Many persons have a wrong idea of what constitutes true happiness. It is not attained through selfgratification but
through fidelity to a worthy purpose.
Hellen Keller
TAKING CORRECTIVE ACTION:
EFFORTS TO CHANGE THE MALIGNANCY-PROMOTING BEHAVIORS OF MONOCYTES AND MACROPHAGES ELICITED BY TUMOR EDUCATION
A Dissertation
Presented In Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy in the Graduate School of the Ohio State University
By Ryan David Roberts, BA *****
The Ohio State University 2008
Dissertation Committee: Approved by: Clay Marsh, MD, Adviser Michael Ostrowski, PhD ______Larry Schlesinger, MD Adviser Virginia Sanders, PhD Integrated Biomedical Sciences Graduate Program
Copyright by
Ryan David Roberts
2008
ABSTRACT
The degree to which the development of solid tumors depends on the cooperation of
“normal” host tissues and cells has become increasingly apparent. Since Virchow’s original observation in 1863, physicians and scientists have suspected that inflammation and the cells responsible for it played some role in cancer progression. More recent science has confirmed that suspicion. Investigators have begun to define the mechanisms by which individual cells interact with tumors in ways that facilitate and even promote tumor growth and spread. It has become apparent that tumors develop ways of manipulating nearby cells so that they perform actions that feed tumors, help them grow, and pull them into the bloodstream. This process has been appropriately termed “tumor education.”
The present work focuses on further characterizing the ways that tumors interact with a particular type of white blood cell--the macrophage. Since Virchow, many other pathologists have observed associations between macrophage density and blood levels of macrophage-trophic factors and patient outcomes. Increased levels of macrophages or the factors that stimulate their growth and differentiation accelerate the progression of many cancer types, including breast cancer, which will be the focus of this work.
Others in our lab recently made observations about the ability of macrophages to produce factors stimulating blood vessel growth in response to tumor-related factors.
ii When control conditions for those experiments gave unexpected results, we felt that we had found a way to fundamentally change the behavior of these tumor-educated macrophages. The first set of experiments presented here shows how we discovered a way to turn pro-angiogenic macrophages into cells that produced factors which oppose angiogenic signals. The mechanism involves the secretion of an alternatively-spliced form of the soluble VEGF receptor (sVEGFR-1) from macrophages stimulated with granulocyte-macrophage colony stimulating factor (GM-CSF).
The next set of experiments extends this original observation by showing the effects of localized GM-CSF treatment in mice bearing mammary tumors. We observed that intratumor GM-CSF treatment slowed tumor growth and metastasis and starved tumors of oxygen and other nutrients. These effects demonstrated a near complete dependence on the activity of the sVEGFR-1. This work is exciting because it demonstrated the relative plasticity of tumor-educated macrophages and showed that we could change the phenotype of these cells within a tumor microenvironment.
The final set outlines experiments we designed to investigate the effects of macrophage depletion in a newly engineered mouse model. Some of the caveats to the use of this particular model gave us unexpected results, but proved to be quite useful in the study of a particular subset of inflammatory cells. Using this model, we were able to demonstrate a near-complete elimination of tumor-associated macrophages.
Macrophage depletion in this model caused a modest increase in the rate of tumor growth and a substantial increase in metastatic activity, which ran completely opposite to what we expected. Interestingly, we found macrophage depletion caused a reactive increase in the levels of blood monocytes, particularly those with a classical, inflammatory phenotype. So while the majority of macrophages had been eliminated
iii from the tumors, the small increase in this particular subset of monocytes had enhanced the tumor-promoting activity in these mice. This data lends further support to the idea that particular subsets of cells within the tumor account for most of the detrimental pro- tumor activity.
Taken together, these studies tell an interesting story. First, they show the profound effect that cells found within the tumor environment can have on tumor growth and progression. Second, they demonstrate the importance of cell phenotype on the ability of these cells to respond to tumor education. In the first studies, we showed that changing the cell phenotype gave desirable outcomes, despite the fact that we drove a substantial increase in the numbers of tumor-associated macrophages. In the last study, we showed that modest increases in the number of monoctyes of a particular phenotype within the tumor resulted in far worse outcomes, despite the removal of most macrophages from within the tumor. Lastly, these studies provide potential directions for the development of therapies for those with breast cancer—they show that the behavior of these cells can be changed in vivo, and they demonstrate which particular group of cells might demonstrate the greatest impact when targeted.
iv DEDICATION
Dedicated to Kim
Your smile makes bad days good. Your touch can right a thousand wrongs. Your praise means more than presidents or scholars. You make me a better person. Thank you.
v ACKNOWLEDGMENTS
It certainly takes a village to raise a graduate student, and I would certainly be remiss if I could not thank a long number of people who have contributed many different parts to what I have become thus far of a scholar.
Firstly, I shall never be able to repay my advisor and mentor, Dr. Clay Marsh for the time and energy he invested in providing an example and ensuring my success. Thank you for showing me how one person can have it all—how one can dedicate himself to his career and his family and enjoy moderate success in both important arenas. Thank you for your boundless energy and for your sometimes painful optimism. Thank you for believing in me and trusting me to make my own decisions and my own mistakes—for giving me the freedom and independence that let me explore and find myself as a young scientist.
I also must thank Dr. Michael Caligiuri for being a kind of quiet, second mentor. I admire the absolute dedication you show to achieving the lofty goals you’ve set for yourself and this institution. I appreciate your “rules” and the loyalty you show to your trainees. I respect you for the way you can make things happen.
Much appreciation goes to Tim Eubank for serving as a kind of trainer to me.
Thanks for teaching me so many techniques and methods, for serving as an effective
vi sounding board, and for complimenting my broad view of science with a healthy dose of
anal-retentiveness and attention to detail.
Thank you to Dr. Allan Yates for seeing enough potential in me to offer me a spot in
the training program—for seeing how I “fit” when I’m not sure I could see it myself.
To Dr. Michael Ostrowski for providing me with an expert in the field that I could talk
to, for serving on my committee, for appreciating my work as something of scientific
worth, and for always providing helpful, constructive criticism. Oh, and especially for
beginning my candidacy exam with a series of questions I could not even pretend to
address.
To Dr. Larry Schlesinger for serving on my committee and for his excellent example of someone who has succeeded as a true physician-scientist. And for always being completely unpredictable.
To Virginia Sanders, for also serving on my committee, for being a bit of an outsider, and for always providing me with a “pure scientist’s” take on my work.
To the other members of my group, Jennifer Curry and Randy Evans for always being willing to help. Especially to Randy for the millions of genotyping reactions and for helping me figure out what on earth we were doing wrong.
Finally, to the Department of Defense and the people at the Breast Cancer Research
Program for funding me through my graduate years and for thinking that I might have the future potential as a scientist to warrant such an investment.
vii VITA
March 29, 1977 Born – Salt Lake City, Utah, USA 2001 B.A. Chemistry, University of Utah 2000-2002 Laboratory Technician, Department of Pediatrics, University of Utah School of Medicine, Salt Lake City, Utah 2002 Assistant to the Vice President for Research, Quadex Pharmaceuticals, Salt Lake City, Utah 2002-present Graduate Fellow, Department of Internal Medicine, The Ohio State University School of Medicine, Columbus, Ohio
PUBLICATIONS
Eubank T, Roberts R, Galloway M, Cohn D, and Marsh C. GM-CSF Induces Expression of Soluble VEGF Receptor-1 from Human Monocytes and Inhibits Angiogenesis in Mice. Immunity. 2004; 21(6):831-42. Liu LF, Roberts R, Moyer-Mileur LJ, Samson-Fang L. Determination of Body Composition in Children with Cerebral Palsy: BIA and Anthropometry versus DEXA. Journal of the American Dietetic Association 2005 May;105(5):794-7.
FIELDS OF STUDY
Major Field: Integrated Biomedical Science
viii TABLE OF CONTENTS
Page
ABSTRACT ...... II
DEDICATION ...... V
ACKNOWLEDGMENTS ...... VI
VITA ...... VIII
PUBLICATIONS ...... viii
FIELDS OF STUDY ...... viii
TABLE OF CONTENTS ...... IX
LIST OF TABLES ...... XIV
LIST OF FIGURES ...... XV
CHAPTER 1: BREAST CANCER ...... 1
Normal breast development ...... 2
Developmental morphology ...... 3
Changes during pregnancy and lactation ...... 4
Differences between mouse and human development ...... 5
Neoplasms of the breast ...... 5
Histological classification ...... 7
Surgical Staging ...... 9
Tumor Grading ...... 10
Hormone and growth factor dependence ...... 11
ix Estrogen ...... 11
Epithelial growth factor (EGF) ...... 12
Classification by genetics and protein expression ...... 12
From the clinics (humans) ...... 13
From the labs (mice) ...... 14
Treatments for people with breast cancer ...... 18
Traditional Therapy ...... 18
Cutting-edge Therapy ...... 20
End of the road: metastasis ...... 21
Metastasis as a biological process ...... 21
References ...... 22
CHAPTER 2: MACROPHAGES AND THE TUMOR MICROENVIRONMENT ...... 25
Tumor microenvironment: interactions with “normal” cells ...... 25
Endothelial cells and angiogenesis ...... 26
Fibroblasts and fibrosis ...... 26
Macrophages and inflammation ...... 27
Inflammation and cancer: epidemiology ...... 28
Inflamation and cancer: molecular mechanisms ...... 29
DNA damage ...... 29
Activation of inflammatory signaling pathways ...... 30
“Reprogramming” the mircroenviroment to prevent metastasis ...... 30
References ...... 31
CHAPTER 3: GM-CSF CAUSES SVEGFR-1 RELEASE FROM HUMAN MONOCYTES ...... 34
Summary ...... 34
x Abstract ...... 35
Background ...... 36
Results ...... 38
GM-CSF reduces VEGF detection in the supernatants of stimulated monocytes ...... 38
The reduction in VEGF detection from GM-CSF-stimulated monocytes not due to sequestration of VEGF within the cells ...... 38
Recombinant VEGF added the supernatants of GM-CSF-stimulated monocytes cannot be detected by ELISA ...... 40
Both sVEGFR-1 mRNA and protein levels are significantly increased in response to GM-CSF treatment ...... 41
Soluble VEGFR-1 production correlates to loss in VEGF detection ...... 42
Antigenic detection of rhVEGF by ELISA is rescued with neutralizing antibodies specific for sVEGFR-1 ...... 43
Angiogenic activity of VEGF on endothelial cells is inhibited by the presence of sVEGFR-1 secreted by monocytes ...... 43
GM-CSF treatment inhibits angiogenesis in a Matrigel plug assay in mice ...... 47
GM-CSF does not alter levels of membrane-bound VEGFR ...... 51
JAK, JNK, and PI3-kinase pathways mediate sVEGFR-1 production ...... 53
Discussion ...... 54
Experimental Procedures ...... 57
Reference List ...... 62
CHAPTER 4: GM-CSF INVOKES AND ANTI-ANGIOGENIC PHENOTYPE SWITCH IN TUMOR-ASSOCIATED MACROPHAGES ...... 65
Summary ...... 65
Abstract ...... 66
Background ...... 67
Results ...... 70
xi Local treatment with GM-CSF slowed tumor growth in a mouse model of breast cancer...... 70
GM-CSF treatment correlated with reduced lung metastasis...... 72
GM-CSF lowered oxygen levels within the tumor proper...... 72
GM-CSF caused increased cell death within the tumor and changes in patterns of necrosis...... 74
GM-CSF increased macrophage, but not neutrophil numbers in tumors...... 74
Tumor-associated macrophages produced sVEGFR-1 in response to GM-CSF treatment...... 76
sVEGFR expression mediated the effects of GM-CSF treatment...... 77
GM-CSF treatment reduced vessel density within the tumor...... 78
Discussion ...... 79
Methods ...... 83
References ...... 87
CHAPTER 5: FAS-MEDIATED MACROPHAGE ABLATION SHOWS THAT PARTICULAR MONOCYTE SUBSETS PROMOTE TUMOR METASTASIS ...... 90
Summary ...... 90
Background ...... 91
Results ...... 93
Dimerizer administration effectively ablates tumor macrophages...... 93
Macrophage ablation in MAFIA mice promotes tumor growth and metastasis. .. 93
Macrophage apoptosis does not stimulate tumor growth...... 95
Macrophage ablation causes reactive monocytosis and stimulates extramedullary hematopoiesis...... 97
Monocytic cells infiltrate tumors near blood vessels...... 98
Dimerizer treatment causes shift toward the classical, inflammatory, Gr-1hi monocyte subtype...... 99
Discussion ...... 101
xii Materials and methods ...... 101
References ...... 104
CHAPTER 6: CONCLUSIONS ...... 106
UNIFIED BIBLIOGRAPHY ...... 109
xiii LIST OF TABLES
Table Page
Table 2.1: Inflammatory conditions and their associated malignancies ...... 29
Table 2.2: Carcinogenic effects of inflammation ...... 30
xiv LIST OF FIGURES
Figure Page
Figure 1.1: Normal Mammary Morphology ...... 4
Figure 1.2: Histological tumor typing ...... 7
Figure 1.3: Modified classification system ...... 10
Figure 3.1: Proposed model for the inhibition of pathological angiogenesis ...... 37
Figure 3.2: The reduction in VEGF detection from GM-CSF-stimulated monocytes not
due to sequestration of VEGF within the cells ...... 39
Figure 3.3: Recombinant sVEGFR-1 masks VEGF from ELISA detection ...... 41
Figure 3.4: GM-CSF augments sVEGFR-1 mRNA and protein while concomitantly
reducing the detection of VEGF by ELISA ...... 44
Figure 3.5: Supernatants from rhGM-CSF-stimulated monocytes inhibit angiogenesis
effects in vitro ...... 46
Figure 3.6: rhGM-CSF treatment inhibits angiogenesis in a Matrigel plug assay in mice
...... 49
Figure 3.7: Investigation of the mechanism of VEGFR-1 expression and sVEGFR-1
secretion from human monocytes ...... 52
xv Figure 4.1: GM-CSF alters the expression of angiogenic molecules in monocytes...... 69
Figure 4.2: Intratumor GM-CSF injections slows tumor growth and prolongs survival. ... 71
Figure 4.3: Local GM-CSF treatment reduces tumor metastasis to lung...... 72
Figure 4.4: Intratumor GM-CSF treatment reduces oxygen levels within mammary
tumors in vivo...... 73
Figure 4.5: Histologic analysis of tumors...... 75
Figure 4.6: sVEGFR neutralization restores normal tumor growth patterns...... 78
Figure 5.1: MAFIA mice...... 92
Figure 5.2: Administration of dimerizer eliminates macrophages from the tumors of
MAFIA+, MMTV-PyMT+ mice...... 94
Figure 5.3: Macrophage ablation increases tumor size and accelerates metastasis...... 95
Figure 5.4: Tumor Growth Assays...... 96
Figure 5.5: Macrophage ablation stimulates extramedullary hematopoiesis and a
reactive monocytosis...... 98
Figure 5.6: Tumors from macrophage-depleted mice show evidence of monocyte
infiltration...... 99
Figure 5.7: Mononuclear cells isolated from whole blood or tumors show a shift toward
the Gr-1hi phenotypes...... 100
xvi CHAPTER 1: BREAST CANCER
Although the world is full of suffering, it is full also of the
overcoming of it.
Hellen Keller
Worldwide, more than 4.4 million women live with breast cancer, and 1.2 million
more join those ranks annually1. Breast cancer is no longer a phenomenon of the industrialized world. As nations develop, the burden of the rapidly growing worldwide incidence of the disease will prove to be an enormous challenge.
Kudos to the physicians and scientists who find better and more humane treatments to help people suffering from this disease. Because of their efforts, at least 30% of those who would have died from the disease just 15 years ago now survive2—at least in
developed nations. However, while boasting one of the most advanced health care
systems in the world, breast cancer still threatens the health of 1 out every 8 females in
the US3. Despite these advances in early diagnosis and treatment, the disease claims the lives of more than 40,000 American women every year; 210,000 more face the uncertainty that accompanies the news of a recent diagnosis year in and year out.
1 Science and medicine have made huge advances toward understanding the biology
underlying the development, progression, and spread of cancer. Industry has leveraged
these advances to develop rational treatments, making therapies safer and more
effective. It remains clear, however, that we have yet to fully understand the disease.
For example, advances to date focus on tumor cells, while a growing body of knowledge
shows the essential role of “normal” tissues in tumor development and conversion to
malignancy4.
One cell type is identified as a “culprit” in the development of several different solid
tumors—the macrophage5. Up to to 35% of tumor-infiltrating inflammatory cells are monocytes/macrophages. Tumor-associated macrophages (TAMs) produce factors that facilitate tumor invasion and angiogenesis, including matrix metalloproteinase (MMP)6
and VEGF7 production. Tumors likely sabotage normal breast development (which
requires M-CSF) by secreting high levels of M-CSF to stimulate cell growth, alter normal
anti-tumor responses, and allow these cells to invade new blood vessels8. Transgenic mice expressing M-CSF or c-fms (the gene encoding the M-CSF receptor) display increased breast ductal branching, hyperplasia, dysplasia, and other pre-neoplastic changes compared to non-transgenic littermates9. The present work will focus on the biology underlying interactions between macrophages and tumors—the ways that factors produced within tumors change the behavior of macrophages and the ways that those behaviors affect tumor progression.
NORMAL BREAST DEVELOPMENT
Mammary gland development for the nurture of the young ties together the
mammalian family. In all mammals, males and females, development of mammary
2 tissue begins before birth, where precursors to the fully functional milk-producing organs
form along a ridge of tissue extending along the lateral wall of the trunk—the epithelial
ridge, or “milk line.”10 Once removed from the influence of maternal hormones, the infant
breast begins to differentiate and involute through a process resembling that
experienced by older women during menopause. By age 2, only a few small ductal
structures remain, surrounded by a fibroblastic stroma. In humans, prepubertal breast
development is identical for males and females.
The breast remains in this state through childhood, until hormones driven by puberty
initiate changes in the stroma and the epithelium10. Proliferation of adipose and fibrous tissue occur first, preceding extension of ducts in the pubertal breast. When the connective tissue nears the end of its proliferative cycle, the epithelial tissue begins to grow. End-buds form and the proliferation of epithelial tissue contained in these buds establishes lobular and ductal structures, including the terminal duct lobular units
(TDLU). Branching and extension continue to occur until about 18 years of age, at which time the process is complete in most females. These changes occur only in females—male breasts remain in a prepubertal state throughout life, unless disease or drugs stimulate further growth and development.
Developmental morphology
Beginning in utero, developing breast epithelium contains two distinct populations of cells. An outer layer of basal cells makes contact with the basement membrane.
Luminal cells line the ducts and lobules and rest atop the basal cells. In the adult gland, these basal and myoepithelial surrounding ductal luminal cells have a cuboidal shape, while those found in the acini retain a flattened shape. These two cell types, however,
3 have no clear functional distinction.
Both sets of cells contract and stain
for actin microfilaments and smooth
muscle actin10.
Compared to basal cells, luminal
cells have more translucent
cytoplasm and an open nuclear
chromatin pattern. Lymphocytes are
found in normal breast tissue, FIGURE 1.1: NORMAL MAMMARY migrating from the small vessels MORPHOLOGY through the interstitium to the lymph. Luminal cells line the insides of ducts. These cells are surrounded by a layer of basal cells, which contact the basement membrane. Note In adulthood, most of the tissue differences in cytoplasmic and nuclear morphology between the two cell types. surrounding the ductal tree consists Terminal buds are surrounded by a layer of fibrobrasts. of adipose cells with some fibrous
tissue, forming suspending (Cooper’s) ligaments.
Changes during pregnancy and lactation
During pregnancy, increased estrogen and progesterone levels initiate dramatic
changes in the breast architecture. The cells in the most distal portions of the mammary
tree proliferate, forming larger and more numerous alveloli. Coincident with this normal
hyperproliferation of the ducts, the relative amount of adipose tissue decreases and new
blood vessels form to create highly vascularized glandular structures8. Much of the remodeling activity that occurs during preganancy requires the activity of macrophages.
Increased hormone levels drive the epithelial cells to secrete factors, such as M-CSF,
4 which recruit macrophages to the breast and stimulate their remodeling activity. Mice
lacking macrophages or M-CSF do not experience these changes during pregnancy and
cannot lactate.
At delivery, estrogen and progesterone levels drop quickly, while lactogenic hormone
levels begin to rise. This stimulates the final stages of glandular differentiation and the
luminal cells begin to release secretory vacuoles containing milk products into the
lumen. At weaning, the loss of hormone signals causes involution and atrophy of the
ductal tissue, which is gradually replaced by adipose cells. This same process occurs,
though to a more profound level, at menopause10. The mechanisms that mediate involution are not well understood and study of these processes may provide useful insights into ways that mammary epithelial tissue can be “turned off.”
Differences between mouse and human development
The development of mammary tissue in mice and humans is remarkably similar, but
differences exist. In male mice, production of testosterone around embryonic day 14
causes destruction of the breast bud. In humans, male and female breast tissue
develops similarly until female sex hormones initiate the changes associated with
puberty.
NEOPLASMS OF THE BREAST
The complicated process of regulating cellular growth and proliferation within the
breast during the different stages of development does not always work flawlessly. In
fact, the regulation of cellular growth within the ductal epithelium of the breast appears to
be more susceptible to processes of tumor formation, both malignant and benign, than
most other epithelial tissues, as is evidenced by incidence rates among the different 5 human cancers3. This phenomenon may result from special properties of the epithelial
cells themselves, or from the effects of cells and tissues surrounding the epithelium that
create an environment where unregulated growth can occur or is promoted. In reality,
some combination of these factors underlies the inherent susceptibility of these cells to
neoproliferative diseases and accounts for the transformation of these cells.
While the incidence of benign lesions of the breast remains much higher than
malignant lesions (with an annual incidence of around 1 in 10011), this work will focus on
malignant lesions. It is important to note, however, that previous diagnosis of “fibrocystic
changes” remains one of the leading risk factors for future development of breast
cancer12, with an odds ratio of 1.7. The risk increases dramatically if those fibrocystic
lesions show some of the genetic or morphologic changes that characterize malignancy,
such as anneuploidy, estrogen receptor (ER) overexpression, increased erbB-2 staining,
TGF-α expression, and loss of p53. Each of these genetic changes occurs with
increasing frequency in breast lesions that demonstrate increasing malignant
phenotype12.
The progression of breast lesions from normal, healthy tissue to malignant, cancerous tissue follows one of a variety of sequential pathways where the cells gradually acquire each of a number of malignant characteristics13. Physicians and
surgeons can evaluate these tumors in a number of ways on histological, anatomical,
and genetic levels. While not always the case, abnormalities noted in these three
distinct manifestations of tumor pathobiology often coincide—lesions which exhibit
certain histological properties often carry particular molecular abnormalities and certain
genetic changes show strong correlations to advanced stage disease. These
observations suggest that certain genetic, epigenetic, and environmental changes 6 dictate particular biologic activities
which mediate changes in cellular
behavior and progression of a lesion
from one stage to the next.
Histological classification
This discussion of the current
models of multistep carcinogenesis
in the mammary epithelium will
begin by outlining the changes seen
by observing resected and biopsied
tumors under the microscope using
conventional histology. Using these
analytic techniques, one can follow
the pathway to malignancy as can
be observed visually. Once thought FIGURE 1.2: HISTOLOGICAL TUMOR TYPING A. Normal mammary gland. Sparse glandular to serve as a medium for predicting profiles suggest nulliparity. B. Diffuse hyperplasia. The uniform outcomes, it is clear that the distribution and minimal hyperplasia of glandular elements suggest a gland responding normally conventional multistep models of to physiologic cues. C. Focal hyperplasia. Focal distribution and carcinogenesis based solely on moderate extent of hyperplasia are consistent with an early lesion. morphology do not completely D. Ductal carcinoma in situ. Well-defined margins of mass suggest confinement by reflect the underlying genetic basement membrane.
changes and, especially in E. Early carcinoma. Although infiltrative, the mass contains some acinar profiles. advanced disease, do not accurately F. Late carcinoma. The mass is highly infiltrative, composed of anplastic cells, and contains foci of necrosis.
7 predict response to treatment14, 15. Still, the basic tenets of classification of breast cancer by histological subtype remain valid, and will be outlined here.
Carcinoma in situ (DCIS/LCIS)
The earliest lesions that can be classified as carcinoma are the in situ carcinomas, ductal carcinoma in situ (DCIS) and lobular carcinoma in situ (LCIS). While still used clinically to describe the location of the carcinoma in relation to the breast architecture, the cellular origin and genetic and prognostic characteristics of lesions arising in the ducts and in the lobules are identical. These in situ carcinomas consist of a malignant population of cells which have remained within the ducts and lobules, confined by the basement membrane. Patients identified with these early lesions have the best outcomes and the best prognosis—in 95% of cases identified as DCIS, mastectomy is curative16. These lesions cannot be identified by palpation or visual inspection, reinforcing the importance of mammography for detection of lesions in the DCIS stage.
Where the basement membrane remains intact, tumor cells have not yet acquired the ability or had the opportunity to spread to other sites.
Invasive (infiltrating) carcinoma
As tumors grow, they spread beyond the confinement of the basement membrane, invading the surrounding tissues and gaining access to the blood and lymph. Once this occurs, tumors can spread to distant sites—the visible outcome of the acquisition of a malignant phenotype. By the time a cancer becomes palpable, more than half of these tumors have spread to the axillary lymph nodes16. These infiltrating lesions can be classified into a number of subtypes: ductal, lobular, tubular, mucinous, medullary, and
8 papillary. Ductal and lobular subtypes make up about 90% of the invasive cancers
identified.
Diagnosis of invasive ductal carcinoma (or carcinoma of no special type, NST) is one
of exclusion—invasive carcinomas which cannot be classified as any other subtype
receive an NST classification. These tumors show a wide spectrum of differentiation and
histological appearance. More well-differentiated lesions tend to express estrogen
receptors (ERs), but not HER-2, and others consist of large sheets of pleomorphic cells,
which tend to be driven by HER-2, rather than sex hormones.
Invasive lobular carcinomas exhibit many of the same characteristics of NST
carcinomas—they present similarly, arise from the same cell types, and usually show
morphology similar to the well-differentiated NST lesions, with ER overexpression. They
differ in that they rarely overexpress HER-2/neu and exhibit different patterns of
metastasis. Lobular carcinomas often spread to the peritoneum, leptomeninges,
gastrointestinal tract, and ovaries and uterus—all sites rarely infiltrated by ductal lesions.
This may result from the common loss of a cluster of genes on chromosome 16q, which
includes genes responsible for cell adhesion such as β-catenin and e-cadherin17.
Surgical Staging
When patients with breast cancer receive surgical treatment by mastectomy or
lumpectomy, disease progression can be assessed using the TNM system. This system
evaluates the tumor based on tumor size (T), nodal involvement (N), and metastasis to
distant sites (M). Numerous long-term studies have validated the accuracy of this
method for predicting long-term outcomes. For instance, patients who present without
nodal involvement, whose tumors are smaller than 2 cm, enjoy a 10-year disease free
9 survival (DFS) rate of 90%, while those who present with distant metastases have a 10-
year DFS of less than 5%, even after receiving the best treatments available18.
Tumor Grading
Where pathologists have attempted to give prognostic meaning to breast cancer
biopsies by classification into histological subtypes; classification by degree of
differentiation (grade) has recently gained favor. Several studies have shown grade to
be a much better predictor of outcome than subtype19, 20. Histological grade also correlates well with the extent, complexity, and type of genomic alterations. The most commonly used criteria for defining the histological grade of breast tumors is the Elston-
FIGURE 1.3: MODIFIED CLASSIFICATION SYSTEM Takes into account differences in grade and typical changes in key gene expression patterns. LOH = Loss of Heterozygosity; DCIS = Ductal Carcinoma in situ; LCIS = Lobular Carcinoma in situ; IDC = Invasive Ductal Carcinoma; ER = estrogen receptor; CDH1 = human e-cadherin gene. Modified from Simpson, et al1.
10 Ellis modification of the Scarf-Bloom-Richardson system. This system scores
specimens in three categories: tubular/gland formation, cellular pleiomorphism, and
number of mitotic bodies per high-power microscopic field. A pathologist gives a score
from one to three (three being the least favorable finding) in each of these areas and the
grade is defined by the sum total of the three scores: <6 points = Grade I, 6-7 points =
Grade II, and >7 points = Grade III. Some scientists suggest a new model of multi-step
carcinogenesis which combines aspects of tumor typing with tumor grading. An
example of this is given in Figure 1.3 .
