Rational Drug Design and Synthesis of Selective FKBP51 Ligands
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Compression of Large Sets of Sequence Data Reveals Fine Diversification of Functional Profiles in Multigene Families of Proteins
Technical note Compression of Large Sets of Sequence Data Reveals Fine Diversification of Functional Profiles in Multigene Families of Proteins: A Study for Peptidyl-Prolyl cis/trans Isomerases (PPIase) Andrzej Galat Retired from: Service d’Ingénierie Moléculaire des Protéines (SIMOPRO), CEA-Université Paris-Saclay, France; [email protected]; Tel.: +33-0164465072 Received: 21 December 2018; Accepted: 21 January 2019; Published: 11 February 2019 Abstract: In this technical note, we describe analyses of more than 15,000 sequences of FK506- binding proteins (FKBP) and cyclophilins, also known as peptidyl-prolyl cis/trans isomerases (PPIases). We have developed a novel way of displaying relative changes of amino acid (AA)- residues at a given sequence position by using heat-maps. This type of representation allows simultaneous estimation of conservation level in a given sequence position in the entire group of functionally-related paralogues (multigene family of proteins). We have also proposed that at least two FKBPs, namely FKBP36, encoded by the Fkbp6 gene and FKBP51, encoded by the Fkbp5 gene, can form dimers bound via a disulfide bridge in the nucleus. This type of dimer may have some crucial function in the regulation of some nuclear complexes at different stages of the cell cycle. Keywords: FKBP; cyclophilin; PPIase; heat-map; immunophilin 1 Introduction About 30 years ago, an exciting adventure began in finding some correlations between pharmacological activities of macrocyclic hydrophobic drugs, namely the cyclic peptide cyclosporine A (CsA), and two macrolides, namely FK506 and rapamycin, which have profound and clinically useful immunosuppressive effects, especially in organ transplantations and in combating some immune disorders. -
Fkbp10 (NM 010221) Mouse Untagged Clone – MC201811 | Origene
OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for MC201811 Fkbp10 (NM_010221) Mouse Untagged Clone Product data: Product Type: Expression Plasmids Product Name: Fkbp10 (NM_010221) Mouse Untagged Clone Tag: Tag Free Symbol: Fkbp10 Synonyms: AI325255; FKBP-10; FKBP-65; Fkbp-rs1; Fkbp1-rs; Fkbp6; FKBP65; Fkbprp Vector: PCMV6-Kan/Neo E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 3 Fkbp10 (NM_010221) Mouse Untagged Clone – MC201811 Fully Sequenced ORF: >BC029546 sequence for NM_010221 GTCCGCTCTCACTGCCGGCGTCCCTGGTCTGGGCACCATGTTCCTTGTGGGGTCCTCCAGCCACACCCTC CATCGGCTCCGCATACTGCCGTTGCTGTTGCTTCTACAGACCTTGGAGAGGGGACTGGGCCGTGCCAGCC CGGCCGGAGCCCCCTTGGAAGATGTGGTCATCGAGAGATACCACATCCCTCGGGCCTGTCCCCGAGAAGT GCAGATGGGGGATTTTGTGCGTTACCACTACAATGGCACTTTCGAAGACGGGAAAAAGTTTGACTCCAGC TATGACCGTAGCACCCTGGTGGCCATCGTTGTGGGCGTAGGCCGCCTCATCACCGGCATGGACCGGGGTC TCATGGGCATGTGTGTCAACGAGCGCCGCCGCCTCATTGTGCCTCCCCACCTGGGCTACGGCAGCATCGG TGTGGCGGGCCTCATCCCCCCTGATGCCACCCTCTATTTTGACGTGGTCCTGCTGGACGTGTGGAACAAA GCAGACACGGTGCAGTCAACTATCCTCCTGCGCCCTCCCTACTGCCCCCGAATGGTGCAGAACAGTGACT TTGTGCGCTATCACTACAATGGCACTCTGCTGGATGGCACTGCCTTTGACAACAGCTACAGTAGGGGAGG CACTTATGACACCTACATCGGCTCTGGTTGGCTGATCAAAGGCATGGACCAGGGGCTGCTGGGCATGTGC -
Genetic and Genomic Analysis of Hyperlipidemia, Obesity and Diabetes Using (C57BL/6J × TALLYHO/Jngj) F2 Mice
