(12) Patent Application Publication (10) Pub. No.: US 2007/0286856A1 Brown Et Al

US 20070286856A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2007/0286856A1 BrOWn et al. (43) Pub. Date: Dec. 13, 2007

(54) MODULATION OF HYALURONAN (30) Foreign Application Priority Data SYNTHESIS AND DEGRADATION IN THE TREATMENT OF DISEASE Oct. 10, 2003 (AU)...... 200390.5551 Dec. 1, 2003 (AU)...... 20033906658 (75) Inventors: Tracey Jean Brown, Flemington (AU); Publication Classification Gary Russell Brownlee, East Burwood (51) Int. Cl. (AU) A6IR 48/00 (2006.01) A 6LX 39/395 (2006.01) A6IP 43/00 (2006.01) Correspondence Address: C7H 2L/04 (2006.01) SEED INTELLECTUAL PROPERTY LAW C07K 6/18 (2006.01) GROUP PLLC (52) U.S. Cl...... 424/133.1; 424/130.1; 424/142.1; 701 FIFTHAVE 514/44; 530/387.1: 530/387.3; SUTES4OO 530/388.1; 530/389.1; 536/22.1; SEATTLE, WA 98104 (US) 536/23.2:536/24.5 (57) ABSTRACT (73) Assignee: ALCHEMIA ONCOLOGY LIMITED, The present invention provides compositions and methods Eight Mile Plains (AU) for modulating the expression of Hyaluronan (HA). In particular, this invention relates to compounds, which (21) Appl. No.: 10/574,903 hybridize with nucleic acid molecules encoding hyaluronan synthase (HAS), particularly HAS isoforms HAS1, HAS2 and HAS3. These compounds may range in size from (22) PCT Filed: Oct. 11, 2004 oligonucleotides to full length sequences. Such compounds (86). PCT No.: PCT/AUO4/O1383 are exemplified to modulate proliferation, such as cancer and inflammatory disorders, such as arthritis. It will be under S 371(c)(1), stood, however, that the compounds can be used for any (2), (4) Date: Feb. 28, 2007 other condition in which HA is involved.

Patent Application Publication Dec. 13, 2007 Sheet 1 of 18 US 2007/0286856A1

FIGURE 1

Patent Application Publication Dec. 13, 2007 Sheet 2 of 18 US 2007/0286856A1 FIGURE 2

4.O Panel A 3 30 -a- ASHAS2 -H Parental

?aL 100 kDa 3. 20

5 40 kDa C 15 kDa O 10 y SS O L -0.2 0.0 0.2 0.4 0.6 0.8 1.0 1.2 KAV

PANEL B 18O i

6 O

2 O O Parental Mock ASHAS2 Patent Application Publication Dec. 13, 2007 Sheet 3 of 18 US 2007/0286856A1 FIGURE3

18 16 ... O parental 14 -V- mock

2 Patent Application Publication Dec. 13, 2007 Sheet 4 of 18 US 2007/0286856A1 FIGURE 4

500000

400000

300000

200000

1OOOOO O. mock IOm ASHAS2 O O 24 48 72 96 120 144 Time (h) Patent Application Publication Dec. 13, 2007 Sheet 5 of 18 US 2007/0286856 A1

FIGURE 5

PANEL. A

Time (h)

PANEL B 2O ASHAS2 O

O 4 8 12 16 20 24 28 32 36 Time (h)

O PANELC O 4 8 12 16 2D 24, 28 32 36 Time (h) Patent Application Publication Dec. 13, 2007 Sheet 6 of 18 US 2007/0286856A1 FIGURE 6

120 1 100 R 33 g 80 - is 60 22 E 40 89Š 20

Parental Mock ASHAS2 Patent Application Publication Dec. 13, 2007 Sheet 7 of 18 US 2007/0286856A1 FIGURE 7

1400 1200 --- Parental - A - Mock 1000 -o- ASHAS2 a 800 is 600 D 400 200 H

10 O

Parental to Mock ASHAS2 Patent Application Publication Dec. 13, 2007 Sheet 8 of 18 US 2007/0286856 A1

FIGURE 8

o15 R. 1.

Patent Application Publication Dec. 13, 2007 Sheet 9 of 18 US 2007/0286856A1 FIGURE 9

120

10O

120

100

Breast cancer Cell lines Patent Application Publication Dec. 13, 2007 Sheet 10 of 18 US 2007/0286856 A1

FIGURE 10

140

120

1CO

Parental Mock ASHAS2

Patent Application Publication Dec. 13, 2007 Sheet 11 of 18 US 2007/0286856 A1

FIGURE 11

18O 1111

O Parental Mock ASHAS2 Patent Application Publication Dec. 13, 2007 Sheet 12 of 18 US 2007/0286856 A1

FIGURE 12

Patent Application Publication Dec. 13, 2007 Sheet 13 of 18 US 2007/0286856 A1

FIGURE 13

2 O 24 48 72 96 120 144 Time (hours) Patent Application Publication Dec. 13, 2007 Sheet 14 of 18 US 2007/0286856 A1

FIGURE 14

10000 kDa

100 kDa 800 kDa

| y 0.2 0.4 0.6 0.8 1.0 1.2 Kav Patent Application Publication Dec. 13, 2007 Sheet 15 of 18 US 2007/0286856 A1

FIGURE 15

500000 A 400000 E E 300000 200000 9 ( OOOOO

O 24, 48 72 96 120 144 Time (h)

100 24.68OOOO

IAO 4, 8 12 16 20 24 28 32 36 time (h)

100 406

4 8 12 16 20 24 28 32 36 me 234.OoO 10sey: 4, 8 12 16 20 24 28 32 36 Time (h) Patent Application Publication Dec. 13, 2007 Sheet 16 of 18 US 2007/0286856 A1

FIGURE 16

120

2 100 () ) g 80

E E 60 55 40 Os N 20

O Parental Mock ASHAS2 Patent Application Publication Dec. 13, 2007 Sheet 17 of 18 US 2007/0286856 A1

FIGURE 17

1400 A 1200 5 1000 MN 800 O SOO O-O-SR 400 -(Af e MTV 200 O A O a-a-a-o.

O 2 4. 6 8 10 12 Weeks

100 af 2 10 B

E 1

SS 0.1

ss O.01 o s O.OO1 Threshold O 0.00001 s 1.0x100 Patent Application Publication Dec. 13, 2007 Sheet 18 of 18 US 2007/0286856 A1

FIGURE 18

100 10 1 0.1 O.O1 O.001 Threshold O.OOO 0.00001 O.OOOOO1 1.0x10-07

125 B 100

O O 50 100 150 200 Days elapsed following intracardiac US 2007/0286856 A1 Dec. 13, 2007

MODULATION OF HYALURONAN SYNTHESIS another with respect to temporal and differential expression AND DEGRADATION IN THE TREATMENT OF during different physiological processes and disease states. DISEASE 0009. In work leading up to the present invention, it was observed that HAS and HYAL are differentially expressed BACKGROUND OF THE INVENTION under various physiological conditions. In particular, they 0001) 1. Field of the Invention were up-regulated during disease conditions such as an inflammatory condition or cancer. HAS, and in particular, 0002 The present invention relates generally to the HAS1, 2 and/or 3 and HYAL1, 2 and/or 3 represent useful modulation of hyaluronan (HA) synthesis and degradation. drug targets. More particularly, the present invention provides composi tions and methods for modulating the expression of genetic SUMMARY OF THE INVENTION material encoding HA synthase (HAS) and other enzymes or receptors primarily involved in hyaluronan metabolism; or 0010 Throughout the specification, unless the context modulating the proteins that synthesise or degrade hyaluro requires otherwise, the word “comprise', or variations such nan including HAS function or activity. The compositions as “comprises' or “comprising, will be understood to imply include or comprise nucleic acid molecules and interactive the inclusion of a stated element or integer or group of molecules Such as antibodies and Small molecule inhibitors elements or integers but not to the exclusion of any other and HAS substrate analogs. The present invention further element or integer or group of elements or integers. contemplates modulation of cellular proliferation, useful in the prophylaxis and/or treatment of inflammatory disorders 0011) Nucleotide and amino acid sequences are referred including hyperproliferative conditions. Such as but not to by a sequence identifier number (SEQID NO:). The SEQ limited to, cancer and psoriasis ID NOs: correspond numerically to the sequence identifiers <400>1 (SEQ ID NO:1), <400>2 (SEQ ID NO:2), etc. A 0003 2. Description of the Prior Art Summary of the sequence identifier numbers is provided in 0004 Bibliographic details of the publications referred to Table 1. A sequence listing is provided after the claims. in this specification are also collected at the end of the 0012. The present invention is directed to compounds, description. Such as nucleic acid and nucleic acid-like oligomer com 0005 Reference to any prior art in this specification is pounds or complexes comprising same, which are targeted not, and should not be taken as, an acknowledgment or any to a nucleic acid encoding HAS and/or HYAL a nucleic acid form of Suggestion that this prior art forms part of the molecule required for or which facilitates expression of general knowledge in any country. HAS and/or HYAL-encoding material as well as compounds Such as interactive molecules including antibodies or recom 0006 Inflammatory conditions represent a major caus binant or chimeric or derivative forms thereof or small ative factor in numerous medically significant disorders. molecules which are specific for HAS and/or HYAL and Inflammation can result from a range of stimuli from outside which antagonize HAS and/or HYAL function or activity. or within the body. However, these stimuli trigger cells and The nucleic acid and nucleic acid-like oligomers or com physiological processes within a host environment. Whilst a plexes comprising same, conveniently target to a nucleic Substantial amount of research has been undertaken to acid encoding an isoform of HAS such as HAS1, HAS2 investigate the cellular and cytokine nature of inflammatory and/or HAS3. The nucleic acid and nucleic acid-like oligo processes, less is known about other possible participants in mers or complexes comprising same, conveniently target to inflammation. a nucleic acid encoding an isoform of HYAL Such as HYAL1, HYAL2, HYAL3 and/or PH-20. Preferred interac 0007 One such class of participants is transmembrane tive molecules are antibodies such as monoclonal or poly proteins. Transmembrane proteins are involved in a range of clonal antibodies. Pharmaceutical and other compositions signalling activities and many have enzymic activity. comprising the compounds of the Subject invention are also 0008 Hyaluronan (HA) metabolism is an intricate bal provided. Methods of screening for modulators of HAS and ance between the rate of HA synthesis and degradation HYAL gene expression in cells, tissues or animals are also where depending upon the physiological role being played contemplated. Methods of treating an animal, particularly a by the HA, the simultaneous synthesis and degradation is human, Suspected of having or being prone to a disease or carefully controlled. Hyaluronan is synthesised by a family condition associated with HA levels or HAS gene and HYAL of distinct yet related transmembrane proteins termed hyalu gene expression are also set forth herein. Such methods roman synthase (HAS) isoforms HAS1, 2 and 3, which can comprise administering a therapeutically or prophylactically be distinguished from one another with respect to temporal effective amount of one or more of the compounds or and differential expression during mouse embryogenesis and compositions of the present invention to the Subject of need in mature tissues, respectively and also in the molecular of treatment or Suspected of needing prophylactic treatment. weight of the HA produced. The extracellular matrix polysaccharide HA or its acidic form, hyaluronic acid, is a 0013 The present invention provides, therefore, in one linear, high molecular weight polymer comprised of repeat embodiment, anti-sense, sense, siRNA, RNAi ribozymes ing disaccharide units of (B1-3) D-glucuronate-(B1-4)N- and DNAZymes which selectively reduce directly or indi acetyl-D-glucosamine (Weissman & Meyer, J. Am. Chem. rectly, HAS and HYALgene expression. In another embodi Soc. 76: 1753, 1954). Hyaluronan is degraded by a family of ment, the present invention provides antibodies or Fab, enzymes known as hyaluronidases which are currently chimeric recombinant or derivative forms thereof. termed HYAL1, HYAL2, HYAL3 and PH-20, where like the 0014. Accordingly, one aspect of the present invention is enzymes which produce HA are also distinguished from one directed to an isolated compound capable of reducing the US 2007/0286856 A1 Dec. 13, 2007

level of hyaluronan synthase (HAS) or function or activity tants. C: Immunodetection of HAS2 protein on parental of HAS. Accordingly, one aspect of the present invention is MDA-MB 231 and, D: on stable clones expressing antisense directed to an isolated compound capable of reducing the mRNA to HAS2. Photographs of parental and ASHAS2 level of hyaluronidases (HYAL) or function or activity of transfectants at 400x magnification. In parental cells note the HYAL. periphery of the cell stains positively for the HAS2 epitope (arrows) that is absent in the antisense transfected, Panel D. TABLE 1. E and F: Immunoreactivity of parental MDA MB231 to Summary of Sequence identifiers CD44 (panel E) and antisense transfected MDA-MB 231 (Panel F). Note the complete lack of staining in the antisense SEQUENCE ID NO: DESCRIPTION transfected cells. 1 Sense primer for human HAS2 2 Antisense primer for human HAS2 0016 FIG. 2 is a graphical representation of the charac 3 Primer for PCINeo terization of the molecular weigh of HA synthesised and 4 Sense primer for GSP2 differential expression of the hyaluronidase genes by paren 5 Sense primer for GSP4 6 Sense primer for HAS tal, mock and HAS2 antisense transfected MDA-MB 231. A: 7 Antisense primer for HAS1 Cells were seeded at 7.5x10 cells in 75 cm culture flasks 8 Sense primer for HAS2 and grown for 24h in complete medium Supplemented with 9 Sense primer for HAS2 10 Antisense primer for HAS2 5uCi of D-6-H-glucosamine hydrochloride. To determine 11 Sense primer for HAS2 the MW of H-HA in the medium, samples were subjected 12 Sense primer for HAS3 to size exclusion chromatography on a Sephacryl S-1000 SF 13 Antisense primer for HAS3 14 Sense primer for HAS3 eluted in 0.15M NaCl/phosphate pH 7.25 at 13.6 ml/h. This 15 Sense primer for GAPDH figure demonstrates the differences in molecular weight 16 Antisense primer for GAPDH synthesized by parental MDA-MD 231 and their transfected 17 Sense primer for GAPDH 18 Sense primer for HYAL1 counterparts harbouring antisense mRNA to HAS2. B: Total 19 Antisense primer for HYAL1 RNA extracted from parental, mock and ASHAS2 trans 2O Sense primer HYAL2 fected MDA-MD 231 was analysed by RT-PCR to detect the 21 Antisense primer HYAL2 levels of the hyaluronidase genes, notable HYAL-1, 2 and 3. 22 Sense primer HYAL3 23 Antisense primer HYAL3 PCR products were resolved by agarose gel electrophoresis 24 Immunising peptide HAS418 containing ethidium bromide. Stained gels were then Sub 25 Immunising peptide HAS419 jected to densitometric analysis to allow comparison of 26 Immunising peptide HAS421 27 Sense primer for HAS levels for each HYAL gene between parental, mock and 28 Sense primer for HAS2 ASHAS2 transfected cells. Note, both parental and mock 29 Sense primer for HAS3 transfected MDA-MD 231 cells express comparable levels 30 Sense primer for GAPDH of both HYAL-1 and 2 but do not express HYAL-2. In 31 Sense primer for HYAL1 32 Sense primer for HYAL2 contrast ASHAS2 transfected cells, HYAL-2 is not 33 Sense primer for HYAL3 expressed whereas HYAL-3 was detected and HYAL-1 was 34 Antisense primer for HAS1 moderately increased in expression. 35 Antisense primer for HAS2 36 Antisense primer for HAS3 0017 FIG. 3 is a graphical representation of the quanti 37 Antisense primer for GAPDH 38 Antisense primer for HYAL1 fication and comparison HAS in parental, mock and 39 Antisense primer for HYAL2 ASHAS2 transfected MDA-MB 231. Cells were seeded at 40 Antisense primer for HYAL3 2.5x10/cells in 25 cm culture flasks and incubated at 37° 41 Hybridisation probe for HAS1 C. for 24 h, 48 h, 72 h, 96 h, 120 hand 144 h. At each time 42 Hybridisation probe for HAS2 43 Hybridisation probe for HAS3 points cells were trypsinized and counted using an auto 44 Hybridisation probe for GAPDH mated coulter counter. HA concentration in the harvested 45 Sense primer for HAS2 culture medium was determined using a hyaluronic acid 46 Antisense primter for HAS2 binding protein (HABP) assay, with the standards and reac 47 Primer for pCL-neo 48 GSP2 sense primer tion buffer provided Corgenix Inc (Colorado, USA). HA 49 GSP4 sense primer synthesis by parental and mock transfected MDA-MB 231 50 Alu sense primer was comparable over the duration of the experiment. In 51 Alu antisense primer contrast, HA synthesis was significantly increased in ASHAS2 transfectants, where approximately 2- to 7-fold more HA was liberated into the culture medium. BRIEF DESCRIPTION OF THE FIGURES 0018 FIG. 4 is a graphical representation showing char 0.015 FIG. 1 is a graphical and photographical represen acterisation of cell proliferation in parental, mock and tation of Real time RT-PCR quantitation of mRNA expres ASHAS2 transfected MDA MB 231. Parental, mock and sion of the HAS family and immunodetection of HAS2 in ASHAS2 transfectants were harvested at approximately parental MDA-MB 231 and antisense transfectants. A: 80% confluency and seeded in to 24-well plates at a cell Expression and quantification of mRNA for HAS2 in paren density of 5x10 cells/well. The rate of cell growth was then tal MDA-MB 231, mock (pCIneo vector only) and stable followed for 24, 48, 72, and 96 hours after plating. All cell clones of MDA MB-231 expressing antisense mRNA to counts were determined using an automated Coulter counter. HAS2 (ASHAS2). B: Expression and quantification of Whereas both parental and mock transfected MDA-MB 231 HAS1 and HAS3 in parental, mock and ASHAS2 transfec displayed exponential cell growth until 72 hours where cells US 2007/0286856 A1 Dec. 13, 2007

became confluent, the ASHAS2 transfected cells grew at a eluted in 0.15M NaCl/phosphate buffer, pH 7.25 at 13.6 much slower rate with an approximate lag period in cell ml/h. Differences in the M of liberated (FIGS. 1A, C, E & doubling of 24 hours. G) and cell-associated HA (FIGS. 1B, D, F & G) was determined in the following cell line: (FIGS. 1A, B) MDA 0019 FIG. 5 is a graphical representation of the effect of MB 453 cell line, (FIGS. 1C, D) MDA-MB 231, (FIGS. 1E, antisense inhibition of HAS2 on cell cycle. The transfected F) BT-549 and (FIGS. 1G, H) Hs578T. To qualitate the HA and control cells were seeded at 2x10 cells/25 cm flask in produced by the cell lines cultures were treated with 400 the presence of 2 mM thymidine and grown until 50% ug/ml dextran sulphate (O-O) and for the identification of confluent. Cells were washed then returned to normal cul HA degradation products the cultures did not contain dex ture medium and harvested, by trypsinisation, at the follow tran Sulphate (o-o). ing time points; Oh, 4 h, 8 h, 12 h, 16 h, 20 h, 24 h, 28 h, 32 h, and 36 h then fixed in 95% w/v ethanol for 2 h at 4° 0023 FIG. 9 is a diagrammatic representation demon C. Cells were pretreated with 100 lug/mL RNAase (Sigma) strating comparison of the invasive potential of human and 50 lug/ml propidium iodide (Sigma) for 30 minutes at breast cancer cell lines and HA receptors. The invasive 37° C. before determining the cell cycle stage in a FACS potential of the breast cell lines (O-O) were examined using Calibur (Trade Mark) analytical instrument (Becton Dick the Boyden chamber chemoinvasion assay as described in inson, San Jose, Calif.). Panel A. population of cells in Materials and Methods. The cells that had traversed the Go/G1; Panel B: in S phase, and PANEL C. in G/M phase. matrigel and spread on the lower surface of the filter were Note the delay of 24 hours of entry into S PHASE in the expressed as a percentage of the cell count determined for ASHAS2 MDA MB 231 transfectants. the HSS78T cell line. The data presented represents the mean +SD average of triplicate experiments performed on two 0020 FIG. 6 is the graphical representation of the effect separate days. Note: percentage variance between triplicate of HAS2 inhibition on the migratory behaviour of the highly determinations <2%. Quantitation of HA receptors (A) metastatic MDA MD 231 cell line. The migration rate of CD44 and (B) RHAMM was determined by immunoblotting parental, mock and antisense transfected cells was examined where Immunoreactive bands were quantified by densitom using the Boyden chamber chemoinvasion assay as etry analysis using ProXpress trade mark Imager and the described in materials and methods. Whereas parental and data analysed using Phoretix 1D software. mock transfectants displayed 100% migration, cells har bouring antisense to HAS2 were inhibited in migration by 0024 FIG. 10 are graphical and photographical represen 93%. tations of mRNA expression of the hyaluronan synthase family and immunodetection of HAS2 in parental MDA-MB 0021 FIG. 7 is the graphical representation of the effect 231 and antisense transfectants, respectfully. A: Total RNA of antisense HAS2 inhibition on the tumorgenicity and was extracted from exponentially dividing cultures of paren metastasis of MDA MB 231. A: Parental, mock and tal MDA-MB 231, mock transfectants and stable clones ASHAS2 transfectants were inoculated into the mammary expressing ASHAS2 mRNA. The level of mRNA for HAS2 fat pad of nude mice. Primary tumor growth was followed was quantitated by real time RT-PCR. B. Immunodetection over a 12 week period following implantation after which of HAS2 protein on stable clones expressing antisense the extent of metastasis to other organs detected using Alu mRNA to HAS2 parental MDA-MB 231 and, C: on the PCR. Mice inoculated with parental or mock transfected parental MDA-MB 231 cell line. (Scale bar 20 um). MDA MB 231 readily established primary tumors which were comparable in growth over the duration of the 12 week 0025 FIG. 11 is a graphical representation comparing experiment. Mice inoculated with parental or mock trans hyaluronidase gene expression by parental, mock and HAS2 fected MDA MB 231 readily established primary tumors antisense transfected MDA-MB 231. Total RNA extracted which were comparable in growth over the duration of the from parental, mock and ASHAS2 transfected MDA-MB 12 week experiment. In contrast, however, mice inoculated 231 was analysed by RT-PCR to detect the presence of the with ASHAS2 transfectants did not establish primary hyaluronidase genes, HYAL-1, 2 and 3. PCR products were tumors. B: Soft organ metastasis in mice inoculated with resolved by agarose gel electrophoresis containing ethidium parental, mock and antisense transfected MDA MD 231. As bromide. Band volume in stained gels was then subjected to assessed by Alu PCR, metastasis was most prevalent in densitometric analysis to allow comparison of levels for brain, and lung but was also detected in kidneys and the liver each HYAL gene expression between parental, mock and in samples prepared from mice injected with either parental ASHAS2 transfected cells. Closed bar: HYAL1; open bar. or mock transfectant MDA-MD 231 cells. No metastasis HYAL2; diagonal hatched bar: HYAL3. Note: percentage could be found in the aforementioned organs in mice that variance between triplicate determinations <2%. were injected with ASHAS2 transfectants. 0026 FIG. 12 is a photographical representation showing 0022 FIG. 8 is a diagrammatic representation demon Immunohistochemical reactivity of parental MDA-MB 231 strating HAS 2 and HAS3 liberate high molecular weight and antisense transfectants to CD44. Sub-confluent stable HA which is rapidly depolymerised. MDA-MB 231 cells transfectants of MDA-MB 231 expressing antisense mRNA were seeded at 7.5x10 cells/75 cm culture flask and were to HAS2 (A), and (B) parental MDA-MB 231 were reacted grown for 24 h in growth media containing ta.00 ug/ml DS with an anti-human CD44. (Scale bar 20 um). and 250 uCi D-6-Hlglucosamine. At the conclusion of the 0027 FIG. 13 is a graphical representation of the quan incubation, the media and cell-associated HA was removed tification and comparison of hyaluronan synthesis in paren and dialysed (M. exclusion of 5 kDa). After substantiation tal, mock and ASHAS2 transfected MDA-MB 231. Cells that the non-dialysable Dpm was HA (as determined by were seeded at 2.5x10/cells in 25 cm culture flasks and Streptomyces hyaluronidase digestion) it was subjected to incubated at 37° C. for 24, 48,72, 96, 120 and 144 h. At each size exclusion chromatography in a Sephacryl S-1000 gel time point cells were trypsinised and quantitated using an US 2007/0286856 A1 Dec. 13, 2007

automated coulter counter. HA concentration in the har fat pad of nude mice. Primary tumor growth was followed vested culture medium was determined using a hyaluronic over a 12-week period with tumour progression recorded acid binding protein (HABP) assay. HA synthesis by paren twice weekly. The results graphed represent the average tal and mock transfected MDA-MB 231 was expressed as tumor volume (mm)+SEM, where n=9-13. B: Alu PCR was HA synthesised (pg/cell). Data represent the average of utilised to determine the extent of soft organ metastasis from triplicate determinations at each time point-tSD. A-A: paren brain, kidney, liver and lung. Results are expressed as the tal MDA-MB 231: O-O: mock transfectants; -: percentage of human tumour DNA in mouse soft organs, ASHAS2 transfectants. n=8 per group. 0028 FIG. 14 is a graphical representation of the char 0032 FIG. 18 is a graphical representation showing the acterisation of the molecular weight of HA synthesised by effect of HAS2 antisense inhibition on the metastasis and in parental and MDA-MB 231 stable transfectants harbouring animal survival. A: Alu PCR was utilised to determine the ASHAS2. Cells were seeded at 7.5x10 cells in 75 cm extent of Soft organ metastasis after intracardiac inoculation culture flasks and grown for 24 h in complete medium of nude mice from brain, kidney, liver, lung and bone. supplemented with 250 uCi of D-6-H-glucosamine Results are expressed as the percentage of human tumour hydrochloride. To determine the MW of H-HA in the DNA in mouse Soft organs, n=9 per group. No metastasis to medium, samples were subjected to size exclusion chroma these organs could be detected where animals had been tography on a Sephacryl S-1000 SF eluted in 0.15M NaCl/ inoculated with MDA-MB 231 ASHAS2 transfected cells. phosphate pH 7.25 at 13.6 ml/h. This figure demonstrates the B: Survival rate of the parental, mock and ASHAS2 trans differences in molecular weight synthesised by parental fectants mice were plotted using Prism stats program MDA-MB 231 and their transfected counterparts harbouring (Kaplan-Meier Survival) with the days elapsed following antisense mRNA to HAS2. Eluted fractions were proven to intracardiac inoculations. There were no different in the be HA as determined by Streptomyces hyaluronidase diges animal survival rate (P=0.0840) between the parental and tion. (O-O: parental cell line; O-O: ASHAS2 MDA-MBA mock transfected mice. Survival curve for ASHAS2 was 231 stable transfectants) significantly different (P<0.0001) from the both control groups. MDA-MB 231 ASHAS2 transfectants (solid); 0029 FIG. 15 is a graphical representation showing the parental cell line (short dash); mock transfectants (long effect of antisense inhibition of HAS2 on cell proliferation dash). and cell cycle in parental, mock and ASHAS2 transfected MDA-MB 231. A: Parental, mock and ASHAS2 transfec tants were harvested at approximately 80% confluency and DETAILED DESCRIPTION OF THE seeded in to 24-well plates at a cell density of 5x10 PREFERRED EMBODIMENTS cells/well (2.5 cm). The rate of cell growth was then 0033. The present invention employs compounds, pref followed for 24, 48, 72, and 96 h after plating. All cell counts erably nucleotides and similar species for use in modulating were determined using an automated Coulter counter. Data the function of HAS or the expression of nucleic acid represents the average of triplicate determinations at each molecules encoding HAS and, in a particular embodiment, time point-SD. : ASHMS2 stable transfectants; A: paren HAS1, HAS2 and/or HAS3 or of a nucleic acid molecule tal cell line; O: mock transfectants. Note: percentage vari required for or which facilitate expression of HAS genetic ance between triplicate determinations <2%. B: The trans material (e.g. a promoter region). As used herein, reference fected and control cells were seeded at 2x10 cells/25 cm to HAS includes any molecule with the same function. In a flask in the presence of 2 mM thymidine and grown until preferred aspect, reference to “HAS’, includes reference to 50% confluent. Cells were harvested and the proportion of the isoforms HAS1, HAS2 or HAS3. In a particularly cells in a particular cell cycle stage was then determined in preferred embodiment, the HAS is HAS2 or HAS3. The a FACS-CaliburTM analytical instrument. B: population of present invention also employs compounds, preferably cells in Go/G1; C: in S phase, and D: in G/M phase. Note: nucleotides and similar species for use in modulating the the delay in 24 hours of entry into S phase in the ASHAS2 function of HYAL or the expression of nucleic acid mol MDA-MB 231 transfectants. ; ASHAS2 stable transfec ecules encoding HYAL and, in a particular embodiment, tants; A: parental cell line; O: mock transfectants. HYAL1, HYAL2, HYAL3 and/or PH-20 of a nucleic acid molecule required for or which facilitate expression of 0030 FIG. 16 is graphical representation showing inhi HYAL genetic material (e.g. a promoter region). As used bition of in vitro invasiveness of MDA-MB 231 expressing antisense mRNA to HAS2. The invasive potential of paren herein, reference to HYAL includes any molecule with the tal MDA-MB 231, mock (vector only) and antisense HAS2 same function. In a preferred aspect, reference to “HYAL’. transfected cells were examined using the Boyden chamber includes reference to the isoforms HYAL1, HYAL2, HYAL3 chemoinvasion assay. The cells that had traversed the matri and/or PH-20. In a particularly preferred embodiment, the gel and spread on the lower surface of the filter were HYAL is HYAL1, HYAL2 or HYAL3. expressed as a percentage of the cell count determined for 0034. Accordingly, one aspect of the present invention the parental MDA-MB 231 cell line. The data presented provides an isolated compound capable of reducing the level represent the average of triplicate experiments performed on of hyaluronan synthase (HAS) and/or hyaluronidase or the two separate days +SD. Note: percentage variance between function or activity of HAS and or HYAL. triplicate determinations <2%. 0035) In one embodiment, the compounds of the present 0031 FIG. 17 is a graphical representation showing the invention down regulate expression of HAS and HYAL effect of HAS2 antisense inhibition on the tumorgenicity and genetic material. This is accomplished by providing oligo metastasis in MDA-MB 231. A: Parental, mock and nucleotides which specifically hybridize or otherwise inter ASHAS2 transfectants were inoculated into the mammary act with one or more nucleic acid molecules encoding HAS US 2007/0286856 A1 Dec. 13, 2007

and/or HYAL or a nucleic acid molecule required for or 0040. A sense compound includes RNAi or other com which facilitates HAS and/or HYAL gene expression. As plex which includes PTGS. used herein, the terms “nucleic acid' and “nucleic acid molecule encoding HAS or HYAL have been used for 0041. In the present invention the phrase “stringent convenience to encompass DNA encoding HAS, RNA hybridization conditions' or “stringent conditions' refers to (including pre-mRNA and mRNA or portions thereof) tran conditions under which a compound of the invention will scribed from such DNA, and also cDNA derived from such hybridize to its target sequence, but to a minimal number of RNA. The hybridization or interaction of a compound of the other sequences. Stringent conditions are sequence-depen present invention with a target nucleic acid may encompass dent and will be different in different circumstances and in antisense or sense targeting. The latter is referred to herein the context of this invention, “stringent conditions’ under as sense Suppression. Consequently, the present invention which oligomeric compounds hybridize to a target sequence provides for antisense or sense inhibition. Such antisense or are determined by the nature and composition of the oligo sense inhibition is typically based upon hydrogen bonding meric compounds and the assays in which they are being based hybridization of oligonucleotide strands or segments investigated. Such that at least one strand or segment is cleaved, degraded, 0042 “Complementary, as used herein, refers to the or otherwise rendered inoperable. Alternatively, post-tran capacity for precise pairing between two nucleotides of an Scriptional gene silencing (PTGS) may be achieved using oligomeric compound. For example, if a nucleotide at a sense Suppression (formally known as co-suppression). In certain position of an oligonucleotide (an oligomeric com yet another alternative, complexes comprising nucleic acid pound), is capable of hydrogen bonding with a nucleotide at molecules and proteins (e.g. ribonucleases) Such as RNAi. a certain position of a target nucleic acid, said target nucleic ribozymes and DNAZymes may be employed. acid being a DNA, RNA, or oligonucleotide molecule, then the position of hydrogen bonding between the oligonucle 0036) The target nucleic acid molecules include the HAS otide and the target nucleic acid is considered to be a and HYAL coding sequences, a promoter region, a 3' regu complementary position. The oligonucleotide and the fur latory region or a nucleotide sequence, the expression of ther DNA, RNA, or oligonucleotide molecule are comple which, facilitates or inhibits HAS or HYAL gene expression mentary to each other when a sufficient number of comple (e.g. a regulatory gene, activator gene or reporter gene). mentary positions in each molecule are occupied by 0037. The functions of the nucleic acid molecule to be nucleotides which can hydrogen bond with each other. Thus, down regulated include replication, transcription and/or “specifically hybridizable” and “complementary” are terms translation. Where the nucleic acid molecule is RNA, the which are used to indicate a sufficient degree of precise compounds may target translocation of the RNA to a site of pairing or complementarity over a sufficient number of protein translation, translocation of the RNA to sites within nucleotides Such that stable and specific binding occurs the cell which are distant from the site of RNA synthesis, between the oligonucleotide and a target nucleic acid. translation of protein from the RNA, splicing of the RNA to 0043. It is understood in the art that the sequence of an yield one or more RNA species, and catalytic activity or antisense or sense compound need not be 100% comple complex formation involving the RNA which may be mentary to that of its target nucleic acid to be specifically engaged in or facilitated by the RNA. One preferred result hybridizable. Moreover, an oligonucleotide may hybridize of Such interference with target nucleic acid function is over one or more segments such that intervening or adjacent reduction in the level of expression of HAS and/or HYAL segments are not involved in the hybridization event (e.g., a genetic material and, hence, levels of HAS and/or HYAL. loop structure or hairpin structure). It is preferred that the Inhibition is the preferred form of modulation of expression antisense or sense compounds of the present invention and mRNA is the preferred target nucleic acid. comprise at least 70% sequence complementarity to a target 0038. In the context of this invention, “hybridization” region within the target nucleic acid, such as 71, 72, 73, 74. means the pairing of complementary Strands of nucleic 75, 76, 77, 78, 79,80, 81, 82, 83, 84, 85, 86, 87, 88, 89,90, acids. In the present invention, the preferred mechanism of 91, 92,93, 94, 95, 96, 97.98, 99 or 100% complementarity pairing involves hydrogen bonding, which may be Watson to the nucleic acid sequence to which they are targeted. For Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, example, an antisense or sense compound in which 18 out of between complementary nucleoside or nucleotide bases 20 nucleotides of the antisense or sense compound are (nucleotides) of the strands of oligomeric compounds. For complementary to a target region, and would therefore example, adenine and thymine are complementary nucle specifically hybridize, would represent 90 percent comple otides which pair through the formation of hydrogen bonds. mentarity. In this example, the remaining noncomplemen Hybridization can occur under varying circumstances. tary nucleotides may be clustered or interspersed with complementary nucleotides and need not be contiguous to 0039. An antisense or sense compound is specifically each other or to complementary nucleotides. As such, an hybridizable when binding of the compound to the target antisense or sense compound which is 18 nucleotides in nucleic acid interferes with the normal function of the target length having 4 (four) noncomplementary nucleotides which nucleic acid to cause a loss of activity, and there is a are flanked by two regions of complete complementarity Sufficient degree of complementarity to avoid non-specific with the target nucleic acid would have 77.8% overall binding of the antisense or sense compound to non-target complementarity with the target nucleic acid and would thus nucleic acid sequences under conditions in which specific fall within the scope of the present invention. Percent binding is desired, i.e., under physiological conditions in the complementarity of an antisense or sense compound with a case of in Vivo assays or therapeutic treatment, and under region of a target nucleic acid can be determined routinely conditions in which assays are performed in the case of in using BLAST programs (basic local alignment search tools) vitro assays. and PowerBLAST programs known in the art (Altschul et US 2007/0286856 A1 Dec. 13, 2007

