The Human Fk506binding Proteins: Characterization of Human FKBP19
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P. -
FKBP2 Antibody Cat
FKBP2 Antibody Cat. No.: 23-414 FKBP2 Antibody Western blot analysis of extracts of various cell lines, using FKBP2 antibody (23-414) at 1:1000 dilution. Secondary antibody: HRP Goat Anti-Rabbit IgG (H+L) at 1:10000 dilution. Lysates/proteins: 25ug per lane. Blocking buffer: 3% nonfat dry milk in TBST. Detection: ECL Basic Kit. Exposure time: 90s. Specifications HOST SPECIES: Rabbit SPECIES REACTIVITY: Human, Mouse, Rat Recombinant fusion protein containing a sequence corresponding to amino acids 22-142 IMMUNOGEN: of human FKBP2 (NP_004461.2). TESTED APPLICATIONS: IF, IHC, WB October 2, 2021 1 https://www.prosci-inc.com/fkbp2-antibody-23-414.html WB: ,1:500 - 1:2000 APPLICATIONS: IHC: ,1:100 - 1:200 IF: ,1:50 - 1:200 POSITIVE CONTROL: 1) MCF7 2) SKOV3 3) Jurkat 4) HeLa 5) Mouse thymus 6) Mouse liver PREDICTED MOLECULAR Observed: 14kDa WEIGHT: Properties PURIFICATION: Affinity purification CLONALITY: Polyclonal ISOTYPE: IgG CONJUGATE: Unconjugated PHYSICAL STATE: Liquid BUFFER: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. STORAGE CONDITIONS: Store at -20˚C. Avoid freeze / thaw cycles. Additional Info OFFICIAL SYMBOL: FKBP2 FKBP-13, FKBP13, PPIase, peptidyl-prolyl cis-trans isomerase FKBP2, 13 kDa FK506-binding protein, 13 kDa FKBP, FK506 binding protein 2, 13kDa, FK506-binding protein 2, PPIase ALTERNATE NAMES: FKBP2, epididymis secretory sperm binding protein, immunophilin FKBP13, proline isomerase, rapamycin-binding protein, rotamase GENE ID: 2286 USER NOTE: Optimal dilutions for each application to be determined by the researcher. Background and References October 2, 2021 2 https://www.prosci-inc.com/fkbp2-antibody-23-414.html The protein encoded by this gene is a member of the immunophilin protein family, which play a role in immunoregulation and basic cellular processes involving protein folding and trafficking. -
Molecular Profile of Tumor-Specific CD8+ T Cell Hypofunction in a Transplantable Murine Cancer Model
Downloaded from http://www.jimmunol.org/ by guest on September 25, 2021 T + is online at: average * The Journal of Immunology , 34 of which you can access for free at: 2016; 197:1477-1488; Prepublished online 1 July from submission to initial decision 4 weeks from acceptance to publication 2016; doi: 10.4049/jimmunol.1600589 http://www.jimmunol.org/content/197/4/1477 Molecular Profile of Tumor-Specific CD8 Cell Hypofunction in a Transplantable Murine Cancer Model Katherine A. Waugh, Sonia M. Leach, Brandon L. Moore, Tullia C. Bruno, Jonathan D. Buhrman and Jill E. Slansky J Immunol cites 95 articles Submit online. Every submission reviewed by practicing scientists ? is published twice each month by Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts http://jimmunol.org/subscription Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html http://www.jimmunol.org/content/suppl/2016/07/01/jimmunol.160058 9.DCSupplemental This article http://www.jimmunol.org/content/197/4/1477.full#ref-list-1 Information about subscribing to The JI No Triage! Fast Publication! Rapid Reviews! 30 days* Why • • • Material References Permissions Email Alerts Subscription Supplementary The Journal of Immunology The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2016 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. This information is current as of September 25, 2021. The Journal of Immunology Molecular Profile of Tumor-Specific CD8+ T Cell Hypofunction in a Transplantable Murine Cancer Model Katherine A. -
Compression of Large Sets of Sequence Data Reveals Fine Diversification of Functional Profiles in Multigene Families of Proteins