HORMONE AND GROWTH FACTOR DEPENDENCE
As mentioned above, expression of certain hormone and growth factor receptors
shows a strong correlation with the tumor grade. Whether these features cause the
development of the different phenotypes or result from other mechanisms of
carcinogenesis has not clearly been shown. Large numbers of breast tumors
demonstrate dependence on these factors for growth; some of the primary first-line and
adjuvant treatments of breast cancer target these two pathways.
Estrogen
Factors affecting hormonal exposure constitute the largest group of major risk factors
(age at menarche, age at first live birth, hormone therapy). This should not surprise
anyone, considering the important role that sex hormones play in the development of the
normal breast. Breast tissues, including the epithelium lining the ductal trees show
strong proliferative responses to estrogens. The normal physiologic differences in
breast development between boys and girls at puberty clearly demonstrate these
responses. Estrogen receptor positivity usually portends a positive response to
11 treatment and a good outcome. ER+ tumors tend to be low-grade, well-differentiated
tumors with lower levels of genetic instability. If a tumor is dependent on estrogen to
grow, removing that growth signal will stunt the growth of the tumor cells.
Epithelial growth factor (EGF)
In contrast to ER, HER2/neu (ErbB-2, one member of the EGF receptor family)
drives tumors that are less well differentiated, higher grade, and tend to be more
aggressive. The recent development of Herceptin® and other HER2-targeting
modalities as adjuvant therapies has improved outcomes in this group of people with
advanced, aggressive disease phenotypes21, 22. Not only has HER2 proved to be a
viable target for blocking the growth signals to tumor cells, but drugs targeting other
ErbB family members (such as Iressa®) have also shown promise in preclinical
studies23, 24.
CLASSIFICATION BY GENETICS AND PROTEIN EXPRESSION
Modern approaches, such as gene expression microarrays, have enabled scientists
to study breast cancers on a global, molecular level. These studies have shown that
information about the genetic state of the tumor cells can predict clinical responses and
outcomes with a fair degree of accuracy25, 26. Using this information, researchers have classified invasive breast tumors into a handful of clinically relevant subtypes. In other studies, researchers have performed similar analyses on mouse models of breast cancer. These studies examined the patterns of gene expression in genetically engineered mice (GEM) designed to develop mammary tumors by expression of particular oncogenes or elimination of tumor suppressor genes in the mammary ductal epithelium. They demonstrate distinct and reproducible patterns of gene expression
12 when tumors are driven by known oncogenes. Many of these patterns show strong
resemblance to subtypes identified in the human studies, and suggest that early
oncogenic events dictate the characteristics of the tumors that develop from those cells.
From the clinics (humans)
Believing that a comprehensive, bird’s-eye view of the genetic changes associated
with breast cancer could provide new and valuable insights into the mechanisms of
disease progression and identify novel biomarkers and therapeutic targets, several
groups began profiling the gene expression patterns of human breast tumors25-28. These groups used clinical outcomes and hierarchical clustering of expression data to develop criteria for new ways of defining tumor subtypes based on their genetic profiles. These discoveries have taken the natural heterogeneity of the disease and provided a way to classify tumors according to the genetic lesions that drive their intrinsic biology, rather than their location or physical appearance. These new methods of classification provide physicians and investigators with better ways to identify particular patients who will benefit from particular treatments—one of the first fields in medicine to make bold steps toward the new paradigms of “personalized medicine.” A number of ongoing trials aim to use these classification methods to identify the women who will most likely benefit from a particular treatment, increasing the efficacy of treatment and sparing those who have low risk for recurrence from the ills associated with treatment itself. A basic outline of the new classification schemes follows.
Luminal subtypes. Gene expression profiling identified two different types of estrogen receptor-positive tumors. Luminal subtype A tumors express high levels of cytokeratin-8 and cytokeratin-18; Luminal B subtype tumors express only low levels of
13 these genes. The discrimination of these two different types of ER+ tumors may have
profound clinical applications: survival rates between the two groups differ significantly.
Patients with Luminal A tumors enjoy the highest rates of DFS, while women with
subtype B tumors do not fare as well and experience much higher rates of metastasis
and worse overall survival.
Basal subtypes. The other major group identified by expression profiling is the ER-
tumors, which can be further classified into 3 distinct subtypes: Basal subtype, erbB2+
subtype, and Normal breast-like subtype. One can identify the Basal group by high
levels of cytokeratin-5 and cytokeratin-17 expression. BRCA mutations appear to drive
tumors exclusively toward this phenotype27. This group, along with the erbB2+ group
experience the worst outcomes; DFS rates in the erbB2+ group are particularly abysmal.
The normal breast-like group captured the patterns of gene expression in normal breast
tissue, as well as benign fibroadenomas. Interestingly, however, three grade I and II
invasive ductal carcinomas from these sample sets also exhibited gene expression
patterns similar to normal tissue.
From the labs (mice)
Researchers studying tumor development using mice have at their disposal an
incredibly useful set of tools not available for use in studies involving humans. The
development of transgenic mouse models has enabled investigators to create mice with
tumors driven by known oncogenes or by loss of known tumor suppressors. The
expression (or loss) of these genes can sometimes be controlled temporally by
conditional expression (or conditional knockout) and spatially by the use of tissue-
specific promoters. While mice are admittedly not human, use of these models allows
14 scientists to study aspects of tumor development and metastasis—including the roles of different immune and stromal cells—that cannot be studied any other way. Information gleaned from these studies has given us insight into some of the most important, and most difficult to study, aspects of tumor biology.
Critics of the use of these genetically engineered mice (GEM) hold that one cannot expect to study human diseases in an animal so different from humans—especially when that disease is not one the animal normally experiences. Other models of tumor development utilize human tumor xenografts transplanted into immunocompromised mice. These studies have the advantage of using actual human tumors that carry the exact mutations and developed in the same way as tumors from the people this huge scientific effort ultimately wants to help. Many scientists have strong feelings about the relevance of these different breast cancer models, but reason would tell us that each model has a useful purpose, and that individual researchers should understand the implications and the shortcomings of the different models to choose appropriate ways to study particular aspects of tumor pathobiology.
For purposes of the current work, we will not elaborate on the details of the different xenograft models, except to say that these models have an important place in the study of breast cancer, especially in the testing of certain kinds of anti-cancer agents. The work which will follow focuses on studies using GEM strains, especially the MMTV-PyMT mice. One might find it interesting to learn how some of the GEM models relate to human breast cancer—both by histology and by patterns of gene expression. A brief summary of the insights to human tumors gleaned from GEM models follows.
15 erbB2, Her2/neu. Overexpression of erbB2 seems a dominant characteristic of a
large group of very aggressive tumors, as noted in the studies classifying tumors by
gene expression patterns. Mouse strains have been developed which drive
overexpression of both normal and activated mutants of erbB2 in the mammary
epithelium of mice using the mouse mammary tumor virus promoter. These mice
develop tumors that resemble human invasive ductal carcinomas and high-grade DCIS
comedocarcinomas. These tumors frequently demonstrate lung metastasis, a pattern
similar to the human erbB2+ tumors. Studies in these mice suggested that erbB3 may
be the primary dimerizing partner in breast tumors29.
BRCA1. Aggressive research in the early 1990’s identified two genes whose germline mutations cause susceptibility to breast cancer. Mutations in these genes were found to be responsible for a large proportion of hereditary breast and ovarian cancers.
The mechanisms by which BRCA mutations cause cancer have proved difficult to study in mouse models. Early attempts showed that heterozygous mutations in either of the
BRCA alleles showed no overt phenotype, but homozygous mice died in utero. The development of tissue-specific conditional knockouts has enabled scientists to study these two proteins and their role in tumorigenesis. These models mimic the human phenotype well enough to be able to answer clinically relevant questions30. They exhibit the characteristics of the Basal subtype of tumors, including relatively low levels of ER expression. They show strong interactions with the p53 pathway; some models show complete dependence on p53 loss of function for carcinogenesis to occur. Loss of
BRCA function in these mice shows consistent correlations with genomic instability.
These mice have proved invaluable in elucidating the function of BRCA proteins, which have proved to be elusive and difficult to understand.
16 c-myc. The c-myc oncogene is frequently amplified in human tumors. The gene
product is a transcription factor that appears to play a role in a number of different types
of cancer. Investigators have created mice which overexpress c-myc off both WAP and
MMTV promoters. Overexpression of c-myc does not result in transformation of the
entire mammary gland in these mice, suggesting the necessity of other genetic
alterations for the carcinogenesis of mammary epithelium31.
Cyclin D1. Cyclins regulate the machinery responsible for cell cycle progression,
especially entry into S phase and DNA replication. Cyclin D1 amplification can be found
in 15-20% of primary human breast cancers32. Similar to c-myc, overexpression of cyclin D1 results in focal tumors surrounded by normal tissue, suggesting the necessity of other genetic changes for development of overt carcinomas.
PyMT. One of the most well-characterized and often-used models of breast cancer is the MMTV-PyMT mouse33. This mouse drives expression of the polyoma virus middle
T antigen in the mammary epithelium of the mouse by the MMTV promoter. Many investigators use these mice because they reproducibly form tumors by 3 months of age, which reproducibly metastasize to the lung, where they can be easily measured. The
PyMT oncogene exhibits a high degree of signaling convergence with the erbB2 pathway, making this model an acceptable surrogate for some studies of PI3 kinase pathway activation. The pattern of oncogenesis by both morphology and IHC is similar to some types of human cancers. These include gradual loss of ER and progesterone receptor (PR) expression, loss of integrin-β1, and upregulation of erbB2 and cyclin D1.
17 TREATMENTS FOR PEOPLE WITH BREAST CANCER
The treatment options for women diagnosed with breast cancer, and the array of
tools physicians have at their disposal, have continuously improved over the last
decade. Traditional treatment options such as surgery, radiation, and chemotherapy still
prove useful and, in most cases, necessary for successful cancer therapy. Better
understanding of tumor biology and the development of new “targeted” therapies have
allowed physicians to identify patients with certain types of tumors that will benefit from
more direct, less toxic adjuvants (and sometimes first-line agents). These new therapies
have shown promise in making treatments easier and more effective for patients.
Traditional Therapy
Surgery and Radiation. Most women with breast cancer will have surgery to remove the primary tumor. Where past guidelines usually recommended complete mastectomy in an effort to reduce the risk of recurrence, breast conserving treatment has gained favor and is now considered to be an option for most women. Breast conserving treatment consists of lumpectomy followed by radiation. Following lumpectomy, pathologists evaluate the borders of the excised lump to ensure that the entire lesion has been removed. If cancer cells appear around the border of the excision, a second lumpectomy or mastectomy is warranted34. During surgery, doctors usually perform an axillary lymph node dissection to evaluate whether the cancer has spread.
Chemotherapy. Chemotherapy usually consists of systemic therapy with cytotoxic drugs which target rapidly dividing cells. Chemotherapy usually causes patients significant discomfort including hair loss, gastrointestinal bleeding, diarrhea, and severe
18 nausea. Much effort has gone toward establishing the best combinations of drugs and the best ways of administering them so that many of these side effects have been reduced or eliminated35, 36. Many studies have demonstrated the benefits of modifying the dose density and dose intensity to maintain therapeutic effects while reducing side effects. Interestingly, some of these drugs seem to exert their effects by different mechanisms when given at low dose intensity with high dose density36.
Chemotherapy regimens usually include a combination of drugs, each of which work in a slightly different way and have non-overlapping side effects. This allows doctors to maximize therapeutic benefits while avoiding dose-limiting comorbidities. A long series of studies have documented the best combinations of drugs for treating women with different stages and extents of disease. For women with node-negative breast cancer, one of the leading treatments is a combination of cyclophosphamide, methotrexate, and fluorouracil. For node-positive breast cancers, the fluorouracil, doxorubicin, cyclophosphamide regimen has proven to be very effective34.
Hormone therapy. As most normal breast tissue and a large number of breast tumors depend on estrogen for sustained growth, anti-estrogen therapy remains a viable strategy for treating ER+ tumors. It is largely because of the effectiveness of such strategies that estrogen receptor positivity remains one of the leading “good news” prognostic indicators. In the past, selective estrogen receptor modulators (SERMs), such as tamoxifen, have been the drugs of choice for ER+ cancers. SERMs work by preventing estrogen molecules from interacting with its receptor inside the cell. These drugs have fallen out of favor because of two rare but serious side effects—an increased risk of developing both endometrial cancer and blood clots.
19 Aromatase inhibitors, a newer class of drugs, can be used instead of SERMs in
postmenopausal women. These drugs, including anastrazole, letrozole, and
exemestane prevent aromatase enzymes in the body from converting androgens (like
testosterone) to estrogens. Studies have shown that these drugs work at least as well
as tamoxifen, but without the serious side effects. They can, however, cause joint pain
and osteoporosis, since they so effectively block estrogen production. Concomitant
treatment with bisphosphonates can often prevent these side effects.
A newer drug called fulvestrant reduces the number of estrogen receptors. Studies
show that it can be effective against tumors that have become resistant to tamoxifen.
Anti-her2 therapies. One of the first humanized monoclonal antibodies developed
was directed against her2 (erbB2) receptors, which are overexpressed in the some of
the most aggressive forms of breast cancer. Studies showed that Herceptin® can
improved outcomes in patients with advanced metastatic disease22. This represents one of the first successful “targeted” therapies for breast cancer.
Cutting-edge Therapy
A number of new therapies for breast cancer have received attention and are
currently in different stages of development. Where many of the traditional breast
cancer drugs are cytotoxic in nature and target rapidly proliferating cells, many of the
newer drugs have been designed to target not the cancer cells themselves, but other,
normal, “host” cells that reside within the tumor. This shift in treatment strategy reflects
a paradigm shift in the field of cancer biology. Scientists have begun to understand the
role that the microenvironment plays in the development and progression of solid
tumors. These new drugs work by affecting the cells that support tumor growth, such as
20 endothelial cells which form blood vessels, and cells that have been modified by “tumor
education” to display phenotypes that permit, rather than prevent tumors from
developing. Some of these strategies currently under investigation target angiogenesis
using multiple strategies; use vaccinations to create T cells that recognize tumor
epitopes with or without adoptive cell transfer; or modulate the activity of other immune
cells with cytokines or other drugs.
END OF THE ROAD: METASTASIS
Localized breast cancer can be treated easily; tumors become difficult to treat and
cause most of their adverse effects when they spread to distant sites. In breast cancer,
the most common sites of metastasis are the lung, bones, and brain37. Adjuvant therapy aims to control the growth of tumors which have spread to distant sites, but the efficacy of these treatments leaves much to be desired. As mentioned above, patients who present with cancers that have already spread have less than a 5% chance of long-term survival18. The mechanisms underlying the metastatic process are multifaceted and poorly understood.
Metastasis as a biological process
Like carcinogenesis, metastasis is a complex, multistep biological process that
requires tumor cells to acquire a number of necessary phenotypes in order to spread to
distant sites and thrive in that new environment. In order for a successful metastasis to
occur, a single tumor cell must be able to detach from the original tumor, grow in the
absence of signals provided by attachment, invade through the tissue matrix to gain
access to blood or lymphatics, survive in the circulation, arrest in another tissue,
extravasate, and generate in that foreign tissue a tumor-friendly environment, including
21 the production of tumor growth factors, the induction of angiogenesis, and evasion of the
local host immune system38. This requires interactions that malignant cancers acquire a whole host of abilities not native to the original tissue type and that they learn to manipulate not only the host of primary origin, but also the cells and the environment in the distant site.
REFERENCES
1. Parkin, D. M., Bray, F., Ferlay, J. & Pisani, P. Global cancer statistics, 2002. CA Cancer. J. Clin. 55, 74-108 (2005). 2. Ries, L. A. G. et al. SEER Cancer Statistics Review, 1975-2004. (2007). 3. Jemal, A. et al. Cancer statistics, 2007. CA Cancer. J. Clin. 57, 43-66 (2007). 4. Park, C. C., Bissell, M. J. & Barcellos-Hoff, M. H. The influence of the microenvironment on the malignant phenotype. Mol. Med. Today 6, 324-329 (2000). 5. Pollard, J. W. Tumour-educated macrophages promote tumour progression and metastasis. Nature reviews.Cancer 4, 71 (2004). 6. Hagemann, T. et al. Enhanced invasiveness of breast cancer cell lines upon co- cultivation with macrophages is due to TNF-alpha dependent up-regulation of matrix metalloproteases. Carcinogenesis 25, 1543-1549 (2004). 7. Eubank, T. D., Galloway, M., Montague, C. M., Waldman, W. J. & Marsh, C. B. M- CSF induces vascular endothelial growth factor production and angiogenic activity from human monocytes. J. Immunol. 171, 2637-2643 (2003). 8. Sapi, E. The role of CSF-1 in normal physiology of mammary gland and breast cancer: an update. Exp Biol Med (Maywood. ) 229, 1-11 (2004). 9. Kirma, N. et al. Overexpression of the colony-stimulating factor (CSF-1) and/or its receptor c-fms in mammary glands of transgenic mice results in hyperplasia and tumor formation. Cancer Res. 64, 4162-4170 (2004). 10. Howard, B. A. & Gusterson, B. A. Human breast development. J. Mammary Gland Biol. Neoplasia 5, 119-137 (2000). 11. Rohan, T. E. & Miller, A. B. Hormone replacement therapy and risk of benign proliferative epithelial disorders of the breast. Eur. J. Cancer Prev. 8, 123-130 (1999). 12. Santen, R. J. & Mansel, R. Benign breast disorders. N. Engl. J. Med. 353, 275-285 (2005). 13. Hanahan, D. & Weinberg, R. A. The hallmarks of cancer. Cell (Cambridge) 100, 57 (2000).
22 14. Simpson, P. T., Reis-Filho, J. S., Gale, T. & Lakhani, S. R. Molecular evolution of breast cancer. J. Pathol. 205, 248-254 (2005). 15. Schedin, P. & Elias, A. Multistep tumorigenesis and the microenvironment. Breast Cancer Res. 6, 93-101 (2004). 16. Kumar, V., Abbas, A. K., Fausto, N., Robbins, S. L. & Cotran, R. S. in Robbins and Cotran pathologic basis of disease 1525 (Elsevier Saunders, Philadelphia, Pa., 2005). 17. Berx, G. & Van Roy, F. The E-cadherin/catenin complex: an important gatekeeper in breast cancer tumorigenesis and malignant progression. Breast Cancer Res. 3, 289- 293 (2001). 18. Cecil, R. L. et al. in Cecil textbook of medicine 2506 (Saunders, Philadelphia, Pa., 2004). 19. Buerger, H. et al. Ductal invasive G2 and G3 carcinomas of the breast are the end stages of at least two different lines of genetic evolution. J. Pathol. 194, 165-170 (2001). 20. Roylance, R. et al. Comparative genomic hybridization of breast tumors stratified by histological grade reveals new insights into the biological progression of breast cancer. Cancer Res. 59, 1433-1436 (1999). 21. Piccart-Gebhart, M. J. et al. Trastuzumab after adjuvant chemotherapy in HER2- positive breast cancer. N. Engl. J. Med. 353, 1659-1672 (2005). 22. Slamon, D. J. et al. Use of chemotherapy plus a monoclonal antibody against HER2 for metastatic breast cancer that overexpresses HER2. N. Engl. J. Med. 344, 783- 792 (2001). 23. Baselga, J. et al. Phase II and tumor pharmacodynamic study of gefitinib in patients with advanced breast cancer. J. Clin. Oncol. 23, 5323-5333 (2005). 24. von Minckwitz, G. et al. A multicentre phase II study on gefitinib in taxane- and anthracycline-pretreated metastatic breast cancer. Breast Cancer Res. Treat. 89, 165-172 (2005). 25. Sorlie, T. et al. Gene expression patterns of breast carcinomas distinguish tumor subclasses with clinical implications. Proc. Natl. Acad. Sci. U. S. A. 98, 10869-10874 (2001). 26. van de Vijver, M. J. et al. A gene-expression signature as a predictor of survival in breast cancer. N. Engl. J. Med. 347, 1999-2009 (2002). 27. Sorlie, T. et al. Repeated observation of breast tumor subtypes in independent gene expression data sets. Proc. Natl. Acad. Sci. U. S. A. 100, 8418-8423 (2003). 28. van 't Veer, L. J. et al. Gene expression profiling predicts clinical outcome of breast cancer. Nature 415, 530-536 (2002). 29. Siegel, P. M., Ryan, E. D., Cardiff, R. D. & Muller, W. J. Elevated expression of activated forms of Neu/ErbB-2 and ErbB-3 are involved in the induction of mammary tumors in transgenic mice: implications for human breast cancer. EMBO J. 18, 2149- 2164 (1999). 23 30. Evers, B. & Jonkers, J. Mouse models of BRCA1 and BRCA2 deficiency: past lessons, current understanding and future prospects. Oncogene 25, 5885-5897 (2006). 31. Schoenenberger, C. A. et al. Targeted c-myc gene expression in mammary glands of transgenic mice induces mammary tumours with constitutive milk protein gene transcription. EMBO J. 7, 169-175 (1988). 32. Hutchinson, J. N. & Muller, W. J. Transgenic mouse models of human breast cancer. Oncogene 19, 6130-6137 (2000). 33. Lin, E. Y. et al. Progression to malignancy in the polyoma middle T oncoprotein mouse breast cancer model provides a reliable model for human diseases 1. Am. J. Pathol. 163, 2113-2126 (2003). 34. National Comprehensive Cancer Network. Breast Cancer: Treatment Guidelines for Patients. Version VII. (2006). 35. Bonadonna, G., Zambetti, M., Moliterni, A., Gianni, L. & Valagussa, P. Clinical relevance of different sequencing of doxorubicin and cyclophosphamide, methotrexate, and Fluorouracil in operable breast cancer. J. Clin. Oncol. 22, 1614- 1620 (2004). 36. Emmenegger, U. et al. A comparative analysis of low-dose metronomic cyclophosphamide reveals absent or low-grade toxicity on tissues highly sensitive to the toxic effects of maximum tolerated dose regimens. Cancer Res. 64, 3994-4000 (2004). 37. Weigelt, B., Peterse, J. L. & van 't Veer, L. J. Breast cancer metastasis: markers and models. Nat. Rev. Cancer. 5, 591-602 (2005). 38. Nguyen, D. X. & Massague, J. Genetic determinants of cancer metastasis. Nat. Rev. Genet. 8, 341-352 (2007).
24 CHAPTER 2: MACROPHAGES AND THE TUMOR
MICROENVIRONMENT
Medicine, to produce health, has to examine disease;
and music, to create harmony, must investigate discord.
Plutarch
Since Virchow’s original observation in 1863, scientists have noted a link between
“lymphoreticular infiltrates” (as Virchow wrote) and cancer. This link has since become
more substantive as scientists have elucidated some of the intercellular interactions and
molecular alterations that drive the tumorigenic process. As the present work focuses
on the interrelationship between mammary tumors and tumor-educated macrophages,
we shall begin by outlining some of the current knowledge about how these two cell
types interact within the tumor microenvironment.
TUMOR MICROENVIRONMENT: INTERACTIONS WITH “NORMAL” CELLS
Large tumors do not contain a homogeneous population of malignant cancer cells,
but necessarily include networks of different cell types which communicate and function
25 like a “tumor organ”. Within a tumor one will find blood vessels, connective tissue,
immune cells, and adipose tissue. Each of these cells functions within the tumor stroma,
releasing factors, responding to signals, and affecting the surrounding environment.
Numerous studies have shown the necessity of this “fertile soil” in order for tumors to
grow and develop. Better understanding of the roles these cells play and the way the
tumor environment affects their behavior will enable researchers to develop better
medicines to treat people with cancer. Understanding this interaction between normal
and malignant cells holds the key to preventing the uncontrolled growth and spread of
tumors.
Endothelial cells and angiogenesis
Since Judah Folkman’s landmark discoveries, research activity in the area of
angiogenesis has exploded. Scientists now understand the critical role that blood
vessels play in feeding and detoxifying tumors so that they can continue to grow.
Tumors that cannot stimulate new blood vessels to form cannot grow beyond 2-3 mm in
diameter1. One interesting finding that has come from the field of angiogenesis is the
discovery that new vessels within the tumor have very different appearance and
properties from other established vessels2. This suggests that it may be possible to
develop therapies of many different types that will target “pathological” vasculature
specifically, sparing the normal tissues from damage.
Fibroblasts and fibrosis
Strands of fibrous tissue normally course through the breast. One prominent feature
of many pathologic states, such as breast cancer and other benign proliferative breast
diseases, is infiltration and proliferation of fibroblasts. These cells lay down extracellular
26 matrix, which can regulate the activity of a whole host of cytokines. They also provide a
rich source of many factors implicated in tumor progression—M-CSF, VEGF, TGF-β,
and others.
Macrophages and inflammation
Recent studies have described the important role of native hematopoietic cells in
tumor progression and metastases41. Intuitively, it seems that many of the cells that have been implicated in tumor promotion and malignant conversion should protect the body against such insults. For instance, macrophages are found in abundance in tumors of the breast3, prostate4, ovaries5, and cervix6. In each of these cancers, greater numbers of macrophages in the tumor predicts a worse outcome. TAMs have been implicated in increased metastases7, neovascularization, production of growth factors
and proteases8, and generation of toxic metabolites that damage DNA9.
However, in other tumors, the presence of macrophages is associated with a better prognosis10, leading to the hypothesis that the tumor microenvironment plays a pivotal
role in determining the phenotype and disposition of TAMs. Understanding the factors
that determine the TAM phenotype may help alter the tumor environment and affect
tumor growth and metastasis.
M-CSF may mediate the unfavorable effects of tumor educated macrophages. Many
studies have emphasized the role of M-CSF, the primary regulator of tissue macrophage
development, in the pathogenesis of breast cancer growth and metastases. For
instance, M-CSF serum levels strongly correlate with tumor size and metastasis11. It is
likely that the effect of M-CSF on tumor progression happens through the recruitment of
TAMs. Up to 35% of tumor-infiltrating inflammatory cells are monocytes/macrophages12.
27 TAMs produce factors that facilitate tumor invasion and angiogenesis, including matrix
metalloproteinases (MMPs)13 and VEGF14. It is likely that tumors sabotage normal breast development (which requires M-CSF) by secreting higher levels of M-CSF to stimulate cell growth, alter normal anti-tumor responses, and allow these cells to invade new blood vessels15. Transgenic mice expressing M-CSF or c-fms (gene encoding the receptor for M-CSF) display increased breast ductal branching, hyperplasia, dysplasia, and other pre-neoplastic changes compared to non-transgenic littermates16.
Macrophages play a pivotal role in tumor-related angiogensis. Eubank, et al. found that rhM-CSF regulates VEGF at the level of transcription and enhances VEGF production by human monocytes in cell culture14. This same study showed that M-CSF
and monocyte/macrophage recruitment correlated positively with angiogenesis in vivo.
The current work addresses questions arising from Dr. Eubank’s research and will bring
the effects of macrophages within the tumor further in to focus.
INFLAMMATION AND CANCER: EPIDEMIOLOGY
One of the strongest indications that chronic inflammation drive carcinogenesis lies
in the strong links that scientists have made between infections and diseases that
involve chronic inflammation and the appearance of cancer at the inflammatory site.
Table 2.1 outlines a number of the relationships that have been described. This
epidemiological evidence from both infectious and non-infectious diseases makes a
strong argument that biological activities associated with chronic inflammation promote
and/or facilitate carcinogenesis in many different tissue types.
Perhaps the most compelling evidence for the causative role in the pathogenesis of
cancer comes from epidemiological studies investigating the association between long
28 TABLE 2.1: INFLAMMATORY CONDITIONS AND THEIR ASSOCIATED MALIGNANCIES
Etiology Associated Cancer H. pylori infection Gastric Carcinoma17, 18 GERD Esophageal Cancer (adenocarcinomas)19 Barret’s Esophagus Inflammatory Bowel Disease Colorectal cancer20, 21 Crohn’s Disease/Ulcerative Colitis Hepatitis B and C viruses Hepatocellular Carcinoma22 Asbestos particles Mesothelioma23
term users of anti-inflammatory NSAIDs and cancer incidence24, 25. These studies have shown that long-term use of anti-inflammatory drugs actually decreases the risk of developing some cancers, especially lung, gastric, and esophageal. Estimates based on these and other studies suggest that inflammation could account for 15-20% of cancer incidence worldwide26.
