DOCSLIB.ORG

Elevated Expression of TANK-Binding Kinase 1 Enhances Tamoxifen Resistance in Breast Cancer

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Elevated Expression of TANK-Binding Kinase 1 Enhances Tamoxifen Resistance in Breast Cancer Elevated expression of TANK-binding kinase 1 PNAS PLUS enhances tamoxifen resistance in breast cancer Congwen Weia,1, Yuan Caob,c,1, Xiaoli Yanga,d,1, Zirui Zhenga, Kai Guana, Qiang Wangb, Yanhong Taie, Yanhong Zhanga, Shengli Maa, Ye Caoa, Xiaoxing Gea, Changzhi Xua, Jia Lia, Hui Yanf, Youguo Linga, Ting Songa, Lin Zhug, Buchang Zhangg, Quanbin Xua, Chengjin Huc,2, Xiu-wu Bianb,2, Xiang Hea,h,2, and Hui Zhonga,2 aState Key Laboratory of Pathogen and Biosecurity, Beijing Institute of Biotechnology, Beijing 100850, China; bInstitute of Pathology and Southwest Cancer Center, Southwest Hospital, Third Military Medical University, Chongqing 400038, China; Departments of cLaboratory Medicine and ePathology, General Hospital of Jinan Military Region, Jinan, Shandong 250031, China; dGeneral Hospital of People’s Armed Police Hospital, Beijing 100039, China; fBeijing Institute of Pharmacology and Toxicology, Beijing 100850, China; gInstitute of Health Science, School of Life Sciences, AnHui University, Hefei, Anhui 230601, China; and hBeijing Institute of Disease Control and Prevention, Beijing 100071, China Edited by Jan-Åke Gustafsson, University of Houston, Houston, TX, and approved December 17, 2013 (received for review August 31, 2013) Resistance to antiestrogens is one of the major challenges in endocrine therapies (19, 20). For instance, ERα phosphorylation breast cancer treatment. Although phosphorylation of estrogen at Ser-118 has been suggested to be involved in protein turnover receptor α (ERα) is an important factor in endocrine resistance, the and directly associated with tamoxifen sensitivity (21–23). How- contributions of specific kinases in endocrine resistance are still ever, the contributions and mechanisms of specific kinase- not fully understood. Here, we report that an important innate mediated ERα phosphorylation in endocrine resistance are not immune response kinase, the IκB kinase-related TANK-binding ki- fully known. nase 1 (TBK1), is a crucial determinant of resistance to tamoxifen Here, we investigated the possible role of TBK1 protein in therapies. We show that TBK1 increases ERα transcriptional activ- tamoxifen resistance and found that phosphorylation by TBK1 at ity through phosphorylation modification of ERα at the Ser-305 the Ser-305 site stabilized ERα and modulated its transcriptional site. Ectopic TBK1 expression impairs the responsiveness of breast activity. Although ubiquitin-like domain (ULD)–mutated TBK1 cancer cells to tamoxifen. By studying the specimens from patients failedtoactivateIFN-β promoters, it retained the ability to with breast cancer, we find a strong positive correlation of TBK1 phosphorylate ERα, induce ERα transactivational activity, and α α with ER ,ER Ser-305, and cyclin D1. Notably, patients with modulate breast cancer cell growth. Moreover, ectopic expres- tumors highly expressing TBK1 respond poorly to tamoxifen treat- sion of TBK1 rendered breast cancer cells resistant to tamoxifen. ment and show high potential for relapse. Therefore, our findings Suppressing TBK1 with its pharmacological inhibitor BX795 suggest that TBK1 contributes to tamoxifen resistance in breast sensitized breast cancer cells to tamoxifen-induced cell death. cancer via phosphorylation modification of ERα. Administration of BX795 in conjunction with tamoxifen achieved synergistic inhibitory effects on tumors. The expression of TBK1 κ e e ANK-binding kinase 1 (TBK1) and I B kinase (IKK ) are was increased in patients with breast cancer and was positively Ttwo IKK-related serine/threonine kinases that display 64% correlated with ERα,ERα S305, and cyclin D1 expression. No- sequence identity and trigger the antiviral response of interfer- tably, patients with tumors highly expressing TBK1 responded ons (IFN) through NF-κB activation and