Genome-wide CRISPR screen identifies regulators of MAPK and MTOR pathways mediating sorafenib resistance in acute myeloid leukemia by Alisa Damnernsawad, Daniel Bottomly, Stephen E. Kurtz, Christopher A. Eide, Shannon K. McWeeney, Jeffrey W. Tyner, and Tamilla Nechiporuk

Haematologica 2020 [Epub ahead of print]

Citation: Alisa Damnernsawad, Daniel Bottomly, Stephen E. Kurtz, Christopher A. Eide, Shannon K. McWeeney, Jeffrey W. Tyner, and Tamilla Nechiporuk. Genome-wide CRISPR screen identifies regulators of MAPK and MTOR pathways mediating sorafenib resistance in acute myeloid leukemia. Haematologica. 2020; 105:xxx doi:10.3324/haematol.2020.257964

Publisher's Disclaimer. E-publishing ahead of print is increasingly important for the rapid dissemination of science. Haematologica is, therefore, E-publishing PDF files of an early version of manuscripts that have completed a regular peer review and have been accepted for publication. E-publishing of this PDF file has been approved by the authors. After having E-published Ahead of Print, manuscripts will then undergo technical and English editing, typesetting, proof correction and be presented for the authors' final approval; the final version of the manuscript will then appear in print on a regular issue of the journal. All legal disclaimers that apply to the journal also pertain to this production process.

Genome-wide CRISPR screen identifies regulators of MAPK and MTOR pathways mediating sorafenib resistance in acute myeloid leukemia

Alisa Damnernsawad1,2, Daniel Bottomly3, Stephen E. Kurtz4, Christopher A. Eide4,

Shannon K. McWeeney3, Jeffrey W. Tyner1,4, § and Tamilla Nechiporuk1, §

1 Department of Cell, Developmental & Cancer Biology, Knight Cancer Institute, Oregon Health & Science University, Portland, OR, USA

2 Department of Biology, Faculty of Science, Mahidol University, Bangkok, Thailand

3 Division of Bioinformatics and Computational Biology, Knight Cancer Institute, Oregon Health & Science University, Portland, OR, USA

4 Division of Hematology and Medical Oncology, Knight Cancer institute, Oregon Health & Science University, Portland, OR, USA

§To whom Correspondence should be addressed, [email protected], [email protected]

Abstract

Drug resistance impedes the long-term effect of targeted therapies in acute myeloid leukemia (AML), necessitating the identification of mechanisms underlying resistance.

Approximately 25% of AML patients carry FLT3 mutations and develop post-treatment insensitivity to FLT3 inhibitors, including sorafenib. Using a genome-wide CRISPR screen, we identified LZTR1, NF1, TSC1 or TSC2, negative regulators of the MAPK and MTOR pathways, as mediators of sorafenib resistance. Analyses of ex vivo drug sensitivity assays in FLT3-ITD

AML patient samples revealed lower expression of LZTR1, NF1, and TSC2 correlated with sorafenib sensitivity. Importantly, MAPK and/or MTOR complex1 (MTORC1) activity were up- regulated in AML cells made resistant to several FLT3 inhibitors, including crenolanib, quizartinib, or sorafenib. These cells were sensitive to MEK inhibitors, and the combination of

FLT3 and MEK inhibitors showed enhanced efficacy, suggesting its effectiveness in AML patients with FLT3 mutations and those with resistance to FLT3 inhibitors.

Introduction

Acute myeloid leukemia (AML), a rapidly progressing hematologic malignancy, is caused by the impaired differentiation and subsequent proliferation of hematopoietic progenitor cells.

AML is characterized by cytogenetic heterogeneity and numerous recurrent genetic lesions [1-

5]. The Fms-related tyrosine kinase 3 (FLT3) receptor tyrosine kinase is normally expressed on hematopoietic stem and progenitor cells and functions in promoting cell proliferation and survival as well as normal development of these cells [6-8]. FLT3 activating mutations occur in approximately 25% of AML patients, either by internal tandem duplications (FLT3-ITD) or point mutations in the tyrosine kinase domain [4, 9-12], stimulating AML cell proliferation and survival.

These mutations are associated with poor prognostic outcomes as well as enhanced risk of relapse [6, 7, 13]. The high frequency and adverse effect of FLT3 mutations has prompted the development of small molecule inhibitors targeting FLT3. Among the FLT3 tyrosine kinase inhibitors (TKIs) that have been developed, several have provided encouraging results in clinical trials [7, 14, 15], and two TKIs, midostaurin and gilteritinib, have been approved for FLT3 mutant AML [16-18]. Yet all FLT3 inhibitors developed to date lack long term clinical durability due to the development of resistance. Point mutations within the kinase domain of FLT3, such as variants in residues D835 and F691, cause resistance to Type II FLT3 inhibitors (quizartinib and sorafenib) in vitro as well as in relapsed/refractory in patients [19-21]. While patients with TKD mutations develop resistance to type II inhibitors, they are sensitive to type I inhibitors, albeit responses are transient [21].

Diverse mutations underlie resistance in AML patients to the type I inhibitor, crenolanib, including rare mutations at the gatekeeper region of FLT3, as well as NRAS and IDH2 mutations in FLT3-independent subclones, and TET2 and IDH1 mutations in FLT3 mutant clones in non-responding patients [22]. Single-cell DNA sequencing of specimens from patients relapsing after treatment with a novel type I inhibitor, gilteritinib, revealed shifts in clonal architecture to select for secondary mutations in NRAS, KRAS, IDH2, or BCR-ABL1, either in the context of FLT3-ITD or FLT3-WT clones [18]. Aberrant activation of ERK either extrinsically through the bone marrow microenvironment or intrinsically in a cell-autonomous manner has been implicated in FLT3 resistance in AML [23, 24]. Up-regulation of the RAS/RAF/ERK pathway is observed after treatment with FLT3 TKI in AML cell lines and AML patient bone marrow samples [23, 25]. Signaling through JAK/STAT5 mediated by granulocyte-mediated colony-stimulating factor (GM-CSF) and interleukin-3 (IL-3) allows AML cells to survive FLT3 inhibitor treatment [26]. Activation of the PI3K/MTOR pathway has also been demonstrated to promote resistance to a FLT3 inhibitor [27].

Sorafenib, a multi-kinase inhibitor targeting not only FLT3 but also RAF, VEGFR, FGFR,

KIT and RET [28], has been evaluated in AML patients with FLT3-ITD in in combination with azacytidine where it demonstrated 46% overall response rate [29]. Combination of sorafenib and standard-of-care chemotherapy extended event free survival in patients younger than 60 years old [30]. Data from a phase I trial showed that FLT3-ITD harboring patients receiving sorafenib after allogeneic hematopoietic stem cell transplantation (HSCT) showed 85% 1-year progression-free survival and 95% 1-year overall survival [31].

To reveal mechanisms of sorafenib resistance we used a genome-wide CRISPR KO screen to identify genes whose loss-of-function variants can promote FLT3 inhibitor sensitive

AML cells to survive in the presence of sorafenib. To confirm aberrant signaling in these pathways renders cells insensitive to FLT3 inhibitors, we established AML cells resistant to both type I and type II FLT3 inhibitors. Our CRISPR screen identified genes in the MTOR and MAPK pathways modulating sorafenib sensitivity. Activities of MTOR and MAPK pathways were up- regulated in cells with acquired resistance, and these cells were sensitive to MEK inhibitors supporting the role of aberrant downstream MAPK signaling in FLT3 inhibitor resistance. We found the combination of FLT3 and MEK inhibitors delivered synergistic efficacy both in FLT3 inhibitor sensitive and resistant AML cells as well as in AML patient samples. In summary, our work identified several negative regulators of MTOR and MAPK signaling pathways, LZTR1,

TSC1/2, NPRL2, NF1, not previously associated with AML, as modulators of sorafenib sensitivity. We show aberrations in MTOR and MAPK pathways as main resistance mechanisms to sorafenib well as other FLT3 inhibitors in AML and suggest the combination of

FLT3i and MEKi for treatment of FLT3 inhibitor resistant AML.

Methods

Cell lines. Human MOLM13 cells were obtained from the Sanger Institute Cancer Cell Line

Panel. Authentication was performed on all cell lines used in this study at the OHSU DNA

Services Core facility. Cell lines were maintained in 20% FBS, RPMI, supplemented with glutamine, penicillin/streptomycin and anti-mycotic reagent. All cell lines were tested for mycoplasma on a monthly schedule. Lentivirus production and transduction. HEK293T cells were transfected using

Lipofectamine-2000 (Invitrogen) with single transfer vectors in combination with packaging plasmids, psPax2 (Addgene, #12260) and VSVG (Invitrogen). Supernatants were collected, filtered through 0.45 µM filters and used for transduction as described [38].

CRISPR/Cas9 library screen and CRISPR/Cas9 gene inactivation by individual sgRNAs.

Cas9-expressing cells were generated using Cas9Blst (Addgene, #52962). Loss-of-function screens were performed using a human genome-wide sgRNA libraries, Y. Kosuke library [32] purchased form Addgene (#67989), as described [38], targeting 18,010 genes with 90,709 sgRNAs (average of 5 guides per gene). High titer lentivirus was generated using standard calcium phosphate precipitation procedures in HEK293T cells. Viral supernatant was concentrated and titer determined using viral titration kit (ABM good, Canada). 100 million cells were used for viral transduction at MOI 0.3, selected with puromycin for 5-7 days to ensure stable viral integration. Inactivation of individual genes were carried out by cloning sgRNAs into plentiCRISPRV2 (Addgene, #52961) as per manufacture suggestions. The following sgRNAs were used in the study: LZTR1: 5’ CCCATAGACGACGGCCGAG 3’, NF1:

5’CATATCAGTCTGTGGGATC 3’, TSC1, 5’ACGTCGTTGTCCTCACAAC 3’, TSC2: 5’

TTGATGCGCACGGCGCCTC 3’, NPRL2: 5’ GAACCCATCAATGTAGGGC 3’, DEPDC 5’

GACTGTGACTCAAGTGTTCC and 5’ TGTTAATGTCGTAGACCCTA, TBC1D7 5’

GTATCGTASAGGAGCAGTACT. Sequencing data was deposited to GSE, accession number

GSE138343.

Drug sensitivity assay. Small-molecule inhibitors, purchased from LC Laboratories Inc

(Woburn, MA, USA) and Selleck Chemicals (Houston, TX, USA), were reconstituted in DMSO.

Cells were seeded at 1,000 cells/well of 384-well plate in 50 μL medium (RPMI-1640 media supplemented with fetal bovine serum (15%), L-glutamine, penicillin-streptomycin and antimycotic) with different concentration of drugs and cultured for 72 hours. Five uL of MTS reagent (CellTiter96 AQueous One; Promega Madison, WI, USA) were added to each well and incubated for 4 hours. Optical density was measured at 490 nm. Relative cell viability was calculated by normalizing to untreated control wells. Prism software (GraphPad) was used to produce non-linear fit and drug response, IC50 and area under the curve (AUC).

Immunoblot analysis. Whole cell protein lysates were prepared using cell lysis buffer (Cell

Signaling Technologies), 1mM PMSF, proteasome (Roche) and phosphatase inhibitor cocktail

(Sigma-Aldrich). Proteins were resolved on 4 -15% gradient gels (Biorad), transferred onto

PVDF membranes (Amersham), and subjected to immunoblotting using primary antibodies from

Cell Signaling Technologies: p44/42 MAPK (ERK1/2; #9102), phospho-ERK1/2 (phospho- p44/42 MAPK Thr202/Tyr204; #4376), AKT (#9272), phospho-AKT (Ser473; #4060), TSC1

(#6935), phospho-TSC2 (Ser664; #40729), phospho-TSC2 (Tyr1571; #3614), TSC2 (#4308), phospho-mTOR (Ser2481; #2974), phospho-mTOR (Ser2448; #2971), mTOR (#2983), NF1

(#14623), MEK (#9122S), phosphor-MEK (#9154), vinculin (#4650); from ThermoFisher

Scientific: GAPDH (#AM4300); from Millipore: anti-pan_Ras (clone RAS 10 MABS195) from

Sigma: LZTR1 (HPA071248). Corresponding HRP-conjugated secondary antibodies (Promega) were used for chemiluminescent detection.

Biostatistical analysis. Pipeline for executing analyses of CRISPR libraries sequences were performed using MAGeCK analyses [60]. The hits were prioritized according to previously described tiering structure [38]. Briefly, tier 1 represents hits having log 2 fold change > 2, 75% of sgRNAs per gene present and concordance among sgRNAs per gene > 75%; tier 2 hits having log 2 fold change > 2 and concordance among sgRNAs per gene is 100%; tier 3 hits having log 2 fold change > 1 and concordance among sgRNAs per gene is 100%. Singleton hits represent significantly enriched genes with log 2 fold change > 2 and adjusted sgRNAs count is

1 and average control mean > 100 reads. Enriched hits not satisfying these criteria were classified into unassigned group.

Data Availability. Raw data files for CRISPR screens have been deposited at GEO and can be found under the accession number GSE130414.

Results

The MTOR and MAPK pathways are central components in sorafenib resistance

To identify genes whose loss-of-function variants contribute to sorafenib resistance in

AML, we selected MOLM13 cells, an AML cell line model harboring FLT3-ITD mutation resulting in sensitivity to several FLT3 inhibitors, including sorafenib. MOLM13 cells, engineered to express Cas9, were stably transduced with a genome-wide lentiviral small guide RNA (sgRNA)

CRISPR knock out library [32] and treated for 14 days with vehicle or 50 nM sorafenib, a concentration projected to kill 80% of the cells within 3 days of drug administration (IC80).

Genomic DNA was harvested from control and sorafenib-treated cultures and evaluated for enriched sgRNAs using MAGeCK robust rank aggregation analyses (RRA) [33] (Figure 1A-B and Supplementary Table 1).

Comparison of sequencing reads from sorafenib-treated cultures to vehicle-treated controls identified significant enrichment for sgRNAs targeting negative regulators of the MAPK and AKT/MTOR pathways (Figure 1B-D). The screen uncovered negative RAS/RAF/MEK/ERK regulator, Leucine Zipper Like Transcription Regulator 1 (LZTR1), which inhibits the MAPK pathway by regulating RAS ubiquitination and degradation [34, 35]; a negative regulator of RAS signaling, Neurofibromin 1 (NF1); three components of the Tuberous Sclerosis (TSC) complex including TSC Complex Subunit 1 (TSC1), TSC Complex Subunit 2 (TSC2), and TBC1 Domain

Family Member 7 (TBC1D7) [36]. Top hits also included members of the GATOR1 complex,

NPRL2 and DEPCD5 proteins [37]. To prioritize candidates for validation, we developed a tiering structure that incorporates three key factors: evidence (determined by the number of sgRNA guide hits per gene), concordance (indicated by the agreement across the set of guides for a given gene) and discovery (based on effect size) to rank sgRNA hits and enable a progression to pathway analysis for lower scoring hits [38]. Using the prioritization scheme, the

Tier 1 hits (n=16) included LZTR1, TSC2, and TBC1D7 and several genes implicated in RNA splicing and ribosome biogenesis, such as DHX15, EBNA1BP2, LSM5, PUS7, RPSA or ABCB1 transporter, linked to poor prognostic factors in AML (Supplementary Table 1,2 and

Supplementary Figure 1). Our tier structure imposed additional constraints for ranking sgRNA hits into the more selective tiers, which generally preserved MAGeCK RRA rankings, although, there are exceptions such as TSC1 that ranked as a Tier 3 hit due to the variance in its log-fold change across the set of sgRNAs for this gene. Using an FDR cutoff, we decided to focus here on connecting the AKT/PI3K/MTOR and RAS/MAPK/MEK networks to verify screen candidates

(Figure 1B, bottom panel, Figure 1D).

Deficiency of top hit genes decreases sorafenib sensitivity in AML cell lines.

To validate top hit genes belonging to LZTR1-connected network, we transduced

MOLM13 cells with lentivirus expressing Cas9 and individual sgRNA to generate single gene deficient cells. Sensitivity to sorafenib was assessed in 72 hr cell viability MTS assay. Cells inactivated for LZTR1, NF1, TSC1, TSC2, and NPRL2 showed reduced sensitivity to sorafenib

(Figure 1E). The degree of sorafenib resistance varied across targeted genes, with TSC1- and

LZTR1-deficient cells demonstrating the strongest resistance to sorafenib (parental IC50 = 5.03 nM, NT IC50 = 6.31 nM, sgTSC1 IC50 = 97.34 nM, and sgLZTR1 IC50 = 22.37 nM), while targeting of TSC2 yielded comparably more modest resistance to sorafenib (IC50 = 14 nM)

(Figure 1E). TBC1D7 deficient cells had decreased sensitivity to sorafenib while DEPCD5- deficient cells were modestly resistant (Supplementary Figure 2). Deficiency of LZRT1, NF1,

TSC1, TSC2 and NPRL2 was evident by western blot analysis (Supplementary Figure 3A). The corresponding efficiencies of CRISPR knockouts were determined by ICE analysis

(Synthego.com) (Supplementary Figure 3B).

Reduced expression levels of LZTR1, NF1, TSC1, and TSC2 correlate with reduced sensitivity to sorafenib in AML patient samples and deficiency results in hyperactivation of MAPK or MTOR pathways in AML cells.

We evaluated results from our CRISPR screen for relevance to drug sensitivity and gene expression profiles observed in patient samples in the Beat AML database [3]. RNA expression levels of LZTR1, NF1, and TSC2 showed negative correlation with sorafenib sensitivity in AML patient samples harboring FLT3-ITD mutations (p < 0.0001, p < 0.001, and p < 0.01, respectively, Figure 2A). We did not observe a significant negative correlation between gene expression and sorafenib sensitivity for other screen hits, including RASA2, TBC1D7, NPRL2, and DEPDC5.

In MOLM13 cells, engineered to model LZTR1 and NF1 deficiencies, we observed elevated levels of phosphorylated ERK, suggesting an increased activation of MAPK signaling pathway (Figure 2B). As MAPK can cross-activate MTOR signaling [39-41], we observed increased phosphorylation level of MTORC1, similar to results with inactivated inhibitory functions of TSC1 and TSC2, indicating common aberrancy in downstream signaling (Figure

2B). Elevated phospho-ERK was evident in TSC1-deficient, but not in TSC2-deficient cells potentially reflecting different roles of TSC1 and TSC2 in the TSC complex. Levels of RAS protein were elevated in LZTR1, but not in NF1 and TSC1 deficient cells (Figure 2C).

MTOR and MAPK pathways are up-regulated in FLT3 inhibitor resistant AML cells

In a parallel approach to understand mechanisms of sorafenib resistance, we generated

AML cell lines resistant to FLT3 inhibitors by gradually exposing MOLM13 cells to both type I

(crenolanib) or type II (quizartinib and sorafenib) FLT3 inhibitors. Crenolanib and sorafenib resistant MOLM13 cells showed reduced sensitivity, detected by higher IC50 and AUC values, to both type I and type II inhibitors, whereas, quizartinib resistant cells showed resistance only to type II inhibitors (Figure 3A). To investigate whether there is an overlap between the acquisition of resistance by CRISPR-derived KO cells versus resistance generated by prolonged drug exposure, we evaluated activity of MTORC1 and MAPK pathways. We detected an increase in levels of phospho-ERK and elevated RAS levels in FLT3 drug-resistant cells indicating up- regulation of the MAPK pathway (Figure 3B). Surprisingly, levels of TSC2 were increased in crenolanib and sorafenib resistant cells; in contrast, loss of function for TSC2 was revealed in the CRISPR KO resistance screen. Previous studies have shown MAPK pathway can inhibit

MTOR activity by phosphorylating TSC2 at S664 causing dissociation of the TSC complex observed in breast and colon carcinomas [41-43]. This observation prompted us to test for levels of phospho-TSC2. We observed enhanced levels of phospho-TSC2 at S664 in these two cell lines suggesting that inhibition of the TSC complex formation by the MAPK pathway promotes resistance to FLT3 inhibitors. Moreover, we observed elevated level of phospho-TSC2 at Y1571, which additionally impairs TSC1-TSC2 interaction [44], supporting inactivation of

TSC2 in these resistant cells, concordant with our CRISPR screen results.

MEK inhibitors re-sensitize FLT3 inhibitor resistant cell lines

Data from the CRISPR screen and resistant cell lines suggested up-regulation of the

MAPK signaling pathway contributes to FLT3 inhibitor resistance in AML. This prompted us to hypothesize that inhibitors targeting MAPK pathway may re-sensitize FLT3 inhibitor resistant cells. Parental and resistant cells were tested for sensitivity to the MEK inhibitor trametinib and

MTOR inhibitors PP242, PI-103 and rapamycin. Resistant cells showed greater sensitivity to trametinib relative to the parental cells (Figure 3C and Supplementary Figure 4A). Combination of each FLT3 inhibitor with trametinib, revealed enhanced efficacy in both resistant and parental

AML cells (Figure 4A and Supplementary Figure 4B). Moreover, combination of sorafenib and trametinib showed high synergy scores in several concentrations as analyzed by

R_SynergyFinder [45] (average synergy (ZIP) score for parental cells = 3.449 versus 8.015 in sorafenib resistant MOLM13; synergy scores above 1 are significant). Similar synergy in sensitivity were obtained with trametinib in combination with either crenolanib or quizartinib

(Supplementary Figure 4D). MTOR inhibitors PP242 and PI-103 did not exhibit substantial cell killing as single-agents in any of the FLT3 inhibitor-resistant cell lines (Figure 3C, bottom panel and Supplementary Figure 4A) and combination of mTORi and a FLT3i resulted in a marginal decrease in cell viabilities (Figure 4A bottom panels and Supplementary Figure 4B,C). In contrast, MTOR inhibitors appeared to re-sensitize TSC1 and NPRL2 deficient cells to sorafenib

(Supplementary Figure 5). The effect of PI-103 was more pronounced than that of PP242 which may reflect its dual targeting of MTOR and PI3K.

