DOCSLIB.ORG

Characterization of Eleven Microsatellite Markers for the Tea Geometrid Ectropis Obliqua (Lepidoptera: Geometridae)

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Characterization of Eleven Microsatellite Markers for the Tea Geometrid Ectropis Obliqua (Lepidoptera: Geometridae) Appl Entomol Zool (2016) 51:673–676 DOI 10.1007/s13355-016-0442-3 TECHNICAL NOTE Characterization of eleven microsatellite markers for the tea geometrid Ectropis obliqua (Lepidoptera: Geometridae) Shengli Jing1,2 · Baoxiao Zheng1 · Li Qiao3 · Kun Zhang1 · Gaoyang Chen1 · Shunqin Guo1 · Xiaoyan Huang1 · Yanping Gao4 · Lili Zhang1,2 · Hongyu Yuan1,2 Received: 23 May 2016 / Accepted: 2 August 2016 / Published online: 29 September 2016 © The Japanese Society of Applied Entomology and Zoology 2016 Abstract The tea geometrid, Ectropis obliqua Prout (Lepi- Keywords Genetic diversity · Genomic library · doptera: Geometridae), is one of the most threatening Geometridae · Lepidoptera · Microsatellite pests of tea (Camellia sinensis (L.) O. Kuntze) plants. In this study, we developed eleven new polymorphic micro- satellite markers from tea geometrid by using the micros- Introduction atellite motif enriched library method. Polymorphism of each locus was detected in 69 individuals from three natu- The tea geometrid, Ectropis obliqua Prout, (Lepidop- ral populations. The number of alleles varied from 2 to 8, tera: Geometridae), is one of the most important pests of and the expected and observed heterozygosities ranged tea (Camellia sinensis (L.) O. Kuntze) plants in south- from 0.042 to 0.801 and from 0.042 to 0.875, respectively. ern China, especially in the producing regions of green Six loci had significant deviations from the Hardy–Wein- tea such as Jiangsu, Zhejiang, Anhui and Henan prov- berg equilibrium (HWE). These microsatellite markers inces (Zhang and Tan 2004). These tea-producing areas will be useful for the future study of this agricultural pest are frequently reported to have severe yield losses of tea in genetic diversity, population structure and evolution of production owing to tea geometrid. Currently, these pests resistance. This information will be allowed to establish are mainly controlled with chemical pesticides which new pest management strategies and improve the effective- can cause some problems such as pesticide-resistance, ness of pest control program of this species. environmental pollution and chemical residues on tea (Ye et al. 2014). Moreover, the intensive use of these pesticides can lead to change the genetic variation of tea geometrid population. Therefore, it is important to study * Shengli Jing the genetic diversity, population ecology and evolution [email protected] of E. oblique by molecular tools. Recently, the study of * Lili Zhang genetic analysis of E. oblique using mitochondrial gene [email protected] sequences has suggested deep genetic divergence among * Hongyu Yuan the seventeen geographical populations (Zhang et al. [email protected] 2014). However, there are not any available nuclear molecular markers for E. oblique such as microsatellite 1 College of Life Science, Xinyang Normal University, Xinyang 464000, China which has been used in other insects (Jing et al. 2012a, b; Kim et al. 2015; Kusumi and Su 2014; Suzuki and Yao 2 Institute for Conservation and Utilization of Agro‑bioresources in Dabie Mountains, Xinyang Normal 2014; Tan et al. 2016). University, Xinyang 464000, China In this study, the eleven new genomic microsatellite 3 Xinyang City Academy of Agricultural Sciences, markers of tea geometrid by a method of enriched genomic Xinyang 464000, China library were developed and used to study the genetic diver- 4 Environmental Monitoring Center Station of Zhumadian, sity in three populations of this species. Zhumadian 463000, China 1 3 674 Appl Entomol Zool (2016) 51:673–676 Materials and methods step of 72 °C for 10 min. PCR amplification products were