interferon regulatory – poorly to tamoxifen treatment and showed a high potential transcription factor (IRF) 3/7 phosphorylation (1 3). In addition for relapse. Therefore, TBK1 is potentially a unique predictive to the proposed roles of IKK-related kinases in controlling transcription factors NF-κB and IRF, the involvement of TBK1 and IKKe in AKT-induced oncogenic transformation has been Significance demonstrated in a recent study (4). TBK1 is identified as a Ras- like (Ral) B effector in the Ral guanine nucleotide exchange We investigated the possible role of TANK-binding kinase 1 factor pathway that is required for Ras-induced transformation (TBK1) protein in tamoxifen resistance and found that phos- (5). IKKe acts downstream of the PI3K-AKT pathway and phorylation by TBK1 at the Ser-305 site stabilized estrogen cooperates with activated MEK to promote cellular trans- receptor α (ERα) and modulated its transcriptional activity. formation (6). IKKe has also been identified recently as a breast Ectopic expression of TBK1 rendered breast cancer cells re- cancer oncogene that is frequently amplified or overexpressed in sistant to tamoxifen. TBK1 inhibition sensitized breast cancer human breast cancer, and the phosphorylation of ERα by IKKe cells to tamoxifen-induced cell death. The expression of TBK1 contributes to tamoxifen resistance in breast cancer (7–9). In- was increased in subjects with breast cancer and was positively terestingly, TBK1 is also highly expressed in breast cancer (10), correlated with ERα,ERα Ser-305, and cyclin D1 expression. and knocking down TBK1 diminishes the viability of MCF-7 Subjects with tumors that highly expressed TBK1 had poor cells (9). However, the exact role of TBK1 in breast cancer re- responsiveness to tamoxifen treatment. Therefore, TBK1 is mains unclear. potentially a unique predictive marker of tamoxifen resistance Estrogen receptor α (ERα) is a nuclear receptor that exerts and a potential therapeutic target for breast cancer. a profound influence on the initiation and progression of breast cancer by regulating cell transformation, proliferation, and me- Author contributions: C.W., Yuan Cao, Q.X., C.H., X.H., and H.Z. designed research; – α C.W., Yuan Cao, X.Y., Z.Z., K.G., Q.W., S.M., Ye Cao, X.G., C.X., J.L., Y.L., T.S., and X.H. tastasis (11 13). For ER -positive patients with breast cancer, performed research; Yuan Cao, Q.W., Y.T., Y.Z., Ye Cao, H.Y., L.Z., and B.Z. contributed targeting the ER signaling pathway with tamoxifen, a selective new reagents/analytic tools; C.W., Yuan Cao, X.Y., Y.T., B.Z., C.H., X.-w.B., X.H., and H.Z. ER modulator, is efficacious in both prevention and treatment of analyzed data; and C.W., Yuan Cao, X.H., and H.Z. wrote the paper. breast cancer (14). Unfortunately, a substantial proportion of The authors declare no conflict of interest. patients are intrinsically resistant to this therapy, and a signifi- This article is a PNAS Direct Submission. cant number of patients with advanced disease eventually de- 1C.W., Yuan Cao, and X.Y. contributed equally to this work. – α velop acquired resistance to the treatment (15 18). ER is a key 2To whom correspondence may be addressed. E-mail: [email protected], bianxiuwu@263. determinant of breast cancer susceptibility to endocrine therapy. net, [email protected], or [email protected]. α Recent studies demonstrate that ER phosphorylation may have This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10. MEDICAL SCIENCES had a significant impact on ERα signaling and its response to 1073/pnas.1316255111/-/DCSupplemental. www.pnas.org/cgi/doi/10.1073/pnas.1316255111 PNAS | Published online January 21, 2014 | E601–E610 Downloaded by guest on October 2, 2021 marker of tamoxifen resistance and a therapeutic target for including ERα-negative 293T (Fig. 1A), ERα-positive ZR-75-1 breast cancer. (Fig. S1A), MCF-7 (Fig. 1 B and C and Fig. S1B), and BT474 (Fig. S1C) cell lines, increased the transcription of a luciferase Results reporter containing the estrogen-responsive element (ERE). TBK1 Regulating