University of Tennessee, Knoxville TRACE: Tennessee Research and Creative Exchange Nutrition Publications and Other Works Nutrition 12-19-2010 Genetic and genomic analysis of hyperlipidemia, obesity and diabetes using (C57BL/6J × TALLYHO/JngJ) F2 mice Taryn P. Stewart Marshall University Hyoung Y. Kim University of Tennessee - Knoxville, [email protected] Arnold M. Saxton University of Tennessee - Knoxville, [email protected] Jung H. Kim Marshall University Follow this and additional works at: https://trace.tennessee.edu/utk_nutrpubs Part of the Animal Sciences Commons, and the Nutrition Commons Recommended Citation BMC Genomics 2010, 11:713 doi:10.1186/1471-2164-11-713 This Article is brought to you for free and open access by the Nutrition at TRACE: Tennessee Research and Creative Exchange. It has been accepted for inclusion in Nutrition Publications and Other Works by an authorized administrator of TRACE: Tennessee Research and Creative Exchange. For more information, please contact [email protected]. Stewart et al. BMC Genomics 2010, 11:713 http://www.biomedcentral.com/1471-2164/11/713 RESEARCH ARTICLE Open Access Genetic and genomic analysis of hyperlipidemia, obesity and diabetes using (C57BL/6J × TALLYHO/JngJ) F2 mice Taryn P Stewart1, Hyoung Yon Kim2, Arnold M Saxton3, Jung Han Kim1* Abstract Background: Type 2 diabetes (T2D) is the most common form of diabetes in humans and is closely associated with dyslipidemia and obesity that magnifies the mortality and morbidity related to T2D. The genetic contribution to human T2D and related metabolic disorders is evident, and mostly follows polygenic inheritance. The TALLYHO/ JngJ (TH) mice are a polygenic model for T2D characterized by obesity, hyperinsulinemia, impaired glucose uptake and tolerance, hyperlipidemia, and hyperglycemia. -
Mouse FKBP10 ORF Mammalian Expression Plasmid, N-His Tag
Mouse FKBP10 ORF mammalian expression plasmid, N-His tag Catalog Number: MG5A1953-NH General Information Plasmid Resuspension protocol Gene : FK506 binding protein 10 1. Centrifuge at 5,000×g for 5 min. Official Symbol : FKBP10 2. Carefully open the tube and add 100 l of sterile water to Synonym : Fkbp6; FKBP65; Fkbprp; FKBP-10; dissolve the DNA. FKBP-65; AI325255; Fkbp-rs1; Fkbp1-rs 3. Close the tube and incubate for 10 minutes at room Source : Mouse temperature. cDNA Size: 1746bp 4. Briefly vortex the tube and then do a quick spin to RefSeq : NM_010221.2 concentrate the liquid at the bottom. Speed is less than Description 5000×g. Lot : Please refer to the label on the tube 5. Store the plasmid at -20 ℃. Vector : pCMV3-SP-N-His Shipping carrier : Each tube contains approximately 10 μg of lyophilized plasmid. The plasmid is ready for: Storage : • Restriction enzyme digestion The lyophilized plasmid can be stored at ambient temperature • PCR amplification for three months. • E. coli transformation Quality control : • DNA sequencing The plasmid is confirmed by full-length sequencing with primers in the sequencing primer list. E.coli strains for transformation (recommended Sequencing primer list : but not limited) pCMV3-F: 5’ CAGGTGTCCACTCCCAGGTCCAAG 3’ Most commercially available competent cells are appropriate for pcDNA3-R : 5’ GGCAACTAGAAGGCACAGTCGAGG 3’ the plasmid, e.g. TOP10, DH5α and TOP10F´. Or Forward T7 : 5’ TAATACGACTCACTATAGGG 3’ ReverseBGH : 5’ TAGAAGGCACAGTCGAGG 3’ pCMV3-F and pcDNA3-R are designed by Sino Biological Inc. Customers can order the primer pair from any oligonucleotide supplier. Manufactured By Sino Biological Inc., FOR RESEARCH USE ONLY. -
Supplementary Table 3