al., J. Mol. Biol. 215: 403-410, 1990; Zhang and Madden, ing a plurality of monomeric units. In the context of this Genome Res. 7: 649-656, 1997). invention, the term "oligonucleotide' refers to an oligomer 0044 According to the present invention, compounds or polymer of ribonucleic acid (RNA) or deoxyribonucleic include antisense or sense nucleic acids, antisense or sense acid (DNA) or mimetics, chimeras, analogs and homologs oligomeric compounds, antisense or sense oligonucleotides, thereof. This term includes oligonucleotides composed of ribozymes, sense oligonucleotides, full-length sense mol naturally occurring nucleotides, Sugars and covalent inter ecules, external guide sequence (EGS) oligonucleotides, nucleoside (backbone) linkages as well as oligonucleotides alternate splicers, primers, probes, and other oligomeric having non-naturally occurring portions which function compounds which hybridize to at least a portion of the target similarly. Such modified or substituted oligonucleotides are nucleic acid. As such, these compounds may be introduced often preferred over native forms because of desirable in the form of single-stranded, double-stranded, circular or properties such as, for example, enhanced cellular uptake, hairpin oligomeric compounds and may contain structural enhanced affinity for a target nucleic acid and increased elements such as internal or terminal bulges or loops. Once stability in the presence of nucleases. introduced to a system, the compounds of the invention may 0051 While oligonucleotides are a preferred form of the elicit the action of one or more enzymes or structural compounds of this invention, the present invention compre proteins to effect modification of the target nucleic acid. hends other families of compounds as well, including but not 0045. As used herein, an “antisense' or “sense' molecule limited to oligonucleotide analogs and mimetics Such as includes an RNA molecule which, by binding to a comple those herein described. mentary sequence in either RNA or DNA, inhibits the 0052 The compounds in accordance with this invention function and/or completion of synthesis of the latter mol preferably comprise from about 10 to about 2000 nucle ecule. It is involved in various regulatory systems in vivo. otides (i.e. from about 10 to about 2000 linked nucleosides). Artificial antisense or sense RNAs have been used to inhibit One of ordinary skill in the art will appreciate that the translation of specific mRNA molecules both in living cells invention embodies compounds of 10, 11, 12, 13, 14, 15, 16, (eukaryotic and bacterial) and in cell-free systems. 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 0046) One non-limiting example of such an enzyme is 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, RNAse H, a cellular endonuclease which cleaves the RNA 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, strand of an RNA:DNA duplex. It is known in the art that 65, 66, 67,68, 69, 70, 71, 72,73, 74, 75, 76, 77, 78,79, 80, single-stranded antisense or sense compounds which are 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, “DNA-like' elicit RNAse H. Activation of RNase H, there 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310,320, fore, results in cleavage of the RNA target, thereby greatly 330, 340, 350, 360, 370, 380,390, 400, 410, 420, 430, 440, enhancing the efficiency of oligonucleotide-mediated inhi 450, 460, 470, 480,490, 500,510,520, 530, 540, 550,560, bition of gene expression. Similar roles have been postulated 570, 580, 590, 600, 610, 620, 630, 640, 650, 660, 670, 680, for other ribonucleases such as those in the RNase III and 690, 700, 710, 720, 730, 740, 750, 760, 770, 780, 790, 800, ribonuclease L family of enzymes. 810, 820, 830, 840, 850, 860, 870, 880, 890, 900, 910, 920, 930, 940, 950, 960, 970, 980, 990, 1000, 1010, 1020, 1030, 0047 While the preferred form of antisense or sense 1040, 1050, 1060, 1080, 1090, 1100, 1110, 1120, 1130, compounds are single-stranded oligonucleotides, in many 1140, 1150, 1160, 1170, 1180, 1190, 1200, 1210, 1220, species the introduction of double-stranded structures, such 1230, 1240, 1250, 1260, 1270, 1280, 1290, 1300, 1310, as double-stranded RNA (dsRNA) molecules, miRNAs, 1320, 1330, 1340, 1350, 1360, 1370, 1380, 1390, 1400, short-interfering RNA molecules (siRNA) and full-length 1410, 1420, 1430, 1440, 1450, 1460, 1470, 1480, 1490, dsRNAs. 1500, 1510, 1520, 1530, 1540, 1550, 1560, 1570, 1580, 0.048 Small interfering RNAs (siRNAs) have an integral 1590, 1600, 1610, 1620, 1630, 1640, 1650, 1660, 1670, role in the phenomenon of RNA interference (RNAi). In 1680, 1690, 1700, 1710, 1720, 1730, 1740, 1750, 1760, RNAi dsRNAs introduced into certain organisms or cells 1770, 1780, 1790, 1800, 1810, 1820, 1830, 1840, 1850, are degraded into approximately 22 nucleotide fragments. 1860, 1870, 1880, 1890, 1900, 1910, 1920, 1930, 1940, These 22 nucleotide siRNA molecules then bind to the 1950, 1960, 1970, 1980, 1990 or 2000 nucleotides in length. complementary portion of their target mRNA and tag it for 0053 Antisense or sense compounds 10-2000 nucle degradation. otides in length comprising a stretch of at least ten (10) Such 0049. A second class of regulatory small RNAs contem as 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, plated by the present invention are referred to as small 25, 26, 27, 28, 29 or 30 consecutive nucleotides selected temporal RNAs. Approximately 22 nucleotide lin-4 and from within the illustrative antisense or sense compounds let-7 RNAs are example of this group. These RNA mol are considered to be suitable antisense or sense compounds ecules have a role in temporal regulation of C. elegans as well. development. These are initially processed from an approxi 0054 Exemplary preferred antisense or sense compounds mate 70 nucleotide ssRNA transcript folded into a stem loop include oligonucleotide sequences that comprise at least the structure. After processing, these stRNAS are thought to 10 consecutive nucleotides from the 5'-terminus of one of prevent translation of their target mRNAs by binding to the the illustrative preferred antisense or sense compounds (the targets complementary 3' untranslated regions (UTRS). remaining nucleotides being a consecutive stretch of the Dicer, RNAase enzyme processes both the types of RNAs same oligonucleotide beginning immediately upstream of (Grishok et al. Science 287(562):2494-2497, 2000). the 5'-terminus of the antisense or sense compound which is 0050. In the context of this invention, the term "oligo specifically hybridizable to the target nucleic acid and con meric compound” refers to a polymer or oligomer compris tinuing until the oligonucleotide contains about 10 to about US 2007/0286856 A1 Dec. 13, 2007

2000 nucleotides). Similarly preferred antisense or sense tiguous nucleotides in either direction (i.e., 5' or 3') from a compounds are represented by oligonucleotide sequences translation initiation codon. Similarly, the terms "stop codon that comprise at least the 10 consecutive nucleotides from region' and “translation termination codon region” refer to the 3'-terminus of one of the illustrative preferred antisense a portion of Such an mRNA or gene that encompasses from or sense compounds (the remaining nucleotides being a about 25 to about 50 contiguous nucleotides in either consecutive stretch of the same oligonucleotide beginning direction (i.e., 5' or 3') from a translation termination codon. immediately downstream of the 3'-terminus of the antisense Consequently, the 'start codon region’ (or “translation ini or sense compound which is specifically hybridizable to the tiation codon region') and the 'stop codon region’ (or target nucleic acid and continuing until the oligonucleotide “translation termination codon region') are all regions contains about 10 to about 2000 nucleotides). One having which may be targeted effectively with the antisense or sense skill in the art armed with the preferred antisense or sense compounds of the present invention. compounds illustrated herein will be able, without undue 0059. The open reading frame (ORF) or “coding region.” experimentation, to identify further preferred antisense or which is known in the art to refer to the region between the sense compounds. translation initiation codon and the translation termination 0.055 Candidate compounds are also referred to herein as codon, is also a region which may be targeted effectively. “lead compounds. In the present invention, the target Within the context of the present invention, a preferred nucleic acid encodes HAS or HYAL or is a gene required for region is the intragenic region encompassing the translation HAS or HYAL gene expression. As indicated above, the initiation or termination codon of the open reading frame term “HAS’ includes isoforms HAS1, HAS2 and HAS3. (ORF) of a gene. HAS2 and HAS3 are particularly preferred. As indicated 0060. Other target regions include the 5' untranslated above, the term “HYAL includes isoforms HYAL1, region (5' UTR), known in the art to refer to the portion of an HYAL2, HYAL3 and PH-20. HYAL1, HYAL2 and HYAL3 mRNA in the 5' direction from the translation initiation are particularly preferred. codon, and thus including nucleotides between the 5' cap site and the translation initiation codon of an mRNA (or corre 0056. The targeting process usually also includes deter sponding nucleotides on the gene), and the 3' untranslated mination of at least one target region, segment, or site within region (3'UTR), known in the art to refer to the portion of an the target nucleic acid for the antisense or sense interaction mRNA in the 3' direction from the translation termination to occur Such that the desired effect, e.g., to reduce expres codon, and thus including nucleotides between the transla sion, will result. Within the context of the present invention, tion termination codon and 3' end of an mRNA (or corre the term “region' is defined as a portion of the target nucleic sponding nucleotides on the gene). The 5' cap site of a acid having at least one identifiable structure, function, or mRNA comprises an N7-methylated guanosine residue characteristic. Within regions of target nucleic acids are joined to the 5'-most residue of the mRNA via a 5'-5' segments. "Segments' are defined as Smaller or Sub-portions triphosphate linkage. The 5' cap region of an mRNA is of regions within a target nucleic acid. “Sites, as used in the considered to include the 5' cap structure itself as well as the present invention, are defined as positions within a target first 50 nucleotides adjacent to the cap site. It is also nucleic acid. preferred to target the 5' cap region. 0057 Since, as is known in the art, the translation ini 0061 Although some eukaryotic mRNA transcripts are tiation codon is typically 5'-AUG (in transcribed mRNA directly translated, many contain one or more regions, molecules; 5'-ATG in the corresponding DNA molecule), the known as “introns,” which are excised from a transcript translation initiation codon is also referred to as the “AUG before it is translated. The remaining (and therefore trans codon, the “start codon’ or the “AUG start codon’. A lated) regions are known as "exons' and are spliced together minority of genes have a translation initiation codon having to form a continuous mRNA sequence. Targeting splice the RNA sequence 5'-GUG, 5'-UUG or 5'-CUG, and sites, i.e., intron-exon junctions or exon-intron junctions, 5'-AUA, 5'-ACG and 5'-CUG have been shown to function may also be particularly useful in situations where aberrant in vivo. Thus, the terms “translation initiation codon’ and splicing is implicated in disease, or where an overproduction “start codon’ can encompass many codon sequences, even of a particular splice product is implicated in disease. though the initiator amino acid in each instance is typically Aberrant fusionjunctions due to rearrangements or deletions methionine (in eukaryotes). It is also known in the art that are also preferred target sites. mRNA transcripts produced eukaryotic genes may have two or more alternative start via the process of splicing of two (or more) mRNAs from codons, any one of which may be preferentially utilized for different gene Sources are known as “fusion transcripts. It translation initiation in a particular cell type or tissue, or is also known that introns can be effectively targeted using under a particular set of conditions. In the context of the antisense or sense compounds targeted to, for example, invention, “start codon’ and “translation initiation codon’ DNA or pre-mRNA. refer to the codon or codons that are used in vivo to initiate 0062. It is also known in the art that alternative RNA translation of an mRNA transcribed from a gene encoding transcripts can be produced from the same genomic region HAS, regardless of the sequence(s) of such codons. It is also of DNA. These alternative transcripts are generally known known in the art that a translation termination codon (or as “variants'. More specifically, “pre-mRNA variants’ are “stop codon”) of a gene may have one of three sequences, transcripts produced from the same genomic DNA that differ i.e., 5'-UAA, 5'-UAG and 5'-UGA (the corresponding DNA from other transcripts produced from the same genomic sequences are 5'-TAA, 5'-TAG and 5'-TGA, respectively). DNA in either their start or stop position and contain both 0.058. The terms “start codon region' and “translation intronic and exonic sequence. initiation codon region” refer to a portion of such an mRNA 0063. Upon excision of one or more exon or intron or gene that encompasses from about 25 to about 50 con regions, or portions thereof during splicing, pre-mRNA US 2007/0286856 A1 Dec. 13, 2007 variants produce smaller “mRNA variants”. Consequently, chosen which are sufficiently complementary to the target, mRNA variants are processed pre-mRNA variants and each i.e., hybridize sufficiently well and with sufficient specificity, unique pre-mRNA variant must always produce a unique to give the desired effect, i.e. to reduce HAS and/or HYAL mRNA variant as a result of splicing. These mRNA variants gene expression or levels of HAS and/or HYAL. are also known as “alternative splice variants'. If no splicing 0070). In a further embodiment, the “preferred target of the pre-mRNA variant occurs then the pre-mRNA variant segments' identified herein may be employed in a screen for is identical to the mRNA variant. additional compounds that modulate the expression of the 0064. It is also known in the art that variants can be HAS and/or HYAL gene. “Modulators' are those com produced through the use of alternative signals to start or pounds that decrease or increase the expression of a nucleic stop transcription and that pre-mRNAs and mRNAs can acid molecule encoding HAS and/or HYAL and which possess more that one start codon or stop codon. Variants comprise at least a 10-nucleotide portion which is comple that originate from a pre-mRNA or mRNA that use alterna mentary to a preferred target segment. The screening method tive start codons are known as “alternative start variants' of comprises the steps of contacting a preferred target segment that pre-mRNA or mRNA. Those transcripts that use an of a nucleic acid molecule encoding HAS and/or HYAL with alternative stop codon are known as 'alternative stop vari one or more candidate modulators, and selecting for one or ants of that pre-mRNA or mRNA. One specific type of more candidate modulators which decrease or increase the alternative stop variant is the “polyA variant in which the expression of a nucleic acid molecule encoding HAS and/or multiple transcripts produced result from the alternative HYAL. Once it is shown that the candidate modulator or selection of one of the “polyA stop signals' by the tran modulators are capable of modulating (e.g. either decreasing Scription machinery, thereby producing transcripts that ter or increasing) the expression of a nucleic acid molecule minate at unique polyA sites. Within the context of the encoding HAS and/or HYAL the modulator may then be invention, the types of variants described herein are also employed in further investigative studies of the function of preferred target nucleic acids. HAS and/or HYAL, or for use as a research, diagnostic, or 0065. The locations on the target nucleic acid to which therapeutic agent in accordance with the present invention. the preferred antisense or sense compounds hybridize are 0071. The preferred target segments of the present inven hereinbelow referred to as “preferred target segments.” As tion may be also be combined with their respective comple used herein the term “preferred target segment' is defined as mentary antisense or sense compounds of the present inven at least a 10-nucleotide portion of a target region to which tion to form stabilized double-stranded (duplexed) an active antisense or sense compound is targeted. While not oligonucleotides. wishing to be bound by theory, it is presently believed that these target segments represent portions of the target nucleic 0072 Such double stranded oligonucleotide moieties acid which are accessible for hybridization. have been shown in the art to modulate target expression and regulate translation as well as RNA processsing via an 0.066 While the specific sequences of certain preferred antisense or sense mechanism. Moreover, the double target segments are set forth herein, one of skill in the art Stranded moieties may be subject to chemical modifications will recognize that these serve to illustrate and describe (Fire et al., Nature 391:806-811, 1998; Timmons and Fire, particular embodiments within the scope of the present Nature 395: 854, 1998; Timmons et al., Gene 263: 103-112, invention. Additional preferred target segments may be 2001; Tabara et al., Science 282: 430-431, 1998; Montgom identified by one having ordinary skill. ery et al., 1998, supra; Tuschl et al., Genes Dev. 13: 0067 Target segments 10-2000 nucleotides in length 3.19.1-3197, 1999: Elbashir et al., Nature, 411: 494-498, comprising a stretch of at least ten (10) consecutive nucle 2001: Elbashir et al., Genes Dev. 15: 188-200, 2001). For otides selected from within the illustrative preferred target example, such double-stranded moieties have been shown to segments are considered to be suitable for targeting as well. inhibit the target by the classical hybridization of antisense 0068 Target segments can include DNA or RNA or sense Strand of the duplex to the target, thereby triggering sequences that comprise at least the 8 consecutive nucle enzymatic degradation of the target (Tijsterman et al., 2002, otides from the 5'-terminus of one of the illustrative pre Supra). ferred target segments (the remaining nucleotides being a consecutive stretch of the same DNA or RNA beginning 0073. As indicated above, the present invention further immediately upstream of the 5'-terminus of the target seg contemplates interactive molecules specific for a HAS. ment and continuing until the DNA or RNA contains about including one or more of HAS1, 2 and/or 3 and which 10 to about 2000 nucleotides). Similarly preferred target modify HAS function or activity. As indicated above, the segments are represented by DNA or RNA sequences that present invention further contemplates interactive molecules comprise at least the 10 consecutive nucleotides from the specific for a HYAL, including one or more of HYAL1, 3'-terminus of one of the illustrative preferred target seg HYAL2, HYAL3 and/or PH-20 and which modify HYAL ments (the remaining nucleotides being a consecutive stretch function or activity. of the same DNA or RNA beginning immediately down 0074 The present invention provides, therefore, antago stream of the 3'-terminus of the target segment and continu nists of HAS and/or HYAL function or activity. Such antago ing until the DNA or RNA contains about 10 to about 2000 nists are useful in reducing the effects of HAS and/or HYAL nucleotides). One having skill in the art armed with the and hence reducing or elevating levels of HA. preferred target segments illustrated herein will be able, 0075) The term “antagonist” includes a modified HAS without undue experimentation, to identify further preferred and/or HYAL molecule or HAS and/or HYAL substrate as target Segments. well as their homologs or chemical equivalent or analogs. In 0069. Once one or more target regions, segments or sites a preferred embodiment, it encompasses interactive mol have been identified, antisense or sense compounds are ecules Such as antibodies and Small molecule inhibitors. US 2007/0286856 A1 Dec. 13, 2007

0.076 The present invention provides, therefore, interac 0084. One method for producing an antibody of the tive molecules such as but not limited to antibodies and other present invention comprises immunizing a non-human ani immunoglobulins including fragments, derivatives, antigen mal. Such as a mouse or a transgenic mouse, with HAS binding portions, recombinant forms, chimeric forms as well and/or HYAL molecule or immunogenic parts thereof as deimmunized including humanized forms thereof whereby antibodies directed against the HAS and/or HYAL directed to the subject modulators and small molecule molecule or immunogenic parts are generated in said ani inhibitors. mal. Various means of increasing the antigenicity of a particular immunogen, such as administering adjuvants or 0.077 Accordingly, in a preferred aspect the present conjugated antigens, comprising the antigen against which invention provides antibodies that bind, interactor otherwise an antibody response is desired and another component, are associate with HAS and/or HYAL and which reduce HAS well known to those in the art and may be utilized. Immu and/or HYAL function or activity. nizations typically involve an initial immunization followed 0078. The antibodies maybe monoclonal or polyclonal by a series of booster immunizations. Animals may be bled antibodies, although, monoclonal antibodies are preferred. and the serum assayed for antibody titer. Animals may be Generally, the antibodies are in isolated, homogenous or boosted until the titer plateaus. Conjugates may be made in fully or partially purified form. recombinant cell culture as protein fusions. Also, aggregat 0079 The antibodies may also be humanized or chimeric ing agents such as alum are Suitably used to enhance the or are human antibodies suitable for administration to immune response. humans. These include humanized antibodies prepared, for 0085. Both polyclonal and monoclonal antibodies can be example, from murine monoclonal antibodies, and human produced by this method. The methods for obtaining both monoclonal antibodies which may be prepared, for example, types of antibodies are well known in the art. Polyclonal using transgenic mice as described below, or by phage antibodies are less preferred but are relatively easily pre display. A “humanized' antibody includes a deimmunized pared by injection of a suitable laboratory animal with an antibody. effective amount of a modified LIF molecule, or immuno 0080 Preferably, antibodies are raised against a HAS genic parts thereof, collecting serum from the animal and such as HAS1, 2 or 3 or immunogenic parts thereof or isolating modified LIF molecule specific antibodies by any immunologically homologous molecules. Preferably, anti of the known immunoabsorbent techniques. Antibodies pro bodies are raised against a HYAL such as HYAL1, 2 or 3 or duced by this technique are generally less favoured, because immunogenic parts thereof or immunologically homologous of the potential for heterogeneity of the product. molecules. 0086) The use of monoclonal antibodies is particularly 0081 Reference to an “antibody” or “antibodies” preferred because of the ability to produce them in large includes reference to all the various forms of antibodies, quantities and the homogeneity of the product. Monoclonal including but not limited to: full antibodies (e.g. having an antibodies may be produced by conventional procedures. intact Fc region), including, for example, monoclonal anti 0087. The term “monoclonal antibody” as used herein bodies; antigen-binding antibody fragments, including, for refers to an antibody obtained from a population of Substan example, Fv, Fab, Fab' and F(ab')2 fragments; humanized tially homogeneous antibodies, i.e., the individual antibod antibodies; human antibodies (e.g., produced in transgenic ies comprising the population are identical except for pos animals or through phage display); and immunoglobulin sible naturally occurring mutations that may be present in derived polypeptides produced through genetic engineering minor amounts. Monoclonal antibodies are highly specific, techniques. Unless otherwise specified, the terms “antibody” being directed against a single antigenic site. Furthermore, or “antibodies” and as used herein encompasses both full in contrast to conventional (polyclonal) antibody prepara antibodies and antigen-binding fragments thereof. tions which typically include different antibodies directed 0082 Unless stated otherwise, specificity in respect of an against different determinants (epitopes), each monoclonal antibody of the present invention is intended to mean that the antibody is directed against a single determinant on the antibody binds Substantially only to its target antigen with no antigen. The modifier “monoclonal indicates the character appreciable binding to unrelated proteins. However, it is of the antibody as being obtained from a substantially possible that an antibody will be designed or selected to bind homogeneous population of antibodies, and is not to be to two or more related proteins. A related protein includes construed as requiring production of the antibody by any different splice variants or fragments of the same protein or particular method. For example, the monoclonal antibodies homologous proteins from different species. Such antibodies to be used in accordance with the present invention may be are still considered to have specificity for those proteins and made by the hybridoma method first described by Kohler et are encompassed by the present invention. The term “sub al., Nature 256:495 (1975), or may be made by recombinant stantially’ means in this context that there is no detectable DNA methods (see, e.g., U.S. Pat. No. 4,816,567). The binding to a non-target antigen above basal, i.e. non-specific, "monoclonal antibodies' may also be isolated from phage levels. antibody libraries using for example, the techniques 0083. The antibodies of the present invention may be described in Clackson et al., Nature 352:624-628, 1991 and prepared by well known procedures. See, for example, Marks et al., J. Mol. Biol. 222:581-597, 1991. Monoclonal Antibodies, Hybridomas: A New Dimension in 0088. The present invention contemplates a method for Biological Analyses, Kennet et al. (eds.), Plenum Press, producing a hybridoma cell line which comprises immuniz New York (1980); and Antibodies: A Laboratory Manual, ing a non-human animal. Such as a mouse or a transgenic Harlow and Lane (eds.), Cold Spring Harbor Laboratory mouse, with a HAS or immunogenic parts thereof harvest Press, Cold Spring Harbor, N.Y., (1988). ing spleen cells from the immunized animal; fusing the US 2007/0286856 A1 Dec. 13, 2007

harvested spleen cells to a myeloma cell line to generate 1989). Single chain antibodies derived from antibodies hybridoma cells; and identifying a hybridoma cell line that provided herein are encompassed by the present invention. produces a monoclonal antibody that binds to a HAS or 0095. In one embodiment, the present invention provides HYAL. antibody fragments or chimeric, recombinant or synthetic 0089. Such hybridoma cell lines and the HAS or HYAL forms of the antibodies of the present invention that bind to monoclonal antibodies produced by them are encompassed a HAS such as HAS1, 2 and/or 3. by the present invention. Monoclonal antibodies secreted by the hybridoma cell lines are purified by conventional tech 0096 Techniques are known for deriving an antibody of niques. Hybridomas or the monoclonal antibodies produced a different subclass or isotype from an antibody of interest, by them may be screened further to identify monoclonal i.e., Subclass Switching. Thus, IgG1 or IgG4 monoclonal antibodies may be derived from an IgM monoclonal anti antibodies with particularly desirable properties. body, for example, and vice versa. Such techniques allow the 0090 The HAS and/or HYAL molecule or immunogenic preparation of new antibodies that possess the antigen part thereof that may be used to immunize animals in the binding properties of a given antibody (the parent antibody), initial stages of the production of the antibodies of the but also exhibit biological properties associated with an present invention may be from any mammalian Source. antibody isotype or subclass different from that of the parent antibody. Recombinant DNA techniques may be employed. 0.091 Antigen-binding fragments of antibodies of the Cloned DNA encoding particular antibody polypeptides present invention may be produced by conventional tech may be employed in Such procedures, e.g. DNA encoding niques. Examples of Such fragments include, but are not limited to, Fab, Fab'. F(ab') and Fv fragments, including the constant region of an antibody of the desired isotype. single chain Fv fragments (termed sR v or scFv). Antibody 0097. The monoclonal production process described fragments and derivatives produced by genetic engineering above may be used in animals, for example mice, to produce techniques, such as disulphide Stabilized FV fragments monoclonal antibodies. Conventional antibodies derived (dsRV), single chain variable region domain (Abs) mol from Such animals, for example murine antibodies, are ecules, minibodies and diabodies are also contemplated for known to be generally unsuitable for administration to use in accordance with the present invention. humans as they may cause an immune response. Therefore, such antibodies may need to be modified in order to provide 0092 Such fragments and derivatives of monoclonal antibodies suitable for administration to humans. Processes antibodies directed against HAS and/or HYAL molecules may be prepared and screened for desired properties, by for preparing chimeric and/or humanized antibodies are well known techniques, including the assays described herein. known in the art and are described in further detail below. Certain of the techniques involve isolating DNA encoding a 0098. The monoclonal antibodies herein specifically polypeptide chain (or a portion thereof) of a mAb of interest, include “chimeric' antibodies in which the variable domain and manipulating the DNA through recombinant DNA tech of the heavy and/or light chain is identical with or homolo nology. The DNA may be fused to another DNA of interest, gous to corresponding sequences in antibodies derived from or altered (e.g. by mutagenesis or other conventional tech a non-human species (e.g., murine), while the remainder of niques) to add, delete, or Substitute one or more amino acid the chain(s) is identical with or homologous to correspond residues, for example. ing sequences in antibodies derived from humans, as well as 0093 DNA encoding antibody polypeptides (e.g. heavy fragments of Such antibodies, so long as they exhibit the or light chain, variable region only or full length) may be desired biological activity (U.S. Pat. No. 4,816,567; and isolated from B-cells of mice that have been immunized Morrison et al., Proc. Natl. Acad. Sci. USA 81:6851-6855, with modified LIF molecules. The DNA may be isolated 1984). using conventional procedures. Phage display is another 0099) “Humanized forms of non-human (e.g., murine) example of a known technique whereby derivatives of antibodies are chimeric antibodies which contain minimal antibodies may be prepared. In one approach, polypeptides sequence derived from the non-human immunoglobulin. For that are components of an antibody of interest are expressed the most part, humanized antibodies are human immuno in any Suitable recombinant expression system, and the globulins (recipient antibody) in which the complementarity expressed polypeptides are allowed to assemble to form determining regions (CDRs) of the recipient are replaced by antibody molecules. the corresponding CDRS from a non-human species (donor antibody) Such as mouse, rat, rabbit or nonhuman primate 0094 Single chain antibodies may be formed by linking having the desired properties, for example specificity, and heavy and light chain variable region (FV region) fragments affinity. In some instances, framework region residues of the via an amino acid bridge (short peptide linker), resulting in human immunoglobulin are replaced by corresponding non a single polypeptide chain. Such single-chain FVS (ScPVS) have been prepared by fusing DNA encoding a peptide human residues. Furthermore, humanized antibodies may linker between DNAs encoding the two variable region comprise residues which are not found in the recipient polypeptides (VL and VH). The resulting antibody frag antibody or in the donor antibody. ments can form dimers or trimers, depending on the length 0.100 These modifications are made to further refine of a flexible linker between the two variable domains (Kortt antibody performance. In general, the humanized antibody et al., Protein Engineering 10: 423, 1997). Techniques will comprise Substantially all of at least one, and typically developed for the production of single chain antibodies two, variable domains, in which all or substantially all of the include those described in U.S. Pat. No. 4,946,778; Bird complementarity determining regions correspond to those of (Science 242: 423, 1988), Huston et al. (Proc. Natl. Acad. a non-human immunoglobulin and all or Substantially all of Sci. USA 85: 5879, 1988) and Ward et al. (Nature 334: 544, the framework region residues are those of a human immu US 2007/0286856 A1 Dec. 13, 2007 noglobulin sequence. The humanized antibody optionally animals (e.g. cows, sheep, pigs, horses, donkeys), laboratory also will comprise at least a portion of an immunoglobulin test animals (e.g. mice, rats, guinea pigs, hamsters, rabbits), constant region (Fc), typically that of a human immunoglo companion animals (e.g. cats, dogs) and captured wild bulin. For further details, see Jones et al., Nature 321:522 animals (e.g. rodents, foxes, deer, kangaroos. A particularly 525, 1986; Reichmann et al., Nature 332:323-329, 1988: preferred host is a human, primate or livestock animal. Presta, Curr: Op. Struct. Biol. 2:593-596, 1992; Liu et al., 0106 The compounds of the present invention can be Proc. Natl. Acad. Sci. USA 84: 3439, 1987; Larrick et al., utilized for diagnostics, therapeutics, prophylaxis and as Bio/Technology 7: 934, 1989; and Winter and Harris, TIPS research reagents and kits. Furthermore, antisense or sense 14: 139, 1993. oligonucleotides or antibodies to HAS and/or HYAL which 0101 The complementarity determining regions (CDRs) are able to inhibit gene expression or HAS and/or HYAL of a given antibody may be readily identified, for example activity with exquisite specificity, are often used by those of using the system described by Kabat et al. in Sequences of ordinary skill to elucidate the function of particular genes or Proteins of Immunological Interest, 5th Ed., US Dept. of gene products or to distinguish between functions of various Health and Human Services, PHS, NIH, NIH Publication members of a biological pathway. No. 91-3242, 1991). 0.107 For use in kits and diagnostics, the compounds of 0102 Procedures for generating human antibodies in the present invention, either alone or in combination with non-human animals have been developed and are well other compounds or therapeutics, can be used as tools in known to those skilled in the art. For example, transgenic differential and/or combinatorial analyses to elucidate mice into which genetic material encoding one or more expression patterns of a portion or the entire complement of human immunoglobulin chains has been introduced may be genes expressed within cells and tissues. used to produce the antibodies of the present invention. 0108) As one non-limiting example, expression patterns Antibodies produced in the animals incorporate human within cells or tissues treated with one or more antisense or immunoglobulin polypeptide chains encoded by the human sense compounds are compared to control cells or tissues not genetic material introduced into the animal. Examples of treated with antisense or sense compounds and the patterns techniques for production and use of Such transgenic ani produced are analyzed for differential levels of gene expres mals are described in U.S. Pat. Nos. 5,814,318, 5,569,825, sion as they pertain, for example, to disease association, and 5,545,806, which are incorporated by reference herein. signalling pathway, cellular localization, expression level. 0103) Another method for generating human antibodies size, structure or function of the genes examined. In another is phage display. Phage display techniques for generating example, similar experiments are conducted with antibodies human antibodies are well known to those skilled in the art, to HAS. These analyses can be performed on stimulated or and include the methods used by companies such as Cam unstimulated cells and in the presence or absence of other bridge Antibody Technology and MorphoSys and which are compounds which affect expression patterns. described in International Patent Publication Nos. WO 0.109 Examples of methods of gene expression analysis 92/01047, WO92/20791, WO 93/06213 and WO 93/11236. known in the art include DNA arrays or microarrays 0104. The compounds of the present invention can also (Brazma and Vilo, FEBS Lett. 480: 17-24, 2000; Celis et al., be applied in the areas of drug discovery and target valida FEBS Lett. 480: 2-16, 2000), SAGE (serial analysis of gene tion. The present invention comprehends the use of the expression)(Madden et al., Drug Discov. Today 5: 415-425, compounds and preferred target segments identified herein 2000), READS (restriction enzyme amplification of digested in drug discovery efforts to elucidate relationships that exist cDNAs) (Prashar and Weissman, Methods Enzymol. 303: between HA, HAS or HA/HAS and HA, HYAL or 258-272, 1999), TOGA (total gene expression analysis) HA/HYAL interaction and a disease state, phenotype, or (Sutcliffe et al., Proc. Natl. Acad. Sci. USA 97: 1976-1981, condition. These methods include detecting or modulating 2000), protein arrays and proteomics (Celis et al. 2000, HAS and/or HYAL comprising contacting a sample, tissue, supra; Jungblut et al., Electrophoresis 20: 2100-2110, 1999), cell, or organism with the compounds of the present inven expressed sequence tag (EST) sequencing (Celis et al., 2000, tion, measuring the nucleic acid or protein level of HAS supra; Larsson et al., J. Biotechnol. 80: 143-157, 2000), and/or HYAL and/or a related phenotypic or chemical end subtractive RNA fingerprinting (SuRF) (Fuchs et al., Anal. point at Some time after treatment, and optionally comparing Biochem. 286: 91-98, 2000; Larson et al., Cytometry 41: the measured value to a non-treated Sample or sample 203-208, 2000), subtractive cloning, differential display treated with a further compound of the invention. These (DD) (Jurecic and Belmont, Curr. Opin. Microbiol. 3: 316 methods can also be performed in parallel or in combination 321, 2000), comparative genomic hybridization (Carulli et with other experiments to determine the function of al., J. Cell Biochem. Suppl. 31: 286-296, 1998), FISH unknown genes for the process of target validation or to (fluorescent in situ hybridization) techniques (Going and determine the validity of a particular gene product as a target Gusterson, Eur: J. Cancer, 35: 1895-1904, 1999) and mass for treatment or prevention of a particular disease, condition, spectrometry methods (To, Comb. Chem. High Throughput or phenotype. Screen, 3: 235-241, 2000). 0105 The present invention contemplates the use of the 0110. The compounds of the invention are useful for compounds described herein as therapeutic agents to treat research and diagnostics, because these compounds hybrid Subjects Suffering from diseases and disorders associated ize to nucleic acids encoding HAS or HYAL or bind to HAS with HA. Subjects treated using the compositions and com or HYAL itself. For example, oligonucleotides that are pounds of the present invention include any animal who may shown to hybridize with such efficiency and under such benefit from such treatment. These include, without limita conditions as disclosed herein as to be effective HAS or tion, humans, marmosets, orangutans and gorillas, livestock HYAL inhibitors of HAS or HYAL gene expression inhibi US 2007/0286856 A1 Dec. 13, 2007