INFLAMATION AND CANCER: MOLECULAR MECHANISMS
Scientists have now begun to elucidate some of the molecular mechanisms that
mediate the biological outcomes observed by Virchow and others. The studies have
demonstrated that the effects of inflammation on surrounding tissues can have a number
of effects that predispose that tissue to cancer. Inflammation can cause or facilitate
each of the steps of carcinogenesis: initiation, promotion, malignant transformation, and
metastasis. Here, we outline a number of the mechanisms that have been elucidated.
DNA damage
In the course of an inflammatory reaction, macrophages and other cells often
produce huge quantities of oxygen radicals. These radicals can be very effective at
29 destroying pathogens, but they also cause significant damage to host cells. These
highly reactive species, such as the NO produced elevated levels of iNOS27, can create adducts to proteins and DNA and have a high capacity to cause permanent DNA damage. This damage can prime the cells to become “initiated” when these mutations occur in regions of DNA containing tumor suppressors or oncogenes.
Activation of inflammatory signaling pathways
Recent work done by Michael Karin and others has shown that pathways associated
with inflammation can mediate carcinogenesis. For example, in murine models of colitis-
induced adenocarcinoma, eliminating a canonical inflammatory mediator, NF-κB can
prevent the development of colon cancers31. Some of the carcinogenic effects of
inflammation that have been described at a molecular level are outlined in Table 2.2.
“REPROGRAMMING” THE MIRCROENVIROMENT TO PREVENT METASTASIS
If local environmental factors dictate the behavior of cells, including macrophages,
and if tumor educated macrophages promote the malignant conversion of cancer cells,
TABLE 2.2: CARCINOGENIC EFFECTS OF INFLAMMATION
Molecular event Carcinogenic effects Generation of oxygen radicals Damages DNA and protein, accelerates mutagenesis27
Activation of NF-κB pathway Inhibits apoptotic pathways, induces cell cycle progression, stimulates production of growth factors, etc28. Production/activation of matrix Facilitates invasion and metastasis, liberates growth factors metalloproteinases (MMPs) from extracellular matrix29. Production of growth factors (IL-6, Promotes growth of tumors, inhibits apoptotic pathways28, EGF) facilitates metastasis30. Alteration of adoptive immune Suppresses anti-tumor immunity, induces inflammatory response Th17 responses28. 30 then it may be possible to change the way that these cells behave by altering the
microenvironment. Macrophages may enhance or facilitate many of these metastasis-
related activities, including promoting angiogenesis, remodeling the matrix, and
providing growth factors that sustain the proliferation of these cells at both primary and
secondary sites. In fact, some researchers believe that macrophages are “obligate
partners for tumor cell migration, invasion, and metastasis7.” The current work will address these issues and shows that such an approach to the treatment of breast and other cancers could be effective at limiting the growth and spread of tumors, regardless of the cumulative genetic change that has occurred in the tumor cells themselves.
REFERENCES
1. Bergers, G. & Benjamin, L. E. Tumorigenesis and the angiogenic switch. Nat. Rev. Cancer. 3, 401-410 (2003). 2. Emmenegger, U. et al. A comparative analysis of low-dose metronomic cyclophosphamide reveals absent or low-grade toxicity on tissues highly sensitive to the toxic effects of maximum tolerated dose regimens. Cancer Res. 64, 3994-4000 (2004). 3. Steele, R. J., Brown, M. & Eremin, O. Characterisation of macrophages infiltrating human mammary carcinomas. Br. J. Cancer 51, 135-138 (1985). 4. Lissbrant, I. F. et al. Tumor associated macrophages in human prostate cancer: relation to clinicopathological variables and survival. Int. J. Oncol. 17, 445-451 (2000). 5. Duyndam, M. C. et al. Vascular endothelial growth factor-165 overexpression stimulates angiogenesis and induces cyst formation and macrophage infiltration in human ovarian cancer xenografts. Am. J. Pathol. 160, 537-548 (2002). 6. Heller, D. S. et al. Presence and quantification of macrophages in squamous cell carcinoma of the cervix. Int. J. Gynecol. Cancer 13, 67-70 (2003). 7. Condeelis, J. & Pollard, J. W. Macrophages: obligate partners for tumor cell migration, invasion, and metastasis. Cell 124, 263-266 (2006). 8. Valkovic, T. et al. Correlation between vascular endothelial growth factor, angiogenesis, and tumor-associated macrophages in invasive ductal breast carcinoma. Virchows Arch. 440, 583-588 (2002). 9. Rao, C. V. Nitric oxide signaling in colon cancer chemoprevention. Mutat. Res. 555, 107-119 (2004). 31 10. Nakayama, Y. et al. Relationships between tumor-associated macrophages and clinicopathological factors in patients with colorectal cancer. Anticancer Res. 22, 4291-4296 (2002). 11. Scholl, S. M. et al. Circulating levels of the macrophage colony stimulating factor CSF-1 in primary and metastatic breast cancer patients. A pilot study. Breast Cancer Res. Treat. 39, 275-283 (1996). 12. Tang, R. et al. M-CSF (monocyte colony stimulating factor) and M-CSF receptor expression by breast tumour cells: M-CSF mediated recruitment of tumour infiltrating monocytes? J. Cell. Biochem. 50, 350-356 (1992). 13. Hagemann, T. et al. Enhanced invasiveness of breast cancer cell lines upon co- cultivation with macrophages is due to TNF-alpha dependent up-regulation of matrix metalloproteases. Carcinogenesis 25, 1543-1549 (2004). 14. Eubank, T. D., Galloway, M., Montague, C. M., Waldman, W. J. & Marsh, C. B. M- CSF induces vascular endothelial growth factor production and angiogenic activity from human monocytes. J. Immunol. 171, 2637-2643 (2003). 15. Sapi, E. The role of CSF-1 in normal physiology of mammary gland and breast cancer: an update. Exp Biol Med (Maywood. ) 229, 1-11 (2004). 16. Kirma, N. et al. Overexpression of the colony-stimulating factor (CSF-1) and/or its receptor c-fms in mammary glands of transgenic mice results in hyperplasia and tumor formation. Cancer Res. 64, 4162-4170 (2004). 17. Nomura, A. et al. Helicobacter pylori infection and gastric carcinoma among Japanese Americans in Hawaii. N. Engl. J. Med. 325, 1132-1136 (1991). 18. Parsonnet, J. et al. Helicobacter pylori infection and the risk of gastric carcinoma. N. Engl. J. Med. 325, 1127-1131 (1991). 19. Lagergren, J., Bergstrom, R., Lindgren, A. & Nyren, O. Symptomatic gastroesophageal reflux as a risk factor for esophageal adenocarcinoma. N. Engl. J. Med. 340, 825-831 (1999). 20. Ekbom, A., Helmick, C., Zack, M. & Adami, H. O. Increased risk of large-bowel cancer in Crohn's disease with colonic involvement. Lancet 336, 357-359 (1990). 21. Ekbom, A., Helmick, C., Zack, M. & Adami, H. O. Ulcerative colitis and colorectal cancer. A population-based study. N. Engl. J. Med. 323, 1228-1233 (1990). 22. El-Serag, H. B. & Mason, A. C. Rising incidence of hepatocellular carcinoma in the United States. N. Engl. J. Med. 340, 745-750 (1999). 23. Stanton, M. F. & Wrench, C. Mechanisms of mesothelioma induction with asbestos and fibrous glass. J. Natl. Cancer Inst. 48, 797-821 (1972). 24. Garcia-Rodriguez, L. A. & Huerta-Alvarez, C. Reduced risk of colorectal cancer among long-term users of aspirin and nonaspirin nonsteroidal antiinflammatory drugs. Epidemiology 12, 88-93 (2001). 25. Baron, J. A. & Sandler, R. S. Nonsteroidal anti-inflammatory drugs and cancer prevention. Annu. Rev. Med. 51, 511-523 (2000).
32 26. Kuper, H., Adami, H. O. & Trichopoulos, D. Infections as a major preventable cause of human cancer. J. Intern. Med. 248, 171-183 (2000). 27. Maeda, H. & Akaike, T. Nitric oxide and oxygen radicals in infection, inflammation, and cancer. Biochemistry (Mosc) 63, 854-865 (1998). 28. Lin, W. W. & Karin, M. A cytokine-mediated link between innate immunity, inflammation, and cancer. J. Clin. Invest. 117, 1175-1183 (2007). 29. Kalluri, R. & Zeisberg, M. Fibroblasts in cancer. Nat. Rev. Cancer. 6, 392-401 (2006). 30. Wyckoff, J. et al. A paracrine loop between tumor cells and macrophages is required for tumor cell migration in mammary tumors. Cancer Res. 64, 7022 (2004). 31. Greten, F. R. et al. IKKbeta links inflammation and tumorigenesis in a mouse model of colitis-associated cancer. Cell 118, 285-296 (2004).
33 CHAPTER 3: GM-CSF CAUSES SVEGFR-1
RELEASE FROM HUMAN MONOCYTES
The most exciting phrase to hear in science, the one that
heralds new discoveries, is not ‘Eureka!’ (I found it) but ‘That’s
funny…’
Isaac Asimov
SUMMARY
Eubank et al. (2003) made an influential discovery when they showed that
monocytes responded to stimulation with M-CSF by producing VEGF, a factor that
promotes new blood vessel growth. Some of the original controls performed during
those studies proved puzzling—when testing to see whether production of VEGF
resulted simply from monocyte survival and differentiation or as a direct response to M-
CSF, we observed that monocytes stimulated with GM-CSF produced no measurable
VEGF. The puzzling part came when we found that, despite a lack of measurable
protein, the mRNA for VEGF increase with GM-CSF stimulation. The following paper
describes the studies that resolved this conundrum.
34 ABSTRACT
GM-CSF promotes homeostasis of myeloid cells. We report that GM-CSF up-
regulates mRNA and protein production of the soluble form of membrane-bound VEGF
receptor-1 (sVEGFR-1) in human monocytes. This sVEGFR-1 was biologically active, as
cell-free supernatants from GM-CSF-stimulated monocytes blocked detection of
endogenously-expressed VEGF and inhibited endothelial cell migration and tube
formation, even in the presence of exogenous rhVEGF. VEGF activity was recovered by
neutralizing sVEGFR-1. To determine whether these events were important in vivo,
Matrigel plugs were incubated with rhVEGF, rhGM-CSF or rhGM-CSF/rhVEGF and
injected into mice. Plugs containing GM-CSF or GM-CSF/VEGF had less endothelial cell
invasion than plugs containing rhVEGF and were similar to plugs incubated with PBS
alone. Neutralizing antibodies specific for sVEGFR-1 injected in these plugs reversed
the effects of GM-CSF or GM-CSF/VEGF, while an isogenic antibody did not. Thus, GM-
CSF and monocytes play a vital role in angiogenesis through the regulation of VEGF
and sVEGFR-1.
35 BACKGROUND
GM-CSF drives hematopoietic precursor cells to mature granulocytes, macrophages
or dendritic cells1 and is used clinically to accelerate bone marrow recovery and increase
the production of white blood cells to facilitate host defense2.
We reported that M-CSF induces human monocytes to produce and release
biologically active VEGF3. VEGF (isoform-A) is an angiogenic factor that promotes blood
vessel formation in human cancer4 and plays a dominant role in human health and disease as a regulator of new blood vessel growth, an inducer of vascular permeability5,
and is highly expressed during episodes of hypoxia6.
VEGF-A signals through VEGF receptor 1 (VEGFR-1) (Flt-1) and VEGFR-2 (KDR)7.
Structurally, both VEGF receptors have seven immunoglobulin (Ig)-like domains in their
extracellular regions and two tyrosine kinase domains and VEGF binds at the second
and third Ig-like domain in both VEGFR-1 and VEGFR-28. In an adult, monocytes express solely VEGFR-19, which is responsible for relaying VEGF signals10. Endothelial cells express both VEGFR-1 and VEGFR-210 and while VEGFR-2 activates cellular
signaling, VEGFR-1 acts as a “sink” on these cells to sequester VEGF from VEGFR-2.
Mice expressing the extracellular domain of VEGFR-1 lacking a functional tyrosine
kinase domain develop normal blood vessels and survive. In contrast, null mutations of
the VEGFR-1 gene results in death early in embryogenesis due to a disorganization of
blood vessels. These data suggest an important regulatory role in vivo for VEGFR-111, 12.
Other mechanisms used by endothelial cells to regulate VEGF include the production of
an alternatively spliced mRNA variant of VEGFR-1, sVEGFR-113. Soluble VEGFR-1 is identical to membrane-bound VEGFR-1 except it lacks the transmembrane region
36 necessary to attach the receptor to the cell membrane13 and any kinase activity. Since receptor dimerization is essential for signaling through VEGF receptors, sVEGFR-1 sequesters VEGF from activating either VEGFR-1 (on monocytes) and/or VEGFR-2 (on endothelial cells) by inhibiting dimerization of VEGFRs14. Once VEGFRs become
activated, signaling follows classical receptor tyrosine kinase activating pathways15.
A relationship between VEGF and GM-CSF has yet to be elucidated. Under immune stress, growth factors like M-CSF and GM-CSF stimulate differentiation of hematopoietic progenitor stem cells in the bone marrow to the myeloid compartment and influence their movement into the bloodstream1. In response to an infectious challenge, monocyte and macrophage recruitment and accumulation at involved sites is advantageous for host defense, however, in alternative settings like breast cancer, growth factors like M-CSF induce the release of VEGF by these monocytes3 and stimulate tumor metastases16.
Data presented in our current study suggests that GM-CSF reduces VEGF activity by inducing secretion of the soluble form of VEGFR-1 by human monocytes reducing
Primary GM-CSF tumor Inhibition of angiogenesis induces tumor VEGF cell death [2]
nearby soluble blood vessel [1] VEGFR-1
Tumor growth is Local injection Soluble VEGFR-1 angiogenesis-dependent [2]. of GM-CSF sequesters VEGF Tumor > 2 mm 3 requires stimulates monocytes fresh blood supply and to produce produces VEGF [3] , soluble VEGFR-1 monocytes/macrophages accumulate [4]
FIGURE 3.1: PROPOSED MODEL FOR THE INHIBITION OF PATHOLOGICAL ANGIOGENESIS
37 biologically active VEGF available for angiogenesis.
This study demonstrates that recombinant GM-CSF stimulates human monocytes to transcribe and translate the alternatively spliced and soluble form of VEGF receptor-1.
By utilizing both in vitro angiogenesis assays (endothelial cell tube formation and migration) and in vivo Matrigel plug assays in mice, we demonstrate that sVEGFR-1
sequesters VEGF from endothelial cells and interrupts angiogenesis. Our model for the
inhibition of angiogenesis via sequestration of VEGF by sVEGFR-1 (Figure 3.1 ) involves
stimulation of local monocytes/macrophages by direct GM-CSF-administration at the site
of the primary tumor.
RESULTS
GM-CSF reduces VEGF detection in the supernatants of stimulated monocytes
Previously, we reported that M-CSF induces human monocytes to up-regulate both
VEGF mRNA transcription and protein production3. Since GM-CSF is also a survival factor for monocytes, we compared the levels of VEGF in the supernatants from non- stimulated and rhGM-CSF (100 ng/ml)-stimulated monocytes and expressed these values per viable monocyte. The data showed that GM-CSF-stimulated monocytes had significantly less VEGF than non-stimulated samples as detected by VEGF ELISA at both 24 and 48 hours (Figure 3.2A).
The reduction in VEGF detection from GM-CSF-stimulated monocytes not due to sequestration of VEGF within the cells
38 FIGURE 3.2: THE REDUCTION IN VEGF DETECTION FROM GM-CSF-STIMULATED MONOCYTES NOT DUE TO SEQUESTRATION OF VEGF WITHIN THE CELLS (A) Monocytes were left non-stimulated (white) or stimulated with GM-CSF (100 ng/ml) (black) for 24 and 48 hours and cell-free supernatants were subjected to VEGF ELISA. There was less VEGF detected by ELISA per monocyte in the GM-CSF- stimulated samples compared to non-stimulated samples (*p<0.01 and **p<0.001). These data represent the mean ± SEM calculated from three independent experiments. (B) Monocytes were left untreated (white) or stimulated with GM-CSF (100 ng/ml) (black) for 2 and 24 hours. Cell lysates were assayed for VEGF by ELISA. At 24 hours there is significantly less VEGF sequestered within monocytes due to GM-CSF- treatment relative to untreated samples. (*p<0.05). These data represent the mean ± SEM calculated from four independent experiments. (C) Monocytes were left non-stimulated (NS) or stimulated with M-CSF (100 ng/ml) (M-CSF) or GM- CSF (100 ng/ml) (GM-CSF) and labeled with 35S- Methionine/Cysteine. VEGF was purified from the cell- free supernatants using heparin-agarose beads, separated on a SDS-PAGE gel, and densitometry was performed using a phosphorimager. The VEGF band on the PAGE gel was clarified by detection of the band at the predicted size and compared to the band at the same size purified from the supernatants of M-CSF- stimulated monocytes, used as a positive control. The photograph is representative of three independent experiments.
Because there was reduced VEGF in the supernatants of GM-CSF-stimulated
monocytes compared to non-stimulated cells, we considered that this loss in VEGF
detection might be from VEGF sequestration intracellularly in GM-CSF-treated cells.
Monocytes were left untreated or treated with rhGM-CSF (100 ng/ml) for 2 and 24 hours
and assayed for VEGF in monocyte whole cell lysates. The data indicate that at 24
39 hours there was significantly less VEGF sequestered within monocytes treated with GM-
CSF than non-treated samples (Figure 3.2B).
Because VEGF levels were insufficient in the supernatants of non-stimulated or GM-
CSF-stimulated cells for immunoprecipitation studies, and the primary structure of VEGF
contains 11% methionines and cysteines, we chose to metabolically label VEGF using
35S-methionine and 35S-cysteine to determine differences in VEGF protein production.
Freshly isolated monocytes were either left non-stimulated or stimulated with rhGM-CSF
(100 ng/ml) or rhM-CSF (100 ng/ml) (positive control) for 36 hours followed by addition of both 35S-methionine and 35S-cysteine. Our results indicate that there is no significant difference in VEGF protein production between untreated and GM-CSF-stimulated monocytes (Figure 3.2C). Furthermore, real-time PCR analysis showed no difference in
VEGF mRNA transcription (data not shown) or cell toxicity due to GM-CSF stimulation after 24 hours (data not shown) to explain the observed differences.
Recombinant VEGF added the supernatants of GM-CSF-stimulated monocytes cannot be detected by ELISA
We next speculated that GM-CSF-stimulated monocytes released an inhibitory factor
into the supernatant that blocked antigenic detection of VEGF by ELISA. We added
recombinant human (rh)VEGF into supernatants generated by untreated, rhM-CSF-, and
rhGM-CSF-stimulated monocytes and incubated these samples at 37°C for 30 minutes.
While the supernatants of monocytes stimulated with GM-CSF blocked detection of
rhVEGF, supernatants from non- or M-CSF-stimulated samples did not (Figure 3.3A).
This data suggests that GM-CSF stimulated the release of a neutralizing factor in these supernatants that sequestered rhVEGF from antigenic detection by ELISA. We hypothesized that the VEGF inhibitory factor present in the supernatants was the
40 alternatively spliced, soluble form of VEGFR-1 (sVEGFR-1). Thus, we assayed the
ability of recombinant sVEGFR-1 to mask rhVEGF from detection by VEGF ELISA. 1, 8,
and 16 ng/ml sVEGFR-1 was incubated with 600 pg/ml rhVEGF at 37°C for 30 minutes
and subjected to VEGF ELISA. There was a significant, dose-dependent reduction in the
detection of rhVEGF due to the presence of recombinant sVEGFR-1 (Figure 3.3B).
Both sVEGFR-1 mRNA and protein levels are significantly increased in response to GM-CSF treatment
FIGURE 3.3: RECOMBINANT SVEGFR-1 MASKS VEGF FROM ELISA DETECTION (A) Monocytes were left untreated (NS) or treated with GM-CSF (100 ng/ml) (GM) for 24 hours. Supernatants were collected and subjected to VEGF ELISA. 450 pg/ml recombinant VEGF (rhVEGF added) was incubated with these supernatants at 37°C for 30 minutes and subjected to VEGF ELISA (NS sups+rhVEGF) and (GM sups+rhVEGF). There are significant differences in rhVEGF concentrations in both GM-CSF-stimulated samples compared to non-stimulated samples (*p<0.001) but no difference between the GM-CSF-stimulated samples (GM sups) alone vs. GM-CSF-stimulated supernatants supplemented with rhVEGF (GM sups + rhVEGF) (p>0.85). These data represent the mean ± SEM calculated from three independent experiments. (B) Increasing concentrations of recombinant sVEGFR-1 (1, 8, and 16 ng/ml) was incubated with 600 pg/ml rhVEGF and VEGF ELISA was performed to investigate the ability of sVEGFR-1 to mask VEGF from antigenic detection of the ELISA. There is a significant dose- dependent decrease in the detection of rhVEGF due to the presence of sVEGFR-1 (*p<0.01 vs. VEGF+sVEGFR-1 (1 ng/ml); **p<0.001 vs. VEGF added; ***p<0.001 vs. VEGF+sVEGFR-1 (1 ng/ml)). These data represent the mean ± SEM calculated from three independent experiments.
41 Since rhVEGFR-1 induced a dose-dependent reduction in rhVEGF detection, we
assayed each supernatant of untreated, M-CSF-, and GM-CSF-stimulated monocytes
for endogenously-expressed sVEGFR-1. An ELISA selective for human sVEGFR-1
showed that rhGM-CSF (100 ng/ml)-treated monocytes produce a significant amount of
the sVEGFR-1 compared to both non- and M-CSF-stimulated cells (Figure 3.4A).
To determine if GM-CSF induced transcription of sVEGFR-1 in human monocytes,
primers and a probe specific for sVEGFR-1 mRNA were designed and real-time PCR
analysis was performed. After stimulation of monocytes with rhGM-CSF, the sVEGFR-1
mRNA peak was detected at 24 to 48 hours followed by a decline in production at 72
hours (Figure 3.4B). This data indicates a significant increase in the transcription of
sVEGFR-1 mRNA in response to GM-CSF. These data led us to hypothesize that GM-
CSF induced monocytes to release sVEGFR-1 into their supernatants.
Soluble VEGFR-1 production correlates to loss in VEGF detection
To evaluate the possibility that preformed VEGF:sVEGFR-1 complexes existed
within the cell, we either left monocytes untreated or treated with rhGM-CSF (100 ng/ml)
for 24 hours and assayed both supernatant and cell lysate for the presence of sVEGFR-
1. Significant concentrations of sVEGFR-1 were released into the supernatant compared
to that remaining within the cell thus limiting availability of sVEGFR-1 for pre-existing
complex formation (Figure 3.4C).
To determine the concentration of GM-CSF needed to induce monocyte production
of sVEGFR-1, monocytes were left non-stimulated or stimulated with 0.1, 1, 10 or 100
ng/ml rhGM-CSF for 48 hours and the supernatants were evaluated for sVEGFR-1 and
VEGF by respective ELISAs. GM-CSF induced a dose-dependent increase in sVEGFR-
42 1 production (Figure 3.4D) and a concomitant dose-dependent decrease in VEGF detection (Figure 3.4E).
Antigenic detection of rhVEGF by ELISA is rescued with neutralizing antibodies specific for sVEGFR-1
To ensure that sVEGFR-1 was responsible for masking antigenic detection of VEGF,
sVEGFR-1 was immunodepleted from the supernatants of 24-hour, rhGM-CSF (100
ng/ml)-stimulated monocytes using specific neutralizing antibodies targeting the
extracellular domain of the sVEGFR-1. Next, rhVEGF (900 pg/ml) was added to these
sVEGFR-1-depleted supernatants and assayed for VEGF by ELISA. Depletion of
sVEGFR-1 from these supernatants recovered the detection of added rhVEGF. There
was no statistical difference comparing rhVEGF (900 pg/ml) alone compared to
sVEGFR-1 depleted supernatants+rhVEGF (900 pg/ml). In contrast, the detection of
rhVEGF was blocked in supernatants immunodepleted using an isotype IgG1 antibody
(Figure 3.4F).
Angiogenic activity of VEGF on endothelial cells is inhibited by the presence of sVEGFR-1 secreted by monocytes
Endothelial cell tube formation and migration are two in vitro methods to measure the angiogenic effects on cells with growth factors like VEGF17. To analyze the anti-
angiogenic activity of sVEGFR-1 produced by GM-CSF-stimulated monocytes, we
cultured human umbilical vein endothelial cells (HUVECs) in cell-free supernatants of
non- or rhGM-CSF-(100 ng/ml)-stimulated monocytes (24 hour incubation) and
incubated these HUVECs on growth factor-reduced Matrigel matrix for 20 hours.
Through qualitative observation (Figure 3.5A) and quantitative analysis of tube formation
(Figure 3.5B), the data indicates that GM-CSF-stimulated monocyte-expressed
43 FIGURE 3.4: GM-CSF AUGMENTS SVEGFR-1 MRNA AND PROTEIN WHILE CONCOMITANTLY REDUCING THE DETECTION OF VEGF BY ELISA
(A) Monocytes were left non-stimulated or stimulated with M-CSF (100 ng/ml) or GM-CSF (100 ng/ml) for 24 hours and the supernatants subjected to sVEGFR-1 ELISA. GM-CSF-stimulated supernatants have significantly increased levels of sVEGFR-1 compared to M-CSF- or non- stimulated controls (*p<0.001). These data represent the mean ± SEM calculated from seven independent monocyte donors. (B) Monocytes were left non-stimulated (white) or stimulated with GM-CSF (100 ng/ml) (black) for 4, 16, 24, 48, or 72 hours and total cellular RNA subjected to real-time PCR. sVEGFR-1 mRNA levels were significantly higher at both 24 and 48 hours versus non-stimulated samples at the same time points (*p<0.01 and ** p<0.001). These data represent the mean ± SEM calculated from three independent experiments.