Supplemental Table 1 M e13 ∆∆Ct e13 M e15 ∆∆Ct e15 chromogranin A -3,26 (9,6 ↓ ) -6,29 (78 ↓ ) -2,56 (5,9 ↓ ) -6,57 (95 ↓ ) crystallin, beta A2 -0,95 (1,9 ↓ ) -4,57 (24 ↓ ) -1,82 (3,5 ↓ ) -4 (16 ↓ ) cyclin-dependent kinase inhibitor 1A (P21) -1,15 (2,2 ↓ ) -1,41 (2,7 ↓ ) -0,36 (1,3 ↓ ) 0,29 (1,2 ↑ ) cytochrome P450, family 4, subfamily b, polypeptide 1 -0,68 (1,6 ↓ ) 0,16 (1,1 ↑ ) -0,56 (1,5 ↓ ) -0,08 (1,1 ↓ ) myelin transcription factor 1 -1,28 (2,4 ↓ ) -2,62 (6,1 ↓ ) -1,46 (2,8 ↓ ) -3,59 (12 ↓ ) neurogenic differentiation 2 -0,06 (1,0 → ) NA -1,34 (2,5 ↓ ) NA neuronatin 0,14 (1,1 ↑ ) 0,12 (1,1 ↑ ) -0,79 (1,7 ↓ ) -2,02 (4,1 ↓ ) protocadherin 21 -1,62 (3,1 ↓ ) -5,71 (52 ↓ ) -1,77 (3,4 ↓ ) -6,41 (85 ↓ ) regulated endocrine-specific protein 18 -2,1 (4,3 ↓ ) -4,73 (27 ↓ ) -1,55 (2,9 ↓ ) -5,09 (34 ↓ ) retinol binding protein 4, plasma -1,68 (3,2 ↓ ) -1,52 (2,9 ↓ ) -1,53 (2,9 ↓ ) -2,15 (4,4 ↓ ) rhomboid, veinlet-like 4 (Drosophila) -1,14 (2,2 ↓ ) -0,29 (1,2 ↓ ) -1,09 (2,1 ↓ ) -0,58 (1,5 ↓ ) sestrin 2 -0,78 (1,7 ↓ ) -0,84 (1,8 ↓ ) -0,67 (1,6 ↓ ) -0,61 (1,5 ↓ ) synaptotagmin 13 -1,63 (3,1 ↓ ) -2,59 (6,0 ↓ ) -1,77 (3,4 ↓ ) -2,71 (6,5 ↓ ) t-complex protein 11 -0,48 (1,4 ↓ ) -1,35 (2,5 ↓ ) -0,68 (1,6 ↓ ) -2,83 (7,1 ↓ ) -0,62 (1,5 ↓ ) -0,76 (1,7 ↓ ) transmembrane 4 superfamily member 2 -0,29 (1,2 ↓ ) -0,55 (1,5 ↓ ) -0,67 (1,6 ↓ ) -0,38 (1,3 ↓ ) 2510004L01Rik -0,7 (1,6 ↓ ) -1,58 (3,0 ↓ ) -0,07 (1,0 → ) 0,16 (1,1 ↑ ) C81234 -3,12 (8,7 ↓ ) -7,75 (215 ↓ ) -2,29 (4,9 ↓ ) -4,86 (29 ↓ ) Insulin 2 NM -9,89 (948 ↓ ) NM -14,2 (18820 ↓ ) Neurogenin 3 NM NA -
A Key Actor of Collagen Crosslinking in Clear Cell Renal Cell Carcinoma
www.aging-us.com AGING 2021, Vol. 13, No. 15 Research Paper FK506 binding protein 10: a key actor of collagen crosslinking in clear cell renal cell carcinoma Yubai Zhang1,4, Yue Yin2, Sijia Liu3, Lei Yang1,4, Changhua Sun4, Ruihua An1 1Department of Urology Surgery, The First Affiliated Hospital of Harbin Medical University, Harbin, China 2Department of Oncology Radiotherapy, The Second Affiliated Hospital of Harbin Medical University, Harbin, China 3Department of Gynecological Radiotherapy, The Affiliated Tumor Hospital of Harbin Medical University, Harbin, China 4Department of Urology Surgery, The First Hospital of Harbin, Harbin, China Correspondence to: Ruihua An; email: [email protected], https://orcid.org/0000-0002-7041-2014 Keywords: FKBP10, clear cell renal cell carcinoma, collagen synthesis, prognosis Received: May 27, 2021 Accepted: July 10, 2021 Published: August 13, 2021 Copyright: © 2021 Zhang et al. This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 3.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. ABSTRACT Clear cell renal cell carcinoma (ccRCC) is the most common type of malignant tumor in the kidney. With numbers of patients whose physical condition or tumor stage not suitable for radical surgery, they only have a narrow choice of using VEGF/mTOR targeted drugs to control their tumors, but ccRCC often shows resistance to these drugs. Therefore, identifying a new therapeutic target is of urgent necessity. In this study, for the first time, we concluded from bioinformatics analyses and in vitro research that FK506 binding protein 10 (FKBP10), together with its molecular partner Lysyl hydroxylase 2 (LH2/PLOD2), participate in the process of type I collagen synthesis in ccRCC via regulating crosslinking of pro-collagen chains. -
Table S2.Up Or Down Regulated Genes in Tcof1 Knockdown Neuroblastoma N1E-115 Cells Involved in Differentbiological Process Anal