Discussion

Sorafenib, as well as other FLT3 inhibitors, in combination with standard-of-care chemotherapy treatment prolongs AML patient survival with or without FLT3 mutations, although relapse caused by drug resistance remains a clinical challenge. To elucidate resistance mechanisms to sorafenib, we subjected MOLM13 AML cells to genome-wide CRISPR screening to identify genes whose loss-of-function contribute to reduced drug sensitivity. The top screen hits indicate that resistance to FLT3 inhibitors in AML can occur via aberrant activation of the AKT/PI3K/MTOR and RAS/MAPK signaling pathways. Our results are consistent with findings from previous studies on FLT3 inhibitor resistance revealing aberrant

ERK and RAS signaling [18, 23] and extend these with the identification of a broad spectrum of genes regulating RAS/MAPK and, additionally, MTOR signaling pathways as modulators of resistance (Figure 4).

Analysis of the screen using the MAGeCK pipeline in combination with a tiering system developed previously [38] identified LZTR1, TSC1/2, NPRL2, NF1, and TBC1D7 as significant hits. The identification of LZTR1 is not unexpected as LZTR1 loss confers MAPK activation by dysregulating RAS signaling [34, 35]; it also facilitates degradation of RAS-GTPases [46, 47].

Consistent with our results, loss of LZTR1 function has recently been shown to cause resistance to TKIs including several FLT3 inhibitors (tandutinib, quizartinib, and ponatinib) in AML cell lines

[35]. LZTR1 loss of function mutations have been observed in other cancers including glioblastoma multiforme, adrenocortical cancer, pancreatic cancer, and recently been reported in hepatocellular carcinoma, a cancer for which sorafenib is a first-line therapy [48, 49]. The screen hits included components of the TSC and the GATOR complexes, which have not been previously identified as modulators of FLT3 inhibitor resistance. Our screen also identified two negative regulators of RAS: NF1 and RASA2. Loss of function mutations in NF1 have been associated with poor prognosis in AML patients [50], suggesting that patients with NF1 mutations would have poor sensitivity to FLT3 inhibitors.

TSC2 and TBC1D7 along with TSC1 form the TSC complex, which acts as a GTPase activating protein for RHEB, a small G-protein upstream of MTOR complex 1 (MTORC1) [36,

51-53]. MTORC1 is activated by another small G-protein, RAG, which is negatively regulated by the GATOR1 complex comprised of NPRL2, NPRL3, and DEPDC5 proteins [37]. Our screen identified TSC1 and components of the GATOR1 complex, DEPDC5 and NPRL2. Loss of function variants of TSC1 and TSC2 are found in ~16% of hepatocarcinoma patients and associate with an aggressive form of hepatocarcinoma [54]. Our data suggest the roles of TSC1 and TSC2 are complex; we note that TSC1, but not TSC2 deficient MOLM13 cells showed increased phospho-ERK activity. This observation may not be surprising giving the structural difference between the two proteins; TSC1 lacks the kinase domain that is present in TSC2 [36,

51]. It is possible that TSC1 executes functions outside of its interactions with TSC2 to regulate the MAPK signaling. Consistent with results from the CRISPR screen, AML patient samples harboring FLT3-ITD mutations with reduced RNA expression levels of LZTR1, NF1, and TSC2 exhibited less sensitivity to sorafenib FLT3-ITD mutation status.

Upregulation of phospho-MTORC1 (Ser2481) is observed in two FLT3 inhibitor resistant cell lines made by gradual exposure to higher concentrations of FLT3 inhibitors supporting a role for MTORC1 in FLT3 inhibitor resistance. Enhanced phospho-ERK levels in FLT3 resistant cells confirmed the importance of the MAPK pathway in FLT3 inhibitor resistance. Concordantly, the resistant cells demonstrate enhanced sensitivity to MEK inhibitors. We also showed the connection between MAPK and MTOR pathways influenced FLT3 inhibitor resistance. We found enhanced levels of phospho-TSC2 at S664 and Y1571 in the resistant lines which are regulated by phosphorylated ERK and AKT, respectively. Importantly, these phosphorylation events inhibit the formation of the TSC complex, mimicking TSC1 and TCS2 loss of function hits as revealed by the CRISPR resistance screen. The combination of FLT3 + MEK inhibitors have a synergistic effectiveness in both sensitive and resistant cells, which is consistent with a recent study that demonstrated synergy for the combination of crenolanib with trametinib in Ba/F3 cells harboring PTPN11 A72D, FLT3 D835Y or double mutations of both [22]. Similarly, the combination of sorafenib or pazopanib with trametinib showed strong synergy in MOLM13 cells

[25]. Moreover, the combination of sorafenib with MEK inhibitor, PD0325901, showed synergy in

MOLM14 and MV4;11 AML cell lines [23], [55], and the combination of gilteritinib and trametinib showed enhanced efficacy in MOLM14 cells with NRAS G12C and NRAS Q61K [18]. Enhanced efficacy is observed in AML patient samples assayed ex vivo for sensitivity to a combination of

FLT3i (quizartinib) and trametinib (Beat AML data, Supplementary Figure 4E). Evaluation of signaling in FLT3i-resistant cells and top hits from the CRISPR KO screen underscore activation of the MTOR pathway in sorafenib resistance. Assessment of MTOR inhibitor sensitivity in combination with FLT3i showed a profound effect only in TSC1- and NPRL2-deficient cells. This result may indicate reliance on multiple pathways in FLT3i resistant cells.

Increased activity of JAK/STAT5 has also been implicated with FLT3 inhibitor resistance.

Granulocyte-mediated colony-stimulating factor and interleukin-3 mediate FLT3 resistance in

AML cells via JAK/STAT5 and PIM/cytokine-activated JAK/STAT5 signaling [26]. Although, we did not evaluate JAK/STAT5 pathways in this report, our CRISPR screen identified several negative regulators of JAK/STAT5 pathways including PTPN1, SUMO3, and PTPN6.

Additionally, our screen identified several tier 1 hits involved in RNA metabolism and splicing, including DHX15, EBNA1BP2, LSMR, PUS7 and RPSA. DHX15, for example, encodes an RNA helicase which is commonly mutated in AML patients with RUNX1-RUNX1T1 fusions[56]. It will be important to pursue these findings in subsequent studies given the roles of RNA metabolism in cancer pathogenesis[57-59].

Acknowledgements

We thank the OHSU Massively Parallel Sequencing Shared Resource and Flow Cytometry Core for technical support, Sunil Joshi for reviewing the manuscript. Supported by grants from the National Cancer Institute (1U01CA217862, 1U54CA224019, 3P30CA069533-18S5). J.W.T. received grants from the V Foundation for Cancer Research, the Gabrielle’s Angel Foundation for Cancer Research, and the National Cancer Institute (1R01CA183947). T.N is supported by R50 CA251708-01.

Disclosures: J.W.T. has received research support from Agios, Aptose, Array, AstraZeneca,

Constellation, Genentech, Gilead, Incyte, Janssen, Petra, Seattle Genetics, Syros, Takeda.

References

1. Papaemmanuil E, Gerstung M, Bullinger L, et al. Genomic Classification and Prognosis in Acute Myeloid Leukemia. N Engl J Med. 2016;374(23):2209-2221. 2. Döhner H, Weisdorf DJ, Bloomfield, CD. Acute Myeloid Leukemia. N Engl J Med. 2015;373(12):1136-1152. 3. Tyner JW, Tognon, CT, Bottomly D, et al. Functional genomic landscape of acute myeloid leukaemia. Nature. 2018;562(7728):526-531. 4. McCurdy SR, Levis MJ. Emerging molecular predictive and prognostic factors in acute myeloid leukemia. Leuk Lymphoma. 2018;59(9):2021-2039. 5. Cancer Genome Atlas Research. Genomic and epigenomic landscapes of adult de novo acute myeloid leukemia. N Engl J Med. 2013;368(22):2059-2074. 6. Gilliland DG, Griffin JD. The roles of FLT3 in hematopoiesis and leukemia. Blood. 2002;100(5):1532-1542. 7. Daver N, Schlenk RF, Russel NH, et al. Targeting FLT3 mutations in AML: review of current knowledge and evidence. Leukemia. 2019;33(2):299-312. 8. Small D. FLT3 Mutations: Biology and Treatment. ASH Education Program Book. 2006(1):178-184. 9. Nakao M, Yokota S, Iwai T, et al. Internal tandem duplication of the flt3 gene found in acute myeloid leukemia. Leukemia. 1996;10(12):1911-918. 10. Yokota S, Kiyoi H, Nakao M, et al. Internal tandem duplication of the FLT3 gene is preferentially seen in acute myeloid leukemia and myelodysplastic syndrome among various hematological malignancies. A study on a large series of patients and cell lines. Leukemia. 1997;11(10):1605-1609. 11. Tse KF, Mukherjee G, Small D. Constitutive activation of FLT3 stimulates multiple intracellular signal transducers and results in transformation. Leukemia. 2000;14(10):1766-1776. 12. Yamamoto Y, Nakano Y, Suzuki R, et al. Activating mutation of D835 within the activation loop of FLT3 in human hematologic malignancies. Blood. 2001;97(8):2434- 2439. 13. Kiyoi H, Yanada M, Ozekia K. Clinical Significance of FLT3 in Leukemia. Int J Hematol. 2005;82(2):85-92. 14. Larrosa-Garcia M, Baer MR. FLT3 Inhibitors in Acute Myeloid Leukemia: Current Status and Future Directions. Mol Cancer Ther. 2017;16(6):991-1001. 15. Wu M, Li C, Zhu X. FLT3 inhibitors in acute myeloid leukemia. J Hematol Oncol. 2018;11(1):133. 16. Stone RM, Mandrekar S, Sanford SL, et al. Midostaurin plus Chemotherapy for Acute Myeloid Leukemia with a FLT3 Mutation. N Engl J Med. 2017;377(5):454-464. 17. Perl AE, Altman JK, Cortes J, et al. Selective inhibition of FLT3 by gilteritinib in relapsed or refractory acute myeloid leukaemia: a multicentre, first-in-human, open-label, phase 1–2 study. Lancet Oncol. 2017;18(8):1061-1075. 18. McMahon CM, Ferng T, Canaani J, et al. Clonal selection with Ras pathway activation mediates secondary clinical resistance to selective FLT3 inhibition in acute myeloid leukemia. Cancer Discov. 2019;9(8):1050-1063. 19. Smith CC, Wang Q, Chin C-S, et al. Validation of ITD mutations in FLT3 as a therapeutic target in human acute myeloid leukaemia. Nature. 2012;485(7397):260-263. 20. Man CH, Fing TK, Ho C, et al. Sorafenib treatment of FLT3-ITD(+) acute myeloid leukemia: favorable initial outcome and mechanisms of subsequent nonresponsiveness associated with the emergence of a D835 mutation. Blood. 2012;119(22):5133-5143. 21. Albers C, Leischner H, Verbeek M, et al. The secondary FLT3-ITD F691L mutation induces resistance to AC220 in FLT3-ITD+ AML but retains in vitro sensitivity to PKC412 and Sunitinib. Leukemia. 2013;27(6):1416-1418. 22. Zhang H, Savage S, Schultz AR, et al. Clinical resistance to crenolanib in acute myeloid leukemia due to diverse molecular mechanisms. Nature Commun. 2019;10(1):244-257. 23. Bruner JK, Ma HS, Li L, et al. Adaptation to TKI Treatment Reactivates ERK Signaling in Tyrosine Kinase–Driven Leukemias and Other Malignancies. Cancer Res. 2017;77(20):5554-5563. 24. Yang X, Sexauer A, Levis M. Bone marrow stroma-mediated resistance to FLT3 inhibitors in FLT3-ITD AML is mediated by persistent activation of extracellular regulated kinase. Br J Haematol. 2014;164(1):61-72. 25. Martínez-López J, Linares M, Morales ML, et al. Preclinical Evidence That Trametinib Enhances the Response to Tyrosine Kinase Inhibitors in Acute Myeloid Leukemia. Blood. 2016;128(22):1581. 26. Sung PJ, Sugita M, Koblish H, et al. Hematopoietic cytokines mediate resistance to targeted therapy in FLT3-ITD acute myeloid leukemia. Blood Adv. 2019;3(7):1061-1072. 27. Lindblad O, Cordero E, Puissant A, et al. Aberrant activation of the PI3K/mTOR pathway promotes resistance to sorafenib in AML. Oncogene. 2016;35(39):5119-5131. 28. Wilhelm S, Carter C, Lynch M, et al. Discovery and development of sorafenib: a multikinase inhibitor for treating cancer. Nat Rev Drug Discov. 2006;5(10):835-844. 29. Ravandi F, Alattar ML, Grunwald MR, et al. Phase 2 study of azacytidine plus sorafenib in patients with acute myeloid leukemia and FLT-3 internal tandem duplication mutation. Blood. 2013;121(23):4655-4662. 30. Röllig C, Serve H, Huttmann A, et al. Addition of sorafenib versus placebo to standard therapy in patients aged 60 years or younger with newly diagnosed acute myeloid leukaemia (SORAML): a multicentre, phase 2, randomised controlled trial. Lancet Oncol. 2015;16(16):1691-1699. 31. Chen Y-B, Li S, Lane AA, et al. Phase I Trial of Maintenance Sorafenib after Allogeneic Hematopoietic Stem Cell Transplantation for Fms-like Tyrosine Kinase 3 Internal Tandem Duplication Acute Myeloid Leukemia. Biol Blood Marrow Transplant. 2014;20(12):2042- 2048. 32. Tzelepis K, Koike-Yusa H, De Braekeleer E, et al. A CRISPR Dropout Screen Identifies Genetic Vulnerabilities and Therapeutic Targets in Acute Myeloid Leukemia. Cell Rep. 2016; 17(4):1193-1205. 33. Li W, Xu H, Xiao T, et al. MAGeCK enables robust identification of essential genes from genome-scale CRISPR/Cas9 knockout screens. Genome Biol. 2014;15(12):554-566. 34. Steklov M, Pandolfi S, Baietti MF, et al, Mutations in LZTR1 drive human disease by dysregulating RAS ubiquitination. Science. 2018;362(6419):1177-1182. 35. Bigenzahn J, Collu GM, Kartnig F, et al. LZTR1 is a regulator of RAS ubiquitination and signaling. Science. 2018;362(6419):1171-1177. 36. Dibble CC, Elis W, Menon S, et al. TBC1D7 is a Third Subunit of the TSC1-TSC2 Complex Upstream of mTORC1. Mol Cell. 2012;47(4):535-546. 37. Shen K, Huang RK, Brignole RG, et al. Architecture of the human GATOR1 and GATOR1– Rag GTPases complexes. Nature. 2018;556(7699):64-69. 38. Nechiporuk T, Kurtz SE, Nikolova O, et al. The TP53 Apoptotic Network is a Primary Mediator of Resistance to BCL2 inhibition in AML Cells. Cancer Discov. 2019;9(7):910- 925. 39. Carriere A, Romea Y, Acosta-Jacquez JK, et al. ERK1/2 Phosphorylate Raptor to Promote Ras-dependent Activation of mTOR Complex 1 (mTORC1). J Biol Chem. 2011;286(1):567- 577. 40. Mendoza MC, Er EE, Blenis J. The Ras-ERK and PI3K-mTOR pathways: cross-talk and compensation. Trends Biochem Sci. 2011;36(6):320-328. 41. Ma L, Chen Z, Erdjument-Bromage H, et al. Phosphorylation and Functional Inactivation of TSC2 by Erk: Implications for Tuberous Sclerosisand Cancer Pathogenesis. Cell. 2005;121(2):179-193. 42. Ma L, Teruya-Feldstein J, Bonner P, et al. Identification of S664 TSC2 Phosphorylation as a Marker for Extracellular Signal-Regulated Kinase–Mediated mTOR Activation in Tuberous Sclerosis and Human Cancer. Cancer Res. 2007;67(15):7106-7112. 43. Ballif BA, Roux PP, Gerber SA, et al. Quantitative phosphorylation profiling of the ERK/p90 ribosomal S6 kinase-signaling cassette and its targets, the tuberous sclerosis tumor suppressors. Proc Natl Acad Sci U S A. 2005;102(3):667-672. 44. Aicher LD, Campbell JS, Yeung RS. Tuberin phosphorylation regulates its interaction with hamartin: Two proteins involved in tuberous sclerosis. J Biol Chem. 2001;276(24):21017-21021. 45. He L, Kulesskiy E, Saarela J, et al. Methods for High-throughput Drug Combination Screening and Synergy Scoring. Methods Mol Biol. 2018;1711:351-398. 46. Castel P, Cheng A, Cuevas-Navarro A, et al. RIT1 oncoproteins escape LZTR1-mediated proteolysis. Science. 2019; 363(6432):1226-1230. 47. Abe T, Umeki I, Kanno S-I, et al. LZTR1 facilitates polyubiquitination and degradation of RAS-GTPases. Cell Death Differ. 2020;27(3):1023-1035. 48. Cancer Genome Atlas Research Network. Comprehensive and Integrative Genomic Characterization of Hepatocellular Carcinoma. Cell. 2017;169(7):1327-1341. 49. Frattini V, Trifonov, V, Chan JM, et al. The integrated landscape of driver genomic alterations in glioblastoma. Nat Genet. 2013;45(10):1141-1149. 50. Eisfeld, A-K, Kohlschmidt J, Mrozek K, et al. NF1 mutations are recurrent in adult acute myeloid leukemia and confer poor outcome. Leukemia. 2018;32(12):2536-2545. 51. Huang J, Manning BD. The TSC1–TSC2 complex: a molecular switchboard controlling cell growth. Biochem J. 2008;412(2):179-190. 52. Laplante M, Sabatini DM. mTOR Signaling in Growth Control and Disease. Cell. 2012;149(2):274-293. 53. Manning BD, Toker A. AKT/PKB Signaling: Navigating the Network. Cell. 2017;169(3):381-405. 54. Ho DWH, Chan LK, Chui YT, et al. TSC1/2 mutations define a molecular subset of HCC with aggressive behaviour and treatment implication. Gut. 2017;66(8):1496-1506. 55. Morales ML, Arenas A, Ortiz-Ruiz A, et al. MEK inhibition enhances the response to tyrosine kinase inhibitors in acute myeloid leukemia. Sci Rep. 2019;9(1):18630-18641. 56. Opatz S, Bamopoulus SA, Metzeler KH, et al. The clinical mutatome of core binding factor leukemia. Leukemia. 2020; 34(6):1553-1562. 57. Wang BD, Lee NH. Aberrant RNA Splicing in Cancer and Drug Resistance. Cancers (Basel). 2018;10(11):458-482. 58. Desterro J, Bak-Gordon P, Carmo-Fonseca M. Targeting mRNA processing as an anticancer strategy. Nat Rev Drug Discov. 2020;19(2):112-129. 59. Di C, Syafrizayanti, Zhang Q, et al. Function, clinical application, and strategies of Pre- mRNA splicing in cancer. Cell Death Differ. 2019;26(7):1181-1194. 60. Badar T, Kantarjian HM, Nogueras-Gonzalez GM, et al. Improvement in clinical outcome of FLT3 ITD mutated acute myeloid leukemia patients over the last one and a half decade. Am J Hematol. 2015; 90(11):1065-1070.

Figure legends

Figure 1. Genome-wide CRISPR knock out screen identifies negative regulators of MAPK and MTOR pathways, LZTR1, NF1, TSC1/2 and NPRL2, attenuating sorafenib sensitivities in AML cell lines.

A. Schematic representation of CRISPR knock out screen in MOLM13 AML cells. B. Scatter plots of differential enrichment of sgRNAs in sorafenib-treated versus DMSO-treated control cells, analyzed at day 14 of drug exposure. Median log fold changes are plotted versus p-values

(top panel), and FDR adjusted p-values (bottom panel), generated from MAGeCK Robust

Ranked Aggregation analysis (RRA). Colors represent various tiers associated with ranking system based on directional concordance among sgRNAs and significance of fold increase (see

Methods Section). C. Plots of normalized sgRNA read counts targeting 5 top candidate genes from sorafenib and DMSO treated samples over time. D. Schematic of the MAPK and MTOR pathways with top hit genes shown in red circles. E. Dose response curve of 72 hour sorafenib sensitivity assay performed on parental MOLM13 cells and MOLM13 transduced with sgRNAs targeting LZTR1, NF1, TSC1, TSC2, NPRL2, and non-targeting (NT) control. Percent of viable cells were measured using MTS assay in triplicate in 7-point escalating drug concentrations.

Figure 2. Low sensitivity to sorafenib correlates with low expression levels of CRISPR top hits LZTR1, NF1, and TSC2 in AML patient specimens and inactivation in MOLM13

AML cell line reveals aberrant activation of MAPK or MTOR pathways.

A. Scatter plots of RNA expression levels (shown as normalized RPKM) plotted against drug sensitivity measured ex vivo as area under the curve (AUC) from AML patient samples harboring FLT3-ITD mutation, n = 86. Pearson’s correlation coefficients are shown as (r) values

Statistical significance is indicated. **** denotes p<0.0001, ***, p<0.001, **, p<0.01, n.s., non- significant. B, C. Immunoblot analyses of proteins from LZTR1, NF1, TSC1 and TSC2 deficient cells (LZTR1_sgRNA, NF1_sgRNA, TSC1_sgRNA and TSC2_sgRNA, correspondingly) in comparison to parental and non-targeting (NT_sgRNA) controls with indicated antibodies. p-

ERK denotes phosphorylated-ERK (Thr202/Tyr204), p-MTOR denotes phosphorylated-MTOR at S2448. Vinculin and GAPDH immunoreactivity serve as loading controls.

Figure 3. AML cell lines made resistant to FLT3 inhibitors demonstrate activation of

MAPK and/or MTOR pathways. A. MOLM13 AML cell lines were made resistant to type I and type II FLT3 inhibitors by continuous exposure to crenolanib, quizartinib or sorafenib. 72 hour drug sensitivity assays performed on parental and FLT3 inhibitor resistant MOLM13 cells. Cell viability was measured in triplicate using MTS assay in 7-point escalating drug concentrations.

B. Immunoblot of whole cell lysates from parental MOLM13 and MOLM13 cells resistant to crenolanib and sorafenib treated with DMSO or FLT3 inhibitors at 20 nM concentration for 4 hours performed with indicated antibodies. C. Dose response curves of trametinib and PP242 on parental and FLT3 inhibitor resistant MOLM13 cells.