size-fractionated by electrophoresis on 6 % denaturing The genomic DNA was extracted from tissue of E. obli- polyacrylamide sequencing gels that were run at a constant qua with a CTAB protocol (Tang et al. 2010). The (AC)13 power of 60 W, and then detected by silver staining (You and (AAG)8-enriched partial genomic libraries were con- et al. 2008). Allele sizes were scored by comparing with structed, employing a Fast Isolation by Amplified fragment pBR322 DNA/Msp I DNA size markers (Tiangen Biotech). length polymorphism (AFLP) of Sequences COntaining The level of polymorphism was determined for 69 indi- repeats (FIASCO) protocol (Zane et al. 2002). Fragments viduals from three populations of E. obliqua and collected containing microsatellite repeats were cloned into pUC18- from tea plants growing fields in Guangshan (114°30′E T vector (TaKaRa) and transformed into DH5α cells. 31°59′N), Luoshan (114°51′E 31°55′N) and Maanshan Finally, 128 positive clones with suitable insert length were (114°02′E 32°05′N), Henan Province, China. For each identified by PCR and sequenced on an ABI 3730 DNA locus, the number of alleles (Na), observed heterozygosity sequencer. (Ho), expected heterozygosity (He), tests for linkage dis- A total of 125 sequences were finally obtained, of equilibrium (LD) and deviations from Hardy–Weinberg which 110 sequences contained at least one microsatellite equilibrium (HWE) were calculated by the software Arle- locus. As a result, 93 primer pairs were designed by using quin 3.5 (Excoffier and Lischer 2010). The occurrence of BatchPrimer3 (You et al. 2008). For all PCR amplifica- a null allele was estimated by the software Micro-Checker tions, we used a PTC-100 thermal cycler (MJ Research) (Van Oosterhout et al. 2004). and performed in 10 µL volumes containing 10 ng of tem- plate DNA, 0.3 µM of each of the two primers, 0.2 mM deoxynucleotide triphosphates (dNTPs), 2.5 mM MgCl2, Results and discussion 1 PCR buffer, and 1 unit of Taq DNA polymerase (Fer- × mentas). The PCR cycling program, in each case, was Among the 93 primer pairs, 35 successfully amplified in 94 °C for 5 min, followed by 35 cycles of 94 °C for 15 s, the three tested individuals. And then a total of 11 out of 35 55 °C for 15 s, and 72 °C for 30 s, with a final extension primer pairs assessed were selected because they showed Table 1 Characteristics of 11 new microsatellite markers developed in Ectropis obliqua Locus Repeat motif Primer sequence (5′-3′) Size range (bp) GenBank accession number CH3 (TGA)12 F: TCGCTTAGAAATAAGCTGAGA 190–202 KU175831 R: TTCTGAATGACCTGGAAGTTA CH5 (GCGCA)4 F: ATGCTGAAGCTGTACCAGAG 160–180 KU175833 R: GAGTCAGTGGCACCTAATGT CH6 (TG)11 F: GCGGTCAAGTGTAAACCTAT 134–154 KU175833 R: GTACATGAACGACGAGTCTG CH25 (AAG)6 F: GACCTTCAGCAATGAAGATAA 146–160 KU175835 R: TCGCTTGAAATGGTAGAGATA CH32 (TCT)6 F: TCTTGCCAATTACTCCTATCA 148–190 KU175839 R: ACTTGTTTACAGATGGCTCAA CH48 (AC)6 F: ACGACAACTTGTGCATCTAAT 158–180 KU175846 R: GGTTGCATGAGTGAAAGTAAG CH53 (AG)11 F: AGTTTCCACTCAGAGACTGGT 122–132 KU175850 R: CCTGAGTAACTAAACTGGCAAT CH76 (CA)11 F: TTTATCGTATAGAGCGACCAG 136–180 KU175856 R: CAGTGCTAGGTAATGATTTGG CH77 (AC)9 F: TATCACACACACACACACACA 158–180 KU175856 R: CCAGGGAAATTACAGTGTTTA CH80 (AGA)4 F: CGAGGAGTAATGAGAAGGAAT 138–150 KU175857 R: AGACACACACACAGACAGACA CH81 (TG)10 F: CCAAAAAGTTGACGAAACTC 156–232 KU175858 R: CATAGCTAAGAACGAATCGAA 1 3 Appl Entomol Zool (2016) 51:673–676 675 Table 2 Diversity estimation Locus Population GS (n 24) Population LS (n 24) Population MAS (n 21) in three populations of Ectropis = = = obliqua Na Ho He D F Na Ho He D F Na Ho He D F CH3 6 0.652 0.757 NS – 6 0.762 0.744 NS – 6 0.789 0.691 NS – CH5 5 0.625 0.752 * – 2 0.042 0.042 NS – 5 0.714 0.688 NS – CH6 8 0.875 0.790 * – 5 0.696 0.647 NS – 5 0.800 0.719 * – CH25 3 0.478 0.617 NS – 3 0.417 0.584 NS 0.10 4 0.350 0.650 * 0.14 CH32 2 0.375 0.439 NS – 4 0.609 0.700 NS – 2 0.619 0.470 NS – CH48 2 0.125 0.120 NS – 8 0.696 0.801 * – 2 0.238 