Table S2.Up or down regulated genes in Tcof1 knockdown neuroblastoma N1E-115 cells involved in differentbiological process analysed by DAVID database Pop Pop Fold Term PValue Genes Bonferroni Benjamini FDR Hits Total Enrichment GO:0044257~cellular protein catabolic 2.77E-10 MKRN1, PPP2R5C, VPRBP, MYLIP, CDC16, ERLEC1, MKRN2, CUL3, 537 13588 1.944851 8.64E-07 8.64E-07 5.02E-07 process ISG15, ATG7, PSENEN, LOC100046898, CDCA3, ANAPC1, ANAPC2, ANAPC5, SOCS3, ENC1, SOCS4, ASB8, DCUN1D1, PSMA6, SIAH1A, TRIM32, RNF138, GM12396, RNF20, USP17L5, FBXO11, RAD23B, NEDD8, UBE2V2, RFFL, CDC GO:0051603~proteolysis involved in 4.52E-10 MKRN1, PPP2R5C, VPRBP, MYLIP, CDC16, ERLEC1, MKRN2, CUL3, 534 13588 1.93519 1.41E-06 7.04E-07 8.18E-07 cellular protein catabolic process ISG15, ATG7, PSENEN, LOC100046898, CDCA3, ANAPC1, ANAPC2, ANAPC5, SOCS3, ENC1, SOCS4, ASB8, DCUN1D1, PSMA6, SIAH1A, TRIM32, RNF138, GM12396, RNF20, USP17L5, FBXO11, RAD23B, NEDD8, UBE2V2, RFFL, CDC GO:0044265~cellular macromolecule 6.09E-10 MKRN1, PPP2R5C, VPRBP, MYLIP, CDC16, ERLEC1, MKRN2, CUL3, 609 13588 1.859332 1.90E-06 6.32E-07 1.10E-06 catabolic process ISG15, RBM8A, ATG7, LOC100046898, PSENEN, CDCA3, ANAPC1, ANAPC2, ANAPC5, SOCS3, ENC1, SOCS4, ASB8, DCUN1D1, PSMA6, SIAH1A, TRIM32, RNF138, GM12396, RNF20, XRN2, USP17L5, FBXO11, RAD23B, UBE2V2, NED GO:0030163~protein catabolic process 1.81E-09 MKRN1, PPP2R5C, VPRBP, MYLIP, CDC16, ERLEC1, MKRN2, CUL3, 556 13588 1.87839 5.64E-06 1.41E-06 3.27E-06 ISG15, ATG7, PSENEN, LOC100046898, CDCA3, ANAPC1, ANAPC2, ANAPC5, SOCS3, ENC1, SOCS4, -
FKBP10 and Bruck Syndrome
View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector LETTERS TO THE EDITOR FKBP10 and Bruck Syndrome: none of them overlapped with either of the two previously described Bruck syndrome loci, confirming that these Phenotypic Heterogeneity patients have Bruck syndrome 3 (BKS3).6,7 One area of or Call for Reclassification? overlap between the two patients was identified on 17q21.2, spanning 1.5Mb of genomic DNA that contains 91 genes. FKBP10, which encodes FKBP65, an extracellular matrix binding protein,8 was an attractive candidate in To the Editor: We read with interest the recent paper by that interval. Sequencing of the entire coding and the Alanay et al., who describe the first human patients with flanking intronic sequence revealed the presence of a FKBP10 (MIM 607063) mutations and conclude that homozygous 8 bp insertion (c.1023insGGAGAATT) along this adds to the growing list of autosomal-recessive non- with resulting frameshift and premature truncation of syndromic osteogenesis imperfecta (OI) genes (MIM the protein (p.T342GfsX367). 610968).1 This is in contrast to our experience with an Interestingly, the OI phenotype that Alanay et al. extremely rare form of OI called Bruck syndrome (MIM described in association with the two mutations is much 259450 and 609220), in which multiple joint contracture more severe than the one we describe here.1 It may be is a prominent finding.2 Below we show this syndrome hard to attribute this to the allelic difference because one to be caused by a mutation in the same gene. -
Produktinformation