44 FIGURE 3.4 (CONTINUED)
(C) Monocytes were left non-stimulated or stimulated with GM-CSF (100 ng/ml) for 24 hours. Supernatants (black) and cell lysates (white) were subjected to sVEGFR-1 ELISA. There is significantly more sVEGFR-1 released into the supernatant than remaining within the cells (*p<0.001). These data represent the mean ± SEM calculated from six individual monocyte donors. (D) Monocytes were left non-stimulated or stimulated with 0.1, 1, 10, or 100 ng/ml GM-CSF for 48 hours and supernatants subjected to sVEGFR-1 ELISA. There is a significant increase in sVEGFR-1 in both the 10 ng/ml and 100 ng/ml GM-CSF-treated samples compared to the 0, 0.1, and 1 ng/ml GM-CSF-stimulated samples (*p<0.01 vs. 0, 0.1, and 1 ng/ml GM-CSF treated samples and **p<0.05 vs. 0, 0.1, 1, and 10 ng/ml GM-CSF treated samples). These data represent the mean ± the SEM from three independent monocyte donors. (E) Supernatants from the GM-CSF dose-dependent trials in Figure 4D were concomitantly assayed by VEGF ELISA to analyze the concentration of GM-CSF that reduced VEGF antigenic detection by VEGF ELISA. GM-CSF at both 10 ng/ml and 100 ng/ml stimulates significant reduction of VEGF in a dose-dependent manner compared to 0, 0.1, and 1 ng/ml GM-CSF- stimulated samples (*p<0.01 vs. each 0, 0.1, and 1 ng/ml GM-CSF treated samples). These data represent the mean ± SEM from three independent monocyte donors. (F) Monocytes were stimulated with GM-CSF (100 ng/ml) and incubated for 24 hours. Supernatants were incubated with an antibody specific for sVEGFR-1 (sVR1 Ab) (2.5 μg/ml) or an isogenic IgG control antibody (IgG Ab) (2.5 μg/ml) for 30 minutes at 37°C then removed using protein G beads. Supernatants were subjected to VEGF ELISA ((GM sups+sVR1 Ab) and (GM sups+ IgG Ab)) for the presence of VEGF. rhVEGF (900 pg/ml) (rhVEGF Added) was incubated with some samples ((rhVEGF Added), (GM sups+sVR1 Ab+rhVEGF) and (GM sups+IgG Ab+rhVEGF)) for 30 minutes and subjected to VEGF ELISA. Supernatants from GM-CSF- stimulated monocytes incubated with the antibody for sVEGFR-1 allowed rhVEGF detection by ELISA while the supernatants from GM-CSF-stimulated monocytes incubated with the isogenic IgG antibody did not (*p<0.001 for VEGF detection vs. GM sups+ IgG Ab sample and no significant difference compared to rhVEGF Added sample). These data represent the mean ± SEM calculated from three individual monocyte donors. sVEGFR-1 inhibited tube formation in HUVECs in combination with added rhVEGF (2.5 ng/ml) compared to that induced by rhVEGF (2.5 ng/ml) alone (positive control). To assure that sVEGFR-1 was responsible for the reduction in HUVEC capillary-like formation, these supernatants were incubated with neutralizing antibodies specific for sVEGFR-1 or equal amounts of isogenic IgG antibodies. As expected, antibodies to sVEGFR-1 restored tube formation to that induced by rhVEGF (2.5 ng/ml) alone. In contrast, HUVEC samples incubated with GM-CSF-stimulated supernatants or GM-CSF- stimulated supernatants + rhVEGF (2.5 ng/ml) + isogenic IgG antibodies had 45 FIGURE 3.5: SUPERNATANTS FROM RHGM-CSF-STIMULATED MONOCYTES INHIBIT ANGIOGENESIS EFFECTS IN VITRO
(A) HUVECs were cultured in Matrigel as follows: HUVECs with EBM media (1 ml) (HUVECs); cells + rhVEGF (2.5 ng/ml) (VEGF); cells + 1 ml supernatants from rhGM-CSF (100 ng/ml)- stimulated monocytes + VEGF (2.5 ng/ml) (GM-CSF sups + VEGF); cells + 1 ml supernatants from rhGM-CSF (100 ng/ml)-stimulated monocytes + VEGF (2.5 ng/ml) + α-sVEGFR-1 neutralizing antibodies (2 μg/ml) (GM-CSF sups + VEGF + α-sVEGFR-1 Ab); or cells + 1 ml supernatants from rhGM-CSF (100 ng/ml)-stimulated monocytes + VEGF (2.5 ng/ml) + IgG1 isotype antibodies (2 μg/ml) (GM-CSF supernatants + rhVEGF + IgG1 isotype Ab). Pictures are representative of three independent trials. (B) Tubule branch points from HUVECs stimulated as indicated above were counted and the sum of three different fields for each condition were averaged. Supernatants from monocytes stimulated with GM-CSF supernatants + rhVEGF (2.5 ng/ml) (GM-CSF sups + VEGF) for 24 hours significantly inhibited endothelial cells from forming tube branch points compared to the rhVEGF (2.5 ng/ml) control (VEGF) and not statistically different from cells in EBM alone (HUVECs). GM-CSF supernatants incubated with rhVEGF (2.5 ng/ml) and neutralizing antibodies specific for sVEGFR-1 (2 μg/ml) (GM-CSF sups + VEGF + α-sVEGFR-1 Ab) rescued HUVEC tube formation similar to rhVEGF control levels and was significantly different than GM-
CSF supernatants incubated with rhVEGF (2.5 ng/ml) and IgG1 isotype antibodies (2 μg/ml) (GM-CSF sups + VEGF + IgG1 isotype Ab) (*p<0.05 vs. HUVECs, GM-CSF sups + VEGF, and GM-CSF sups + VEGF + IgG1 isotype Ab). Error bars represent the mean ± SEM calculated from three independent studies.
46 FIGURE 3.5 (CONTINUED)
(C) HUVECs were grown on Matrigel as follows: HUVECs with EBM media (1 ml) (HUVECs); cells + rhVEGF (5 ng/ml) (VEGF); or cells + rhVEGF (5 ng/ml) + rh sVEGFR-1 (50 ng/ml) (VEGF+ recomb. sVEGFR-1). The circular photographs are 40x magnification. Black boxes within indicate areas at 200x magnification below. Arrows denote tubule formation. Photos are representative of two independent trials. (D) Quantification of tubule branch points from the photographs in Figure 5C. There are significantly more tubule branch points in the VEGF condition versus media alone and VEGF + recombinant sVEGFR-1 (p<0.05 and p<0.01, respectively).
substantially less tube formation than samples treated with antibodies to sVEGFR-1
(Figure 3.5 A and B). To verify that sVEGFR-1 can prevent tube formation of endothelial
cells, we cultured HUVECs alone, with rhVEGF (5 ng/ml) or with VEGF (5 ng/ml) +
recombinant sVEGFR-1 (50 ng/ml) (Figure 3.5C). We speculate that any tube formation
of HUVECs in the basal media alone arises from VEGF produced by the endothelial
cells themselves (Uchida et al., 1994). Indeed, recombinant sVEGFR-1 significantly
inhibited endothelial cell tube formation compared to media alone and VEGF control
samples (Figure 3.5D). In addition, to corroborate the HUVEC tube formation assay, we assayed the ability of GM-CSF-stimulated supernatants from monocytes to reduce
HUVEC migration through a porous filter disk using rhVEGF as the chemoattractant.
These results were similar to the tube formation assay by limiting endothelial cell migration (data not shown).
GM-CSF treatment inhibits angiogenesis in a Matrigel plug assay in mice
Our next objective was to determine if these in vitro observations correlated to in vivo effects of GM-CSF on angiogenesis, thus we used the Matrigel plug assay in mice. Prior to injection, unpolymerized growth factor-reduced Matrigel matrix was supplemented
47 with PBS alone, rhVEGF (10 ng/ml), or rhVEGF (10 ng/ml) + recombinant human sVEGFR-1 (160 ng/ml) to assess if recombinant sVEGFR-1 could inhibit angiogenesis and von Willebrand factor (vWf) (+) cell recruitment within the Matrigel plugs augmented by VEGF as the positive control. After 10 days, the mice were sacrificed and the plugs were removed, sectioned, and analyzed for vWf (+) cells to identify endothelial cell recruitment. VEGF-treated plugs significantly increased migration of vWf (+) cells and
blood vessel formation within the Matrigel plugs compared to PBS-treated plugs (mean
values: 28±1 vWf (+) cells per HPF for VEGF; 15±1 vWf (+) cells per HPF for PBS plugs)(p<0.001 for VEGF-treated plugs vs. PBS plugs). Additionally, those plugs incubated with VEGF (10 ng/ml) + recombinant sVEGFR-1 (160 ng/ml) had significantly less vWf (+) cells (mean value: 20±1 vWf (+) cells per HPF) than the VEGF (10 ng/ml)- treated plugs (p<0.001). This data suggest that recombinant human sVEGFR-1 inhibited
VEGF activity within these plugs.
We next incubated Matrigel with rhVEGF (10 ng/ml); rhGM-CSF (10 ng/ml); rhGM-
CSF (10 ng/ml) + rhVEGF (10 ng/ml); rhGM-CSF (100 ng/ml); rhGM-CSF (100 ng/ml) + rhVEGF (10 ng/ml); rhGM-CSF (100 ng/ml) + rhVEGF (10 ng/ml) + neutralizing
antibodies specific for sVEGFR-1 (2 μg/ml); or rhGM-CSF (100 ng/ml) + rhVEGF (10
ng/ml) + isotype IgG1 antibodies (2 μg/ml) and then subcutaneously injected into
C57BL/6 female mice. Qualitative observation of these slides suggested that both plugs incubated with rhGM-CSF (100 ng/ml) or rhGM-CSF (100 ng/ml) + rhVEGF (10 ng/ml)
(Figure 3.6E and F) had less CD31 (+) cells compared to plugs treated with rhVEGF (10 ng/ml) (Figure 3.6). Importantly, plugs supplemented with rhGM-CSF (100 ng/ml) + rhVEGF (10 ng/ml) + neutralizing antibodies for sVEGFR-1 (Figure 3.6G) had significantly more CD31 (+) cells than plugs treated with PBS, rhGM-CSF (100 ng/ml),
48 FIGURE 3.6: RHGM-CSF TREATMENT INHIBITS ANGIOGENESIS IN A MATRIGEL PLUG ASSAY IN MICE Qualitative representation of angiogenesis in mice in response to Matrigel plugs treated with the following conditions: (A) Matrigel supplemented with PBS (B) Matrigel supplemented with rhVEGF (10 ng/ml) (C) Matrigel supplemented with rhGM-CSF (10 ng/ml) (D) Matrigel supplemented with rhGM-CSF (10 ng/ml) + rhVEGF (10 ng/ml) (E) Matrigel supplemented with rhGM-CSF (100 ng/ml) (F) Matrigel supplemented with rhGM-CSF (100 ng/ml) + rhVEGF (10 ng/ml) (G) Matrigel supplemented with rhGM-CSF (100 ng/ml) + rhVEGF (10 ng/ml) + α- sVEGFR-1 antibodies (2 μg/ml) (H) Matrigel supplemented with rhGM-CSF (100 ng/ml) + rhVEGF (10 ng/ml) + IgG1 isotype antibodies (2 μg/ml) (I) Relative count of CD31 (+) cells (black) and CD68 (+) cells (mononuclear cells) (white) which penetrate the Matrigel plugs in response to stimuli and observed using a 40x objective. There was significantly more CD31 (+) cells in matrigel plugs treated with rhVEGF (10 ng/ml) alone and GM-CSF (100 ng/ml) + rhVEGF (10 ng/ml) + α-sVEGFR-1 antibodies (2 μg/ml) (B and G) than in plugs treated with GM-CSF (100 ng/ml) (E), GM-CSF (100 ng/ml) + rhVEGF (10 ng/ml)-treated plugs (F) or GM-CSF (100 ng/ml) + rhVEGF (10 ng/ml) + IgG isotype antibody (2 μg/ml) (H)(*p<0.05).
49 FIGURE 3.6 (CONTINUED)
(J) Total cells counts identified by H&E staining for cell nuclei which penetrated the Matrigel plugs in response to stimuli and observed using a 40x objective. GM-CSF (100 ng/ml)-treated plugs (E) displayed reduced blood vessel presence within the plugs compared to rhVEGF (10 ng/ml) alone (B) and those plugs containing rhGM-CSF + VEGF + α-sVEGFR-1 neutralizing antibodies (G). The GM-CSF (100 ng/ml)- (E) and GM-CSF (10 ng/ml)-treated plugs (C) had less cells than plugs treated with VEGF (10 ng/ml) (B) or with sVEGF-R Ab (G) (*p<0.003 vs. GM-CSF (10 ng/ml) + VEGF (10 ng/ml) sample, **p<0.003 vs. GM-CSF (10 ng/ml) sample, and ***p<0.001 vs. each PBS, GM-CSF (100 ng/ml), and GM-CSF (100 ng/ml) + VEGF (10 ng/ml) sample). Values represent the number of total cell nuclei per 40x field. At least three mice were tested per group. Note: Large pictures are 400x magnification and insets are 100x magnification for all samples. (K) C57BL/6 mice were sacrificed and bone marrow from femur collected. After washing in RPMI-1640, the bone marrow was cultured and either left non-stimulated, stimulated with hGM- CSF (100 ng/ml) or with mGM-CSF (100 ng/ml). Every two days the media was collected and fresh media and GM-CSF-treatment was administered. After 10 days, the plates were washed with PBS and pictures taken (5 per well). (L) Cell counts represent percent mGM-CSF activity (ability to induce murine bone marrow cell maturation) from Figure 7K. Human GM-CSF induces murine bone marrow cell maturation significantly more than PBS treatment (non-stimulated) (p<0.05).
rhGM-CSF (100 ng/ml) + rhVEGF (10 ng/ml), and rhGM-CSF (100 ng/ml) + rhVEGF (10
ng/ml) + isogenic antibodies of the same isotype (mouse IgG1) (Figure 3.6A, E, F, and H,
respectively). When considering CD31 (+) and CD68 (+) cell recruitment, CD68 (+)
cell migration was less affected by the addition of GM-CSF than was CD31 (+) cell
migration.
To quantify differences, digital photographs of the H&E, CD31, and CD68 stained
slides were taken using an inverted, phase-contrast microscope at 400x magnification
for each sample. Figure 3.6I illustrates a significant reduction in the number of CD31 (+)
cells invading the plugs treated with PBS, rhGM-CSF (100 ng/ml), rhGM-CSF (100ng/ml)
+ rhVEGF (10 ng/ml), or rhGM-CSF + rhVEGF + IgG1 isotype antibodies compared to plugs treated with rhVEGF (10 ng/ml) or rhGM-CSF (100 ng/ml) + rhVEGF (10 ng/ml) +
α-VEGFR-1 antibodies. Of interest, plugs treated with rhGM-CSF had a dose-dependent
50 reduction in relative cell counts (Figure 3.6J). In addition there was no statistical difference between plugs injected with rhGM-CSF (10 ng/ml) or rhGM-CSF (100 ng/ml) compared to rhGM-CSF (10 ng/ml) + rhVEGF (10 ng/ml) or rhGM-CSF (100 ng/ml) + rhVEGF (10 ng/ml), respectively.
Because there is confusion as to whether recombinant human GM-CSF can stimulate the maturation of bone marrow-derived murine macrophages, we compared the ability of rhGM-CSF and rmGM-CSF to induce macrophage maturation at 10 days.
Using bone marrow obtained from normal C57BL/6 mice, we found that both rhGM-CSF and rmGM-CSF induced more macrophage maturation than non-stimulated cells (Figure
3.6K). Of note, rmGM-CSF at equal concentrations was more potent than rhGM-CSF in promoting maturation (Figure 3.6L).
GM-CSF does not alter levels of membrane-bound VEGFR
Because sVEGFR-1 is an alternatively-spliced variant of the membrane-bound
form of the same gene product (flt-1), it is important to understand if the ratio of soluble
to membrane-bound VEGFR is altered by GM-CSF stimulation in monocytes. After
isolating a fresh population of CD14 (+) cells (monocytes) from whole blood (Figure
3.7A), relative expression of membrane-bound VEGFR-1 was investigated (Figure 3.7B).
By standardizing the expression of VEGFR-1 using an antibody specific for the receptor
and subtracting the relative value of isotype IgG1, our data shows no significant difference in VEGFR-1 expression at the membrane surface at 24 hours between non- stimulated and GM-CSF-stimulated cells (p>0.2) (Figure 3.7C and D).
51 FIGURE 3.7: INVESTIGATION OF THE MECHANISM OF VEGFR-1 EXPRESSION AND SVEGFR-1 SECRETION FROM HUMAN MONOCYTES (A) A population of CD14(+) cells isolated by flow cytometry using α-human CD14- phycoerythrin antibodies. (B) Fresh CD14(+) cells were analyzed for VEGFR-1 expression using mouse α- human VEGFR-1- phycoerythrin (shaded) and
mouse α-human IgG1- phycoerythrin (open) antibodies. There is no significant difference between the isotype and VEGFR-1 antibody (p>0.5). These data represent the mean ± SEM calculated from three independent monocyte donors. (C) Non-stimulated CD14(+) cells were cultured for 24 hours and analyzed for VEGFR-1 expression (shaded) and IgG1 (open) compared to fresh cells (Figure 7B). There is a significant difference between fresh and non- stimulated monocytes after 24 hours for VEGFR-1 expression (p<0.05). These data represent the mean ± SEM calculated from three independent monocyte donors. (D) GM-CSF (100 ng/ml)-stimulated CD14(+) cells were cultured for 24 hours and analyzed for VEGFR-1 expression (shaded) and IgG1 (open) compared to fresh cells (Figure 7B). There is a significant difference in VEGFR-1 expression between fresh and GM-CSF-stimulated monocytes after 24 hours (p<0.05), and no significant difference in VEGFR-1 expression between non- stimulated and GM-CSF-stimulated monocytes at 24 hours in culture (p>0.2). These data represent the mean ± SEM calculated from three independent monocyte donors.
52 FIGURE 3.7 (CONTINUED)
(E) Monocytes were left untreated (NS), with DMSO (NS+DMSO), or treated with GM-CSF (100 ng/ml) (GM) in combination with inhibitors (AG490, LY294002, or SP600125) for 24 hours. Supernatants were subjected to sVEGFR-1 (black bars) and VEGF (white bars) ELISAs. AG490 (JAK2), LY294002 (PI3-kinase), and SP600125 (JNK) reduced the production of sVEGFR-1 (●p<0.05 vs. GM-CSF+50 μM AG490); ●●p<0.05 vs. GM-CSF+20 μM LY294002 ♦p<0.03 vs. GM- CSF+80 μM SP600125; and ♦♦p<0.02 vs. GM-CSF alone). Concomitantly, all three inhibitors rescued the detection of VEGF (°p<0.05 vs. GM-CSF+20 μM LY294002; °°p<0.02 vs. non- stimulated; ◊p<0.02 vs. GM-CSF+80 μM SP600125; and ◊◊p<0.001 vs. GM-CSF+50 μM AG490). These data represent the mean ± SEM calculated from three independent monocyte donors.
JAK, JNK, and PI3-kinase pathways mediate sVEGFR-1 production
Since the known biological effects attributed to myeloid progenitor cells by GM-
CSF include three known pathways; JNK18, 19, PI3-kinase and JAK20 we assayed the
ability of three potent inhibitors of these pathways (SP600125, LY294002, and AG490,
respectively) to reduce the production of sVEGFR-1 from human monocytes subsequent
to stimulation by GM-CSF. Human monocytes were left untreated or stimulated with
rhGM-CSF (100 ng/ml) in the presence or absence of specific signal transduction
inhibitors. Supernatants were collected and subjected to sVEGFR-1 and VEGF ELISAs,
respectively. Our results indicate a dose-dependent reduction in sVEGFR-1 from each
AG490 (JAK), SP600125 (JNK) and LY294002 (PI3-kinase pathway) and restoration of
VEGF antigenic detection within these same supernatants (Figure 3.7E). Trypan blue
analysis was performed to ensure changes in sVEGFR-1 and VEGF production was not
due to toxicity to the cells. Of note, 50 μM AG490 restored VEGF detection to higher
levels than seen in non-stimulated cells. We are evaluating the possibility that the JAK
activity is a negative regulator of native VEGF production to explain this finding.
53 DISCUSSION
This paper introduces a novel role for GM-CSF in regulating VEGF activity by
stimulating secretion of the soluble form of the membrane-bound VEGFR-1 (sVEGFR-1)
from human monocytes, inhibiting VEGF-induced angiogenesis, both in vitro and in vivo.
The impetus of this study emanated from a report showing that M-CSF (+/-) mice
were protected from breast cancer metastases and that overexpressing M-CSF in the
primary tumor induced metastases to a level seen in wild type mice16. As a potential mechanism for this effect, we reported that M-CSF induces human monocytes to release biologically active VEGF3. In the performance of that study, we observed that GM-CSF- stimulated monocytes had significantly less VEGF compared to both rhM-CSF- stimulated and non-stimulated monocytes as detected by VEGF ELISA. Now, we report the reduction in VEGF observed in response to rhGM-CSF stimulation is due to the production of a soluble form of VEGF receptor-1. An ELISA specific for human sVEGFR-
1 protein showed monocytes produced significantly more sVEGFR-1 in response to GM-
CSF than in response to M-CSF- or those left untreated. This data was further supported by real-time PCR analysis showing that sVEGFR-1 mRNA in GM-CSF-stimulated monocytes peaked at 48 hours while there was no increase in mRNA levels in non- stimulated cells. Likewise, GM-CSF-stimulated monocytes produced a dose-dependent increase in sVEGFR-1 mRNA transcription, and subsequent protein expression which was significantly greater than in non-stimulated samples.
To investigate the mechanism of loss in antigenic VEGF detection in the supernatants of GM-CSF-stimulated monocytes, these supernatants were incubated with neutralizing antibodies specific for sVEGFR-1 to rescue rhVEGF detection. As
54 predicted, rhVEGF detection was restored in samples incubated with antibodies to
sVEGFR-1 while incubation with isogenic IgG antibodies did not restore VEGF detection.
Of note, while neutralizing antibodies to sVEGFR-1 restored detection of exogenous
rhVEGF, neutralizing antibodies did not rescue detection of endogenous VEGF released
in the supernatants of GM-CSF-stimulated monocytes. We speculate that the affinity of
pre-formed protein-receptor complexes were too strong for the antibodies to disrupt
while antibodies added to these supernatants prior to adding rhVEGF allowed
competitive inhibition of binding of rhVEGF to the sVEGFR-1.
Next, we wanted to know if supernatants from GM-CSF-stimulated monocytes
containing sVEGFR-1 inhibited tube formation of endothelial cells in an in vitro Matrigel
angiogenesis model. Cell-free supernatants from GM-CSF-stimulated monocytes
inhibited HUVEC tube formation compared to supernatants from non-stimulated cells,
confirming that GM-CSF induced monocytes to produce anti-angiogenic molecules.
More importantly, in vivo data showed that mice injected with Matrigel plugs supplemented with recombinant rhGM-CSF + rhVEGF had significantly less angiogenesis into these plugs compared to plugs supplemented with rhVEGF. Similarly,
CD31 (+) cells that invaded the plugs was proportional to bioavailable antigenic VEGF.
In contrast, infiltration of CD68 (+) cells within these plugs not statistically different in any condition. These data suggest that CD68 (+) cells were responding to GM-CSF to regulate VEGF activity and inhibit recruitment of endothelial cells. The mechanism for
the differences in angiogenesis seen in plugs treated with or without rhGM-CSF likely
reflects the relative production of sVEGFR-1 in GM-CSF-stimulated samples, as
antibodies to sVEGFR-1 in rhGM-CSF-treated Matrigel plugs restored blood vessel
55 formation and CD31 (+) cell recruitment to levels seen in plugs incubated with rhVEGF alone.
Since it has been shown that certain tumors can metastasize in the presence of
VEGF (Folkman et al., 1990), it is of great interest pharmacologically to understand the mechanism by which GM-CSF induces overproduction of sVEGFR-1, a molecule that can sequester VEGF and block its activity. sVEGFR-1 mRNA and protein was up- regulated by GM-CSF, and since there were no change in the amount of VEGFR-1 surface expression on monocytes in GM-CSF-stimulated cells compared to cells left untreated after 24 hours, we concluded that sVEGFR-1 was transcriptionally regulated by GM-CSF. However, it is possible that GM-CSF induced the production of an intermediate factor to account for sVEGFR-1 expression. To dissect the signaling pathways involved, we used pharmacological inhibitors instead of transfection studies because of the difficulty in transfecting primary human monocytes, and found that each
JAK, JNK, and PI3-kinase inhibitors reduced the production of sVEGFR-1 in GM-CSF- stimulated monocytes and recovered detection of VEGF in the samples.
The observation that rhGM-CSF stimulates human monocytes to release sVEGFR-1 and inhibit VEGF-induced angiogenesis has direct impact on solid organ tumors, where monocyte and macrophage influx into primary tumors under the influence of M-CSF stimulation may enhance tumor metastases (Lin et al., 2001) perhaps through the production of VEGF (Eubank et al, 2003). The observation that rhGM-CSF reduces the biological activity of VEGF suggests that in addition to promoting granulocyte production after chemotherapy, rhGM-CSF may also have anti-tumor effects through the ability to reduce tumor metastases and angiogenesis. Pharmacologically, GM-CSF is currently used in therapy to treat a number of conditions related to neutropenia and bone marrow
56 transplantation. Existing treatment strategies for recovery of bone marrow in transplant
patients include 125 to 250 μg/m2 daily given by IV infusion over 2 hours beginning
within 2 hours after allogeneic BMT (bone marrow transplantation) and continued for up
to 27 days. However, as opposed to systemic administration of rhGM-CSF to induce
bone marrow recovery, our data suggests that local injection of rhGM-CSF may be
needed to reduce tumor metastases through the production and release of sVEGFR-1
by monocytes.
Soluble VEGFR-1 treatment in tumors is a valid approach as past studies using
various forms of sVEGFR-1 have targeted VEGF and reduced its angiogenic effects21.
Currently, a “decoy” soluble-receptor, known as VEGF-TRAP, composed of the first three Ig-like domains of VEGFR-1 fused to the constant region (Fc) of human IgG1
effectively suppresses tumor growth and vascularization in vivo22. To our knowledge, this is the first report to show that monocytes are an endogenous source of sVEGFR-1 from
GM-CSF treatment. At present, we are investigating involvement of M-CSF and GM-
CSF and their effects on monocytes and macrophages in both physiological and
pathophysiological angiogenesis utilizing murine models.
EXPERIMENTAL PROCEDURES
Materials - Blood donors were obtained from the American Red Cross (Columbus,
OH). Fetal bovine serum (FBS) (certified < 0.06 EU/ml endotoxin levels) was obtained
from Hyclone Laboratories (Logan, UT). Recombinant human (rh)GM-CSF, rhVEGF, rh-
sVEGFR-1, human VEGF Duoset ELISA Development Kit, and human sVEGFR-1
Quantitikine Kit were purchased from R&D Systems (Minneapolis, MN). α-human
VEGFR-1 antibody was purchased from Sigma-Aldrich (St. Louis, MO). Growth Factor-
57 Reduced Matrigel™ matrix and BD Biocoat Invasion Chambers were purchased from
Discovery Labware (Bedford, MA). Human Umbilical Vein Endothelial Cells (HUVECs),
Endothelial Basal Medium (EBM), and EGM Singlequots® were all purchased from
BioWhittaker, Inc (Walkersville, MD). Absolutely RNA™ RT-PCR Miniprep Kit for total
RNA purification was purchased from Stratagene® (La Jolla, CA). SuperScript First-
Strand Synthesis System for RT-PCR Kit for cDNA synthesis was purchased from Gibco
BRL (Carlsbad, CA). Taqman Universal PCR Master Mix was obtained from Applied
Biosystems. Human sVEGFR-1 (sFlt-1) Probe (5’- 6FAM™-CTGTTTTCTCTCGGATCT-
MGB™ - 3’), sFlt-1 Forward Primer (5’-AGGTGAGCACTGCAACAAAAAG-3’), and the
sFlt-1 Reverse Primer (5’-GTGGTACAATCATTCCTTGTGCTT-3’) were designed using
Primer Express v1.0 software (ABI Prism, Perkin-Elmer, Branchburg, NJ) and
synthesized by Applied Biosystems. The primers and probe sequence specific for VEGF
mRNA analysis by real-time PCR are as previously described3. C57BL/6 female mice
were purchased from Jackson Laboratories (Bar Harbor, ME). Human serum albumin
(0.1%) was added to all samples to act as a carrier for recombinant VEGF. The JAK
inhibitor (JAK2 and JAK3) AG490, PI3-kinase inhibitor LY294002, and JNK inhibitor
SP600125 were purchased from Calb ioc h e m (S an Diego, CA).
Monocyte Isolation - Single donor monocytes were isolated either from source
leukocyte packs obtained from the American Red Cross or by negative selection from
fresh blood using Monocyte Negative Isolation Kit (Miltenyi Biotec, Auburn, CA). Of note,
monocyte purity is >90% as per the manufacturer. For all experiments, monocytes were
resuspended in either 5x106 or 10x106 cells/condition in RPMI-1640 + 0.1% human
serum albumin (HSA) + 10 μg/ml polymyxin B and left non-stimulated or stimulated with
58 100 ng/ml of rhM-CSF or rhGM-CSF. Polymyxin B was added as further protection
against endotoxin contamination in cell cultures.
VEGF and sVEGFR-1 production measured by ELISA - Human monocytes were stimulated immediately after isolation by 100 ng/ml rhM-CSF, rhGM-CSF or left untreated and then incubated at 37°C, 5% CO2 for the indicated time (0, 24, or 48 hours) and cell-free supernatants were collected. For inhibitor studies, compounds were added to monocytes for 30 minutes at 37°C and the cells were stimulated or left untreated for
24 hours.
VEGF and sVEGFR-1 measurement in monocytic whole cell lysates - Isolated monocytes were stimulated with 1, 10, or 100 ng/ml of rhGM-CSF and analyzed as previously described (Eubank et al., 2003).