the Transcriptional Activity of ERα Is Independent of TBK1 enhanced the transcriptional activity of ERα regardless of Its Role in the Innate Immune Response. To define the exact role of the presence of 17β-estradiol (E2) (Fig. 1B), suggesting that TBK1 in breast tumor growth, we investigated whether TBK1 the activation of ERα by TBK1 is both ligand-dependent and regulates estrogen signaling. TBK1 overexpression in cell lines, -independent. This effect required TBK1 kinase activity, because Fig. 1. TBK1 regulates the transcriptional activity of ERα independent of its role in the innate immune response. The 293T cells (A) or MCF-7 cells (B) were transfected with the ERE-Luc reporter, ERα, and TBK1 with or without E2. The Luc activity was measured 24 h later and normalized for transfection efficiency. #P < 0.01 and **P < 0.01 vs. control (Ctrl) Flag vector without E2 or with E2, respectively. IB, immunoblot. (C) MCF-7 cells were cotransfected with ERE-Luc together with TBK1, TBK1 L352A, I353A, or TBK1 K38A. Cells were treated with or without 1 μM BX795 for 2 h. The Luc activity was measured 24 h later and normalized for transfection efficiency. (D) MCF-7 cells were transfected with TBK1 siRNA oligos (siTBK1) and siRNA-resistant TBK1 (siTBK1/TBK1) expression plasmid. The Luc activity was measured 24 h later and normalized for transfection efficiency. (E) MCF-7 cells were transfected with pS2-Luc or catD-Luc together with TBK1 or TBK1 L352A, I353A. The Luc activity was measured 24 h later and normalized for transfection efficiency. (F) 293T cells were transfected with HA-ERα and different doses of Flag-TBK1. Whole-cell lysates were analyzed by immunoblotting with anti-Flag or anti-HA antibody. α-Tubulin was used as an equal loading control. (G) MCF-7 cells were transfected with Flag-TBK1 or its mutants in the presence or absence of 1 μM BX795 for 2 h. Whole-cell lysates were analyzed by immunoblotting with anti-Flag or anti-ERα antibody. α-Tubulin was used as an equal loading control. (H) MCF-7 cells were transfected with siTBK1 and siTBK1/TBK1 expression plasmid. ZR-75-1 cells were transfected with Flag-TBK1.
Load more

Recommended publications
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • Activation of the STAT3 Signaling Pathway by the RNA-Dependent RNA Polymerase Protein of Arenavirus
    viruses Article Activation of the STAT3 Signaling Pathway by the RNA-Dependent RNA Polymerase Protein of Arenavirus Qingxing Wang 1,2 , Qilin Xin 3 , Weijuan Shang 1, Weiwei Wan 1,2, Gengfu Xiao 1,2,* and Lei-Ke Zhang 1,2,* 1 State Key Laboratory of Virology, Wuhan Institute of Virology, Chinese Academy of Sciences, Wuhan 430071, hubei, China; [email protected] (Q.W.); [email protected] (W.S.); [email protected] (W.W.) 2 University of Chinese Academy of Sciences, Beijing 100049, China 3 UMR754, Viral Infections and Comparative Pathology, 50 Avenue Tony Garnier, CEDEX 07, 69366 Lyon, France; [email protected] * Correspondence: [email protected] (G.X.); [email protected] (L.-K.Z.) Abstract: Arenaviruses cause chronic and asymptomatic infections in their natural host, rodents, and several arenaviruses cause severe hemorrhagic fever that has a high mortality in infected humans, seriously threatening public health. There are currently no FDA-licensed drugs available against arenaviruses; therefore, it is important to develop novel antiviral strategies to combat them, which would be facilitated by a detailed understanding of the interactions between the viruses and their hosts. To this end, we performed a transcriptomic analysis on cells infected with arenavirus lymphocytic choriomeningitis virus (LCMV), a neglected human pathogen with clinical significance, and found that the signal transducer and activator of transcription 3 (STAT3) signaling pathway was activated. A further investigation indicated that STAT3 could be activated by the RNA-dependent RNA polymerase L protein (Lp) of LCMV. Our functional analysis found that STAT3 cannot affect Citation: Wang, Q.; Xin, Q.; Shang, LCMV multiplication in A549 cells.