Produktinformation Diagnostik & molekulare Diagnostik Laborgeräte & Service Zellkultur & Verbrauchsmaterial Forschungsprodukte & Biochemikalien Weitere Information auf den folgenden Seiten! See the following pages for more information! Lieferung & Zahlungsart Lieferung: frei Haus Bestellung auf Rechnung SZABO-SCANDIC Lieferung: € 10,- HandelsgmbH & Co KG Erstbestellung Vorauskassa Quellenstraße 110, A-1100 Wien T. +43(0)1 489 3961-0 Zuschläge F. +43(0)1 489 3961-7 [email protected] • Mindermengenzuschlag www.szabo-scandic.com • Trockeneiszuschlag • Gefahrgutzuschlag linkedin.com/company/szaboscandic • Expressversand facebook.com/szaboscandic FKBP10 Recombinant Protein (OPCD03243) Data Sheet Product Number OPCD03243 Product Page http://www.avivasysbio.com/fkbp10-recombinant-protein-opcd03243.html Product Name FKBP10 Recombinant Protein (OPCD03243) Size 10 ug Gene Symbol FKBP10 Alias Symbols 65kDa, 65 kDa FK506-binding protein, 65 kDa FKBP, AI325255, FK506-binding protein 10, FKBP-10, Fkbp1-rs, Fkbp6, Fkbp65, FKBP65, FKBP-65 , Fkbprp, Fkbp-rs, Fkbp-rs1, Immunophilin FKBP65, Peptidyl-prolyl cis-trans isomerase FKBP10, PPIase FKBP10, Rotamase Molecular Weight 30 kDa Product Format Lyophilized Tag N-terminal His Tag Conjugation Unconjugated NCBI Gene Id 14230 Host E.coli Purity > 95% Source Prokaryotic Expressed Recombinant Official Gene Full Name FK506 binding protein 10 Description of Target PPIases accelerate the folding of proteins during protein synthesis. Reconstitution and Storage Reconstitute in PBS or others. Store at 2-8C for one month. Aliquot and store at -80C for 12 months. Avoid repeated freeze/thaw cycles. Additional Information Endotoxin Level: < 1.0 EU per 1 ug (determined by the LAL method) Additional Information Residues: Val316 - Asp573 Lead Time Domestic: within 1-2 weeks delivery International: 1-3 weeks Formulation Lyophilized in PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. -
HSP90-Incorporating Chaperome Networks As Biosensor for Disease-Related Pathways in Patient- Specific Midbrain Dopamine Neurons
ARTICLE DOI: 10.1038/s41467-018-06486-6 OPEN HSP90-incorporating chaperome networks as biosensor for disease-related pathways in patient- specific midbrain dopamine neurons Sarah Kishinevsky1,2,3,4, Tai Wang3, Anna Rodina3, Sun Young Chung1,2, Chao Xu3, John Philip5, Tony Taldone3, Suhasini Joshi3, Mary L. Alpaugh3,14, Alexander Bolaender3, Simon Gutbier6, Davinder Sandhu7, Faranak Fattahi1,2, Bastian Zimmer1,2, Smit K. Shah3, Elizabeth Chang5, Carmen Inda3,15, John Koren 3rd3,16, Nathalie G. Saurat1,2, Marcel Leist 6, Steven S. Gross7, Venkatraman E. Seshan8, Christine Klein9, Mark J. Tomishima1,2,10, Hediye Erdjument-Bromage11,12, Thomas A. Neubert 11,12, Ronald C. Henrickson5, 1234567890():,; Gabriela Chiosis3,13 & Lorenz Studer1,2 Environmental and genetic risk factors contribute to Parkinson’s Disease (PD) pathogenesis and the associated midbrain dopamine (mDA) neuron loss. Here, we identify early PD pathogenic events by developing methodology that utilizes recent innovations in human pluripotent stem cells (hPSC) and chemical sensors of HSP90-incorporating chaperome networks. We show that events triggered by PD-related genetic or toxic stimuli alter the neuronal proteome, thereby altering the stress-specific chaperome networks, which produce changes detected by chemical sensors. Through this method we identify STAT3 and NF-κB signaling activation as examples of genetic stress, and phospho-tyrosine hydroxylase (TH) activation as an example of toxic stress-induced pathways in PD neurons. Importantly, pharmacological inhibition of the stress chaperome network reversed abnormal phospho- STAT3 signaling and phospho-TH-related dopamine levels and rescued PD neuron viability. The use of chemical sensors of chaperome networks on hPSC-derived lineages may present a general strategy to identify molecular events associated with neurodegenerative diseases. -