35S-Methionine/Cysteine labeling of VEGF - Freshly isolated monocytes were either left non-stimulated or stimulated with rhM-CSF (100 ng/ml) or rhGM-CSF (100 ng/ml) for 36 hours at 37°C and 5% CO2. All supernatants were aspirated and fresh
DMEM (methionine/cysteine-free) media (1 ml) was added to each sample followed by
50 μCi/ml of both 35S-methionine and 35S-cysteine for 12 hours. The cultured monocytes
were centrifuged at 5,000 rpm for 5 minutes and the supernatants collected and
incubated with heparin agarose for 2 hours at 4°C to isolate labeled VEGF and
separated on an 8% SDS-PAGE gel. Gels were dried and subjected to densitometry
using a phosphorimager. VEGF was identified by the predicted molecular weight and by
comparing to the band purified from M-CSF-stimulated monocytes, used as a positive
control for VEGF production.
59 Total RNA isolation from monocytes - Monocyte total RNA was collected as previously described3.
Real-time polymerase chain reaction - Soluble VEGFR-1 primers and probe with
MGB quencher were designed based on the human sVEGFR-1 sequence (accession
U01134). 2x Universal Master Mix was used in the reaction mixture containing 0.83 μl of
12 μM each forward and reverse primers, 200 nM probe (FAM-MGB), 0.25 μl of "20X"
18S internal control probe (VIC-MGB), 17.3 μl DEPC-treated water, and 4 μl cDNA from each sample for a 50 μl total reaction volume. The real-time polymerase chain reaction was completed on the ABI Prism Sequence Detector 7700 (Perkin-Elmer) using
Sequence Detector v1.7 software. Reaction conditions were as follows: 50° C for 2
minutes, 95° C for 10 minutes, 40 cycles of 95° C for 15 seconds and 60° C for 1 minute.
Fold induction or reduction of VEGF or soluble VEGFR-1 mRNA was calculated as
previously described3.
In vitro HUVEC tube formation assay - Isolated monocytes were left non- stimulated or stimulated with rhGM-CSF (100 ng/ml) and incubated at 37°C, in 5% CO2,
for 24 hours. Cell-free supernatants were harvested and then frozen at –80°C. Prior to
using these rhGM-CSF-stimulated monocyte supernatants, all remaining rhGM-CSF was
immunodepleted using α-rhGM-CSF antibodies (2 μg/ml) at 4°C for 2 hours and subjected to protein G agarose beads for removal. HUVECs were cultured in these supernatants using growth factor-depleted Matrigel. Anti-angiogenic activity was assessed by the inhibition of branch points from capillary-like tube structures formed between the endothelial cells. Matrigel was distributed in a 96-well plate (60 μl/well) and
allowed to solidify at 37°C. HUVECs (pass 1 to 4) were serum-starved in EBM for 2
60 hours. All controls and samples were resuspended in EBM and had 1.5 x 105
HUVECs/well. All components were rotated at 4°C for at least one hour before addition
to HUVECs. The culture was incubated at 37°C for 20 hours. Tube formation was
observed and digital pictures were captured. Quantification of anti-angiogenic activity
was measured by counting branch points from tubes formed between discrete
endothelial cells in each well relative to the positive control (2.5 ng/ml rhVEGF). Total
branch points in three high-powered fields were counted per well in a blinded manner.
Additionally, HUVECs were cultured in EBM alone; with rhVEGF (5 ng/ml); or with
rhVEGF (5 ng/ml) + recombinant sVEGFR-1 (50 ng/ml) and allowed to incubate at 37°C
for 16 hours. Five photographs per well were taken and the number of tube branch
points were quantified as indicated above.
In vivo Matrigel plug assay - Six week old C57BL/6 female mice were anesthetized
with isoflurane and subcutaneously injected with 0.5 ml growth factor-reduced Matrigel™
matrix supplemented with either PBS + 0.1% HSA; with 1, 10, or 100 ng/ml rhM-CSF; 10
ng/ml rhVEGF alone or in combination with 1, 10, or 100 ng/ml rhGM-CSF; or 100 ng/ml
rhGM-CSF incubated with 2 μg/ml sVEGFR-1 neutralizing antibodies or isotype
antibodies. All components added to the unpolymerized Matrigel were allowed to
incubate at 4°C for at least 4 hours prior to injection. After 10 days, the mice were
sacrificed, skinned and the Matrigel plugs removed and flash-frozen in liquid nitrogen. At
least three mice were used per experimental group.
Histology - Total cellular influx within the plugs was determined using Hematoxylin and Eosin (H&E) stain. Photographs of randomly selected high-powered fields using a
40x objective lens were captured for each sample, then counted in a blinded manner and averaged. Relative cell counts per high powered field were quantified by counting 61 individual endothelial cells, identified by CD31 immunostaining (50:1 in PBS for 1 hour at
room temperature followed by three washes in PBS for a total of 30 minutes for frozen
sections), or by von Willebrand factor immunostaining (by Dr. Donna Kusewitt,
Veterinary Pathology, Director of Veterinary Biosciences and
Histology/Immunohistochemistry, The Ohio State University, for formalin-fixed, paraffin
embedded sections) which passed inside the perimeter of the Matrigel plug and
contributed to the composition of a blood vessel. Mononuclear cells were identified by
CD68 immunostaining (200:1 in PBS for 1 hour at room temperature followed by three
washes in PBS for a total of 30 minutes). “Angiogenesis” is defined as the process of
vascularization involving development of blood vessels within the Matrigel plugs.
FLOW analysis for VEGFR-1 expression – Human monocytes isolated from whole blood were cultured for 24 hours in EBM and either left untreated or treated with 100 ng/ml rhGM-CSF and subsequently counted and stained for the expression of membrane-bound VEGFR-1 using either mouse α-human VEGFR-1-phycoerythrin mAb
(R&D Systems) or mouse IgG1-phycoerythrin isotype antibody (Pharmingen).
Statistical Analyses - Minitab statistical software utilizing a non-parametric ANOVA
with Tukey's post-hoc test was performed to determine differences between groups
using MiniTab software (State College, PA). Groups were considered significantly
different at p<0.05.
REFERENCE LIST
1. Wognum, A. W., Westerman, Y., Visser, T. P. & Wagemaker, G. Distribution of receptors for granulocyte-macrophage colony-stimulating factor on immature CD34+ bone marrow cells, differentiating monomyeloid progenitors, and mature blood cell subsets. Blood 84, 764-774 (1994).
62 2. Bleharski, J. R. et al. A role for triggering receptor expressed on myeloid cells-1 in host defense during the early-induced and adaptive phases of the immune response. J. Immunol. 170, 3812-3818 (2003). 3. Eubank, T. D., Galloway, M., Montague, C. M., Waldman, W. J. & Marsh, C. B. M- CSF induces vascular endothelial growth factor production and angiogenic activity from human monocytes. J. Immunol. 171, 2637-2643 (2003). 4. Leung, D. W., Cachianes, G., Kuang, W. J., Goeddel, D. V. & Ferrara, N. Vascular endothelial growth factor is a secreted angiogenic mitogen. Science 246, 1306-1309 (1989). 5. Dvorak, H. F. VPF/VEGF and the angiogenic response. Semin. Perinatol. 24, 75-78 (2000). 6. Cao, Y. et al. Expression of angiostatin cDNA in a murine fibrosarcoma suppresses primary tumor growth and produces long-term dormancy of metastases. J. Clin. Invest. 101, 1055-1063 (1998). 7. Matsumoto, T. & Claesson-Welsh, L. VEGF receptor signal transduction. Sci. STKE 2001, RE21 (2001). 8. Wiesmann, C. et al. Crystal structure at 1.7 A resolution of VEGF in complex with domain 2 of the Flt-1 receptor. Cell 91, 695-704 (1997). 9. Barleon, B. et al. Migration of human monocytes in response to vascular endothelial growth factor (VEGF) is mediated via the VEGF receptor flt-1. Blood 87, 3336-3343 (1996). 10. Neufeld, G., Cohen, T., Gengrinovitch, S. & Poltorak, Z. Vascular endothelial growth factor (VEGF) and its receptors. FASEB J. 13, 9-22 (1999). 11. Risau, W. Mechanisms of angiogenesis. Nature 386, 671-674 (1997). 12. Ferrara, N. et al. Heterozygous embryonic lethality induced by targeted inactivation of the VEGF gene. Nature 380, 439-442 (1996). 13. Kendall, R. L., Wang, G. & Thomas, K. A. Identification of a natural soluble form of the vascular endothelial growth factor receptor, FLT-1, and its heterodimerization with KDR. Biochem. Biophys. Res. Commun. 226, 324-328 (1996). 14. Roeckl, W. et al. Differential binding characteristics and cellular inhibition by soluble VEGF receptors 1 and 2. Exp. Cell Res. 241, 161-170 (1998). 15. Kliche, S. & Waltenberger, J. VEGF receptor signaling and endothelial function. IUBMB Life 52, 61-66 (2001). 16. Lin, E. Y., Nguyen, A. V., Russell, R. G. & Pollard, J. W. Colony-stimulating factor 1 promotes progression of mammary tumors to malignancy. J. Exp. Med. 193, 727-740 (2001). 17. Yahata, Y. et al. Nuclear translocation of phosphorylated STAT3 is essential for vascular endothelial growth factor-induced human dermal microvascular endothelial cell migration and tube formation. J. Biol. Chem. 278, 40026-40031 (2003).
63 18. Terada, K., Kaziro, Y. & Satoh, T. Ras-dependent activation of c-Jun N-terminal kinase/stress-activated protein kinase in response to interleukin-3 stimulation in hematopoietic BaF3 cells. J. Biol. Chem. 272, 4544-4548 (1997). 19. Nagata, Y., Nishida, E. & Todokoro, K. Activation of JNK signaling pathway by erythropoietin, thrombopoietin, and interleukin-3. Blood 89, 2664-2669 (1997). 20. Wojchowski, D. M. & He, T. C. Signal transduction in the erythropoietin receptor system. Stem Cells 11, 381-392 (1993). 21. Goldman, C. K. et al. Paracrine expression of a native soluble vascular endothelial growth factor receptor inhibits tumor growth, metastasis, and mortality rate. Proc. Natl. Acad. Sci. U. S. A. 95, 8795-8800 (1998). 22. Holash, J. et al. VEGF-Trap: a VEGF blocker with potent antitumor effects. Proc. Natl. Acad. Sci. U. S. A. 99, 11393-11398 (2002).
64 CHAPTER 4: GM-CSF INVOKES AND ANTI-
ANGIOGENIC PHENOTYPE SWITCH IN TUMOR-
ASSOCIATED MACROPHAGES
Stupid is forever. Ignorance can be fixed.
Don Wood
SUMMARY
When we discovered that angiogenic activity of monocyte/macrophages could
respond so differently in response to different cytokines, we were excited at the idea that
we might be able to reverse the pro-angiogenic behavior of macrophages who found
themselves held in the trance of mammary tumors. To do this, we made use of a mouse
model of breast cancer—the same one responsible for several of the seminal
discoveries describing tumor-macrophage interactions. The results of those studies,
presented here, are encouraging.
65 ABSTRACT
Tumor-educated macrophages facilitate tumor metastasis and mediate angiogenesis. When we discovered that GM-CSF caused macrophages to block VEGF activity by producing a soluble VEGF receptor (sVEGFR-1), we wondered whether GM-
CSF could alter macrophage behavior within living tumors to impede its development.
Here we show that GM-CSF treatment of mice with mammary tumors slows tumor growth and prevents metastasis. These treated tumors have more macrophages, fewer blood vessels, and show lower oxygen levels. Administration of blocking antibodies shows that the effects of GM-CSF are sVEGFR-1 dependent. In situ hybridization identifies macrophages as the primary source of sVEGFR-1. These data suggest that
GM-CSF invokes a macrophage phenotype switch in the tumor microenvironment, reducing angiogenesis and limiting metastasis. This shows that tumor-associated macrophages can be re-educated to elicit behaviors which change the course of disease.
66 BACKGROUND
Cancers direct cells in the tumor environment to behave in ways that facilitate tumor
growth and spread. As tumors develop, they influence endothelial cells, macrophages,
T cells, and fibroblasts to evade host defenses, maintain a sufficient blood supply, and
produce factors that promote growth, survival, and metastases1.
Diversity in the native characteristics of the tumor cells and in the tissues in which
they reside forces cancers to employ different mechanisms to overcome barriers to
malignant transformation. Some tumors routinely downregulate immune surveillance
molecules to avoid attack by cytotoxic T cells and natural killer (NK) cells2, 3. Some secrete high levels of growth factors to stimulate blood vessel growth4. Others
downregulate molecules which maintain cell-cell interactions5. The behavioral changes tumors impose on surrounding tissues and cells (“tumor education”)6 often represent an inappropriate triggering of developmental programs within the tumor cells themselves7.
One type of immune cell, the macrophage, plays an important role in the
development of normal breast tissue and in the development of breast tumors.
Macrophage activity, stimulated by macrophage colony stimulating factor (M-CSF), is
essential for normal breast development, especially during pregnancy and lactation8. In
breast tumors, macrophages constitute up to 35% of the infiltrating inflammatory cells9.
These tumor-associated macrophages (TAMs) produce factors that facilitate tumor invasion and angiogenesis, such as matrix metalloproteinases10 (MMPs) and VEGF11
(vascular endothelial growth factor).
The milieu of cytokines secreted by tumor cells, stromal cells, and infiltrating immune
cells dictates the behavior of macrophages within the tumor and determines the factors
67 they produce. Many breast tumors secrete M-CSF, the predominant macrophage-tropic
factor within most breast tumors. M-CSF is over expressed in over 70% of human
breast cancers, stimulated by activation of native developmental programs12. Serum M-
CSF levels show strong correlations with tumor size, metastasis, and poor outcomes in
humans13, 14. Landmark studies showed that mice deficient in M-CSF are protected
against breast tumor metastasis, and that re-expressing M-CSF solely in the breast
tissue restores metastatic activity15. Several groups demonstrated mechanisms that
underlie this observation. Pollard’s group described an M-CSF/EGF paracrine loop
between tumors and macrophages16. We showed that M-CSF stimulates monocyte/macrophages to produce biologically active VEGF11, inducing angiogenesis.
Recent studies further illustrated the important role macrophages play in tumor-related
angiogenesis17.
In sharp contrast to M-CSF, GM-CSF-stimulated monocytes exhibit several anti-
tumor behaviors. GM-CSF enhances the ability of macrophages to present antigen and
initiate immune responses18. We showed that GM-CSF also stimulates monocytes to
secrete soluble VEGF receptor-1 (sVEGFR-1), which binds and inactivates VEGF19. In
these studies, we found such VEGF inactivation to be biologically relevant, impeding the
growth of blood vessels in Matrigel plugs. Angiogenesis within the tumors is necessary
for tumor progression, as tumors cannot grow beyond a few cubic millimeters without
blood vessel formation to supply oxygen and nutrients.20, 21.
Recent studies illustrate the importance of sVEGFR-1 expression in blocking cancer
progression. For example, Bando et al measured intra-tumor protein levels of free and
total VEGF, and sVEGFR-1 from 202 human primary breast cancer tissues. Low
68 sVEGFR-1 and high total VEGF were significantly associated with poor prognosis in
both disease-free and overall survival22. Toi et al found 94 of 110 human primary breast carcinomas expressed increased sVEGFR-1. In that analysis, tumors in which the sVEGFR-1 levels exceeded VEGF levels by 10-fold had a markedly favorable prognosis.
Multivariate analysis demonstrated the ratio of sVEGFR1 and VEGF was an independent prognostic indicator after nodal status23. Other clinical studies have shown
similar findings for patients with colorectal cancer24, glioblastoma25, and acute myeloid leukemia26.
These observations have led us to speculate that macrophage behavior could be
manipulated in vivo by GM-CSF. We wanted to know whether the macrophage
phenotypes elicited by tumor-education could be reversed by altering the relative
concentrations of macrophage-tropic factors within the tumor microenvironment. With
these studies, we will show that intra-tumor GM-CSF injections reversed the effects of
FIGURE 4.1: GM-CSF ALTERS THE EXPRESSION OF ANGIOGENIC MOLECULES IN MONOCYTES. Many breast tumors express M-CSF, which stimulates monocyte/macrophages to adopt a pro-angiogenic phenotype marked by VEGF expression. GM-CSF, on the other hand, makes these cells produce sVEGFR-1, which can block vascular growth. sVEGFR-1 not only affects the relatively small amount of VEGF produced by the monocytes themselves, but will bind VEGF from any source, including that produced by the tumor cells. This and other effects of GM-CSF may slow tumor growth and hinder metastasis. The underlying hypothesis of this paper is that local GM-CSF injection will alter the tumor microenvironment in ways that will change the phenotype of the macrophages within the tumor, causing them to adopt anti-tumor, anti- angiogenic behaviors.
69 tumor education and induced an anti-tumor phenotype in tumor-associated
macrophages (Figure 4.1).
RESULTS
Local treatment with GM-CSF slowed tumor growth in a mouse model of breast cancer.
Based on our in vitro work19, we proposed that treating tumors with high levels of
GM-CSF would stimulate TAMs to secrete soluble VEGF receptor-1, counter the actions of tumor-derived VEGF, and block angiogenesis27. Since tumors require new blood vessels to grow beyond a few cubic millimeters20, 21, we suspected that this approach would reduce tumor growth and metastases. The model we chose to test our hypothesis involved transplantation of syngeneic tumor cells from a PyMT+ donor mouse to a single mammary gland of an FVB recipient. We chose to use the PyMT model because 1) tumor progression in these mice closely resembles that seen in many aggressive human tumors28, 2) these tumors readily metastasize, and 3) the syngeneic model maintains a fully-functional immune system in these mice. Transplantation of the tumor into a single mammary gland allowed us to isolate the primary lesion, avoiding problems associated with tumors arising in ten separate mammary pads. When tumors became palpable, we randomized the mice into treatment groups and began treatment. Mice received intra- tumor injections of equal volumes of PBS or rmGM-CSF three times per week for three weeks. Once a week, tumor measurements were recorded.
Mice treated with GM-CSF demonstrated a 66% reduction in tumor size after three
weeks (p=0.025, Figure 4.2A). We let the tumors grow until they reached 2 cm in their
greatest dimension, at which time the mice were euthanized (in accordance with the
70
FIGURE 4.2: INTRATUMOR GM-CSF INJECTIONS SLOWS TUMOR GROWTH AND PROLONGS SURVIVAL. (A) 8-10 week old female FVB mice were injected with 5 X 105 PyMT tumor cells into the left abdominal mammary fat pad. Upon palpable tumor formation, mice were randomized to treatment with PBS (vehicle) or 100ng GM-CSF. Mice were treated with this dose of GM-CSF by intratumor injection three times per week until tumors reached the maximum size allowed by our ILACUC protocol. Tumor volume and mouse weight were measured weekly. Data shown represent average tumor size ±SEM from eight (GM-CSF) and ten (vehicle) mice. P=0.025 by repeated measures ANOVA. (B) Kaplan-Meier analysis of mice shown in (A). Censored data (one mouse in each group) represent mice who died from causes other than tumor burden. Median survival was 3 weeks for vehicle-treated mice and 6 weeks for GM-CSF-treated mice. P=0.010 by Mantel-Cox nonparametric log rank test. protocol approved by our Institutional Animal Care and Use Committee). Figure 4.2B shows the results of the Kaplan-Meier analysis, demonstrating a three week increase in the median survival of mice treated with GM-CSF (3 weeks vs. 6 weeks, p=0.010). GM-
CSF-treated mice had no significant changes in body weight or overt clinical side effects.
CBC analysis revealed no difference between treatment groups in the concentrations of any cell type (Total WBCs, neutrophils, lymphocytes, monocytes, eosinophils, basophils, platelets; Mann-Whitney U, n=7 mice/group). In blood collected from mice treated with
GM-CSF, serum levels of the cytokine remained undetectable from 6 to 12 hours after intratumor injection (less than 14 pg/ml, 9 mice per group).
71 GM-CSF treatment correlated with reduced lung metastasis.
The PyMT breast cancer model
metastasizes readily to the lung28.
Because tumor angiogenesis is an essential component of metastases and
GM-CSF treatment stimulates macrophages in vitro to produce anti- angiogenic factors (such as sVEGFR-
1)19, we predicted that GM-CSF treatment would reduce lung metastases. Lungs harvested from the same mice shown in Figure 4.2 were FIGURE 4.3: LOCAL GM-CSF TREATMENT REDUCES TUMOR METASTASIS TO LUNG. insufflated, fixed whole, and stained with On euthanasia, lungs were removed from GM-CSF and PBS-treated mice, insufflated, hematoxylin to identify tumor masses fixed in formalin, stained with hematoxylin, and whole-mounted. These lungs were then within the lungs (Figure 4.3A). Despite imaged on a stereo microscope and tumor metastases noted. the fact that all tumors were allowed to (A) Representative images of lungs from GM-CSF and PBS-treated mice. Arrows grow to 2 cm in diameter before the mice show metastatic tumor growths, which appear as small opacities. were removed from the study, GM-CSF (B) Quantification of tumor metastases. Dotted line shows mean values over 5 and 6 treatment reduced the number of lung mice per group. P=0.037 by Mann-Whitney U test. metastases (Figure 4.3B, p=0.037 by
Mann-Whitney U).
GM-CSF lowered oxygen levels within the tumor proper.
72 If the reductions in tumor growth
and metastasis in GM-CSF-treated
mice resulted from the production of
sVEGFR-1 and a subsequent block in
angiogenesis, we predicted that GM-
CSF-treated mice had reduced
oxygen levels within their tumors. To
track changes in oxygen
concentration in real-time within the
tumors of PBS- or GM-CSF-treated
mice, we mixed an oxygen-sensitive
nanoprobe (lithium octa-n-butoxy 2,3-
naphthalocyanine [LiNc-BuO]
FIGURE 4.4: INTRATUMOR GM-CSF microcrystals)29 with PyMT tumor cells TREATMENT REDUCES OXYGEN LEVELS WITHIN MAMMARY TUMORS IN VIVO. and injected them into the mammary 8-10-week-old FVB female mice were given orthotopic injections of tumor cells containing fat pads of normal FVB female mice. nanoparticles of LiNC-BuO, allowing for real- time, in vivo oxygen measurement by electron High resolution, 3-dimensional EPR paramagnetic resonanance imag ing (EPR). Oxygen levels in these mice were measured weekly by 2D EPR, and once at 3 weeks by 3D techniques were used to analyze EPR. oxygen tension within the tumors (A) Representative samples of 3D EPR imaging showing particle distribution and oxygen tension throughout the three weeks of throughout the tumor. N anoparticles were uniformly distributed and limited in space to an area corresponding to the tumor proper. treatment. GM-CSF-treated tumors Numeric values on oxygen maps represent oxygen concentration in mmHg. demonstrated reduced oxygen levels (B) Trends in tumor oxygen levels over time. Lines represent average oxygen concentration compared to tumors treated with PBS in mmHg taken from 2D EPR measurements ±SEM from 5 mice per group. P=0.050 by (Figure 4.4, p=0.050 by repeated repeated measures ANOVA. 73 measures ANOVA). Distribution maps show uniform probe allocation throughout the
tumor, equal between groups, and limited to the tumor itself.
GM-CSF caused increased cell death within the tumor and changes in patterns of necrosis.
Depriving tumors of oxygen and other nutrients causes cell death and tissue
necrosis. To evaluate the effects of reduced angiogenesis and oxygen deprivation on the
tumors, we used fluorescent microscopy techniques to assess the extent of cell death
and necrosis in H&E-stained tumor sections30. Histologic evaluation validated the
biological significance of lower oxygen levels; GM-CSF-treated tumors had higher levels
of tissue necrosis compared to those treated with PBS (p=0.011 by Mann-Whitney U,
Figure 4.5A-C). Of particular note are the patterns of necrosis observed in these two
different tissues. Mice treated with PBS demonstrated typical focal patterns of necrosis
with a single area of involvement near the outer surface of the tumor. In contrast, GM-
CSF-treated tumors revealed diffuse, multifocal patterns of necrosis, with smaller
necrotic foci distributed throughout the tumor.
GM-CSF increased macrophage, but not neutrophil numbers in tumors.
Many different cell types compose murine breast tumors. To examine whether GM-
CSF treatment altered the cell types that infiltrated the tumor, we performed
immunohistochemistry on these tumors to determine changes in cell influx in response
to GM-CSF treatment. We found significant increases in F4/80+ (macrophage) staining
within tumors treated with GM-CSF (p=0.014, Figure 4.5F-H). We did not find significant
differences in the numbers of neutrophils (7/4+ cells) recruited to the tumors (3.18% vs
4.49% 7/4+ cells, 7 and 9 mice per group, p=0.315 by Mann-Whitney U).
74 FIGURE 4.5: HISTOLOGIC ANALYSIS OF TUMORS.
On euthanasia, tumors were removed from GM-CSF and PBS-treated mice, fixed in formalin, paraffin-embedded, sectioned, and stained with H&E, by IHC for F4/80, and by ISH for sVEGFR- 1 mRNA.
75 FIGURE 4.5 (CONTINUED)
(A)-(B) H&E sections were imaged at 10X under green fluorescence conditions. Under these conditions, necrotic tissue will autofluoresce, allowing for identification of necrotic regions. Necrotic regions were quantified and compared to the area of the entire tumor section to obtain the percent necrotic tissue, as shown in (C). P=0.011 by Mann-Whitney U. (D)-(E) H&E sections from different tumors viewed at 10X under white light. (F)-(G) IHC for F4/80 (brown stain) shows number and distribution of macrophages in tumors treated with vehicle or GM-CSF. GM-CSF-treated tumors contain accumulations of F4/80- positive cells around the necrotic areas. Macrophage numbers were digitally quantified by comparing the number of F4/80 positive pixels to the total number of pixels in each high power field for stitched images taken across entire tumors. Results of this analysis are shown in (H). P=0.014 by Mann-Whitney U. (I)-(J) ISH identified cells expressing mRNA for sVEGFR-1 (dark blue/black stain). Distribution of sVEGFR-1-positive cells as well as cell phenotypes correlate well with macrophage phenotype and distribution, suggesting that these are the cells producing the sVEGFR-1.
Tumor-associated macrophages produced sVEGFR-1 in response to GM-CSF treatment.
We showed that GM-CSF-treated macrophages produce and release sVEGFR-1,
which limits the bioactivity of VEGF within the environment19. Here, we hypothesized
that changing the cytokine milieu in the tumor microenvironment by the addition of GM-
CSF would induce tumor-educated macrophages to produce sVEGFR-1. We stained
serial tumor sections by immunohistochemistry for F4/80 and by in situ hybridization for
sVEGFR-1. Grossly, GM-CSF- and vehicle-treated tumors looked distinctly different
(Figure 4.5D-E). Vehicle-treated tumors had a more uniform appearance, contrasting
with the splotchy, irregular tissue variations seen at low magnification in the GM-CSF-
treated tumors. Not only did GM-CSF increase macrophage recruitment to the tumor, but
promoted the organization of these cells into inflammatory nodules, containing mostly
F4/80+ macrophages (Figure 5f-g, images taken from regions marked with white boxes
on d and e). Macrophages in the GM-CSF-treated tumors produced sVEGFR-1 mRNA,
especially along the interface between the nodules and the tumor cells (Figure 5j-l).
76 PBS-treated tumors did not develop inflammatory nodules, nor did we find expression of
sVEGFR-1 mRNA.
There was no difference in VEGF expression between the PBS- and GM-CSF-
treated groups. When we extracted extracellular fluid from the tumors and subjected
these samples to ELISA analysis for VEGF, we found a significant reduction in VEGF
detection in the GM-CSF-treated tumors (4.0 vs 9.7 μg/ml, p=0.049 by Student T, n=10 and 13 per group). Since the ELISA antibody binds an epitope blocked by sVEGFR-119,
this finding is consistent with reduced VEGF activity in the treated samples from the
actions of sVEGFR-1. sVEGFR expression mediated the effects of GM-CSF treatment.
We suspected that the biological effects we observed, such as reduced tumor growth
rate, were dependent on the activity of sVEGFR-1. To test this hypothesis, we injected
PyMT tumor cells into the mammary fat pad of normal FVB mice, as in the previous
studies. Upon formation of a palpable tumor, the mice were randomized to one of the
following four treatment groups: PBS, GM-CSF, GM-CSF plus a neutralizing antibody to
sVEGFR-1, or GM-CSF plus an equimolar concentration of isotype IgG control antibody.
Treatment with a neutralizing antibody to sVEGFR-1 returned the growth rate of GM-
CSF-treated tumors to near vehicle-treated levels (Figure 4.6A, p=0.006 overall, p=0.046
for GM-CSF + αsVEGFR vs GM-CSF + isotype by repeated measures ANOVA with
Tukey post-hoc testing). In contrast, growth rates for GM-CSF-treated tumors and GM-
CSF plus isotype-treated tumors were not different (p = 0.843).