0.215 NS – CH53 5 0.652 0.715 NS – 7 0.833 0.729 NS – 5 0.800 0.700 NS – CH76 7 0.792 0.739 NS – 3 0.458 0.606 NS – 7 0.762 0.678 NS – CH77 5 0.458 0.761 * 0.13 8 0.667 0.791 * 0.19 6 0.619 0.718 NS – CH80 5 0.458 0.595 * – 6 0.375 0.768 * – 4 0.476 0.436 NS – CH81 7 0.708 0.768 NS – 3 0.375 0.577 NS – 6 0.619 0.727 NS – Mean 5 0.564 0.641 – – 5 0.539 0.635 – – 5 0.617 0.608 – – * significant deviations from Hardy–Weinberg expectations (p < 0.05) N population sample size, Ho observed heterozygosity, He expected heterozygosity, Na number of alleles, D deviation from Hardy–Weinberg equilibrium, F frequencies of null allele, NS not significant, Population GS Guangshan population, Population LS Luoshan population, Population MAS Maanshan population polymorphisms among 69 individuals of the three popula- To the best of our knowledge, this study is the first report tions which were collected from the tea producing areas of on the development of polymorphic microsatellite markers China. The sequences of these 11 microsatellite loci were in this pest. These new loci will provide powerful molecu- deposited in NCBI database (Genbank accession numbers lar tools for investigating the genetic divergence among showed in Table 1). different geographic populations and studying the genetic It was found that the degree of polymorphism among diversity and population structure of this threatening agri- three populations was similar. The average number of cultural pest. alleles per locus for each population was 5, and the mean observed heterozygosity was small different. The num- Acknowledgments This work was supported by the National Natural bers of detected alleles per locus in 69 individuals ranged Science Foundation of China (31401732) and the Project of Henan Provincial Science and Technology (Grant No. 162102110089). from 2 to 8, with an average of 5 alleles. The observed heterozygosity ranged from 0.042 to 0.875 (mean 0.573) and expected heterozygosity from 0.042 to 0.801 (mean 0.628) (Table 2).
Load more

Recommended publications
  • Viruses 2015, 7, 306-319; Doi:10.3390/V7010306 OPEN ACCESS
    Viruses 2015, 7, 306-319; doi:10.3390/v7010306 OPEN ACCESS viruses ISSN 1999-4915 www.mdpi.com/journal/viruses Review History and Current Status of Development and Use of Viral Insecticides in China Xiulian Sun Key Laboratory of Agricultural and Environmental Microbiology, Wuhan Institute of Virology, Chinese Academy of Sciences, Wuhan 430071, China; E-Mail: [email protected]; Tel.: +86-27-8719-8641; Fax: +86-27-8719-8072 Academic Editors: John Burand and Madoka Nakai Received: 1 December 2014 / Accepted: 14 January 2015 / Published: 20 January 2015 Abstract: The use of insect viruses as biological control agents started in the early 1960s in China. To date, more than 32 viruses have been used to control insect pests in agriculture, forestry, pastures, and domestic gardens in China. In 2014, 57 products from 11 viruses were authorized as commercial viral insecticides by the Ministry of Agriculture of China. Approximately 1600 tons of viral insecticidal formulations have been produced annually in recent years, accounting for about 0.2% of the total insecticide output of China. The development and use of Helicoverpa armigera nucleopolyhedrovirus, Mamestra brassicae nucleopolyhedrovirus, Spodoptera litura nucleopolyhedrovirus, and Periplaneta fuliginosa densovirus are discussed as case studies. Additionally, some baculoviruses have been genetically modified to improve their killing rate, infectivity, and ultraviolet resistance. In this context, the biosafety assessment of a genetically modified Helicoverpa armigera nucleopolyhedrovirus is discussed. Keywords: viral insecticides; commercialization; genetic modification 1. Introduction Research on insect viruses in China started with the Bombyx mori nucleopolyhedrovirus in the mid-1950s [1] and, to date, more than 200 insect virus isolates have been recorded in China.