tors will also be effective primers or probes under conditions HAS and/or HYAL is separated from any putative complex favoring gene amplification or detection, respectively. These and the amount of free (i.e. uncomplexed) label is a measure primers and probes are useful in methods requiring the of the binding of the agent being tested to target molecule. specific detection of nucleic acid molecules encoding HAS One may also measure the amount of bound, rather than free, or HYAL and in the amplification of said nucleic acid HAS and/or HYAL. It is also possible to label the compound molecules for detection or for use in further studies of HAS rather than HAS or HYAL and to measure the amount of or its gene. Hybridization of the antisense or sense oligo compound binding HAS or HYAL in the presence and in the nucleotides, particularly the primers and probes, of the absence of the compound being tested. Such compounds invention with a nucleic acid encoding HAS or HYAL can may inhibit HAS and/or HYAL which is useful, for example, be detected by means known in the art. Such means may in finding inhibitors of gene expression, or, alternatively, include conjugation of an enzyme to the oligonucleotide, may potentiate HAS and/or HYAL inhibition. radiolabelling of the oligonucleotide or any other suitable 0116. Another technique for drug screening provides detection means. Similarly, antibodies may be labeled with high throughput Screening for compounds having Suitable reporter molecules including enzymes and radiolabels for binding affinity to a target and is described in detail in imaging purposes, diagnostic purposes or quantitative pur Geysen (International Patent Publication No. WO poses. Kits using Such detection means for detecting the 84/03564). Briefly stated, large numbers of different small level of HAS or HYAL in a sample may also be prepared. peptide test compounds are synthesized on a solid Substrate, 0111. The specificity and sensitivity of antisense or sense Such as plastic pins or some other Surface. The peptide test compounds or antibodies are also harnessed by those of skill compounds are reacted with HAS and/or HYAL and washed. in the art for therapeutic uses. Such compounds have been Bound HAS and/or HYAL molecules are then detected by employed as therapeutic moieties in the treatment of disease methods well known in the art. This method may be adapted states in animals, including humans. for Screening for non-peptide, chemical entities. This aspect, therefore, extends to combinatorial approaches to screening 0112 For therapeutics, an animal, preferably a human, for HAS and/or HYAL antagonists or agonists. Suspected of having a disease or disorder which can be treated by modulating the expression of the HAS and/or 0.117) Purified HAS and/or HYAL can be coated directly HYAL gene is treated by administering antisense or sense onto plates for use in the aforementioned drug screening compounds in accordance with this invention. Alternatively, techniques. However, non-neutralizing antibodies to the antibodies may be used to inhibit HAS and/or HYAL activ target may also be used to immobilize the target on the Solid ity. For example, in one non-limiting embodiment, the phase. methods comprise the step of administering to the animal in 0118. Another useful group of compounds is a mimetic. need of treatment, a therapeutically effective amount of a A mimetic in this context refers to a substance which has HAS and/or HYAL gene expression inhibitor. The HAS or some chemical similarity to the substrate of HAS and/or HYAL gene expression inhibitors of the present invention HYAL but which antagonises HAS and/or HYAL activity. A effectively inhibit the activity of the HAS and/or HYAL mimetic may be a carbohydrate or peptide or chemical protein or inhibit the expression of the HAS and/or HYAL molecule that mimics elements of secondary structure gene. In one embodiment, the activity or expression of HAS (Johnson et al., “Peptide Turn Mimetics' in Biotechnology or its gene in an animal is inhibited by about 10%. Prefer and Pharmacy, Pezzuto et al., Eds. Chapman and Hall, New ably, the activity or expression of HAS and/or HYAL or its York, 1993). The underlying rationale behind the use of gene in an animal is inhibited by about 30%. More prefer mimetics is that the backbone of the substrate of HAS and/or ably, the activity or expression of HAS and/or HYAL or its HYAL exists chiefly to orient the substrate in such a way as gene in an animal is inhibited by 50% or more. to facilitate molecular interactions with HAS and HYAL. A 0113 For example, the reduction of the expression of the mimetic is designed to permit molecular interactions similar HAS and/or HYAL gene may be measured in serum, adipose to the natural molecule. Peptide or non-peptide mimetics tissue, skin cells, liver or any other body fluid, tissue or may be useful, for example, to inhibit the activity of HAS organ of the animal. Preferably, the cells contained within and/or HYAL. said fluids, tissues or organs being analyzed contain a 0119) The designing of mimetics to a pharmaceutically nucleic acid molecule encoding a HAS and/or HYAL pro active compound is a known approach to the development of tein. pharmaceuticals based on a "lead compound. This might be desirable where the active compound is difficult or expen 0114. The present invention contemplates, therefore, sive to synthesize or where it is unsuitable for a particular methods of screening for compounds comprising, for method of administration. Mimetic design, synthesis and example, contacting a candidate compound with genetic testing are generally used to avoid randomly screening large material encoding HAS and/or HYAL including mRina or numbers of molecules for a desired property. HAS or HYAL itself. The screening procedure includes 0.120. There are several steps commonly taken in the assaying (i) for the presence of a complex between the drug design of a mimetic from a compound having a given and HAS and/or HYAL or genetic material encoding same desired property. First, the particular parts of the compound or (ii) for an alteration in the expression levels of nucleic that are critical and/or important in determining the desired acid molecules encoding the HAS and/or HYAL. Whole property are determined. In the case of a peptide, this can be cells may also be screened for interaction between the cell done by Systematically varying the amino acid residues in and the drug. the peptide, e.g. by Substituting each residue in turn. Alanine 0115 One form of assay involves competitive binding scans of peptides are commonly used to refine Such peptide assays. In Such competitive binding assays, the candidate motifs. These parts or residues constituting the active region compound or HAS and/or HYAL is typically labeled. Free of the compound are known as its “pharmacophore'. US 2007/0286856 A1 Dec. 13, 2007

0121 Once the pharmacophore has been found, its struc peptides from banks of chemically or biologically produced ture is modeled according to its physical properties, e.g. banks of peptides. Selected peptides would then act as the Stereochemistry, bonding, size and/or charge, using data pharmacore. from a range of sources, e.g. spectroscopic techniques, X-ray 0.126 Two-hybrid screening is also useful in identifying diffraction data and NMR. Computational analysis, similar other members of a biochemical or genetic pathway asso ity mapping (which models the charge and/or Volume of a ciated with a target. Two-hybrid screening conveniently uses pharmacophore, rather than the bonding between atoms) and Saccharomyces cerevisiae and Saccharomyces pombe. Tar other techniques can be used in this modeling process. get interactions and Screens for inhibitors can be carried out 0122) In a variant of this approach, the three-dimensional using the yeast two-hybrid system, which takes advantage of structure of the ligand and its binding partner are modeled. transcriptional factors that are composed of two physically This can be especially useful where the ligand and/or separable, functional domains. The most commonly used is binding partner change conformation on binding, allowing the yeast GAL.4 transcriptional activator consisting of a the model to take account of this in the design of the DNA binding domain and a transcriptional activation mimetic. Modeling can be used to generate inhibitors which domain. Two different cloning vectors are used to generate interact with the linear sequence or a three-dimensional separate fusions of the GAL4 domains to genes encoding configuration. potential binding proteins. The fusion proteins are co-ex pressed, targeted to the nucleus and if interactions occur, 0123. A template molecule is then selected onto which activation of a reporter gene (e.g. lacZ) produces a detect chemical groups which mimic the pharmacophore can be able phenotype. In the present case, for example, S. cerevi grafted. The template molecule and the chemical groups siae is co-transformed with a library or vector expressing a grafted onto it can conveniently be selected so that the cDNA GAL4 activation domain fusion, and a vector mimetic is easy to synthesize, is likely to be pharmacologi expressing a target gene Such as, for example, HAS or cally acceptable, and does not degrade in Vivo, while retain HYAL gene fused to GAL4. If lacZ is used as the reporter ing the biological activity of the lead compound. Alterna gene, co-expression of the fusion proteins will produce a tively, where the mimetic is peptide-based, further stability blue color. Small molecules or other candidate compounds can be achieved by cyclizing the peptide, increasing its which interact with a target will result in loss of color of the rigidity. The mimetic or mimetics found by this approach cells. Reference may be made to the yeast two-hybrid can then be screened to see whether they have the target systems as disclosed by Munder et al. (Appl. Microbiol. property, or to what extent they exhibit it. Further optimi Biotechnol. 52(3): 311-320, 1999) and Young et al., Nat. Zation or modification can then be carried out to arrive atone Biotechnol. 16(10): 946-950, 1998). Molecules thus identi or more final mimetics for in vivo or clinical testing. fied by this system are then re-tested in animal cells. 0.124. The goal of rational drug design is to produce 0127. As indicated above, the present invention also structural analogs of biologically active polypeptides of extends to small molecule inhibitors identified as described interest or of small molecules with which they interact (e.g. above and which bind and inhibit the activity of HAS and/or agonists, antagonists, inhibitors or enhancers) in order to HYAL. fashion drugs which are, for example, more active or stable forms of the polypeptide, or which, e.g. enhance or interfere 0128. It is to be understood that unless otherwise indi with the function of a polypeptide in vivo. See, e.g. Hodgson cated, the Subject invention is not limited to specific formu (Bio/Technology 9: 19-21, 1991). In one approach, the lations of components, manufacturing methods, dosage regi three-dimensional structure of HAS and/or HYAL interest is ments, treatment protocols or the like, as such may vary. It determined by X-ray crystallography, by computer modeling is also to be understood that the terminology used herein is or most typically, by a combination of approaches. Useful for the purpose of describing particular embodiments only information regarding the structure of a polypeptide may and is not intended to be limiting. also be gained by modeling based on the structure of 0129. It must be noted that, as used in the subject homologous proteins. An example of rational drug design is specification, the singular forms “a”, “an and “the include the development of HIV protease inhibitors (Erickson et al., plural aspects unless the context clearly dictates otherwise. Science 249: 527-533, 1990). In addition, target molecules Thus, for example, reference to “a compound includes a may be analyzed by an alanine scan (Wells, Methods Enzy single compound, as well as two or more compounds; mol. 202: 2699-2705, 1991). In this technique, an amino reference to “an antibody' includes a single antibody, as acid residue is replaced by Ala and its effect on the peptide's well as two or more antibodies; and so forth. activity is determined. Each of the amino acid residues of the peptide is analyzed in this manner to determine the impor 0.130. The terms “compound”, “active agent”, “pharma tant regions of the peptide. cologically active agent”, “medicament”, “active' and 'drug are used interchangeably herein to refer to an antago 0125. It is also possible to isolate a HAS and/or HYAL nist of HAS and/or HYAL function or activity or of expres specific antibody, selected by a functional assay and then to sion of genetic material encoding same which induces a Solve its crystal structure. In principle, this approach yields desired pharmacological and/or physiological effect such as a pharmacore upon which Subsequent drug design can be but not limited to controlling inflammation and reducing based. It is possible to bypass protein crystallography alto cancer growth. The terms also encompass pharmaceutically gether by generating anti-idiotypic antibodies (anti-ids) to a acceptable and pharmacologically active ingredients of functional, pharmacologically active antibody. As a mirror those active agents specifically mentioned herein including image of a mirror image, the binding site of the anti-ids but not limited to salts, esters, amides, prodrugs, active would be expected to be an analog of the original receptor. metabolites, analogs and the like. When the terms “com The anti-id could then be used to identify and isolate pound”, “active agent”, “pharmacologically active agent'. US 2007/0286856 A1 Dec. 13, 2007

“medicament”, “active' and “drug are used, then it is to be drome, AAT, Abderhalden-Kaufmann-Lignac Syndrome, understood that this includes the active agent perse as well Abdominal Muscle Deficiency Syndrome, Abdominal Wall as pharmaceutically acceptable, pharmacologically active Defect, Abdominal Epilepsy, Abdominal Migraine, Abduc salts, esters, amides, prodrugs, metabolites, analogs, etc. The tor Spasmodic Dysphonia, Abductor Spastic Dysphonia, term "compound is not to be construed as a chemical Abercrombie Syndrome, blepharon-Macrostomia Syn compound only but extends to RNA and DNA encoding a drome, ABS, Absence of HPRT, Absence of Corpus Callo modified LIF molecule. sum Schinzel Typ, Absence Defect of Limbs Scalp and 0131 The terms “effective amount” and “therapeutically Skull, Absence of Menstruation Primar, Absence of HGPRT, effective amount of the compound as used herein mean a Absorptive Hyperoxaluriaor Enteric, Abt-Letterer-Siwe Dis sufficient amount of the agent to provide the desired thera ease, ACADL, ACADM Deficiency, ACADM, ACADS, peutic or physiological effect Such as inhibiting inflamma Acanthocytosis-Neurologic Disorder, Acanthocytosis, tion or reducing the growth or spread of cancer cells. Acantholysis Bullosa, Acanthosis Nigricans, Acanthosis Undesirable effects, e.g. side effects, are sometimes mani Bullosa, Acanthosis Nigricans With Insulin Resistance Type fested along with the desired therapeutic effect; hence, a A, Acanthosis Nigricans With Insulin Resistance Type B. practitioner balances the potential benefits against the poten Acanthotic Nevus, Acatalasemia, Acatalasia, ACC. Acces tial risks in determining what is an appropriate 'effective sory Atrioventricular Pathways. Accessory Atrioventricular amount. The exact amount required will vary from subject Pathways, Acephaly, ACF with Cardiac Defects, Achalasia, to Subject, depending on the species, age and general con Achard-Thiers Syndrome, ACHARD (Marfan variant), dition of the subject, mode of administration and the like. Achard's syndrome, Acholuric Jaundice, Achondrogenesis, Thus, it may not be possible to specify an exact “effective Achondrogenesis Type IV. Achondrogenesis Type III, amount. However, an appropriate “effective amount” in Achondroplasia, Achondroplasia Tarda, Achondroplastic any individual case may be determined by one of ordinary Dwarfism, Achoo Syndrome, Achromat, Achromatope, Ach skill in the art using only routine experimentation. The romatopic, Achromatopsia, Achromic Nevi, Acid Cerami present invention extends to a method of treatment or dase Deficiency, Acid Maltase Deficiency, Acid Maltase prophylaxis. Deficiency, Acid Beta-glucosidase Deficiency, Acidemia 0132) By “pharmaceutically acceptable' carrier, excipi Methylmalonic, Acidemia Propionic, Acidemia with Epi ent or diluent is meant a pharmaceutical vehicle comprised sodic Ataxia and Weakness, Acidosis, Aclasis Tarsoepiphy of a material that is not biologically or otherwise undesir seal, ACM, Acoustic Neurilemoma, Acoustic Neuroma, able, i.e. the material may be administered to a Subject along ACPS with Leg Hypoplasia, ACPS II, ACPS IV, ACPS III, with the selected active agent without causing any or a Acquired Aphasia with Convulsive Disorder, Acquired Substantial adverse reaction. Carriers may include excipients Brown Syndrome, Acquired Epileptic Aphasia, Acquired and other additives such as diluents, detergents, coloring Factor XIII Deficiency, Acquired Form of ACC (caused by agents, wetting or emulsifying agents, pH buffering agents, infection while still in womb), Acquired Hyperoxaluria, Acquired Hypogammaglobulinemia, Acquired Immunode preservatives, and the like. ficiency Syndrome (AIDS), Acquired Iron Overload, 0133. Similarly, a “pharmacologically acceptable' salt, Acquired Lipodystrophy, Acquired Partial Lipodystrophy, ester, amide, prodrug or derivative of a compound as pro Acquired Wandering Spleen, ACR, Acral Dysostosis with vided herein is a salt, ester, amide, prodrug or derivative that Facial and Genital Abnormalities, Acro Renal, Acrocallosal this not biologically or otherwise undesirable. Syndrome Schinzel Type, Acrocephalosyndactyly, Acro cephaloSyndactyly Type I, AcrocephaloSyndactyly Type I 0134) The terms “treating and “treatment as used Subtype I, Acrocephalopolysyndactyly Type II, Acrocepha herein refer to reduction in severity and/or frequency of lopolysyndactyly Type III, Acrocephalopolysyndactyly symptoms of diseases or disorders or physiological condi Type IV. Acrocephalosyndactyly V (ACS5 or ACSV) Sub tions elimination of symptoms and/or underlying cause, type I, Acrocephaly Skull Asymmetry and Mild Syndactyly, prevention of the occurrence of symptoms of disease and/or Acrocephaly, Acrochondrohyperplasia, Acrodermatitis their underlying cause and improvement or remediation of Enteropathica, Acrodysostosis, Acrodystrophic Neuropathy, conditions associated with cytokine activity. Acrodystrophic Neuropathy, Acrofacial Dysostosis Nager 0135 “Treating a patient may involve prevention of the Type, Acrofacial Dysostosis Nager Type, Acrofacial Dysos disorder or disease condition or physiological event in a tosis Postaxial Type, Acrofacial Dysostosis Type Genee susceptible individual as well as treatment of a clinically Wiedep, Acrogeria Familial, Acromegaly, Acromelalgia symptomatic individual by inhibiting a disease or disorder. Hereditary, Acromesomelic Dysplasia, Acromesomelic 0136. Accordingly, another aspect of the present inven Dwarfism, Acromicric Skeletal Dysplasia, Acromicric Dys tion is directed towards therapeutic or prophylactic compo plasia, Acroosteolysis with Osteoporosis and Changes in sition comprising a compound capable of reducing the levels Skull and Mandible, Acroosteolysis, Acroparesthesia, ACS I, ACS Type II, ACS Type III, ACS, ACS3, ACTH Defi or activity of HAS and/or HYAL and hence reducing levels ciency, Action Myoclonus, Acute Brachial Neuritis Syn of HA. drome, Acute Brachial Radiculitis Syndrome, Acute Cere 0137 The compositions and compounds of the present bral Gaucher Disease, Acute Cholangitis, Acute invention can be used in the treatment or prevention of Disseminated Encephalomyeloradiculopathy, Acute Dis diseases associated with HA. The present invention contem seminated Histiocytosis-X, Acute Hemorrhagic Polioen plates treatment of diseases and disorders such as A-Beta cephalitis, Acute Idiopathic Polyneuritis, Acute Immune Lipoproteinemia, A-V. A Beta-2-Microglobulin Amyloido Mediation Polyneuritis, Acute Infantile Pelizaeus sis, A-T, A1 AD. A1AT, Aagenaes, Aarskog syndrome, Merzbacher Brain Sclerosis, Acute Intermittant Porphyria, Aarskog-Scott Syndrome, Aase-Smith syndrome, Aase Syn Acute Porphyrias, Acute Sarcoidosis, Acute Shoulder Neu US 2007/0286856 A1 Dec. 13, 2007 ritis, Acute Toxic Epidermolysis, Acyl-CoA Dehydrogenase Syndrome, Allan-Herndon Syndrome, Allan-Herndon-Dud Deficiency Long-Chain, Acyl-CoA Dehydrogenase Defi ley Mental Retardation, Allergic Granulomatous Antitis, ciency Short-Chain, Acyl-CoA Dihydroxyacetone Acyl Allergic Granulomatous Angiitis of Cronkhite-Canada, Alo transferase, Acyl-coenzyme A Oxidase Deficiency, ADA, bar Holoprosencephaly, Alopecia Areata, Alopecia Areata, ADA Deficiency, Adam Complex, Adamantiades-Behcet’s Alopecia Celsi, Alopecia Cicatrisata, Alopecia Circum Syndrome, Adamantinoma, Adams Oliver Syndrome, Adap scripta, Alopecia-Poliosis-Uveitis-Vitiligo-Deafness-Cuta tive Colitis, ADD combined type, ADD, Addison Disease neous-Uveo-O, Alopecia Seminuniversalis, Alopecia Tota with Cerebral Sclerosis, Addison's Anemia, Addison's Ane lis, Alopecia Universalis, Alpers Disease, Alpers Disease, mia, Addison's Disease, Addison's Disease, Addison's Dis Alpers Diffuse Degeneration of Cerebral Gray Matter with ease. Addison-Biermer Anemia, Addison-Biermer Anemia, Hepatic Cirrhosis, Alpers Progressive Infantile Poliodystro Addison-Schilder Disease, Addisonian Pernicious Anemia, phy, Alpha-1-Antitrypsin Deficiency, Alpha-1 4 Glucosidase Addisonian Pernicious Anemia, Adducted Thumbs-Mental Deficiency, Alpha-1 4 Glucosidase Deficiency, Alpha-Ga Retardation, Adductor Spasmodic Dysphonia, Adductor lactosidase A Deficiency, Alpha-Galactosidase B Deficiency, Spastic Dysphonia, Adenoma Associated Virilism of Older Alpha-1 4 Glucosidase Deficiency, Alpha High-Density Women, Adenomatosis of the Colon and Rectum, Adenoma Lipoprotein Deficiency, Alpha-L-Fucosidase Deficiency tous polyposis of the Colon, Adenomatous Polyposis Famil Fucosidosis Type 3, Alpha-GalNAc Deficiency Schindler ial, Adenosine Deaminase Deficiency, Adenosine Deami Type, Alpha-1 4 Glucosidase Deficiency, Alpha-L-Fucosi nase Deficiency, Adenylosuccinase deficiency, ADHD dase Deficiency Fucosidosis Type 3. Alphalipoproteinemia, predominantly hyperactive-impulsive type, ADHD pre Alpha Mannosidosis, Alpha-N-Acetylgalactosaminidase dominantly inattentive type, ADHD, Adhesive Arachnoidi Deficiency Schindler Type, Alpha-NAGADeficiency Schin tis, Adie Syndrome, Adie's Syndrome, Adie's Tonic Pupil, dler Type, Alpha-Neuraminidase Deficiency, Alpha-Thalas Adie's Pupil, Adipogenital Retinitis Pigmentosa Polydac semia/mental retardation syndrome non-deletion type, tyly, Adipogenital-Retinitis Pigmentosa Syndrome, Adiposa Alphalipoproteinemia, Alport Syndrome, ALS, Alstroems Dolorosa, Adiposis Dolorosa, Adiposogenital Dystrophy, Syndrome, Alstroem, Alstrom Syndrome. Alternating Adolescent Cystinosis, ADPKD, Adrenal Cortex Adenoma, Hemiplegia Syndrome. Alternating Hemiplegia of Child Adrenal Disease, Adrenal Hyperfunction resulting from hood, Alzheimer's Disease, Amaurotic Familial Idiocy, Pituitary ACTH Excess, Adrenal Hypoplasia, Adrenal Insuf Amaurotic Familial Idiocy, Amaurotic Familial Idiocy ficiency, Adrenal Neoplasm, Adrenal Virilism, Adrenal Vir Adult, Amaurotic Familial Infantile Idiocy, Amaurotic ilism, Adreno-Retinitis Pigmentosa-Polydactyly Syndrome, Familial Infantile Idiocy, Ambiguous Genitalia, AMC, Adrenocortical Insufficiency, Adrenocortical Hypofunction, AMD, Ameloblastoma, Amelogenesis Imperfecta, Amenor Adrenocorticotropic Hormone Deficiency Isolated, Adreno rhea-Galactorrhea Nonpuerperal, Amenorrhea-Galactor genital Syndrome, Adrenogenital Syndrome, Adrenoleukod rhea-FSH Decrease Syndrome, Amenorrhea, Amino Acid yStrophy, Adrenomyeloneuropathy, Adreno-Retinitis Pig Disorders, Aminoaciduria-Osteomalacia-Hyperphospha mentosa-Polydactyly Syndrome, Adult Cystinosis, Adult turia Syndrome, AMN, AMN, Amniocentesis, Amniocente Dermatomyositis, Adult Hypophosphatasia, Adult Macula sis, Amniotic Bands, Amniotic Band Syndrome, Amniotic Lutea Retinae Degeneration, Adult Onset ALD, Adult-Onset Band Disruption Complex, Amniotic Band Sequence, Amni Ceroidosis, Adult Onset Medullary Cystic Disease. Adult otic Rupture Sequence, Amputation Congenital, AMS, Onset Pernicious Anemia, Adult Onset Pernicious Anemia, Amsterdam Dwarf Syndrome de Lange, Amylo-1 6-Glu Adult Onset Schindler Disease, Adult-Onset Subacute cosidase Deficiency, Amyloid Arthropathy of Chronic Necrotizing Encephalomyelopathy, Adult Onset Pernicious Hemodialysis, Amyloid Corneal Dystrophy, Amyloid Poly Anemia, Adult Polycystic Kidney Disease, Adult Onset neuropathy, Amyloidosis, Amyloidosis of Familial Mediter Medullary Cystic Disease, Adynlosuccinate Lyase Defi ranean Fever, Amylopectinosis, Amyoplasia Congenita, ciency. AE, AEC Syndrome, AFD, AFD. A fibrinogenemia, Amyotrophic Lateral Sclerosis, Amyotrophic Lateral Scle African Siderosis, AGA, Aganglionic Megacolon, Age rosis, Amyotrophic Lateral Sclerosis-Polyglucosan Bodies, Related Macular Degeneration, Agenesis of Commissura AN, AN 1, AN 2, Anal Atresia, Anal Membrane, Anal Rectal Magna Cerebri, Agenesis of Corpus Callosum, Agenesis of Malformations, Anal Rectal Malformations, Anal Stenosis, Corpus Callosum-Infantile Spasms-Ocular Anomalies, Analine 60 Amyloidosis, Analphalipoproteinemia, Analrec Agenesis of Corpus Callosum and Chorioretinal Abnormal tal, Analrectal, Analrectal, Anaplastic Astrocytoma, Ander ity, Agenesis of Corpus Callosum-Chorioretinitis Abnormal sen Disease, Anderson-Fabry Disease, Andersen Glyco ity, Aggressive mastocytosis, Agnosis Primary, AGR Triad, genosis, Anderson-Warburg Syndrome, Andre Syndrome, AGU, Agyria, Agyria-pachygria-band spectrum, AHC, Andre Syndrome Type II, Androgen Insensitivity, Androgen AHD, AHDS, AHF Deficiency, AHG Deficiency, AHO, Insensitivity Syndrome Partial, Androgen Insensitivity Syn Ahumada Del Castillo, Aicardi Syndrome, Aicardi Syn drome, Androgen Insensitivity Syndrome Partial, Andro drome, AIED, AIMP, AIP, AIS, AIS, Akinetic Seizure, genic Steroids, Anemia Autoimmune Hemolytic, Anemia ALA-D Porphyria, Alactasia, Alactasia, Alagile Syndrome, Blackfan Diamond, Anemia, Congenital, Triphalangeal Aland Island Eye Disease (X-Linked), Alaninuria, Albers Thumb Syndrome, Anemia Hemolytic Cold Antibody, Ane Schonberg Disease, Albinism, Albinism, Albinismus, Albi mia Hemolytic Cold Antibody, Anemia Hemolytic with noidism, Albright Hereditary Osteodystrophy, Alcaptonuria, PGK Deficiency, Anemia Pernicious, Anencephaly, Angel Alcaptonuria, Alcohol-Related Birth Defects, Alcoholic man Syndrome, Angio-Osteohypertrophy Syndrome, Embryopathy, Ald, ALD, ALD, Aldosterone, Aldosteronism Angiofollicular Lymph Node Hyperplasia, Angiohemo With Normal Blood Pressure, Aldrich Syndrome, Alex philia, Angiokeratoma Corporis, Angiokeratoma Corporis ander's Disease, Alexanders Disease, Algodystrophy, Algo Diffusum, Angiokeratoma Diffuse, Angiomatosis Retina, neurodystrophy, Alkaptonuria, Alkaptonuric Ochronosis, Angiomatous Lymphoid, Angioneurotic Edema Hereditary, Alkyl DHAP synthase deficiency, Allan-Herndon-Dudley Anhidrotic Ectodermal Dysplasia, Anhidrotic X-Linked US 2007/0286856 A1 Dec. 13, 2007