    [Show full text]
  • Interferon Regulatory Factor 3-CL, an Isoform of IRF3, Antagonizes Activity of IRF3
    Cellular & Molecular Immunology (2011) 8, 67–74 ß 2011 CSI and USTC. All rights reserved 1672-7681/11 $32.00 www.nature.com/cmi RESEARCH ARTICLE Interferon regulatory factor 3-CL, an isoform of IRF3, antagonizes activity of IRF3 Chunhua Li1,2,3, Lixin Ma2 and Xinwen Chen1 Interferon regulatory factor 3 (IRF3), one member of the IRF family, plays a central role in induction of type I interferon (IFN) and regulation of apoptosis. Controlled activity of IRF3 is essential for its functions. During reverse transcription (RT)-PCR to clone the full-length open reading frame (ORF) of IRF3, we cloned a full-length ORF encoding an isoform of IRF3, termed as IRF3-CL, and has a unique carboxyl-terminus of 125 amino acids. IRF3-CL is ubiquitously expressed in distinct cell lines. Overexpression of IRF3-CL inhibits Sendai virus (SeV)-triggered induction of IFN-b and SeV-induced and inhibitor of NF-kB kinase-e (IKKe)-mediated nuclear translocation of IRF3. When IKKe is overexpressed, IRF3-CL is associated with IRF3. These results suggest that IRF3-CL, the alternative splicing isoform of IRF-3, may function as a negative regulator of IRF3. Cellular & Molecular Immunology (2011) 8, 67–74; doi:10.1038/cmi.2010.55; published online 6 December 2010 Keywords: interferon regulatory factor 3; negative regulation; splicing variant INTRODUCTION A single gene is capable of generating multiple transcripts from a The interferon regulatory factor (IRF) family of transcriptional factors common mRNA precursor through alternative splicing, which may plays versatile roles in many biological processes, including innate and produce distinct protein isoforms with diverse and even antagonistic adaptive immune responses, cell growth control, apoptosis and functions.
    [Show full text]
  • IRF8 Regulates Gram-Negative Bacteria–Mediated NLRP3 Inflammasome Activation and Cell Death
    IRF8 Regulates Gram-Negative Bacteria− Mediated NLRP3 Inflammasome Activation and Cell Death This information is current as Rajendra Karki, Ein Lee, Bhesh R. Sharma, Balaji Banoth of September 25, 2021. and Thirumala-Devi Kanneganti J Immunol published online 23 March 2020 http://www.jimmunol.org/content/early/2020/03/20/jimmun ol.1901508 Downloaded from Supplementary http://www.jimmunol.org/content/suppl/2020/03/20/jimmunol.190150 Material 8.DCSupplemental http://www.jimmunol.org/ Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication by guest on September 25, 2021 *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2020 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. Published March 23, 2020, doi:10.4049/jimmunol.1901508 The Journal of Immunology IRF8 Regulates Gram-Negative Bacteria–Mediated NLRP3 Inflammasome Activation and Cell Death Rajendra Karki,*,1 Ein Lee,*,†,1 Bhesh R. Sharma,*,1 Balaji Banoth,* and Thirumala-Devi Kanneganti* Inflammasomes are intracellular signaling complexes that are assembled in response to a variety of pathogenic or physiologic stimuli to initiate inflammatory responses.