    [Show full text]
  • Detecting Deep Divergence in Seventeen Populations of Tea Geometrid (Ectropis Obliqua Prout) in China by COI Mtdna and Cross-Breeding
    Detecting Deep Divergence in Seventeen Populations of Tea Geometrid (Ectropis obliqua Prout) in China by COI mtDNA and Cross-Breeding Gui-Hua Zhang1., Zhi-Jun Yuan1., Chuan-Xi Zhang2, Kun-Shan Yin1, Mei-Jun Tang1, Hua-Wei Guo1, Jian-Yu Fu1*, Qiang Xiao1* 1 Key Laboratory of Tea Plants Biology and Resources Utilization of Agriculture Ministry, Tea Research Institute, Chinese Academy of Agricultural Sciences, Hangzhou, China, 2 Institute of Insect Science, Zhejiang University, Hangzhou, China Abstract The tea geometrid (Ectropis obliqua Prout, Lepidoptera: Geometridae) is a dominant chewing insect endemic in most tea- growing areas in China. Recently some E. obliqua populations have been found to be resistant to the nucleopolyhedrovirus (EoNPV), a host-specific virus that has so far been found only in E. obliqua. Although the resistant populations are morphologically indistinguishable from susceptible populations, we conducted a nationwide collection and examined the genetic divergence in the COI region of the mtDNA in E. obliqua. Phylogenetic analyses of mtDNA in 17 populations revealed two divergent clades with genetic distance greater than 3.7% between clades and less than 0.7% within clades. Therefore, we suggest that E. obliqua falls into two distinct groups. Further inheritance analyses using reciprocal single-pair mating showed an abnormal F1 generation with an unbalanced sex ratio and the inability to produce fertile eggs (or any eggs) through F1 self-crossing. These data revealed a potential cryptic species complex with deep divergence and reproductive isolation within E. obliqua. Uneven distribution of the groups suggests a possible geographic effect on the divergence. Future investigations will be conducted to examine whether EoNPV selection or other factors prompted the evolution of resistance.
    [Show full text]
  • Effects of Chemical Insecticide Imidacloprid on the Release of C6
    www.nature.com/scientificreports OPEN Efects of Chemical Insecticide Imidacloprid on the Release of C6 Green Leaf Volatiles in Tea Plants Received: 31 May 2018 Accepted: 23 November 2018 (Camellia sinensis) Published: xx xx xxxx Qiying Zhou1,2,3, Xi Cheng1, Shuangshuang Wang1, Shengrui Liu1 & Chaoling Wei1 Chemical insecticides are widely used for pest control worldwide. However, the impact of insecticides on indirect plant defense is seldom reported. Here, using tea plants and the pesticide imidacloprid, efects of chemical insecticides on C6-green leaf volatiles (GLVs) anabolism and release were investigated frst time. Compared with the non-treated control plants, the treatment of imidacloprid resulted in the lower release amount of key GLVs: (Z)-3-hexenal, n-hexenal, (Z)-3-hexene-1-ol and (Z)-3-Hexenyl acetate. The qPCR analysis revealed a slight higher transcript level of the CsLOX3 gene but a signifcantly lower transcript level of CsHPL gene. Our results suggest that imidacloprid treatment can have a negative efect on the emission of GLVs due to suppressing the critical GLVs synthesis-related gene, consequently afecting plant indirect defense. In response to insect herbivore and pathogen attacks, tea plants can exhibit direct and indirect defenses. Direct defenses employs structural or toxic components to against the aggressor. By contrast, indirect defenses utilizes 1–4 volatiles to attract natural enemies of the attackers . Green leaf volatiles (GLVs) including six-carbon (C6) alde- hydes, alcohols, and their esters, are important components of plant indirect defenses5–7. GLVs are formed by a two-step reaction catalyzed by lipoxygenase (LOX) and fatty acid 13-hydroperoxide lyase (13HPL), which use linolenic or linoleic acids as substrate.
    [Show full text]
  • Acquired Natural Enemies of Oxyops Vitiosa 1
    Christensen et al.: Acquired Natural Enemies of Oxyops vitiosa 1 ACQUIRED NATURAL ENEMIES OF THE WEED BIOLOGICAL CONTROL AGENT OXYOPS VITIOSA (COLEPOTERA: CURCULIONIDAE) ROBIN M. CHRISTENSEN, PAUL D. PRATT, SHERYL L. COSTELLO, MIN B. RAYAMAJHI AND TED D. CENTER USDA/ARS, Invasive Plant Research Laboratory, 3225 College Ave., Ft. Lauderdale, FL 33314 ABSTRACT The Australian curculionid Oxyops vitiosa Pascoe was introduced into Florida in 1997 as a biological control agent of the invasive tree Melaleuca quinquenervia (Cav.) S. T. Blake. Pop- ulations of the weevil increased rapidly and became widely distributed throughout much of the invasive tree’s adventive distribution. In this study we ask if O. vitiosa has acquired nat- ural enemies in Florida, how these enemies circumvent the protective terpenoid laden exu- dates on larvae, and what influence 1 of the most common natural enemies has on O. vitiosa population densities? Surveys of O. vitiosa populations and rearing of field-collected individ- uals resulted in no instances of parasitoids or pathogens exploiting weevil eggs or larvae. In contrast, 44 species of predatory arthropods were commonly associated (>5 individuals when pooled across all sites and sample dates) with O. vitiosa. Eleven predatory species were ob- served feeding on O. vitiosa during timed surveys, including 6 pentatomid species, 2 formi- cids and 3 arachnids. Species with mandibulate or chelicerate mouthparts fed on adult stages whereas pentatomids, with haustellate beaks, pierced larval exoskeletons thereby by- passing the protective larval coating. Observations of predation were rare, with only 8% of timed surveys resulting in 1 or more instances of attack. Feeding by the pentatomid Podisus mucronatus Uhler accounted for 76% of all recorded predation events.