Ectodermal Dysplasias, Aniridia, Aniridia-Ambiguous Type II, Ataxia Cerebral Palsy, Ataxiadynamia, Ataxiophe Genitalia-Mental Retardation, Aniridia Associated with mia, ATD, Athetoid Cerebral Palsy, Atopic Eczema, Atresia Mental Retardation, Aniridia-Cerebellar Ataxia-Mental of Esophagus with or without Tracheoesophageal Fistula, Deficiency, Aniridia Partial-Cerebellar Ataxia-Mental Retar Atrial Septal Defects, Atrial Septal Defect Primum, Atrial dation, Aniridia Partial-Cerebellar Ataxia-Oligophrenia, and Septal and Small Ventricular Septal Defect, Atrial Aniridia Type I, Aniridia Type II, Aniridia-Wilms Tumor Flutter, Atrial Fibrillation, Atriodigital Dysplasia, Atriosep Association, Aniridia-Wilms Tumor-Gonadoblastoma, tal Defects, Atrioventricular Block, Atrioventricular Canal Ankyloblepharon-Ectoderrnal Defects-Cleft Lip/Palate, Defect, Atrioventricular Septal Defect, Atrioventricular Sep Ankylosing Spondylitis, Ankylosing Spondylitis, Annular tal Defect, Atrophia Bulborum Hereditaria, Atrophic Beri groves, Anodontia, Anodontia, Anodontia Vera, Anomalous beri, Atrophy Olivopontocerebellar, Attention Deficit Dis Trichromasy, Anomalous Dysplasia of Dentin, Coronal Den order, Attention Deficit Hyperactivity Disorder, Attentuated tin Dysplasia, Anomic Aphasia, Anophthalmia, Anorectal, Adenomatous Polyposis Coli, Atypical Amyloidosis, Atypi Anorectal Malformations, Anosmia, Anterior Bowing of the cal Hyperphenylalaninemia, Atypical Hyperphenylalanine Legs with Dwarfism, Anterior Membrane Corneal Dystro mia, Auditory Canal Atresia, Auriculotemporal Syndrome, phy, Anti-Convulsant Syndrome, Anti-Epstein-Barr Virus Autism, Autism Asperger's Type, Autism Dementia Ataxia Nuclear Antigen (EBNA) Antibody Deficiency, Antibody and Loss of Purposeful Hand Use, Autism Infantile Autism, Deficiency, Antibody Deficiency with near normal Immu Autoimmune Addison's Disease, Autoimmune Hemolytic noglobulins, Antihemophilic Factor Deficiency, Antihemo Anemia, Autoimmune Hemolytic Anemia, Autoimmune philic Globulin Deficiency, Antiphospholipid Syndrome, Hemolytic Anemia, Autoimmune Hemolytic Anemia, Antiphospholipid Syndrome, Antiphospholipid Antibody Autoimmune Hepatitis, Autoimmune-Polyendocrinopathy Syndrome, Antithrombin III Deficiency, Antithrombin III Candidias, Autoimmune Polyglandular Disease Type I. Deficiency Classical (Type I), Antitrypsin Deficiency, Ant Autosomal Dominant Albinism, Autosomal Dominant Com ley-Bixler Syndrome, Antoni’s Palsy, Anxietas Tibialis, pelling Helioophthalmic Outburst Syndrome, Autosomal Aorta Arch Syndrome, Aortic and Mitral Atresia with Hypo Dominant Desmin Distal myopathy with Late Onset, Auto plasic Left Heart Syndrome, Aortic Stenosis, Aortic Steno somal Dominant EDS, Autosomal Dominant Emery-Dre sis, Aparoschisis, APC, APECED Syndrome, Apert Syn ifuss Muscular Dystrophy, Autosomal Dominant Keratoco drome, Aperts, Aphasia, Aplasia AXialis Extracorticales nus, Autosomal Dominant Pelizaeus-Merzbacher Brain Congenital, Aplasia Cutis Congenita, Aplasia Cutis Con Sclerosis, Autosomal Dominant Polycystic Kidney Disease, genita with Terminal Transverse Limb Defects, Aplastic Autosomal Dominant Spinocerebellar Degeneration, Auto Anemia, Aplastic Anemia with Congenital Anomalies, Somal Recessive Agammaglobulinemia, Autosomal Reces APLS, Apnea, Appalachian Type Amyloidosis, Apple Peel sive Centronuclear myopathy, Autosomal Recessive Con Syndrome, Apraxia, Apraxia, Apraxia Buccofacial, Apraxia radi-Hunermann Syndrome, Autosomal Recessive EDS, Constructional, Apraxia Ideational, Apraxia Ideokinetic, Autosomal Recessive Emery-Dreifuss Muscular Dystrophy, Apraxia Ideomotor, Apraxia Motor, Apraxia Oculomotor, Autosomal Recessive Forms of Ocular Albinism, Autosomal APS, Arachnitis, Arachnodactyly Contractural Beals Type, Recessive Inheritance Agenesis of Corpus Callosum, Auto Arachnodactyly, Arachnoid Cysts, Arachnoiditis Ossificans, somal Recessive Keratoconus, Autosomal Recessive Poly Arachnoiditis, Aran-Duchenne, Aran-Duchenne Muscular cystic Kidney Disease, Autosomal Recessive Severe Com Atrophy, Aregenerative Anemia, Arginase Deficiency, bined Immunodeficiency, AV, AV, AVM, AVSD, AWTA, Argininemia, Arginino Succinase Deficiency, Argininosuc Axilla Abscess, Axonal Neuropathy Giant, Azorean Neuro cinase Deficiency, Argininosuccinate Lyase Deficiency, logic Disease, B-K Mole Syndrome, Babinski-Froelich Syn Argininosuccinic Acid Lyase-ASL, Argininosuccinic Acid drome. BADS, Baillarger's Syndrome, Balkan Disease, Synthetase Deficiency, Argininosuccinic Aciduria, Argonz Baller-Gerold Syndrome, Ballooning Mitral Valve, Balo Del Castillo Syndrome, Arhinencephaly, Armenian Syn Disease Concentric Sclerosis, Baltic Myoclonus Epilepsy, drome, Arnold-Chiari Malformation, Arnold-Chiari Syn Bannayan-Zonana syndrome (BZS), Bannayan-Riley-Ru drome, ARPKD, Arrhythmic Myoclonus, Arrhythmogenic valcaba syndrome, Banti’s Disease, Bardet-Biedl Syn Right Ventricular Dysplasia, Arteriohepatic Dysplasia, Arte drome, Bare Lymphocyte Syndrome, Barlow's syndrome, riovenous Malformation, Arteriovenous Malformation, Barraquer-Simons Disease, Barrett Esophagus, Barrett Arteriovenous Malformation of the Brain, Arteritis Giant Ulcer, Barth Syndrome, Barth syndrome, Bartter's Syn Cell, Arthritis, Arthritis Urethritica, Arthro-Dento-Osteod drome, Basal Cell Nevus Syndrome, Basedow Disease, ysplasia, Arthro-Opthalmopathy, Arthrochalasis Multiplex Bassen-Kornzweig Syndrome, Batten Disease, Batten Congenita, Arthrogryposis Multiplex Congenita, Arthrogry Mayou Syndrome, Batten-Spielmeyer-Vogt's Disease, Bat posis Multiplex Congenita, Distal, Type IIA, ARVD, Aryl ten. Turner Syndrome, Batten Turner Type Congenital sulfatase-B Deficiency, AS, AS, AS, AS, ASA Deficiency, myopathy, Batten-Vogt Syndrome, BBB Syndrome, BBB Ascending Paralysis, ASD, Atrioseptal Defects, ASH, Ash Syndrome (Opitz), BBB Syndrome, BBBG Syndrome, ermans Syndrome, Ashkenazi Type Amyloidosis, ASL Defi BCKD Deficiency, BD, BDLS, BE, Beals Syndrome, Beals ciency, Aspartylglucosaminuria, Aspartylglycosaminuria, Syndrome, Beals-Hecht Syndrome, Bean Syndrome, BEB, Asperger's Syndrome, Asperger's Type Autism, Asphyxiat BEB, Bechterew Syndrome. Becker Disease, Becker Mus ing Thoracic Dysplasia, Asplenia Syndrome, ASS Defi cular Dystrophy, Becker Muscular Dystrophy, Becker ciency, Asthma, Astrocytoma Grade I (Benign), Astrocy Nevus, Beckwith Wiedemann Syndrome. Beckwith-Syn toma Grade II (Benign), Asymmetric Crying Facies with drome, Begnez-Cesar's Syndrome, Behcet’s syndrome, Cardiac Defects, Asymmetrical septal hypertrophy, Asymp Behcet’s Disease, Behcet’s Disease, Behr 1, Behr 2, Bell's tomatic Callosal Agenesis, AT, AT III Deficiency, AT III Palsy, Benign Acanthosis Nigricans, Benign Astrocytoma, Variant IA, AT III Variant Ib, AT3, Ataxia, Ataxia Telang Benign Cranial Nerve Tumors, Benign Cystinosis, Benign iectasia, Ataxia Telangiectasia, Ataxia with Lactic Acidosis Essential Blepharospasm, Benign Essential Tremor, Benign US 2007/0286856 A1 Dec. 13, 2007

Familial Hematuria, Benign Focal Amyotrophy, Benign drome, BRRS, Brueghel Syndrome, Bruton’s Agamma Focal Amyotrophy of ALS, Benign Hydrocephalus, Benign globulinemia Common, BS, BSS, Buchanan’s Syndrome, Hypermobility Syndrome, Benign Keratosis Nigricans, Budd's Syndrome, Budd-Chiari Syndrome, Buerger-Gruetz Benign Paroxysmal Peritonitis, Benign Recurrent Hema Syndrome, Bulbospinal Muscular Atrophy-X-linked, Bull turia, Benign Recurrent Intrahepatic Cholestasis, Benign dog Syndrome, Bullosa Hereditaria, Bullous CIE, Bullous Spinal Muscular Atrophy with Hypertrophy of the Calves, CIE, Bullous Congenital Ichthyosiform Erythroderma, Benign Symmetrical Lipomatosis, Benign Tumors of the Bullous Ichthyosis, Bullous Pemphigoid, Burkitt's Lym Central Nervous System, Berardinelli-Seip Syndrome, phoma, Burkitt's Lymphoma African type, Burkitt's Lym Berger's Disease, Beriberi, Berman Syndrome, Bernard phoma Non-african type, BWS, Byler's Disease, C Syn Horner Syndrome, Bernard-Soulier Syndrome, Besnier Pru drome, C1 Esterase Inhibitor Dysfunction Type II rigo, Best Disease, Beta-Alanine-Pyruvate Aminotrans Angioedema, C1-INH, C1 Esterase Inhibitor Deficiency ferase, Beta-Galactosidase Deficiency Morquio Syndrome, Type I Angioedema, C1 NH, Cacchi-Ricci Disease, CAD, Beta-Glucuronidase Deficiency, Beta Oxidation Defects, CADASIL, CAH, CAH, Calcaneal Valgus, Calcaneovalgus, Beta-oxidation Defects, Beta Thalassemia Major, Beta Calcium Pyrophosphate Dihydrate Deposits, Callosal Agen Thalassemia Minor, Betalipoprotein Deficiency, Bethlem esis and Ocular Abnormalities, Calves-Hypertrophy of Spi myopathy, Beuren Syndrome, BH4. Deficiency, BH4. Defi nal Muscular Atrophy, Campomelic Dysplasia, Campomelic ciency, Biber-Haab-Dimmer Corneal Dystrophy, Bicuspid Dwarfism, Campomelic Syndrome, Camptodactyly-Cleft Aortic Valve, Bicuspid Aortic Valve, Biedl-Bardet, Bifid Palate-Clubfoot, Camptodactyly-Limited Jaw Excursion, Cranium, Bifunctional Enzyme Deficiency, Bilateral Acous Camptomelic Dwarfism, Camptomelic Syndrome, Camp tic Neurofibromatosis, Bilateral Acoustic Neuroma, Bilat tomelic Syndrome Long-Limb Type, Camurati-Engelmann eral Right-Sidedness Sequence, Bilateral Renal Agenesis, Disease, Camurati-Engelmann Disease, Canada-Cronkhite Bilateral Temporal Lobe Disorder, Bilious Attacks, Bilirubin Disease, Canavan disease, Canavan's Disease Included, Glucuronosyltransferase Deficiency Type I, Binder Syn Canavan's Leukodystrophy, Cancer, Cancer Family Syn drome, Binswanger's Disease, Binswanger's Encephalopa drome Lynch Type, Cantrell Syndrome, Cantrell-Haller thy, Biotinidase deficiency, Bird-Headed Dwarfism Seckel Ravich Syndrome, Cantrell Pentalogy, Carbamyl Phosphate Type, Birth Defects, Birthmark, Bitemporal Forceps Marks Synthetase Deficiency, Carbohydrate Deficient Glycopro Syndrome, Biventricular Fibrosis, Bjornstad Syndrome, tein Syndrome, Carbohydrate-Deficient Glycoprotein Syn B-K Mole Syndrome, Black Locks-Albinism-Deafness of drome Type Ia, Carbohydrate-Induced Hyperlipemia, Car Sensoneural Type (BADS), Blackfan-Diamond Anemia, bohydrate Intolerance of Glucose Galactose, Carbon Blennorrheal Idiopathic Arthritis, Blepharophimosis, Ptosis, Dioxide Acidosis, Carboxylase Deficiency Multiple, Car Epicanthus Inversus Syndrome, Blepharospasm, Ble diac-Limb Syndrome, Cardio-auditory Syndrome, Cardio pharospasm, Blepharospasm Benign Essential, Ble auditory Syndrome of Jervell and Lange-Nielsen, Cardio pharospasm Oromandibular Dystonia, Blessig Cysts, BLFS, cutaneous Syndrome, Cardio-facial-cutaneous syndrome, Blindness, Bloch-Siemens Incontinentia Pigmenti Melano Cardiofacial Syndrome Cayler Type, Cardiomegalia Glyco blastosis Cutis Linearis, Bloch-Siemens-Sulzberger Syn genica Diffusa, Cardiomegalia Glycogenica Diffusa, Cardi drome, Bloch-Sulzberger Syndrome, Blood types, Blood omyopathic Lentiginosis, Cardiomyopathy, Cardiomyopa type A, Blood type B, Blood type AB, Blood type O, Bloom thy, Cardio myopathy Associated with Desmin Storage Syndrome, Bloom-Torre-Mackacek Syndrome, Blue Rubber myopathy, Cardiomyopathy Due to Desmin Defect, Cardio Bleb Nevus, Blue Baby, Blue Diaper Syndrome, BMD, myopathy-Neutropenia Syndrome, Cardio myopathy-Neu BOD, BOFS, Bone Tumor-Epidermoid Cyst-Polyposis, tropenia Syndrome, Cardio myopathy-Neutropenia Syn Bonnet-Dechaume-Blanc Syndrome, Bonnevie-Ulrich Syn drome Lethal Infantile Cardio myopathy, Cardiopathic drome, Book Syndrome. BOR Syndrome, BORJ, Borjeson Amyloidosis, Cardiospasm, Cardocardiac Syndrome, Car Syndrome, Borjeson-Forssman-Lehmann Syndrome, nitine-Acylcarnitine Translocase Deficiency, Carnitine Defi Bowen Syndrome, Bowen-Conradi Syndrome, Bowen-Con ciency and Disorders, Carnitine Deficiency Primary, Car radi Hutterite, Bowen-Conradi Type Hutterite Syndrome, nitine Deficiency Secondary, Carnitine Deficiency Bowman's Layer, BPEI, BPES, Brachial Neuritis, Brachial Secondary to MCAD Deficiency, Carnitine Deficiency Syn Neuritis Syndrome, Brachial Plexus Neuritis, Brachial drome, Carnitine Palmitoyl Transferase I & II (CPT I & II), Plexus-Neuropathy, Brachiocephalic Ischemia, Brachmann Carnitine Palmitoyltransferase Deficiency, Carnitine Palmi de Lange Syndrome, Brachycephaly, Brachycephaly, Bra toyltransferase Deficiency Type 1, Carnitine Palmitoyltrans chymorphic Type Congenital, Bradycardia, Brain Tumors, ferase Deficiency Type 2 benign classical muscular form Brain Tumors Benign, Brain Tumors Malignant, Branched included severe infantile form included, Carnitine Transport Chain Alpha-Ketoacid Dehydrogenase Deficiency, Defect (Primary Carnitine Deficiency), Carnosinase Defi Branched Chain Ketonuria I, Brancher Deficiency, Bran ciency, Carnosinemia, Caroli Disease, Carpenter syndrome, chio-Oculo-Facial Syndrome, Branchio-Oto-Renal Dyspla Carpenters, Cartilage-Hair Hypoplasia, Cartilage-Hair sia, Branchio-Oto-Renal Syndrome, Branchiooculofacial Hypoplasia, Castleman's Disease, Castleman's Disease Syndrome, Branchiootic Syndrome, Brandt Syndrome, Hyaline Vascular Type, Castleman's Disease Plasma Cell Brandywine Type Dentinogenesis Imperfecta, Brandywine Type, Castleman Tumor, Cat Eye Syndrome, Cat's Cry type Dentinogenesis Imperfecta, Breast Cancer, BRIC Syn Syndrome, Catalayse deficiency, Cataract-Dental Syn drome, Brittle Bone Disease, Broad Beta Disease, Broad drome, Cataract X-Linked with Hutchinsonian Teeth, Cat Thumb Syndrome, Broad Thumbs and Great Toes Charac echolamine hormones, Catel-Manzke Syndrome, Catel teristic Facies and Mental Retardation, Broad Thumb-Hal Manzke Type Palatodigital Syndrome, Caudal Dysplasia, lux, Broca's Aphasia, Brocq-Duhring Disease, Bronze Dia Caudal Dysplasia Sequence, Caudal Regression Syndrome, betes, Bronze Schilder's Disease, Brown Albinism, Brown Causalgia Syndrome Major, Cavernomas, Cavernous Enamel Hereditary, Brown-Sequard Syndrome, Brown Syn Angioma, Cavernous Hemangioma, Cavernous Lymphan US 2007/0286856 A1 Dec. 13, 2007 18 gioma, Cavernous Malformations, Cayler Syndrome, Calcificans Congenita, Chondrodystrophia Fetalis, Chon Cazenave's Vitiligo, CBGD, CBGD, CBPS, CBPS, CCA, drodystrophic Myotonia, Chondrodystrophy, Chondrodys CCD, CCD, CCHS, CCM Syndrome, CCMS, CCO, CD, trophy with Clubfeet, Chondrodystrophy Epiphyseal, Chon CDG1a, CDG1A, CDGS Type Ia, CDGS Type Ia, CDGS, drodystrophy Hyperplastic Form, Chondroectodermal CDI, CdLS. Celiac Disease, Celiac sprue, Celiac Sprue Dysplasias, Chondrogenesis Imperfecta, Chondrohystro Dermatitis, Cellelar Immunodeficiency with Purine Nucleo phia, Chondroosteodystrophy, Choreoacanthocytosis, side Phosphorylase Deficiency, Celsus' Vitiligo, Central Chorionic Villi Sampling, Chorioretinal Anomalies, Chori Apnea, Central Core Disease, Central Core Disease, Central oretinal Anomalies with ACC, Chorireninal Coloboma-Jou Diabetes Insipidus, Central Form Neurofibromatosis, Cen bert Syndrome, Choroidal Sclerosis, Choroideremia, tral Hypoventilation, Central Sleep Apnea, Centrifugal Chotzen Syndrome, Chotzen Syndrome, Christ-Siemens Lipodystrophy, Centronuclear myopathy, CEP, Cephalocele, Touraine Syndrome, Christ-Siemans-Touraine Syndrome, Cephalothoracic Lipodystrophy, Ceramide Trihexosidase Christmas Disease, Christmas Tree Syndrome, Chromosome Deficiency, Cerebellar Agenesis, Cerebellar Aplasia, Cer 3 Deletion of Distal 3p, Chromosome 3 Distal 3p Mono ebellar Hemiagenesis, Cerebellar Hypoplasia, Cerebellar somy, Chromosome 3-Distal 3q2 Duplication, Chromosome Vermis Aplasia, Cerebellar Vermis Agenesis-Hypernea-Epi 3-Distal 3q2 Trisomy, Chromosome 3 Monosomy 3p2. sodic Eye Moves-Ataxia-Retardation, Cerebellar Syndrome, Chromosome 3q Partial Duplication Syndrome, Chromo Cerebellarparenchymal Disorder IV. Cerebellomedullary some 3q, Partial Trisomy Syndrome, Chromosome 3-Tri Malformation Syndrome, Cerebellomedullary Malforma Somy 3q2, Chromosome 4 Deletion 4q31-qter Syndrome, tion Syndrome, Cerebello-Oculocutaneous Telangiectasia, Chromosome 4 Deletion 4q32-qter Syndrome, Chromosome Cerebelloparenchymal Disorder IV Familial, Cerebellopon 4 Deletion 4q33-qter Syndrome, Chromosome 4 Long Arm tine Angle Tumor, Cerebral Arachnoiditis, Cerebral Auto Deletion, Chromosome 4 Long Arm Deletion, Chromosome somal Dominant Arteriopathy with Subcortical Infarcts and 4 Monosomy 4q, Chromosome 4-Monosomy 4q, Chromo Leukodystrophy, Cerebral Beriberi, Cerebral Diplegia, some 4 Monosomy Distal 4q, Chromosome 4 Partial Dele Cerebral Gigantism, Cerebral Malformations Vascular, tion 4p, Chromosome 4, Partial Deletion of the Short Arm, Cerebral Palsy, Cerebro-Oculorenal Dystrophy, Cerebro Chromosome 4 Partial Monosomy of Distal 4q, Chromo Oculo-Facio-Skeletal Syndrome, Cerebrocostomandibular some 4 Partial Monosomy 4p, Chromosome 4 Partial Tri syndrome, Cerebrohepatorenal Syndrome, Cerebromacular Somy 4 (q25-qter), Chromosome 4 Partial Trisomy 4 (q26 or Degeneration, Cerebromacular Degeneration, Cerebromus q27-qter), Chromosome 4 Partial Trisomy 4 (q31 or cular Dystrophy Fukuyama Type, Cerebroocular Dysgen 32-qter), Chromosome 4 Partial Trisomy 4p, Chromosome 4 esis, Cerebroocular Dysplasia-Muscular Dystrophy Syn Partial Trisomies 4q2 and 4q3, Chromosome 4 Partial Tri drome, Cerebrooculofacioskeletal Syndrome, Somy Distal 4, Chromosome 4 Ring, Chromosome 4 4q Cerebroretinal Arteriovenous Aneurysm, Cerebroside Lipi Terminal Deletion Syndrome, Chromosome 4q-Syndrome, dosis, Cerebrosidosis, Cerebrotendinous Xanthomatosis, Chromosome 4q-Syndrome, Chromosome 4 Trisomy 4, Cerebrovascular Ferrocalcinosis, Ceroid-Lipofuscinosis Chromosome 4 Trisomy 4p, Chromosome 4 XY/47 XXY Adult form, Cervical Dystonia, Cervical Dystonia, Cervico (Mosiac), Chromosome 5 Monosomy 5p, Chromosome 5, Oculo-Acoustic Syndrome, Cervical Spinal Stenosis, Cer Partial Deletion of the Short Arm Syndrome, Chromosome vical Vertebral Fusion, CES, CF, CFC syndrome, CFIDS, 5 Trisomy 5p, Chromosome 5 Trisomy 5p Complete (5p11 CFND, CGD, CGF, CGF, Chalasodermia Generalized, Cha pter), Chromosome 5 Trisomy 5p Partial (5p13 or 14-pter), narin Dorfman Disease, Chanarin Dorfman Syndrome, Cha Chromosome 5p-Syndrome, Chromosome 6 Partial Trisomy narin Dorfman Ichthyosis Syndrome, Chandler's Syndrome, 6q, Chromosome 6 Ring, Chromosome 6 Trisomy 6q2. Charcot's Disease, Charcot-Marie-Tooth, Charcot-Marie Chromosome 7 Monosomy 7p2, Chromosome 7 Partial Tooth Disease, Charcot-Marie-Tooth Disease Variant, Char Deletion of Short Arm (7p2-), Chromosome 7 Terminal 7p cot-Marie-Tooth-Roussy-Levy Disease, CHARGE Associa Deletion del (7) (p21-p22), Chromosome 8 Monosomy tion, Charge Syndrome, CHARGE Syndrome, Chaunds 8p2, Chromosome 8 Monosomy 8p21-pter, Chromosome 8 Ectodermal Dysplasias, Chediak-Higashi Syndrome, Che Partial Deletion (short arm), Chromosome 8 Partial Mono diak-Higashi Syndrome, Chediak-Steinbrinck-Higashi Syn somy 8p2, Chromosome 9 Complete Trisomy 9P, Chromo drome, Cheilitis Granulomatosa, Cheiloschisis, Chemke some 9 Partial Deletion of Short Arm, Chromosome 9 Partial Syndrome, Cheney Syndrome, Cherry Red Spot and Myo Monosomy 9p, Chromosome 9 Partial Monosomy 9p22. clonus Syndrome, CHF, CHH, CHH, Chiari's Disease, Chromosome 9 Partial Monosomy 9p22-pter, Chromosome Chiari Malformation 1, Chiari Malformation, Chiari Type I 9 Partial Trisomy 9P Included, Chromosome 9 Ring, Chro (Chiari Malformation I), Chiari Type II (Chiari Malforma mosome 9 Tetrasomy 9p, Chromosome 9 Tetrasomy 9p tion II), Chiari I Syndrome, Chiari-Budd Syndrome, Chiari Mosaicism, Chromosome 9 Trisomy 9p. (Multiple Variants), Frommel Syndrome, Chiari Malformation II, CHILD Syn Chromosome 9 Trisomy 9 (pter-p21 to q32) Included, Chro drome, CHILD Ichthyosis Syndrome, CHILD Syndrome mosome 9 Trisomy Mosaic, Chromosome 9 Trisomy Ichthyosis, Childhood Adrenoleukodystrophy, Childhood Mosaic, Chromosome 10 Distal Trisomy 10q, Chromosome Dermatomyositis, Childhood-onset Dystonia, Childhood 10 Monosomy, Chromosome 10 Monosomy 10p, Chromo Cyclic Vomiting, Childhood Giant Axonal Neuropathy, some 10, Partial Deletion (short arm), Chromosome 10, Childhood Hypophasphatasia, Childhood Muscular Dystro 10p-Partial, Chromosome 10 Partial Trisomy 10q24-qter, phy, CHN, Cholestasis, Cholestasis Hereditary Norwegian Chromosome 10 Trisomy 10q2, Partial Monosomy of Long Type, Cholestasis Intrahepatic, Cholestasis Neonatal, Arm of Chromosome 11, Chromosome 11 Partial Mono Cholestasis of Oral Contraceptive Users, Cholestasis with somy 11q, Chromosome 11 Partial Trisomy, Chromosome Peripheral Pulmonary Stenosis, Cholestasis of Pregnancy, 11 Partial Trisomy 11q13-qter, Chromosome 11 Partial Cholesterol Desmolase Deficiency, Cholesterol Desmolase Trisomy 11q21-qter, Chromosome 11 Partial Trisomy Deficiency, Chondrodysplasia Punctata, Chondrodystrophia 11q23-qter, Chromosome 11q, Partial Trisomy, Chromo US 2007/0286856 A1 Dec. 13, 2007