77
FIGURE 4.6: SVEGFR NEUTRALIZATION RESTORES NORMAL TUMOR GROWTH PATTERNS. (A) Graph shows change in tumor volume over time. Lines represent mean tumor size ± SEM for each group at each timepoint. Groups consisted of 4, 5, 8, and 4 mice, respectively. p=0.006 overall, p=0.046 for GM-CSF + α-sVEGFR vs GM-CSF + isotype by repeated measures ANOVA with Tukey post-hoc testing. (B) Mice were injected with a fluorescently-labeled dextran immediately before euthanasia. Harvested and sectioned tumors were then imaged with a fluorescent microscope to assess the extent of functional blood vessel development within the tumor. Images show representative samples from tumors taken from each group. Stitched images taken across the entire tumor section were digitally quantified for number of fluorescent pixels for each mouse. The average percent of Texas Red-positive pixels per mouse is shown the graph. P=0.023 by Kruskal-Wallis test.
GM-CSF treatment reduced vessel density within the tumor.
According to our hypothesis, the lower levels of oxygen we observed in GM-CSF- treated tumors result from a sVEGFR-1-mediated block in angiogenesis. To test the effects of GM-CSF on blood vessel growth within the tumor, we injected mice with Texas
78 Red-conjugated dextran (70 kD) five minutes prior to euthanasia. Tumors which were
removed, fixed, and sectioned were analyzed by fluorescent microscopy for the quality
and quantity of functional blood vessels. As shown in Figure 4.6B-F, GM-CSF treatment
reduced the number of vessels in the tumor (p=0.023 by Kruskal-Wallis). We also
observed differences in the quality of the blood vessels within these tumors—while
vehicle-treated tumors demonstrate tortuous, irregular, leaky blood vessels typical of
tumor-related neovascularization, GM-CSF-treated tumors have straight, regular, less
permeable vessels reminiscent of normalized vessels (a hallmark of anti-VEGF
therapy31, 32).
DISCUSSION
This manuscript presents the novel observation that tumor-associated macrophages
(TAMs) can be re-educated in murine breast cancer. Understanding the mechanisms of
“tumor education” and basic macrophage biology has allowed us to identify factors that
can alter macrophage behaviors within the tumor environment. Our data show that we
can re-educate TAMs to an anti-tumor phenotype by local administration of GM-CSF in a
murine model of breast cancer through the production of sVEGFR-1.
GM-CSF treatment slows tumor growth and prevents lung metastasis in our mouse model. This approach contrasts with previous work limiting mononuclear phagocyte
trafficking to the tumor15. Our data show that re-educating the TAMs can produce nearly
identical effects. In our studies, we find increased numbers of TAMs in tumors treated
with GM-CSF, and still demonstrate improved outcomes. The effects of GM-CSF are
robust, especially in light of the aggressive nature of the PyMT tumor model28.
79 Other groups have examined the relationship of GM-CSF and tumor metastasis.
Park et al33 showed that NF-κB activity drove GM-CSF expression, activated osteoclasts and facilitated lytic bone metastases when ovarian tumors were injected into the left ventricle of mice. Contrasting with this, our study highlights the diverse effects that a single cytokine has in different microenvironments. In the studies presented here, we created a locally high concentration of GM-CSF in already-developed breast tumors.
While it was difficult to assess bone metastasis in these studies (PyMT tumors do not readily metastasize to bone28), we did assess systemic effects of GM-CSF treatment and
found no measureable change in circulating GM-CSF levels, and no alterations in
peripheral blood cell populations. Thus, the results of our intervention stem from local
alterations in the microenvironment and not from systemic effects of GM-CSF in a
hematogenously disseminated tumor model.
In these studies we took advantage of in vivo, intratumor oxygen measurement by
EPR as a surrogate for angiogenic activity. Most rapidly growing tumors have large
oxygen demands. This demand must be met by the production of new blood vessels to
deliver nutrients and oxygen. We found reduced oxygen levels within the tumors of GM-
CSF-treated mice, correlating with reduced angiogenesis. This evidence supports the
hypothesis that the production of sVEGFR-1 by TAMs blocks functional vessel
development. The effects of treatment are especially noticeable in the 3D imaging,
where effects at the border of the tumor can be separated from measurements within the
tumor (e.g., tumors in GM-CSF-treated mice have less than 5 mmHg O2 across ~90% of
the tumor by 3D measures at week 3).
Altered amounts and patterns of necrosis found in GM-CSF-treated tumors illustrate
the biological significance of oxygen deprivation, and provide outcomes which correlate 80 with reduced angiogenesis and oxygen delivery to the tumors. Differing patterns of
necrosis in GM-CSF- vs. vehicle-treated tumors correlate with GM-CSF-stimulated
changes in macrophage distribution and behavior in the focal nodules of inflammatory
cell accumulation throughout the tumor (see discussion of IHC and ISH below).
Reduced levels of functional angiogenesis at three weeks confirm that the
mechanism behind the GM-CSF effect includes angiogenic blockade. Patterns of blood
vessel growth in treated tumors appear more like normalized or physiologic
vasculature34, as opposed to the highly irregular, tortuous patterns of growth seen in untreated tumors or in mice treated with neutralizing antibodies to sVEGFR-1. These patterns correlate well with other studies examining the biological effects of VEGF blockade in patients treated with bevacizumab32.
We propose that this anti-angiogenic activity is attributable to a change in TAM
phenotype within the tumor, marked by the expression of sVEGFR-1. Until now, most
tumors (especially those of the breast) show strong negative correlation between
macrophage infiltration and outcome6, 35, 36. In the current studies, we reduced rates of
breast cancer growth and metastasis despite increasing the number of macrophages in
the GM-CSF-treated tumors. We conclude from this data that we have successfully re-
educated the TAMs within these tumors—manipulating their behavior to affect desirable
outcomes.
Further support for that hypothesis comes from the combined IHC/ISH studies.
Throughout GM-CSF-treated tumors, macrophages congregate in inflammatory nodules,
often surrounding areas of necrotic tissue. PBS-treated tumors do not have these
nodules, suggesting that they form specifically as a result of GM-CSF treatment. We
81 found the densest regions of sVEGFR-1 expression at the interface of inflammatory
nodules and the tumor cells. These areas of tissue necrosis spatially match areas of
macrophage accumulation and production of sVEGFR-1.
Neutralization of sVEGFR-1 with blocking antibodies show definitive evidence that
this important anti-angiogenic factor largely mediates the effects of GM-CSF treatment
on tumor growth. However, sVEGFR-1 blockade does not completely reverse the
effects of GM-CSF treatment. Plausible explanations for this include 1) that the blocking
antibody had less than 100% activity or 2) that other mechanisms can account for part of
the GM-CSF effect. Others have explored the use of autologous tumor cells engineered
to produce GM-CSF to treat human cancers, especially melanoma37. Their studies show that GM-CSF can stimulate the differentiation and activity of dendritic cells, activating the
adaptive immune response to the tumor. These T-cell responses could also occur in the present model. Such effects likely account for at least a portion of the response not due to sVEGFR-1.
Taken together, our data show that GM-CSF slows tumor growth by starving the tumors of oxygen and nutrients via increasing levels of sVEGFR-1 within the tumor, preventing angiogenesis. We reprogrammed the tumor microenvironment and changed the way “tumor educated” cells behave in vivo using therapeutically-plausible techniques. Such models provide a powerful platform for studying the involvement of
macrophages and other cells in the processes which comprise malignant transformation.
Detailed studies of the changes invoked by treatment within each cell type and within the tumor organ will help us understand the contributions made by each of the players within this complex environment to the process of malignant transformation.
82 METHODS
Mice. All procedures involving mice were conducted in accordance with OSU
ILACUC protocol regarding the use and care of experimental animals. The PyMT
transgenic mice were purchased from Jackson Laboratories (Bar Harbor, ME). Mammary
tumors from the PyMT transgenics were removed and orthotopically injected into normal
FVB female mice for these studies.
Tumor injections. MET-1 tumor cells (derived from tumor-bearing MMTV-PyMT
mice) were cultured in DMEM containing 10% FBS, 10 μg/ml insulin, and 5 ng/ml rhEGF
until 80% confluent. These cells were trypsinized, washed, and resuspended in DMEM
media at 500,000 cells per 100 μl. The cell suspension was drawn into insulin syringes
and orthotopically injected into the number four mammary fat pads of normal female
FVB mice.
Treatment study. After the tumors became palpable (about 4 weeks), mice were
randomized to treatment groups. Either PBS or 100 ng rmGM-CSF in 50 μls was
administered using an insulin syringe directly into the tumor. For longer timepoint
studies, mice were treated until their tumors reached 2 cm in their greatest dimension, at
which time they were euthanized in accordance with protocols approved by our local
ILACUC. For short timepoint studies, a total of seven treatments were administered
(three times per week). Tumor dimensions and mouse weight were measured weekly for
long timepoint studies or at each treatment for the shorter studies. For studies analyzing
the effect of neutralizing sVEGFR-1 in combination with GM-CSF treatment, tumors
were orthotopically injected. After the tumors became palpable, either PBS, 100 ng
rmGM-CSF, 100 ng rmGM-CSF + 4 μg anti-VEGF receptor-1 neutralizing antibody, 100
83 ng rmGM-CSF + 4 μg isotype IgG control (goat), or 4 μg anti-VEGF receptor-1
neutralizing antibody in 50 μl was injected directly into the tumors using insulin syringes.
EPR oximetry. Lithium octa-n-butoxy 2,3-naphthalocyanine (LiNc-BuO)
microcrystals were a gift from Dr. Periannan Kuppusamy, The Ohio State University.
PyMT tumor cells were prepared as the previous treatment study. 10 mg microcrystals
were resuspended in 500 μl DMEM and vortexed copiously. 25 μl of this suspension was
added to 5x105 PyMT cells for each 100 μl injection. Oxygen measurements were performed immediately, weekly, and upon sacrifice for anoxic values using in vivo EPR oximetry. Measurements of tumor oxygenation was performed non-invasively using an
L-band in vivo EPR spectrometer (L-band, Magnettech, Germany) equipped with automatic coupling and tuning controls. Mice, under anesthesia (2% isofluorane), were placed in a right-lateral positions with their tumor close to the loop of the surface coil
resonator. EPR spectra were acquired as single 30-second scans. The instrument
settings were: incident microwave power, 4 mW; modulation amplitude, 180 mG;
modulation frequency 100 kHz; receiver time constant, 0.2 s. The peak-to-peak width of
the EPR spectrum was used to calculate pO2 using a standard calibration curve. Three-
dimensional imaging was performed as described previously38.
Evaluation of angiogenesis. Texas red–conjugated dextran (mol wt 70,000;
Molecular Probes, Eugene, OR) was prepared to 6.2 mg/mL in PBS and was injected i.v. via the tail vein at 20 μg/g of mouse body weight. The mice were humanely sacrificed for tissue preparation 5 minutes after administration. Each tumor was removed and cut in half - one half was placed into a cryovial and flash frozen in liquid nitrogen, the other half was formalin-fixed for immunohistochemical staining. Tumor sections were analyzed
84 blindly for fluorescence using confocal microscopy and functional blood vessels (texas
red-dextran positive) were identified and quantified using Adobe Photoshop CS2.
Evaluation of necrosis. Upon euthanasia, the lungs from mice treated with GM-
CSF or PBS were removed, insufflated, fixed in formalin and paraffin embedded, sectioned and stained with hematoxylin & eosin. Necrotic tissue within the tumors was evaluated by capturing digital images using a 1x objective and exposure to green fluorescent light as described (Achilles, E. G. et al., 2001). Necrosis was quantified in a blinded manner using Adobe Photoshop CS2 software.
Tumor metastases. Upon euthanasia, the lungs from mice implanted with tumor cells and treated with GM-CSF or PBS were removed, insufflated, fixed in formalin, and stained with hematoxylin. Tumor cell metastases were evaluated by subjecting the lungs to Bright Field light under a stereomicroscope. Each tumor incident was counted in a blinded manner.
In situ hybridization. Our protocol for detection of RNAs by in situ hybridization has been previously published39. In brief, the tissue was deparaffinized, proteased (30
minutes in 2 mg/ml of pepsin in RNase free water), washed in sterile water, then 100%
ethanol, and air-dried. Probes that were each 48 nucleotides long were made from
cDNA specific for VEGF, s-FLT-1 mRNA and scrambled cDNAs that contained the same
nucleotides as the former two but in a random order. The probes were labeled with the
3’ oligonucleotide tailing kit (Enzo Diagnostics, Farmingdale, NY) using biotin as the
reporter nucleotide. Hybridization was done at 37° C overnight and followed by a wash
in 0.2XSSC and 2% bovine serum albumin. The probe-target complex was seen due to
the action of alkaline phosphatase (as part of the streptavidin complex – Enzo
85 Diagnostics) on the chromogen nitroblue tetrazolium and bromochloroindolyl phosphate
(NBT/BCIP). Nuclear fast red served as the counterstain. The negative controls
included: omission of the probe and the use of the scrambled probe and, in each case,
yielded no signal.
Immunohistochemistry. To identify cells within the tumors that were producing either VEGF or sVEGFR-1 mRNA, serial sections of the tumors were cut and stained for
F4/80+ cells. Our protocol for the immunohistochemical detection in paraffin embedded tissue sections has been previously published39. In brief, optimal conditions for rat anti-
mouse F4/80 were protease digestion (protease 1, Ventana Medical Systems, Tucson
AZ) for 4 minutes, dilutions of 1:100, dilution of the biotinylated anti-rat secondary
antibody at 1:200, and use of the DAB detection system from Enzo Diagnostics
(Farmingdale, NY). For identification of cell infiltrates in response to treatment, the
formalin-fixed, paraffin-embedded mammary tumors were stained to identify F4/80+
(macrophages) and 7/4 (neutrophils) as well as hematoxylin & eosin (H&E) for tissue
morphology. Total cell influx was analyzed by digital images captured of the entire
tumors and quantified using Adobe Photoshop CS2 software.
Statistical Analyses. For data comparing single independent measurements
between two treatment groups, Mann-Whitney U test was used to determine whether
observations could have come from identical distributions (metastases, tissue necrosis,
immunohistochemical stains). The similar nonparametric Kruskal-Wallis test was used
when comparing more than two groups (Texas Red angiogenesis data). When groups
were larger and distributions approximated the normal distribution, equality of means
between groups was compared by Student’s T test. Growth data and ongoing oximetry
data were compared by repeated measures ANOVA with Tukey posthoc testing, since
86 measures of an individual mouse from one observation to the next were not
independent. Kaplan-Meier survival analyses used Mantel-Cox Log Rank testing to
determine differences between groups.
REFERENCES
1. Hanahan, D. & Weinberg, R. A. The hallmarks of cancer. Cell (Cambridge) 100, 57 (2000). 2. Watson, N. F. et al. Immunosurveillance is active in colorectal cancer as downregulation but not complete loss of MHC class I expression correlates with a poor prognosis. International journal of cancer.Journal international du cancer 118, 6 (2006). 3. Tsuruma, T. et al. Interleukin-10 reduces natural killer (NK) sensitivity of tumor cells by downregulating NK target structure expression. Cell. Immunol. 198, 103 (1999). 4. Demirkesen, C. et al. The correlation of angiogenesis with metastasis in primary cutaneous melanoma: a comparative analysis of microvessel density, expression of vascular endothelial growth factor and basic fibroblastic growth factor. Pathology 38, 132 (2006). 5. Oka, H. et al. Expression of E-Cadherin Cell-Adhesion Molecules in Human Breast- Cancer Tissues and Its Relationship to Metastasis. Cancer Res. 53, 1696-1701 (1993). 6. Pollard, J. W. Tumour-educated macrophages promote tumour progression and metastasis. Nature reviews.Cancer 4, 71 (2004). 7. Lotem, J. & Sachs, L. Cytokine control of developmental programs in normal hematopoiesis and leukemia. Oncogene 21, 3284-3294 (2002). 8. Pollard, J. W. Role of colony-stimulating factor-1 in reproduction and development. Mol. Reprod. Dev. 46, 54 (1997). 9. Tang, R. et al. M-CSF (monocyte colony stimulating factor) and M-CSF receptor expression by breast tumour cells: M-CSF mediated recruitment of tumour infiltrating monocytes? J. Cell. Biochem. 50, 350-356 (1992). 10. Hagemann, T. et al. Enhanced invasiveness of breast cancer cell lines upon co- cultivation with macrophages is due to TNF-alpha dependent up-regulation of matrix metalloproteases. Carcinogenesis 25, 1543-1549 (2004). 11. Eubank, T. D., Galloway, M., Montague, C. M., Waldman, W. J. & Marsh, C. B. M- CSF induces vascular endothelial growth factor production and angiogenic activity from human monocytes. J. Immunol. 171, 2637-2643 (2003). 12. Sapi, E. The role of CSF-1 in normal physiology of mammary gland and breast cancer: an update. Exp Biol Med (Maywood. ) 229, 1-11 (2004).
87 13. Scholl, S. M. et al. Circulating levels of the macrophage colony stimulating factor CSF-1 in primary and metastatic breast cancer patients. A pilot study. Breast Cancer Res. Treat. 39, 275-283 (1996). 14. Kacinski, B. M. CSF-1 and its receptor in ovarian, endometrial and breast cancer. Ann. Med. 27, 79-85 (1995). 15. Lin, E. Y., Nguyen, A. V., Russell, R. G. & Pollard, J. W. Colony-stimulating factor 1 promotes progression of mammary tumors to malignancy. J. Exp. Med. 193, 727-740 (2001). 16. Wyckoff, J. et al. A paracrine loop between tumor cells and macrophages is required for tumor cell migration in mammary tumors. Cancer Res. 64, 7022 (2004). 17. Lin, E. Y. et al. Macrophages regulate the angiogenic switch in a mouse model of breast cancer. Cancer Res. 66, 11238-11246 (2006). 18. Armstrong, C. A. et al. Antitumor effects of granulocyte-macrophage colony- stimulating factor production by melanoma cells. Cancer Res. 56, 2191-2198 (1996). 19. Eubank, T. D. et al. GM-CSF induces expression of soluble VEGF receptor-1 from human monocytes and inhibits angiogenesis in mice. Immunity 21, 831-842 (2004). 20. Gimbrone, M. A.,Jr et al. Preservation of vascular integrity in organs perfused in vitro with a platelet-rich medium. Nature 222, 33-36 (1969). 21. Folkman, J., Cole, P. & Zimmerman, S. Tumor behavior in isolated perfused organs: in vitro growth and metastases of biopsy material in rabbit thyroid and canine intestinal segment. Ann. Surg. 164, 491-502 (1966). 22. Bando, H. et al. Association between intratumoral free and total VEGF, soluble VEGFR-1, VEGFR-2 and prognosis in breast cancer. Br. J. Cancer 92, 553-561 (2005). 23. Toi, M. et al. Significance of vascular endothelial growth factor (VEGF)/soluble VEGF receptor-1 relationship in breast cancer. Int. J. Cancer 98, 14-18 (2002). 24. Yamaguchi, T. et al. Overexpression of soluble vascular endothelial growth factor receptor 1 in colorectal cancer: Association with progression and prognosis. Cancer. Sci. 98, 405-410 (2007). 25. Lamszus, K. et al. Levels of soluble vascular endothelial growth factor (VEGF) receptor 1 in astrocytic tumors and its relation to malignancy, vascularity, and VEGF- A. Clin. Cancer Res. 9, 1399-1405 (2003). 26. Aref, S. et al. Soluble VEGF/sFLt1 ratio is an independent predictor of AML patient out come. Hematology 10, 131-134 (2005). 27. Kendall, R. L. & Thomas, K. A. Inhibition of vascular endothelial cell growth factor activity by an endogenously encoded soluble receptor. Proc. Natl. Acad. Sci. U. S. A. 90, 10705-10709 (1993). 28. Lin, E. Y. et al. Progression to malignancy in the polyoma middle T oncoprotein mouse breast cancer model provides a reliable model for human diseases 1. Am. J. Pathol. 163, 2113-2126 (2003).
88 29. Pandian, R. P., Parinandi, N. L., Ilangovan, G., Zweier, J. L. & Kuppusamy, P. Novel particulate spin probe for targeted determination of oxygen in cells and tissues. Free Radic. Biol. Med. 35, 1138-1148 (2003). 30. Shaked, Y. et al. Therapy-induced acute recruitment of circulating endothelial progenitor cells to tumors. American Association for the Advancement of Science.Science 313, 1785 (2006). 31. Jain, R. K. Normalization of tumor vasculature: an emerging concept in antiangiogenic therapy. Science 307, 58-62 (2005). 32. Willett, C. G. et al. Surrogate markers for antiangiogenic therapy and dose-limiting toxicities for bevacizumab with radiation and chemotherapy: continued experience of a phase I trial in rectal cancer patients. J. Clin. Oncol. 23, 8136-8139 (2005). 33. Park, B. K. et al. NF-kappaB in breast cancer cells promotes osteolytic bone metastasis by inducing osteoclastogenesis via GM-CSF. Nat. Med. 13, 62-69 (2007). 34. Willett, C. G. et al. Direct evidence that the VEGF-specific antibody bevacizumab has antivascular effects in human rectal cancer. Nat. Med. 10, 145-147 (2004). 35. Lin, E. Y. & Pollard, J. W. Macrophages: modulators of breast cancer progression. Novartis Found. Symp. 256, 158-168 (2004). 36. Mantovani, A., Bottazzi, B., Colotta, F., Sozzani, S. & Ruco, L. The origin and function of tumor-associated macrophages. Immunol. Today 13, 265-270 (1992). 37. Soiffer, R. et al. Vaccination with irradiated autologous melanoma cells engineered to secrete human granulocyte-macrophage colony-stimulating factor generates potent antitumor immunity in patients with metastatic melanoma. Proc. Natl. Acad. Sci. U. S. A. 95, 13141-13146 (1998). 38. Bratasz, A. et al. In vivo imaging of changes in tumor oxygenation during growth and after treatment. Magn. Reson. Med. 57, 950-959 (2007). 39. Chiesa-Vottero, A. G. et al. Immunohistochemical overexpression of p16 and p53 in uterine serous carcinoma and ovarian high-grade serous carcinoma. Int. J. Gynecol. Pathol. 26, 328-333 (2007).
89 CHAPTER 5: FAS-MEDIATED MACROPHAGE
ABLATION SHOWS THAT PARTICULAR
MONOCYTE SUBSETS PROMOTE TUMOR
METASTASIS
The opposite of a correct statement is a false statement. But
the opposite of a profound truth may well be another profound
truth.
Niels Bohr
SUMMARY
When we learned about the MAFIA mice that Don Cohen from the University of
Kentucky had developed in his lab, we were curious to see how they worked differently
from other models of macrophage elimination. We decided to use them to test
macrophage involvement at the different stages of tumor development. However, when
we performed our initial studies to verify whether this model could eliminate tumor-
associated macrophages, Mother Nature had some surprises for us.
90 BACKGROUND
Many characteristics that define malignant tumors1 arise from their ability to change the way that cells around them respond. They learn to generate signals that cause otherwise normal cells to behave in ways that suit their proliferative and metastatic tendencies. They convince blood vessels to grow, they turn off killer immune cells, and they elicit growth signals from cells that otherwise wouldn’t provide them.
One type of immune cell that often succumbs to tumor manipulation is the macrophage. Since Virchow in 1863, scientists have recognized that these inflammatory cells did something to tumors that made things worse for patients. Modern clinical science has uncovered strong links between these inflammatory cells and patient outcomes2, 3. Basic scientists have shown how breast tumors revert to developmental
programs that invoke reciprocal macrophage-tumor interactions which enable tumor cell
growth and survival as well as spread of these cells to other parts of the body4.
Other scientists have noted that macrophages and other classical cell types actually demonstrate a number of diverse phenotypes. Tacke and colleagues5 have identified different subpopulations of monocytes (which are blood-borne macrophage precursors), each of which behave differently and respond differently to various challenges. These monocyte subsets have been characterized primarily using the Gr-1 antigen, with the
“classical,” inflammatory monocytes identified by high Gr-1 surface expression.
Recently, David Hume’s group6 showed that a particular subset of neutrophils transcribed genes typically associated with macrophages. This subset identified by their high Gr-1 expression. Other groups, working to characterize some of the bad macrophage players in tumor pathogenesis, have identified a subset of tumor associated
91 macrophages which they have termed myeloid-derived suppressor cells (MDSCs)7.
Once again, this subset was delineated by high Gr-1 expression. There exists a
possibility that these three cellular subsets may be intimately related.
In the present studies, we wanted to explore the effects of macrophage ablation in a tumor model and the effects of altering levels of particular cellular subsets on tumor growth and metastasis. To do this, we made use of a previously characterized mouse
model, the MAFIA (macrophage fas-induced apoptosis) mouse8 (Figure 5.1). To create this mouse, Burnett and colleagues generated a construct which expressed an inducible suicide gene9 under the regulation of the M-CSF receptor promoter. Administration of an engineered ligand (AP2018710) induces apoptosis of cells which express the suicide
FIGURE 5.1: MAFIA MICE. A) The suicide gene contains a modified FK-binding protein coupled with the signaling portion of the Fas receptor. The whole construct is anchored to the cell membrane by other modifications. In the MAFIA mice, expression of this gene is limited to macrophages and a subset of neutrophils by placing the gene under the control of the M-CSF receptor promoter (fms). B) In the absence of any dimerizing agent, the suicide gene remains inactive. Upon administration of the pharmaceutical dimerizing agent AP20187, crosslinking of the receptors occurs, activating the Fas receptor domain and initiating the death cascade through the activation of caspase 3.
92 gene—in this case, the macrophage. This model provides us with a unique method for
temporal ablation of mouse macrophages.
RESULTS
Dimerizer administration effectively ablates tumor macrophages.
We wanted to verify that activation of the suicide gene could eliminate
macrophages from the tumors of MMTV-PyMT transgenic mice. To do so, we stained
FFPE sections of tumors extracted from MAFIA-PyMT mice with antibodies directed at
the F4/80 antigen. Figure 5.2 shows the results of these experiments. Both qualitative
and quantitative analysis of these sections demonstrate a near-complete elimination of
F4/80+ cells from the tumors. We note that macrophage numbers from the treated
tumors always measure artificially high, since the macrophages that would normally
destroy the F4/80+ apoptotic bodies have been eliminated. These data confirm the
validity of this model as a method for testing the effects of macrophage ablation on
tumor progression.
Macrophage ablation in MAFIA mice promotes tumor growth and metastasis.
To test the effects of macrophage ablation, we randomized ten-week old PyMT+
mice with or without the MAFIA transgene to treatment with dimerizer (AP20187) or
vehicle (dimerizer diluent, see Materials and Methods). After five weeks of treatment,
we removed their tumors and weighed them to compare total tumor burden between
groups. As a group, MAFIA+ mice that received dimerizer (macrophages ablated) had
larger tumors that mice that did not have the MAFIA transgene or that did not receive
dimerizer (macrophages normal, Figure 5.3A).
93
FIGURE 5.2: ADMINISTRATION OF DIMERIZER ELIMINATES MACROPHAGES FROM THE TUMORS OF MAFIA+, MMTV-PYMT+ MICE. A) Tumors were removed from MAFIA+, PyMT+ mice treated with vehicle or dimerizer. Sections stained with antibodies directed at the F4/80 antigen reveal a relative paucity of macrophages throughout most of the tumors in mice treated with dimerizer. B) Sections of tumors from the same mice were stained by immunofluorescence and whole sections imaged using a fluorescent microscope fitted with a mechanized stage. Fluorescent pixel density was calculated using Adobe Photoshop CS3 software. For this analysis, n=3 mice per group, p=0.007 by Student’s T test.
We removed the lungs from these same mice and mounted them whole, according to
procedures outlined in Materials and Methods. We imaged these lungs under a
stereomicroscope equipped with a lighted stage to count the metastases. Mice whose
macrophages were ablated had significantly more metastases than mice with normal
macrophage levels (Figure 5.3B).