    [Show full text]
  • Transcriptomic Analysis Reveals Insect Hormone Biosynthesis Pathway Involved in Desynchronized Development Phenomenon in Hybridi
    insects Article Transcriptomic Analysis Reveals Insect Hormone Biosynthesis Pathway Involved in Desynchronized Development Phenomenon in Hybridized Sibling Species of Tea Geometrids (Ectropis grisescens and Ectropis obliqua) 1, 1, 2 1 2 1, Zhibo Wang y, Jiahe Bai y, Yongjian Liu , Hong Li , Shuai Zhan and Qiang Xiao * 1 Key Laboratory of Tea Quality and Safety Control, Tea Research Institute, Ministry of Agriculture, Chinese Academy of Agricultural Sciences, Hangzhou 310008, China; [email protected] (Z.W.); [email protected] (J.B.); [email protected] (H.L.) 2 Key Laboratory of Insect Developmental and Evolutionary Biology, Institute of Plant Physiology and Ecology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200032, China; [email protected] (Y.L.); [email protected] (S.Z.) * Correspondence: [email protected]; Tel.: +86-0571-86650801 These authors contributed equally to this work. y Received: 19 September 2019; Accepted: 24 October 2019; Published: 1 November 2019 Abstract: Ectropis grisescens and Ectropis obliqua are sibling species of tea-chewing pests. An investigation of the distribution of tea geometrids was implemented for enhancing controlling efficiency. E. grisescens is distributed across a wider range of tea-producing areas than Ectropis obliqua in China with sympatric distribution found in some areas. In order to explore reproductive isolation mechanisms in co-occurrence areas, hybridization experiments were carried out. Results showed they can mate but produce infertile hybrids. During experiments, the desynchronized development phenomenon was found in the hybridized generation of sibling tea geometrids. Furthermore, transcriptome analysis of those individuals of fast-growing and slow-growing morphs revealed that the insect hormone biosynthesis pathway was enriched in two unsynchronized development groups of hybrid offspring.
    [Show full text]
  • Spodoptera Frugiperda Gloria Patricia Barrera1†, Mariano Nicolás Belaich2*†, Manuel Alfonso Patarroyo3,4, Laura Fernanda Villamizar1 and Pablo Daniel Ghiringhelli2
    Barrera et al. BMC Genomics (2015) 16:1008 DOI 10.1186/s12864-015-2218-5 RESEARCH ARTICLE Open Access Evidence of recent interspecies horizontal gene transfer regarding nucleopolyhedrovirus infection of Spodoptera frugiperda Gloria Patricia Barrera1†, Mariano Nicolás Belaich2*†, Manuel Alfonso Patarroyo3,4, Laura Fernanda Villamizar1 and Pablo Daniel Ghiringhelli2 Abstract Background: Baculoviruses are insect-associated viruses carrying large, circular double-stranded-DNA genomes with significant biotechnological applications such as biological pest control, recombinant protein production, gene delivery in mammals and as a model of DNA genome evolution. These pathogens infect insects from the orders Lepidoptera, Hymenoptera and Diptera, and have high species diversity which is expressed in their diverse biological properties including morphology, virulence or pathogenicity. Spodoptera frugiperda (Lepidoptera: Noctuidae), the fall armyworm, represents a significant pest for agriculture in America; it is a host for baculoviruses such as the Spodoptera frugiperda multiple nucleopolyhedrovirus (SfMNPV) (Colombia strain, genotype A) having been classified as a Group II alphabaculovirus making it a very attractive target for bioinsecticidal use. Results: Genome analysis by pyrosequencing revealed that SfMNPV ColA has 145 ORFs, 2 of which were not present in the other sequenced genotypes of the virus (SfMNPV-NicB, SfMNPV-NicG, SfMNPV-19 and SfMNPV-3AP2). An in-depth bioinformatics study showed that ORF023 and ORF024 were acquired by a recent homologous recombination process between Spodoptera frugiperda and Spodoptera litura (the Oriental leafworm moth) nucleopolyhedroviruses. Auxiliary genes are numerous in the affected locus which has a homologous region (hr3), a repetitive sequence associated with genome replication which became lost in SfColA along with 1 ORF.