some 12 Isochromosome 12p Mosaic, Chromosome 13 Ulcerative, Colitis Gravis, Colitis Gravis, Colitis Ulcerative Partial Monosomy 13q, Chromosome 13, Partial Monosomy Chronic Non-Specific Ulcerative Colitis, Collodion Baby, of the Long Arm, Chromosome 14 Ring, Chromosome 14 Coloboma Heart Defects Atresia of the Choanae Retardation Trisomy, Chromosome 15 Distal Trisomy 15q, Chromosome of Growth and Development Genital and Urinary Anomalies r15, Chromosome 15 Ring, Chromosome 15 Trisomy 15q2. and Ear Anomalies, Coloboma, Coloboma, Colonic Neuro Chromosome 15q Partial Duplication Syndrome, Chromo sis, Color blindness, Color blindness, Colour blindness, some 17 Interstitial Deletion 17p, Chromosome 18 Long Colour blindness, Colpocephaly, Columnar-Like Esopha Arm Deletion Syndrome, Chromosome 18 Monosomy 18p. gus, Combined Cone-Rod Degeneration, Combined Immu Chromosome 18 Monosomy 18Q, Chromosome 18 Ring, nodeficiency with Immunoglobulins, Combined Mesoecto Chromosome 18 Tetrasomy 18p, Chromosome 18q-Syn dermal Dysplasia, Common Variable drome, Chromosome 21 Mosaic 21 Syndrome, Chromo Hypogammaglobulinemia, Common Variable Immunodefi Some 21 Ring, Chromosome 21 Translocation 21 Syndrome, ciency, Common Ventricle, Communicating Hydrocephalus, Chromosome 22 Inverted Duplication (22pter-22q11), Complete Absense of Hypoxanthine-Guanine Phosphoribo Chromosome 22 Partial Trisomy (22pter-22q11), Chromo syltran?ferase, Complete Atrioventricular Septal Defect, some 22 Ring, Chromosome 22 Trisomy Mosaic, Chromo Complement Component 1 Inhibitor Deficiency, Comple some 48 XXYY. Chromosome 48 XXXY. Chromosome r15, ment Component C1 Regulatory Component Deficiency, Chromosomal Triplication, Chromosome Triplication, Complete Heart Block, Complex Carbohydrate Intolerance, Chromosome Triploidy Syndrome, Chromosome X, Chro Complex Regional Pain Syndrome, Complex V ATP Syn mosome XXY. Chronic Acholuric Jaundice, Chronic Adhe thase Deficiency, Complex I, Complex I NADH dehydro sive Arachnoiditis, Chronic Adrenocortical Insufficiency, genase deficiency, Complex II, Complex II Succinate dehy Chronic Cavernositis, Chronic Congenital Aregenerative drogenase deficiency, Complex III, Complex III Anemia, Chronic Dysphagocytosis, Chronic Familial Ubiquinone-cytochrome c oxidoreductase deficiency, Com Granulomatosis, Chronic Familial Icterus, Chronic Fatigue plex IV, Complex IV Cytochrome c oxidase deficiency, Immune Dysfunction Syndrome (CFIDS), Chronic Granu Complex IV Deficiency, Complex V. Cone-Rod Degenera lomatous Disease, Chronic Guillain-Barre Syndrome, tion, Cone-Rod Degeneration Progressive, Cone Dystrophy, Chronic Idiopathic Jaundice, Chronic Idiopathic Polyneuri Cone-Rod Dystrophy, Confluent Reticular Papillomatosis, tis (CIP), Chronic Inflammatory Demyelinating Polyneur Congenital with low PK Kinetics, Congenital Absence of opathy, Chronic Inflammatory Demyelinating Polyradiculo Abdominal Muscles, Congenital Absence of the Thymus neuropathy, Chronic Motor Tic, Chronic Mucocutaneous and Parathyroids, Congenital Achromia, Congenital Addi Candidiasis, Chronic Multiple Tics, Chronic Non-Specific son's Disease, Congenital Adrenal Hyperplasia, Congenital Ulcerative Colitis, Chronic Non-Specific Ulcerative Colitis, Adreneal Hyperplasia, Congenital Afibrinogenemia, Con Chronic Obliterative Cholangitis, Chronic Peptic Ulcer and genital Alveolar HypoVentilation, Congenital Anemia of Esophagitis Syndrome, Chronic Progressive Chorea, Newborn, Congenital Bilateral Persylvian Syndrome, Con Chronic Progressive External Opthalmoplegia Syndrome, genital Brown Syndrome, Congenital Cardiovascular Chronic Progressive External Opthalmoplegia and myopa Defects, Congenital Central Hypoventilation Syndrome, thy, Chronic Progressive External Opthalmoplegia with Congenital Cerebral Palsy, Congenital Cervical Synostosis, Ragged Red Fibers, Chronic Relapsing Polyneuropathy, Congenital Clasped Thumb with Mental Retardation, Con Chronic Sarcoidosis, Chronic Spasmodic Dysphonia, genital Contractural Arachnodactyly, Congenital Contrac Chronic Vomiting in Childhood, CHS, Churg-Strauss Syn tures Multiple with Arachnodactyly, Congenital Cyanosis, drome, Cicatricial Pemphigoid, CIP, Cirrhosis Congenital Congenital Defect of the Skull and Scalp, Congenital Dila Pigmentary, Cirrhosis, Cistinuria, Citrulinemia, CJD. Clas tation of Intrahepatic Bile Duct, Congenital Dysmyelinating sic Schindler Disease, Classic Type Pfeiffer Syndrome, Neuropathy, Congenital Dysphagocytosis, Congenital Dys Classical Maple Syrup Urine Disease, Classical Hemophilia, plastic Angiectasia, Congenital Erythropoietic Porphyria, Classical Form Cockayne Syndrome Type I (Type A), Clas Congenital Erythropoietic Porphyria, Congenital Factor sical Leigh's Disease, Classical Phenylketonuria, Classical XIII Deficiency, Congenital Failure of Autonomic Control X-Linked Pelizaeus-Merzbacher Brain Sclerosis, CLE, Cleft of Respiration, Congenital Familial Nonhemolytic Jaundice Lip/Palate Mucous Cysts Lower Lip PP Digital and Genital Type I, Congenital Familial Protracted Diarrhea, Congenital Anomalies, Cleft Lip-Palate Blepharophimosis Lagopthal Form Cockayne Syndrome Type II (Type B), Congenital mos and Hypertelorism, Cleft Lip/Palate with Abnormal Generalized Fibromatosis, Congenital German Measles, Thumbs and Microcephaly, Cleft palate-joint contractures Congenital Giant AXonal Neuropathy, Congenital Heart dandy walker malformations, Cleft Palate and Cleft Lip, Block, Congenital Heart Defects, Congenital Hemidysplasia Cleidocranial Dysplasia w/Micrognathia, Absent Thumbs, with Ichthyosis Erythroderma and Limb Defects, Congenital & Distal Aphalangia, Cleidocranial Dysostosis, Cleidocra Hemolytic Jaundice, Congenital Hemolytic Anemia, Con nial Dysplasia, Click murmur syndrome, CLN1, Clonic genital Hepatic Fibrosis, Congenital Hereditary Corneal Spasmodic, Cloustons Syndrome, Clubfoot, CMDI, CMM, Dystrophy, Congenital Hereditary Lymphedema, Congenital CMT, CMTC, CMTX, COA Syndrome, Coarctation of the Hyperchondroplasia, Congenital Hypomyelinating Poly aorta, Coarctation of the aorta, Coats Disease, Cobblestone neuropathy, Congenital Hypomyelination Neuropathy, Con dysplasia, Cochin Jewish Disorder, Cockayne Syndrome, genital Hypomyelination, Congenital Hypomyelination COD-MD Syndrome, COD, Coffin Lowry Syndrome, Coffin Neuropathy, Congenital Hypomyelination (Onion Bulb) Syndrome, Coffin Siris Syndrome, COFS Syndrome, Cogan Polyneuropathy, Congenital Ichthyosiform Erythroderma, Corneal Dystrophy, Cogan Reese Syndrome, Cohen Syn Congenital Keratoconus, Congenital Lactic Acidosis, Con drome, Cold Agglutinin Disease, Cold Antibody Disease, genital Lactose Intolerance, Congenital Lipodystrophy, Cold Antibody Disease, Cold Antibody Hemolytic Anemia, Congenital Liver Cirrhosis, Congenital Lobar Emphysema, Cold Agglutinin Disease, Cold Agglutinin Disease, Colitis Congenital Localized Emphysema, Congenital Macroglos US 2007/0286856 A1 Dec. 13, 2007 20 sia, Congenital Medullary Stenosis, Congenital Megacolon, Synostosis, Craniosynostosis-Hypertrichosis-Facial and Congenital Melanocytic Nevus, Congenital Mesodermal Other Anomalies, Craniosynostosis Midfacial Hypoplasia Dysmorphodystrophy, Congenital Mesodermal Dystrophy, and Foot Abnormalities, Craniosynostosis Primary, Cranio Congenital MicroVillus Atrophy, Congenital Multiple Synostosis-Radial Aplasia Syndrome, Craniosynostosis with Arthrogryposis, Congenital Myotonic Dystrophy, Congeni Radial Defects, Cranium Bifidum, CREST Syndrome, tal Neuropathy caused by Hypomyelination, Congenital CREST Syndrome, Creutzfeldt Jakob Disease, Cri du Chat Pancytopenia, Congenital Pernicious Anemia, Congenital Syndrome, Crib Death, Crigler Najjar Syndrome Type I, Pernicious Anemia due to Defect of Intrinsic Factor, Con Crohn's Disease, Crohn's Disease, Cronkhite-Canada Syn genital Pernicious Anemia due to Defect of Intrinsic Factor, drome, Cross Syndrome, Cross Syndrome, Cross-McKu Congenital Pigmentary Cirrhosis, Congenital Porphyria, sick-Breen Syndrome, Crouzon, Crouzon Syndrome, Crou Congenital Proximal myopathy Associated with Desmin Zon Craniofacial Dysostosis, Cryoglobulinemia Essential Storage myopathy, Congenital Pulmonary Emphysema, Mixed, Cryptopthalmos-Syndactyly Syndrome, Cryp Congenital Pure Red Cell Anemia, Congenital Pure Red Cell torchidism-Dwarfism-Subnormal Mentality, Crystalline Aplasia, Congenital Retinal Blindness, Congenital Retinal Corneal Dystrophy of Schnyder, CS, CSD, CSID, CSO, Cyst, Congenital Retinitis Pigmentosa, Congenital Retin CST Syndrome, Curly Hair-Ankyloblephanon-Nail Dyspla oschisis, Congenital Rod Disease, Congenital Rubella Syn sia, Curschmann-Batten-Steinert Syndrome, Curth Macklin drome, Congenital Scalp Defects with Distal Limb Reduc Type Ichthyosis Hystric, Curth-Macklin Type, Cushings, tion Anomalies, Congenital Sensory Neuropathy, Congenital Cushing Syndrome, Cushing's III, Cutaneous Malignant SMA with arthrogryposis, Congenital Spherocytic Anemia, Melanoma Hereditary, Cutaneous Porphyrias, Cutis Laxa, Congenital Spondyloepiphyseal Dysplasia, Congenital Teth Cutis Laxa, Cutis Laxa-Growth Deficiency Syndrome, Cutis ered Cervical Spinal Cord Syndrome, Congenital Tyrosino Marmorata Telangiectatica Congenita, CVI. CVID, CVS, sis, Congenital Varicella Syndrome, Congenital Vascular CVS, Cyclic vomiting syndrome, Cystic Disease of the Cavernous Malformations, Congenital Vascular Veils in the Renal Medulla, Cystic Disease of the Renal Medulla, Cystic Retina, Congenital Word Blindness, Congenital Wandering Hygroma, Cystic Fibrosis, Cystic Lymphangioma, Cystine Spleen (Pediatric), Congestive Cardio myopathy, Conical Lysine-Arginine-Ornithinuria, Cystine Storage Disease, Cornea, Conjugated Hyperbilirubinemia, Conjunctivitis, Cystinosis, Cystinuria, Cystinuria with Dibasic Aminoaci Conjunctivitis Ligneous, Conjunctivo-Urethro-Synovial duria, Cystinuria Type I, Cystinuria Type II, Cystinuria Type Syndrome, Conn's Syndrome, Connective Tissue Disease, III, Cysts of the Renal Medulla Congenital, Cysts of the Conradi Disease, Conradi Hunermann Syndrome, Constitu Renal Medulla Congenital, Cytochrome C. Oxidase Defi tional Aplastic Anemia, Constitutional Erythroid Hypopla ciency, D.C., Dacryosialoadenopathy, Dacryosialoadeno sia, Constitutional Eczema, Constitutional Liver Dysfunc pathia, Dalpro, Dalton, Daltonism, Danbolt-Cross Syn tion, Constitutional Thrombopathy, Constricting Bands drome, Dancing Eyes-Dancing Feet Syndrome, Dandy Congenital, Constrictive Pericarditis with Dwarfism, Con Walker Syndrome, Dandy-Walker Cyst, Dandy-Walker tinuous Muscle Fiber Activity Syndrome, Contractural Deformity, Dandy Walker Malformation, Danish Cardiac Arachnodactyly, Contractural Arachnodactyly, Contractures Type Amyloidosis (Type III), Darier Disease, Davidson's of Feet Muscle Atrophy and Oculomotor Apraxia, Convul Disease, Davies’ Disease, DBA, DBS, DC, DD, De Barsy sions, Cooley's anemia, Copper Transport Disease, Copro Syndrome, De Barsy-Moens-Diercks Syndrome, de Lange porphyria Porphyria Hepatica, Cor Triatriatum, Cor Tria Syndrome, De Morsier Syndrome, De Santis Cacchione triatum Sinistrum, Cor Triloculare Biatriatum, Cor Syndrome, de Toni-Fanconi Syndrome, Deafness Congeni Biloculare, Cori Disease, Cornea Dystrophy, Corneal Amy tal and Functional Heart Disease, Deafness-Dwarfism-Reti loidosis, Corneal Clouding-Cutis Laxa-Mental Retardation, nal Atrophy, Deafness-Functional Heart Disease, Deafness Corneal Dystrophy, Cornelia de Lange Syndrome, Coronal Onychodystrophy Osteodystrophy and Mental Retardation, Dentine Dysplasia, Coronary Artery Disease, Coronary Deafness and Pili Torti Bjornstad Type, Deafness Senso Heart Disease, Corpus Callosum Agenesis, Cortical-Basal rineural with Imperforate Anus and Hypoplastic Thumbs, Ganglionic Degeneration, Corticalis Deformaris, Cortico Debrancher Deficiency, Deciduous Skin, Defect of Entero Basal Ganglionic Degeneration (CBGD), Corticobasal cyte Intrinsic Factor Receptor, Defect of Enterocyte Intrinsic Degeneration, Corticosterone Methloxidase Deficiency Factor Receptor, Defect in Natural Killer Lymphocytes, Type I, Corticosterone Methyloxidase Deficiency Type II, Defect of Renal Reabsorption of Carnitine, Deficiency of Cortisol, Costello Syndrome, Cot Death, COVESDEM Syn Glycoprotein Neuraminidase, Deficiency of Mitochondrial drome, COX, COX Deficiency, COX Deficiency French Respiratory Chain Complex IV. Deficiency of Platelet Gly Canadian Type, COX Deficiency Infantile Mitochondrial coprotein Ib. Deficiency of Von Willebrand Factor Receptor, myopathy de Toni-Fanconi-Debre included, COX Defi Deficiency of Short-Chain Acyl-CoA Dehydrogenase ciency Type Benign Infantile Mitochondrial Mypoathy, CP, (ACADS, Deformity with Mesomelic Dwarfism, Degenera CPEO, CPEO with myopathy, CPEO with Ragged-Red tive Chorea, Degenerative Lumbar Spinal Stenosis, Degos Fibers, CPPD Familial Form, CPT Deficiency, CPTD, Cra Disease, Degos-Kohlmeier Disease, Degos Syndrome, nial Arteritis, Cranial Meningoencephalocele, Cranio-Oro DEH. Deerine-Roussy Syndrome, Dejerine Sotas Disease, Digital Syndrome, Craniocarpotarsal dystrophy, Craniocele, Deletion 9p Syndrome Partial, Deletion 11q Syndrome Craniodigital Syndrome-Mental Retardation Scott Type, Partial, Deletion 13q Syndrome Partial, Delleman-Oorthuys Craniofacial Dysostosis, Craniofacial Dysostosis-PD Arte Syndrome, Delleman Syndrome, Dementia with Lobar Atro riosus-Hypertrichosis-Hypoplasia of Labia, Craniofrontona phy and Neuronal Cytoplasmic Inclusions, Demyelinating sal Dysplasia, Craniometaphyseal Dysplasia, Cranioorodigi Disease, DeMyer Syndrome, Dentin Dysplasia Coronal, tal Syndrome, Cranioorodigital Syndrome Type II, Dentin Dysplasia Radicular, Dentin Dysplasia Type I, Den Craniostenosis Crouzon Type, Craniostenosis, Craniosteno tin Dysplasia Type II, Dentinogenesis Imperfecta Brandy sis, Craniosynostosis-Choanal Atresia-Radial Humeral wine type, Dentinogenesis Imperfecta Shields Type, Denti US 2007/0286856 A1 Dec. 13, 2007 nogenesis Imperfecta Shields Type, Dentinogenesis Distal Arthrogryposis Type IIA, Distal Arthrogryposis Type Imperfecta Type III, Dentinogenesis Imperfecta Type III, 2A, Distal Duplication 6q Distal Duplication 10q, Dup Dento-Oculo-Osseous Dysplasia, Dento-Oculo-Osseous (10q) Syndrome, Distal Duplication 15q Distal Monosomy Dysplasia, Dentooculocutaneous Syndrome, Denys-Drash 9p, Distal Trisomy 6q Distal Trisomy 10q Syndrome, Distal Syndrome, Depakene, DepakeneTM exposure, Depakote, Trisomy 11q, Divalproex, DJS, DKC, DLE, DLPIII, DM, Depakote Sprinkle, Depigmentation-Gingival Fibromatosis DMC Syndrome, DMC Disease, DMD, DNS Hereditary, Microphthalmia, Dercum Disease, Dercum Disease, Derma DOC I, DOC2, DOC 4, DOC 6 (Harlequin Type), DOC 8 titis Atopic, Dermatitis Exfoliativa, Dermatitis Herpetifor Curth-Macklin Type, DOC 11 Phytanic Acid Type, DOC 12 mis, Dermatitis Multiformis, Dermatochalasia Generalized, (Neutral Lipid Storage Type), DOC 13, DOC 14, DOC 14 Dermatolysis Generalized, Dermatomegaly, Dermatomyosi Trichothiodystrophy Type, DOC 15 (Keratitis Deafness tis sine myositis, Dermatomyositis, Dermatosparaxis, Der Type), DOC 16, DOC 16 Unilateral Hemidysplasia Type, matostomatitis Stevens Johnson Type, Desbuquois Syn DOC 18, DOC 19, DOC 20, DOC 24, Dohle's Bodies drome, Desmin Storage myopathy, Desquamation of Myelopathy, Dolichospondylic Dysplasia, Dolichostenom Newborn, Deuteranomaly, Deuteranomaly, Developmental elia, Dolichostenomelia Syndrome, Dominant Type Kenny Reading Disorder, Developmental Gerstmann Syndrome, Caffe Syndrome, Dominant Type Myotonia Congenita, Devergie Disease, Devic Disease, Devic Syndrome, Dex Donahue Syndrome, Donath-Landsteiner Hemolytic Ane trocardia-Bronchiectasis and Sinusitis, Dextrocardia with mia, Donath-Landsteiner Syndrome, DOOR Syndrome, Situs Inversus, DGS, DGSX Golabi-Rosen Syndrome DOORS Syndrome, Dopa-responsive Dystonia (DRD), Included, DH, DHAP alkyl transferase deficiency, DHBS Dorfman Chanarin Syndrome, Dowling-Meara Syndrome, Deficiency, DHBS Deficiency, DHOF, DHPR Deficiency, Down Syndrome, DR Syndrome, Drash Syndrome, DRD, DHPR Deficiency, Diabetes Insipidus, Diabetes Insipidus Dreifuss-Emery Type Muscular Dystrophy with Contrac Diabetes Mellitus Optic Atrophy and Deafness, Diabetes tures, Dressler Syndrome, Drifting Spleen, Drug-induced Insipidus Neurohypophyseal, Diabetes Insulin Dependent, Acanthosis Nigricans, Drug-induced Lupus Erythematosus, Diabetes Mellitus, Diabetes Mellitus Addison's Disease Drug-related Adrenal Insufficiency, Drummond's Syn Myxedema, Diabetic Acidosis, Diabetic Bearded Woman drome, Dry Beriberi, Dry Eye, DTD, Duane's Retraction Syndrome, Diamond-Blackfan Anemia, Diaphragmatic Syndrome, Duane Syndrome, Duane Syndrome Type IA 1B Apnea, Diaphyseal Aclasis, Diastrophic Dwarfism, and 1C, Duane Syndrome Type 2A 2B and 2C, Duane Diastrophic Dysplasia, Diastrophic Nanism Syndrome, Syndrome Type 3A 3B and 3C, Dubin Johnson Syndrome, Dicarboxylic Aminoaciduria, Dicarboxylicaciduria Caused Dubowitz Syndrome, Duchenne, Duchenne Muscular Dys by Defect in Beta-Oxidation of Fatty Acids, Dicarboxyli trophy, Duchenne's Paralysis, Duhring's Disease, Duncan caciduria due to Defect in Beta-Oxidation of Fatty Acids, Disease, Duncan's Disease, Duodenal Atresia, Duodenal Dicarboxylicaciduria due to MCADH Deficiency, Dichro Stenosis, Duodenitis, Duplication 4p Syndrome, Duplica masy, Dicker-Opitz, DIDMOAD. Diencephalic Syndrome, tion 6q Partial, Dupuy's Syndrome, Dupuytren’s Contrac Diencephalic Syndrome of Childhood, Diencephalic Syn ture, Dutch-Kennedy Syndrome, Dwarfism, Dwarfism Cam drome of Emaciation, Dienoyl-CoA Reductase Deficiency, pomelic, Dwarfism Cortical Thickening of the Tubular Diffuse Cerebral Degeneration in Infancy. Diffuse Degen Bones & Transient Hypocalcemia, Dwarfism Levi’s Type, erative Cerebral Disease. Diffuse Idiopathic Skeletal Hyper Dwarfism Metatropic, Dwarfism-Onychodysplasia, Dwarf ostosis, Diffusum-Glycopeptiduria, DiGeorge Syndrome, ism-Pericarditis, Dwarfism with Renal Atrophy and Deaf DiGeorge Syndrome, Digital-Oro-Cranio Syndrome, ness, Dwarfism with Rickets, DWM. Dyggve Melchior Digito-Oto-Palatal Syndrome, Digito-Oto-Palatal Syndrome Clausen Syndrome, Dysautonomia Familial, Dysbetalipo Type I, Digito-Oto-Palatal Syndrome Type II, Dihydrobiop proteinemia Familial, Dyschondrodysplasia with Heman terin Synthetase Deficiency, Dihydrobiopterin Synthetase giomas, Dyschondrosteosis, Dyschromatosis Universalis Deficiency, Dihydropteridine Reductase Deficiency, Dihy Hereditaria, Dysencephalia Splanchinocystica, Dyskeratosis dropteridine Reductase Deficiency, Dihydroxyacetonephos Congenita, Dyskeratosis Congenita Autosomal Recessive, phate synthase, Dilated (Congestive) Cardio myopathy, Dyskeratosis Congenita Scoggins Type, Dyskeratosis Con Dimitri Disease, Diplegia of Cerebral Palsy, Diplo-Y Syn genita Syndrome, Dyskeratosis Follicularis Vegetans, Dys drome, Disaccharidase Deficiency, Disaccharide Intolerance lexia, Dysmyelogenic Leukodystrophy, Dysmyelogenic I, Discoid Lupus, Discoid Lupus Erythematosus, DISH, Leukodystrophy-Megalobare, Dysphonia Spastica, Dyspla Disorder of Cornification, Disorder of Cornification Type I, sia Epiphysialis Punctata, Dysplasia Epiphyseal Disorder of Cornification 4, Disorder of Cornification 6, Hemimelica, Dysplasia of Nails With Hypodontia, Dyspla Disorder of Cornification 8, Disorder of Cornification 9 sia Cleidocranial, Dysplasia Fibrous, Dysplasia Gigantism Netherton's Type, Disorder of Cornification 11 Phytanic Syndromex-Linked, Dysplasia Osteodental, Dysplastic Acid Type, Disorder of Cornification 12 (Neutral Lipid Nevus Syndrome, Dysplastic Nevus Syndrome, Dysplastic Storage Type), Disorder of Cornification 13, Disorder of Nevus Type, Dyssynergia Cerebellaris Myoclonica, Dyssyn Cornification 14, Disorder of Cornification 14 Trichothiod ergia Esophagus, Dystonia, Dystonia, Dystopia Canthorurn, ystrophy Type, Disorder of Cornification 15 (Keratitis Deaf Dystopia Canthorum, Dystrophia Adiposogenitalis, Dystro ness Type), Disorder of Cornification 16, Disorder of Corni phia Endothelialis Cornea, Dystrophia Mesodermalis, Dys fication 18 Erythrokeratodermia Variabilis Type, Disorder of trophic Epidermolysis Bullosa, Dystrophic Epidermolysis Cornification 19, Disorder of Cornification 20, Disorder of Bullosa, Dystrophy, Asphyxiating Thoracic, Dystrophy Cornification 24, Displaced Spleen, Disseminated Lupus Myotonic, E-D Syndrome, Eagle-Barrett Syndrome, Eales Erythematosus, Disseminated Neurodermatitis, Dissemi Retinopathy, Eales Disease, Ear Anomalies-Contractures nated Sclerosis, Distal 11q Monosomy, Distal 11q-Syn Dysplasia of Bone with Kyphoscoliosis, Ear Patella Short drome, Distal Arthrogryposis Multiplex Congenita Type Stature Syndrome, Early Constraint Defects, Early Hyper IIA, Distal Arthrogryposis Multiplex Congenita Type IIA, calcemia Syndrome with Elfin Facie, Early-onset Dystonia, US 2007/0286856 A1 Dec. 13, 2007 22

Eaton Lambert Syndrome, EB. Ebsteins anomaly, EBV phy of Meesmann Juvenile, Epitheliomatosis Multiplex with Susceptibility (EBVS), EBVS, ECD, ECPSG, Ectodermal Nevus, Epithelium, Epival, EPS, Epstein-Barr Virus-In Dysplasias, Ectodermal Dysplasia Anhidrotic with Cleft Lip duced Lymphoproliferative Disease in Males, Erb-Goldflam and Cleft Palate, Ectodermal Dysplasia-Exocrine Pancreatic syndrome, Erdheim Chester Disease, Erythema Multiforme Insufficiency, Ectodermal Dysplasia Rapp-Hodgkin type, Exudativum, Erythema Polymorphe Stevens Johnson Type, Ectodermal and Mesodermal Dysplasia Congenital, Ecto Erythroblastophthisis, Erythroblastosis Fetalis, Erythroblas dermal and Mesodermal Dysplasia with Osseous Involve tosis Neonatorum, Erythroblastotic Anemia of Childhood, ment, Ectodermosis Erosiva Pluriorificialis, Ectopia Lentis, Erythrocyte Phosphoglycerate Kinase Deficiency, Erythro Ectopia Vesicae, Ectopic ACTH Syndrome, Ectopic Adreno genesis Imperfecta, Erythrokeratodermia Progressiva Sym corticotropic Hormone Syndrome, Ectopic Anus, Ectrodac metrica, Erythrokeratodermia Progressiva Symmetrica Ich tilia of the Hand, Ectrodactyly, Ectrodactyly-Ectodermal thyosis, Erythrokeratodermia Variabilis, Dysplasia-Clefting Syndrome, Ectrodactyly Ectodermal Erythrokeratodermia Variabilis, Erythrokeratodermia Vari Dysplasias Clefting Syndrome, Ectrodactyly Ectodermal abilis Type, Erythrokeratolysis Hiemalis, Erythrokeratolysis Dysplasia Cleft Lip/Cleft Palate, Eczema, Eczema-Throm Hiemalis, Erythrokeratolysis Hiemalis, Erythropoietic Por bocytopenia-Immunodeficiency Syndrome, EDA, EDMD, phyrias, Erythropoietic Porphyria, Escobar Syndrome, EDS, EDS Arterial-Ecchymotic Type, EDS Arthrochalasia, Esophageal Atresia, Esophageal Aperistalsis, Esophagitis EDS Classic Severe Form, EDS Dysfibronectinemic, EDS Peptic Ulcer, Esophagus Atresia and/or Tracheoesophageal Gravis Type, EDS Hypermobility, EDS Kyphoscoliotic, Fistula, Essential Familial Hyperlipemia, Essential Fructo EDS Kyphoscoliosis, EDS Mitis Type, EDS Ocular-Scoli Suria, Essential Hematuria, Essential Hemorrhagic Throm otic, EDS Progeroid, EDS Periodontosis, EDS Vascular, bocythemia, Essential Hemorrhagic Thrombocythemia, EEC Syndrome, EFE, EHBA, EHK, Ehlers Danlos Syn Essential Mixed Cryoglobulinemia, Essential Moschowitz drome, Ehlers-Danlos syndrome, Ehlers Danlos IX, Eisen Disease, Essential Thrombocythemia, Essential Thromb menger Complex, Eisenmenger's complex, Eisenmenger ocythemia, Essential Thrombocytopenia, Essential Throm Disease, Eisenmenger Reaction, Eisenmenger Syndrome, bocytosis, Essential Thrombocytosis, Essential Tremor, Eisenmenger Syndrome, Ekbom Syndrome, Ekman-Lob Esterase Inhibitor Deficiency, Estren-Dameshek variant of stein Disease, Ektrodactyly of the Hand, Ektrodactyly of the Fanconi. Anemia, Estrogen-related Cholestasis, ET. ET, Hand, EKV, Elastin fiber disorders, Elastorrhexis General ETF, Ethylmalonic Adipicaciduria, Eulenburg Disease, pc, ized, Elastosis Dystrophica Syndrome, Elective Mutism EVCS, Exaggerated Startle Reaction, Exencephaly, Exog (obsolete), Elective Mutism, Electrocardiogram (ECG or enous Hypertriglyceridemia, Exomphalos-Macroglossia-Gi EKG), Electron Transfer Flavoprotein (ETF) Dehydroge gantism Syndrom, Exophthalmic Goiter, Expanded Rubella nase Deficiency: (GAII & MADD), Electrophysiologic Syndrome, Exstrophy of the Bladder, EXT, External Chon study (EPS), Elephant Nails From Birth, Elephantiasis Con dromatosis Syndrome, Extrahepatic Biliary Atresia, genita Angiomatosa, Hemangiectatic Hypertrophy, Elfin Extramedullary Plasmacytoma, Exudative Retinitis, Eye Facies with Hypercalcemia, Ellis-van Creveld Syndrome, Retraction Syndrome, FA1, FAA, Fabry Disease, FAC, Ellis Van Creveld Syndrome, Embryoma Kidney, Embryo FACB, FACD, FACE, FACF, FACG, FACH, Facial Nerve nal Adenomyosarcoma Kidney, Embryonal Carcinosarcoma Palsy, Facial Paralysis, Facial Ectodermal Dysplasias, Facial Kidney, Embryonal Mixed Tumor Kidney, EMC, Emery Ectodermal Dysplasia, Facio-Scapulo-Humeral Dystrophy, Dreyfus Muscular Dystrophy, Emery-Dreifuss Muscular Facio-Auriculo-Vertebral Spectrum, Facio-cardio-cutaneous Dystrophy, Emery-Dreifuss Syndrome, EMF, EMG Syn syndrome, Facio-Fronto-Nasal Dysplasia, Faciocutaneosk drome, Empty Sella Syndrome, Encephalitis Periaxialis Dif eletal Syndrome, Faciodigitogenital syndrome, Faciogenital fusa, Encephalitis Periaxialis Concentrica, Encephalocele, dysplasia, Faciogenitopopliteal Syndrome, Faciopala Encephalofacial Angiomatosis, Encephalopathy, Encephal toosseous Syndrome, Faciopalatoosseous Syndrome Type otrigeminal Angiomatosis, Enchondromatosis with Multiple II, Facioscapulohumeral muscular dystrophy, Factitious Cavernous Hemangiomas, Endemic Polyneuritis, Endocar Hypoglycemia, Factor VIII Deficiency, Factor IX Defi dial Cushion Defect, Endocardial Cushion Defect, Endocar ciency, Factor IX Deficiency, Factor XI Deficiency, Factor dial Cushion Defects, Endocardial Dysplasia, Endocardial XII deficiency, Factor XIII Deficiency, Fahr Disease, Fahr's Fibroelastosis (EFE), Endogenous Hypertriglyceridemia, Disease, Failure of Secretion Gastric Intrinsic Factor, Fair Endolymphatic Hydrops, Endometrial Growths, bank Disease, Fallots Tetralogy, Familial Acrogeria, Famil Endometriosis, Endomyocardial Fibrosis, Endothelial Cor ial Acrogeria, Familial Acromiciria, Familial Acromiciria, neal Dystrophy Congenital, Endothelial Epithelial Corneal Familial Adenomatous Colon Polyposis, Familial Adenoma Dystrophy, Endothelium, Engelmann Disease, Enlarged tous Polyposis with Extraintestinal Manifestations, Familial Tongue, Enterocolitis, Enterocyte Cobalamin Malabsorp Alobar Holoprosencephaly, Familial Alpha-Lipoprotein tion, Eosinophia Syndrome, Eosinophilic Cellulitis, Eosino Deficiency, Familial Amyotrophic Chorea with Acanthocy philic Fasciitis, Eosinophilic Granuloma, Eosinophilic Syn tosis, Familial Arrhythmic Myoclonus, Familial Articular drome, Epidermal Nevus Syndrome, Epidermolysis bullosa, Chondrocalcinosis, Familial Atypical Mole-Malignant Epidermolysis Bullosa, Epidermolysis Bullosa Acquisita, Melanoma Syndrome, Familial Broad Beta Disease, Famil Epidermolysis Bullosa Hereditaria, Epidermolysis Bullosa ial Calcium Gout, Familial Calcium Pyrophosphate Arthr Letalias, Epidermolysis Hereditaria Tarda, Epidermolytic opathy, Familial Chronic Obstructive Lung Disease, Famil Hyperkeratosis, Epidermolytic Hyperkeratosis (Bullous ial Continuous Skin Peeling, Familial Cutaneous CIE), Epilepsia Procursiva, Epilepsy, Epinephrine, Epiphy Amyloidosis, Familial Dysproteinemia, Familial Emphy seal Changes and High Myopia, Epiphyseal Osteochon sema, Familial Enteropathy Microvillus, Familial Foveal droma Benign, Epiphysealis Hemimelica Dysplasia, Epi Retinoschisis, Familial Hibernation Syndrome, Familial sodic-Abnormal Eye Movement, Epithelial Basement High Cholesterol, Familial Hemochromatosis, Familial Membrane Corneal Dystrophy, Epithelial Corneal Dystro High Blood Cholesterol, Familial High-Density Lipoprotein US 2007/0286856 A1 Dec. 13, 2007