Figure 4. Evaluation of MTOR and MEK inhibitor sensitivities in combination with FLT3 inhibitors.

A. FLT3i-resistant MOLM13 cell lines described in Fig 3A tested for sensitivity to sorafenib, trametinib and PP242. 72 hour drug sensitivity assays were performed on parental and FLT3 inhibitor resistant MOLM13 cells. Cell viability was measured in triplicate using MTS assay in 7- point escalating drug concentrations. Drug combinations were tested at equimolar concentrations. B. Immunoblot of parental MOLM13 cells treated with the sorafenib, trametinib,

PP4242 or the combinations at 10 nM for 24 hours performed with the indicated antibodies.

Vinculin immunoreactivity served as a loading control.

Supplementary Table 1: Normalized gene-level CRISPR results with RRA p-values ≤ 0.05, tiers are shown

Gene ID Num neg|score neg|p-value neg|rank neg|lfc pos|score pos|p-value pos|rank pos|goodsgrna pos|lfc Tiers

LZTR1 5 1.00 1.00 17994 3.01 9.2E-07 4.1E-06 1 5 3.01 Tier1

BIRC6 5 1.00 1.00 17992 1.99 1.2E-05 5.1E-05 5 5 1.99 Tier3

TSC2 4 0.97 0.97 17330 3.39 1.2E-05 4.9E-05 4 3 3.39 Tier1

TXNDC9 5 0.51 0.60 10419 3.17 1.1E-05 4.9E-05 3 4 3.17 Tier2

ZNHIT3 6 1.00 1.00 17993 1.96 7.2E-06 4.2E-05 2 6 1.96 Tier3

ABCB1 5 0.00 0.02 324 2.75 1.2E-04 5.4E-04 29 3 2.75 Tier1

ACTL6A 5 0.57 0.63 10949 0.98 1.2E-04 5.4E-04 31 3 0.98 Tier2

AP2S1 7 1.00 1.00 17922 1.76 3.3E-05 2.1E-04 7 6 1.76 Tier3

ATP8A2 5 0.15 0.29 5013 1.61 8.7E-05 4.0E-04 21 3 1.61 Tier2

C1orf52 5 0.95 0.95 17030 2.70 1.0E-04 4.7E-04 24 3 2.70 Tier2

CADM2 5 0.98 0.98 17499 2.81 6.7E-05 3.1E-04 17 4 2.81 Tier2

CDK1 5 1.00 1.00 17982 2.02 1.2E-04 5.3E-04 28 5 2.02 Tier2

CEP63 5 0.68 0.70 12239 2.86 7.0E-05 3.2E-04 18 4 2.86 Tier2

DHX15 5 1.00 1.00 17989 2.63 4.2E-05 2.0E-04 10 5 2.63 Tier1

EBNA1BP2 5 0.95 0.95 16936 2.15 5.7E-05 2.7E-04 11 4 2.15 Tier1

EXOSC8 5 1.00 1.00 17981 1.94 9.8E-05 4.5E-04 23 5 1.94 Tier3

HADH 5 0.22 0.36 6274 -0.34 2.9E-05 1.4E-04 6 2 -0.34 Singleton

HRC 5 1.00 1.00 17984 1.77 1.1E-04 4.8E-04 25 5 1.77 Tier3

LSM5 2 1.00 1.00 17988 3.55 6.7E-05 1.2E-04 16 2 3.55 Tier1

MAK 3 1.00 1.00 17987 2.33 7.6E-05 2.3E-04 19 3 2.33 Tier3

MAT2A 4 1.00 1.00 17991 2.64 5.8E-05 2.3E-04 12 4 2.64 Tier3

NPRL2 5 1.00 1.00 17874 1.96 4.2E-05 2.0E-04 9 4 1.96 Tier3

PIP5K1A 8 1.00 1.00 17986 1.27 7.9E-05 5.5E-04 20 8 1.27 Singleton

PPP1R8 13 0.83 0.92 14798 1.82 3.7E-05 3.3E-04 8 7 1.82 Tier3

PUS7 5 0.08 0.18 3207 2.03 1.1E-04 5.0E-04 27 4 2.03 Tier1

RSL1D1 4 1.00 1.00 17990 2.47 6.2E-05 2.5E-04 14 4 2.47 Tier3

SMARCB1 4 0.98 0.98 17470 2.61 1.3E-04 4.9E-04 32 3 2.61 Tier1

TMEM62 5 0.94 0.94 16783 2.89 5.9E-05 2.7E-04 13 4 2.89 Tier2

TNK2 5 1.00 1.00 17888 2.23 6.7E-05 3.1E-04 15 5 2.23 Tier1

TSC1 5 1.00 1.00 17985 2.12 9.3E-05 4.3E-04 22 5 2.12 Tier3

TTF2 5 1.00 1.00 17983 1.64 1.1E-04 5.0E-04 26 5 1.64 Tier3

ZNF816 3 0.47 0.48 10037 3.65 1.2E-04 3.8E-04 30 2 3.65 Tier2

NDST4 5 0.05 0.12 2278 -1.04 1.4E-04 6.6E-04 35 2 -1.04 Singleton

PIWIL2 5 0.98 0.98 17588 2.01 1.3E-04 6.2E-04 33 4 2.01 Tier3

SEPSECS 5 0.44 0.57 9813 1.01 1.4E-04 6.2E-04 34 3 1.01 Tier2

TAF7 5 0.94 0.94 16713 2.61 1.5E-04 6.7E-04 36 3 2.61 Tier2 TPK1 4 1.00 1.00 17979 1.99 1.8E-04 6.6E-04 40 4 1.99 Tier3

PNPO 5 0.61 0.65 11384 0.70 1.5E-04 6.9E-04 37 3 0.70 Tier2

GMNN 4 0.00 0.01 138 -0.32 2.1E-04 7.7E-04 44 1 -0.32 Unassigned

DUSP18 5 1.00 1.00 17980 2.02 1.7E-04 8.1E-04 38 5 2.02 Tier2

SCAF4 5 0.56 0.62 10865 2.66 1.7E-04 8.1E-04 39 4 2.66 Tier2

TUBE1 5 1.00 1.00 17978 2.23 1.8E-04 8.4E-04 41 5 2.23 Tier2

RPLP0 5 0.93 0.93 16592 0.60 2.0E-04 9.3E-04 42 2 0.60 Singleton

TRIP13 5 0.54 0.62 10741 2.08 2.1E-04 9.4E-04 43 4 2.08 Tier3

GOT1 5 0.18 0.31 5529 2.58 2.2E-04 1.0E-03 46 4 2.58 Tier2

RPL27A 4 1.00 1.00 17976 1.85 2.8E-04 1.0E-03 50 4 1.85 Tier3

ZDHHC24 5 1.00 1.00 17977 1.79 2.1E-04 9.8E-04 45 5 1.79 Tier3

UBTF 4 1.00 1.00 17975 1.78 2.9E-04 1.1E-03 52 4 1.78 Tier3

MANBAL 4 0.49 0.54 10280 1.19 3.0E-04 1.1E-03 53 2 1.19 Tier3

STAM 4 0.99 0.99 17681 2.59 3.1E-04 1.1E-03 54 3 2.59 Tier1

LTA4H 5 0.54 0.62 10716 1.06 2.6E-04 1.2E-03 47 3 1.06 Tier2

TP53BP1 5 0.30 0.44 7767 0.40 2.7E-04 1.2E-03 48 2 0.40 Tier2

TMTC4 5 0.99 0.99 17816 1.88 2.8E-04 1.3E-03 49 4 1.88 Tier3

IMPAD1 4 0.04 0.09 1810 1.77 3.6E-04 1.3E-03 59 2 1.77 Tier2

FAM92A1 5 0.05 0.12 2250 -0.49 3.1E-04 1.4E-03 55 2 -0.49 Tier2

KRT76 5 0.64 0.68 11838 1.95 3.2E-04 1.5E-03 56 3 1.95 Tier3

C6 3 1.00 1.00 17971 2.10 5.1E-04 1.5E-03 68 3 2.10 Tier3

MSL2 5 0.98 0.98 17442 1.83 3.3E-04 1.5E-03 57 4 1.83 Tier3

PNMA6C 1 1.00 1.00 17940 4.57 1.6E-03 1.6E-03 167 1 4.57 Singleton

PRUNE 5 0.94 0.94 16844 1.84 3.4E-04 1.6E-03 58 4 1.84 Tier3

DEFB114 1 1.00 1.00 17938 4.10 1.7E-03 1.6E-03 173 1 4.10 Singleton

UBE2Q2 5 0.44 0.57 9822 1.50 3.8E-04 1.7E-03 62 3 1.50 Tier2

UNK 5 0.98 0.98 17509 2.29 3.8E-04 1.7E-03 61 4 2.29 Tier3

UXS1 5 1.00 1.00 17974 1.57 3.7E-04 1.7E-03 60 5 1.57 Singleton

IMPDH2 4 0.99 0.99 17752 2.44 5.2E-04 1.9E-03 69 4 2.44 Tier1

TEX10 5 0.92 0.92 16375 2.38 4.1E-04 1.9E-03 63 4 2.38 Tier2

C15orf38-AP3S2 1 1.00 1.00 17929 4.55 2.0E-03 1.9E-03 200 1 4.55 Singleton

TMEM150A 5 0.97 0.98 17425 1.32 4.3E-04 2.0E-03 64 3 1.32 Tier3

CETN3 3 1.00 1.00 17969 2.26 7.1E-04 2.1E-03 81 3 2.26 Tier3

FAM127B 2 1.00 1.00 17955 3.07 1.1E-03 2.1E-03 121 2 3.07 Tier1

NDOR1 4 0.98 0.98 17533 2.17 5.8E-04 2.1E-03 73 3 2.17 Tier1

CCDC130 5 1.00 1.00 17972 1.53 4.9E-04 2.2E-03 67 5 1.53 Unassigned

FAM134C 5 1.00 1.00 17973 1.34 4.9E-04 2.2E-03 65 5 1.34 Tier3

TRAPPC3L 3 1.00 1.00 17968 1.90 7.7E-04 2.2E-03 85 3 1.90 Tier3

ZNF37A 5 0.14 0.27 4744 -0.41 4.9E-04 2.2E-03 66 1 -0.41 Singleton GRAMD3 3 1.00 1.00 17965 2.79 8.1E-04 2.4E-03 92 3 2.79 Tier3

COCH 5 0.37 0.51 8918 1.40 5.5E-04 2.5E-03 71 3 1.40 Tier3

PLAGL2 5 0.99 0.99 17829 2.39 5.4E-04 2.5E-03 70 4 2.39 Tier2

RCN1 3 1.00 1.00 17960 2.00 8.5E-04 2.5E-03 101 3 2.00 Tier3

RDX 16 0.20 0.47 5917 0.35 2.9E-04 2.4E-03 51 6 0.35 Tier3

GP5 5 0.83 0.83 14875 0.19 5.7E-04 2.6E-03 72 2 0.19 Tier2

AK6 3 0.92 0.92 16382 1.74 9.9E-04 2.9E-03 108 2 1.74 Tier3

CCL2 5 1.00 1.00 17901 1.78 6.1E-04 2.8E-03 76 5 1.78 Tier3

CLN3 4 1.00 1.00 17966 1.49 8.0E-04 2.9E-03 89 4 1.49 Unassigned

DCX 5 1.00 1.00 17970 1.81 6.3E-04 2.8E-03 78 5 1.81 Tier3

HSPB6 4 1.00 1.00 17967 1.48 7.9E-04 2.8E-03 88 4 1.48 Unassigned

PPIL4 5 0.96 0.96 17044 2.28 6.2E-04 2.8E-03 77 3 2.28 Tier2

PRH2 5 0.97 0.97 17287 2.03 5.8E-04 2.6E-03 74 4 2.03 Tier2

TBC1D7 4 0.26 0.38 6947 2.35 8.0E-04 2.9E-03 90 3 2.35 Tier1

XAB2 5 0.15 0.28 4995 1.70 6.1E-04 2.7E-03 75 4 1.70 Tier2

MAPK12 4 1.00 1.00 17963 1.50 8.4E-04 3.0E-03 96 4 1.50 Unassigned

RPSA 2 1.00 1.00 17942 2.62 1.5E-03 3.0E-03 158 2 2.62 Tier1

SUN2 5 0.81 0.81 14439 2.35 6.6E-04 3.0E-03 79 4 2.35 Tier2

WFDC1 5 0.67 0.69 12143 0.17 6.7E-04 3.0E-03 80 2 0.17 Tier2

AMBRA1 5 0.99 0.99 17813 1.68 8.6E-04 3.8E-03 103 4 1.68 Tier3

AVPR1A 5 1.00 1.00 17964 1.48 8.4E-04 3.8E-03 95 5 1.48 Tier2

C11orf65 4 0.80 0.80 14204 2.13 1.0E-03 3.7E-03 115 3 2.13 Tier1

C19orf40 4 0.42 0.49 9613 1.78 1.0E-03 3.7E-03 114 2 1.78 Tier2

CNOT6 5 0.75 0.76 13405 1.80 7.4E-04 3.3E-03 83 3 1.80 Tier3

COPS8 5 1.00 1.00 17902 1.68 8.4E-04 3.8E-03 97 5 1.68 Tier3

CYFIP1 5 0.83 0.83 14807 1.35 8.6E-04 3.8E-03 104 3 1.35 Tier2

DCBLD1 5 0.90 0.90 16006 1.26 7.2E-04 3.2E-03 82 3 1.26 Singleton

DNAH6 5 1.00 1.00 17961 1.47 8.5E-04 3.8E-03 100 5 1.47 Unassigned

ELMOD2 4 1.00 1.00 17956 1.78 1.1E-03 3.8E-03 120 4 1.78 Tier3

GABRR1 5 0.38 0.52 8942 2.24 8.0E-04 3.6E-03 91 4 2.24 Tier2

LMTK2 5 1.00 1.00 17962 1.46 8.5E-04 3.8E-03 99 5 1.46 Unassigned

NDNL2 5 0.41 0.55 9572 -0.05 8.3E-04 3.7E-03 94 2 -0.05 Tier2

PHKG1 5 0.78 0.78 13931 1.64 8.2E-04 3.7E-03 93 4 1.64 Tier3

TNFRSF14 5 1.00 1.00 17913 2.24 7.6E-04 3.4E-03 84 5 2.24 Tier2

UBQLN4 5 1.00 1.00 17897 1.63 8.5E-04 3.8E-03 98 5 1.63 Tier2

ZNF330 5 0.94 0.94 16798 2.06 8.6E-04 3.8E-03 102 4 2.06 Tier2

ZNF407 5 0.05 0.12 2147 0.49 7.8E-04 3.5E-03 87 2 0.49 Singleton

ZNF572 4 0.91 0.91 16178 1.86 9.3E-04 3.3E-03 105 2 1.86 Tier2

EFR3A 4 1.00 1.00 17954 1.37 1.1E-03 4.0E-03 124 4 1.37 Singleton ZNF596 3 0.19 0.29 5745 0.57 1.4E-03 4.1E-03 148 1 0.57 Singleton

BCLAF1 3 1.00 1.00 17944 1.64 1.5E-03 4.2E-03 154 3 1.64 Singleton

MMD 5 0.98 0.98 17552 1.87 9.4E-04 4.2E-03 106 4 1.87 Tier3

NLGN4X 5 0.71 0.72 12747 0.78 9.5E-04 4.2E-03 107 3 0.78 Singleton

BRDT 5 0.47 0.58 10052 2.00 1.0E-03 4.6E-03 113 4 2.00 Tier2

CARS 5 1.00 1.00 17957 1.18 1.1E-03 4.7E-03 119 5 1.18 Tier2

CCDC136 5 0.83 0.83 14741 0.75 1.0E-03 4.5E-03 112 3 0.75 Singleton

CNGA1 4 1.00 1.00 17949 1.77 1.3E-03 4.6E-03 137 4 1.77 Tier3

CNOT3 5 0.99 0.99 17835 1.71 1.1E-03 4.7E-03 118 4 1.71 Tier2

CNST 5 0.96 0.96 17161 0.88 9.9E-04 4.4E-03 109 3 0.88 Tier2

FAM122A 5 1.00 1.00 17959 1.73 1.0E-03 4.6E-03 116 5 1.73 Tier3

GNPNAT1 2 0.96 0.96 17174 2.81 2.2E-03 4.4E-03 217 2 2.81 Singleton

MOXD1 5 0.88 0.88 15601 1.46 1.0E-03 4.4E-03 110 4 1.46 Tier2

NEURL1 5 1.00 1.00 17904 1.54 1.0E-03 4.5E-03 111 5 1.54 Tier3

PITRM1 4 0.98 0.98 17623 2.27 1.3E-03 4.5E-03 134 3 2.27 Tier3

SMC2 5 1.00 1.00 17958 1.72 1.0E-03 4.7E-03 117 5 1.72 Tier2

EXOSC10 5 0.84 0.84 14891 2.14 1.1E-03 4.8E-03 122 4 2.14 Tier2

SCN4B 10 0.13 0.31 4498 0.32 7.7E-04 4.9E-03 86 4 0.32 Tier2

SRPK1 5 0.92 0.92 16300 2.19 1.1E-03 4.9E-03 123 3 2.19 Tier2

TSTD2 5 0.59 0.64 11243 -0.13 1.1E-03 5.0E-03 125 2 -0.13 Tier2

AIFM1 5 1.00 1.00 17952 1.26 1.2E-03 5.4E-03 129 5 1.26 Singleton

ARHGEF38 5 0.99 0.99 17710 1.45 1.2E-03 5.3E-03 126 4 1.45 Tier3

DHODH 5 0.16 0.30 5209 0.55 1.2E-03 5.5E-03 130 2 0.55 Tier2

DNAJC16 4 0.81 0.81 14508 0.37 1.6E-03 5.7E-03 165 1 0.37 Singleton

KLF11 5 1.00 1.00 17951 1.14 1.3E-03 5.6E-03 132 5 1.14 Unassigned

MTIF2 4 0.38 0.47 9054 1.95 1.6E-03 5.6E-03 161 3 1.95 Tier3

PDE4D 4 0.05 0.11 2102 1.14 1.6E-03 5.6E-03 160 2 1.14 Tier2

PICALM 4 1.00 1.00 17941 1.33 1.6E-03 5.6E-03 162 4 1.33 Singleton

PPAN 5 1.00 1.00 17953 1.17 1.2E-03 5.3E-03 127 5 1.17 Tier3

STAG2 5 0.83 0.84 14877 2.23 1.2E-03 5.3E-03 128 3 2.23 Tier2

TARDBP 3 0.89 0.89 15773 2.68 2.0E-03 5.7E-03 202 2 2.68 Tier2

TMC4 5 1.00 1.00 17896 1.91 1.3E-03 5.6E-03 131 5 1.91 Tier3

TMEM168 3 0.14 0.22 4626 2.10 2.0E-03 5.6E-03 199 2 2.10 Tier2

ZNF589 5 0.94 0.94 16778 1.67 1.3E-03 5.6E-03 133 4 1.67 Tier3

AQP3 5 0.81 0.81 14489 0.44 1.3E-03 5.8E-03 135 2 0.44 Singleton

RPS4X 3 0.99 0.99 17790 1.26 2.0E-03 5.8E-03 205 3 1.26 Singleton

TMED8 5 1.00 1.00 17950 1.01 1.3E-03 5.8E-03 136 5 1.01 Tier3

CLC 5 0.13 0.26 4483 0.97 1.4E-03 6.0E-03 142 3 0.97 Tier2

DRAP1 5 1.00 1.00 17948 1.60 1.3E-03 6.0E-03 140 5 1.60 Tier3 KANSL2 5 0.15 0.28 4950 0.53 1.4E-03 6.0E-03 143 2 0.53 Singleton

NANOGNB 4 0.90 0.90 15957 0.88 1.6E-03 5.8E-03 170 2 0.88 Singleton

SLC25A21 5 1.00 1.00 17947 1.05 1.3E-03 6.0E-03 141 5 1.05 Tier3

TRAPPC8 5 0.89 0.89 15794 2.21 1.3E-03 5.9E-03 138 3 2.21 Tier2

PIK3C2G 5 0.16 0.29 5132 0.72 1.4E-03 6.1E-03 144 3 0.72 Tier2

PGBD1 4 0.26 0.38 6916 0.07 1.7E-03 6.2E-03 178 2 0.07 Singleton

ATCAY 5 1.00 1.00 17946 1.12 1.4E-03 6.2E-03 146 5 1.12 Unassigned

MYRF 5 0.72 0.73 12818 1.65 1.5E-03 6.5E-03 153 4 1.65 Tier3

SMARCC1 5 1.00 1.00 17945 1.19 1.5E-03 6.5E-03 152 5 1.19 Unassigned

SNRPD3 5 0.99 0.99 17782 1.79 1.5E-03 6.4E-03 150 3 1.79 Tier3

TMEM246 5 0.81 0.81 14332 1.52 1.5E-03 6.4E-03 151 4 1.52 Tier3

AARS2 5 1.00 1.00 17943 1.37 1.5E-03 6.7E-03 155 5 1.37 Tier3

DEFB123 3 0.37 0.41 8924 2.61 2.4E-03 6.8E-03 230 2 2.61 Tier2

EIF4E 3 1.00 1.00 17924 2.11 2.3E-03 6.6E-03 227 3 2.11 Tier2

GRB2 5 0.09 0.20 3588 0.75 1.5E-03 6.7E-03 157 4 0.75 Singleton

RIOK1 4 0.25 0.38 6858 0.55 1.9E-03 6.7E-03 191 2 0.55 Tier3

ZNF675 4 0.81 0.81 14326 1.92 1.9E-03 6.7E-03 193 3 1.92 Tier3

CLRN1 7 0.92 0.92 16378 1.76 1.3E-03 6.9E-03 139 6 1.76 Tier3

CXorf56 7 0.98 0.98 17615 0.59 1.4E-03 7.3E-03 147 3 0.59 Tier2

FASTKD2 5 1.00 1.00 17939 1.65 1.6E-03 7.2E-03 171 5 1.65 Tier3

MRPL32 5 0.96 0.96 17055 1.69 1.6E-03 7.2E-03 169 4 1.69 Tier2

MRPL51 5 0.77 0.77 13659 2.13 1.6E-03 7.0E-03 163 4 2.13 Tier2

MRPS10 5 0.11 0.23 4032 2.15 1.7E-03 7.3E-03 172 3 2.15 Tier2

NR2C1 4 1.00 1.00 17930 2.31 2.0E-03 7.0E-03 197 4 2.31 Tier3

RAB20 5 0.92 0.93 16466 1.32 1.7E-03 7.3E-03 174 3 1.32 Tier2

SF3B14 5 1.00 1.00 17937 1.49 1.7E-03 7.3E-03 175 5 1.49 Tier2

TMEM11 5 0.73 0.74 13000 1.48 1.6E-03 7.0E-03 164 4 1.48 Tier2

U2AF1L4 5 0.95 0.95 17016 0.48 1.6E-03 7.1E-03 168 2 0.48 Tier2

ZNF345 3 0.32 0.37 8084 0.12 2.5E-03 7.1E-03 236 1 0.12 Singleton

ZNF552 4 0.41 0.49 9543 1.25 2.0E-03 7.3E-03 207 2 1.25 Tier2

ABHD13 4 0.01 0.02 584 -0.22 2.2E-03 7.8E-03 215 2 -0.22 Tier2

C1orf131 5 0.96 0.96 17096 2.10 1.9E-03 8.1E-03 188 3 2.10 Tier2

C5orf15 3 0.50 0.51 10327 -0.19 2.9E-03 8.1E-03 264 1 -0.19 Singleton

CCDC90B 7 0.94 0.94 16790 1.52 1.4E-03 7.4E-03 149 6 1.52 Tier3

CDC42EP4 5 0.68 0.70 12351 2.05 1.7E-03 7.5E-03 177 4 2.05 Tier2

CFHR4 6 0.72 0.75 12812 1.48 1.6E-03 8.0E-03 166 4 1.48 Tier3

COPS7A 5 1.00 1.00 17934 1.48 1.8E-03 7.9E-03 183 5 1.48 Unassigned

CREB5 5 1.00 1.00 17933 1.20 1.8E-03 7.9E-03 184 5 1.20 Singleton

DENND1A 5 0.17 0.31 5405 1.05 1.9E-03 8.1E-03 190 4 1.05 Tier2 DZIP3 5 0.06 0.14 2576 1.15 1.9E-03 8.1E-03 189 3 1.15 Tier2