    [Show full text]
  • Sensory Genes Identification with Head Transcriptome of the Migratory
    www.nature.com/scientificreports OPEN Sensory genes identification with head transcriptome of the migratory armyworm, Mythimna Received: 25 October 2016 Accepted: 08 March 2017 separata Published: 07 April 2017 Zhenxing Liu, Xiaoyun Wang, Chaoliang Lei & Fen Zhu Sensory system plays important roles in a wide array of insect’s behavior and physiological events, including the host landing and locating, feeding, flying, sex responding, mating and oviposition which happen independently and in sequence. The armyworm Mythimna separata (Lepidoptera: Noctuidae) of migratory insect is destructive for alimentarn crop and economic crop throughout the world. Here we present the high throughput sequencing of the head transcriptome and identify members of the major sensory genes which are crucial for armyworm’s success worldwide, including 8 opsins, 22 chemosensory proteins, 50 odorant binding proteins, 60 odorant receptors, 8 gustatory receptors, 24 ionotropic receptors, and 2 sensory neuron membrane proteins. It is worth noting that a duplication of the LW opsin gene exists in this insect. Several genes were clustered with functionally validated genes, such as Co-receptors of OR and IR, PBPs, PRs, CO2 GRs, bitter GRs and sweet GRs, were also identified. The transcriptome gene library provided the basis for further studies that elucidate the fundamental molecular mechanism of biology and control in M. separata. Our research exhibits the first comprehensive catalogue of the sensory genes fundamental for success and distribution in M. separata, which are potential novel targets for pest control strategies. Insects are the most successful living creature consideration of the numbers, the biomass, and their distribu- tion, in which the sensory systems play a significant role in their success.
    [Show full text]
  • The Baculoviral Genome
    1 The Baculoviral Genome M. Leticia Ferrelli1, Marcelo F. Berretta2, Mariano N. Belaich3, P. Daniel Ghiringhelli3, Alicia Sciocco-Cap2 and Víctor Romanowski1 1Instituto de Biotecnología y Biología Molecular, Facultad de Ciencias Exactas, Universidad Nacional de La Plata, CONICET 2Laboratorio de Ingeniería Genética y Biología Celular y Molecular - Area Virosis de Insectos, Departamento de Ciencia y Tecnología, Universidad Nacional de Quilmes 3Instituto de Microbiología y Zoología Agrícola, INTA Castelar Argentina 1. Introduction The molecular biology of Baculoviruses has drawn a great deal of interest due to the variety of applications of these viruses as: 1) agents for biological control of insect pests (Szewczyk et al., 2006); 2) vectors for expression of recombinant proteins in insect cells (Kost et al., 2005); 3) vehicles for gene transduction of mammal cells (Hu, 2006, 2008); and 4) display systems of recombinant epitopes (Makela et al., 2010). Baculoviridae is a family of insect-specific viruses, with more than 600 reported species, mainly isolated from Lepidoptera (butterflies and moths) and in some cases from Hymenoptera (sawflies) and Diptera (mosquitoes). Baculoviruses have circular, double- stranded DNA genomes ranging in size from approximately 80 to 180 kbp, depending on the species, that are predicted to encode for up to 180 genes. The viral genome associates with proteins forming a nucleocapsid. This structure is surrounded by a membrane envelope to form a rod-shaped virion (hence, the name of the Family: baculum is Latin for rod or stick). During their biological cycle, most baculoviruses produce two different virion phenotypes: the budded virus (BV) appears early in infected cells and is responsible for the dissemination of the disease inside the insect body, whereas the occluded virus (OV) is produced in the very late stage of the infection and becomes embedded in a protein matrix forming a distinct structure known as occlusion body (OB) which is responsible for the horizontal transmission of the virus.