Deficiency, Familial High Serum Cholesterol, Familial Forsius-Eriksson Syndrome (X-Linked), Fothergill Disease, Hyperlipidema, Familial Hypoproteinemia with Lym Fountain Syndrome, Foveal Dystrophy Progressive, FPO phangietatic Enteropathy, Familial Jaundice, Familial Juve Syndrome Type II, FPO, Fraccaro Type Achondrogenesis nile Nephronophtisis-Associated Ocular Anomaly, Familial (Type IB), Fragile X syndrome, Franceschetti-Zwalen-Klein Lichen Amyloidosis (Type IX), Familial Lumbar Stenosis, Syndrome, Francois Dyscephaly Syndrome, Francois Familial Lymphedema Praecox, Familial Mediterranean Neetens Speckled Dystrophy, Flecked Corneal Dystrophy, Fever, Familial Multiple Polyposis, Familial Nuchal Bleb, Fraser Syndrome, FRAXA, FRDA, Fredrickson Type I Familial Paroxysmal Polyserositis, Familial Polyposis Coli, Hyperlipoproteinemia, Freeman-Sheldon Syndrome, Freire Familial Primary Pulmonary Hypertension, Familial Renal Maia Syndrome, Frey's Syndrome, Friedreich's Ataxia, Glycosuria, Familial Splenic Anemia, Familial Startle Dis Friedreich's Ataxia, Friedreich's Disease, Friedreich's ease, Familial Visceral Amyloidosis (Type VIII), FAMMM, Tabes, FRNS, Froelich's Syndrome, Frommel-Chiari Syn FANCA, FANCB, FANCC, FANCD, FANCE, Fanconi Pan drome. Frommel-Chiari Syndrome Lactation-Uterus Atro myelopathy, Fanconi Pancytopenia, Fanconi II, Fanconi's phy, Frontodigital Syndrome, Frontofacionasal Dysostosis, Anemia, Fanconi's Anemia Type I, Fanconi's Anemia Frontofacionasal Dysplasia, Frontonasal Dysplasia, Fronto Complementation Group, Fanconi's Anemia Complementa nasal Dysplasia with Coronal Craniosynostosis, Fructose-1- tion Group A, Fanconi's Anemia Complementation Group Phosphate Aldolase Deficiency, Fructosemia, Fructosuria, B. Fanconi's Anemia Complementation Group C, Fanconi's Fryns Syndrome, FSH, FSHD, FSS, Fuchs Dystrophy, Anemia Complementation Group D, Fanconi's Anemia Fucosidosis Type 1, Fucosidosis Type 2, Fucosidosis Type 3. Complementation Group E, Fanconi's Anemia Complemen Fukuhara Syndrome, Fukuyama Disease, Fukuyama Type tation Group G, Fanconi's Anemia Complementation Group Muscular Dystrophy, Fukuyama Type Muscular Dystrophy, H, Fanconi's Anemia Estren-Dameshek Variant, FANF, Fumarylacetoacetase deficiency, Furrowed Tongue, G Syn FANG, FANH, FAP, FAPG, Farber's Disease, Farber's drome, G6PD Deficiency, G6PD, GAI, GAIIB, GA IIA, GA Lipogranulomatosis, FAS, Fasting Hypoglycemia, Fat-In II, GAII & MADD, Galactorrhea-Amenorrhea Syndrome duced Hyperlipemia, Fatal Granulomatous Disease of Child Nonpuerperal, Galactorrhea-Amenorrhea without Preg hood, Fatty Oxidation Disorders, Fatty Liver with Encepha nancy, Galactosamine-6-Sulfatase Deficiency, Galactose-1- lopathy, FAV, FCH, FCMD, FCS Syndrome, FD, FDH, Phosphate Uridyl Transferase Deficiency, Galactosemia, Febrile Mucocutaneous Syndrome Stevens Johnson Type, GALB Deficiency, Galloway-Mowat Syndrome, Galloway Febrile Neutrophilic Dermatosis Acute, Febrile Seizures, Syndrome, GALT Deficiency, Gammaglobulin Deficiency, Feinberg’s syndrome, Feissinger-Leroy-Reiter Syndrome, GAN, Ganglioside Neuraminidase Deficiency, Ganglioside Female Pseudo-Turner Syndrome, Femoral Dysgenesis Sialidase. Deficiency, Gangliosidosis GM1 Type 1, Gangli Bilateral-Robin Anomaly, Femoral Dysgenesis Bilateral, osidosis GM2 Type 2, Gangliosidosis Beta Hexosaminidase Femoral Facial Syndrome. Femoral Hypoplasia-Unusual B Deficiency, Gardner Syndrome, Gardner Syndrome, Gar Facies Syndrome, Fetal Alcohol Syndrome, Fetal Anti goylism, Garies-Mason Syndrome, Gasser Syndrome, Gas Convulsant Syndrome, Fetal Cystic Hygroma, Fetal Effects tric Intrinsic Factor Failure of Secretion, Enterocyte Cobal of Alcohol, Fetal Effects of Chickenpox, Fetal Effects of amin, Gastrinoma, Gastritis, Gastroesophageal Laceration Thalidomide, Fetal Effects of Varicella Zoster Virus, Fetal Hemorrhage, Gastrointestinal Polyposis and Ectodermal Endomyocardial Fibrosis, Fetal Face Syndrome, Fetal Iritis Changes, Gastroschisis, Gaucher Disease, Gaucher Syndrome, Fetal Transfusion Syndrome, Fetal Valproate Schlagenhaufer, Gayet-Wernicke Syndrome, GBS, GCA, Syndrome, Fetal Valproic Acid Exposure Syndrome, Fetal GCM Syndrome, GCPS, Gee-Herter Disease, Gee-Thaysen Varicella Infection, Fetal Varicella Zoster Syndrome, FFDD Disease, Gehrig's Disease, Gelineau's Syndrome, Genee Type II, FG Syndrome, FGDY, FHS, Fibrin Stabilizing Wiedemann Syndrome, Generalized Dystonia, Generalized Factor Deficiency, Fibrinase Deficiency, Fibrinoid Degen Familial Neuromyotonia, Generalized Fibromatosis, Gener eration of Astrocytes, Fibrinoid Leukodystrophy, Fibrinoli alized Flexion Epilepsy, Generalized Glycogenosis, Gener gase Deficiency, Fibroblastoma Perineural, Fibrocystic Dis alized Glycogenosis, Generalized Hyperhidrosis, General ease of Pancreas, Fibrodysplasia Ossificans Progressiva, ized Lipofuscinosis, Generalized Myasthenia Gravis, Fibroelastic Endocarditis, Fibromyalgia, Fibromyalgia-Fi Generalized Myotonia, Generalized Sporadic Neuromyto bromyositis, Fibromyositis, Fibrosing Cholangitis, Fibrosi nia, Genetic Disorders, Genital Defects, Genital and Urinary tis, Fibrous Ankylosis of Multiple Joints, Fibrous Cavern Tract Defects, Genital and Urinary Tract Defects, Gerst ositis, Fibrous Dysplasia, Fibrous Plaques of the Penis, mann Syndrome, Gerstmann Tetrad, GHBP, GHD, GHR, Fibrous Sclerosis of the Penis, Fickler-Winkler Type, Fiedler Giant Axonal Disease, Giant Axonal Neuropathy, Giant Disease, Fifth Digit Syndrome, Filippi Syndrome, Finnish Benign Lymphoma, Giant Cell Glioblastoma Astrocytoma, Type Amyloidosis (Type V), First Degree Congenital Heart Giant Cell Arteritis, Giant Cell Disease of the Liver, Giant Block, First and Second Branchial Arch Syndrome, Fis Cell Hepatitis, Giant Cell of Newborns Cirrhosis, Giant Cyst cher's Syndrome, Fish Odor Syndrome, Fissured Tongue, of the Retina, Giant Lymph Node Hyperplasia, Giant Plate Flat Adenoma Syndrome, Flatau-Schilder Disease, Flavin let Syndrome Hereditary, Giant Tongue, gic Macular Dys Containing Monooxygenase 2, Floating Beta Disease, Float trophy, Gilbert's Disease, Gilbert Syndrome, Gilbert-Drey ing-Harbor Syndrome, Floating Spleen, Floppy Infant Syn fus Syndrome, Gilbert-Dreyfus Syndrome, Gilbert drome, Floppy Valve Syndrome, Fluent aphasia, FMD, Lereboullet Syndrome, Gilford Syndrome, Gilles de la FMF, FMO Adult Liver Form, FMO2, FND, Focal Dermal Tourette's syndrome, Gillespie Syndrome, Gingival Fibro Dysplasia Syndrome, Focal Dermal Hypoplasia, Focal Der matosis-Abnormal Fingers Nails Nose Ear Splenomegaly, mato-Phalangeal Dysplasia, Focal Dystonia, Focal Epilepsy, GLADeficiency, GLA, GLB1, Glioma Retina, Global apha Focal Facial Dermal Dysplasia Type II, Focal Neuromyo sia, Globoid Leukodystrophy, Glossoptosis Micrognathia tonia, FODH, Folling Syndrome, Fong Disease, FOP, Forbes and Cleft Palate, Glucocerebrosidase deficiency, Glucocer Disease, Forbes-Albright Syndrome. Forestier's Disease, ebrosidosis, Glucose-6-Phosphate Dehydrogenase Defi US 2007/0286856 A1 Dec. 13, 2007 24 ciency, Glucose-6-Phosphate Tranport Defect, Glucose-6- imoto's Thyroiditis, Hashimoto's Thyroiditis, Hashimoto Phosphate Translocase Deficiency, Glucose-G-Phosphatase Pritzker Syndrome, Hay Well’s Syndrome, Hay-Wells Deficiency, Glucose-Galactose Malabsorption, Glucose-Ga Syndrome of Ectodermal Dysplasia, HCMM, HCP, HCTD, lactose Malabsorption, Glucosyl Ceramide Lipidosis, Glu HD, Heart-Hand Syndrome (Holt-Oram Type), Heart Dis taric Aciduria I, Glutaric Acidemia I, Glutaric Acidemia II, ease, Hecht Syndrome, HED, Heerferdt-Waldenstrom and Glutaric Aciduria II, Glutaric Aciduria Type II, Glutaric Lofgren's Syndromes, Hegglin's Disease, Heinrichsbauer Aciduria Type III, Glutaricacidemia I, Glutaricacidemia II, Syndrome, Hemangiomas, Hemangioma Familial, Heman Glutaricaciduria I, Glutaricaciduria II, Glutaricaciduria Type gioma-Thrombocytopenia Syndrome, Hemangiomatosis IIA, Glutaricaciduria Type IIB, Glutaryl-CoA Dehydroge Chondrodystrophica, Hemangiomatous Branchial Clefts nase Deficiency, Glutaurate-Aspartate Transport Defect, Lip Pseudocleft Syndrome, Hemifacial Microsomia, Gluten-Sensitive Enteropathy, Glycogen Disease of Muscle Hemimegalencephaly, Hemiparesis of Cerebral Palsy, Type VII, Glycogen Storage Disease I, Glycogen Storage Hemiplegia of Cerebral Palsy, Hemisection of the Spinal Disease III, Glycogen Storage Disease IV. Glycogen Storage Cord, Hemochromatosis, Hemochromatosis Syndrome, Disease Type V. Glycogen Storage Disease VI, Glycogen Hemodialysis-Related Amyloidosis, Hemoglobin Lepore Storage Disease VII, Glycogen Storage Disease VIII, Gly Syndromes, Hemolytic Anemia of Newborn, Hemolytic cogen Storage Disease Type II, Glycogen Storage Disease Cold Antibody Anemia, Hemolytic Disease of Newborn, Type II, Glycogenosis, Glycogenosis Type I, Glycogenosis Hemolytic-Uremic Syndrome, Hemolytic-Uremic Syn Type IA, Glycogenosis Type IB, Glycogenosis Type II, drome, Hemophilia, Hemophilia A, Hemophilia B, Hemo Glycogenosis Type II, Glycogenosis Type III, Glycogenosis philia B Factor IX, Hemophilia C, Hemorrhagic Dystrophic Type IV. Glycogenosis Type V. Glycogenosis Type VI, Thrombocytopenia, Hemorrhagica Aleukia, Hemosiderosis, Glycogenosis Type VII, Glycogenosis Type VIII, Glycolic Hepatic Fructokinase Deficiency, Hepatic Phosphorylase Aciduria, Glycolic Aciduria, Glycolipid Lipidosis, GM2 Kinase Deficiency, Hepatic Porphyria, Hepatic Porphyrias, Gangliosidosis Type 1, GM2 Gangliosidosis Type 1, Hepatic Porphyrias, Hepatic Veno-Occlusive Disease, GNPTA, Goitrous Autoimmune Thyroiditis, Goldenhar Hepato-Renal Syndrome, Hepatolenticular Degeneration, Syndrome, Goldenhar-Gorlin Syndrome, Goldscheider's Hepatophosphorylase Deficiency, Hepatorenal Glycogeno Disease, Goltz Syndrome, Goltz-Gorlin Syndrome, Gonadal sis, Hepatorenal Syndrome, Hepatorenal Tyrosinemia, Dysgenesis 45 X, Gonadal Dysgenesis XO, Goniodysgen Hereditary Acromelalgia, Hereditary Alkaptonuria, Heredi esis-Hypodontia, Goodman Syndrome, Goodman, Goodpas tary Amyloidosis, Hereditary Angioedema, Hereditary ture Syndrome, Gordon Syndrome, Gorlin’s Syndrome, Areflexic Dystasia, Heredopathia Atactica Polyneuritifor Gorlin-Chaudhry-Moss Syndrome, Gottron Erythrokerato mis, Hereditary Ataxia, Hereditary Ataxia, Hereditary dermia Congenitalis Progressiva Symmetrica, Gottron’s Ataxia Friedrich's Type, Hereditary Benign Acanthosis Nig Syndrome, Gougerot-Carteaud Syndrome, Grand Mal Epi ricans, Hereditary Cerebellar Ataxia, Hereditary Chorea, lepsy, Granular Type Corneal Dystrophy, Granulomatous Hereditary Chronic Progressive Chorea, Hereditary Connec Arteritis, Granulomatous Colitis, Granulomatous Dermatitis tive Tissue Disorders, Hereditary Coproporphyria, Heredi with Eosinophilia, Granulomatous Ileitis, Graves Disease, tary Coproporphyria Porphyria, Hereditary Cutaneous Graves Hyperthyroidism, Graves Disease, Greig Cepha Malignant Melanoma, Hereditary Deafness-Retinitis Pig lopolysyndactyly Syndrome, Groenouw Type I Corneal mentosa, Heritable Disorder of Zinc Deficiency, Hereditary Dystrophy, Groenouw Type II Corneal Dystrophy, Gron DNS, Hereditary Dystopic Lipidosis, Hereditary Emphy blad-Strandberg Syndrome, Grotton Syndrome, Growth sema, Hereditary Fructose Intolerance, Hereditary Hemor Hormone Receptor Deficiency, Growth Hormone Binding rhagic Telangiectasia, Hereditary Hemorrhagic Telangiecta Protein Deficiency, Growth Hormone Deficiency, Growth sia Type I, Hereditary Hemorrhagic Telangiectasia Type II, Mental Deficiency Syndrome of Myhre. Growth Retarda Hereditary Hemorrhagic Telangiectasia Type III, Hereditary tion-Rieger Anomaly, GRS. Gruber Syndrome, GS, GSD6, Hyperuricemia and Choreoathetosis Syndrome, Hereditary GSD8, GTS, Guanosine Triphosphate-Cyclohydrolase Defi Leptocytosis Major, Hereditary Leptocytosis Minor, Heredi ciency, Guanosine Triphosphate-Cyclohydrolase Defi tary Lymphedema, Hereditary Lymphedema Tarda, Heredi ciency, Guenther Porphyria, Guerin-Stem Syndrome, Guil tary Lymphedema Type I, Hereditary Lymphedema Type II, lain-Barré, Guillain-Barre Syndrome, Gunther Disease, H Hereditary Motor Sensory Neuropathy, Hereditary Motor Disease, H. Gottron’s Syndrome, H. Gottron’s Syndrome, Sensory Neuropathy I, Hereditary Motor Sensory Neuropa Habit Spasms, HAE, Hageman Factor Deficiency, Hageman thy Type III, Hereditary Nephritis, Hereditary Nephritis and factor, Haim-Munk Syndrome, Hajdu-Cheney Syndrome, Nerve Deafness, Hereditary Nephropathic Amyloidosis, Hajdu Cheney, HAL Deficiency, Hall-Pallister Syndrome, Hereditary Nephropathy and Deafness, Hereditary Nonpoly Hallermann-Streiff-Francois syndrome, Hallermann-Streiff posis Colorectal Cancer, Hereditary Nonpolyposis Colorec Syndrome, Hallervorden-Spatz Disease, Hallervorden-Spatz tal Carcinoma, Hereditary Nonspherocytic Hemolytic Ane Syndrome, Hallopeau-Siemens Disease, Hallux Duplication mia, Hereditary Onychoosteodysplasia, Hereditary Optic Postaxial Polydactyly and Absence of Corpus Callosum, Neuroretinopathy, Hereditary Polyposis Coli, Hereditary Halushi-Behcet’s Syndrome, Hamartoma of the Lymphatics, Sensory and Autonomic Neuropathy Type I, Hereditary Hand-Schueller-Christian Syndrome, HANE, Hanhart Syn Sensory and Autonomic Neuropathy Type II, Hereditary drome, Happy Puppet Syndrome, Harada Syndrome, HARD Sensory and Autonomic Neuropathy Type III, Hereditary +/-E Syndrome, HARD Syndrome, Hare Lip, Harlequin Sensory Motor Neuropathy, Hereditary Sensory Neuropathy Fetus, Harlequin Type DOC 6, Harlequin Type Ichthyosis, type I, Hereditary Sensory Neuropathy Type I, Hereditary Harlequin Type Ichthyosis, Harley Syndrome, Harrington Sensory Neuropathy Type II, Hereditary Sensory Neuropa Syndrome, Hart Syndrome, Hartnup Disease, Hartnup Dis thy Type III, Hereditary Sensory Radicular Neuropathy Type order, Hartnup Syndrome, Hashimoto's Disease, Hash I, Hereditary Sensory Radicular Neuropathy Type I, Heredi imoto-Pritzker Syndrome, Hashimoto's Syndrome, Hash tary Sensory Radicular Neuropathy Type II, Hereditary Site US 2007/0286856 A1 Dec. 13, 2007

Specific Cancer, Hereditary Spherocytic Hemolytic Anemia, E Syndrome, Hyperimmunoglobulin E-Recurrent Infection Hereditary Spherocytosis, Hereditary Tyrosinemia Type 1, Syndrome, Hyperimmunoglobulinemia E-Staphylococcal, Heritable Connective Tissue Disorders, Herlitz Syndrome, Hyperkalemia, Hyperkinetic Syndrome, Hyperlipemic Hermans-Herzberg Phakomatosis, Hermansky-Pudlak Syn Retinitis, Hyperlipidemia I, Hyperlipidemia IV. Hyperlipo drome, Hermansky-Pudlak Syndrome, Hermaphroditism, proteinemia Type I, Hyperlipoproteinemia Type III, Hyper Herpes Zoster, Herpes Iris Stevens-Johnson Type, Hers lipoproteinemia Type IV. Hyperoxaluria, Hyperphalangy Disease, Heterozygous Beta Thalassemia, Hexoaminidase Clinodactyly of Index Finger with Pierre Robin. Syndrome, Alpha-Subunit Deficiency (Variant B), Hexoaminidase Hyperphenylalanemia, Hyperplastic Epidermolysis Bullosa, Alpha-Subunit Deficiency (Variant B), HFA. HFM, HGPS, Hyperpnea, Hyperpotassemia, Hyperprebeta-Lipoproteine HH, HHHO, HHRH, HHT, Hiatal Hernia-Microcephaly mia, Hyperprolinemia Type I, Hyperprolinemia Type II, Nephrosis Galloway Type, Hidradenitis Suppurativa, Hid Hypersplenism, Hypertelorism with Esophageal Abnormali rosadenitis Axillaris, Hidrosadenitis Suppurativa, Hidrotic ties and Hypospadias, Hypertelorism-Hypospadias Syn Ectodermal Dysplasias, HIE Syndrome, High Imperforate drome, Hypertrophic Cardiomyopathy, Hypertrophic Inter Anus, High Potassium, High Scapula, HIM, Hirschsprung's stitial Neuropathy, Hypertrophic Interstitial Neuritis, Disease, Hirschsprung's Disease Acquired, Hirschsprung Hypertrophic Interstitial Radiculoneuropathy, Hypertrophic Disease Polydactyly of Ulnar & Big Toe and VSD, Hirschs Neuropathy of Refsum, Hypertrophic Obstructive Cardio prung Disease with Type D Brachydactyly, Hirsutism, HIS myopathy, Hyperuricemia Choreoathetosis Self-multilation Deficiency. Histidine Ammonia-Lyase (HAL) Deficiency, Syndrome, Hyperuricemia-Oligophrenia, Hypervalinemia, Histidase Deficiency. Histidinemia, Histidinemia, Histiocy Hypocalcified (Hypomineralized) Type, Hypochondrogen tosis, Histiocytosis X, HLHS, HLP Type II, HMG, HMI, esis, Hypochrondroplasia, Hypogammaglobulinemia, HMSN I, HNHA, HOCM, Hodgkin Disease, Hodgkin’s Hypogammaglobulinemia Transient of Infancy, Hypogenital Disease, Hodgkin’s Lymphoma, Hollaender-Simons Dis Dystrophy with Diabetic Tendency, Hypoglossia-Hypodac ease, Holmes-Adie Syndrome, Holocarboxylase Synthetase tylia Syndrome, Hypoglycemia, Hypoglycemia, Exogenous Deficiency, Holoprosencephaly, Holoprosencephaly Malfor Hypoglycemia, Hypoglycemia with Macroglossia, mation Complex, Holoprosencephaly Sequence, Holt-Oram Hypoglycosylation Syndrome Type 1a, Hypoglycosylation Syndrome, Holt-Oram Type Heart-Hand Syndrome, Syndrome Type 1a, Hypogonadism with Anosmia, Hypogo Homocystinemia, Homocystinuria, Homocystinuria, nadotropic Hypogonadism and Anosmia, Hypohidrotic Homogentisic Acid Oxidase Deficiency, Homogentisic Aci Ectodermal Dysplasia, Hypohidrotic Ectodermal Dysplasia dura, Homozygous Alpha-1-Antitrypsin Deficiency, HOOD, Autosomal Dominant type, Hypohidrotic Ectodermal Dys Horner Syndrome, Horton's disease, HOS, HOS1, Houston plasias Autorecessive, Hypokalemia, Hypokalemic Alkalo Harris Type Achrondrogenesis (Type IA), HPS, HRS, HS, sis with Hypercalciuria, Hypokalemic Syndrome, Hypolac HS, HS, HS, HS, HSAN Type I, HSAN Type II, HSAN-III, tasia, Hypomaturation Type (Snow-Capped Teeth), HSMN, HSMN Type III, HSN I, HSN-III, Huebner-Herter Hypomelanosis of Ito, Hypomelia-Hypotrichosis-Facial Disease, Hunner's Patch, Hunner's Ulcer, Hunter Syn Hemangioma Syndrome, Hypomyelination Neuropathy, drome, Hunter Syndrome, Hunter-Thompson Type Acrome Hypoparathyroidism, Hypophosphatasia, Hypophos somelic Dysplasia, Huntington's Chorea, Huntington's Dis phatemic Rickets with Hypercalcemia, Hypopigmentation, ease, Hurler Disease, Hurler Disease, Hurler Syndrome, Hypopigmentation, Hypopigmented macular lesion, Hypo Hurler-Scheie Syndrome, HUS, HUS, Hutchinson-Gilford plasia of the Depressor Anguli Oris Muscle with Cardiac Progeria Syndrome, Hutchinson-Gilford Syndrome, Hutch Defects, Hypoplastic Anemia, Hypoplastic Congenital Ane inson-Weber-Peutz Syndrome, Hutchinson-Weber-Peutz mia, Hypoplastic Chondrodystrophy, Hypoplastic Enamel Syndrome, Hutterite Syndrome Bowen-Conradi Type, Hya Onycholysis-Hypohidrosis, Hypoplastic (Hypoplastic-Ex line Panneuropathy, Hydranencephaly, Hydrocephalus, plastic) Type, Hypoplastic Left Heart Syndrome, Hydrocephalus Agyria and Retinal Dysplasia, Hydroceph Hypoplastic Left Heart Syndrome, Hypoplastic-Tripha alus Internal Dandy-Walker Type, Hydrocephalus Noncom langeal Thumbs, Hypopotassemia Syndrome, Hypospadias municating Dandy-Walker Type, Hydrocephaly, Hydro Dysphagia Syndrome, Hyposmia, Hypothalamic Hamarto nephrosis With Peculiar Facial Expression, Hydroxylase blastoma Hypopituitarism Imperforate Anus Polydactyly, Deficiency, Hygroma Colli, Hyper-IgE Syndrome, Hyper Hypothalamic Infantilism-Obesity, Hypothyroidism, Hypo IgM Syndrome, Hyper IgM Syndrome, Hyperaldoster tonia-Hypomentia-Hypogonadism-Obesity Syndrome, onism, Hyperaldosteronism With Hypokalemic Alkatosis, Hypoxanthine-Guanine Phosphoribosyltran?ferase Defect Hyperaldosteronism Without Hypertension, Hyperammone (Complete Absense of), I-Cell Disease, Iatrogenic Hypogly mia, Hyperammonemia Due to Carbamylphosphate Syn cemia, IBGC, IBIDS Syndrome, IBM, IBS, IC, I-Cell Dis thetase Deficiency, Hyperammonemia Due to Ornithine ease, ICD, ICE Syndrome Cogan-Reese Type, Icelandic Transcarbamylase Deficiency, Hyperammonemia Type II, Type Amyloidosis (Type VI), I-Cell Disease, Ichthyosiform Hyper-Beta Carnosinemia, Hyperbilirubinemia I, Hyperbi Erythroderma Corneal Involvement and Deafness, Ichthy lirubinemia II, Hypercalcemia Familial with Nephrocalci osiform Erythroderma Hair Abnormality Growth and Men, nosis and Indicanuria, Hypercalcemia-Supravalvar Aortic Ichthyosiform Erythroderma with Leukocyte Vacuolation, Stenosis, Hypercalciuric Rickets, Hypercapnic acidosis, Ichthyosis, Ichthyosis Congenita, Ichthyosis Congenital Hypercatabolic Protein-Losing Enteropathy, Hyperchlo with Trichothiodystrophy, Ichthyosis Hystrix, Ichthyosis remic acidosis, Hypercholesterolemia, Hypercholester Hystrix Gravior, Ichthyosis Linearis Circumflexa, Ichthyo olemia Type IV. Hyperchylomicronemia, Hypercystinuria, sis Simplex, Ichthyosis Tay Syndrome, Ichthyosis Vulgaris, Hyperekplexia, Hyperextensible joints, Hyperglobulinemic Ichthyosis Vulgaris, Ichthyotic Neutral Lipid Storage Dis Purpura, Hyperglycinemia with Ketoacidosis and Lactic ease, Icteric Leptospirosis, Icterohemorrhagic Leptospirosis, Acidosis Propionic Type, Hyperglycinemia Nonketotic, Icterus (Chronic Familial), Icterus Gravis Neonatorum, Ict Hypergonadotropic Hypogonadism, Hyperimmunoglobulin erus Intermittens Juvenalis, Idiopathic Alveolar Hypoventi US 2007/0286856 A1 Dec. 13, 2007 26 lation, Idiopathic Amyloidosis, Idiopathic Arteritis of Taka Myoclonus, Intermediate Cystinosis, Intermediate Maple yasu, Idiopathic Basal Ganglia Calcification (IBGC), Syrup Urine Disease, Intermittent Ataxia with Pyruvate Idiopathic Brachial Plexus Neuropathy, Idiopathic Cervical Dehydrogenase Deficiency, Intermittent Ataxia with Pyru Dystonia, Idiopathic Dilatation of the Pulmonary Artery, vate Dehydrogenase Deficiency, Intermittent Maple Syrup Idiopathic Dilatation of the Pulmonary Artery, Idiopathic Urine Disease, Internal Hydrocephalus, Interstitial Cystitis, Facial Palsy, Idiopathic Familial Hyperlipemia, Idiopathic Interstitial Deletion of 4q Included, Interstitial Deletion of Hypertrophic Subaortic Stenosis, Idiopathic Hypoproteine 4q-Included, Intestinal Lipodystrophy, Intestinal Lipophagic mia, Idiopathic Immunoglobulin Deficiency, Idiopathic Granulomatosis, Intestinal Lymphangiectasia, Intestinal Neonatal Hepatitis, Idiopathic Non-Specific Ulcerative Polyposis I, Intestinal Polyposis II, Intestinal Polyposis II, Colitis, Idiopathic Non-Specific Ulcerative Colitis, Idio Intestinal Polyposis III, Intestinal Polyposis-Cutaneous Pig pathic Peripheral Periphlebitis, Idiopathic Pulmonary Fibro mentation Syndrome, Intestinal Polyposis-Cutaneous Pig sis, Idiopathic Refractory Sideroblastic Anemia, Idiopathic mentation Syndrome, Intestinal Pseudoobstruction with Refractory Sideroblastic Anemia, Idiopathic Renal Hema External Opthalmoplegia, Intracranial Neoplasm, Intracra turia, Idiopathic Steatorrhea, Idiopathic Thrombocythemia, nial Tumors, Intracranial Vascular Malformations, Intrauter Idiopathic Thrombocythemia, Idiopathic Thrombocytopenic ine Dwarfism, Intrauterine Synechiae, Inverted Smile And Purpura, Idiopathic Thrombocytopenia Purpura (ITP), Occult Neuropathic Bladder, Iowa Type Amyloidosis (Type IDPA, IDPA, IgA Nephropathy, IgA Nephropathy, IHSS, IV), IP, IPA, Iridocorneal Endothelial Syndrome, Iridocor Ileitis, Ileocolitis, Illinois Type Amyloidosis, ILS, IM, neal Endothelial (ICE) Syndrome Cogan-Resse Type, Iri IMD2, IMD5, IMD5, Immune Defect due to Absence of dogoniodysgenesis With Somatic Anomalies, Iris Atrophy Thymus, Immune Hemolytic Anemia Paroxysmal Cold, with Corneal Edema and Glaucoma, Iris Nevus Syndrome, Immunodeficiency with Ataxia Telangiectasia, Immunode Iron Overload Anemia, Iron Overload Anemia, Iron Over ficiency Cellular with Abnormal Immunoglobulin Synthesis, load Disease, Irritable Bowel Syndrome, Irritable Colon Immunodeficiency Common Variable Unclassifiable. Immu Syndrome, Isaacs Syndrome, Isaacs-Merten Syndrome, nodeficiency with Hyper-IgM, Immunodeficiency with Leu Ischemic Cardio myopathy, Isolated Lissencephaly kopenia, Immunodeficiency-2, Immunodeficiency-5 Sequence, Isoleucine 33 Amyloidosis, Isovaleric Acid CoA (IMD5). Immunoglobulin Deficiency, Imperforate Anus, Dehydrogenase Deficiency, Isovaleric Acidaemia, Isovaleri Imperforate Anus with Hand Foot and Ear Anomalies, cacidemia, Isovaleryl CoA Carboxylase Deficiency, ITO Imperforate Nasolacrimal Duct and Premature Aging Syn Hypomelanosis, ITO, ITP, ITP, IVA, Ivemark Syndrome, drome, Impotent Neutrophil Syndrome, Inability To Open Iwanoff Cysts, Jackknife Convulsion, Jackson-Weiss Cran Mouth Completely And Short Finger-Flexor, INAD, INAD, iosynostosis, Jackson-Weiss Syndrome, Jacksonian Epi Inborn Error of Urea Synthesis Arginase Type, Inborn Error lepsy, Jacobsen Syndrome, Jadassohn-Lewandowsky Syn of Urea Synthesis Arginino Succinic Type, Inborn Errors of drome, Jaffe-Lichenstein Disease, Jakob's Disease, Jakob Urea Synthesis Carbamyl Phosphate Type, Inborn Error of Creutzfeldt Disease, Janeway I. Janeway Urea Synthesis Citrullinemia Type, Inborn Errors of Urea Dysgammaglobulinemia, Jansen Metaphyseal Dysostosis, Synthesis Glutamate Synthetase Type, INCL, Inclusion Jansen Type Metaphyseal Chondrodysplasia, Jarcho-Levin body myositis, Incomplete Atrioventricular Septal Defect, Syndrome, Jaw-Winking, JBS. JBS. JDMS, Jegher's Syn Incomplete Testicular Feminization, Incomplete Testicular drome, Jegher's Syndrome, Jejunal Atresia, Jeunitis, Feminization, Incontinentia Pigmenti, Incontinentia Pig Jejunoileitis, Jervell and Lange-Nielsen Syndrome, Jeune menti, Incontinenti Pigmenti Achromians, Index Finger Syndrome, JMS, Job Syndrome, Job-Buckley Syndrome, Anomaly with Pierre Robin Syndrome, Indiana Type Amy Johanson-Blizzard Syndrome, John Dalton, Johnson loidosis (Type II), Indolent systemic mastocytosis, Infantile Stevens Disease, Jonston's Alopecia, Joseph’s Disease, Acquired Aphasia, Infantile Autosomal Recessive Polycys Joseph’s Disease Type I, Joseph's Disease Type II, Joseph's tic Kidney Disease, Infantile Beriberi, Infantile Cerebral Disease Type III, Joubert Syndrome, Joubert-Bolthauser Ganglioside, Infantile Cerebral Ganglioside. Infantile Cere Syndrome, JRA, JRA, Juberg Hayward Syndrome, Juberg bral Paralysis, Infantile Cystinosis, Infantile Epileptic, Marsidi Syndrome, Juberg-Marsidi Mental Retardation Syn Infantile Fanconi Syndrome with Cystinosis, Infantile Finn drome, Jumping Frenchmen, Jumping Frenchmen of Maine, ish Type Neuronal Ceroid Lipofuscinosis, Infantile Gaucher Juvenile Arthritis, Juvenile Arthritis, Juvenile Autosomal Disease, Infantile Hypoglycemia, Infantile Hypophasphata Recessive Polycystic Kidney Disease, Juvenile Cystinosis, sia, Infantile Lobar Emphysema, Infantile Myoclonic Juvenile (Childhood) Dermatomyositis (JDMS), Juvenile Encephalopathy, Infantile Myoclonic Encephalopathy and Diabetes, Juvenile Gaucher Disease, Juvenile Gout Chore Polymyoclonia, Infantile Myofibromatosis, Infantile Necro oathetosis and Mental Retardation Syndrome, Juvenile tizing Encephalopathy, Infantile Neuronal Ceroid Lipofus Intestinal Malabsorption of Vit B12, Juvenile Intestinal cinosis, Infantile Neuroaxonal Dystrophy, Infantile Onset Malabsorption of Vitamin B12, Juvenile Macular Degenera Schindler Disease, Infantile Phytanic Acid Storage Disease, tion, Juvenile Pernicious Anemia, Juvenile Retinoschisis, Infantile Refsum Disease (IRD), Infantile Sipoidosis GM-2 Juvenile Rheumatoid Arthritis, Juvenile Rheumatoid Arthri Gangliosideosis (Type S), Infantile Sipoidosis GM-2 Gan tis, Juvenile Spinal Muscular Atrophy Included, Juvenile gliosideosis (Type S, Infantile Sleep Apnea, Infantile Spinal Muscular Atrophy ALS Included, Juvenile Spinal Spasms, Infantile Spinal Muscular Atrophy (all types), Muscular Atrophy Type III, Juxta-Articular Adiposis Dolo Infantile Spinal Muscular Atrophy ALS, Infantile Spinal rosa, Juxta-Articular Adiposis Dolorosa, Juxtaglomerular Muscular Atrophy Type I, Infantile Type Neuronal Ceroid Hyperplasia, Kabuki Make-Up Syndrome, Kahler Disease, Lipofuscinosis, Infectious Jaundice, Inflammatory Breast Kallmann Syndrome, Kanner Syndrome, Kanzaki Disease, Cancer, Inflammatory Linear Nevus Sebaceous Syndrome, Kaposi Disease (not Kaposi Sarcoma), Kappa Light Chain Iniencephaly, Insulin Resistant Acanthosis Nigricans, Insu Deficiency, Karsch-Neugebauer Syndrome, Karsch-Neuge lin Lipodystrophy, Insulin dependent Diabetes, Intention bauer Syndrome, Kartagener Syndrome-Chronic Sinobron US 2007/0286856 A1 Dec. 13, 2007 27 chial Disease and Dextrocardia, Kartagener Triad, Kasa Larsen Syndrome, Laryngeal Dystonia, Latah (Observed in bach-Merritt Syndrome, Kast Syndrome, Kawasaki Disease, Malaysia), Late Infantile Neuroaxonal Dystrophy, Late Kawasaki Syndrome. KBG Syndrome, KD, Kearns-Sayre Infantile Neuroaxonal Dystrophy, Late Onset Cockayne Disease, Kearns-Sayre Syndrome, Kearns-Sayre Syndrome, Syndrome Type III (Type C), Late-Onset Dystonia, Late Kennedy Disease, Kennedy Syndrome, Kennedy Type Spi Onset Immunoglobulin Deficiency, Late-Onset Immunoglo nal and Bulbar Muscular Atrophy, Kennedy-Stefanis Dis bulin Deficiency, Late Onset Pelizaeus-Merzbacher Brain ease, Kenny Disease, Kenny Syndrome, Kenny Type Tubu Sclerosis, Lattice Corneal Dystrophy, Lattice Dystrophy, lar Stenosis, Kenny-Caffe Syndrome, Kera. Palmoplant. Launois-Bensaude, Launois-Cleret Syndrome, Laurence Con. Pes Planus Ony. Periodon. Arach. Keratitis Ichthyosis Syndrome, Laurence-Moon Syndrome, Laurence-Moon/ Deafness Syndrome, Keratoconus, Keratoconus, Keratoco Bardet-Biedl, Lawrence-Seip Syndrome, LCA, LCAD Defi nus Posticus Circumscriptus, Keratolysis, Keratolysis Exfo ciency, LCAD, LCAD, LCAD, LCADH Deficiency, LCH, liativa Congenita, Keratolytic Winter Erythema, Keratoma LCHAD, LCHAD, LCPD, Le Jeune Syndrome, Leband lacia, Keratosis Follicularis, Keratosis Follicularis Spinulosa Syndrome, Leber's Amaurosis, Leber's Congenital Amau Decalvans, Keratosis Follicularis Spinulosa Decalvans Ich rosis, Congenital Absence of the Rods and Cones, Leber's thyosis, Keratosis Nigricans, Keratosis Palmoplantaris with Congenital Tapetoretinal Degeneration, Leber's Congenital Periodontopathia and Onychogryposis, Keratosis Pal Tapetoretinal Dysplasia, Leber's Disease, Leber's Optic moplantaris Congenital Pes Planus Onychogryposis Period Atrophy, Leber's Optic Neuropathy, Left Ventricular Fibro ontosis Arachnodactyly, Keratosis Palmoplantaris Congeni sis, Leg Ulcer, Legg-Calve-Perthes Disease, Leigh's Dis tal, Pes Planus, Onychogryphosis, Periodontosis, ease, Leigh's Disease, Leigh's Syndrome, Leigh's Syn Arachnodactyly, Acroosteolysis, Keratosis Rubra Figurata, drome (Subacute Necrotizing Encephalomyelopathy), Leigh Keratosis Seborrheica, Ketoacid Decarboxylase Deficiency, Necrotizing Encephalopathy, Lennox-Gastaut Syndrome, Ketoaciduria, Ketotic Glycinemia, Ketotic Glycinemia, Lentigio-Polypose-Digestive Syndrome, Lentigio-Poly KFS, KID Syndrome, Kidney Agenesis, Kidneys Cystic pose-Digestive Syndrome, Lenz, Dysmorphogenetic Syn Retinal Aplasia Joubert Syndrome, Killian Syndrome, Kil drome, Lenz, Dysplasia, Lenz, Microphthalmia Syndrome, lian/Teschler-Nicola Syndrome, Kiloh-Nevin syndrome III, Lenz, Syndrome, LEOPARD Syndrome, Leprechaunism, Kinky Hair Disease, Kinsbourne Syndrome, Kleeb Leprechaunism, Leptomeningeal Angiomatosis, Leptospiral lattschadel Deformity, Kleine-Levin Syndrome, Kleine Jaundice, Leri-Weill Disease, Leri-Weil Dyschondrosteosis, Levin Hibernation Syndrome, Klinefelter, Klippel-Feil Syn Leri-Weil Syndrome, LermoyeZ Syndrome, Leroy Disease, drome, Klippel-Feil Syndrome Type I, Klippel-Feil Lesch Nyhan Syndrome, Lethal Infantile Cardiomyopathy, Syndrome Type II, Klippel-Feil Syndrome Type III, Klippel Lethal Neonatal Dwarfism, Lethal Osteochondrodysplasia, Trenaunay Syndrome, Klippel-Trenaunay-Weber Syn Letterer-Siwe Disease, Leukocytic Anomaly Albinism, Leu drome, Kluver-Bucy Syndrome, KMS, Kniest Dysplasia, kocytic Inclusions with Platelet Abnormality, Leukodystro Kniest Syndrome, Kobner's Disease, Koebberling-Dunni phy, Leukodystrophy with Rosenthal Fibers, Leukoencepha gan Syndrome, Kohlmeier-Degos Disease, Kok Disease, litis Periaxialis Concentric, Levine-Critchley Syndrome, Korsakoff Psychosis, Korsakoff’s Syndrome, Krabbe's Dis Levulosuria, Levy-Hollister Syndrome, LGMD, LGS, ease Included, Krabbe's Leukodystrophy, Kramer Syn LHON, LHON, LIC, Lichen Ruber Acuminatus, Lichen drome, KSS, KSS, KTS, KTW Syndrome, Kufs Disease, Acuminatus, Lichen Amyloidosis, Lichen Planus, Lichen Kugelberg-Welander Disease, Kugelberg-Welander Disease, Psoriasis, Lignac-Debre-Fanconi Syndrome, Lignac-Fan Kugelberg-Welander Syndrome, Kugelberg-Welander Syn coni Syndrome, Ligneous Conjunctivitis, Limb-Girdle Mus drome, Kugelberg-Welander Syndrome, Kussmaul-Landry cular Dystrophy, Limb Girdle Muscular Dystrophy, Limb Paralysis, KWS, L-3-Hydroxy-Acyl-CoA Dehydrogenase Malformations-Dento-Digital Syndrome, Limit Dextrinosis, (LCHAD) Deficiency, Laband Syndrome, Labhart-Willi Linear Nevoid Hypermelanosis, Linear Nevus Sebacous Syndrome, Labyrinthine Syndrome, Labyrinthine Hydrops, Syndrome, Linear Scleroderma, Linear Sebaceous Nevus Lacrimo-Auriculo-Dento-Digital Syndrome, Lactase Iso Sequence, Linear Sebaceous Nevus Syndrome, Lingua Fis lated Intolerance, Lactase Deficiency, Lactation-Uterus Surata, Lingua Plicata, Lingua Scrotalis, Linguofacial Dys Atrophy, Lactic Acidosis Leber Hereditary Optic Neuropa kinesia, Lip Pseudocleft-hemangiomatous Branchial Cyst thy, Lactic and Pyruvate Acidemia with Carbohydrate Sen Syndrome, Lipid Granulomatosis, Lipid Histiocytosis, Lipid sitivity, Lactic and Pyruvate Acidemia with Episodic Ataxia Kerasin Type, Lipid Storage Disease, Lipid-Storage myopa and Weakness, Lactic and Pyruvate Acidemia with Carbo thy Associated with SCAD Deficiency, Lipidosis Ganglio hydrate Sensitivity, Lactic and Pyruvate, Lactic acidosis, side Infantile, Lipidosis Ganglioside Infantile, Lipoatrophic Lactose Intolerance of Adulthood, Lactose Intolerance, Lac Diabetes Mellitus, Lipodystrophy, Lipoid Corneal Dystro tose Intolerance of Childhood, Lactose Intolerance, LADD phy, Lipoid Hyperplasia-Male Pseudohermaphroditism, Syndrome, LADD, Lafora Disease Included, Lafora Body Lipoid Hyperplasia-Male Pseudohermaphroditism, Lipoma Disease, Laki-Lorand Factor Deficiency, LAM, Lambert tosis of Pancreas Congenital, Lipomucopolysaccharidosis Type Ichthyosis, Lambert-Eaton Syndrome, Lambert-Eaton Type I, Lipomyelomeningocele, Lipoprotein Lipase Defi Myasthenic Syndrome, Lamellar Recessive Ichthyosis, ciency Familial, LIS, LIS1, Lissencephaly 1, Lissencephaly Lamellar Recessive Ichthyosis, Lamellar Ichthyosis, Lamel Type I, Lissencephaly variants with agenesis of the corpus lar Recessive Ichthyosis, Lancereaux-Mathieu-Weil Spiro callosum cerebellar hypoplasia or other anomalies, Little chetosis, Landau-Kleffner Syndrome, Landouzy Dejerine Disease, Liver Phosphorylase Deficiency, LKS, LM Syn Muscular Dystrophy, Landry Ascending Paralysis, Langer drome, Lobar Atrophy, Lobar Atrophy of the Brain, Lobar Salidino Type Achondrogensis (Type II), Langer Giedion Holoprosencephaly, Lobar Tension Emphysema in Infancy, Syndrome, Langerhans-Cell Granulomatosis, Langerhans Lobstein Disease (Type I), Lobster Claw Deformity, Lobster Cell Histiocytosis (LCH), Large Atrial and Ventricular Claw Deformity, Localized Epidermolysis Bullosa, Local Defect, Laron Dwarfism, Laron Type Pituitary Dwarfism, ized Lipodystrophy, Localized Neuritis of the Shoulder US 2007/0286856 A1 Dec. 13, 2007 28