ERCC8 5 1.00 1.00 17932 1.15 1.8E-03 8.0E-03 186 5 1.15 Unassigned

MYL3 5 1.00 1.00 17931 1.06 1.8E-03 8.1E-03 187 5 1.06 Singleton

NT5M 5 1.00 1.00 17935 1.04 1.8E-03 7.8E-03 182 5 1.04 Unassigned

PFN1 5 0.48 0.58 10122 1.99 1.8E-03 8.0E-03 185 3 1.99 Tier3

RAB4A 5 1.00 1.00 17936 0.98 1.7E-03 7.5E-03 176 5 0.98 Unassigned

RPUSD4 5 0.86 0.86 15260 2.04 1.8E-03 7.6E-03 179 3 2.04 Tier2

SKAP2 1 0.99 0.99 17796 3.55 7.9E-03 7.9E-03 583 1 3.55 Singleton

SLC7A5 5 0.49 0.59 10211 1.80 1.8E-03 7.7E-03 181 4 1.80 Tier3

VPS36 5 0.36 0.50 8693 1.42 1.8E-03 7.7E-03 180 4 1.42 Singleton

WDR70 4 0.54 0.57 10725 0.83 2.3E-03 8.1E-03 221 3 0.83 Singleton

MYB 5 0.27 0.41 7179 1.79 1.9E-03 8.2E-03 192 3 1.79 Tier3

CDH23 10 0.94 0.94 16725 1.13 1.4E-03 8.4E-03 145 8 1.13 Unassigned

TMEM64 5 0.90 0.90 15929 0.31 1.9E-03 8.4E-03 196 2 0.31 Singleton

BRCA2 5 0.99 0.99 17777 2.05 2.1E-03 9.0E-03 211 4 2.05 Tier2

C4BPB 4 0.81 0.81 14356 2.18 2.4E-03 8.5E-03 229 3 2.18 Tier2

CDCA7 5 1.00 1.00 17928 1.20 2.0E-03 8.8E-03 203 5 1.20 Unassigned

GEMIN5 5 1.00 1.00 17919 1.80 2.1E-03 8.9E-03 209 5 1.80 Tier3

IFNGR2 5 0.77 0.77 13758 1.77 2.1E-03 8.9E-03 208 4 1.77 Tier2

KLHL41 5 0.14 0.27 4782 2.08 2.1E-03 9.0E-03 210 3 2.08 Tier2

RGPD2 1 0.99 0.99 17779 3.43 8.8E-03 8.8E-03 631 1 3.43 Singleton

TAF2 4 0.74 0.74 13115 1.88 2.4E-03 8.6E-03 231 3 1.88 Tier2

TFIP11 5 1.00 1.00 17915 2.07 2.0E-03 8.6E-03 201 5 2.07 Tier2

TMEM198 5 0.81 0.81 14324 2.04 2.0E-03 8.8E-03 204 3 2.04 Tier2

TUBD1 9 0.23 0.44 6387 0.28 1.5E-03 8.9E-03 156 4 0.28 Tier2

WDR89 5 0.68 0.70 12275 2.01 2.0E-03 8.9E-03 206 3 2.01 Tier2

YARS 4 0.50 0.55 10398 2.25 2.5E-03 8.7E-03 233 3 2.25 Tier3

ATP6AP2 4 0.94 0.94 16801 1.21 2.6E-03 9.1E-03 239 2 1.21 Tier3

RAB14 4 1.00 1.00 17878 1.72 2.6E-03 9.2E-03 243 4 1.72 Tier2

RBFOX1 5 1.00 1.00 17927 1.34 2.1E-03 9.3E-03 212 5 1.34 Tier3

ESAM 5 0.89 0.89 15901 1.57 2.2E-03 9.4E-03 213 4 1.57 Singleton

FBXW8 5 0.83 0.83 14709 2.04 2.2E-03 9.4E-03 214 3 2.04 Tier2

GTPBP4 4 0.71 0.71 12718 1.97 2.7E-03 9.5E-03 248 3 1.97 Tier2

PRAMEF11 1 0.99 0.99 17761 3.43 9.6E-03 9.5E-03 669 1 3.43 Singleton

HMGA2 4 0.18 0.29 5545 0.49 2.8E-03 9.7E-03 251 2 0.49 Singleton

RXRB 5 0.24 0.38 6620 -0.04 2.2E-03 9.7E-03 216 2 -0.04 Tier2

TRA2B 7 0.16 0.32 5083 1.03 1.9E-03 9.6E-03 195 4 1.03 Tier2

EXOSC6 5 0.57 0.63 10978 1.51 2.3E-03 9.8E-03 219 4 1.51 Unassigned

PSMB2 5 0.98 0.98 17579 2.08 2.2E-03 9.8E-03 218 4 2.08 Tier2 ECSIT 12 0.72 0.86 12942 0.92 1.5E-03 1.0E-02 159 9 0.92 Tier3

KAL1 4 1.00 1.00 17916 1.17 2.8E-03 9.9E-03 261 4 1.17 Unassigned

LATS1 5 0.27 0.40 7099 -0.38 2.3E-03 9.9E-03 220 1 -0.38 Singleton

NOP16 5 0.58 0.64 11108 2.04 2.3E-03 1.0E-02 223 4 2.04 Tier2

SNRNP25 5 0.63 0.67 11695 1.47 2.3E-03 1.0E-02 222 4 1.47 Tier2

DNASE1 5 0.69 0.71 12417 0.33 2.3E-03 1.0E-02 226 2 0.33 Tier2

GNB1L 5 1.00 1.00 17926 1.49 2.3E-03 1.0E-02 224 5 1.49 Unassigned

TMEM160 5 1.00 1.00 17925 1.20 2.3E-03 1.0E-02 225 5 1.20 Unassigned

HMHA1 5 0.99 0.99 17747 1.62 2.4E-03 1.0E-02 228 4 1.62 Tier2

AFAP1L1 4 0.69 0.69 12387 1.79 3.0E-03 1.0E-02 269 3 1.79 Tier3

ARL2BP 4 1.00 1.00 17911 1.63 3.0E-03 1.1E-02 270 4 1.63 Tier2

EXOC6 5 1.00 1.00 17923 1.10 2.4E-03 1.1E-02 232 5 1.10 Unassigned

INTS6 8 0.00 0.00 27 -1.75 1.9E-03 1.1E-02 194 3 -1.75 Tier3

EIF3F 4 1.00 1.00 17909 1.55 3.1E-03 1.1E-02 274 4 1.55 Tier3

GPI 5 0.97 0.98 17426 1.96 2.5E-03 1.1E-02 234 3 1.96 Tier3

CCDC84 4 0.11 0.21 4089 -0.88 3.1E-03 1.1E-02 275 1 -0.88 Singleton

TAZ 5 0.31 0.45 7898 1.35 2.5E-03 1.1E-02 235 3 1.35 Tier2

VPS33A 5 1.00 1.00 17921 1.72 2.5E-03 1.1E-02 237 5 1.72 Tier3

ALDH1L1 5 0.92 0.92 16359 0.67 2.6E-03 1.1E-02 240 2 0.67 Singleton

MED30 5 0.28 0.41 7235 1.44 2.6E-03 1.1E-02 241 4 1.44 Tier3

STX4 4 0.08 0.16 3126 0.58 3.1E-03 1.1E-02 281 2 0.58 Tier2

ACOT9 3 0.98 0.98 17624 2.39 4.3E-03 1.2E-02 353 3 2.39 Tier2

C5orf51 4 0.13 0.23 4568 0.57 3.4E-03 1.2E-02 300 2 0.57 Singleton

CDX4 5 0.99 0.99 17853 1.99 2.7E-03 1.2E-02 247 4 1.99 Tier3

CNIH3 5 0.60 0.65 11274 0.10 2.6E-03 1.1E-02 244 2 0.10 Singleton

COPG1 5 0.99 0.99 17792 1.74 2.8E-03 1.2E-02 257 4 1.74 Tier3

CXCR3 5 0.77 0.77 13630 1.96 2.8E-03 1.2E-02 252 4 1.96 Tier3

DROSHA 5 0.98 0.98 17459 1.60 2.6E-03 1.1E-02 242 4 1.60 Tier3

GNB5 5 0.98 0.98 17441 1.52 2.8E-03 1.2E-02 260 4 1.52 Tier2

METTL23 6 0.03 0.10 1725 -0.76 2.5E-03 1.2E-02 238 1 -0.76 Singleton

MORC1 5 1.00 1.00 17917 1.40 2.8E-03 1.2E-02 259 5 1.40 Tier2

NPHP3 4 0.92 0.92 16402 1.31 3.2E-03 1.1E-02 290 3 1.31 Singleton

NUDCD3 5 1.00 1.00 17918 1.42 2.8E-03 1.2E-02 258 5 1.42 Tier2

PDCD4 5 0.48 0.58 10144 -0.13 2.7E-03 1.2E-02 246 2 -0.13 Tier2

RHOD 5 1.00 1.00 17920 1.34 2.7E-03 1.2E-02 245 5 1.34 Singleton

SET 2 0.99 0.99 17839 1.99 6.2E-03 1.2E-02 473 2 1.99 Tier3

SNX18 5 0.96 0.96 17158 0.86 2.8E-03 1.2E-02 256 3 0.86 Singleton

SURF2 5 0.61 0.65 11408 0.63 2.7E-03 1.2E-02 250 2 0.63 Tier2

UBOX5 5 0.91 0.92 16292 1.42 2.8E-03 1.2E-02 255 4 1.42 Tier3 VAV2 5 0.97 0.97 17329 1.62 2.8E-03 1.2E-02 253 4 1.62 Tier3

VPS18 5 0.88 0.88 15600 1.82 2.7E-03 1.2E-02 249 4 1.82 Tier3

CLEC2D 11 0.05 0.15 2080 0.69 2.0E-03 1.2E-02 198 5 0.69 Tier2

ARHGAP39 5 1.00 1.00 17912 1.21 2.9E-03 1.3E-02 268 5 1.21 Unassigned

CDKL3 5 0.85 0.85 15213 0.58 2.9E-03 1.2E-02 263 2 0.58 Tier2

DBI 6 0.93 0.93 16622 1.52 2.8E-03 1.3E-02 254 5 1.52 Tier2

LACRT 5 1.00 1.00 17914 1.17 2.9E-03 1.3E-02 267 5 1.17 Unassigned

PDSS2 4 0.56 0.59 10895 1.48 3.6E-03 1.3E-02 307 2 1.48 Tier2

PRKCE 5 0.94 0.94 16770 1.69 2.9E-03 1.3E-02 266 3 1.69 Tier3

SEC61B 5 0.59 0.64 11231 1.94 2.9E-03 1.2E-02 262 4 1.94 Tier3

WDR25 5 0.89 0.89 15789 1.54 2.9E-03 1.2E-02 265 4 1.54 Tier2

C16orf13 5 1.00 1.00 17906 1.14 3.2E-03 1.4E-02 289 5 1.14 Unassigned

CALY 5 0.92 0.92 16462 1.39 3.2E-03 1.4E-02 286 4 1.39 Unassigned

CDADC1 4 0.43 0.50 9728 1.72 3.8E-03 1.3E-02 317 2 1.72 Tier2

CTC1 5 1.00 1.00 17910 1.24 3.1E-03 1.3E-02 273 5 1.24 Unassigned

DNASE1L3 5 0.37 0.51 8884 1.90 3.2E-03 1.4E-02 288 3 1.90 Tier3

ETV1 5 1.00 1.00 17908 1.26 3.1E-03 1.3E-02 279 5 1.26 Singleton

FAM213B 5 1.00 1.00 17907 1.05 3.2E-03 1.4E-02 285 5 1.05 Unassigned

HIGD1C 5 0.09 0.20 3508 -0.74 3.1E-03 1.3E-02 282 2 -0.74 Singleton

HIST1H2BG 5 0.78 0.78 13838 1.97 3.2E-03 1.4E-02 291 3 1.97 Tier3

KPNA3 4 1.00 1.00 17894 1.38 3.9E-03 1.4E-02 322 4 1.38 Tier3

MAGEA8 5 0.28 0.41 7252 0.77 3.2E-03 1.4E-02 283 3 0.77 Tier2

MAPK8IP3 5 0.46 0.58 9976 1.82 3.1E-03 1.3E-02 280 4 1.82 Tier3

MBD3L3 1 0.99 0.99 17659 3.13 1.4E-02 1.4E-02 894 1 3.13 Singleton

PPIP5K2 5 0.54 0.62 10713 0.09 3.3E-03 1.4E-02 293 2 0.09 Tier2

PSMA7 5 0.96 0.96 17182 1.41 3.2E-03 1.4E-02 292 4 1.41 Singleton

RAB33B 5 0.72 0.73 12894 0.52 3.3E-03 1.4E-02 295 2 0.52 Tier2

RABGGTB 5 0.20 0.34 5939 2.00 3.0E-03 1.3E-02 272 4 2.00 Tier3

SENP1 4 1.00 1.00 17895 1.48 3.9E-03 1.3E-02 320 4 1.48 Unassigned

SHFM1 2 0.95 0.95 16889 2.65 6.8E-03 1.3E-02 510 2 2.65 Singleton

SPIC 4 0.28 0.41 7357 1.84 4.0E-03 1.4E-02 331 3 1.84 Tier3

SPICE1 5 0.15 0.28 4916 0.37 3.0E-03 1.3E-02 271 2 0.37 Singleton

STOML2 5 1.00 1.00 17905 1.35 3.3E-03 1.4E-02 294 5 1.35 Tier3

TARS 4 0.95 0.95 16906 1.63 3.7E-03 1.3E-02 314 2 1.63 Tier2

TM4SF20 5 0.99 0.99 17687 1.35 3.1E-03 1.3E-02 276 4 1.35 Singleton

TMEM121 5 0.88 0.88 15604 1.36 3.1E-03 1.3E-02 278 4 1.36 Tier3

TMEM82 4 0.48 0.53 10169 1.83 4.0E-03 1.4E-02 329 3 1.83 Tier2

RPS16 4 1.00 1.00 17890 1.26 4.0E-03 1.4E-02 333 4 1.26 Unassigned

RALBP1 4 0.07 0.15 2795 1.81 4.0E-03 1.4E-02 334 3 1.81 Tier3 CENPU 4 0.03 0.07 1456 0.26 4.0E-03 1.4E-02 336 2 0.26 Tier2

COX4I1 5 1.00 1.00 17898 1.53 3.4E-03 1.4E-02 296 5 1.53 Singleton

CRIPAK 3 0.99 0.99 17864 1.36 5.2E-03 1.4E-02 412 3 1.36 Unassigned

NNMT 5 0.76 0.76 13507 -0.10 3.4E-03 1.4E-02 298 2 -0.10 Tier2

AUTS2 5 1.00 1.00 17900 0.81 3.5E-03 1.5E-02 304 5 0.81 Unassigned

C10orf11 4 1.00 1.00 17884 1.42 4.2E-03 1.5E-02 349 4 1.42 Tier3

C14orf166 4 1.00 1.00 17883 1.59 4.3E-03 1.5E-02 350 4 1.59 Tier2

CCDC178 5 0.21 0.35 6107 1.99 3.5E-03 1.5E-02 302 3 1.99 Tier3

CCDC62 4 0.32 0.44 8064 0.77 4.3E-03 1.5E-02 351 2 0.77 Singleton

DYNC1LI2 4 0.52 0.55 10488 1.30 4.3E-03 1.5E-02 358 2 1.30 Tier2

GEMIN7 5 0.88 0.88 15683 0.68 3.5E-03 1.5E-02 303 2 0.68 Tier2

GPR75 5 0.10 0.22 3835 1.46 3.6E-03 1.5E-02 306 4 1.46 Tier3

MC5R 4 1.00 1.00 17886 1.31 4.2E-03 1.5E-02 345 4 1.31 Unassigned

MRPS24 5 0.94 0.94 16789 1.71 3.5E-03 1.5E-02 301 4 1.71 Tier2

PPCS 7 0.88 0.88 15589 0.99 3.1E-03 1.5E-02 277 5 0.99 Tier2

SDSL 5 0.79 0.79 13990 0.92 3.6E-03 1.5E-02 305 4 0.92 Tier2

SPRED1 5 1.00 1.00 17903 1.33 3.4E-03 1.5E-02 299 5 1.33 Unassigned

THOC2 4 0.92 0.92 16438 1.50 4.2E-03 1.5E-02 346 3 1.50 Tier3

ZNF83 3 0.99 0.99 17750 2.26 5.4E-03 1.5E-02 423 3 2.26 Tier2

TMPO 4 1.00 1.00 17880 1.18 4.4E-03 1.5E-02 362 4 1.18 Unassigned

HTR7 5 1.00 1.00 17899 1.17 3.6E-03 1.5E-02 309 5 1.17 Unassigned

PLEKHM1 5 0.52 0.60 10509 0.46 3.6E-03 1.5E-02 310 2 0.46 Tier2

NOL9 4 0.98 0.98 17618 1.67 4.5E-03 1.5E-02 366 3 1.67 Tier2

CRYGC 5 0.99 0.99 17837 1.03 3.7E-03 1.6E-02 313 3 1.03 Tier2

FZD10 4 0.27 0.40 7183 1.74 4.5E-03 1.6E-02 372 3 1.74 Tier3

GABARAPL2 5 0.87 0.87 15479 1.98 3.7E-03 1.6E-02 311 4 1.98 Tier3

GTF2H4 4 0.96 0.96 17230 2.07 4.5E-03 1.6E-02 368 3 2.07 Tier2

PSMB3 5 0.23 0.37 6505 1.23 3.7E-03 1.6E-02 312 3 1.23 Tier2

ZNF207 5 0.99 0.99 17669 1.33 3.7E-03 1.6E-02 315 4 1.33 Singleton

ZNF813 4 0.98 0.98 17617 1.48 4.6E-03 1.6E-02 373 3 1.48 Singleton

ABCC9 5 1.00 1.00 17892 1.33 3.9E-03 1.7E-02 325 5 1.33 Tier3

CACNA1S 5 1.00 1.00 17881 1.40 4.0E-03 1.7E-02 332 4 1.40 Tier3

CDK16 5 0.06 0.14 2594 1.93 3.9E-03 1.6E-02 321 3 1.93 Tier3

CENPE 4 0.06 0.15 2693 1.73 4.7E-03 1.6E-02 381 3 1.73 Tier3

CFHR3 4 0.99 0.99 17821 2.01 4.8E-03 1.7E-02 386 4 2.01 Tier2

CLINT1 5 0.12 0.25 4300 -0.13 3.8E-03 1.6E-02 318 2 -0.13 Singleton

DCLRE1B 5 0.85 0.85 15061 1.39 3.9E-03 1.7E-02 326 4 1.39 Tier2

HOOK2 4 1.00 1.00 17873 1.01 4.8E-03 1.7E-02 388 4 1.01 Unassigned

HYOU1 5 1.00 1.00 17891 1.40 4.0E-03 1.7E-02 327 5 1.40 Unassigned KRTAP19-6 3 0.99 0.99 17843 1.88 6.0E-03 1.7E-02 457 3 1.88 Tier3