    [Show full text]
  • Tea: Biological Control of Insect and Mite Pests in China ⇑ Gong-Yin Ye A, , Qiang Xiao B, Mao Chen C, Xue-Xin Chen A, Zhi-Jun Yuan B, David W
    Biological Control 68 (2014) 73–91 Contents lists available at SciVerse ScienceDirect Biological Control journal homepage: www.elsevier.com/locate/ybcon Tea: Biological control of insect and mite pests in China ⇑ Gong-Yin Ye a, , Qiang Xiao b, Mao Chen c, Xue-xin Chen a, Zhi-jun Yuan b, David W. Stanley d, Cui Hu a a Key Laboratory of Agricultural Entomology of Ministry of Agriculture, Institute of Insect Sciences, Zhejiang University, Hangzhou 310058, China b Tea Research Institute, Chinese Academy of Agricultural Sciences, Hangzhou 310008, China c Department of Entomology, Cornell University, New York State Agricultural Experiment Station, Geneva, NY 14456, USA d USDA/Agricultural Research Service, Biological Control of Insects Research Laboratory, 1503 S. Providence Road, Columbia, MO 65203, USA highlights graphical abstract More than 1100 species of natural enemies recorded in China have been summarized. Biological characteristics of some dominant natural enemies have been well reviewed. Various biocontrol measures combined with other IPM approaches have been reviewed. The future researches and policy implementation of tea pests are suggested. article info abstract Article history: Tea is one of the most economically important crops in China. To secure its production and quality, bio- Available online 3 July 2013 logical control measures within the context of integrated pest management (IPM) has been widely pop- ularized in China. IMP programs also provide better control of arthropod pests on tea with less chemical Keywords: insecticide usage and minimal impact on the environment. More than 1100 species of natural enemies Tea ecosystem including about 80 species of viruses, 40 species of fungi, 240 species of parasitoids and 600 species of Biological control predators, as well as several species of bacteria have been recorded in tea ecosystems in China.
    [Show full text]
  • Benzothiadiazole and B-Aminobutyricacid Induce Resistance to Ectropis Obliqua in Tea Plants (Camellia Sinensis (L.) O
    molecules Article Benzothiadiazole and B-Aminobutyricacid Induce Resistance to Ectropis Obliqua in Tea Plants (Camellia Sinensis (L.) O. Kuntz) Huan Li 1,†, Ying Yu 2,†, Zhenzhen Li 1, Emmanuel Arkorful 2, Yiyang Yang 1, Xinqiu Liu 2, Xinghui Li 2,* and Ronglin Li 1,* 1 Institute of Leisure Agriculture, Jiangsu Academy of Agricultural Science, Nanjing 210014, China; [email protected] (H.L.); [email protected] (Z.L.); [email protected] (Y.Y.) 2 Tea Research Institute, Nanjing Agricultural University, Nanjing 210095, China; [email protected] (Y.Y.); [email protected] (E.A.); [email protected] (X.L.) * Correspondence: [email protected] (X.L.); [email protected] (R.L.); Tel./Fax: +86-25-8439-6212 (X.L.); +86-25-8439-0422 (R.L.) † These authors contributed equally to this work. Received: 14 April 2018; Accepted: 24 May 2018; Published: 28 May 2018 Abstract: In order to investigate the effect of benzothiadiazole (BTH) and β-aminobutyric acid (BABA) on the resistance of tea plants (Camellia sinensis) to tea geometrid (Ectropis obliqua), three levels each of benzothiadiazole (BTH) and β-aminobutyric acid (BABA) were sprayed on 10-year-old tea plants. Generally PPO and PAL activities increased with low concentrations of BTH and BABA treatments. Quantitative RT-PCR revealed a 1.43 and 2.72-fold increase in PPO gene expression, and 3.26 and 3.99-fold increase in PAL gene expression with 75 mg/L BTH and 400 mg/L BABA respectively. Analysis of hydrolysis of synthetic substrates also revealed that chymotrypsin-like enzyme activity present in larval midgut extracts was not significantly inhibited by BTH and BABA.
    [Show full text]
  • Wolbachia Strain Wgri from the Tea Geometrid Moth Ectropis Grisescens Contributes to Its Host’S Fecundity
    fmicb-12-694466 July 13, 2021 Time: 17:17 # 1 ORIGINAL RESEARCH published: 19 July 2021 doi: 10.3389/fmicb.2021.694466 Wolbachia Strain wGri From the Tea Geometrid Moth Ectropis grisescens Contributes to Its Host’s Fecundity Yong Zhang1,2†, Song Liu1†, Rui Jiang1†, Chen Zhang1, Tian Gao1, Yun Wang3, Cui Liu1, Yanhua Long2*, Yinglao Zhang2* and Yunqiu Yang1* 1 State Key Laboratory of Tea Plant Biology and Utilization, Anhui Agricultural University, Hefei, China, 2 School of Life Sciences, Anhui Agricultural University, Hefei, China, 3 Lu’an Academy of Agricultural Sciences, Lu’an, China Members of the Wolbachia genus manipulate insect–host reproduction and are the most abundant bacterial endosymbionts of insects. The tea Geometrid moth Ectropis grisescens (Warren) (Lepidoptera: Geometridae) is the most devastating insect pest of tea plants [Camellia sinensis (L.) O. Kuntze] in China. However, limited data on the diversity, typing, or phenotypes of Wolbachia in E. grisescens are available. Here, Edited by: we used a culture-independent method to compare the gut bacteria of E. grisescens George Tsiamis, University of Patras, Greece and other tea Geometridae moths. The results showed that the composition of core Reviewed by: gut bacteria in larvae of the three Geometridae moth species was similar, except for Aggeliki Saridaki, the presence of Wolbachia. Moreover, Wolbachia was also present in adult female Technical University of Crete, Greece Monica Rosenblueth, E. grisescens samples. A Wolbachia strain was isolated from E. grisescens and National Autonomous University designated as wGri. Comparative analyses showed that this strain shared multilocus of Mexico, Mexico sequence types and Wolbachia surface protein hypervariable region profiles with *Correspondence: cytoplasmic incompatibility (CI)-inducing strains in supergroup B; however, the wGri- Yunqiu Yang [email protected] associated phenotypes were undetermined.