Girdle, Loeffler's Disease, Loeffler Endomyocardial Fibro nesco-Sjogren Syndrome, Marinesco-Sjogren-Gorland Syn sis with Eosinophilia, Loeffler Fibroplastic Parietal drome, Marker X Syndrome, Maroteaux Lamy Syndrome, Endocarditis, Loken Syndrome, Loken-Senior Syndrome, Maroteaux Type Acromesomelic Dysplasia, Marshall's Long-Chain 3-hydroxyacyl-CoA Dehydrogenase Ectodermal Dysplasias With Ocular and Hearing Defects, (LCHAD), Long Chain Acyl CoA Dehydrogenase Defi Marshall-Smith Syndrome, Marshall Syndrome, Marshall ciency, Long-Chain Acyl-CoA Dehydrogenase (ACADL), Type Deafness-Myopia-Cataract-Saddle Nose, Martin-Al Long-Chain Acyl-CoA Dehydrogenase Deficiency, Long bright Syndrome, Martin-Bell Syndrome, Martorell Syn QT Syndrome without Deafness, Lou Gehrig's Disease, Lou drome, MASA Syndrome, Massive Myoclonia, Mast Cell Gehrig's Disease Included, Louis-Bar Syndrome, Low Leukemia, Mastocytosis, Mastocytosis With an Associated Blood Sugar, Low-Density Beta Lipoprotein Deficiency, Hematologic Disorder, Maumenee Corneal Dystrophy, Low Imperforate Anus, Low Potassium Syndrome, Lowe Maxillary Ameloblastoma, Maxillofacial Dysostosis, Max syndrome, Lowe's Syndrome, Lowe-Bickel Syndrome, illonasal Dysplasia, Maxillonasal Dysplasia Binder Type, Lowe-Terry-MacLachlan Syndrome, LS, LS, LTD, Lubs Maxillopalpebral Synkinesis, May-Hegglin Anomaly, Syndrome, Lubs Syndrome, Luft Disease, Lumbar Canal MCAD Deficiency, MCAD, MCAD, MCAD, McArdle Dis Stenosis, Lumbar Spinal Stenosis, Lumbosacral Spinal ease, McCune-Albright, MCD, McKusick Type Metaphy Stenosis, Lundborg-Unverricht Disease, Lundborg-Unver seal Chondrodysplasia, McKusick Type Metaphyseal Chon richt Disease Included, Lupus, Lupus, Lupus Erythemato drodysplasia, MCR, MCTD, Meckel Syndrome, Meckel Sus, Luschka-Magendie Foramina Atresia, Lyell Syndrome, Gruber Syndrome, Median Cleft Face Syndrome, Lyelles Syndrome, Lymphadenoid Goiter, Lymphangiectatic Mediterranean Anemia, Medium-Chain Acyl-CoA dehydro Protein-Losing Enteropathy, Lymphangioleiomatosis, Lym genase (ACADM), Medium Chain Acyl-CoA Dehydroge phangioleimyomatosis, Lymphangiomas, Lymphatic Mal nase (MCAD) Deficiency, Medium-Chain Acyl-CoA Dehy formations, Lynch Syndromes, Lynch Syndrome I, Lynch drogenase Deficiency, Medium Chain Acyl CoA Syndrome II, Lysosomal Alpha-N-Acetylgalactosaminidase Dehydrogenase Deficiency, Medullary Cystic Disease, Med Deficiency Schindler Type, Lysosomal Glycoaminoacid ullary Cystic Disease, Medullary Sponge Kidney, MEF, Storage Disease-Angiokeratoma Corporis Diffusum, Lyso Megaesophagus, Megalencephaly, Megalencephaly with Somal Glucosidase Deficiency, Lysosomal Glucosidase Hyaline Inclusion, Megalencephaly with Hyaline Panneur Deficiency, MAA, Machado Disease, Machado-Joseph Dis opathy, Megaloblastic Anemia, Megaloblastic Anemia of ease, Macrencephaly, Macrocephaly, Macrocephaly Hemi Pregnancy, Megalocornea-Mental Retardation Syndrome, hypertrophy, Macrocephaly with Multiple Lipomas and Meier-Gorlin Syndrome, Meige's Lymphedema, Meige's Hemangiomata, Macrocephaly with Pseudopapilledema and Syndrome, Melanodermic Leukodystrophy, Melanoplakia Multiple Hemangiomata, Macroglobulinemia, Macroglos Intestinal Polyposis, Melanoplakia-Intestinal Polyposis, sia, Macroglossia-Omphalocele-Visceromegaly Syndrome, MELAS Syndrome, MELAS, Melkersson Syndrome, Macrostomia Ablepheron Syndrome, Macrothrombocytope Melnick-Fraser Syndrome, Melnick-Needles Osteodys nia Familial Bernard-Soulier Type, Macula Lutea degenera plasty, Melnick-Needles Syndrome, Membranous Lipodys tion, Macular Amyloidosis, Macular Degeneration, Macular trophy, Mendes Da Costa Syndrome, Meniere Disease, Degeneration Disciform, Macular Degeneration Senile, Méniere's Disease, Meningeal Capillary Angiomatosis, Macular Dystrophy, Macular Type Corneal Dystrophy, Menkes Disease, Menke's Syndrome I, Mental Retardation MAD, MAD, Madelung’s Disease, Maffucci Syndrome, Aphasia Shuffling Gait Adducted Thumbs (MASA), Mental Major Epilepsy, Malabsorption, Malabsorption-Ectodermal Retardation-Deafness-Skeletal Abnormalities-Coarse Face Dysplasia-Nasal Alar Hypoplasia, Maladie de Roger, Mala with Full Lips, Mental Retardation with Hypoplastic 5th die de Tics, Male Malformation of Limbs and Kidneys, Male Fingernails and Toenails, Mental Retardation with Osteo Turner Syndrome, Malignant Acanthosis, Malignant Acan cartilaginous Abnormalities, Mental Retradation-X-linked thosis Nigricans, Malignant Astrocytoma, Malignant Atro with Growth Delay-Deafness-Microgenitalism, Menzel phic Papulosis, Malignant Fever, Malignant Hyperphenyla Type OPCA, Mermaid Syndrome, MERRF, MERRF Syn laninemia, Malignant Hyperphenylalaninemia, Malignant drome, MERRF, Merten-Singleton Syndrome, MES, Hyperpyrexia, Malignant Hyperthermia, Malignant Mela Mesangial IGA Nephropathy, Mesenteric Lipodystrophy, noma, Malignant Tumors of the Central Nervous System, Mesiodens-Cataract Syndrome, Mesodermal Dysmorphod Mallory-Weiss Laceration, Mallory-Weiss Tear, Mallory ystrophy, Mesomelic Dwarfism-Madelung Deformity, Meta Weiss Syndrome, Mammary Paget’s Disease, Mandibular bolic Acidosis, Metachromatic Leukodystrophy, Metatarsus Ameloblastoma, Mandibulofacial Dysostosis, Mannosido Varus, Metatropic Dwarfism Syndrome, Metatropic Dyspla sis, Map-Dot-Fingerprint Type Corneal Dystrophy, Maple sia, Metatropic Dysplasia I, Metatropic Dysplasia II, Meth Syrup Urine Disease, Maple Syrup Urine Disease, Marble ylmalonic Acidemia, Methylmalonic Aciduria, Meulen Bones, Marchiafava-Micheli Syndrome, Marcus Gunn Jaw gracht's Disease, MFD1, MG, MH, MHA, Micrencephaly, Winking Syndrome, Marcus Gunn Phenomenon, Marcus Microcephalic Primordial Dwarfism I, Microcephaly, Gunn Ptosis with jaw-winking, Marcus Gunn Syndrome, Microcephaly-Hiatal Hernia-Nephrosis Galloway Type, Marcus Gunn (Jaw-Winking) Syndrome, Marcus Gunn Pto Microcephaly-Hiatal Hernia-Nephrotic Syndrome, Micro sis (with jaw-winking), Marden-Walker Syndrome, Marden cystic Corneal Dystrophy, Microcythemia, Microlissen Walker Type Connective Tissue Disorder, Marfan's Abiotro cephaly, Microphthalmia, Microphthalmia, Microphthalmia phy, Marfan-Achard syndrome, Marfan Syndrome, Marfan or Anopthalmos with Associated Anomalies, Micropolygy Syndrome, Marfan's Syndrome I, Marfan's Variant, Marfan ria With Muscular Dystrophy, Microtia Absent Patellae Achard syndrome, Marfanoid Hypermobility Syndrome, Micrognathia Syndrome, Microvillus Inclusion Disease, Marginal Corneal Dystrophy, Marie's Ataxia, Marie's MID, Midsystolic-click-late systolic murmur syndrome, Ataxia, Marie Disease, Marie-Sainton Disease, Marie Miescher's Type I Syndrome, Mikulicz. Syndrome, Miku Strumpell Disease, Marie-Strumpell Spondylitis, Mari licz-Radecki Syndrome, Mikulicz-Sjogren Syndrome, Mild US 2007/0286856 A1 Dec. 13, 2007 29

Autosomal Recessive, Mild Intermediate Maple Syrup Glutaric Aciduria Type II, Multiple Angiomas and Endoch Urine Disease, Mild Maple Syrup Urine Disease, Miller ondromas, Multiple Carboxylase Deficiency, Multiple Car Syndrome, Miller-Dieker Syndrome, Miller-Fisher Syn tilaginous Enchondroses, Multiple Cartilaginous Exostoses, drome, Milroy Disease, Minkowski-Chauffard Syndrome, Multiple Enchondromatosis, Multiple Endocrine Deficiency Minor Epilepsy, Minot-Von Willebrand Disease, Mirror Syndrome Type II, Multiple Epiphyseal Dysplasia, Multiple Image Dextrocardia, Mitochondrial Beta-Oxidation Disor Exostoses, Multiple Exostoses Syndrome, Multiple Familial ders, Mitrochondrial and Cytosolic, Mitochondrial Cytopa Polyposis, Multiple Lentigines Syndrome, Multiple thy, Mitochondrial Cytopathy, Kearn-Sayre Type, Myeloma, Multiple Neuritis of the Shoulder Girdle, Mul Mitochondrial Encephalopathy, Mitochondrial Encephalo tiple Osteochondromatosis, Multiple Peripheral Neuritis, myopathy Lactic Acidosis and Strokelike Episodes, Mito Multiple Polyposis of the Colon, Multiple Pterygium Syn chondrial myopathy, Mitochondrial myopathy Encephalopa drome, Multiple Sclerosis, Multiple Sclerosis, Multiple Sul thy Lactic Acidosis Stroke-Like Episode, Mitochondrial fatase Deficiency, Multiple Symmetric Lipomatosis, Mul PEPCK Deficiency, Mitral-valve prolapse, Mixed Apnea, tiple System Atrophy, Multisynostotic Osteodysgenesis, Mixed Connective Tissue Disease, Mixed Connective Tissue Multisynostotic Osteodysgenesis with Long Bone Fractures, Disease, Mixed Hepatic Porphyria, Mixed Non-Fluent Mulvihill-Smith Syndrome, MURCS Association, Murk Aphasia, Mixed Sleep Apnea, Mixed Tonic and Clonic Jansen Type Metaphyseal Chondrodysplasia, Muscle Car Torticollis, MJD, MKS, MLI, ML II, ML II, ML III, ML IV. nitine Deficiency, Muscle Core Disease, Muscle Phosphof ML Disorder Type I, ML Disorder Type II, ML Disorder ructokinase Deficiency, Muscular Central Core Disease, Type III, ML Disorder Type IV, MLNS, MMR Syndrome, Muscular Dystrophy, Muscular Dystrophy Classic X-linked MND, MNGIE, MNS, Mobitz I, Mobitz II, Mobius Syn Recessive, Muscular Dystrophy Congenital With Central drome, Moebius Syndrome, Moersch-Woltmann Syndrome, Nervous System Involvement, Muscular Dystrophy Con Mohr Syndrome, Monilethrix, Monomodal Visual Amnesia, genital Progressive with Mental Retardation, Muscular Dys Mononeuritis Multiplex, Mononeuritis Peripheral, Monon trophy Facioscapulohumeral, Muscular Rheumatism, Mus europathym Peripheral, Monosomy 3p2, Monosomy 9p Par cular Rigidity—Progressive Spasm, Musculoskeletal Pain tial, Monosomy 11q Partial, Monosomy 13q Partial, Mono Syndrome, Mutilating Acropathy, Mutilating Acropathy, somy 18q Syndrome, Monosomy X, Monostotic Fibrous Mutism, mvp, MVP. MWS, Myasthenia Gravis, Myasthenia Dysplasia, Morgagni-Turner-Albright Syndrome, Morphea, Gravis, Myasthenia Gravis Pseudoparalytica, Myasthenic Morquio Disease, Morquio Syndrome, Morquio Syndrome Syndrome of Lambert-Eaton, Myelinoclastic Diffuse Scle A. Morquio Syndrome B. Morquio-Brailsford Syndrome, rosis, Myelomatosis, Myhre Syndrome, Myoclonic Astatic Morvan Disease, Mosaic Tetrasomy 9p, Motor Neuron Dis Petit Mal Epilepsy, Myoclonic Dystonia, Myoclonic ease, Motor Neuron Disease, Motor Neuron Syndrome, Encephalopathy of Infants, Myoclonic Epilepsy, Myoclonic Motor Neurone Disease, Motoneuron Disease, Motoneurone Epilepsy Hartung Type, Myoclonus Epilepsy Associated Disease, Motor System Disease (Focal and Slow). Moya with Ragged Red Fibers, Myoclonic Epilepsy and Ragged moya Disease, Moyamoya Disease, MPS, MPS I, MPS I H, Red Fiber Disease, Myoclonic Progressive Familial Epi MPS 1 H/S Hurler/Scheie Syndrome, MPS I S Scheie lepsy, Myoclonic Progressice Familial Epilepsy, Myoclonic Syndrome, MPS II, MPS IIA, MPS IIB, MPS II-AR Auto Seizure, Myoclonus, Myoclonus Epilepsy, Myoencephal somal Recessive Hunter Syndrome, MPS II-XR, MPS II-XR opathy Ragged-Red Fiber Disease, Myofibromatosis, Myo Severe Autosomal Recessive, MPS III, MPS III A B C and fibromatosis Congenital, Myogenic Facio-Scapulo-Peroneal D Sanfiloppo A, MPS IV, MPS IVA and B Morquio A, MPS Syndrome, Myoneurogastointestinal Disorder and Encepha V, MPS VI, MPS VI Severe Intermediate Mild Maroteaux lopathy, Myopathic Arthrogryposis Multiplex Congenita, Lamy, MPS VII, MPS VII Sly Syndrome, MPS VIII, MPS Myopathic Carnitine Deficiency, myopathy Central Fibrillar, Disorder, MPS Disorder I, MPS Disorder II, MPS Disorder myopathy Congenital Nonprogressive, myopathy Congeni III, MPS Disorder VI, MPS Disorder Type VII, MRS, MS, tal Nonprogressive with Central Axis, myopathy with Defi MSA, MSD, MSL, MSS, MSUD, MSUD, MSUD Type Ib, ciency of Carnitine Palmitoyltransferase, myopathy-Mari MSUD Type II, Mucocutaneous Lymph Node Syndrome, nesco-Sjogren Syndrome, myopathy-Metabolic Carnitine Mucolipidosis I, Mucolipidosis II, Mucolipidosis II, Palmitoyltransderase Deficiency, myopathy Mitochondrial Mucolipidosis III, Mucolipidosis IV. Mucopolysaccharido Encephalopathy-Lactic Acidosis-Stroke, myopathy with sis, Mucopolysaccharidosis I-H. Mucopolysaccharidosis Sarcoplasmic Bodies and Intermediate Filaments, Myophos I-S, Mucopolysaccharidosis II. Mucopolysaccharidosis III, phorylase Deficiency, Myositis Ossificans Progressiv, Myo Mucopolysaccharidosis IV. Mucopolysaccharidosis VI, tonia Atrophica, Myotonia Congenita, Myotonia Congenita Mucopolysaccharidosis VII, Mucopolysaccharidosis Type I, Intermittens, Myotonic Dystrophy, Myotonic myopathy Mucopolysaccharidosis Type II. Mucopolysaccharidosis Dwarfism Chondrodystrophy Ocular and Facial Anomalies, Type III, Mucopolysaccharidosis Type VII, Mucosis, Muco Myotubular myopathy, Myotubular myopathy X-linked, sulfatidosis, Mucous Colitis, Mucoviscidosis, Mulibrey My proic Acid, Myriachit (Observed in Siberia), Myxedema, Dwarfism, Mulibrey Nanism Syndrome, Mullerian Duct N-Acetylglucosamine-1-Phosphotransferase Deficiency, Aplasia-Renal Aplasia-Cervicothoracic Somite Dysplasia, N-Acetyl Glutamate Synthetase Deficiency, NADH-CoQ Mullerian Duct-Renal-Cervicothoracic-Upper Limb reductasedeficiency, Naegeli Ectodermal Dysplasias, Nager Defects, Mullerian Duct and Renal Agenesis with Upper Syndrome, Nager Acrofacial Dysostosis Syndrome, Nager Limb and Rib Anomalies, Mullerian-Renal-Cervicothoracic Acrofacial Dysostosis Syndrome, Nager Syndrome, NAGS Somite Abnormalities, Multi-Infarct Dementia Deficiency, Nail Dystrophy-Deafness Syndrome, Nail Dys Binswanger's Type, Multicentric Castleman's Disease, Mul genesis and Hypodontia, Nail-Patella Syndrome, Nance tifocal Eosinophilic Granuloma, Multiple Acyl-CoA Dehy Horan Syndrome, Nanocephalic Dwarfism, Nanocephaly, drogenase Deficiency, Multiple Acyl-CoA Dehydrogenase Nanophthalmia, Narcolepsy, Narcoleptic syndrome, NARP, Deficiency, Multiple Acyl-CoA Dehydrogenase Deficiency/ Nasal-fronto-faciodysplasia, Nasal Alar Hypoplasia US 2007/0286856 A1 Dec. 13, 2007 30

Hypothyroidism Pancreatic Achylia Congenital Deafness, Deficiency due to MCAD Deficiency, Nonketotic Hypogly Nasomaxillary Hypoplasia, Nasu Lipodystrophy, NBIA1, cemia Caused by Deficiency of Acyl-CoA Dehydrogenase, ND, NDI, NDP. Necrotizing Encephalomyelopathy of Nonketotic Glycinemia, Nonne’s Syndrome. Nonne-Mil Leigh's, Necrotizing Respiratory Granulomatosis, Neill roy-Meige Syndrome. Nonopalescent Qpalescent Dentine, Dingwall Syndrome, Nelson Syndrome, Nemaline myopa Nonpuerperal Galactorrhea-Amenorrhea, Nonsecretory thy, Neonatal Adrenoleukodystrophy, Neonatal Adrenoleu Myeloma, Nonspherocytic Hemolytic Anemia, Nontropical kodystrophy (NALD), Neonatal Adrenoleukodystrophy Sprue, Noonan Syndrome, Norepinephrine, Normal Pres (ALD), Neonatal Autosomal Recessive Polycystic Kidney sure Hydrocephalus, Norman-Roberts Syndrome, Norrbott Disease, Neonatal Dwarfism, Neonatal Hepatitis, Neonatal nian Gaucher Disease, Norrie Disease, Norwegian Type Hypoglycemia, Neonatal Lactose Intolerance, Neonatal Hereditary Cholestasis, NPD, NPS, NS, NSA, Nuchal Dys Lymphedema due to Exudative Enteropathy, Neonatal Prog tonia Dementia Syndrome, Nutritional Neuropathy, Nyhan eroid Syndrome, Neonatal Pseudo-Hydrocephalic Progeroid Syndrome, OAV Spectrum, Obstructive Apnea, Obstructive Syndrome of Wiedemann-Rautenstrauch, Neoplastic Arach Hydrocephalus, Obstructive Sleep Apnea, OCC Syndrome, noiditis, Nephroblastom, Nephrogenic Diabetes Insipidus, Occlusive Thromboaortopathy, OCCS, Occult Intracranial Nephronophthesis Familial Juvenile, Nephronophthesis Vascular Malformations, Occult Spinal Dysraphism Familial Juvenile, Nephropathic Cystinosis, Nephropathy Sequence, Ochoa Syndrome, Ochronosis, Ochronotic Pseudohermaphroditism-Wilms Tumor, Nephrosis-Micro Arthritis, OCR, OCRL, Octocephaly, Ocular Albinism, Ocu cephaly Syndrome, Nephrosis-Neuronal Dysmigration Syn lar Herpes, Ocular Myasthenia Gravis, Oculo-Auriculo drome, Nephrotic-Glycosuric-Dwarfism-Rickets Vertebral Dysplasia, Oculo-Auriculo-Vertebral Spectrum, Hypophosphatemic Syndrome, Netherton Disease, Oculo-Bucco-Genital Syndrome, Oculocerebral Syndrome Netherton Syndrome, Netherton Syndrome Ichthyosis, with Hypopigmentation, Oculocerebrocutaneous Syndrome, Nettleship Falls Syndrome (X-Linked), Neu-Laxova Syn Oculo-Cerebro-Renal, Oculocerebrorenal Dystrophy, Ocu drome, Neuhauser Syndrome, Neural-tube defects, Neural locerebrorenal Syndrome, Oculocraniosomatic Syndrome gic Amyotrophy, Neuralgic Amyotrophy, Neuraminidase (obsolete), Oculocutaneous Albinism, Oculocutaneous Albi Deficiency, Neuraocutaneous melanosis, Neurinoma of the nism Chediak-Higashi Type, Oculo-Dento-Digital Dyspla Acoustic Nerve, Neurinoma, Neuroacanthocytosis, Neu sia, Oculo-Dento-Digital Dysplasia, Oculodentodigital Syn roaxonal Dystrophy Schindler Type, Neurodegeneration drome, Oculo-Dento-Osseous Dysplasia, Oculo-Dento with brain iron accumulation type 1 (NBIA1), Neurofibroma Osseous Dysplasia, Oculo Gastrointestinal Muscular of the Acoustic Nerve, Neurogenic Arthrogryposis Multi Dystrophy, Oculo Gastrointestinal Muscular Dystrophy, plex Congenita, Neuromyelitis Optica, Neuromyotonia, Oculogastrointestinal Muscular Dystrophy, Oculomandibu Neuromyotonia, Focal, Neuromyotonia, Generalized, lodyscephaly with hypotrichosis, Oculomandibulofacial Familial, Neuromytonia, Generalized, Sporadic, Neuronal Syndrome, Oculomotor with Congenital Contractures and Axonal Dystrophy Schindler Type, Neuronal Ceroid Lipo Muscle Atrophy, Oculosympathetic Palsy, ODD Syndrome, fuscinosis Adult Type, Neuronal Ceroid Lipofuscinosis ODD Syndrome, ODOD, Odontogenic Tumor, Odontotri Juvenile Type, Neuronal Ceroid Lipofuscinosis Type 1, chomelic Syndrome, OFD, OFD Syndrome, Ohio Type Neuronopathic Acute Gaucher Disease, Neuropathic Amy Amyloidosis (Type VII), OI, OI Congenita, OI Tarda, Old loidosis, Neuropathic Beriberi, Neuropathy Ataxia and field Syndrome, Oligohydramnios Sequence, Oligophrenia Retinitis Pigmentosa, Neuropathy of Brachialpelxus Syn Micropthalmos, Oligophrenic Polydystrophy, Olivoponto drome, Neuropathy Hereditary Sensory Type I, Neuropathy cerebellar Atrophy, Olivopontocerebellar Atrophy, Olivop Hereditary Sensory Type II, Neutral Lipid Storage Disease, ontocerebellar Atrophy with Dementia and Extrapyramidal Nevii, Nevoid Basal Cell Carcinoma Syndrome. Nevus, Signs, Olivopontocerebellar Atrophy with Retinal Degen Nevus Cavernosus, Nevus Comedonicus, Nevus Depigmen eration, Olivopontocerebellar Atrophy I, Olivopontocerebel tosus, Nevus Sebaceous of Jadassohn, Nezelof's Syndrome, lar Atrophy II, Olivopontocerebellar Atrophy III, Olivopon Nezelof's Thymic Aplasia, Nezelof Type Severe Combined tocerebellar Atrophy IV. Olivopontocerebellar Atrophy V. Immunodeficiency, NF, NF1, NF2, NF-1, NF-2, NHS, Nie Ollier Disease, Ollier Osteochondromatosis, Omphalocele man Pick Disease, Nieman Pick disease Type A (acute Visceromegaly-Macroglossia Syndrome, Ondine's Curse, neuronopathic form), Nieman Pick disease Type B, Nieman Onion-Bulb Neuropathy, Onion Bulb Polyneuropathy, Ony Pick Disease Type C (chronic neuronopathic form), Nieman choosteodysplasia, Onychotrichodysplasia with Neutrope Pick disease Type D (Nova Scotia variant), Nieman Pick nia, OPCA, OPCAI, OPCA II, OPCA III, OPCA IV, OPCA disease Type E, Nieman Pick disease Type F (sea-blue V. OPD Syndrome, OPD Syndrome Type I, OPD Syndrome histiocyte disease), Night Blindness, Nigrospinodentatal Type II, OPD I. Syndrome, OPD II Syndrome, Opthalmoar Degeneration, Niikawakuroki Syndrome, NLS, NM, Noack thropathy, Opthalmoplegia-Intestinal Pseudoobstruction, Syndrome Type I, Nocturnal Myoclonus Hereditary Essen Opthalmoplegia, Pigmentary Degeneration of the Retina and tial Myoclonus, Nodular Cornea Degeneration, Non-Bullous Cadio myopathy, Opthalmoplegia Plus Syndrome, Opthal CIE, Non-Bullous Congenital Ichthyosiform Erythroderma, moplegia Syndrome, Opitz BBB Syndrome, Opitz, BBB/G Non-Communicating Hydrocephalus, Non-Deletion Type Compound Syndrome, Opitz, BBBG Syndrome, Opitz-Frias Alpha-Thalassemia/Mental Retardation syndrome. Non-Ke Syndrome, Opitz, G. Syndrome, Opitz G/BBB Syndrome, tonic Hyperglycinemia Type I (NKHI), Non-Ketotic Hyper Opitz, Hypertelorism-Hypospadias Syndrome, Opitz-Kaveg glycinemia, Non-Lipid Reticuloendotheliosis, Non-Neu gia Syndrome, Opitz, Oculogenitolaryngeal Syndrome, ronopathic Chronic Adult Gaucher Disease, Non-Scarring Opitz, Trigonocephaly Syndrome, Opitz Syndrome, Opso Epidermolysis Bullosa, Nonarteriosclerotic Cerebral Calci clonus, OpSoclonus-Myoclonus, Opthalmoneuromyelitis, fications, Nonarticular Rheumatism, Noncerebral, Juvenile Optic Atrophy Polyneuropathy and Deafness, Optic Neu Gaucher Disease. Nondiabetic Glycosuria, Nonischemic roencephalomyelopathy, Optic Neuromyelitis, Opticomyeli Cardio myopathy, Nonketotic Hypoglycemia and Carnitine tis, Optochiasmatic Arachnoiditis, Oral-Facial Clefts, Oral US 2007/0286856 A1 Dec. 13, 2007 facial Dyskinesia, Oral Facial Dystonia, Oral-Facial-Digital Chromosome 9, Partial Duplication 3q Syndrome, Partial Syndrome, Oral-Facial-Digital Syndrome Type I, Oral-Fa Duplication 15q Syndrome, Partial Facial Palsy With Uri cial-Digital Syndrome I, Oral-Facial-Digital Syndrome II, nary Abnormalities, Partial Gigantism of Hands and Feet Oral-Facial-Digital Syndrome III, Oral-Facial-Digital Syn Nevi-Hemihypertrophy-Macrocephaly, Partial Lipodystro drome IV. Orbital Cyst with Cerebral and Focal Dermal phy, Partial Monosomy of Long Arm of Chromosome 11, Malformations, Ornithine Carbamyl Transferase Deficiency, Partial Monosomy of the Long Arm of Chromosome 13, Ornithine Transcarbamylase Deficiency, Orocraniodigital Partial Spinal Sensory Syndrome, Partial Trisomy 11q, Par Syndrome, Orofaciodigital Syndrome, Oromandibular Dys tington Syndrome, PAT. Patent Ductus Arteriosus, Patho tonia, Orthostatic Hypotension, Osler-Weber-Rendu disease, logical Myoclonus, Pauciarticular-Onset Juvenile Arthritis, Osseous-Oculo-Dento Dysplasia, Osseous-Oculo-Dento Pauciarticular-Onset Juvenile Arthritis, Paulitis, PBC, PBS, Dysplasia, Osteitis deformans, Osteochondrodystrophy PC Deficiency, PC Deficiency Group A, PC Deficiency Deformans, Osteochondroplasia, Osteodysplasty of Melnick Group B, PC, Eulenburg Disease, PCC Deficiency, PCH, and Needles, Osteogenesis Imperfect, Osteogenesis Imper PCLD, PCT, PD, PDA, PDH Deficiency, PDH Deficiency, fecta, Osteogenesis Imperfecta Congenita, Osteogenesis Pearson Syndrome Pyruvate Carboxylase Deficiency, Pedi Imperfecta Tarda, Osteohypertrophic Nevus Flammeus, atric Obstructive Sleep Apnea, Peeling Skin Syndrome, Osteopathia Hyperostotica Scleroticans Multiplex Infanta Pelizaeus-Merzbacher Disease, Pelizaeus-Merzbacher Brain lis, Osteopathia Hyperostotica Scleroticans Multiplex Infan Sclerosis, Pelizaeus-Merzbacher Brain Sclerosis, Pellagra talis, Osteopathyrosis, Osteopetrosis, Osteopetrosis Autoso Cerebellar Ataxia-Renal Aminoaciduria Syndrome, Pelvic mal Dominant Adult Type, Osteopetrosis Autosomal Pain Syndrome, Pemphigus Vulgaris, Pena Shokeir II Syn Recessive Malignant Infantile Type, Osteopetrosis Mild drome, Pena Shokeir Syndrome Type II, Penile Fibromato Autosomal Recessive Intermediate Typ, Osteosclerosis Fra sis, Penile Fibrosis, Penile Induration, Penta X Syndrome, gilis Generalisata, Osteosclerotic Myeloma, Ostium Primum Pentalogy of Cantrell, Pentalogy Syndrome, Pentasomy X, Defect (endocardial cushion defects included), Ostium PEPCK Deficiency, Pepper Syndrome, Perheentupa Syn Secundum Defect, OTC Deficiency, Oto Palato Digital drome, Periarticular Fibrositis, Pericardial Constriction with Syndrome, Oto-Palato-Digital Syndrome Type I, Oto-Pala Growth Failure, Pericollagen Amyloidosis, Perinatal Poly tal-Digital Syndrome Type II, Otodental Dysplasia, Otopala cystic Kidney Diseases, Perineal Anus, Periodic Amyloid todigital Syndrome, Otopalataldigital Syndrome Type II, Syndrome, Periodic Peritonitis Syndrome, Periodic Somno Oudtshoorn Skin, Ovarian Dwarfism Turner Type, Ovary lence and Morbid Hunger, Periodic Syndrome, Peripheral Aplasia Turner Type, OWR, Oxalosis, Oxidase deficiency, Cystoid Degeneration of the Retina, Peripheral Dysostosis Oxycephaly, Oxycephaly, Oxycephaly-Acrocephaly, P-V. Nasal Hypoplasia-Mental Retardation, Peripheral Neuritis, PA, PAC, Pachyonychia Ichtyosiforme, Pachyonychia Con Peripheral Neuropathy, Peritoneopericardial Diaphragmatic genita with Natal Teeth, Pachyonychia Congenita, Pachy Hernia, Pernicious Anemia, Pernicious Anemia, Pernicious onychia Congenita Keratosis Disseminata Circumscripta Anemia, Peromelia with Micrognathia, Peroneal Muscular (follicularis), Pachyonychia Congenita Jadassohn-Lewan Atrophy, Peroneal Nerve Palsy, Peroutka Sneeze, Peroxiso dowsky Type, PAF with MSA, Paget’s Disease, Paget’s mal Acyl-CoA Oxidase, Peroxisomal Beta-Oxidation Dis Disease of Bone, Paget’s Disease of the Breast, Paget’s orders, Peroxisomal Bifunctional Enzyme, Peroxisomal Disease of the Nipple, Paget’s Disease of the Nipple and Thiolase, Peroxisomal Thiolase Deficiency, Persistent Trun Areola, Pagon Syndrome, Painful Opthalmoplegia, PAIS. cus Arteriosus, Perthes Disease, Petit Mal Epilepsy, Petit Palatal Myoclonus, Palato-Oto-Digital Syndrome, Palatal Mal Variant, Peutz-Jeghers Syndrome, Peutz-Jeghers Syn Oto-Digital Syndrome Type I, Palatal-Oto-Digital Syn drome, Peutz-Touraine Syndrome, Peutz-Touraine Syn drome Type II, Pallister Syndrome, Pallister-Hall Syndrome, drome, Peyronie Disease, Pfeiffer, Pfeiffer Syndrome Type I, Pallister-Killian Mosaic Syndrome, Pallister Mosaic Aneu PGA I, PGA II, PGA II, PGA III, PGK, PH Type I, PH Type ploidy, Pallister Mosaic Syndrome, Pallister Mosaic Syn I, Pharyngeal Pouch Syndrome, PHD Short-Chain Acyl drome Tetrasomy 12p. Pallister-W Syndrome, Palmoplantar CoA Dehydrogenase Deficiency, Phenylalanine Hydroxy Hyperkeratosis and Alopecia, Palsy, Pancreatic Fibrosis, lase Deficiency, Phenylalaninemia, Phenylketonuria, Phe Pancreatic Insufficiency and Bone Marrow Dysfunction, nylketonuria, Phenylpyruvic Oligophrenia, Phocomelia, Pancreatic Ulcerogenic Tumor Syndrome, Panmyelophthi Phocomelia Syndrome, Phosphoenolpyruvate Carboxyki sis, Panmyelopathy, Pantothenate kinase associated neuro nase Deficiency, Phosphofructokinase Deficiency, Phospho degeneration (PKAN), Papillon-Lefevre Syndrome, Papil glycerate Kinase Deficiency, Phosphoglycerokinase, Phos lotonic Psuedotabes, Paralysis Periodica Paramyotonica, phorylase 6 Kinase Deficiency, Phosphorylase Deficiency Paralytic Beriberi, Paralytic Brachial Neuritis, Paramedian Glycogen Storage Disease, Phosphorylase Kinase Defi Lower Lip Pits-Popliteal Pyerygium Syndrome, Paramedian ciency of Liver, Photic Sneeze Reflex, Photic Sneezing, Diencephalic Syndrome, Paramyeloidosis, Paramyoclonus Phototherapeutic keratectomy, PHS, Physicist John Dalton, Multiple, Paramyotonia Congenita, Paramyotonia Con Phytanic Acid Storage Disease, Pi Phenotype ZZ, PI, Pick genita of Von Eulenburg, Parkinson's disease, Paroxysmal Disease of the Brain, Pick's Disease, Pick's Disease, Pick Atrial Tachycardia, Paroxysmal Cold Hemoglobinuria, Par wickian Syndrome, Pierre Robin Anomalad, Pierre Robin oxysmal Dystonia, Paroxysmal Dystonia Choreathetosis, Complex, Pierre Robin Sequence, Pierre Robin Syndrome, Paroxysmal Kinesigenic Dystonia, Paroxysmal Nocturnal Pierre Robin Syndrome with Hyperphalangy and Clinodac Hemoglobinuria, Paroxysmal Normal Hemoglobinuria, Par tyly, Pierre-Marie's Disease, Pigmentary Degeneration of oxysmal Sleep, Parrot Syndrome, Parry Disease, Parry Globus Pallidus Substantia Nigra Red Nucleus, Pili Torti Romberg Syndrome, Parsonage-Turner Syndrome, Partial and Nerve Deafness, Pili Torti-Sensorineural Hearing Loss, Androgen Insensitivity Syndrome, Partial Deletion of the Pituitary Dwarfism II, Pituitary Tumor after Adrenalectomy, Short Arm of chromosome 4, Partial Deletion of the Short Pityriasis Pilaris, Pityriasis Rubra Pilaris, PJS, PJS, PKAN, Arm of Chromosome 5, Partial Deletion of Short Arm of PKD. PKD. PKD1, PKD2, PKD3, PKU, PKU, PKU1, US 2007/0286856 A1 Dec. 13, 2007 32