94
FIGURE 5.3: MACROPHAGE ABLATION INCREASES TUMOR SIZE AND ACCELERATES METASTASIS. A) MAFIA+ or – mice were treated with vehicle or dimerizer according to the protocol outlined in methods. At euthanasia, all tumors were resected from the mice and weighed to calculate total tumor burden. MAFIA+ mice treated with dimerizer averaged tumors that were slightly larger than those from macrophage normal animals. For simplicity of analysis, and to avoid using unnecessary numbers of animals, mice are grouped into normal and macrophage ablated groups, though genotypes and conditions are shown on the graphs. p=0.037 by Student’s T test, black lines show mean. B) Lungs extracted from these same animals were processed and analyzed as outlined in methods. MA FIA+ mice treated with dimerizer averaged more metastases than those with normal macrophages (p=0.008 by Mann-Whitney U, chosen for extreme values and non- standard distribution of counts). Black lines show median values.
Macrophage apoptosis does not stimulate tumor growth.
One hypothesis proposed to explain the outcomes we observed is that massive
apoptosis induced by administration of the dimerizer might create pools of apoptotic bodies that might stimulate tumor cells to grow and take on malignant characteristics.
To test this hypothesis, we performed three-dimensional tumor growth assays (TGAs)11
with the aid of Dr. Brett Hall’s lab at Nationwide Children’s Hospital. Figure 5.4A shows
data validating the use of the MET-1 cell line developed in the Hall lab. Figure 5.4B
shows the results of our experimental data. Tumor cells were cultured for the first 48
95
FIGURE 5.4: TUMOR GROWTH ASSAYS. A) This graph shows data validating the use of the newly-developed Met-1DsRed cell line in the three-dimensional tumor growth assay (TGA). As the fluorescently-labeled cells multiply, the fluorescence in tensity obtained by the plate reader increases proportionally. B) 12,500 Met-1DsRed cells per well were cultured alone (No Macs) or together with 125 (100), 1,250 (10), 12,500 (1), or 125,000 (0.1) MAFIA+ bone marrow-derived macrophages. After 48, all wells received dimerizer. These studies show that dimerizer, the apoptotic process, and/or the apoptotic bodies do not have any mitogenic effects on this PyMT tumor cell line. Studies were repeated three times per data point with bone marrow macrophages derived from three different donors. Error bars were omitted from this graph in the interest of clarity. hours alone or together with increasing numbers of bone-marrow –derived macrophages from MAFIA+ mice. After 48 hours, we administered a dose of dimerizer to induce apoptosis in the macrophages. From the graph, one can see that this apoptosis (or the drug itself) actually caused a decrease in the rate of tumor cell growth. One can also see that, before treatment, tumor growth in this system decreased with increasing macrophage number.
This observation may stem from a crowding effect of the macrophages on the tumor cells, although this would be very unlikely, especially at the lower macrophage d enisities.
Taken in context with the other results shown in this study, these results suggest tha t
96 some of the more mature macrophages may actually take on roles that negatively affect
tumor growth.
Macrophage ablation causes reactive monocytosis and stimulates extramedullary hematopoiesis.
We removed blood and spleens from the mice in an effort to further characterize the
effects of macrophage ablation on the hematopoietic system in these mice. Spleens
stained for F4/80 (Figure 5.5A) showed a reduction in the number of macrophages and
disruption of the splenic architecture, as was previously described8. We also noted in these spleen samples several areas of extramedullary hematopoiesis (see arrows), suggesting a stimulus for blood cell production that could not be met by the bone marrow.
CBC analysis on blood samples from these mice (Figure 5.5B) showed that nucleated cells, band neutrophils, segmented neutrophils, lymphocytes, and platelets were not significantly different between MAFIA+ mice treated with dimerizer and those treated with vehicle. However, significantly lower hemoglobin and red cell counts showed that macrophage-depleted mice experienced relative anemia when compared to their vehicle-treated counterparts. Most interestingly, dimerizer-treated mice demonstrated a marked reactive monocytosis, with a nearly 5-fold increase in blood monocyte levels.
97
FIGURE 5.5: MACROPHAGE ABLATION STIMULATES EXTRAMEDULLARY HEMATOPOIESIS AND A REACTIVE MONOCYTOSIS. A) Spleens taken from MAFIA+ mice treated with or without dimerizer were stained with antibodies directed at the F4/80 antigen. Macrophage-depleted mice show loss of splenic architecture and signs of extramedullary hematopoiesis (arrows). This evidence suggests a demand for the production of hematopoietic cells that cannot be met by the bone marrow. B) Graphs showing results of CBC analysis on the blood of tumor-bearing MAFIA+ mice treated for 5 weeks with vehicle or dimerizer. Macrophage-depleted mice display some evidence of anemia with a large reactive increase in blood monocyte levels. Statistical data shown represent Student’s T test performed on 8 and 6 mice per group, respectively.
Monocytic cells infiltrate tumors near blood vessels.
While preliminary analysis of the F4/80-stained tumors showed a paucity of
macrophages in the tumors of mice treated with AP20187, closer inspection told a more
98 FIGURE 5.6: TUMORS FROM MACROPHAGE- DEPLETED MICE SHOW EVIDENCE OF MONOCYTE INFILTRATION. Certain regions of the tumors from macrophage- depleted mice show patches of cells that stain positive for F4/80. Many of these patches, such as the one shown here, show a relatively large number of smaller, monocyte-like cells (black-center arrows). Many of the cells with more mature morphologies show signs of blebbing and apoptosis (white-center arrows).
interesting story. Near areas of high blood vessel density (Figure 5.6), one could find
relatively high numbers of F4/80+ cells migrating through the tumor. Most of these cells
demonstrated a younger, more monocyte-like morphology (black-center arrows), and
many of the cells which displayed more mature morphologic character showed signs of
blebbing and apoptosis (white-center arrows).
Dimerizer treatment causes shift toward the classical, inflammatory, Gr-1hi monocyte subtype.
We have taken note of recent work describing the characteristics of monocyte subpopulations5, 12, and feel it may relate to studies in the realm of tumor biology. This work has shown that the Gr-1hi monocytes exhibit many pro-inflammatory properties. If inflammation can drive cancer13, then any selection for or against this particular monocyte subset might affect tumor progression. Likewise, changes in the Gr-1hi,
F4/80+ population within the tumor could also change the outcome7. We therefore wanted to show how treatment with dimerizer affected these monocyte and tumor
macrophage subpopulations. To do so, we isolated white blood cells from whole blood
99
FIGURE 5.7: MONONUCLEAR CELLS ISOLATED FROM WHOLE BLOOD OR TUMORS SHOW A SHIFT TOWARD THE GR-1HI PHENOTYPES. Monocytes isolated from tumor-bearing mice show a shift from the normal 50-50 relative distribution of Gr-1hi and Gr-1lo populations (as evidenced by the gray graph showing monocytes isolated from mice treated with vehicle) to one enriched for the inflammatory, Gr-1hi cells (averaging a 26 to 74 ratio in depleted mice). This trend continues in the mononuclear cells isolated from tumors, as evidenced in the graph on the right. Within the tumors, population distributions change from one that is 3.7% Gr-1hi in mice treated with vehicle to one that is 29.6% Gr-1hi in mice treated with dimerizer.
and from tumors collected from MAFIA+ mice treated with or without dimerizer. We then
stained these cells with markers that delineated the different subpopulations. The
results (Figure 5.7) show that treatment with dimerizer causes a shift toward the Gr-1hi
phenotype monocyte in the blood, and the Gr-1hi MDSC in the tumor.
100 DISCUSSION
Decades of studies have established that tumor-associated macrophages (TAMs)
promote tumor progression by providing tumor growth factors13, blunting anti-tumor
immune responses7, and facilitating metastasis4. Contrary to what we expected, our
data show that elimination of macrophages by Fas-induced apoptosis actually
accelerated tumor growth and increased metastasis.
We provide some evidence here that the mechanism underlying this observation
may involve a reactive increase in a particular subset of cells. So, while we have
reduced or eliminated the majority of macrophages within the tumor environment, we
may have actually increased the numbers of one particular subset of cells.
While further study will be required to prove such a hypothesis, we suspect that
these mesenchymal-derived stem cells, these Gr-1+ tumor associated macrophages,
and the Gr-1hi inflammatory monocyte subset may be interrelated. If such were truly the
case, this could provide interesting therapeutic opportunities. Our data suggest that it
might be possible to eliminate the tumor-promoting activities of macrophages by
targeting one particular subset. This would likely reduce potential side effects and could
make such treatments more effective, if the anti-tumor behaviors of other macrophage
subsets were preserved.
MATERIALS AND METHODS
Mice. MMTV-PyMT14 and MAFIA8 mice were obtained from Jackson Laboratories
and bred at the animal facility at the Ohio State University College of Medicine. All
experiments were conducted in accordance with protocols approved by the OSU
Institutional Animal Care and Use Committee. Heterozygous PyMT+ male mice (on an 101 FVB background) were bred to heterozygous or homozygous MAFIA+ female mice (on a
B6 background). Only F1 animals from these crosses were used to ensure background consistency and genetic identity. Ear punch pieces were digested in accordance with the “Non-organic Tail DNA Extraction Protocol” published by Jackson Labs. Mice were identified by PCR of these samples using the following primers: PyMT-Fv3, 5’-
AATCCTTGTGTTGCTGAGCCCGATG -3’ and PyMT-Rv3, 5’-
TCGAAATGAGCCCTCTGCAAATCCC -3’, to amplify a 255bp product corresponding to
a portion of the polyomavirus middle T antigen protein, or MAFIA-F, 5’- AAG TTC ATC
TGC ACC ACC G -3’ and MAFIA-R, 5’- TCC TTG AAG AAG ATG GTG CG -3’ to amplify
a 173bp product corresponding to the GFP portion of the transgene.
Dimerizer. AP20187 was kindly provided in lyophilized form by ARIAD
Pharmaceuticals. This was reconstituted with 100% ethanol to give a final concentration of 50 mg/ml. This stock solution was separated into 50 μl aliquots and stored at -20°C.
“Dimerizer diluent” was prepared by creating a solution containing 4% ethanol, 10%
PEG-400, and 1.7% Tween-20 in milliQ water, then sterilizing by filtration. When ready for use, 50 μl aliquots were reconstituted with 950 μl of dimerizer diluent to make a 2.5 mg/ml “1X” solution for induction treatments. This concentration corresponds to a 100 ul dose for the average 25 gram mouse to receive 10 mg/kg. Maintenance doses were prepared by diluting this 1X solution 10-fold with dimerizer diluent.
Macrophage ablation. At 10 weeks ± 2 days of age, we randomized female PyMT+ mice with or without th e MAFIA transgene to either dimerizer (AP20187, Ariad
Pharmaceuticals) or vehicle treatment (dimerizer diluents) groups. This time corresponded with the first appearance of palpable tumors, as determined in preliminary studies. Treatment with dimerizer or vehicle began at this time continued for five weeks. 102 In accordance with the recommendations of the manufacturer, mice were treated with a
five-day induction regimen consisting of daily tail vein injections at 10 mg/kg. After
induction therapy, mice were treated with 1 mg/kg of AP20187 three times per week.
The last dose of dimerizer was given the evening before sacrifice (12-16 hours prior).
Immunohistochemistry. After five weeks of treatment (at 15 weeks ±2 days of
age), mice were euthanized and their organs harvested for analysis. Tumors and
spleens were fixed in 10% NBF, then embedded in paraffin and sectioned. Optimal
conditions for rat anti-mouse F4/80 (clone CI:A3-1, AbD Serotec) were protease
digestion (protease 1, Ventana Medical Systems, Tucson AZ) for 4 minutes, dilutions of
1:100, dilution of the biotinylated anti-rat secondary antibody at 1:200, and use of the
DAB detection system from Enzo Diagnostics (Farmingdale, NY). Total cell influx was
analyzed by digital images captured of the entire tumors and quantified using Adobe
Photoshop CS2 software.
Lung Whole Mounts. The methods we used for quantification of lung metastasis have been described previously15. Briefly, lungs removed immediately after
euthanization were insufflated with PBS to equivalent pressures, then fixed in 10%
formalin. The lungs were whole mounted and stained with hematoxylin. These were
then viewed under a steromicroscope to count the metastases, which appear as
opacities in the cleared lung fields.
Tumor Growth Assays (TGAs). MET-1 Tumor cells16, a highly metastatic cell line derived from MMTV-PyMT mice, were stably transfected with a plasmid coding for
DsRed. The remaining details of the TGAs have beed described in detail previously11.
103 Flow Cytometry. Blood samples were cleared of red blood cells by 5 minute
incubations using RBC lysis buffer (eBioscience). Samples were pelleted then
resuspended in FACS buffer containing FC Block (BD Pharmingen). These samples
were stained with PE-Cy7 anti-mouse F4/80, PerCP-Cy5.5 anti-mouse Gr-1 (both from
BioLegend) and PI (BD Pharmingen). Samples were then washed twice with FACS
buffer and fixed with 1% paraformaldehyde. Samples were run on a BD FACSAria
machine and analysis performed using FCS Express software.
For flow performed on tumor samples, pieces of tumor were minced in RPMI, then
filtered through a cell strainer. Buffy layers containing mostly lymphocytes and
monocytes were separated by centrifugation over a lymphocyte separation medium
gradient (cellgro). These samples were then processed as described for blood.
REFERENCES
1. Hanahan, D. & Weinberg, R. A. The hallmarks of cancer. Cell (Cambridge) 100, 57 (2000). 2. Scholl, S. M. et al. Circulating levels of the macrophage colony stimulating factor CSF- 1 in primary and metastatic breast cancer patients. A pilot study. Breast Cancer Res. Treat. 39, 275-283 (1996). 3. Kacinski, B. M. CSF-1 and its receptor in ovarian, endometrial and breast cancer. Ann. Med. 27, 79-85 (1995). 4. Condeelis, J. & Pollard, J. W. Macrophages: obligate partners for tumor cell migration, invasion, and metastasis. Cell 124, 263-266 (2006). 5. Tacke, F. & Randolph, G. J. Migratory fate and differentiation of blood monocyte subsets. Immunobiology 211, 609-618 (2006). 6. Sasmono, R. T. et al. Mouse neutrophilic granulocytes express mRNA encoding the macrophage colony-stimulating factor receptor (CSF-1R) as well as many other macrophage-specific transcripts and can transdifferentiate into macrophages in vitro in response to CSF-1. J. Leukoc. Biol. 82, 111-123 (2007). 7. Sica, A. & Bronte, V. Altered macrophage differentiation and immune dysfunction i n tumor development. J. Clin. Invest. 117, 1155-1166 (2007). 8. Burnett, S. H. et al. Conditional macrophage ablation in transgenic mice expressing a Fas-based suicide gene. J. Leukoc. Biol. 75, 612-623 (2004). 104 9. Yang, W. et al. Investigating protein-ligand interactions with a mutant FKBP possessing a designed specificity pocket. J. Med. Chem. 43, 1135-1142 (2000). 10. Jin, L. et al. In vivo selection using a cell-growth switch. Nat. Genet. 26, 64-66 (2000). 11. Sasser, A. K. et al. Human bone marrow stromal cells enhance breast cancer cell growth rates in a cell line-dependent manner when evaluated in 3D tumor environments. Cancer Lett. 254, 255-264 (2007). 12. Strauss-Ayali, D., Conrad, S. M. & Mosser, D. M. Monocyte subpopulations and their differentiation patterns during infection. J. Leukoc. Biol. 82, 244-252 (2007). 13. Lin, W. W. & Karin, M. A cytokine-mediated link between innate immunity, inflammation, and cancer. J. Clin. Invest. 117, 1175-1183 (2007). 14. Lin, E. Y. et al. Progression to malignancy in the polyoma middle T oncoprotein mouse breast cancer model provides a reliable model for human diseases 1. Am. J. Pathol. 163, 2113-2126 (2003). 15. Jessen, K. A. et al. Molecular analysis of metastasis in a polyomavirus middle T mouse model: the role of osteopontin. Breast Cancer Res. 6, R157-69 (2004). 16. Borowsky, A. D. et al. Syngeneic mouse mammary carcinoma cell lines: two closely related cell lines with divergent metastatic behavior. Clin. Exp. Metastasis 22, 47-59 (2005).
105 CHAPTER 6: CONCLUSIONS
I am among those who think that science has great beauty. A
scientist in his laboratory is not only a technician: he is also a
child placed before natural phenomena which impress him like
a fairy tale.
Marie Curie
The studies described in this document strengthen the hypothesis that macrophage- tumor interactions are critical regulators of the growth and dissemination of malignant breast tumors.
Perhaps the most striking aspect of this research is the magnitude of the effect that monocyte/macrophages can exert on a tumor environment, and the disparity between the effects these cells can exert. The outcomes we observed when copious numbers of macrophages were re-educated by treatment with GM-CSF contrast nicely with the outcomes we observed when we selected for a very small population of a particular type of monocyte/macrophage. On the one hand, the end effect of amplifying and re- educating the tumor-associated macrophages was to decrease the rate of tumor growth by as much as 90% (see Figure 4.6). On the other hand, small increases in the Gr-1hi population (with consequent elimination of other tumor-associated macrophages) 106 increased the metastatic rate nearly six fold (see Figure 5.3). Comparing and
contrasting these studies serves to underscore the profound effects of the cells within
the tumor environment on the growth and spread of mammary tumors.
While tumors may alter the behavior of macrophages by manipulating the cytokine
environment, the permissive effects of “tumor education” are not permanent and can be
overcome by treatment. Both in vitro and in vivo, we showed that macrophage behavior
can be altered by changing environmental cues. The magnitude of these changes can
be large enough not just to affect macrophage behavior, but can negate the effects of
tumor-derived signals intended to tip the angiogenic switch to favor vascular expansion
and tumor growth and spread.
Whether or not such discoveries will prove useful in treating patients who develop
breast cancer remains to be seen. Nonetheless, the conceptual advance made by
showing a definitive therapeutic alteration of macrophage phenotypes within the tumor microenvironment should not be understated. The fact that the phenotype switch causes a dramatic effect on tumor growth provides substantial evidence for the viability of
targeting mononuclear phagocytes in the tumor microenvironment as a treatment modality.
These studies also show the profound contribution that myeloid cells make to angiogenesis within a tumor environment to affect tumor size and metastases.
Moreover, these observations argue further for targeting the bone-marrow derived precursor cells that facilitate tumor development. In the end, the studies shown here may prove most useful in that they create models that can help us in the study of macrophage behavior in the tumor environment.
107 Collectively, these studies show that the mere presence of macrophages within breast tumors does not define poor prognosis for outcome. For instance, in the studies involving PyMT breast tumors in MAFIA mice, we dramatically reduced the levels of tumor-associated macrophages, yet the outcome was worse. Similarly, direct tumor treatment with GM-CSF augmented macrophage density within the tumor, yet this resulted in better outcomes. This data provides strong evidence that the tumor- promoting behaviors of tumor-associated macrophages likely arise from a particular subgroup of cells that can be manipulated to regulate the tumor microenvironment and augment patient outcome. These findings expand our understanding of the natural and potential functions of these cells within the tumor environment, and hint at ways that one might target these cellular subgroups to provide therapeutic advantage.
And so I close this, the culmination of 6 years of work and the end of this chapter in the book of my life with a quote of my own—you know, something I feel I’ve learned and could pass on to others. It is this:
It’s easy to think you’re brilliant, but Another knows more than
we. We make hypotheses, thinking we know the outcome.
When we test it, one of two things happens: either we get the
result we expect, and feel smart; or we get something
completely different, and find something new—something that
is at once puzzling, surprising, and exciting. This is discovery.
Here we learn the mind of God.
108 UNIFIED BIBLIOGRAPHY
1. Abdel-Ghany, M. et al. The interacting binding domains of the beta(4) integrin and calcium-activated chloride channels (CLCAs) in metastasis. J. Biol. Chem. 278, 49406-49416 (2003). 2. Achilles, E. G. et al. Heterogeneity of angiogenic activity in a human liposarcoma: a proposed mechanism for"no take"of human tumors in mice. J. Natl. Cancer Inst. 93, 1075 (2001). 3. Aref, S. et al. Soluble VEGF/sFLt1 ratio is an independent predictor of AML patient out come. Hematology 10, 131-134 (2005). 4. Armstrong, C. A. et al. Antitumor effects of granulocyte-macrophage colony- stimulating factor production by melanoma cells. Cancer Res. 56, 2191-2198 (1996). 5. Baldwin, G. C. et al. Nonhematopoietic tumor cells express functional GM-CSF receptors. Blood 73, 1033-1037 (1989). 6. Balkwill, F. R. & Rolph, M. in Germ zappers 31 (Cold Spring Harbor Laboratory Press, Woodbury, N.Y., 2002). 7. Bando, H. et al. Association between intratumoral free and total VEGF, soluble VEGFR-1, VEGFR-2 and prognosis in breast cancer. Br. J. Cancer 92, 553-561 (2005). 8. Barleon, B. et al. Migration of human monocytes in response to vascular endothelial growth factor (VEGF) is mediated via the VEGF receptor flt-1. Blood 87, 3336-3343 (1996). 9. Baron, J. A. & Sandler, R. S. Nonsteroidal anti-inflammatory drugs and cancer prevention. Annu. Rev. Med. 51, 511-523 (2000). 10. Baselga, J. et al. Phase II and tumor pharmacodynamic study of gefitinib in patients with advanced breast cancer. J. Clin. Oncol. 23, 5323-5333 (2005). 11. Bergers, G. & Benjamin, L. E. Tumorigenesis and the angiogenic switch. Nat. Rev. Cancer. 3, 401-410 (2003). 12. Berx, G. & Van Roy, F. The E-cadherin/catenin complex: an important gatekeeper in breast cancer tumorigenesis and malignant progression. Breast Cancer Res. 3, 289- 293 (2001). 13. Bleharski, J. R. et al. A role for triggering receptor expressed on myeloid cells-1 in host defense during the early-induced and adaptive phases of the immune response. J. Immunol. 170, 3812-3818 (2003).
109 14. Bonadonna, G., Zambetti, M., Moliterni, A., Gianni, L. & Valagussa, P. Clinical relevance of different sequencing of doxorubicin and cyclophosphamide, methotrexate, and Fluorouracil in operable breast cancer. J. Clin. Oncol. 22, 1614- 1620 (2004). 15. Borowsky, A. D. et al. Syngeneic mouse mammary carcinoma cell lines: two closely related cell lines with divergent metastatic behavior. Clin. Exp. Metastasis 22, 47-59 (2005). 16. Bratasz, A. et al. In vivo imaging of changes in tumor oxygenation during growth and after treatment. Magn. Reson. Med. 57, 950-959 (2007). 17. Buerger, H. et al. Ductal invasive G2 and G3 carcinomas of the breast are the end stages of at least two different lines of genetic evolution. J. Pathol. 194, 165-170 (2001). 18. Burnett, S. H. et al. Conditional macrophage ablation in transgenic mice expressing a Fas-based suicide gene. J. Leukoc. Biol. 75, 612-623 (2004). 19. Cao, Y., Linden, P., Shima, D., Browne, F. & Folkman, J. In vivo angiogenic activity and hypoxia induction of heterodimers of placenta growth factor/vascular endothelial growth factor. J. Clin. Invest. 98, 2507-2511 (1996). 20. Cao, Y. et al. Expression of angiostatin cDNA in a murine fibrosarcoma suppresses primary tumor growth and produces long-term dormancy of metastases. J. Clin. Invest. 101, 1055-1063 (1998). 21. Cardiff, R. D. Mouse models of human breast cancer. Comp. Med. 53, 250-253 (2003). 22. Cardiff, R. D., Moghanaki, D. & Jensen, R. A. Genetically engineered mouse models of mammary intraepithelial neoplasia. J. Mammary Gland Biol. Neoplasia 5, 421-437 (2000). 23. Cecil, R. L. et al. in Cecil textbook of medicine 2506 (Saunders, Philadelphia, Pa., 2004). 24. Chiesa-V ottero, A. G. et al. Immunohistochemical overexpression of p16 and p53 in uterine serous carcinoma and ovarian high-grade serous carcinoma. Int. J. Gynecol. Pathol. 26, 328-333 (2007). 25. Cho, H. J. et al. Mobilized endothelial progenitor cells by granulocyte-macrophage colony-stimulating factor accelerate reendothelialization and reduce vascular inflammation after intravascular radiation. Circulation 108, 2918-2925 (2003). 26. Chu, K. C. & Anderson, W. F. Rates for breast cancer characteristics by estrogen and progesterone receptor status in the major racial/ethnic groups. Breast Cancer Res. Treat. 74, 199 (2002). 27. Clarijs, M., Poot, F., Laka, A., Pirard, C. & Bourlond, A. Granulomatous slack skin: treatment with extensive surgery and review of the literature. Dermatology 206, 393- 397 (2003).
110 28. Clarijs, R., Schalkwijk, L., Ruiter, D. J. & de Waal, R. M. EMAP-II expression is associated with macrophage accumulation in primary uveal melanoma. Invest. Ophthalmol. Vis. Sci. 44, 1801-1806 (2003). 29. Clauss, M. Molecular biology of the VEGF and the VEGF receptor family. Semin. Thromb. Hemost. 26, 561-569 (2000). 30. Clemons, M. & Goss, P. Estrogen and the risk of breast cancer. N. Engl. J. Med. 344, 276 (2001). 31. Colotta, F. et al. Differential expression of the common beta and specific alpha chains of the receptors for GM-CSF, IL-3, and IL-5 in endothelial cells. Exp. Cell Res. 206, 311-317 (1993). 32. Condeelis, J. & Pollard, J. W. Macrophages: obligate partners for tumor cell migration, invasion, and metastasis. Cell 124, 263-266 (2006). 33. Coussens, L. M. & Werb, Z. Inflammation and cancer. Nature 420, 860-867 (2002). 34. Dabrosin, C., Margetts, P. J. & Gauldie, J. Estradiol increases extracellular levels of vascular endothelial growth factor in vivo in murine mammary cancer. International journal of cancer.Journal international du cancer 107, 535 (2003). 35. Dechsupa, S. et al. Quercetin, Siamois 1 and Siamois 2 Induce Apoptosis in Human Breast Cancer MDA-MB-435 Cells Xenograft In Vivo. Cancer Biol Ther 6 (2007). 36. Demirkesen, C. et al. The correlation of angiogenesis with metastasis in primary cutaneous melanoma: a comparative analysis of microvessel density, expression of vascular endothelial growth factor and basic fibroblastic growth factor. Pathology 38, 132 (2006). 37. Duyndam, M. C. et al. Vascular endothelial growth factor-165 overexpression stimulates angiogenesis and induces cyst formation and macrophage infiltration in human ovarian cancer xenografts. Am. J. Pathol. 160, 537-548 (2002). 38. Dvorak, H. F. VPF/VEGF and the angiogenic response. Semin. Perinatol. 24, 75-78 (2000). 39. Dvorak, H. F., Brown, L. F., Detmar, M. & Dvorak, A. M. Vascular permeability factor/vascular endothelial growth factor, microvascular hyperpermeability, and angiogenesis. Am. J. Pathol. 146, 1029-1039 (1995). 40. Ekbom, A., Helmick, C., Zack, M. & Adami, H. O. Increased risk of large-bowel cancer in Crohn's disease with colonic involvement. Lancet 336, 357-359 (1990). 41. Ekbom, A., Helmick, C., Zack, M. & Adami, H. O. Ulcerative colitis and colorectal cancer. A population-based study. N. Engl. J. Med. 323, 1228-1233 (1990). 42. El-Serag, H. B. & Mason, A. C. Rising incidence of hepatocellular carcinoma in the United States. N. Engl. J. Med. 340, 745-750 (1999). 43. Emmenegger, U. et al. A comparative analysis of low-dose metronomic cyclophosphamide reveals absent or low-grade toxicity on tissues highly sensitive to the toxic effects of maximum tolerated dose regimens. Cancer Res. 64, 3994-4000 (2004).