    [Show full text]
  • Chemosensory Systems in Predatory Mites: from Ecology to Genome
    Systematic & Applied Acarology ± ,661 SULQW KWWSVGRLRUJVDD ,661 RQOLQH 5HYLHZ &KHPRVHQVRU\V\VWHPVLQSUHGDWRU\PLWHVIURPHFRORJ\WRJHQRPH <$2=21*68%2=+$1* ;8(121*;8 Laboratory of Predatory Mites, Institute of Plant Protection, Chinese Academy of Agricultural Sciences, 100193 Beijing, People’s Republic of China; *Corresponding authors: [email protected], [email protected] $EVWUDFW 7KHUHFHSWLRQRIFKHPLFDOFXHVLQWKHHQYLURQPHQWLVHVVHQWLDOIRUWKHVXUYLYDORIDOPRVWDOORUJDQLVPVLQFOXGLQJ SK\WRVHLLGPLWHV&RPSDUHGZLWKWKHSURJUHVVPDGHLQWKHILHOGRILQVHFWROIDFWLRQWKHXQGHUVWDQGLQJRIKRZ SUHGDWRU\ PLWHV SHUFHLYH FKHPLFDO FRPSRXQGV DQG UHDFW WR WKHLU VXUURXQGLQJV LV PHUHO\ IUDJPHQWDULO\ GRFXPHQWHGLQSDVWGHFDGHV,QWKLVUHYLHZZHSURYLGHDJXLGHLQWKHILHOGIURPFKHPRHFRORJ\RIKHUELYRUH LQGXFHGSODQWYRODWLOHV +,39V DVHDUO\DVVWRWKHDGYDQFHVPDGHLQFRPSDUDWLYHJHQRPLFVRISUHGDWRU\ PLWHVLQ:HSUHVHQWIURPWKUHHDVSHFWVLHFKHPRVHQVRU\JXLGHGIHHGLQJEHKDYLRUVHQVRU\VWUXFWXUHV DQG FKHPRUHFHSWRUV SUHGLFWHG IURP JHQRPHV 7KH PROHFXODU SULQFLSOHV RI FKHPRVHQVRU\ V\VWHP UHPDLQ H[FLWLQJDUHDVIRUIXWXUHUHVHDUFKVLQFHLQVLJKWVLQWRWKHPHFKDQLVPVXQGHUO\LQJWKHVHQVLQJRIFKHPLFDOVLJQDOV ZLOOQRWRQO\FRQWULEXWHWRDEHWWHUXQGHUVWDQGLQJRISUHGDWRUEHKDYLRUDQGSK\VLRORJ\EXWPD\DOVRRSHQQHZ DYHQXHVIRUWKHGHYHORSPHQWRIPRUHVSHFLILFDQGVXVWDLQDEOHDSSURDFKHVWRFRQWUROSHVWVE\PDQLSXODWLQJ EHKDYLRUV LQ SUHGDWRUV :H WKHQ VXJJHVW WKUHH GLUHFWLRQV IRU IXWXUH UHVHDUFK FKHPRUHFHSWRU JHQH LGHQWLILFDWLRQ DQG IXQFWLRQ YHULILFDWLRQ QHXUDO UHVSRQVH FLUFXLW WR VWLPXOL DQG DSSOLFDWLRQ RI FKHPRSHUFHSWLRQRQIHHGLQJEHKDYLRU7KHSRWHQWLDOPHWKRGVDQGWHFKQLTXHVDUHSURYLGHGDVZHOO
    [Show full text]