MOCS2 8 0.33 0.54 8241 0.51 3.2E-03 1.6E-02 287 3 0.51 Tier2

NF1 4 0.99 0.99 17741 1.98 4.6E-03 1.6E-02 379 4 1.98 Tier2

NUP43 4 0.96 0.96 17108 1.78 4.8E-03 1.7E-02 389 3 1.78 Tier3

RAD23B 5 1.00 1.00 17893 1.00 3.9E-03 1.6E-02 324 5 1.00 Singleton

RBM34 5 0.79 0.79 14110 1.60 4.0E-03 1.7E-02 328 3 1.60 Tier3

SEC14L1 5 0.00 0.01 196 -2.53 3.9E-03 1.6E-02 323 1 -2.53 Singleton

SF3B5 5 0.98 0.99 17635 1.70 3.8E-03 1.6E-02 319 4 1.70 Tier3

TADA2B 3 0.81 0.81 14410 0.54 6.0E-03 1.6E-02 454 1 0.54 Singleton

TPI1 9 0.98 0.98 17437 1.07 3.2E-03 1.7E-02 284 5 1.07 Tier2

VPS45 3 0.98 0.98 17589 2.23 6.1E-03 1.7E-02 462 3 2.23 Tier2

AKR1C1 4 0.96 0.96 17143 1.47 5.5E-03 1.9E-02 428 2 1.47 Tier2

ARPP19 5 0.68 0.70 12355 1.28 4.6E-03 1.9E-02 378 4 1.28 Tier2

C5orf22 5 0.19 0.32 5656 0.58 4.4E-03 1.8E-02 363 2 0.58 Singleton

C9orf43 5 0.83 0.83 14716 1.69 4.6E-03 1.9E-02 377 4 1.69 Tier3

C9orf64 5 0.97 0.97 17326 0.57 4.4E-03 1.8E-02 360 1 0.57 Singleton

CCDC110 3 0.57 0.57 10980 1.58 6.4E-03 1.7E-02 483 2 1.58 Singleton

CCNI 5 0.00 0.01 174 1.41 4.2E-03 1.7E-02 342 4 1.41 Unassigned

CHMP4C 4 0.12 0.21 4296 -0.27 5.4E-03 1.9E-02 418 2 -0.27 Singleton

CPNE4 4 0.47 0.52 10016 1.67 5.5E-03 1.9E-02 429 3 1.67 Tier3

CPSF7 5 0.82 0.82 14534 1.65 4.7E-03 1.9E-02 382 3 1.65 Tier3

DNMT3A 10 0.13 0.31 4494 1.27 3.4E-03 1.9E-02 297 6 1.27 Tier3

ENTPD8 5 0.26 0.40 7043 1.36 4.3E-03 1.8E-02 359 4 1.36 Unassigned

ERCC1 5 0.89 0.89 15786 1.15 4.2E-03 1.8E-02 348 4 1.15 Singleton

FKBPL 5 0.85 0.85 15066 1.14 4.6E-03 1.9E-02 375 4 1.14 Tier2

GPR65 5 0.72 0.73 12932 1.84 4.3E-03 1.8E-02 357 3 1.84 Tier3

IBA57 5 0.90 0.90 15972 1.86 4.4E-03 1.8E-02 364 4 1.86 Tier3

ITGAM 5 0.24 0.37 6563 0.21 4.6E-03 1.9E-02 374 2 0.21 Tier2

KIF16B 5 1.00 1.00 17889 1.23 4.0E-03 1.7E-02 335 5 1.23 Singleton

NAA25 4 0.99 0.99 17691 1.62 5.1E-03 1.8E-02 409 4 1.62 Singleton

NDUFA1 4 0.23 0.35 6517 0.92 5.0E-03 1.7E-02 396 2 0.92 Tier2

PAGE4 4 0.38 0.47 8947 0.40 5.5E-03 1.9E-02 430 2 0.40 Singleton

PARD6B 3 0.21 0.30 6030 1.24 6.8E-03 1.9E-02 512 2 1.24 Singleton

PEX11A 5 0.38 0.52 8987 1.91 4.3E-03 1.8E-02 354 3 1.91 Tier3

PGK2 5 0.02 0.06 1108 -0.67 4.1E-03 1.7E-02 340 1 -0.67 Singleton

PIGC 4 0.27 0.39 7105 0.94 5.4E-03 1.9E-02 425 2 0.94 Tier2

PIM1 5 0.99 0.99 17767 1.85 4.6E-03 1.9E-02 380 4 1.85 Tier3

PLG 8 0.66 0.78 12012 1.31 3.7E-03 1.9E-02 316 5 1.31 Tier3

POLE2 3 0.99 0.99 17831 1.98 6.4E-03 1.8E-02 489 3 1.98 Tier3 POLR3A 5 0.87 0.87 15501 1.87 4.5E-03 1.9E-02 371 4 1.87 Tier3

PRKRIP1 5 1.00 1.00 17885 1.42 4.2E-03 1.8E-02 347 5 1.42 Tier3

PSMA2 5 0.11 0.23 3992 0.01 4.5E-03 1.9E-02 367 2 0.01 Singleton

PUS3 4 0.99 0.99 17868 1.46 5.1E-03 1.8E-02 404 4 1.46 Unassigned

RAB2B 5 0.45 0.57 9898 1.32 4.1E-03 1.7E-02 341 4 1.32 Tier2

RASSF3 5 0.08 0.18 3206 -0.20 4.4E-03 1.8E-02 365 2 -0.20 Tier2

RBM17 4 0.81 0.81 14449 1.56 5.6E-03 1.9E-02 433 3 1.56 Tier2

RD3 5 0.91 0.91 16264 1.35 4.4E-03 1.8E-02 361 4 1.35 Tier2

RHOG 5 0.19 0.32 5701 0.95 4.5E-03 1.9E-02 369 3 0.95 Tier3

RIOK2 4 0.90 0.90 15944 2.00 5.6E-03 1.9E-02 437 3 2.00 Tier2

ROBO2 5 1.00 1.00 17887 1.22 4.1E-03 1.7E-02 339 5 1.22 Singleton

SLC41A1 5 0.22 0.36 6314 1.30 4.3E-03 1.8E-02 355 4 1.30 Unassigned

SPCS2 4 0.38 0.47 9006 1.26 5.2E-03 1.8E-02 411 2 1.26 Tier2

SPRTN 5 0.90 0.90 15964 1.89 4.1E-03 1.7E-02 338 4 1.89 Tier3

TBCD 5 0.96 0.96 17224 1.83 4.5E-03 1.9E-02 370 3 1.83 Tier3

TCTN3 4 0.97 0.97 17294 1.60 5.1E-03 1.8E-02 408 3 1.60 Tier2

TGM1 4 1.00 1.00 17871 1.50 4.9E-03 1.7E-02 393 4 1.50 Singleton

THAP11 5 0.92 0.92 16338 1.53 4.6E-03 1.9E-02 376 4 1.53 Unassigned

TM6SF1 5 0.68 0.70 12341 -0.04 4.1E-03 1.7E-02 337 2 -0.04 Singleton

TMPRSS15 4 0.12 0.22 4307 1.92 5.3E-03 1.8E-02 416 3 1.92 Tier2

UBFD1 5 0.83 0.84 14878 0.93 4.2E-03 1.8E-02 344 3 0.93 Tier2

USP9Y 4 0.99 0.99 17859 1.07 5.5E-03 1.9E-02 426 4 1.07 Unassigned

ARID2 5 0.28 0.41 7228 1.47 4.7E-03 1.9E-02 384 3 1.47 Tier2

DEPDC5 5 0.99 0.99 17783 1.34 4.7E-03 1.9E-02 383 4 1.34 Tier2

PACRGL 7 0.07 0.19 2962 -0.58 4.2E-03 1.9E-02 343 1 -0.58 Singleton

SMURF2 4 0.99 0.99 17851 1.16 5.7E-03 1.9E-02 442 4 1.16 Singleton

CHRM3 5 0.84 0.84 15013 0.49 4.8E-03 1.9E-02 385 2 0.49 Singleton

NCAPD3 5 0.13 0.26 4563 1.83 4.8E-03 2.0E-02 387 3 1.83 Tier3

SLK 5 0.97 0.97 17311 1.32 4.8E-03 2.0E-02 390 4 1.32 Unassigned

TEN1 5 0.99 0.99 17744 1.82 4.9E-03 2.0E-02 391 4 1.82 Tier3

MMP16 5 0.00 0.01 261 -1.42 4.9E-03 2.0E-02 392 1 -1.42 Singleton

C10orf12 4 0.93 0.93 16579 1.72 6.0E-03 2.0E-02 452 3 1.72 Tier3

CDKAL1 5 0.71 0.72 12759 0.79 4.9E-03 2.0E-02 394 3 0.79 Singleton

GLB1L3 5 0.37 0.51 8805 0.66 5.0E-03 2.0E-02 399 2 0.66 Singleton

GZMB 5 0.14 0.27 4771 1.82 5.1E-03 2.0E-02 402 3 1.82 Tier3

IQCH 9 0.27 0.49 7191 0.87 4.0E-03 2.1E-02 330 7 0.87 Tier3

LRRC49 5 0.24 0.38 6661 1.40 5.1E-03 2.1E-02 405 4 1.40 Singleton

MBL2 5 0.02 0.06 1156 -0.91 5.1E-03 2.0E-02 401 1 -0.91 Unassigned

MCM6 5 0.98 0.98 17614 1.67 4.9E-03 2.0E-02 395 4 1.67 Tier3 PSMD2 5 0.08 0.18 3282 1.42 5.0E-03 2.0E-02 398 4 1.42 Unassigned

PTPN6 5 0.35 0.49 8590 1.34 5.1E-03 2.0E-02 403 4 1.34 Tier3

PUSL1 5 0.22 0.35 6227 0.25 5.1E-03 2.1E-02 407 2 0.25 Singleton

RBM6 5 0.01 0.02 399 1.17 5.0E-03 2.0E-02 397 3 1.17 Unassigned

RPS6KA6 3 0.74 0.74 13111 2.22 7.5E-03 2.0E-02 552 2 2.22 Tier2

ABL1 5 0.64 0.68 11823 0.29 6.1E-03 2.4E-02 464 2 0.29 Singleton

AICDA 5 0.77 0.77 13669 0.62 7.1E-03 2.7E-02 527 2 0.62 Tier2

ALDH1A2 5 0.98 0.98 17522 0.71 7.2E-03 2.7E-02 531 3 0.71 Tier2

ANAPC11 9 0.40 0.62 9407 0.92 4.3E-03 2.2E-02 352 5 0.92 Tier2

ATP6AP1 5 0.89 0.89 15874 1.50 6.3E-03 2.4E-02 481 3 1.50 Singleton

BOLA3 6 0.05 0.14 2295 0.01 5.6E-03 2.3E-02 435 2 0.01 Singleton

C11orf52 4 0.72 0.72 12817 0.06 7.7E-03 2.6E-02 570 1 0.06 Singleton

C12orf5 5 0.67 0.69 12161 1.76 5.8E-03 2.3E-02 448 3 1.76 Tier3

C16orf59 5 0.27 0.40 7107 0.31 5.2E-03 2.1E-02 414 2 0.31 Singleton

C1QTNF6 5 0.99 0.99 17771 1.32 6.2E-03 2.4E-02 469 4 1.32 Unassigned

C4orf26 4 0.61 0.62 11447 1.66 6.5E-03 2.2E-02 491 3 1.66 Singleton

C5orf63 5 0.29 0.43 7580 0.18 5.6E-03 2.2E-02 440 2 0.18 Singleton

C6orf163 4 0.55 0.58 10797 0.96 7.2E-03 2.5E-02 535 2 0.96 Tier3

C6orf201 5 0.13 0.26 4519 0.30 5.7E-03 2.3E-02 445 2 0.30 Tier2

C6orf62 5 0.01 0.04 769 -1.48 7.2E-03 2.7E-02 530 2 -1.48 Tier2

CAPG 5 0.99 0.99 17763 1.52 5.6E-03 2.2E-02 439 4 1.52 Singleton

CBFA2T2 5 0.99 0.99 17705 1.68 6.0E-03 2.3E-02 458 4 1.68 Tier3

CCT8 5 0.99 0.99 17671 0.52 6.9E-03 2.6E-02 514 2 0.52 Tier2

CD164 5 0.89 0.89 15747 1.40 5.4E-03 2.1E-02 421 4 1.40 Unassigned

CDH15 4 0.99 0.99 17826 1.52 6.6E-03 2.2E-02 497 4 1.52 Singleton

CDS2 5 0.17 0.30 5356 0.00 6.5E-03 2.5E-02 492 2 0.00 Tier2

CEACAM19 5 0.99 0.99 17820 1.34 6.9E-03 2.6E-02 516 4 1.34 Tier3

CIRH1A 5 0.04 0.11 2044 1.45 5.8E-03 2.3E-02 446 4 1.45 Tier2

COG2 4 0.20 0.32 5946 1.94 7.1E-03 2.4E-02 528 3 1.94 Tier2

CYP4A11 3 0.91 0.91 16285 2.14 9.5E-03 2.5E-02 662 2 2.14 Tier2

DCDC1 4 0.99 0.99 17824 1.37 6.7E-03 2.3E-02 501 4 1.37 Unassigned

DCLRE1C 5 0.08 0.18 3185 0.04 6.8E-03 2.6E-02 509 2 0.04 Tier2

DDX23 5 0.31 0.44 7778 1.80 6.7E-03 2.5E-02 503 3 1.80 Tier3

DHRS12 5 0.99 0.99 17686 1.39 6.4E-03 2.4E-02 487 4 1.39 Tier2

DPH6 6 0.58 0.68 11113 1.60 6.0E-03 2.5E-02 455 4 1.60 Tier3

DYNC1H1 5 0.66 0.68 11997 1.13 6.8E-03 2.6E-02 506 3 1.13 Tier2

ECHDC1 13 0.15 0.38 5017 1.30 3.6E-03 2.2E-02 308 8 1.30 Tier2

EEF1E1 4 0.99 0.99 17788 1.66 7.7E-03 2.6E-02 571 4 1.66 Tier3

EMC2 4 0.99 0.99 17808 1.50 7.4E-03 2.5E-02 547 4 1.50 Unassigned ENTPD7 5 0.98 0.98 17583 1.82 7.0E-03 2.6E-02 521 4 1.82 Tier3

EXOC5 5 0.19 0.32 5720 0.83 7.1E-03 2.7E-02 526 4 0.83 Singleton

FABP4 5 0.96 0.96 17212 1.76 5.5E-03 2.2E-02 431 4 1.76 Tier2

FANCC 4 0.96 0.96 17099 1.93 7.6E-03 2.6E-02 560 3 1.93 Tier2

GAPDH 5 0.99 0.99 17685 0.69 6.9E-03 2.6E-02 515 2 0.69 Tier2

GPR116 5 0.19 0.33 5778 0.81 6.2E-03 2.4E-02 468 3 0.81 Tier2

GPX2 5 0.99 0.99 17799 1.51 5.6E-03 2.2E-02 436 4 1.51 Unassigned

JOSD1 5 0.98 0.98 17516 1.79 6.6E-03 2.5E-02 500 4 1.79 Tier3

KEAP1 5 0.99 0.99 17828 1.46 6.4E-03 2.4E-02 486 4 1.46 Tier3

KLC4 5 0.65 0.68 11955 0.99 5.9E-03 2.3E-02 449 3 0.99 Tier2

KLRF2 3 0.06 0.11 2416 -1.37 9.4E-03 2.5E-02 659 1 -1.37 Singleton

KRTAP19-8 3 0.80 0.80 14284 0.57 8.7E-03 2.4E-02 625 1 0.57 Singleton

KRTAP9-6 2 0.10 0.15 3763 0.48 1.4E-02 2.7E-02 901 1 0.48 Singleton

LMNB1 5 0.87 0.87 15470 1.15 7.1E-03 2.6E-02 524 4 1.15 Tier2

LONP2 5 0.90 0.90 15962 0.83 5.7E-03 2.2E-02 441 3 0.83 Tier2

LRSAM1 5 0.74 0.74 13169 1.61 6.0E-03 2.3E-02 453 4 1.61 Tier3

LYRM4 4 0.99 0.99 17801 1.61 7.7E-03 2.6E-02 572 4 1.61 Tier3

MATN3 5 0.72 0.73 12832 0.72 7.2E-03 2.7E-02 532 3 0.72 Tier2

MMP9 5 0.93 0.93 16485 1.75 6.8E-03 2.6E-02 505 3 1.75 Tier3

MRAS 8 0.21 0.40 6025 1.33 4.3E-03 2.1E-02 356 6 1.33 Tier2

MRPS31 4 0.06 0.13 2447 1.65 6.8E-03 2.3E-02 511 3 1.65 Tier3

MTMR11 5 0.36 0.50 8637 1.69 7.0E-03 2.6E-02 518 3 1.69 Tier3

MTPN 5 0.65 0.68 11849 1.78 5.6E-03 2.2E-02 438 4 1.78 Tier3

NDRG3 4 0.92 0.92 16403 1.64 8.0E-03 2.7E-02 584 3 1.64 Tier2

NFKB2 5 0.52 0.60 10532 1.28 5.4E-03 2.1E-02 420 4 1.28 Unassigned

NIPA2 4 0.11 0.21 4104 -0.57 6.5E-03 2.2E-02 495 1 -0.57 Singleton

NIPAL4 5 0.96 0.96 17190 1.57 5.5E-03 2.2E-02 427 3 1.57 Tier2

NOP56 5 0.17 0.30 5354 1.84 5.6E-03 2.2E-02 434 4 1.84 Tier3

NRSN2 5 0.99 0.99 17651 1.73 6.8E-03 2.6E-02 513 3 1.73 Tier3

OSBPL10 5 0.48 0.58 10124 1.22 5.9E-03 2.3E-02 450 3 1.22 Singleton

PLCXD2 4 0.76 0.76 13490 1.68 6.2E-03 2.1E-02 472 3 1.68 Tier3

PPAT 5 0.84 0.84 14984 0.97 6.0E-03 2.3E-02 456 3 0.97 Tier2

PPIA 1 0.98 0.98 17514 2.83 2.1E-02 2.1E-02 1252 1 2.83 Singleton

PPP1R12A 4 0.99 0.99 17809 1.57 7.4E-03 2.5E-02 546 4 1.57 Tier2

PSMA6 4 0.96 0.96 17125 1.75 7.9E-03 2.7E-02 579 3 1.75 Tier2

PTGES2 5 0.62 0.66 11567 1.26 5.8E-03 2.3E-02 447 3 1.26 Singleton

RACGAP1 5 0.37 0.51 8846 1.69 6.2E-03 2.4E-02 470 3 1.69 Singleton

RAD51 5 0.37 0.51 8903 1.35 5.4E-03 2.1E-02 422 3 1.35 Tier2

RAD51B 4 0.97 0.97 17352 1.56 7.4E-03 2.5E-02 545 3 1.56 Unassigned RASSF6 4 0.98 0.98 17463 1.52 6.5E-03 2.2E-02 496 2 1.52 Tier2

RNASEH2B 4 0.89 0.89 15828 1.49 7.9E-03 2.7E-02 581 2 1.49 Tier2

RNF111 5 0.94 0.94 16759 1.42 5.4E-03 2.1E-02 417 4 1.42 Tier2

RNF4 5 0.95 0.95 16930 1.28 6.3E-03 2.4E-02 478 4 1.28 Tier2

RNF8 5 0.88 0.88 15716 0.80 6.3E-03 2.4E-02 479 3 0.80 Tier2

RPL14 5 0.87 0.87 15496 1.25 7.0E-03 2.6E-02 520 4 1.25 Singleton

RPL3L 5 0.95 0.95 17035 0.51 6.4E-03 2.4E-02 485 2 0.51 Singleton

RPL4 2 0.99 0.99 17704 1.78 1.2E-02 2.3E-02 795 2 1.78 Unassigned

RPS27L 4 0.40 0.48 9349 1.98 6.4E-03 2.2E-02 488 3 1.98 Tier2

RRP1 4 0.86 0.86 15272 1.39 7.0E-03 2.4E-02 519 2 1.39 Tier2

SCYL1 5 0.24 0.38 6684 1.27 5.7E-03 2.2E-02 443 4 1.27 Unassigned

SERP2 4 0.05 0.12 2266 -0.09 6.2E-03 2.1E-02 466 2 -0.09 Singleton

SESTD1 5 0.70 0.71 12502 0.36 6.3E-03 2.4E-02 477 2 0.36 Tier2

SETD2 5 0.06 0.14 2557 -0.43 7.1E-03 2.6E-02 525 1 -0.43 Singleton

SH3BGRL 5 0.97 0.97 17416 1.89 5.2E-03 2.1E-02 413 3 1.89 Tier3

SH3GL1 6 0.99 0.99 17641 1.27 5.0E-03 2.1E-02 400 5 1.27 Singleton

SHOX 5 0.08 0.18 3196 -0.80 6.3E-03 2.4E-02 476 2 -0.80 Singleton

SLC25A29 5 0.99 0.99 17785 1.32 6.3E-03 2.4E-02 475 4 1.32 Singleton

SLC35G2 4 0.99 0.99 17814 1.29 7.0E-03 2.4E-02 522 4 1.29 Singleton

SLC52A3 5 0.19 0.32 5627 0.48 6.1E-03 2.4E-02 461 2 0.48 Tier2

SLMO2 4 0.99 0.99 17728 1.05 7.5E-03 2.5E-02 558 4 1.05 Singleton

SNRPA 5 0.94 0.94 16760 1.20 7.1E-03 2.6E-02 523 4 1.20 Singleton

SNX31 4 0.99 0.99 17797 1.06 7.9E-03 2.7E-02 577 4 1.06 Singleton

SRRM1 5 0.05 0.11 2117 1.30 7.2E-03 2.7E-02 534 4 1.30 Singleton

SSR4 5 0.40 0.54 9293 1.21 6.4E-03 2.4E-02 484 4 1.21 Unassigned

ST3GAL4 5 0.65 0.68 11948 1.60 6.5E-03 2.5E-02 494 4 1.60 Singleton

SULT1C4 5 0.10 0.22 3817 1.78 6.2E-03 2.4E-02 465 3 1.78 Tier3

TAAR6 5 0.14 0.27 4725 0.96 6.1E-03 2.3E-02 460 3 0.96 Tier3

TAF3 4 0.82 0.82 14548 1.56 6.7E-03 2.3E-02 504 3 1.56 Singleton

TIA1 5 0.80 0.80 14254 1.41 5.4E-03 2.1E-02 419 4 1.41 Singleton

TIPIN 5 0.07 0.16 2946 1.62 6.1E-03 2.4E-02 463 4 1.62 Tier2

TMEM249 4 0.96 0.96 17235 1.83 6.3E-03 2.2E-02 480 3 1.83 Tier2

TMIGD2 5 0.84 0.84 14917 1.47 5.9E-03 2.3E-02 451 4 1.47 Tier3

TMOD2 5 0.74 0.75 13259 1.33 5.5E-03 2.2E-02 432 4 1.33 Tier2

TMX1 4 0.99 0.99 17838 1.11 6.2E-03 2.1E-02 474 4 1.11 Unassigned

TOP1 4 0.79 0.79 14050 0.65 7.3E-03 2.5E-02 537 2 0.65 Singleton

TPP2 4 0.29 0.42 7551 1.45 7.8E-03 2.6E-02 576 2 1.45 Tier2

TRDMT1 5 0.88 0.88 15628 1.09 6.2E-03 2.4E-02 467 3 1.09 Tier2

TRPV3 5 0.88 0.88 15717 1.28 6.5E-03 2.5E-02 493 4 1.28 Unassigned TTC27 5 0.96 0.96 17242 1.80 5.4E-03 2.2E-02 424 4 1.80 Tier3