Technical note Compression of Large Sets of Sequence Data Reveals Fine Diversification of Functional Profiles in Multigene Families of Proteins: A Study for Peptidyl-Prolyl cis/trans Isomerases (PPIase) Andrzej Galat Retired from: Service d’Ingénierie Moléculaire des Protéines (SIMOPRO), CEA-Université Paris-Saclay, France; [email protected]; Tel.: +33-0164465072 Received: 21 December 2018; Accepted: 21 January 2019; Published: 11 February 2019 Abstract: In this technical note, we describe analyses of more than 15,000 sequences of FK506- binding proteins (FKBP) and cyclophilins, also known as peptidyl-prolyl cis/trans isomerases (PPIases). We have developed a novel way of displaying relative changes of amino acid (AA)- residues at a given sequence position by using heat-maps. This type of representation allows simultaneous estimation of conservation level in a given sequence position in the entire group of functionally-related paralogues (multigene family of proteins). We have also proposed that at least two FKBPs, namely FKBP36, encoded by the Fkbp6 gene and FKBP51, encoded by the Fkbp5 gene, can form dimers bound via a disulfide bridge in the nucleus. This type of dimer may have some crucial function in the regulation of some nuclear complexes at different stages of the cell cycle. Keywords: FKBP; cyclophilin; PPIase; heat-map; immunophilin 1 Introduction About 30 years ago, an exciting adventure began in finding some correlations between pharmacological activities of macrocyclic hydrophobic drugs, namely the cyclic peptide cyclosporine A (CsA), and two macrolides, namely FK506 and rapamycin, which have profound and clinically useful immunosuppressive effects, especially in organ transplantations and in combating some immune disorders. -
Regulation of the Tyrosine Kinase Itk by the Peptidyl-Prolyl Isomerase Cyclophilin A
Regulation of the tyrosine kinase Itk by the peptidyl-prolyl isomerase cyclophilin A Kristine N. Brazin, Robert J. Mallis, D. Bruce Fulton, and Amy H. Andreotti* Department of Biochemistry, Biophysics and Molecular Biology, Iowa State University, Ames, IA 50011 Edited by Owen N. Witte, University of California, Los Angeles, CA, and approved December 14, 2001 (received for review October 5, 2001) Interleukin-2 tyrosine kinase (Itk) is a nonreceptor protein tyrosine ulation of the cis and trans conformers. The majority of folded kinase of the Tec family that participates in the intracellular proteins for which three-dimensional structural information has signaling events leading to T cell activation. Tec family members been gathered contain trans prolyl imide bonds. The cis con- contain the conserved SH3, SH2, and catalytic domains common to formation occurs at a frequency of Ϸ6% in folded proteins (17), many kinase families, but they are distinguished by unique se- and a small subset of proteins are conformationally heteroge- quences outside of this region. The mechanism by which Itk and neous with respect to cis͞trans isomerization (18–21). Further- related Tec kinases are regulated is not well understood. Our more, the activation energy for interconversion between cis and studies indicate that Itk catalytic activity is inhibited by the peptidyl trans proline is high (Ϸ20 kcal͞mol) leading to slow intercon- prolyl isomerase activity of cyclophilin A (CypA). NMR structural version rates (22). This barrier is a rate-limiting step in protein studies combined with mutational analysis show that a proline- folding and may serve to kinetically isolate two functionally and dependent conformational switch within the Itk SH2 domain reg- conformationally distinct molecules. -
Prostate Cancer Prognostics Using Biomarkers Prostatakrebsprognostik Mittels Biomarkern Prognostic Du Cancer De La Prostate Au Moyen De Biomarqueurs