    [Show full text]
  • Localization of Ralb Signaling at Endomembrane Compartments and Its Modulation by Autophagy Received: 14 January 2019 Manish Kumar Singh1,2, Alexandre P
    www.nature.com/scientificreports Corrected: Publisher Correction OPEN Localization of RalB signaling at endomembrane compartments and its modulation by autophagy Received: 14 January 2019 Manish Kumar Singh1,2, Alexandre P. J. Martin1,2, Carine Jofre 3, Giulia Zago1,2, Accepted: 30 May 2019 Jacques Camonis1,2, Mathieu Coppey1,4 & Maria Carla Parrini1,2 Published online: 20 June 2019 The monomeric GTPase RalB controls crucial physiological processes, including autophagy and invasion, but it still remains unclear how this multi-functionality is achieved. Previously, we reported that the RalGEF (Guanine nucleotide Exchange Factor) RGL2 binds and activates RalB to promote invasion. Here we show that RGL2, a major activator of RalB, is also required for autophagy. Using a novel automated image analysis method, Endomapper, we quantifed the endogenous localization of the RGL2 activator and its substrate RalB at diferent endomembrane compartments, in an isogenic normal and Ras-transformed cell model. In both normal and Ras-transformed cells, we observed that RGL2 and RalB substantially localize at early and recycling endosomes, and to lesser extent at autophagosomes, but not at trans-Golgi. Interestingly the use of a FRET-based RalB biosensor indicated that RalB signaling is active at these endomembrane compartments at basal level in rich medium. Furthermore, induction of autophagy by nutrient starvation led to a considerable reduction of early and recycling endosomes, in contrast to the expected increase of autophagosomes, in both normal and Ras-transformed cells. However, autophagy mildly afected relative abundances of both RGL2 and RalB at early and recycling endosomes, and at autophagosomes. Interestingly, RalB activity increased at autophagosomes upon starvation in normal cells.
    [Show full text]
  • RNF11 at the Crossroads of Protein Ubiquitination
    biomolecules Review RNF11 at the Crossroads of Protein Ubiquitination Anna Mattioni, Luisa Castagnoli and Elena Santonico * Department of Biology, University of Rome Tor Vergata, Via della ricerca scientifica, 00133 Rome, Italy; [email protected] (A.M.); [email protected] (L.C.) * Correspondence: [email protected] Received: 29 September 2020; Accepted: 8 November 2020; Published: 11 November 2020 Abstract: RNF11 (Ring Finger Protein 11) is a 154 amino-acid long protein that contains a RING-H2 domain, whose sequence has remained substantially unchanged throughout vertebrate evolution. RNF11 has drawn attention as a modulator of protein degradation by HECT E3 ligases. Indeed, the large number of substrates that are regulated by HECT ligases, such as ITCH, SMURF1/2, WWP1/2, and NEDD4, and their role in turning off the signaling by ubiquitin-mediated degradation, candidates RNF11 as the master regulator of a plethora of signaling pathways. Starting from the analysis of the primary sequence motifs and from the list of RNF11 protein partners, we summarize the evidence implicating RNF11 as an important player in modulating ubiquitin-regulated processes that are involved in transforming growth factor beta (TGF-β), nuclear factor-κB (NF-κB), and Epidermal Growth Factor (EGF) signaling pathways. This connection appears to be particularly significant, since RNF11 is overexpressed in several tumors, even though its role as tumor growth inhibitor or promoter is still controversial. The review highlights the different facets and peculiarities of this unconventional small RING-E3 ligase and its implication in tumorigenesis, invasion, neuroinflammation, and cancer metastasis. Keywords: Ring Finger Protein 11; HECT ligases; ubiquitination 1.