TWISTNB 5 0.82 0.82 14641 0.47 6.8E-03 2.6E-02 508 2 0.47 Singleton

UBE2E2 5 0.85 0.86 15223 1.13 6.7E-03 2.5E-02 502 3 1.13 Tier3

UBE2I 5 0.99 0.99 17860 1.79 7.2E-03 2.7E-02 533 4 1.79 Tier3

UBE2L3 6 0.99 0.99 17806 1.06 5.1E-03 2.1E-02 406 5 1.06 Singleton

USP27X 4 0.99 0.99 17803 0.95 7.7E-03 2.6E-02 564 4 0.95 Singleton

VPS13A 3 0.99 0.99 17753 1.37 9.8E-03 2.6E-02 677 3 1.37 Unassigned

VPS37B 5 0.95 0.95 17007 1.21 6.1E-03 2.3E-02 459 4 1.21 Tier3

WNT5A 5 0.13 0.26 4428 -0.63 6.6E-03 2.5E-02 499 1 -0.63 Singleton

ZBTB21 5 0.48 0.58 10166 0.40 5.7E-03 2.3E-02 444 2 0.40 Tier2

ZMYND11 5 0.96 0.96 17213 1.80 6.6E-03 2.5E-02 498 3 1.80 Tier3

ZNF217 5 0.99 0.99 17768 1.83 6.8E-03 2.6E-02 507 4 1.83 Tier3

ZNF440 5 0.89 0.89 15783 0.61 5.2E-03 2.1E-02 410 2 0.61 Singleton

ZNF492 5 0.12 0.24 4206 0.90 6.4E-03 2.5E-02 490 4 0.90 Singleton

ZNF563 3 0.99 0.99 17764 1.72 9.6E-03 2.6E-02 665 3 1.72 Tier3

ZNF581 4 0.93 0.93 16569 1.80 7.7E-03 2.6E-02 567 3 1.80 Tier2

ZNF701 6 0.99 0.99 17657 1.49 6.4E-03 2.6E-02 482 5 1.49 Tier3

ZNF770 4 0.49 0.54 10288 0.46 7.2E-03 2.4E-02 529 2 0.46 Singleton

HDAC3 5 0.99 0.99 17780 1.38 7.2E-03 2.7E-02 536 3 1.38 Singleton

ABCA6 5 0.32 0.45 7949 1.28 7.5E-03 2.8E-02 553 3 1.28 Singleton

ACTR8 5 0.20 0.34 5952 1.29 7.4E-03 2.7E-02 542 4 1.29 Tier3

ARL8B 5 0.06 0.13 2450 -0.98 7.5E-03 2.8E-02 557 2 -0.98 Tier2

CLTC 5 0.27 0.41 7170 1.26 7.5E-03 2.8E-02 554 3 1.26 Tier2

CPSF3L 5 0.46 0.58 9999 1.27 7.5E-03 2.8E-02 549 4 1.27 Tier3

CRTAC1 5 0.93 0.93 16657 1.20 7.5E-03 2.8E-02 550 4 1.20 Unassigned

EIF2B3 5 0.39 0.53 9172 0.24 7.4E-03 2.7E-02 544 2 0.24 Singleton

FAM19A4 5 0.12 0.24 4193 -0.33 7.3E-03 2.7E-02 539 2 -0.33 Singleton

GABARAPL1 5 0.99 0.99 17683 1.71 7.5E-03 2.8E-02 555 3 1.71 Tier3

GADD45G 5 0.99 0.99 17863 1.34 7.5E-03 2.8E-02 551 4 1.34 Tier3

KIAA0895 5 0.94 0.94 16847 1.42 7.4E-03 2.7E-02 540 3 1.42 Tier2

NPBWR1 5 0.99 0.99 17846 1.29 7.4E-03 2.8E-02 548 4 1.29 Tier2

POT1 5 0.02 0.07 1213 -0.39 7.5E-03 2.8E-02 556 2 -0.39 Tier2

PRMT3 5 0.04 0.11 1985 1.81 7.4E-03 2.7E-02 543 3 1.81 Tier3

SLC35A1 4 0.99 0.99 17789 1.10 8.3E-03 2.8E-02 594 4 1.10 Unassigned

TLCD1 5 0.97 0.97 17375 0.83 7.5E-03 2.8E-02 559 4 0.83 Tier2

ZNHIT6 5 0.08 0.18 3138 0.91 7.4E-03 2.7E-02 541 4 0.91 Tier2

PPP1CB 4 0.72 0.72 12862 0.66 8.3E-03 2.8E-02 595 2 0.66 Singleton

INPPL1 5 0.94 0.94 16746 0.51 7.6E-03 2.8E-02 561 2 0.51 Tier2

KCNIP2 5 0.97 0.97 17413 1.20 7.6E-03 2.8E-02 563 4 1.20 Singleton KIAA1429 5 0.33 0.46 8132 -0.38 7.6E-03 2.8E-02 562 2 -0.38 Singleton

CCDC74B 3 0.99 0.99 17721 1.34 1.1E-02 2.9E-02 724 3 1.34 Unassigned

CLTB 5 0.96 0.96 17245 1.18 7.7E-03 2.8E-02 568 4 1.18 Unassigned

ELP5 5 0.96 0.96 17234 1.71 7.8E-03 2.9E-02 575 4 1.71 Tier3

FAM105A 4 0.16 0.26 5043 1.40 8.5E-03 2.8E-02 604 3 1.40 Singleton

MDN1 5 0.25 0.38 6724 1.24 7.8E-03 2.8E-02 573 4 1.24 Singleton

MTRF1 3 0.23 0.31 6414 1.18 1.1E-02 2.8E-02 717 2 1.18 Singleton

OTX1 5 0.96 0.96 17239 1.20 7.7E-03 2.8E-02 569 4 1.20 Unassigned

PLGLB2 1 0.97 0.97 17373 2.64 2.8E-02 2.8E-02 1579 1 2.64 Singleton

PRAMEF22 2 0.79 0.79 14078 1.89 1.5E-02 2.9E-02 960 1 1.89 Singleton

SLC6A6 5 0.19 0.32 5743 1.08 7.8E-03 2.9E-02 574 3 1.08 Singleton

TDP1 4 0.89 0.89 15880 1.53 8.6E-03 2.9E-02 612 2 1.53 Tier2

TMEM207 5 0.99 0.99 17656 0.53 7.9E-03 2.9E-02 578 1 0.53 Singleton

TMPRSS13 5 0.06 0.14 2553 1.73 7.7E-03 2.8E-02 566 3 1.73 Tier3

FFAR3 5 0.99 0.99 17649 1.57 7.9E-03 2.9E-02 580 4 1.57 Unassigned

ILF2 5 0.03 0.09 1665 0.44 7.9E-03 2.9E-02 582 2 0.44 Singleton

CAMSAP3 5 0.76 0.76 13570 1.73 8.0E-03 2.9E-02 585 4 1.73 Tier3

NCBP2 6 0.75 0.77 13427 1.38 7.3E-03 2.9E-02 538 4 1.38 Tier3

PDILT 5 0.65 0.68 11880 0.23 8.0E-03 2.9E-02 586 2 0.23 Singleton

RAB27A 4 0.99 0.99 17748 1.65 8.7E-03 2.9E-02 620 4 1.65 Tier3

RSRC1 5 0.76 0.76 13547 1.69 8.0E-03 2.9E-02 587 3 1.69 Tier3

GOLGA7 5 0.55 0.62 10770 0.70 8.2E-03 3.0E-02 591 3 0.70 Tier2

POLR3D 5 0.89 0.89 15740 1.70 8.2E-03 3.0E-02 589 3 1.70 Tier3

TMEM50B 5 0.84 0.84 15008 0.72 8.2E-03 3.0E-02 590 3 0.72 Tier2

ZP2 5 0.84 0.84 15046 1.74 8.1E-03 3.0E-02 588 3 1.74 Tier3

NLRC4 5 0.94 0.94 16846 1.64 8.2E-03 3.0E-02 592 4 1.64 Tier3

ABLIM3 5 0.22 0.35 6222 0.73 8.7E-03 3.1E-02 622 3 0.73 Tier2

ABRA 5 0.09 0.19 3454 -0.76 8.3E-03 3.0E-02 600 2 -0.76 Tier3

ABT1 5 0.99 0.99 17866 1.06 8.4E-03 3.0E-02 603 4 1.06 Tier2

ARHGEF9 5 0.08 0.17 3123 -0.11 8.7E-03 3.1E-02 624 2 -0.11 Singleton

ASPHD2 5 0.88 0.88 15665 1.20 8.9E-03 3.2E-02 633 3 1.20 Singleton

ATPAF1 13 0.34 0.60 8348 0.56 5.3E-03 3.0E-02 415 5 0.56 Tier2

C19orf24 5 0.60 0.65 11341 1.15 8.5E-03 3.1E-02 605 4 1.15 Singleton

CCNA2 5 0.75 0.75 13344 1.77 8.9E-03 3.2E-02 635 3 1.77 Tier3

CIAO1 5 0.99 0.99 17867 1.52 8.7E-03 3.1E-02 623 4 1.52 Tier2

DCAKD 5 0.29 0.43 7534 1.73 8.3E-03 3.0E-02 593 4 1.73 Tier3

DCTN2 5 0.61 0.66 11463 0.38 8.7E-03 3.1E-02 618 2 0.38 Singleton

DLGAP2 5 0.76 0.77 13605 1.18 8.6E-03 3.1E-02 614 3 1.18 Tier2

DYNC1I2 5 0.35 0.49 8567 1.61 8.9E-03 3.2E-02 636 3 1.61 Tier2 FAM208A 5 0.45 0.57 9895 1.20 8.6E-03 3.1E-02 610 4 1.20 Singleton

GPHA2 5 0.96 0.96 17087 1.19 8.3E-03 3.0E-02 597 4 1.19 Tier2

KAZALD1 5 0.65 0.68 11896 1.32 8.8E-03 3.2E-02 630 3 1.32 Tier2

KCTD21 5 0.33 0.47 8224 0.66 8.5E-03 3.1E-02 607 2 0.66 Singleton

LEPROTL1 5 0.99 0.99 17769 1.43 8.6E-03 3.1E-02 615 4 1.43 Tier3

MLLT10 7 0.34 0.52 8365 0.16 6.9E-03 3.1E-02 517 2 0.16 Tier2

NAGA 5 0.99 0.99 17653 1.21 8.9E-03 3.2E-02 637 4 1.21 Tier2

NUAK1 5 0.54 0.61 10699 1.69 8.6E-03 3.1E-02 613 3 1.69 Tier3

PRKRIR 5 0.14 0.27 4748 -0.43 8.6E-03 3.1E-02 617 1 -0.43 Singleton

PSG11 2 0.98 0.98 17595 1.57 1.7E-02 3.2E-02 1052 2 1.57 Unassigned

PTPLB 5 0.91 0.91 16234 1.28 8.4E-03 3.0E-02 601 4 1.28 Tier3

RASGEF1B 5 0.34 0.48 8333 1.74 8.9E-03 3.2E-02 634 3 1.74 Tier3

RBM25 5 0.26 0.39 6955 0.46 8.3E-03 3.0E-02 598 2 0.46 Tier2

RNASE3 5 0.34 0.48 8395 -0.09 8.3E-03 3.0E-02 596 2 -0.09 Tier2

RPGRIP1 4 0.99 0.99 17773 1.25 9.0E-03 3.0E-02 640 4 1.25 Unassigned

SLC13A4 5 0.87 0.87 15519 1.68 8.8E-03 3.2E-02 628 3 1.68 Tier3

SLC22A13 5 0.71 0.72 12754 1.73 8.8E-03 3.1E-02 626 3 1.73 Tier3

SNF8 5 0.83 0.83 14767 1.24 8.7E-03 3.1E-02 621 4 1.24 Tier2

SYNDIG1L 5 0.83 0.83 14833 0.66 8.6E-03 3.1E-02 611 2 0.66 Singleton

TCERG1 4 0.89 0.89 15883 1.49 9.4E-03 3.1E-02 655 3 1.49 Tier2

TIPARP 5 0.79 0.79 14024 1.32 8.7E-03 3.1E-02 619 3 1.32 Tier2

TIPRL 2 0.98 0.98 17593 2.38 1.7E-02 3.2E-02 1053 2 2.38 Singleton

TSPAN8 5 0.63 0.66 11612 1.51 8.6E-03 3.1E-02 616 4 1.51 Tier3

UQCRB 5 0.01 0.03 676 1.76 8.4E-03 3.0E-02 602 3 1.76 Tier3

VPS8 5 0.28 0.42 7395 1.72 8.8E-03 3.1E-02 627 3 1.72 Tier3

VWA9 5 0.83 0.83 14846 0.28 8.5E-03 3.1E-02 609 2 0.28 Tier2

XRCC2 5 0.01 0.02 441 -0.38 8.5E-03 3.1E-02 606 2 -0.38 Singleton

ZNF335 5 0.93 0.93 16571 0.88 8.5E-03 3.1E-02 608 3 0.88 Tier2

ZNF653 5 0.92 0.92 16356 1.41 8.8E-03 3.2E-02 629 4 1.41 Tier2

ABCC2 5 0.33 0.47 8177 0.63 9.1E-03 3.2E-02 641 2 0.63 Tier2

ARHGEF40 5 0.94 0.94 16854 0.48 9.3E-03 3.3E-02 652 2 0.48 Tier2

C12orf65 5 0.92 0.92 16445 1.15 9.3E-03 3.3E-02 654 3 1.15 Tier2

C1QTNF5 5 0.99 0.99 17849 1.24 9.3E-03 3.3E-02 653 4 1.24 Unassigned

C21orf33 5 0.93 0.93 16610 1.37 9.0E-03 3.2E-02 638 4 1.37 Singleton

CYP7A1 5 0.99 0.99 17742 1.57 9.4E-03 3.3E-02 657 4 1.57 Unassigned

DNAJA4 4 0.99 0.99 17751 1.48 9.9E-03 3.3E-02 681 4 1.48 Unassigned

FGGY 5 0.03 0.08 1484 -0.30 9.2E-03 3.3E-02 644 2 -0.30 Unassigned

GPR141 5 0.91 0.91 16206 1.30 9.3E-03 3.3E-02 651 4 1.30 Unassigned

MMD2 5 0.95 0.95 16990 1.68 9.2E-03 3.3E-02 646 3 1.68 Tier3 MTX2 4 0.99 0.99 17754 1.37 9.8E-03 3.3E-02 676 4 1.37 Tier3

NMRK2 5 0.03 0.08 1546 -0.34 9.3E-03 3.3E-02 650 2 -0.34 Tier2

P4HA1 5 0.36 0.50 8667 -0.01 9.4E-03 3.3E-02 658 1 -0.01 Singleton

PHOX2A 5 0.98 0.98 17485 1.13 9.4E-03 3.3E-02 656 4 1.13 Unassigned

POTED 4 0.99 0.99 17760 1.04 9.6E-03 3.2E-02 670 4 1.04 Unassigned

PRIMPOL 4 0.02 0.06 1276 0.24 9.6E-03 3.2E-02 667 2 0.24 Unassigned

PXMP2 5 0.93 0.93 16501 0.74 9.3E-03 3.3E-02 649 3 0.74 Singleton

RGS7 4 0.99 0.99 17757 1.28 9.7E-03 3.2E-02 672 4 1.28 Unassigned

S100A7A 2 0.98 0.98 17584 1.75 1.7E-02 3.2E-02 1082 2 1.75 Singleton

SLC8A3 11 0.97 0.97 17264 0.96 6.2E-03 3.3E-02 471 8 0.96 Tier3

SLCO6A1 5 0.65 0.68 11847 1.69 9.2E-03 3.3E-02 648 3 1.69 Tier3

TM2D1 5 0.60 0.65 11261 1.16 9.2E-03 3.3E-02 645 3 1.16 Singleton

TMEM210 5 0.90 0.90 16030 1.64 9.2E-03 3.3E-02 647 4 1.64 Tier3

TMEM212 4 0.17 0.27 5280 1.53 9.7E-03 3.3E-02 675 3 1.53 Unassigned

WIPI1 5 0.98 0.98 17527 1.67 9.1E-03 3.2E-02 643 3 1.67 Tier3

ZNF259 5 0.12 0.24 4178 1.69 9.0E-03 3.2E-02 639 3 1.69 Tier3

MRPS12 5 0.94 0.94 16756 1.52 9.4E-03 3.3E-02 661 4 1.52 Tier2

SMS 5 0.87 0.87 15497 1.71 9.4E-03 3.3E-02 660 3 1.71 Tier2

KIAA1683 5 0.73 0.73 12945 1.26 9.5E-03 3.3E-02 663 4 1.26 Unassigned

GSTA3 4 0.85 0.85 15063 1.09 1.0E-02 3.4E-02 688 2 1.09 Tier2

KRTAP10-10 4 0.99 0.99 17745 1.00 1.0E-02 3.4E-02 685 4 1.00 Unassigned

MRGPRX3 5 0.28 0.42 7328 0.59 9.5E-03 3.4E-02 664 2 0.59 Singleton

PPP4C 5 0.68 0.70 12332 -0.13 9.6E-03 3.4E-02 668 1 -0.13 Singleton

PMVK 5 0.85 0.85 15075 0.78 9.6E-03 3.4E-02 671 3 0.78 Tier2

GRAPL 4 0.93 0.93 16552 1.63 1.0E-02 3.4E-02 694 3 1.63 Tier3

RFK 4 0.42 0.49 9632 1.23 1.0E-02 3.4E-02 693 3 1.23 Singleton

SCGN 5 0.21 0.35 6113 0.18 9.7E-03 3.4E-02 674 2 0.18 Tier2

TCP10L 5 0.95 0.95 16996 1.33 9.7E-03 3.4E-02 673 4 1.33 Tier2

LMBRD1 4 0.41 0.49 9550 0.11 1.0E-02 3.4E-02 697 1 0.11 Singleton

CHMP3 5 0.20 0.33 5866 1.04 9.8E-03 3.5E-02 678 3 1.04 Singleton

NHSL1 5 0.97 0.97 17335 1.24 9.8E-03 3.5E-02 680 3 1.24 Tier2

WDR53 5 0.95 0.95 17017 1.17 9.8E-03 3.5E-02 679 4 1.17 Singleton

HIST2H2BE 1 0.97 0.97 17256 2.40 3.5E-02 3.5E-02 1846 1 2.40 Singleton

CLPSL2 6 0.60 0.69 11323 0.58 8.9E-03 3.5E-02 632 3 0.58 Tier2

FRMD7 5 0.07 0.16 2890 -0.35 1.0E-02 3.5E-02 683 1 -0.35 Singleton

KRTAP4-8 2 0.98 0.98 17556 1.61 1.9E-02 3.5E-02 1138 2 1.61 Unassigned

SMARCD2 5 0.98 0.98 17498 1.16 9.9E-03 3.5E-02 682 4 1.16 Singleton

ALDOC 5 0.83 0.83 14781 0.94 1.0E-02 3.5E-02 687 3 0.94 Tier2

ARL3 5 0.57 0.63 10998 1.33 1.1E-02 3.6E-02 712 3 1.33 Tier2 C19orf18 5 0.13 0.26 4545 1.64 1.0E-02 3.6E-02 709 3 1.64 Tier3

