynne 71, 73 Lenz, Petra 112 Stanton, Bruce A. 25 Lucu, Cedomil 11 Stidham, Jim 8 Lundquist, Richard R. 37 Swenson, Erik R. 20, 90 Madejczyk, Michael S. 93 Stone, Susanna 90 Mahringer, Anne 102 Swinburne, Cecily J. 25 Marquis, Hannah 52 Symour, Amy 102 Mattingly, Carolyn J. 43, 103, 107, Tallack, Shelly M.L. 68 109, 111 Tarley, Mia 48, 50 McCall, A. Scott 37 Teo, Rachael 111 Melita, August 31 Theodosiou, Nicole A. 88 Mennone, Albert 99 Thete, Junes 111 Merson, Rebeka 43 Tilly, Ben C. 27, 31 Messier-Solek, Cynthia 62 Towle, David W. 1, 11, 12, 112 Miller, David S. 102 Unal, Ebru 112 Miller, Emily E. 52 Wang, Guizhi 62 Monaco, Eric 42 Weihrauch, Dirk 12, 75 Monette, Michelle Y. 23 Wiegers, Thomas C. 109 Murphy, Cynthia G. 109 Wilbur, Bradley 48 Nava, Gerardo M. 111 Wray, Charles 45, 47 Oh, Jun-taek 116 Yook, Hae Lim 79 Parton, Angela 69 Petzel, David 9 Phillips, Matt 50 Planchart, Antonio J. 43, 103,107 Preston, Robert 83 Rast, Jonathan 62 Richards, Elizabeth K. 88 Robertson, Anthony J. 96 Rosenstein, Michael C. 109 Ruensirikul, Sirilak 83 Samford, Jennifer 92 Saraceni-Richards, Cynthia A. 109 Sato, J. Denry 25 Schiffer, Lena 71, 73 Schiffer, Mario 71, 73 Schroeder, Kaitlyn 92 Seymour, Amy 102 Shaw, Joseph R. 25 Shimoda, Larissa 20 Silva, Patricio 14, 16, 17, 19, 54 Simard, Maxwell 45 Simeone, Alyssa 88 Simonik, Elizabeth 65, 81 SPECIES

Asychis elongata 86 Leucoraja erinacea 69, 88, 93 (bamboo worm) (little skate) Calanus finmarchicus 112 Mya arenaria 121 (copepod) (softshell clam) Carcinus maenas 12, 35, 65 Myoxocephalus octodecimspinosus 7, 48, 50, 77 (green crab) (longhorn sculpin) Chironomidae 116 Myxine glutinosa 75, 79 (chironomid) (Atlantic hagfish) Ciona intestinalis 99, 111 Raja erinacea 64 (sea squirt) (Little skate) Danio rerio 52, 71, 73, Salmo salar 55 (zebrafish) 103, 107 (Atlantic salmon) Fundulus heteroclitus 1, 8, 9, 23, Squalus acanthias 6, 14, 16, 17, (spiny dogfish shark) (killfish) 25, 42, 83, 19, 20, 27, 102 31, 37, 39, Gadus morhua 92 43, 45, 47, (Atlantic cod) 54, 68, 90 Homarus americanus 11, 81, 114 Strongylocentrotus purpuratus 59, 62, 96 (American lobster) (purple sea urchin) Zostera marina 120 (eelgrass)