    [Show full text]
  • The Role of Rala and Ralb in Cancer Samuel C
    University of South Florida Scholar Commons Graduate Theses and Dissertations Graduate School 4-7-2008 The Role of RalA and RalB in Cancer Samuel C. Falsetti University of South Florida Follow this and additional works at: https://scholarcommons.usf.edu/etd Part of the American Studies Commons Scholar Commons Citation Falsetti, Samuel C., "The Role of RalA and RalB in Cancer" (2008). Graduate Theses and Dissertations. https://scholarcommons.usf.edu/etd/232 This Dissertation is brought to you for free and open access by the Graduate School at Scholar Commons. It has been accepted for inclusion in Graduate Theses and Dissertations by an authorized administrator of Scholar Commons. For more information, please contact [email protected]. The Role of RalA and RalB in Cancer By Samuel C. Falsetti A dissertation submitted in partial fulfillment Of the requirements for the degree of Doctor of Philosophy Department of Molecular Medicine College of Medicine University of South Florida Major Professor: Saïd M. Sebti, Ph.D. Larry P. Solomonson, Ph.D. Gloria C. Ferreira, Ph.D. Srikumar Chellapan, Ph.D. Gary Reuther, Ph.D. Douglas Cress, Ph.D. Date of Approval: April 7th, 2008 Keywords: Ras, RACK1, Geranylgeranyltransferase I inhibitors, ovarian cancer, proteomics © Copyright 2008, Samuel C. Falsetti Dedication This thesis is dedicated to my greatest supporter, my wife. Without her loving advice and patience none of this would be possible. Acknowledgments I would like to extend my sincere gratitude to my wife, Nicole. She is the most inspirational person in my life and I am honored to be with her; in truth, this degree ought to come with two names printed on it.
    [Show full text]
  • Expression and Prognostic Role of IKBKE and TBK1 in Stage I Non-Small Cell Lung Cancer
    Cancer Management and Research Dovepress open access to scientific and medical research Open Access Full Text Article ORIGINAL RESEARCH Expression and prognostic role of IKBKE and TBK1 in stage I non-small cell lung cancer This article was published in the following Dove Press journal: Cancer Management and Research Xin Wang1,2 Background: The inhibitors of nuclear factor kappa-B kinase subunit epsilon (IKBKE) and Feifei Teng2 TANK-binding kinase 1 (TBK1) are important members of the nonclassical IKK family that Jie Lu3 share the kinase domain. They are important oncogenes for activation of several signaling Dianbin Mu4 pathways in several tumors. This study aims to explore the expression of IKBKE and TBK1 Jianbo Zhang4 and their prognostic role in stage I non-small cell lung cancer (NSCLC). Jinming Yu1,2 Patients and methods: A total of 142 surgically resected stage I NSCLC patients were enrolled and immunohistochemistry of IKBKE and TBK1 was performed. 1 Department of Oncology, Renmin Results: IKBKE and TBK1 were expressed in 121 (85.2%) and 114 (80.3%) of stage I Hospital of Wuhan University, Wuhan, fi Hubei 430060, People’s Republic of China; NSCLC patients respectively. IKBKE expression was signi cantly associated with TBK1 2Department of Radiation Oncology, expression (P=0.004). Furthermore, multivariate regression analyses showed there was a fi Shandong Cancer Hospital Af liated to significant relationship between patients with risk factors, the recurrence pattern of metas- Shandong University, Shandong Academy of Medical Sciences, Jinan, Shandong tasis and IKBKE+/TBK1+ co-expression (P=0.032 and P=0.022, respectively). In Kaplan– 250117, People’s Republic of China; Meier survival curve analyses, the IKBKE+/TBK1+ co-expression subgroup was signifi- 3Department of Neurosurgery, Shandong Province Qianfoshan Hospital of Shandong cantly associated with poor overall survival (P=0.014).