CDC20 5 0.46 0.57 9933 1.70 1.1E-02 3.6E-02 711 3 1.70 Tier3

CDH24 5 0.93 0.93 16558 1.37 1.0E-02 3.6E-02 703 4 1.37 Singleton

CNFN 5 0.89 0.89 15908 1.10 1.0E-02 3.6E-02 691 4 1.10 Unassigned

CYCS 2 0.50 0.50 10355 1.44 1.9E-02 3.6E-02 1162 1 1.44 Singleton

CYP3A43 2 0.98 0.98 17540 1.91 1.9E-02 3.6E-02 1171 2 1.91 Singleton

ERCC3 5 0.63 0.66 11617 1.66 1.0E-02 3.6E-02 701 3 1.66 Tier3

F7 5 0.62 0.66 11553 1.68 1.1E-02 3.7E-02 715 3 1.68 Tier2

FAM43B 5 0.86 0.86 15315 1.66 1.0E-02 3.6E-02 690 3 1.66 Tier2

FGD6 5 0.72 0.73 12903 1.28 1.0E-02 3.6E-02 708 4 1.28 Tier3

GANAB 5 0.99 0.99 17819 1.34 1.0E-02 3.6E-02 705 4 1.34 Unassigned

GRID1 5 0.66 0.68 11974 1.09 1.1E-02 3.7E-02 713 4 1.09 Unassigned

IGDCC4 5 0.21 0.34 6012 1.12 1.0E-02 3.6E-02 700 4 1.12 Unassigned

KLF3 5 0.95 0.95 16975 1.30 1.0E-02 3.5E-02 686 4 1.30 Singleton

KRTAP19-4 3 0.99 0.99 17676 1.13 1.4E-02 3.6E-02 863 3 1.13 Unassigned

LRAT 5 0.28 0.42 7374 -0.23 1.0E-02 3.5E-02 684 2 -0.23 Tier2

NR1D1 5 0.79 0.79 14003 0.61 1.0E-02 3.6E-02 704 2 0.61 Tier2

PALM2 5 0.37 0.51 8888 1.63 1.0E-02 3.6E-02 698 4 1.63 Unassigned

PGS1 5 0.44 0.57 9806 0.75 1.0E-02 3.5E-02 689 3 0.75 Tier3

PKD1L2 5 0.86 0.86 15304 1.21 1.0E-02 3.6E-02 707 4 1.21 Tier2

PRDX6 5 0.31 0.45 7903 0.60 1.0E-02 3.6E-02 695 2 0.60 Singleton

PRPF19 5 0.74 0.74 13159 1.27 1.0E-02 3.6E-02 692 4 1.27 Tier2

RMI1 4 0.22 0.34 6260 1.23 1.1E-02 3.7E-02 736 2 1.23 Tier2

SAFB2 5 0.87 0.87 15431 1.18 1.0E-02 3.6E-02 699 4 1.18 Unassigned

SERPINA1 5 0.41 0.55 9531 0.85 1.0E-02 3.6E-02 702 3 0.85 Tier3

SPAG11A 4 0.99 0.99 17725 1.30 1.1E-02 3.6E-02 720 4 1.30 Singleton

SYCP2L 5 0.99 0.99 17694 1.70 1.0E-02 3.6E-02 710 4 1.70 Tier3

TACR1 5 0.02 0.05 1028 -0.83 1.0E-02 3.6E-02 696 2 -0.83 Unassigned

TMCO2 5 0.17 0.30 5243 -0.44 1.0E-02 3.6E-02 706 1 -0.44 Singleton

TMX3 4 0.84 0.84 15004 0.88 1.1E-02 3.6E-02 733 2 0.88 Tier3

VARS2 4 0.99 0.99 17732 1.46 1.1E-02 3.5E-02 714 4 1.46 Unassigned

B3GALNT1 4 0.69 0.69 12367 1.46 1.1E-02 3.7E-02 739 3 1.46 Unassigned

AARS 5 0.78 0.78 13852 0.15 1.5E-02 4.8E-02 923 2 0.15 Singleton

ABAT 5 0.26 0.40 7009 1.64 1.1E-02 3.8E-02 732 3 1.64 Singleton

ACTR3 4 0.07 0.15 2805 1.69 1.1E-02 3.7E-02 748 3 1.69 Tier2

ACVR2B 5 0.96 0.96 17058 1.47 1.1E-02 3.8E-02 741 4 1.47 Unassigned

ADD3 5 0.91 0.91 16258 1.62 1.2E-02 4.2E-02 806 3 1.62 Tier3

ADPGK 5 0.97 0.97 17390 1.19 1.5E-02 4.8E-02 919 4 1.19 Tier3

AKAP3 4 0.99 0.99 17698 1.06 1.2E-02 4.1E-02 807 4 1.06 Singleton ALG5 4 0.88 0.88 15651 1.64 1.3E-02 4.2E-02 818 3 1.64 Tier2

ALG9 5 0.46 0.58 9991 1.30 1.4E-02 4.6E-02 876 4 1.30 Unassigned

ARF4 3 0.11 0.18 3973 1.90 1.8E-02 4.6E-02 1088 2 1.90 Tier3

ARHGAP44 5 0.97 0.97 17385 1.12 1.3E-02 4.4E-02 845 4 1.12 Singleton

ARL14 4 0.99 0.99 17689 1.20 1.3E-02 4.2E-02 819 4 1.20 Singleton

ARMC6 5 0.43 0.56 9681 1.18 1.2E-02 3.9E-02 764 4 1.18 Tier2

ARRDC3 5 0.47 0.58 10057 1.61 1.2E-02 4.2E-02 804 3 1.61 Tier3

ASB14 5 0.76 0.77 13601 0.33 1.5E-02 4.9E-02 938 2 0.33 Tier2

ATG7 5 0.90 0.90 15968 1.24 1.3E-02 4.3E-02 828 4 1.24 Tier2

ATP10A 5 0.90 0.90 15983 0.99 1.5E-02 4.9E-02 924 3 0.99 Tier2

B4GALT7 5 0.99 0.99 17697 1.03 1.5E-02 4.9E-02 945 4 1.03 Unassigned

BDP1 3 0.98 0.98 17596 1.34 1.7E-02 4.4E-02 1051 3 1.34 Unassigned

BMS1 5 0.12 0.25 4352 0.34 1.2E-02 4.2E-02 798 2 0.34 Singleton

BRPF1 5 0.93 0.93 16496 1.14 1.1E-02 3.7E-02 716 4 1.14 Singleton

C10orf118 5 0.37 0.51 8876 0.73 1.5E-02 5.0E-02 946 2 0.73 Tier3

C11orf31 5 0.56 0.62 10833 0.50 1.3E-02 4.2E-02 814 2 0.50 Singleton

C3orf80 5 0.74 0.75 13245 1.13 1.5E-02 4.9E-02 928 4 1.13 Singleton

C5orf49 4 0.60 0.62 11325 0.14 1.1E-02 3.8E-02 759 1 0.14 Singleton

CAND2 5 0.98 0.98 17627 1.20 1.5E-02 4.9E-02 935 4 1.20 Singleton

CAPZA2 3 0.58 0.58 11060 1.34 1.9E-02 4.8E-02 1121 2 1.34 Singleton

CASP2 6 0.37 0.52 8889 1.07 9.6E-03 3.7E-02 666 3 1.07 Tier3

CCDC150 5 0.96 0.96 17151 0.21 1.1E-02 3.9E-02 756 2 0.21 Tier2

CCDC64 5 0.23 0.36 6418 1.09 1.4E-02 4.7E-02 899 3 1.09 Tier2

CD151 5 0.80 0.80 14301 1.49 1.2E-02 4.1E-02 793 4 1.49 Tier3

CD3G 4 0.67 0.67 12144 1.12 1.5E-02 4.7E-02 940 2 1.12 Tier3

CD46 5 0.78 0.78 13811 0.58 1.3E-02 4.4E-02 835 2 0.58 Tier3

CDH11 5 0.97 0.97 17340 1.18 1.3E-02 4.2E-02 811 4 1.18 Unassigned

CGRRF1 5 0.91 0.91 16136 1.03 1.4E-02 4.7E-02 884 4 1.03 Unassigned

CHP1 5 0.27 0.41 7132 1.09 1.3E-02 4.4E-02 842 4 1.09 Unassigned

CLASRP 5 0.17 0.30 5283 1.17 1.5E-02 4.8E-02 920 4 1.17 Singleton

CMPK1 5 0.99 0.99 17731 1.47 1.1E-02 3.7E-02 726 4 1.47 Tier2

COMMD10 4 0.93 0.93 16649 1.55 1.4E-02 4.5E-02 906 3 1.55 Tier2

COQ10B 5 0.98 0.98 17559 1.21 1.1E-02 3.7E-02 721 4 1.21 Unassigned

CORO6 4 0.78 0.78 13880 1.34 1.5E-02 4.7E-02 933 3 1.34 Singleton

CST8 5 0.99 0.99 17652 1.50 1.4E-02 4.7E-02 900 4 1.50 Tier2

CSTF3 8 0.99 0.99 17869 1.29 1.1E-02 4.7E-02 738 5 1.29 Tier3

CTSZ 5 0.98 0.98 17466 1.56 1.4E-02 4.6E-02 877 3 1.56 Tier3

DBH 5 0.49 0.59 10224 1.60 1.1E-02 3.9E-02 757 3 1.60 Unassigned

DDX6 4 0.92 0.92 16441 1.68 1.4E-02 4.4E-02 875 3 1.68 Tier3 DEFB108B 2 0.94 0.94 16851 2.10 2.7E-02 5.0E-02 1533 2 2.10 Singleton

DENND2C 5 0.57 0.63 10985 1.58 1.5E-02 4.9E-02 927 3 1.58 Tier3

DHRS11 5 0.36 0.50 8755 0.91 1.4E-02 4.6E-02 883 3 0.91 Tier2

DIRAS1 5 0.95 0.95 16896 1.56 1.4E-02 4.8E-02 915 3 1.56 Singleton

DIRAS2 4 0.37 0.46 8781 0.75 1.2E-02 4.0E-02 781 2 0.75 Singleton

DOCK10 4 0.66 0.66 12021 0.13 1.6E-02 5.0E-02 1012 1 0.13 Singleton

DOK1 5 0.34 0.48 8376 0.26 1.4E-02 4.8E-02 914 2 0.26 Singleton

DUSP27 5 0.98 0.98 17515 1.07 1.1E-02 3.9E-02 760 4 1.07 Unassigned

DUSP3 5 0.92 0.92 16448 0.71 1.5E-02 4.9E-02 936 3 0.71 Singleton

ECH1 5 0.78 0.78 13875 1.15 1.4E-02 4.5E-02 868 4 1.15 Unassigned

EEA1 5 0.23 0.36 6380 0.34 1.2E-02 4.1E-02 782 1 0.34 Singleton

EIF2S2 4 0.13 0.22 4433 1.04 1.6E-02 4.9E-02 987 2 1.04 Tier2

EPN1 4 0.05 0.11 2119 -0.35 1.2E-02 4.0E-02 791 2 -0.35 Singleton

ESRP1 5 0.56 0.63 10915 0.96 1.3E-02 4.3E-02 831 3 0.96 Tier2

ETHE1 5 0.93 0.93 16534 1.06 1.2E-02 4.0E-02 765 4 1.06 Singleton

FAM21B 1 0.96 0.96 17149 2.36 4.0E-02 4.0E-02 2061 1 2.36 Singleton

FAM96B 5 0.95 0.95 16948 1.38 1.1E-02 3.9E-02 751 4 1.38 Tier3

FANCA 5 0.17 0.30 5244 1.13 1.1E-02 3.8E-02 737 3 1.13 Tier3

FBXO39 5 0.87 0.87 15434 1.50 1.2E-02 4.0E-02 775 3 1.50 Tier2

FBXO48 5 0.14 0.27 4650 0.38 1.2E-02 4.1E-02 787 2 0.38 Tier2

FBXW4 5 0.55 0.62 10810 1.10 1.2E-02 4.0E-02 769 3 1.10 Singleton

FCER1G 5 0.99 0.99 17856 1.20 1.1E-02 3.8E-02 730 4 1.20 Singleton

FEN1 5 0.68 0.70 12303 1.22 1.3E-02 4.3E-02 820 3 1.22 Tier2

FIP1L1 4 0.38 0.47 9053 0.82 1.6E-02 4.9E-02 1001 2 0.82 Tier2

FRYL 5 0.03 0.08 1562 -0.93 1.2E-02 4.2E-02 802 2 -0.93 Singleton

FTSJ3 5 0.92 0.92 16404 1.55 1.1E-02 3.7E-02 718 4 1.55 Tier2

FZD4 4 0.77 0.77 13638 1.32 1.4E-02 4.6E-02 911 2 1.32 Tier2

GAB2 4 0.25 0.37 6766 1.62 1.1E-02 3.8E-02 753 3 1.62 Tier3

GBAS 4 0.52 0.55 10487 1.18 1.3E-02 4.3E-02 841 2 1.18 Tier2

GCNT3 5 0.22 0.36 6289 0.62 1.3E-02 4.3E-02 833 2 0.62 Tier2

GCOM1 5 0.76 0.76 13505 1.53 1.5E-02 4.9E-02 939 3 1.53 Tier3

GJB5 5 0.28 0.42 7391 1.03 1.5E-02 4.9E-02 925 4 1.03 Singleton

GNB2L1 5 0.25 0.39 6791 1.73 1.1E-02 3.7E-02 719 3 1.73 Tier2

GPR135 5 0.10 0.22 3836 0.41 1.4E-02 4.6E-02 878 2 0.41 Tier2

GPR180 5 0.29 0.43 7600 1.60 1.2E-02 4.2E-02 809 3 1.60 Tier3

GPX7 4 0.99 0.99 17696 1.00 1.3E-02 4.1E-02 813 4 1.00 Unassigned

GSTM3 5 0.03 0.08 1565 -0.82 1.4E-02 4.6E-02 879 2 -0.82 Tier2

GTF2A1L 4 0.91 0.91 16170 0.58 1.3E-02 4.3E-02 836 2 0.58 Singleton

GZMK 5 0.99 0.99 17762 1.44 1.4E-02 4.5E-02 870 4 1.44 Tier3 HBM 5 0.98 0.98 17604 1.15 1.5E-02 4.9E-02 941 4 1.15 Unassigned

HDAC9 5 0.89 0.89 15893 0.94 1.3E-02 4.5E-02 850 3 0.94 Singleton

HEPN1 5 0.01 0.03 580 -0.98 1.4E-02 4.6E-02 872 1 -0.98 Singleton

HIST1H4H 4 0.38 0.47 9079 1.08 1.3E-02 4.3E-02 854 2 1.08 Singleton

HJURP 5 0.17 0.30 5247 1.13 1.5E-02 4.8E-02 917 4 1.13 Singleton

HNRNPA1 4 0.95 0.95 16921 1.64 1.1E-02 3.8E-02 761 3 1.64 Tier3

HPS6 5 0.40 0.54 9416 0.11 1.5E-02 4.8E-02 918 2 0.11 Singleton

HYAL1 15 0.49 0.75 10257 0.70 8.3E-03 4.7E-02 599 8 0.70 Tier3

IGIP 3 0.98 0.98 17612 1.16 1.6E-02 4.2E-02 1003 3 1.16 Unassigned

IKBKAP 5 0.79 0.79 13986 1.61 1.3E-02 4.4E-02 837 4 1.61 Tier2

IL25 5 0.75 0.76 13428 -0.41 1.4E-02 4.7E-02 897 2 -0.41 Tier2

INIP 5 0.14 0.27 4743 0.66 1.4E-02 4.8E-02 913 2 0.66 Singleton

INO80B 5 0.95 0.95 16912 1.65 1.2E-02 4.2E-02 801 4 1.65 Tier3

INVS 4 0.90 0.90 15937 1.80 1.4E-02 4.4E-02 874 3 1.80 Tier2

IPPK 5 0.83 0.83 14849 1.24 1.5E-02 4.9E-02 943 3 1.24 Singleton

JADE3 5 0.87 0.87 15494 1.30 1.3E-02 4.4E-02 834 4 1.30 Tier2

KCNH7 5 0.32 0.46 8001 0.29 1.5E-02 4.9E-02 934 2 0.29 Tier2

KCNK1 5 0.01 0.03 541 1.17 1.4E-02 4.7E-02 886 4 1.17 Unassigned

KNOP1 5 0.85 0.85 15116 0.27 1.2E-02 4.1E-02 790 2 0.27 Singleton

KRIT1 5 0.19 0.32 5648 -0.38 1.1E-02 3.7E-02 727 2 -0.38 Singleton

KRTAP20-1 3 0.98 0.98 17631 1.14 1.5E-02 4.0E-02 950 3 1.14 Unassigned

KRTAP5-1 3 0.98 0.98 17625 1.97 1.5E-02 4.0E-02 954 3 1.97 Tier3

LCE5A 4 0.27 0.39 7052 0.71 1.6E-02 5.0E-02 1013 2 0.71 Tier2

LDB1 5 0.93 0.93 16497 1.62 1.3E-02 4.3E-02 825 3 1.62 Singleton

LDLRAP1 5 0.05 0.12 2196 1.64 1.2E-02 4.1E-02 792 3 1.64 Tier2

LGR5 5 0.91 0.91 16217 0.77 1.3E-02 4.3E-02 823 4 0.77 Tier2

LIN28A 5 0.95 0.95 16983 1.17 1.2E-02 4.1E-02 786 4 1.17 Unassigned

LOH12CR1 4 0.71 0.71 12765 0.79 1.4E-02 4.6E-02 916 2 0.79 Tier2

LRRC16A 5 0.95 0.95 16992 1.71 1.1E-02 3.8E-02 745 3 1.71 Tier3

LRRC6 4 0.77 0.77 13707 1.42 1.6E-02 4.9E-02 998 3 1.42 Unassigned

LSG1 5 0.44 0.57 9794 1.14 1.5E-02 5.0E-02 947 3 1.14 Tier2

LTC4S 5 0.45 0.57 9914 1.58 1.2E-02 4.2E-02 810 3 1.58 Tier3

MAP1LC3A 5 0.83 0.83 14711 1.23 1.1E-02 3.8E-02 729 4 1.23 Tier2

MARS 5 0.23 0.36 6351 1.61 1.2E-02 4.0E-02 770 3 1.61 Tier3

MAU2 5 0.32 0.45 7955 0.92 1.4E-02 4.7E-02 904 3 0.92 Tier2

MBD2 5 0.13 0.27 4607 1.58 1.4E-02 4.7E-02 902 3 1.58 Unassigned

MBNL2 5 0.91 0.91 16133 1.60 1.1E-02 3.8E-02 743 3 1.60 Tier2

MBOAT1 5 0.34 0.48 8424 -0.14 1.3E-02 4.3E-02 816 2 -0.14 Singleton

MCTP1 5 0.97 0.97 17316 1.10 1.2E-02 4.2E-02 794 3 1.10 Tier2 MED23 5 0.03 0.08 1541 -0.24 1.3E-02 4.3E-02 832 2 -0.24 Singleton

MEN1 5 0.78 0.78 13797 1.26 1.2E-02 4.1E-02 779 4 1.26 Tier3

MFAP1 5 0.63 0.67 11706 0.48 1.1E-02 3.8E-02 740 2 0.48 Tier2

MGAT3 5 0.81 0.81 14312 0.61 1.2E-02 4.1E-02 789 2 0.61 Singleton

MIA2 5 0.03 0.08 1442 -1.29 1.5E-02 4.9E-02 932 1 -1.29 Singleton

MPHOSPH8 5 0.05 0.12 2289 0.18 1.1E-02 3.7E-02 723 2 0.18 Singleton

MPP5 5 0.57 0.63 11022 1.67 1.3E-02 4.5E-02 846 3 1.67 Tier3

MRPL1 4 0.13 0.23 4616 1.65 1.6E-02 4.9E-02 991 3 1.65 Tier3

MSRB3 5 0.90 0.90 15976 1.13 1.2E-02 4.0E-02 767 4 1.13 Unassigned

MUM1 5 0.98 0.98 17482 0.50 1.3E-02 4.2E-02 812 1 0.50 Singleton

MYBL2 5 0.76 0.76 13513 1.56 1.4E-02 4.8E-02 912 3 1.56 Tier3

MZF1 5 0.02 0.06 1192 -0.60 1.1E-02 3.9E-02 750 2 -0.60 Unassigned

NAA35 5 0.25 0.38 6728 -0.58 1.1E-02 3.7E-02 722 2 -0.58 Tier2

NAV1 5 0.38 0.52 9076 0.79 1.2E-02 4.1E-02 785 3 0.79 Tier2

NDFIP2 4 0.69 0.69 12457 1.66 1.4E-02 4.5E-02 898 3 1.66 Tier2

NDUFAF4 3 0.82 0.82 14543 1.88 1.6E-02 4.2E-02 1010 2 1.88 Tier3

NEK8 5 0.93 0.93 16520 0.81 1.1E-02 3.8E-02 742 3 0.81 Singleton

NELFE 5 0.70 0.71 12508 0.28 1.5E-02 4.8E-02 921 2 0.28 Singleton

NGLY1 4 0.18 0.29 5530 1.52 1.4E-02 4.5E-02 910 3 1.52 Singleton

NINJ2 5 0.99 0.99 17775 1.61 1.2E-02 4.2E-02 796 3 1.61 Unassigned

NIPBL 5 0.99 0.99 17807 1.39 1.4E-02 4.7E-02 885 4 1.39 Singleton

NMNAT2 5 0.98 0.98 17599 1.26 1.3E-02 4.5E-02 857 4 1.26 Singleton

NRIP3 5 0.96 0.96 17061 1.65 1.2E-02 4.0E-02 776 3 1.65 Tier3

NSUN4 5 0.79 0.79 13993 -0.36 1.4E-02 4.6E-02 880 1 -0.36 Singleton

NT5E 4 0.57 0.59 10984 1.10 1.6E-02 5.0E-02 1011 2 1.10 Singleton

NUP88 4 0.13 0.22 4413 1.40 1.3E-02 4.3E-02 848 3 1.40 Singleton

ORC4 4 0.15 0.25 4918 1.75 1.2E-02 3.9E-02 777 3 1.75 Tier2

PAFAH1B1 4 0.65 0.66 11927 1.41 1.5E-02 4.8E-02 969 3 1.41 Singleton

PBX3 5 0.85 0.85 15139 0.60 1.1E-02 3.9E-02 749 2 0.60 Singleton

PDCD5 4 0.43 0.50 9732 1.68 1.6E-02 4.9E-02 989 3 1.68 Tier2

PDE4B 5 0.18 0.31 5531 0.39 1.3E-02 4.3E-02 821 1 0.39 Singleton

PDRG1 5 0.83 0.83 14779 0.17 1.1E-02 3.8E-02 744 1 0.17 Singleton

PECR 5 0.78 0.78 13869 1.06 1.3E-02 4.5E-02 856 4 1.06 Tier2

PHTF1 4 0.53 0.56 10585 1.46 1.4E-02 4.5E-02 891 3 1.46 Tier2

PHYHIP 5 0.16 0.29 5089 -0.02 1.5E-02 4.9E-02 944 2 -0.02 Tier2

PIAS1 5 0.84 0.84 14971 -0.41 1.4E-02 4.6E-02 882 2 -0.41 Singleton

PIDD 5 0.88 0.88 15711 1.05 1.3E-02 4.4E-02 844 4 1.05 Tier3

PIK3R5 5 0.97 0.97 17263 1.09 1.2E-02 4.1E-02 788 4 1.09 Tier2

PLA2G4A 5 0.99 0.99 17723 1.45 1.1E-02 3.7E-02 725 4 1.45 Tier3 PLCD4 5 0.99 0.99 17734 1.45 1.4E-02 4.7E-02 890 4 1.45 Singleton