(19) TZZ Z_T (11) EP 2 885 640 B1 (12) EUROPEAN PATENT SPECIFICATION (45) Date of publication and mention (51) Int Cl.: of the grant of the patent: G01N 33/574 (2006.01) C12Q 1/68 (2018.01) 18.07.2018 Bulletin 2018/29 C40B 30/04 (2006.01) (21) Application number: 13829137.2 (86) International application number: PCT/US2013/055429 (22) Date of filing: 16.08.2013 (87) International publication number: WO 2014/028884 (20.02.2014 Gazette 2014/08) (54) PROSTATE CANCER PROGNOSTICS USING BIOMARKERS PROSTATAKREBSPROGNOSTIK MITTELS BIOMARKERN PROGNOSTIC DU CANCER DE LA PROSTATE AU MOYEN DE BIOMARQUEURS (84) Designated Contracting States: • GHADESSI, Mercedeh AL AT BE BG CH CY CZ DE DK EE ES FI FR GB New Westminster, British Columbia V3M 6E2 (CA) GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO • JENKINS, Robert, B. PL PT RO RS SE SI SK SM TR Rochester, Minnesota 55902 (US) • VERGARA CORREA, Ismael A. (30) Priority: 16.08.2012 US 201261684066 P Bundoora, Victoria 3083 (AU) 13.02.2013 US 201361764365 P 14.03.2013 US 201361783124 P (74) Representative: Cornish, Kristina Victoria Joy et al Kilburn & Strode LLP (43) Date of publication of application: Lacon London 24.06.2015 Bulletin 2015/26 84 Theobalds Road London WC1X 8NL (GB) (73) Proprietors: • Genomedx Biosciences, Inc. (56) References cited: Vancouver BC V6B 2W9 (CA) WO-A1-2009/143603 WO-A1-2013/090620 • MAYO FOUNDATION FOR MEDICAL WO-A2-2006/091776 WO-A2-2006/110264 EDUCATION AND RESEARCH WO-A2-2007/056049 US-A1- 2006 134 663 Rochester, MN 55905 (US) US-A1- 2007 037 165 US-A1- 2007 065 827 US-A1- -
FKBP8 Antibody Cat
FKBP8 Antibody Cat. No.: 62-126 FKBP8 Antibody With HepG2 cell line lysate, the resolved proteins were electrophoretically transferred to PVDF membrane and incubated sequentially with primary antibody FKBP38 (1:1000, 4˚C,overnight ) and horseradish peroxidase–conjugated second antibody. After washing, the bound antibody complex was detected using an ECL chemiluminescence reagentand XAR film (Kodak). Specifications HOST SPECIES: Rabbit SPECIES REACTIVITY: Human HOMOLOGY: Predicted species reactivity based on immunogen sequence: Mouse, Rat This FKBP8 antibody is generated from rabbits immunized with a KLH conjugated IMMUNOGEN: synthetic peptide between 199-226 amino acids from the Central region of human FKBP8. TESTED APPLICATIONS: WB APPLICATIONS: For WB starting dilution is: 1:1000 PREDICTED MOLECULAR 45 kDa WEIGHT: September 28, 2021 1 https://www.prosci-inc.com/fkbp8-antibody-62-126.html Properties This antibody is purified through a protein A column, followed by peptide affinity PURIFICATION: purification. CLONALITY: Polyclonal ISOTYPE: Rabbit Ig CONJUGATE: Unconjugated PHYSICAL STATE: Liquid BUFFER: Supplied in PBS with 0.09% (W/V) sodium azide. CONCENTRATION: batch dependent Store at 4˚C for three months and -20˚C, stable for up to one year. As with all antibodies STORAGE CONDITIONS: care should be taken to avoid repeated freeze thaw cycles. Antibodies should not be exposed to prolonged high temperatures. Additional Info OFFICIAL SYMBOL: FKBP8 Peptidyl-prolyl cis-trans isomerase FKBP8, PPIase FKBP8, 38 kDa FK506-binding protein, ALTERNATE NAMES: 38 kDa FKBP, FKBP-38, hFKBP38, FK506-binding protein 8, FKBP-8, FKBPR38, Rotamase, FKBP8, FKBP38 ACCESSION NO.: Q14318 PROTEIN GI NO.: 193806337 GENE ID: 23770 USER NOTE: Optimal dilutions for each application to be determined by the researcher. -
Naringenin Regulates FKBP4/NR3C1/TMEM173 Signaling Pathway in Autophagy and Proliferation of Breast Cancer and Tumor-Infltrating Dendritic Cell Maturation
Naringenin Regulates FKBP4/NR3C1/TMEM173 Signaling Pathway in Autophagy and Proliferation of Breast Cancer and Tumor-Inltrating Dendritic Cell Maturation Hanchu Xiong ( [email protected] ) Zhejiang Provincial People's Hospital https://orcid.org/0000-0001-6075-6895 Zihan Chen First Hospital of Zhejiang Province: Zhejiang University School of Medicine First Aliated Hospital Baihua Lin Zhejiang Provincial People's Hospital Cong Chen Zhejiang University School of Medicine Sir Run Run Shaw Hospital Zhaoqing Li Zhejiang University School of Medicine Sir Run Run Shaw Hospital Yongshi Jia Zhejiang Provincial People's Hospital Linbo Wang Zhejiang University School of Medicine Sir Run Run Shaw Hospital Jichun Zhou Zhejiang University School of Medicine Sir Run Run Shaw Hospital Research Keywords: FKBP4, TMEM173, Autophagy, Exosome, Dendritic cell, Breast cancer Posted Date: July 7th, 2021 DOI: https://doi.org/10.21203/rs.3.rs-659646/v1 License: This work is licensed under a Creative Commons Attribution 4.0 International License. Read Full License Page 1/38 Abstract Background TMEM173 is a pattern recognition receptor detecting cytoplasmic nucleic acids and transmits cGAS related signals that activate host innate immune responses. It has also been found to be involved in tumor immunity and tumorigenesis. Methods Bc-GenExMiner, PROMO and STRING database were used for analyzing clinical features and interplays of FKBP4, TMEM173 and NR3C1. Transient transfection, western blotting, quantitative real-time PCR, luciferase reporter assay, immunouorescence and nuclear and cytoplasmic fractionation were used for regulation of FKBP4, TMEM173 and NR3C1. Both knockdown and overexpression of FKBP4, TMEM173 and NR3C1 were used to analyze effects on autophagy and proliferation of breast cancer (BC) cells. -
Pin1 Inhibitors: Towards Understanding the Enzymatic
Pin1 Inhibitors: Towards Understanding the Enzymatic Mechanism Guoyan Xu Dissertation submitted to the faculty of the Virginia Polytechnic Institute and State University In the partial fulfillment of the requirement for the degree of Doctor of Philosophy In Chemistry Felicia A Etzkorn, Chair David G. I. Kingston Neal Castagnoli Paul R. Carlier Brian E. Hanson May 6, 2010 Blacksburg, Virginia Keywords: Pin1, anti-cancer drug target, transition-state analogues, ketoamides, ketones, reduced amides, PPIase assay, inhibition Pin1 Inhibitors: Towards Understanding the Enzymatic Mechanism Guoyan Xu Abstract An important role of Pin1 is to catalyze the cis-trans isomerization of pSer/Thr- Pro bonds; as such, it plays an important role in many cellular events through the effects of conformational change on the function of its biological substrates, including Cdc25, c- Jun, and p53. The expression of Pin1 correlates with cyclin D1 levels, which contributes to cancer cell transformation. Overexpression of Pin1 promotes tumor growth, while its inhibition causes tumor cell apoptosis. Because Pin1 is overexpressed in many human cancer tissues, including breast, prostate, and lung cancer tissues, it plays an important role in oncogenesis, making its study vital for the development of anti-cancer agents. Many inhibitors have been discovered for Pin1, including 1) several classes of designed inhibitors such as alkene isosteres, non-peptidic, small molecular Pin1 inhibitors, and indanyl ketones, and 2) several natural products such as juglone, pepticinnamin E analogues, PiB and its derivatives obtained from a library screen. These Pin1 inhibitors show promise in the development of novel diagnostic and therapeutic anticancer drugs due to their ability to block cell cycle progression. -
De Novo Phosphatidylcholine Synthesis in Intestinal Lipid Metabolism and Disease
De Novo Phosphatidylcholine Synthesis in Intestinal Lipid Metabolism and Disease by John Paul Kennelly A thesis submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy in Nutrition and Metabolism Department of Agricultural, Food and Nutritional Science University of Alberta © John Paul Kennelly, 2018 Abstract Phosphatidylcholine (PC), the most abundant phospholipid in eukaryotic cells, is an important component of cellular membranes and lipoprotein particles. The enzyme CTP: phosphocholine cytidylyltransferase (CT) regulates de novo PC synthesis in response to changes in membrane lipid composition in all nucleated mammalian cells. The aim of this thesis was to determine the role that CTα plays in metabolic function and immune function in the murine intestinal epithelium. Mice with intestinal epithelial cell-specific deletion of CTα (CTαIKO mice) were generated. When fed a chow diet, CTαIKO mice showed normal lipid absorption after an oil gavage despite a ~30% decrease in small intestinal PC concentrations relative to control mice. These