KEYWORDS

ABC transporter 99, 102 elasmobranch 68 acid-base balance 81 embryonic development 69 actin 52, 59 environmental exposure 96 albumin 16 epipodite 11 ammonia 65, 75 evolution 64 ammonium transporter 12 expressed sequence tags 1, 112 amrinone 31 fish health 55 anion-exchanger 7 fish intestine 55 anti-sense morpholino 25 fish cell lines 55 antioxidant(s) 79 functional determinants 99 aquaporins 88 functional genomics 112 arhydrogen-receptor 102 furosemide 17 arsenic 103 gastrointestinal cell cultures 55 arterial blood gases 90 gene expression microarray 96 bacteria 62 gene regulation 64 barometric pressure 90 genomics 43, 109 bioinformatics 111 gill 6, 7, 9, biomarker 116 12, 42, blade growth 120 50, 75 bumetanide 17 glomerulus 71, 73 carbonic anhydrase 35 GPx4 79 CFTR 6, 25 growth rate 120 chemical-gene interactions 109 Gulf of Maine 112 chloride 16 heavy metal 116 chloride secretion 27 hemoglobin 92, 11 CNP 27, 31 epatocyte 93 cofilin 52 hypoxia 20 colon evolution 88 infection 62 comparative physiology 81 immune response 103 confocal fluorescence microscopy 102 immunity 62, 64 conservation 45, 47 immunohistochemistry 6 cornea 37, 39 insect 116 crab 81 intertidal 65 craniofacial 107 intestine 23 creatinine 16 intracellular calcium 20 cross-linking 37 invertebrate 86, 114 crustacean 35, 65 ion transport 11 cyclic GNP 27, 31 ischemia 52 c-type natriuretic peptide 14 isoforms 48 CYP1a1 43 keratoconus 37 depth 90 kidney 52 development 103, 107 kidney tubule 102 dioxin 107 knockdown 8 DNA 111 light intensity 120 DNA sequencing 1 little skate cell line 69 manganese 93 sodium 16 microarray 1, 112 sonic hedgehog pathway 39 microsatellites 47 spawning 83 morpholino 8 squaliformes 68 mRNA 7 stress 92 mtDNA 45 sutural fibers 39 multidrug efflux 59 TCDD 107 myelin 86, 114 teratogen 96 Na+/H+ exchange 48, 77 tissue distribution 42, 48 NaKATPase 54 toxicology 43 NCC 54 transcription factor binding sites 111 Na-K-Cl cotransporter 23 transport 93 nervous system 86, 114 vascular smooth muscle 20 neuroendocrine factor 11 vasoactive intestinal peptide 14, 17 NHE 48,77 vasotocin receptor 42 NKCC 54 vision 68 organic solute and steroid tranporter 69 water efflux 9 oxidative stress 79 wt-1 73 oxygenation 90 xenobiotics 43 p38-MAP kinase 25 zinc chloride 96 P-gp 59 pathways 109 PGE receptor 6 phosphorylation 23 podocytes 71 polychaete 86 polyunsturrated fatty acid 79 population genetics 45, 47, 121 PSP 121 quantitative PCR 1 rectal gland 19, 27, 31 red tide 121 Rh glycoproteins 50, 75 RhgC1 50 Rhesus protein 12 salinity 35, 83 salt disposal 19 salt load 19 SB202190 14 serum- and glucocorticoid-iducible kinase 25 serum osmolality 9 sickling 92 skin 77 slit diaphram 71 RESEARCH SUPPORT

Appalachia State University 75

Boehringer Ingelheim Funds 102

Cades Foundation, Honolulu 86, 114

Canadian Institutes for Health 64 Research

Cystic Fibrosis Foundation 25

German Research Foundation 102

Environmental Protection 120, 120 Agency

Higuchi Foundation, 37, 39 University of Kansas Endowment Association

Irving A Hansen Memorial 69 Foundation

Aspirnaut Initiative 37

Kansas State University 37, 39

Katherine A. Davis Foundation 79

MDI Biological Laboratory New Investigator Award 9, 11, 20, 27, 31, 43, 45, 47, 50, 52, 55, 59, 62, 64, 68, 71, 73, 75, 77, 81, 88, 90, 92, 111, 112, 116, 121 Student Research Fellowships 12, 37, 45. 75, 79, 83

National Institutes of Health (NIH)

NIH / National Center for Investigator Research Grants 69 Research Resources

Maine IDeA Network of 9, 25, 37, 43, 45, 47, 52, 69, 81, Biomedical Research Excellence 83, 103, 107, 109, 111

Kansas IDeA Network of 37 Biomedical Research Excellence NIH / National Institute of Investigator Research Grants 59 Child Health and Human Development

NIH / National Institute of Investigator Research Grants 23, 25, 27, 31, 93, 99, 93, 99, Diabetes and Digestive and Kidney Diseases

NIH / National Institute of Investigator Research Grants 25, 69, 96, 109, 114 Environmental Health Sciences Center for Membrane Toxicity 27, 31, 43, 79, 83, 90, 99, 102, Studies 111

Short Term Educational Experience for Research (STEER) 25, 83

Center for Comparative 96, 103, 107, 119 Toxicology

NIH / National Eye Institute Investigator Research Grants 37

National Oceanic and Investigator Research Grants 121 Atmospheric Administration

Natural Sciences and 13, 55, 62, 75 Engineering Research Council of Canada (NSERC)

Ohio University 79, 112

University of Hawaii Pacific 114 Biosciences Research Center

Sunnybrook Research Institute 62

Seton Hall University 116

Thomas H. Maren Foundation 35

University of Maine 52, 103

United States Department of Agricultural Research Service 55 Agriculture National Research Initiative 92

Penobscot East Resource 114 Center

National Science Foundation Collaborative Research at 35, 41, 48, 65, 68, 77, 81 Undergraduate Institutions

Investigator Research Grants 11, 86, 112

Research Experience for 6, 7, 8, 9, 11, 12, 31, 37, 48, 50, Undergraduates 65, 75, 96

Thomas and Kate Jeffress 81 Memorial Trust