POMP 5 0.48 0.58 10161 0.21 1.2E-02 4.0E-02 771 2 0.21 Tier2

PPAN-P2RY11 1 0.95 0.95 17019 2.22 4.7E-02 4.7E-02 2341 1 2.22 Singleton

PPP2R5A 5 0.14 0.27 4736 1.32 1.3E-02 4.3E-02 824 4 1.32 Tier2

PRPF8 5 0.99 0.99 17717 1.04 1.5E-02 5.0E-02 951 4 1.04 Unassigned

PSMA1 4 0.09 0.17 3411 -0.66 1.6E-02 4.8E-02 972 1 -0.66 Singleton

PTPN1 5 0.96 0.96 17226 1.52 1.4E-02 4.7E-02 903 4 1.52 Tier2

RAB1A 5 0.02 0.06 1070 1.60 1.1E-02 3.9E-02 752 3 1.60 Unassigned

RAB22A 4 0.77 0.77 13765 1.33 1.2E-02 4.1E-02 800 2 1.33 Tier2

RAB9B 5 0.12 0.24 4160 0.76 1.3E-02 4.5E-02 858 3 0.76 Singleton

RABL3 4 0.18 0.29 5534 0.56 1.6E-02 4.9E-02 985 2 0.56 Tier2

RAD1 4 0.00 0.00 14 -2.94 1.5E-02 4.7E-02 949 1 -2.94 Unassigned

RAF1 5 0.41 0.55 9495 0.19 1.4E-02 4.7E-02 907 2 0.19 Singleton

RANBP1 5 0.07 0.16 2867 0.12 1.3E-02 4.3E-02 822 2 0.12 Tier2

RANBP3 5 0.23 0.37 6486 1.61 1.4E-02 4.7E-02 896 3 1.61 Tier2

RASA3 5 0.73 0.73 12954 1.56 1.4E-02 4.6E-02 871 3 1.56 Unassigned

RASL11B 5 0.48 0.58 10167 1.62 1.2E-02 4.1E-02 780 4 1.62 Tier3

RBM45 5 0.20 0.34 5927 0.93 1.3E-02 4.4E-02 843 3 0.93 Singleton

RHD 5 0.05 0.13 2391 -0.55 1.4E-02 4.7E-02 892 2 -0.55 Singleton

ROCK1 5 0.78 0.78 13802 1.67 1.3E-02 4.3E-02 829 3 1.67 Tier3

RPH3A 5 0.85 0.85 15059 1.39 1.1E-02 3.8E-02 746 3 1.39 Tier2

RPL32 2 0.13 0.17 4469 0.38 2.6E-02 4.7E-02 1468 1 0.38 Singleton

RPL35A 3 0.03 0.07 1568 -1.82 1.6E-02 4.3E-02 1022 1 -1.82 Singleton

RPS29 2 0.74 0.74 13194 1.70 2.0E-02 3.8E-02 1218 1 1.70 Singleton

RRAGA 5 0.85 0.85 15076 1.58 1.3E-02 4.5E-02 855 3 1.58 Singleton

RRM2 5 0.22 0.35 6158 1.33 1.4E-02 4.5E-02 864 4 1.33 Tier2

SACM1L 5 0.96 0.96 17237 0.56 1.5E-02 5.0E-02 948 2 0.56 Singleton

SARS 5 0.40 0.54 9378 0.66 1.2E-02 4.0E-02 774 2 0.66 Singleton

SDAD1 5 0.00 0.01 125 -1.61 1.3E-02 4.5E-02 851 2 -1.61 Tier3

SERPINB1 5 0.02 0.06 1107 1.56 1.5E-02 4.9E-02 929 4 1.56 Unassigned

SERPINE2 5 0.82 0.82 14680 1.27 1.3E-02 4.3E-02 826 4 1.27 Singleton

SF3A3 4 0.98 0.98 17550 1.56 1.2E-02 4.1E-02 797 3 1.56 Unassigned

SFTPB 5 0.99 0.99 17678 1.27 1.3E-02 4.4E-02 839 4 1.27 Unassigned

SGSM2 5 0.96 0.96 17144 1.09 1.4E-02 4.6E-02 881 4 1.09 Unassigned

SIAH1 4 0.81 0.81 14491 1.18 1.2E-02 4.1E-02 803 2 1.18 Tier2

SIPA1L2 5 0.50 0.60 10366 0.02 1.4E-02 4.7E-02 908 2 0.02 Singleton

SLC16A6 5 0.02 0.06 1054 -1.00 1.3E-02 4.4E-02 838 2 -1.00 Unassigned

SLC25A11 5 0.98 0.98 17505 1.07 1.1E-02 3.8E-02 747 4 1.07 Tier3

SLC35A2 5 0.35 0.49 8456 0.97 1.1E-02 3.9E-02 755 3 0.97 Tier2 SLC35A3 5 0.00 0.02 374 -1.81 1.1E-02 3.9E-02 763 2 -1.81 Singleton

SLC38A2 5 0.99 0.99 17726 1.21 1.1E-02 3.8E-02 735 4 1.21 Tier3

SMARCA1 5 0.35 0.49 8525 0.34 1.4E-02 4.5E-02 865 2 0.34 Singleton

SMCO4 3 0.97 0.97 17297 1.87 1.6E-02 4.3E-02 1014 3 1.87 Tier3

SNX9 4 0.52 0.56 10540 0.51 1.5E-02 4.7E-02 930 2 0.51 Singleton

SPAST 5 0.03 0.08 1435 0.31 1.2E-02 4.0E-02 766 2 0.31 Unassigned

SPATA31A3 1 0.96 0.96 17201 2.35 3.8E-02 3.8E-02 1980 1 2.35 Singleton

SRFBP1 5 0.71 0.72 12733 1.65 1.2E-02 4.1E-02 784 3 1.65 Tier3

SRP19 4 0.99 0.99 17702 1.43 1.2E-02 4.1E-02 799 4 1.43 Tier3

SRP54 4 0.00 0.01 224 -1.28 1.6E-02 4.9E-02 983 2 -1.28 Singleton

SSBP2 4 0.23 0.35 6442 1.24 1.1E-02 3.8E-02 758 2 1.24 Tier2

SSX2 3 0.20 0.30 5949 1.44 1.7E-02 4.4E-02 1047 2 1.44 Tier3

SUB1 4 0.00 0.01 192 -2.54 1.6E-02 4.9E-02 997 1 -2.54 Singleton

SUMO2 2 0.85 0.85 15220 1.94 2.2E-02 4.0E-02 1296 1 1.94 Singleton

SYNGR3 5 0.94 0.94 16838 1.29 1.3E-02 4.5E-02 860 4 1.29 Unassigned

TAAR8 5 0.30 0.44 7673 1.63 1.3E-02 4.5E-02 862 4 1.63 Unassigned

TAGLN2 5 0.92 0.92 16308 0.75 1.4E-02 4.7E-02 895 3 0.75 Tier2

TDGF1 3 0.99 0.99 17660 1.47 1.4E-02 3.7E-02 893 3 1.47 Unassigned

TKT 5 0.93 0.93 16639 1.06 1.4E-02 4.7E-02 889 4 1.06 Unassigned

TMED7-TICAM2 2 0.97 0.97 17396 1.45 2.7E-02 4.9E-02 1513 2 1.45 Unassigned

TMEM109 5 0.65 0.68 11966 1.21 1.2E-02 4.2E-02 805 3 1.21 Tier2

TMEM192 5 0.30 0.44 7665 1.66 1.2E-02 4.2E-02 808 3 1.66 Tier2

TMEM50A 4 0.80 0.80 14293 1.34 1.5E-02 4.8E-02 959 2 1.34 Tier2

TNFRSF17 5 0.21 0.34 6005 1.60 1.3E-02 4.5E-02 861 3 1.60 Tier3

TNS4 5 0.12 0.24 4215 1.59 1.4E-02 4.6E-02 873 3 1.59 Tier3

TOX4 5 0.21 0.34 6077 1.17 1.4E-02 4.7E-02 905 3 1.17 Tier2

TRIM45 5 0.97 0.97 17407 1.11 1.3E-02 4.5E-02 849 4 1.11 Unassigned

TSFM 5 0.94 0.94 16859 1.34 1.2E-02 4.1E-02 783 4 1.34 Tier3

TSPAN13 5 0.92 0.92 16457 1.54 1.2E-02 4.0E-02 773 4 1.54 Tier3

TTC17 4 0.44 0.50 9773 1.64 1.3E-02 4.2E-02 817 3 1.64 Tier3

TYR 4 0.95 0.95 16885 1.48 1.3E-02 4.3E-02 859 3 1.48 Singleton

UBA2 4 0.07 0.15 2865 0.31 1.5E-02 4.6E-02 922 2 0.31 Tier2

UBE3D 5 0.20 0.34 5933 1.37 1.1E-02 3.9E-02 762 4 1.37 Singleton

UGCG 5 0.04 0.11 2006 1.55 1.4E-02 4.7E-02 909 3 1.55 Tier3

UNC13D 5 0.99 0.99 17832 1.46 1.3E-02 4.4E-02 840 4 1.46 Singleton

UQCC2 5 0.58 0.64 11083 1.58 1.3E-02 4.5E-02 847 3 1.58 Unassigned

UROD 5 0.01 0.02 512 1.17 1.2E-02 4.0E-02 772 3 1.17 Unassigned

USF2 5 0.98 0.98 17549 1.18 1.4E-02 4.5E-02 869 4 1.18 Tier2

VASH1 5 0.21 0.34 5979 -0.44 1.1E-02 3.9E-02 754 1 -0.44 Singleton VPREB1 5 0.84 0.84 14963 1.27 1.3E-02 4.5E-02 853 4 1.27 Tier2

WNT6 4 0.40 0.48 9368 -0.23 1.5E-02 4.6E-02 926 1 -0.23 Singleton

WNT7A 5 0.54 0.61 10654 1.15 1.1E-02 3.8E-02 728 4 1.15 Singleton

WNT8A 5 0.43 0.56 9696 1.72 1.1E-02 3.8E-02 731 4 1.72 Tier2

XPO4 5 0.99 0.99 17855 1.01 1.5E-02 4.9E-02 931 4 1.01 Tier2

ZDHHC6 5 0.95 0.95 16957 0.44 1.3E-02 4.5E-02 852 2 0.44 Tier2

ZFP2 5 0.58 0.64 11072 1.63 1.2E-02 4.0E-02 778 4 1.63 Tier2

ZIC4 11 0.02 0.06 941 0.87 7.7E-03 4.0E-02 565 6 0.87 Tier3

ZNF285 5 0.25 0.38 6745 1.16 1.4E-02 4.5E-02 866 4 1.16 Tier2

ZNF468 7 0.09 0.22 3339 -0.28 9.1E-03 3.8E-02 642 2 -0.28 Tier2

ZNF556 5 0.82 0.82 14545 1.38 1.4E-02 4.7E-02 888 4 1.38 Tier2

ZNF683 5 0.77 0.77 13645 0.50 1.2E-02 4.0E-02 768 2 0.50 Tier2

ZSWIM2 5 0.99 0.99 17661 1.60 1.3E-02 4.3E-02 827 4 1.60 Unassigned Supplementary Table 2. GSEA analyses for combined tiers 1,2,3. geneSet description normalizedEnrichmentScorepValue size userId hsa03018 RNA degradation 1.72759804 0.00104932 12 CNOT3;CNOT6;EXOSC10;EXOSC8;LSM5 hsa05168 Herpes simplex infection 1.65370929 0.00205973 14 CCL2;CDK1;IFNGR2;SRPK1;TNFRSF14 hsa04910 Insulin signaling pathway 1.61328357 0.00539374 9 EIF4E;PHKG1;TSC1;TSC2 hsa05231 Choline metabolism in cancer 1.5763168 0.0030896 14 TSC1;TSC2 hsa04211 Longevity regulating pathway 1.59041059 0.00661521 7 EIF4E;TSC1;TSC2 hsa04640 Hematopoietic cell lineage -1.0538121 0.36082474 7 CD3G;GP5;HLA-DQA1;ITGA2;ITGA3;ITGAM;TFRC hsa03010 Ribosome 1.33807098 0.07331976 14 MRPL1;MRPL17;MRPL32;MRPS10;MRPS12;RPL19;RPL27A;RPS13;RPS27L;RPSA hsa04115 p53 signaling pathway 1.3442413 0.07724426 13 CDK1;TSC2 hsa04150 mTOR signaling pathway 1.47487899 0.01004016 24 EIF4E;FZD10;NPRL2;RPS6KA6;SLC7A5;TBC1D7;TSC1;TSC2 hsa03022 Basal transcription factors 1.34659342 0.11135857 7 GTF2H4;TAF2;TAF7 hsa04216 Ferroptosis -1.003018 0.46666666 9 ACSL4;ATG7;FTL;MAP1LC3A;MAP1LC3C;SLC39A14;SLC40A1;STEAP3;TFRC hsa04919 Thyroid hormone signaling pathway 1.34742967 0.09284952 10 TSC2 hsa01524 Platinum drug resistance -1.0668721 0.34782608 8 ABCC2;AKT2;BBC3;BIRC5;CASP9;GSTA3;GSTM3;GSTO2 hsa04012 ErbB signaling pathway -1.1045096 0.28571428 5 ABL2;AKT2;JUN;MAP2K2;PRKCB hsa05160 Hepatitis C -1.154562 0.23913043 6 AKT2;CLDN14;CLDN4;IRF3;NR1H3;RIPK1 hsa04370 VEGF signaling pathway -0.6652701 0.96350364 6 AKT2;CASP9;MAP2K2;PLA2G4A;PLA2G4C;PRKCB hsa04730 Long-term depression -0.7126874 0.91538461 6 LYN;MAP2K2;PLA2G4A;PLA2G4C;PRKCB;PRKG2 hsa04514 Cell adhesion molecules (CAMs) -1.2628601 0.17142857 8 CLDN14;CLDN4;HLA-DQA1;ITGAM;MPZL1;NRXN1;PTPRC;SELL hsa04620 Toll-like receptor signaling pathway -1.2985066 0.12380952 7 AKT2;FOS;IRF3;JUN;MAP2K2;RIPK1;TICAM2 hsa04917 Prolactin signaling pathway -1.1642552 0.22222222 5 AKT2;CCND2;CYP17A1;FOS;MAP2K2 Supplementary Figure 1. String Network analyses of Tier 1 candidates

#term ID term description observed gene backgroundcount genecountfalse discoverymatching rate proteins in your network (IDs) matching proteins in your network (labels) HSA-8953854 Metabolism of RNA 5 652 0.0125 ENSP00000336741,ENSP00000346067,ENSP00000348722,ENSP00000407323,ENSP00000410758DHX15,EBNA1BP2,LSM5,PUS7,RPSA HSA-8854214 TBC/RABGAPs 2 43 0.0282 ENSP00000219476,ENSP00000475727 TBC1D7,TSC2 1.5 Parental NT_sgRNA

1.0 TBC1D7_sgRNA DEPDC5_sgRNA

0.5

0.0 24 hours 72 hours Number of cells relative to vehicle treated

Supplementary figure 2 Sorafenib sensitivity in TBC1D7 and DEPDC5 deficient MOLM13 cells. Cells were treated with 50nM sorafenib or vehicle alone (DMSO) for indicated times and the number of viable cells were determined using Guava® ViaCount™ (Luminex). Histogram represents number of viable cells in sorafenib treated cultures relative to vehicle alone. A

ParentalNT_sgRNATSC1_sgRNA ParentalNT_sgRNA TSC2_sgRNA ParentalNT_sgRNA NPRL2_sgRNA NT_sgRNALZTR1_sgRNA ParentalNT_sgRNA NF1_sgRNA

TSC1 TSC2 NPRL2 LZTR1 NF1 TSC2 Beta actin VINCULIN GAPDH VINCULIN Beta actin

B

16 LZTR1_sgRNA 35 LZTR1_sgRNA Edit eff: 85 Edit eff: 88 14 30 R2: 0.900 R2: 0.880 12 25 10 20 8 15 6 4 10 2 5 Percentage of indel in mixture Percentage of indel in mixture 0 0 -30 -20 -10 0 10 -30 -20 -10 0 10 Indel Indel 50 NF1_sgRNA 40 TSC1_sgRNA NPRL2_sgRNA 30 Edit eff: 97 35 Edit eff: 48 Edit eff: 94 2 40 R : 0.970 R2: 0.900 R2: 0.940 25 30 20 25 30 15 20 20 15 10 10 10 5 5 Percentage of indel in mixture Percentage of indel in mixture Percentage of indel in mixture 0 0 0 -30 -20 -10 0 10 -30 -20 -10 0 10 -30 -20 -10 0 10 Indel Indel Indel 30 DEPDC5_sgRNA 17.5 60 TBC1D7_sgRNA DEPDC5_sgRNA 25 Edit eff: 50 Edit eff: 67 Edit eff: 88 2 15.0 2 2 R : 0.500 R : 0.790 50 R : 0.880 20 12.5 40 10.0 30 15 7.5 20 10 5.0 10 5 2.5 Percentage of indel in mixture Percentage of indel in mixture Percentage of indel in mixture 0 0 0 -30 -20 -10 0 10 -30 -20 -10 0 10 -30 -20 -10 0 10 Indel Indel Indel

Supplementary figure 3 Validation of sgRNA efficiency using Western blot analysis and ICE assay. A. Immunoblot analysis of protein lysates from MOLM13 parental and MOLM13 transduced with non-targeting control, TSC1, TSC2, NPRL2, LZTR1, and NF1 sgRNAs using indicated antibodies. B. Analyses for sgRNA effectiveness in MOLM13 cells inactivated for LZTR1, TSC1, NF1 and NPRL2 individually using corresponding sgRNAs. Chromatograms were analyzed for percent of various deletions using ICE assay. A D Parental MOLM13 Parental MOLM13 Average synergy: 3.449 (ZIP) 100 100 Crenolanib resistant MOLM13 Quizartinib resistant MOLM13 −20 −15 −10 −5 0 5 10 15 20 Sorafenib resistant MOLM13

50 50 % viabilit y % viabilit y 20 15 0 0 10 5 0 10 100 1000 0 10 100 1000 0 PI-103 (nM) Rapamycin (nM) −5 Synergy score −10 −15 Crenolanib resistant MOLM13 Quizartinib resistant MOLM13 −20 B 1 Crenolanib 100 Quizartinib 0.333 0.111 100 Trametinib Trametinib Sorafenib (uM) 0.037 1 Combination Combination 0.333 0.012 0.111 0.004 0.037 0.012 0.001 0.004 50 0.001 50 0 0 Trametinib (uM) % viabilit y % viabilit y Sorafenib resistant MOLM13 0 Average synergy: 8.015 (ZIP) 0 0 10 100 1000 0 10 100 1000 −40 −20 0 20 40 Concentration (nM) Concentration (nM)

Crenolanib resistant MOLM13 Quizartinib resistant MOLM13 Sorafenib 100 Sorafenib 100 PP242 PP242 40 Combination Combination 20

50 50 0 Synergy score

% viabilit y −20 % viabilit y

−40 0 0 1 0 10 100 1000 0.333 0 10 100 1000 0.111 Sorafenib (uM) Concentration (nM) Concentration (nM) 0.037 1 0.333 0.012 0.111 0.004 0.037 0.012 0.001 0.004 0.001 C Parental MOLM13 Sorafenib resistant MOLM13 0 0 Trametinib (uM) Sorafenib Sorafenib 100 PI-103 100 PI-103 Combination Combination E AML patient samples 50 50 **** % viabilit y % viabilit y

300 *** 0 0 0 10 100 1000 0 10 100 1000 Concentration (nM) Concentration (nM) 200 Crenolanib resistant MOLM13 Quizartinib resistant MOLM13

Sorafenib Sorafenib AU C 100 PI-103 100 PI-103 100 Combination Combination

50 50 0 % viabilit y % viabilit y

0 Quizartinib Trametinib 0 Combination 0 10 100 1000 0 10 100 1000 Concentration (nM) Concentration (nM)

Supplementary figure 4. Evaluation of sensitivity to MTOR inhibitors and combination of FLT3 and trametinib or FLT3 and MTOR inhibitors. A. FLT3i-resistant MOLM13 cell lines described in Fig 3A were tested for sensitivity to MTOR inhibitors, PI-103 and rapamycin, in 72 hour drug sensitivity assays as described in Fig 3A. B, C. Dose response curves of indicated single agents or their combination on parental and FLT3 inhibitor resistant MOLM13 cells. Drug combinations were tested at equimolar concentrations and sensitivity was assessed as in Fig 3A. D. Surface plots generated by R_SynergyFinder for the combination of sorafenib and trametinib on parental (top) or sorafenib resistant (bottom) MOLM13 cells. E. Scatter plots showing sensitivity to quizartinib, trametinib, or their combination as area under the dose response curve (AUC) in ex vivo AML patient samples (n =181). AUCs were analyzed using a one-way ANOVA/Friedman test: *** denotes p < 0.0001, **** , p < 0.00001, n.s. A 150 MOLM13 100 NT_sgRNA TSC1_sgRNA 100 NPRL2_sgRNA 50 50 % viabilit y % viabilit y

0 0 0 10 100 1000 0 10 100 1000 PI-103 (nM) PP242 (nM)

B TSC1_sgRNA NPRL2_sgRNA C Sorafenib MOLM13 Sorafenib 100 100 100 PI-103 NT_sgRNA Sorafenib Combination TSC1_sgRNA Sorafenib + PI-103 NPRL2_sgRNA Sorafenib + PI-103

50 50 50 % viabilit y % viabilit y % viabilit y

0 0 0 0 10 100 1000 0 10 100 1000 0 10 100 1000 Concentration (nM) Concentration (nM) Concentration (nM)

150 Sorafenib MOLM13 Sorafenib 100 PP242 NT_sgRNA Sorafenib 100 Combination TSC1_sgRNA Sorafenib + PP242 100 NPRL2_sgRNA Sorafenib + PP242 50 50 % viabilit y 50 % viabilit y % viabilit y

0 0 0 0 10 100 1000 0 10 100 1000 0 10 100 1000 Concentration (nM) Concentration (nM) Concentration (nM)

Supplementary figure 5. Evaluation of sensitivity to MTOR inhibitors and combination of FLT3 and MTOR inhibitors in TSC1 and NPRL2 deficient cells. A. Sensitivity to MTOR inhibitors, PI-103 and PP242, of TSC1 and NPRL2 deficient MOLM13 cell lines were determined in 72 hour drug sensitivity assays as in Fig 3A. B, C. Dose response curves of indicated single agents or their combination on TSC1 and NPRL2 deficient MOLM13 cells. Drug combinations were tested at equimolar concentrations and sensitivity was assessed as in Fig 3A.