111 44. Eubank, T. D., Galloway, M., Montague, C. M., Waldman, W. J. & Marsh, C. B. M- CSF induces vascular endothelial growth factor production and angiogenic activity from human monocytes. J. Immunol. 171, 2637-2643 (2003). 45. Eubank, T. D. et al. GM-CSF induces expression of soluble VEGF receptor-1 from human monocytes and inhibits angiogenesis in mice. Immunity 21, 831-842 (2004). 46. Evers, B. & Jonkers, J. Mouse models of BRCA1 and BRCA2 deficiency: past lessons, current understanding and future prospects. Oncogene 25, 5885-5897 (2006). 47. Ferrara, N. Role of vascular endothelial growth factor in physiologic and pathologic angiogenesis: therapeutic implications. Semin. Oncol. 29, 10-14 (2002). 48. Ferrara, N. et al. Heterozygous embryonic lethality induced by targeted inactivation of the VEGF gene. Nature 380, 439-442 (1996). 49. Ferrara, N. & Davis-Smyth, T. The biology of vascular endothelial growth factor. Endocr. Rev. 18, 4-25 (1997). 50. Ferrara, N. & Keyt, B. Vascular endothelial growth factor: basic biology and clinical implications. EXS 79, 209-232 (1997). 51. Folkman, J. What is the evidence that tumors are angiogenesis dependent? J. Natl. Cancer Inst. 82, 4 (1990). 52. Folkman, J., Cole, P. & Zimmerman, S. Tumor behavior in isolated perfused organs: in vitro growth and metastases of biopsy material in rabbit thyroid and canine intestinal segment. Ann. Surg. 164, 491-502 (1966). 53. Garcia-Rodriguez, L. A. & Huerta-Alvarez, C. Reduced risk of colorectal cancer among long-term users of aspirin and nonaspirin nonsteroidal antiinflammatory drugs. Epidemiology 12, 88-93 (2001). 54. Garvin, S., Nilsson, U. W. & Dabrosin, C. Effects of oestradiol and tamoxifen on VEGF, soluble VEGFR-1, and VEGFR-2 in breast cancer and endothelial cells. Br. J. Cancer 93, 1005-1010 (2005). 55. Gilbert, S. F. in Developmental biology (Sinauer Associates, Sunderland, Mass, 2003). 56. Gimbrone, M. A.,Jr et al. Preservation of vascular integrity in organs perfused in vitro with a platelet-rich medium. Nature 222, 33-36 (1969). 57. Goldman, C. K. et al. Paracrine expression of a native soluble vascular endothelial growth factor receptor inhibits tumor growth, metastasis, and mortality rate. Proc. Natl. Acad. Sci. U. S. A. 95, 8795-8800 (1998). 58. Greten, F. R. et al. IKKbeta links inflammation and tumorigenesis in a mouse model of colitis-associated cancer. Cell 118, 285-296 (2004). 59. Gunther, E. J. et al. A novel doxycycline-inducible system for the transgenic analysis of mammary gland biology. FASEB J. 16, 283-292 (2002).
112 60. Hagemann, T. et al. Enhanced invasiveness of breast cancer cell lines upon co- cultivation with macrophages is due to TNF-alpha dependent up-regulation of matrix metalloproteases. Carcinogenesis 25, 1543-1549 (2004). 61. Hanahan, D. & Weinberg, R. A. The hallmarks of cancer. Cell (Cambridge) 100, 57 (2000). 62. He, Y. et al. Alternative splicing of vascular endothelial growth factor (VEGF)-R1 (FLT-1) pre-mRNA is important for the regulation of VEGF activity. Mol. Endocrinol. 13, 537-545 (1999). 63. Heller, D. S. et al. Presence and quantification of macrophages in squamous cell carcinoma of the cervix. Int. J. Gynecol. Cancer 13, 67-70 (2003). 64. Henderson, B. E. et al. An epidemiologic study of breast cancer. J. Natl. Cancer Inst. 53, 609 (1974). 65. Heuser, C. et al. Anti-CD30-scFv-Fc-IL-2 antibody-cytokine fusion protein that induces resting NK cells to highly efficient cytolysis of Hodgkin's lymphoma derived tumour cells. Int. J. Cancer 110, 386-394 (2004). 66. Heuser, L. S., Taylor, S. H. & Folkman, J. Prevention of carcinomatosis and bloody malignant ascites in the rat by an inhibitor of angiogenesis. J. Surg. Res. 36, 244-250 (1984). 67. Holash, J. et al. VEGF-Trap: a VEGF blocker with potent antitumor effects. Proc. Natl. Acad. Sci. U. S. A. 99, 11393-11398 (2002). 68. Howard, B. A. & Gusterson, B. A. Human breast development. J. Mammary Gland Biol. Neoplasia 5, 119-137 (2000). 69. Hutchinson, J. N. & Muller, W. J. Transgenic mouse models of human breast cancer. Oncogene 19, 6130-6137 (2000). 70. Jain, R. K. Normalization of tumor vasculature: an emerging concept in antiangiogenic therapy. Science 307, 58-62 (2005). 71. Jemal, A. et al. Cancer statistics, 2007. CA Cancer. J. Clin. 57, 43-66 (2007). 72. Jessen, K. A. et al. Molecular analysis of metastasis in a polyomavirus middle T mouse model: the role of osteopontin. Breast Cancer Res. 6, R157-69 (2004). 73. Jin, L. et al. In vivo selection using a cell-growth switch. Nat. Genet. 26, 64-66 (2000). 74. Kacinski, B. M. CSF-1 and its receptor in ovarian, endometrial and breast cancer. Ann. Med. 27, 79-85 (1995). 75. Kalluri, R. & Zeisberg, M. Fibroblasts in cancer. Nat. Rev. Cancer. 6, 392-401 (2006). 76. Kasper, G. et al. Stromelysin-3 over-expression enhances tumourigenesis in MCF-7 and MDA-MB-231 breast cancer cell lines: involvement of the IGF-1 signalling pathway. BMC Cancer 7, 12 (2007).
113 77. Kendall, R. L. & Thomas, K. A. Inhibition of vascular endothelial cell growth factor activity by an endogenously encoded soluble receptor. Proc. Natl. Acad. Sci. U. S. A. 90, 10705-10709 (1993). 78. Kendall, R. L., Wang, G. & Thomas, K. A. Identification of a natural soluble form of the vascular endothelial growth factor receptor, FLT-1, and its heterodimerization with KDR. Biochem. Biophys. Res. Commun. 226, 324-328 (1996). 79. Kerbel, R. S. et al. Possible mechanisms of acquired resistance to anti-angiogenic drugs: implications for the use of combination therapy approaches. Cancer Metastasis Rev. 20, 79-86 (2001). 80. Key, M. E. Macrophages in cancer metastases and their relevance to metastatic growth. Cancer Metastasis Rev. 2, 75-88 (1983). 81. Kirma, N. et al. Overexpression of the colony-stimulating factor (CSF-1) and/or its receptor c-fms in mammary glands of transgenic mice results in hyperplasia and tumor formation. Cancer Res. 64, 4162-4170 (2004). 82. Kirman, I. et al. Perioperative sargramostim (recombinant human GM-CSF) induces an increase in the level of soluble VEGFR1 in colon cancer patients undergoing minimally invasive surgery. Eur. J. Surg. Oncol. (2007). 83. Kliche, S. & Waltenberger, J. VEGF receptor signaling and endothelial function. IUBMB Life 52, 61-66 (2001). 84. Kumar, V., Abbas, A. K., Fausto, N., Robbins, S. L. & Cotran, R. S. in Robbins and Cotran pathologic basis of disease 1525 (Elsevier Saunders, Philadelphia, Pa., 2005). 85. Kuper, H., Adami, H. O. & Trichopoulos, D. Infections as a major preventable cause of human cancer. J. Intern. Med. 248, 171-183 (2000). 86. Kurata, H., Arai, T., Yokota, T. & Arai, K. Differential expression of granulocyte- macrophage colony-stimulating factor and IL-3 receptor subunits on human CD34+ cells and leukemic cell lines. J. Allergy Clin. Immunol. 96, 1083-1099 (1995). 87. Lagergren, J., Bergstrom, R., Lindgren, A. & Nyren, O. Symptomatic gastroesophageal reflux as a risk factor for esophageal adenocarcinoma. N. Engl. J. Med. 340, 825-831 (1999). 88. Lamszus, K. et al. Levels of soluble vascular endothelial growth factor (VEGF) receptor 1 in astrocytic tumors and its relation to malignancy, vascularity, and VEGF- A. Clin. Cancer Res. 9, 1399-1405 (2003). 89. Leung, D. W., Cachianes, G., Kuang, W. J., Goeddel, D. V. & Ferrara, N. Vascular endothelial growth factor is a secreted angiogenic mitogen. Science 246, 1306-1309 (1989). 90. Li, B. et al. Vascular endothelial growth factor blockade reduces intratumoral regulatory T cells and enhances the efficacy of a GM-CSF-secreting cancer immunotherapy. Clin. Cancer Res. 12, 6808-6816 (2006).
114 91. Lin, E. Y. et al. Progression to malignancy in the polyoma middle T oncoprotein mouse breast cancer model provides a reliable model for human diseases 1. Am. J. Pathol. 163, 2113-2126 (2003). 92. Lin, E. Y. et al. Macrophages regulate the angiogenic switch in a mouse model of breast cancer. Cancer Res. 66, 11238-11246 (2006). 93. Lin, E. Y., Nguyen, A. V., Russell, R. G. & Pollard, J. W. Colony-stimulating factor 1 promotes progression of mammary tumors to malignancy. J. Exp. Med. 193, 727-740 (2001). 94. Lin, E. Y. & Pollard, J. W. Macrophages: modulators of breast cancer progression. Novartis Found. Symp. 256, 158-168 (2004). 95. Lin, W. W. & Karin, M. A cytokine-mediated link between innate immunity, inflammation, and cancer. J. Clin. Invest. 117, 1175-1183 (2007). 96. Lissbrant, I. F. et al. Tumor associated macrophages in human prostate cancer: relation to clinicopathological variables and survival. Int. J. Oncol. 17, 445-451 (2000). 97. Lotem, J. & Sachs, L. Cytokine control of developmental programs in normal hematopoiesis and leukemia. Oncogene 21, 3284-3294 (2002). 98. Lu, H., Knutson, K. L., Gad, E. & Disis, M. L. The tumor antigen repertoire identified in tumor-bearing Neu transgenic mice predicts human tumor antigens. Cancer Res. 66, 9754-9761 (2006). 99. Maeda, H. & Akaike, T. Nitric oxide and oxygen radicals in infection, inflammation, and cancer. Biochemistry (Mosc) 63, 854-865 (1998). 100. Maher, M. G. et al. Prognostic significance of colony-stimulating factor receptor expression in ipsilateral breast cancer recurrence. Clin. Cancer Res. 4, 1851-1856 (1998). 101. Mantovani, A. In vitro effects on tumor cells of macrophages isolated from an early- passage chemically-induced murine sarcoma and from its spontaneous metastases. Int. J. Cancer 27, 221-228 (1981). 102. Mantovani, A., Bottazzi, B., Colotta, F., Sozzani, S. & Ruco, L. The origin and function of tumor-associated macrophages. Immunol. Today 13, 265-270 (1992). 103. Martinez-Moczygemba, M. & Huston, D. P. Biology of common beta receptor- signaling cytokines: IL-3, IL-5, and GM-CSF. J. Allergy Clin. Immunol. 112, 653-65; quiz 666 (2003). 104. Martiny-Baron, G. & Marme, D. VEGF-mediated tumour angiogenesis: a new target for cancer therapy. Curr. Opin. Biotechnol. 6, 675-680 (1995). 105. Matsumoto, T. & Claesson-Welsh, L. VEGF receptor signal transduction. Sci. STKE 2001, RE21 (2001). 106. Milas, L., Wike, J., Hunter, N., Volpe, J. & Basic, I. Macrophage content of murine sarcomas and carcinomas: associations with tumor growth parameters and tumor radiocurability. Cancer Res. 47, 1069-1075 (1987).
115 107. Morikawa, S. et al. Abnormalities in pericytes on blood vessels and endothelial sprouts in tumors 1. Am. J. Pathol. 160, 985-1000 (2002). 108. Nagata, Y., Nishida, E. & Todokoro, K. Activation of JNK signaling pathway by erythropoietin, thrombopoietin, and interleukin-3. Blood 89, 2664-2669 (1997). 109. Nakayama, Y. et al. Relationships between tumor-associated macrophages and clinicopathological factors in patients with colorectal cancer. Anticancer Res. 22, 4291-4296 (2002). 110. National Comprehensive Cancer Network. Breast Cancer: Treatment Guidelines for Patients. Version VII. (2006). 111. Nelson, B. H., Lord, J. D. & Greenberg, P. D. A membrane-proximal region of the interleukin-2 receptor gamma c chain sufficient for Jak kinase activation and induction of proliferation in T cells. Mol. Cell. Biol. 16, 309-317 (1996). 112. Neufeld, G., Cohen, T., Gengrinovitch, S. & Poltorak, Z. Vascular endothelial growth factor (VEGF) and its receptors. FASEB J. 13, 9-22 (1999). 113. Nguyen, D. X. & Massague, J. Genetic determinants of cancer metastasis. Nat. Rev. Genet. 8, 341-352 (2007). 114. Nomura, A. et al. Helicobacter pylori infection and gastric carcinoma among Japanese Americans in Hawaii. N. Engl. J. Med. 325, 1132-1136 (1991). 115. Oka, H. et al. Expression of E-Cadherin Cell-Adhesion Molecules in Human Breast- Cancer Tissues and Its Relationship to Metastasis. Cancer Res. 53, 1696-1701 (1993). 116. Pandian, R. P., Dang, V., Manoharan, P. T., Zweier, J. L. & Kuppusamy, P. Effect of nitrogen dioxide on the EPR property of lithium octa-n-butoxy 2,3- naphthalocyanine (LiNc-BuO) microcrystals. J. Magn. Reson. 181, 154-161 (2006). 117. Pandian, R. P., Parinandi, N. L., Ilangovan, G., Zweier, J. L. & Kuppusamy, P. Novel particulate spin probe for targeted determination of oxygen in cells and tissues. Free Radic. Biol. Med. 35, 1138-1148 (2003). 118. Park, B. K. et al. NF-kappaB in breast cancer cells promotes osteolytic bone metastasis by inducing osteoclastogenesis via GM-CSF. Nat. Med. 13, 62-69 (2007). 119. Park, C. C., Bissell, M. J. & Barcellos-Hoff, M. H. The influence of the microenvironment on the malignant phenotype. Mol. Med. Today 6, 324-329 (2000). 120. Parkin, D. M., Bray, F., Ferlay, J. & Pisani, P. Global cancer statistics, 2002. CA Cancer. J. Clin. 55, 74-108 (2005). 121. Parsonnet, J. et al. Helicobacter pylori infection and the risk of gastric carcinoma. N. Engl. J. Med. 325, 1127-1131 (1991). 122. Piccart-Gebhart, M. J. et al. Trastuzumab after adjuvant chemotherapy in HER2- positive breast cancer. N. Engl. J. Med. 353, 1659-1672 (2005). 123. Pollard, J. W. Tumour-educated macrophages promote tumour progression and metastasis. Nature reviews.Cancer 4, 71 (2004).
116 124. Pollard, J. W. Role of colony-stimulating factor-1 in reproduction and development. Mol. Reprod. Dev. 46, 54 (1997). 125. Qiu, T. H. et al. Global expression profiling identifies signatures of tumor virulence in MMTV-PyMT-transgenic mice: correlation to human disease. Cancer Res. 64, 5973-5981 (2004). 126. Rao, C. V. Nitric oxide signaling in colon cancer chemoprevention. Mutat. Res. 555, 107-119 (2004). 127. Ravdin, P. M. et al. The decrease in breast-cancer incidence in 2003 in the United States. N. Engl. J. Med. 356, 1670 (2007). 128. Ries, L. A. G. et al. SEER Cancer Statistics Review, 1975-2004. (2007). 129. Risau, W. Mechanisms of angiogenesis. Nature 386, 671-674 (1997). 130. Roeckl, W. et al. Differential binding characteristics and cellular inhibition by soluble VEGF receptors 1 and 2. Exp. Cell Res. 241, 161-170 (1998). 131. Rohan, T. E. & Miller, A. B. Hormone replacement therapy and risk of benign proliferative epithelial disorders of the breast. Eur. J. Cancer Prev. 8, 123-130 (1999). 132. Roy, S. et al. Transcriptome analysis of the ischemia-reperfused remodeling myocardium: temporal changes in inflammation and extracellular matrix. Physiol Genomics 25, 364-374 (2006). 133. Roylance, R. et al. Comparative genomic hybridization of breast tumors stratified by histological grade reveals new insights into the biological progression of breast cancer. Cancer Res. 59, 1433-1436 (1999). 134. Russo, J. & Russo, I. H. Influence of differentiation and cell kinetics on the susceptibility of the rat mammary gland to carcinogenesis. Cancer Res. 40, 2677 (1980). 135. Saishin, Y. et al. VEGF-TRAP(R1R2) suppresses choroidal neovascularization and VEGF-induced breakdown of the blood-retinal barrier. J. Cell. Physiol. 195, 241-248 (2003). 136. Santen, R. J. & Mansel, R. Benign breast disorders. N. Engl. J. Med. 353, 275-285 (2005). 137. Sapi, E. The role of CSF-1 in normal physiology of mammary gland and breast cancer: an update. Exp Biol Med (Maywood. ) 229, 1-11 (2004). 138. Sasmono, R. T. et al. Mouse neutrophilic granulocytes express mRNA encoding the macrophage colony-stimulating factor receptor (CSF-1R) as well as many other macrophage-specific transcripts and can transdifferentiate into macrophages in vitro in response to CSF-1. J. Leukoc. Biol. 82, 111-123 (2007). 139. Sasser, A. K. et al. Human bone marrow stromal cells enhance breast cancer cell growth rates in a cell line-dependent manner when evaluated in 3D tumor environments. Cancer Lett. 254, 255-264 (2007).
117 140. Scalerandi, M. & Sansone, B. C. Inhibition of vascularization in tumor growth. Phys. Rev. Lett. 89, 218101 (2002). 141. Schairer, C., Mink, P. J., Carroll, L. & Devesa, S. S. Probabilities of death from breast cancer and other causes among female breast cancer patients. J. Natl. Cancer Inst. 96, 1311 (2004). 142. Schedin, P. & Elias, A. Multistep tumorigenesis and the microenvironment. Breast Cancer Res. 6, 93-101 (2004). 143. Schoenenberger, C. A. et al. Targeted c-myc gene expression in mammary glands of transgenic mice induces mammary tumours with constitutive milk protein gene transcription. EMBO J. 7, 169-175 (1988). 144. Scholl, S. M. et al. Circulating levels of the macrophage colony stimulating factor CSF-1 in primary and metastatic breast cancer patients. A pilot study. Breast Cancer Res. Treat. 39, 275-283 (1996). 145. Shaked, Y. et al. Therapy-induced acute recruitment of circulating endothelial progenitor cells to tumors. American Association for the Advancement of Science.Science 313, 1785 (2006). 146. Shweiki, D., Neeman, M., Itin, A. & Keshet, E. Induction of vascular endothelial growth factor expression by hypoxia and by glucose deficiency in multicell spheroids: implications for tumor angiogenesis. Proc. Natl. Acad. Sci. U. S. A. 92, 768-772 (1995). 147. Sica, A. & Bronte, V. Altered macrophage differentiation and immune dysfunction in tumor development. J. Clin. Invest. 117, 1155-1166 (2007). 148. Siegel, P. M., Ryan, E. D., Cardiff, R. D. & Muller, W. J. Elevated expression of activated forms of Neu/ErbB-2 and ErbB-3 are involved in the induction of mammary tumors in transgenic mice: implications for human breast cancer. EMBO J. 18, 2149- 2164 (1999). 149. Simpson, P. T., Reis-Filho, J. S., Gale, T. & Lakhani, S. R. Molecular evolution of breast cancer. J. Pathol. 205, 248-254 (2005). 150. Slamon, D. J. et al. Use of chemotherapy plus a monoclonal antibody against HER2 for metastatic breast cancer that overexpresses HER2. N. Engl. J. Med. 344, 783-792 (2001). 151. Soiffer, R. et al. Vaccination with irradiated autologous melanoma cells engineered to secrete human granulocyte-macrophage colony-stimulating factor generates potent antitumor immunity in patients with metastatic melanoma. Proc. Natl. Acad. Sci. U. S. A. 95, 13141-13146 (1998). 152. Sondergaard, H. et al. Interleukin 21 therapy increases the density of tumor infiltrating CD8(+ )T cells and inhibits the growth of syngeneic tumors. Cancer Immunol. Immunother. (2007). 153. Sorlie, T. et al. Gene expression patterns of breast carcinomas distinguish tumor subclasses with clinical implications. Proc. Natl. Acad. Sci. U. S. A. 98, 10869-10874 (2001).
118 154. Sorlie, T. et al. Repeated observation of breast tumor subtypes in independent gene expression data sets. Proc. Natl. Acad. Sci. U. S. A. 100, 8418-8423 (2003). 155. Stanton, M. F. & Wrench, C. Mechanisms of mesothelioma induction with asbestos and fibrous glass. J. Natl. Cancer Inst. 48, 797-821 (1972). 156. Steeg, P. S. Tumor metastasis: mechanistic insights and clinical challenges. Nat. Med. 12, 895-904 (2006). 157. Steele, R. J., Brown, M. & Eremin, O. Characterisation of macrophages infiltrating human mammary carcinomas. Br. J. Cancer 51, 135-138 (1985). 158. Steger, G. G., Kaboo, R., deKernion, J. B., Figlin, R. & Belldegrun, A. The effects of granulocyte-macrophage colony-stimulating factor on tumour-infiltrating lymphocytes from renal cell carcinoma. Br. J. Cancer 72, 101-107 (1995). 159. Strauss-Ayali, D., Conrad, S. M. & Mosser, D. M. Monocyte subpopulations and their differentiation patterns during infection. J. Leukoc. Biol. 82, 244-252 (2007). 160. Tacke, F. & Randolph, G. J. Migratory fate and differentiation of blood monocyte subsets. Immunobiology 211, 609-618 (2006). 161. Tang, R. et al. M-CSF (monocyte colony stimulating factor) and M-CSF receptor expression by breast tumour cells: M-CSF mediated recruitment of tumour infiltrating monocytes? J. Cell. Biochem. 50, 350-356 (1992). 162. Terada, K., Kaziro, Y. & Satoh, T. Ras-dependent activation of c-Jun N-terminal kinase/stress-activated protein kinase in response to interleukin-3 stimulation in hematopoietic BaF3 cells. J. Biol. Chem. 272, 4544-4548 (1997). 163. The Breast International Group (. A Comparison of Letrozole and Tamoxifen in Postmenopausal Women with Early Breast Cancer. N. Engl. J. Med. 353, 2747-2757 (2005). 164. Toi, M. et al. Significance of vascular endothelial growth factor (VEGF)/soluble VEGF receptor-1 relationship in breast cancer. Int. J. Cancer 98, 14-18 (2002). 165. Topper, Y. J. & Freeman, C. S. Multiple hormone interactions in the developmental biology of the mammary gland. Physiol. Rev. 60, 1049-1106 (1980). 166. Tsuruma, T. et al. Interleukin-10 reduces natural killer (NK) sensitivity of tumor cells by downregulating NK target structure expression. Cell. Immunol. 198, 103 (1999). 167. Uchida, K. et al. Glomerular endothelial cells in culture express and secrete vascular endothelial growth factor. Am. J. Physiol. 266, F81-8 (1994). 168. Valkovic, T. et al. Correlation between vascular endothelial growth factor, angiogenesis, and tumor-associated macrophages in invasive ductal breast carcinoma. Virchows Arch. 440, 583-588 (2002). 169. van de Vijver, M. J. et al. A gene-expression signature as a predictor of survival in breast cancer. N. Engl. J. Med. 347, 1999-2009 (2002). 170. van 't Veer, L. J. et al. Gene expression profiling predicts clinical outcome of breast cancer. Nature 415, 530-536 (2002).
119 171. Verheul, H. M. & Pinedo, H. M. The role of vascular endothelial growth factor (VEGF) in tumor angiogenesis and early clinical development of VEGF-receptor kinase inhibitors. Clin. Breast Cancer 1 Suppl 1, S80-S84 (2000). 172. von Minckwitz, G. et al. A multicentre phase II study on gefitinib in taxane- and anthracycline-pretreated metastatic breast cancer. Breast Cancer Res. Treat. 89, 165-172 (2005). 173. Walker, F. & Burgess, A. W. Specific binding of radioiodinated granulocyte- macrophage colony-stimulating factor to hemopoietic cells. EMBO J. 4, 933-939 (1985). 174. Watson, N. F. et al. Immunosurveillance is active in colorectal cancer as downregulation but not complete loss of MHC class I expression correlates with a poor prognosis. International journal of cancer.Journal international du cancer 118, 6 (2006). 175. WEIDNER, N., SEMPLE, J. P., WELCH, W. R. & Folkman, J. TUMOR ANGIOGENESIS AND METASTASIS - CORRELATION IN INVASIVE BREAST- CARCINOMA. N. Engl. J. Med. 324, 1-8 (1991). 176. Weigelt, B., Peterse, J. L. & van 't Veer, L. J. Breast cancer metastasis: markers and models. Nat. Rev. Cancer. 5, 591-602 (2005). 177. Whitworth, P. W., Pak, C. C., Esgro, J., Kleinerman, E. S. & Fidler, I. J. Macrophages and cancer. Cancer Metastasis Rev. 8, 319-351 (1990). 178. Wierzbowska, A. et al. Circulating VEGF and its soluble receptors sVEGFR-1 and sVEGFR-2 in patients with acute leukemia. Eur. Cytokine Netw. 14, 149-153 (2003). 179. Wiesmann, C. et al. Crystal structure at 1.7 A resolution of VEGF in complex with domain 2 of the Flt-1 receptor. Cell 91, 695-704 (1997). 180. Willett, C. G. et al. Direct evidence that the VEGF-specific antibody bevacizumab has antivascular effects in human rectal cancer. Nat. Med. 10, 145-147 (2004). 181. Willett, C. G. et al. Surrogate markers for antiangiogenic therapy and dose-limiting toxicities for bevacizumab with radiation and chemotherapy: continued experience of a phase I trial in rectal cancer patients. J. Clin. Oncol. 23, 8136-8139 (2005). 182. Williams, C. S., Mann, M. & DuBois, R. N. The role of cyclooxygenases in inflammation, cancer, and development. Oncogene 18, 7908-7916 (1999). 183. Williams, R. H. & Larsen, P. R. in Williams textbook of endocrinology (Saunders, Philadelphia, Pa, 2003). 184. Wognum, A. W., Westerman, Y., Visser, T. P. & Wagemaker, G. Distribution of receptors for granulocyte-macrophage colony-stimulating factor on immature CD34+ bone marrow cells, differentiating monomyeloid progenitors, and mature blood cell subsets. Blood 84, 764-774 (1994). 185. Wojchowski, D. M. & He, T. C. Signal transduction in the erythropoietin receptor system. Stem Cells 11, 381-392 (1993). 186. Wyckoff, J. et al. A paracrine loop between tumor cells and macrophages is required for tumor cell migration in mammary tumors. Cancer Res. 64, 7022 (2004). 120 187. Yager, J. D. & Davidson, N. E. Estrogen Carcinogenesis in Breast Cancer. N. Engl. J. Med. 354, 270-282 (2006). 188. Yahata, Y. et al. Nuclear translocation of phosphorylated STAT3 is essential for vascular endothelial growth factor-induced human dermal microvascular endothelial cell migration and tube formation. J. Biol. Chem. 278, 40026-40031 (2003). 189. Yamaguchi, T. et al. Overexpression of soluble vascular endothelial growth factor receptor 1 in colorectal cancer: Association with progression and prognosis. Cancer. Sci. 98, 405-410 (2007). 190. Yang, W. et al. Investigating protein-ligand interactions with a mutant FKBP possessing a designed specificity pocket. J. Med. Chem. 43, 1135-1142 (2000). 191. Yue, W. et al. Genotoxic metabolites of estradiol in breast: potential mechanism of estradiol induced carcinogenesis. J. Steroid Biochem. Mol. Biol. 86, 477 (2003). 192. Zhang, C. et al. Role of SCC-S2 in experimental metastasis and modulation of VEGFR-2, MMP-1, and MMP-9 expression. Mol. Ther. 13, 947-955 (2006). 193. Zhang, Y. et al. Th1 cell adjuvant therapy combined with tumor vaccination: a novel strategy for promoting CTL responses while avoiding the accumulation of Tregs. Int. Immunol. 19, 151-161 (2007). 194. Zhao, Y. et al. A novel approach to generate host antitumor T cells: adoptive immunotherapy by T cells maturing in xenogeneic thymus. J. Immunother. 30, 83-88 (2007).
121