data suggest that biliary PC can fully support chylomicron output under these conditions. However, when acutely fed a high-fat diet, CTαIKO mice showed impaired intestinal fatty acid and cholesterol uptake from the intestinal lumen into enterocytes, resulting in lower postprandial plasma triglyceride concentrations. Impaired intestinal fatty acid uptake in CTαIKO mice was linked to disruption of intestinal membrane lipid transporters (Cd36, Slc27a4 and Npc1l1) and higher postprandial plasma Glucagon-like Peptide 1 and Peptide YY. Unexpectedly, there was a shift in expression of bile acid transporters to the proximal small intestine of CTαIKO mice, which was associated with enhanced biliary bile acid, PC and cholesterol output relative to control mice. -
SI Appendix Table of Contents
SI Appendix Contact-ID, a tool for profiling organelle-membrane contact sites, reveals regulatory proteins of mitochondrial-associated membrane formation Chulhwan Kwak1,2†, Sanghee Shin3,4,†, Jong-Seok Park2,†, Minkyo Jung5, Truong Thi My Nhung6, Myeong-Gyun Kang1,2, Chaiheon Lee2, Tae-Hyuk Kwon2, Sang Ki Park6,*, Ji Young Mun5,*, Jong-Seo Kim3,4,*, and Hyun-Woo Rhee1,4* 1Department of Chemistry, Seoul National University, Seoul, 08826, Korea 2Department of Chemistry, Ulsan National Institute of Science and Technology (UNIST), Ulsan, 44919, Korea 3Center for RNA Research, Institute of Basic Science (IBS), Seoul, 08826, Korea 4School of Biological Sciences, Seoul National University, Seoul, 08826, Korea 5Department of Structure and Function of Neural Network, Korea Brain Research Institute, Daegu, 41062, South Korea 6 Department of Life Sciences, Pohang University of Science and Technology (POSTECH), 37673, Pohang, Republic of Korea. *Corresponding authors: [email protected] (H.-W.R.), [email protected] (J.-S.K.), [email protected] (J. Y. M.), [email protected] (S. K. P.) † These authors equally contributed to this work. Table of Contents Table S1------------------------------------------------------------------------------------------------------------------------------------------------S3 Figure S1-17------------------------------------------------------------------------------------------------------------------------------S4-32 Movie S1-4& dataset S1-5 legends-------------------------------------------------------------------------------------------------------S33 -
Joint Gene Network Construction by Single-Cell RNA Sequencing Data
bioRxiv preprint doi: https://doi.org/10.1101/2021.07.14.452387; this version posted July 14, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Biometrics xx, 1–24 DOI: pending...... xxxx 2021 Joint Gene Network Construction by Single-Cell RNA Sequencing Data Meichen Dong1, Yiping He2, Yuchao Jiang 1,3, Fei Zou1,3,∗ 1Department of Biostatistics, University of North Carolina at Chapel Hill, Chapel Hill, North Carolina, U.S.A. 2Department of Pathology, Duke University, Durham, North Carolina, U.S.A. 3Department of Genetics, University of North Carolina at Chapel Hill, Chapel Hill, North Carolina, U.S.A. email: [email protected] Summary: In contrast to differential gene expression analysis at single gene level, gene regulatory networks (GRN) analysis depicts complex transcriptomic interactions among genes for better understandings of underlying genetic architectures of human diseases and traits. Recently, single-cell RNA sequencing (scRNA-seq) data has started to be used for constructing GRNs at a much finer resolution than bulk RNA-seq data and microarray data. However, scRNA- seq data are inherently sparse which hinders direct application of the popular Gaussian graphical models (GGMs). Furthermore, most existing approaches for constructing GRNs with scRNA-seq data only consider gene networks under one condition. To better understand GRNs under different but related conditions with single-cell resolution, we propose to construct Joint Gene Networks with scRNA-seq data (JGNsc) using the GGMs framework.