    [Show full text]
  • Association of Gene Ontology Categories with Decay Rate for Hepg2 Experiments These Tables Show Details for All Gene Ontology Categories
    Supplementary Table 1: Association of Gene Ontology Categories with Decay Rate for HepG2 Experiments These tables show details for all Gene Ontology categories. Inferences for manual classification scheme shown at the bottom. Those categories used in Figure 1A are highlighted in bold. Standard Deviations are shown in parentheses. P-values less than 1E-20 are indicated with a "0". Rate r (hour^-1) Half-life < 2hr. Decay % GO Number Category Name Probe Sets Group Non-Group Distribution p-value In-Group Non-Group Representation p-value GO:0006350 transcription 1523 0.221 (0.009) 0.127 (0.002) FASTER 0 13.1 (0.4) 4.5 (0.1) OVER 0 GO:0006351 transcription, DNA-dependent 1498 0.220 (0.009) 0.127 (0.002) FASTER 0 13.0 (0.4) 4.5 (0.1) OVER 0 GO:0006355 regulation of transcription, DNA-dependent 1163 0.230 (0.011) 0.128 (0.002) FASTER 5.00E-21 14.2 (0.5) 4.6 (0.1) OVER 0 GO:0006366 transcription from Pol II promoter 845 0.225 (0.012) 0.130 (0.002) FASTER 1.88E-14 13.0 (0.5) 4.8 (0.1) OVER 0 GO:0006139 nucleobase, nucleoside, nucleotide and nucleic acid metabolism3004 0.173 (0.006) 0.127 (0.002) FASTER 1.28E-12 8.4 (0.2) 4.5 (0.1) OVER 0 GO:0006357 regulation of transcription from Pol II promoter 487 0.231 (0.016) 0.132 (0.002) FASTER 6.05E-10 13.5 (0.6) 4.9 (0.1) OVER 0 GO:0008283 cell proliferation 625 0.189 (0.014) 0.132 (0.002) FASTER 1.95E-05 10.1 (0.6) 5.0 (0.1) OVER 1.50E-20 GO:0006513 monoubiquitination 36 0.305 (0.049) 0.134 (0.002) FASTER 2.69E-04 25.4 (4.4) 5.1 (0.1) OVER 2.04E-06 GO:0007050 cell cycle arrest 57 0.311 (0.054) 0.133 (0.002)
    [Show full text]
  • Targeting the Hippo Pathway in Prostate Cancer: What's New?
    cancers Review Targeting the Hippo Pathway in Prostate Cancer: What’s New? Kelly Coffey Solid Tumour Target Discovery Laboratory, Translational and Clinical Research Institute, Newcastle University Centre for Cancer, Faculty of Medical Sciences, Newcastle University, Newcastle upon Tyne NE2 4HH, UK; [email protected] Simple Summary: Prostate cancer is the most commonly diagnosed cancer in men in the UK, accounting for the deaths of over 11,000 men per year. A major problem in this disease are tumours which no longer respond to available treatments. Understanding how this occurs will reveal new ways to treat these patients. In this review, the latest findings regarding a particular group of cellular factors which make up a signalling network called the Hippo pathway will be described. Accumulating evidence suggests that this network contributes to prostate cancer progression and resistance to current treatments. Identifying how this pathway can be targeted with drugs is a promising area of research to improve the treatment of prostate cancer. Abstract: Identifying novel therapeutic targets for the treatment of prostate cancer (PC) remains a key area of research. With the emergence of resistance to androgen receptor (AR)-targeting therapies, other signalling pathways which crosstalk with AR signalling are important. Over recent years, evidence has accumulated for targeting the Hippo signalling pathway. Discovered in Drosophila melanogasta, the Hippo pathway plays a role in the regulation of organ size, proliferation, migration and invasion. In response to a variety of stimuli, including cell–cell contact, nutrients and stress, a kinase cascade is activated, which includes STK4/3 and LATS1/2 to inhibit the effector proteins YAP and its paralogue TAZ.