Functional Studies on Pirna Pathway Components MOV10L1 and FKBP6
THESIS/THÈSE To obtain the title of/Pour obtenir le grade de DOCTEUR DE L’UNIVERSITÉ DE GRENOBLE Discipline/Spécialité : Cell Biology/Biologie cellulaire Arrêté ministériel : 7 août 2006 Presented by/Présentée par Jordi Xiol Thesis supervisor/Thèse dirigée par Ramesh Pillai Thesis prepared at/Thèse préparée au sein du European Molecular Biology Laboratory (EMBL), Grenoble Outstation In/dans l'École Doctorale de Chimie et Sciences du vivant Functional studies on piRNA pathway components MOV10L1 and FKBP6 Études fonctionelles sur les composants de la voie des piRNA MOV10L1 et FKBP6 Public defense/Thèse soutenue publiquement le 08/06/2011 Jury members/devant le jury composé de: Dr. Julius Brennecke Rapporteur Prof. René Ketting Rapporteur Dr. André Verdel Examinateur Prof. Winfried Weissenhorn Président Summary Piwi-interacting RNAs (piRNAs) associate to members of the PIWI clade of Argonaute proteins and are responsible for silencing of transposable elements in animal germ lines. In mouse, PIWI proteins mediate DNA methylation at the level of transposon promoters and are required for male fertility. piRNAs are produced through two biogenesis pathways, known as primary processing and ping-pong amplification cycle. This study focuses on the functions of two PIWI-associated proteins: the putative RNA helicase MOV10L1 and the immunophilin FKBP6. Here, the role of MOV10L1 as a primary piRNA processing factor is described. Genetic disruption of MOV10L1’s RNA helicase domain results in male-specific sterility and derepression of retrotransposons due to reduction of DNA methylation. A complete loss of piRNAs is observed in the mutant, pointing to a pivotal role of MOV10L1 in piRNA biogenesis. -
Combinatorial Immune and Stress Response, Cytoskeleton and Signal
Journal of Hazardous Materials 378 (2019) 120778 Contents lists available at ScienceDirect Journal of Hazardous Materials journal homepage: www.elsevier.com/locate/jhazmat Combinatorial immune and stress response, cytoskeleton and signal transduction effects of graphene and triphenyl phosphate (TPP) in mussel T Mytilus galloprovincialis ⁎ ⁎ Xiangjing Menga,c, Fei Lia, , Xiaoqing Wanga,c, Jialin Liua, Chenglong Jia,b, Huifeng Wua,b, a CAS Key Laboratory of Coastal Environmental Processes and Ecological Remediation, Yantai Institute of Coastal Zone Research (YIC), Chinese Academy of Sciences (CAS), Shandong Key Laboratory of Coastal Environmental Processes, YICCAS, Yantai 264003, PR China b Laboratory for Marine Fisheries Science and Food Production Processes, Qingdao National Laboratory for Marine Science and Technology, Qingdao 266237, PR China c University of Chinese Academy of Sciences, Beijing 100049, PR China GRAPHICAL ABSTRACT ARTICLE INFO ABSTRACT Keywords: Owing to its unique surface properties, graphene can absorb environmental pollutants, thereby affecting their Joint effects environmental behavior. Triphenyl phosphate (TPP) is a highly produced flame retardant. However, the toxi- Graphene cities of graphene and its combinations with contaminants remain largely unexplored. In this work, we in- Triphenyl phosphate (TPP) vestigated the toxicological effects of graphene and TPP to mussel Mytilus galloprovincialis. Results indicated that Toxicity graphene could damage the digestive gland tissues, but no significant changes were found in