    [Show full text]
  • Workflows for Rapid Functional Annotation of Diverse
    insects Article Workflows for Rapid Functional Annotation of Diverse Arthropod Genomes Surya Saha 1,2 , Amanda M. Cooksey 2,3, Anna K. Childers 4 , Monica F. Poelchau 5 and Fiona M. McCarthy 2,* 1 Boyce Thompson Institute, 533 Tower Rd., Ithaca, NY 14853, USA; [email protected] 2 School of Animal and Comparative Biomedical Sciences, University of Arizona, 1117 E. Lowell St., Tucson, AZ 85721, USA; [email protected] 3 CyVerse, BioScience Research Laboratories, University of Arizona, 1230 N. Cherry Ave., Tucson, AZ 85721, USA 4 Bee Research Laboratory, Beltsville Agricultural Research Center, Agricultural Research Service, USDA, 10300 Baltimore Ave., Beltsville, MD 20705, USA; [email protected] 5 National Agricultural Library, Agricultural Research Service, USDA, 10301 Baltimore Ave., Beltsville, MD 20705, USA; [email protected] * Correspondence: fi[email protected] Simple Summary: Genomic technologies are accumulating information about genes faster than ever before, and sequencing initiatives, such as the Earth BioGenome Project, i5k, and Ag100Pest Initiative, are expected to increase this rate of acquisition. However, if genomic sequencing is to be used for the improvement of human health, agriculture, and our understanding of biological systems, it is necessary to identify genes and understand how they contribute to biological outcomes. While there are several well-established workflows for assembling genomic sequences and identifying genes, understanding gene function is essential to create actionable knowledge. Moreover, this functional annotation process must be easily accessible and provide information at a genomic scale to keep up Citation: Saha, S.; Cooksey, A.M.; with new sequence data. We report a well-defined workflow for rapid functional annotation of whole Childers, A.K.; Poelchau, M.F.; proteomes to produce Gene Ontology and pathways information.
    [Show full text]
  • Molecular Basis of Tank-Binding Kinase 1 Activation by Transautophosphorylation
    Molecular basis of Tank-binding kinase 1 activation by transautophosphorylation Xiaolei Maa,1, Elizabeth Helgasonb,1, Qui T. Phungc, Clifford L. Quanb, Rekha S. Iyera, Michelle W. Leec, Krista K. Bowmana, Melissa A. Starovasnika, and Erin C. Dueberb,2 Departments of aStructural Biology, bEarly Discovery Biochemistry, and cProtein Chemistry, Genentech, South San Francisco, CA 94080 Edited by Tony Hunter, Salk Institute for Biological Studies, La Jolla, CA, and approved April 25, 2012 (received for review December 30, 2011) Tank-binding kinase (TBK)1 plays a central role in innate immunity: it the C-terminal scaffolding/dimerization domain (SDD), a do- serves as an integrator of multiple signals induced by receptor- main arrangement that appears to be shared among the IKK mediated pathogen detection and as a modulator of IFN levels. family of kinases (3). Deletion or mutation of the ULD in TBK1 Efforts to better understand the biology of this key immunological or IKKε severely impairs kinase activation and substrate phos- factor have intensified recently as growing evidence implicates phorylation in cells (22, 23). Furthermore, the integrity of the aberrant TBK1 activity in a variety of autoimmune diseases and ULD in IKKβ is not only required for kinase activity (24) but was fi cancers. Nevertheless, key molecular details of TBK1 regulation and shown also to confer substrate speci city in conjunction with the β substrate selection remain unanswered. Here, structures of phos- adjacent SDD (25). Recent crystal structures of the IKK phorylated and unphosphorylated human TBK1 kinase and ubiq- homodimer demonstrate that the ULD and SDD form a joint, uitin-like domains, combined with biochemical studies, indicate three-way interface with the KD within each protomer of the a molecular mechanism of activation via transautophosphorylation.
    [Show full text]