Plagiocephaly, Plagiocephaly, Plagiocephaly, Plasma Cell Premature Atrial Contractions, Premature Senility Syn Myeloma, Plasma Cell Leukemia, Plasma Thromboplastin drome, Premature Supraventricular Contractions, Premature Component Deficiency, Plasma Transglutaminase Defi Ventricular Complexes, Prenatal or Connatal Neuroaxonal ciency, Plastic Induration Corpora Cavernosa, Plastic Indu Dystrophy, Presenile Dementia, Presenile Macula Lutea ration of the Penis, PLD, Plicated Tongue, PLS, PMD, Retinae Degeneration, Primary Adrenal Insufficiency, Pri Pneumorenal Syndrome, PNH, PNM, PNP Deficiency, mary Agammaglobulinemias, Primary Aldosteronism, Pri POD, POH, Poikiloderma Atrophicans and Cataract, Poiki mary Alveolar Hypoventilation, Primary Amyloidosis, Pri loderma Congenitale, Poland Anomaly, Poland Sequence, mary Anemia, Primary Anemia, Primary Beriberi, Primary Poland Syndactyly, Poland Syndrome, Poliodystrophia Biliary, Primary Biliary Cirrhosis, Primary Brown Syn Cerebri Progressiva, Polyarthritis Enterica, Polyarteritis drome, Primary Carnitine Deficiency, Primary Central Nodosa, Polyarticular-Onset Juvenile Arthritis Type I, Pol Hypoventilation Syndrome, Primary Ciliary Dyskinesia yarticular-Onset Juvenile Arthritis Type II, Polyarticular Kartagener Type, Primary Cutaneous Amyloidosis, Primary Onset Juvenile Arthritis Types I and II, Polychondritis, Dystonia, Primary Failure Adrenocortical Insufficiency, Pri Polycystic Kidney Disease, Polycystic Kidney Disease mary Familial Hypoplasia of the Maxilla, Primary Hemo Medullary Type, Polycystic Kidney Disease Medullary chromatosis, Primary Hyperhidrosis, Primary Hyperox Type, Polycystic Liver Disease, Polycystic Ovary Disease, aluria Type I, Primary Hyperoxaluria Type 1 (PH1), Polycystic Renal Diseases, Polydactyly-Joubert Syndrome, Primary Hyperoxaluria Type 1, Primary Hyperoxaluria Type Polydysplastic Epidermolysis Bullosa, Polydystrophia Oli II, Primary Hyperoxaluria Type III, Primary Hypogonadism, gophrenia, Polydystrophic Dwarfism, Polyglandular Primary Intestinal Lymphangiectasia, Primary Lateral Scle Autoimmune Syndrome Type III, Polyglandular Autoim rosis, Primary Nonhereditary Amyloidosis, Primary Oblit mune Syndrome Type II, Polyglandular Autoimmune Syn erative Pulmonary Vascular Disease, Primary Progressive drome Type I, Polyglandular Autoimmune Syndrome Type Multiple Sclerosis, Primary Pulmonary Hypertension, Pri II, Polyglandular Deficiency Syndrome Type II, Polyglan mary Reading Disability, Primary Renal Glycosuria, Pri dular Syndromes, Polymorphic Macula Lutea Degeneration, mary Sclerosing Cholangitis, Primary Thrombocythemia, Polymorphic Macular Degeneration, Polymorphism of Primary Thrombocythemia, Primary Tumors of Central Ner Platelet Glycoprotien Ib, Polymorphous Corneal Dystrophy vous System, Primary Visual Agnosia, Proctocolitis Idio Hereditary, Polymyalgia Rheumatica, Polymyalgia Rheu pathic, Proctocolitis Idiopathic, Progeria of Adulthood, Pro matica, Polymyositis and Dermatomyositis, Primary Agam geria of Childhood, Progeroid Nanism, Progeriod Short mag-lobulinemi, Polyneuritis Peripheral, Polyneuropathy Stature with Pigmented Nevi, Progeroid Syndrome of De Deafness-Optic Atrophy, Polyneuropathy Peripheral, Barsy, Progressive Autonomic Failure with Multiple System Polyneuropathy and Polyradiculoneuropathy, Polyostotic Atrophy, Progressive Bulbar Palsy, Progressive Bulbar Fibrous Dysplasia, Polyostotic Sclerosing Histiocytosis, Palsy Included, Progressive Cardiomyopathic Lentiginosis, Polyposis Familial, Polyposis Gardner Type, Polyposis Progressive Cerebellar Ataxia Familial, Progressive Cere Hamartomatous Intestinal, Polyposis Hamartomatous Intes bral Poliodystrophy, Progressive Choroidal Atrophy, Pro tinal, Polyposis-Osteomatosis-Epidermoid Cyst Syndrome, gressive Diaphyseal Dysplasia, Progressive Diaphyseal Polyposis Skin Pigmentation Alopecia and Fingernail Dysplasia, Progressive Facial Hemiatrophy, Progressive Changes, Polyps and Spots Syndrome, Polyps and Spots Familial Myoclonic Epilepsy, Progressive Hemifacial Atro Syndrome, Polyserositis Recurrent, Polysomy Y. Polysyn phy, Progressive Hypoerythemia, Progressive Infantile dactyly with Peculiar Skull Shape, Polysyndactyly-Dysmor Poliodystrophy, Progressive Lenticular Degeneration, Pro phic Craniofacies Greig Type, Pompe Disease, Pompe Dis gressive Lipodystrophy, Progressive Muscular Dystrophy of ease, Popliteal Pterygium Syndrome, Porcupine Man, Childhood, Progressive Myoclonic Epilepsy, Progressive Porencephaly, Porencephaly, Porphobilinogen deaminase Osseous Heteroplasia, Progressive Pallid Degeneration Syn (PBG-D), Porphyria, Porphyria Acute Intermittant, Porphy drome, Progressive Pallid Degeneration Syndrome, Progres ria Acute Intermittent, Porphyria ALA-D, Porphyria Cuta sive Spinobulbar Muscular Atrophy, Progressive Supra nea Tarda, Porphyria Cutanea Tarda, Porphyria Cutanea nuclear Palsy, Progressive Systemic Sclerosis, Progressive Tarda Hereditaria, Porphyria Cutanea Tarda Symptomatica, Tapetochoroidal Dystrophy, Proline Oxidase Deficiency, Porphyria Hepatica Variegate, Porphyria Swedish Type, Propionic Acidemia, Propionic Acidemia, Propionic Aci Porphyria Variegate, Porphyriam Acute Intermittent, Por demia Type I (PCCA Deficiency), Propionic Acidemia Type phyrins, Porrigo Decalvans, Port Wine Stains, Portuguese II (PCCB Deficiency), Propionyl CoA Carboxylase Defi Type Amyloidosis, Post-Infective Polyneuritis, Postanoxic ciency, Propionyl CoA Carboxylase Deficiency, Prota Intention Myoclonus, Postaxial Acrofacial Dysostosis, Post nomaly, Protanopia, Protein-Losing Enteropathy Secondary axial Polydactyly, Postencephalitic Intention Myoclonus, to Congestive Heart Failure, Proteus Syndrome, Proximal Posterior Corneal Dystrophy Hereditary, Posterior Thalamic Deletion of 4q Included, Proximal Deletion of 4q-Included, Syndrome, Postmyelographic Arachnoiditis, Postnatal Cere PRP PRS, Prune Belly Syndrome, PS, Pseudo-Hurler Poly bral Palsy, Postoperative Cholestasis, Postpartum Galactor dystrophy, Pseudo-Polydystrophy, Pseudoacanthosis Nigri rhea-Amenorrhea Syndrome, Postpartum Hypopituitarism, cans, Pseudoachondroplasia, Pseudocholinesterase Defi Postpartum Panhypopituitary Syndrome, Postpartum Pan ciency, Pseudogout Familial, Pseudohemophilia, hypopituitarism, Postpartum Pituitary Necrosis, Postural Pseudohermaphroditism, Pseudohermaphroditism, Hypotension, Potassium-Losing Nephritis, Potassium Loss Pseudohermaphroditism-Nephron Disorder-Wilm's Tumor, Syndrome, Potter Type I Infantile Polycystic Kidney Dis Pseudohypertrophic Muscular Dystrophy, Pseudohypopar eases, Potter Type III Polycystic Kidney Disease, PPH, PPS, athyroidism, Pseudohypoparathyroidism, Pseudohypophos Prader-Willi Syndrome, Prader-Labhart-Willi Fancone Syn phatasia, Pseudopolydystrophy, Pseudothalidomide Syn drome, Prealbumin Tyr-77 Amyloidosis, Preexcitation Syn drome, Pseudoxanthoma Elasticum, Pseudoxanthoma drome, Preexcitation Syndrome, Pregnenolone Deficiency, Elasticum, Psoriasis, Psorospermosis Follicularis, PSP, PSS, US 2007/0286856 A1 Dec. 13, 2007

Psychomotor Convulsion, Psychomotor Epilepsy, Psycho sis Juvenile, Retraction Syndrome, Retrobulbar Neuropathy, motor Equivalent Epilepsy, PTC Deficiency, Pterygium, Retrolenticular Syndrome, Rett Syndrome, Reverse Coarc Pterygium Colli Syndrome, Pterygium Universale, Ptery tion, Reye Syndrome, Reye's Syndrome, RGS, Rh Blood golymphangiectasia, Pulmonary Atresia, Pulmonary Lym Factors, Rh Disease, Rh Factor Incompatibility, Rh Incom phangiomyomatosis, Pulmonary Stenosis, Pulmonic Steno patibility, Rhesus Incompatibility, Rheumatic Fever, Rheu sis-Ventricular Septal Defect, Pulp Stones, Pulpal Dysplasia, matoid Arthritis, Rheumatoid Myositis, Rhinosinusogenic Pulseless Disease, Pure Alymphocytosis, Pure Cutaneous Cerebral Arachnoiditis, Rhizomelic Chondrodysplasia Histiocytosis, Purine Nucleoside Phosphorylase Deficiency, Punctata (RCDP), Acatalasemia, Classical Refsum disease, Purpura Hemorrhagica, Purtilo Syndrome, PXE, PXE RHS, Rhythmical Myoclonus, Rib Gap Defects with Micro Dominant Type, PXE Recessive Type, Pycnodysostosis, gnathia, Ribbing Disease (obsolete), Ribbing Disease, Rich Pyknodysostosis, Pyknoepilepsy, Pyroglutamic Aciduria, ner-Hanhart Syndrome, Rieger Syndrome, Rieter's Syn Pyroglutamicaciduria, Pyrroline Carboxylate Dehydroge drome, Right Ventricular Fibrosis, Riley-Day Syndrome, nase Deficiency, Pyruvate Carboxylase Deficiency, Pyruvate Riley-Smith syndrome, Ring Chromosome 14, Ring Chro Carboxylase Deficiency Group A. Pyruvate Carboxylase mosome 18, Ring 4, Ring 4 Chromosome, Ring 6. Ring 6 Deficiency Group B, Pyruvate Dehydrogenase Deficiency, Chromosome, Ring 9, Ring 9 Chromosome R9, Ring 14. Pyruvate Dehydrogenase Deficiency, Pyruvate Dehydroge Ring 15, Ring 15 Chromosome (mosaic pattern), Ring 18, nase Deficiency, Pyruvate Kinase Deficiency, q25-qter, q26 Ring Chromosome 18, Ring 21, Ring 21 Chromosome, Ring or q27-qter, q31 or 32-qter, QT Prolongation with Extracel 22, Ring 22 Chromosome, Ritter Disease, Ritter-Lyell Syn lular Hypohypocalcinemia, QT Prolongation without Con drome, RLS, RMSS, Roberts SC-Phocomelia Syndrome, genital Deafness, QT Prolonged with Congenital Deafness, Roberts Syndrome, Roberts Tetraphocomelia Syndrome, Quadriparesis of Cerebral Palsy, Quadriplegia of Cerebral Robertson's Ectodermal Dysplasias, Robin Anomalad, Palsy, Quantal Squander, Quantal Squander, ra, ré, r14, r 18, Robin Sequence, Robin Syndrome, Robinow Dwarfism, r21, r22, Rachischisis Posterior, Radial Aplasia-Amega Robinow Syndrome, Robinow Syndrome Dominant Form, karyocytic Thrombocytopenia, Radial Aplasia-Thrombocy Robinow Syndrome Recessive Form, Rod myopathy, Roger topenia Syndrome, Radial Nerve Palsy, Radicular Neuropa Disease, Rokitansky's Disease, Romano-Ward Syndrome, thy Sensory, Radicular Neuropathy Sensory, Radicular Romberg Syndrome, Rootless Teeth, Rosenberg-Chutorian Neuropathy Sensory Recessive, Radicular Dentin Dysplasia, Syndrome, Rosewater Syndrome, Rosewater Syndrome, Rapid-onset Dystonia-parkinsonism, Rapp-Hodgkin Syn Rosselli-Gulienatti Syndrome, Rothmund-Thomson Syn drome, Rapp-Hodgkin (hypohidrotic) Ectodermal Dysplasia drome, Roussy-Levy Syndrome, RP RSX-Linked, RS, RS, syndrome, Rapp-Hodgkin Hypohidrotic Ectodermal Dys RSDS, RSH Syndrome, RSS, RSTS, RTS, RTS, RTS, plasias, Rare hereditary ataxia with polyneuritic changes and Rubella Congenital, Rubinstein Syndrome, Rubinstein deafness caused by a defect in the enzyme phytanic acid Taybi Syndrome, Rubinstein Taybi Broad Thumb-Hallux hydroxylase, Rautenstrauch-Wiedemann Syndrome, Rau syndrome, Rufous Albinism, Ruhr's Syndrome, Russell's tenstrauch-Wiedemann Type Neonatal Progeria, Raynaud's Diencephalic Cachexia, Russell’s Syndrome, Russell Syn Phenomenon, RDP. Reactive Functional Hypoglycemia, drome, Russell-Silver Dwarfism, Russell-Silver Syndrome, Reactive Hypoglycemia Secondary to Mild Diabetes, Reces Russell-Silver Syndrome X-linked, Ruvalcaba-Myhre sive Type Kenny-Caffe Syndrome, Recklin Recessive Type Smith syndrome (RMSS), Ruvalcaba Syndrome, Ruvalcaba Myotonia Congenita, Recklinghausen Disease, Recto Type Osseous Dysplasia with Mental Retardation, Sacral perineal Fistula, Recurrent Vomiting, Reflex Neurovascular Regression, Sacral Agenesis Congenital, SAE, Saethre Dystrophy, Reflex Sympathetic Dystrophy Syndrome, Chotzen Syndrome, Sakati, Sakati Syndrome, Sakati-Nyhan Refractive Errors, Refractory Anemia, Refrigeration Palsy, Syndrome, Salaam Spasms, Salivosudoriparous Syndrome, Refsum Disease, Refsum's Disease, Regional Enteritis, Salzman Nodular Corneal Dystrophy, Sandhoff Disease, Reid-Barlow's syndrome, Reifenstein Syndrome, Reifen Sanfilippo Syndrome, Sanfilippo Type A, Sanfilippo Type B, stein Syndrome, Reiger Anomaly-Growth Retardation, Santavuori Disease, Santavuori-Haltia Disease, Sarcoid of Reiger Syndrome, Reimann Periodic Disease, Reimann's Boeck, Sarcoidosis, Sarcoidosis, Sathre-chotzen, Saturday Syndrome, Reis-Bucklers Corneal Dystrophy, Reiter's Syn Night Palsy, SBMA, SC Phocomelia Syndrome, SC Syn drome, Reiter's Syndrome, Relapsing Guillain-Barre Syn drome, SCA3, SCAD Deficiency, SCAD Deficiency Adult drome, Relapsing-Remitting Multiple Sclerosis, Renal Onset Localized, SCAD Deficiency Congenital Generalized, Agenesis, Renal Dysplasia-Blindness Hereditary, Renal SCAD, SCAD, SCAD, SCADH Deficiency, Scalded Skin Dysplasia-Retinal Aplasia Loken-Senior Type, Renal Gly Syndrome, Scalp Defect Congenital, Scaphocephaly, cosuria, Renal Glycosuria Type A, Renal Glycosuria Type B, Scaphocephaly, Scaphocephaly, Scapula Elevata, Scapulop Renal Glycosuria Type O, Renal-Oculocerebrodystrophy, eroneal myopathy, Scapuloperoneal Muscular Dystrophy, Renal-Retinal Dysplasia with Medullary Cystic Disease, Scapuloperoneal Syndrome Myopathic Type, Scarring Renal-Retinal Dysplasia with Medullary Cystic Disease, Bullosa, Scarring Bullosa, SCHAD, Schaumann's Disease, Renal-Retinal Dystrophy Familial, Renal-Retinal Syn Scheie Syndrome, Schereshevkii-Turner Syndrome, drome, Rendu-Osler-Weber Syndrome, Respiratory Acido Schilder Disease, Schilder Encephalitis, Schilder's Disease, sis, Respiratory Chain Disorders, Respiratory Myoclonus, Schindler Disease Type I (Infantile Onset), Schindler Dis Restless Legs Syndrome, Restrictive Cardio myopathy, ease Infantile Onset, Schindler Disease, Schindler Disease Retention Hyperlipemia, Rethore Syndrome (obsolete), Type II (Adult Onset), Schinzel Syndrome, Schinzel Reticular Dysgenesis, Retinal Aplastic-Cystic Kidneys-Jou Giedion Syndrome, Schinzel Acrocallosal Syndrome, Schin bert Syndrome, Retinal Cone Degeneration, Retinal Cone Zel-Giedion Midface-Retraction Syndrome, Schizencephaly, Dystrophy, Retinal Cone-Rod Dystrophy, Retinitis Pigmen Schmid Type Metaphyseal Chondrodysplasia, Schmid tosa, Retinitis Pigmentosa and Congenital Deafness, Ret Metaphyseal Dysostosis, Schmid-Fraccaro Syndrome, inoblastoma, Retinol Deficiency, Retinoschisis, Retinoschi Schmidt Syndrome, Schopf-Schultz-Passarge Syndrome, US 2007/0286856 A1 Dec. 13, 2007 34

Schueller-Christian Disease, Schut-Haymaker Type, Syndrome, Sinus Arrhythmia, Sinus Venosus, Sinus tachy Schwartz-Jampel-Aberfeld Syndrome, Schwartz-Jampel cardia, Sirenomelia Sequence, Sirenomelus, Situs Inversus Syndrome Types 1A and 1B, Schwartz-Jampel Syndrome, Bronchiectasis and Sinusitis, SJA Syndrome, Sjogren Lars Schwartz-Jampel Syndrome Type 2, SCI, D SCID, sclero son Syndrome Ichthyosis, Sjogren Syndrome, Sjogren Lars derma, Scleroderma, Sclerosis Familial Progressive Sys son Syndrome Ichthyosis, Sjögren's Syndrome, SJS, Skel temic, Sclerosis Diffuse Familial Brain, Scott Craniodigital etal dysplasia, Skeletal Dysplasia Weismann Netter Stuhl Syndrome With Mental Retardation, Scrotal Tongue, SCS, Type, Skin Peeling Syndrome, Skin Neoplasms, Skull SCS, SD, SDS, SDYS, Seasonal Conjunctivitis, Sebaceous Asymmetry and Mild Retardation, Skull Asymmetry and Nevus Syndrome, Sebaceous nevus, Seborrheic Keratosis, Mild Syndactyly, SLE, Sleep Epilepsy, Sleep Apnea, SLO, Seborrheic Warts, Seckel Syndrome, Seckel Type Dwarfism, Sly Syndrome, SMA, SMA Infantile Acute Form, SMAI, Second Degree Congenital Heart Block, Secondary Amy SMA-III, SMA type I, SMA type II, SMA type III, SMA3, loidosis, Secondary Blepharospasm, Secondary Non-tropi SMAX1, SMCR, Smith Lemli Opitz Syndrome, Smith cal Sprue, Secondary Brown Syndrome, Secondary Beriberi, Magenis Syndrome, Smith-Magenis Chromosome Region, Secondary Generalized Amyloidosis, Secondary Dystonia, Smith-McCort Dwarfism, Smith-Opitz-Inborn Syndrome, Secretory Component Deficiency, Secretory IgA Deficiency, Smith Disease, Smoldering Myeloma, SMS, SMS, SNE, SED Tarda, SED Congenital, SEDC, Segmental linear ach Sneezing From Light Exposure, Sodium valproate, Solitary romic nevus, Segmental Dystonia, Segmental Myoclonus, Plasmacytoma of Bone, Sorsby Disease, Sotos Syndrome, Seip Syndrome, Seitelberger Disease, Seitelberger Disease, Souques-Charcot Syndrome, South African Genetic Porphy Seizures, Selective Deficiency of IgG Subclasses, Selective ria, Spasmodic Dysphonia, Spasmodic Torticollis, Spas Mutism, Selective Deficiency of IgG Subclass, Selective modic Torticollis, Spasmodic Wryneck, Spastic Cerebral IgM Deficiency, Selective Mutism, Selective IgA Defi Palsy, Spastic Colon, Spastic Dysphonia, Spastic Paraplegia, ciency, Self-Healing Histiocytosis, Semilobar Holoprosen SPD Calcinosis, Specific Antibody Deficiency with Normal cephaly, Seminiferous Tubule Dysgenesis, Senile Retin Immunoglobulins, Specific Reading Disability, SPH2, oschisis, Senile Warts, Senior-Loken Syndrome, Sensory Spherocytic Anemia, Spherocytosis, Spherophakia-Brachy Neuropathy Hereditary Type I, Sensory Neuropathy Heredi morphia Syndrome, Sphingomyelin Lipidosis, Sphingomy tary Type II, Sensory Neuropathy Hereditary Type I, Sen elinase Deficiency, Spider fingers, Spielmeyer-Vogt Disease, sory Radicular Neuropathy, Sensory Radicular Neuropathy, Spielmeyer-Vogt-Batten Syndrome, Spina Bifida, Spina Sensory Radicular Neuropathy Recessive, Septic Progres Bifida, Spina Bifida Aperta, Spinal Arachnoiditis, Spinal sive Granulomatosis, Septo-Optic Dysplasia, Serous Cir Arteriovenous Malformation, Spinal Ataxia Hereditofamil cumscribed Meningitis, Serum Protease Inhibitor Defi ial, Spinal and Bulbar Muscular Atrophy, Spinal Diffuse ciency, Serum Carnosinase Deficiency, Setleis Syndrome, Idiopathic Skeletal Hyperostosis, Spinal DISH, Spinal Mus Severe Combined Immunodeficiency. Severe Combined cular Atrophy, Spinal Muscular Atrophy, Spinal Muscular Immunodeficiency with Adenosine Deaminase Deficiency, Atrophy All Types, Spinal Muscular Atrophy Type ALS, Severe Combined Immunodeficiency (SCID), Sex Reversal, Spinal Muscular Atrophy-Hypertrophy of the Calves, Spinal Sexual Infantilism, SGB Syndrome. Sheehan Syndrome, Muscular Atrophy Type I, Spinal Muscular Atrophy Type Shields Type Dentinogenesis Imperfecta, Shingles, vari III, Spinal Muscular Atrophy type 3, Spinal Muscular Atro cella-zoster virus, Ship Beriberi, SHORT Syndrome, Short phy-Hypertrophy of the Calves, Spinal Ossifying Arach Arm 18 Deletion Syndrome, Short Chain Acyl CoA Dehy noiditis, Spinal Stenosis, Spino Cerebellar Ataxia, Spinoc drogenase Deficiency, Short Chain Acyl-CoA Dehydroge erebellar Atrophy Type I, Spinocerebellar Ataxia Type I nase (SCAD) Deficiency, Short Stature and Facial Telang (SCA1), Spinocerebellar Ataxia Type II (SCAII), Spinocer iectasis, Short Stature Facial/Skeletal Anomalies ebellar Ataxia Type III (SCAIII), Spinocerebellar Ataxia Retardation-Macrodontia, Short Stature-Hyperextensibility Type III (SCA3), Spinocerebellar Ataxia Type IV (SCAIV), Rieger Anomaly-Teething Delay, Short Stature Spinocerebellar Ataxia Type V (SCAV), Spinocerebellar Onychodysplasia, Short Stature Telangiectatic Erythema of Ataxia Type VI (SCAVI), Spinocerebellar Ataxia Type VII the Face, SHORT Syndrome, Shoshin Beriberi, Shoulder (SCAVII), Spirochetal Jaundice, Splenic Agenesis Syn girdle syndrome, Shprintzen-Goldberg Syndrome, Shulman drome, Splenic Ptosis, Splenoptosis, Split Hand Deformity Syndrome, Shwachman-Bodian Syndrome, Shwachman Mandibulofacial Dysostosis, Split Hand Deformity-Man Diamond Syndrome, Shwachman Syndrome, Shwachman dibulofacial Dysostosis, Split Hand Deformity, Split-Hand Diamond-Oski Syndrome, Shwachmann Syndrome, Shy Deformity, Spondyloarthritis, Spondylocostal Dysplasia— Drager Syndrome, Shy-Magee Syndrome, SI Deficiency, Type I, Spondyloepiphyseal Dysplasia Tarda, Spondylotho Sialidase Deficiency, Sialidosis Type I Juvenile, Sialidosis racic Dysplasia, Spondylotic Caudal Radiculopathy, Sponge Type II Infantile, Sialidosis, Sialolipidosis, Sick Sinus Syn Kidney, Spongioblastoma Multiforme, Spontaneous drome, Sickle Cell Anemia, Sickle Cell Disease, Sickle Hypoglycemia, Sprengel Deformity, Spring Ophthalmia, Cell-Hemoglobin C Disease, Sickle Cell-Hemoglobin D SRS, ST, Stale Fish Syndrome, Staphyloccal Scalded Skin Disease, Sickle Cell-Thalassemia Disease, Sickle Cell Trait, Syndrome, Stargardt’s Disease, Startle Disease, Status Epi Sideroblastic Anemias, Sideroblastic Anemia, Sideroblasto lepticus, Steele-Richardson-Olszewski Syndrome, Steely sis, Sideroblastosis, SIDS, Siegel-Cattan-Mamou Syn Hair Disease, Stein-Leventhal Syndrome, Steinert Disease, drome, Siemens-Bloch type Pigmented Dermatosis, Stengel’s Syndrome, Stengel-Batten-Mayou-Spielmeyer Siemens Syndrome, Siewerling-Creutzfeldt Disease, Siew Vogt-Stock Disease, Stenosing Cholangitis, Stenosis of the ert Syndrome, Silver Syndrome, Silver-Russell Dwarfism, Lumbar Vertebral Canal, Stenosis, Steroid Sulfatase Defi Silver-Russell Syndrome, Simmond's Disease, Simons Syn ciency, Stevanovic's Ectodermal Dysplasias, Stevens drome, Simplex Epidermolysis Bullosa, Simpson Dysmor Johnson Syndrome, Stevens-Johnson Syndrome, STGD, phia Syndrome, Simpson-Golabi-Behmel Syndrome, Sind Stickler Syndrome, Stickler Syndrome, Stiff-Man Syn ing-Larsen-Johansson Disease, Singleton-Merten drome, Stiff Man Syndrome, Stiff Person Syndrome, Stills US 2007/0286856 A1 Dec. 13, 2007

Disease, Stilling-Turk-Duane Syndrome, Stillis Disease, Hyperesthetic Anesthesia, Thalassemia Intermedia, Thalas Stimulus-Sensitive Myoclonus, Stone Man Syndrome, semia Minor, Thalassemia Major. Thiamine Deficiency, Stone Man, Streeter Anomaly, Striatonigral Degeneration Thiamine-Responsive Maple Syrup Urine Disease. Thin Autosomal Dominant Type, Striopallidodentate Calcinosis, Basement-Membrane Nephropathy. Thiolase deficiency, Stroma, Descemet's Membrane, Stromal Corneal Dystro RCDP. Acyl-CoA dihydroxyacetonephosphate acyltrans phy, Struma Lymphomatosa, Sturge-Kalischer-Weber Syn ferase. Third and Fourth Pharyngeal Pouch Syndrome. Third drome, Sturge Weber Syndrome, Sturge-Weber Phakomato Degree Congenital (Complete) Heart Block, Thomsen Dis sis, Subacute Necrotizing Encephalomyelopathy, Subacute ease, Thoracic-Pelvic-Phalangeal Dystrophy, Thoracic Spi Necrotizing Encephalomyelopathy, Subacute Spongiform nal Canal, Thoracoabdominal Syndrome, Thoracoabdomi Encephalopathy, Subacute Necrotizing Encephalopathy, nal Ectopia Cordis Syndrome. Three M Syndrome. Three-M Subacute Sarcoidosis, Subacute Neuronopathic, Subaortic Slender-Boned Nanism, Thrombasthenia of Glanzmann and Stenosis, Subcortical Arteriosclerotic Encephalopathy, Sub Naegeli, Thrombocythemia Essential, Thrombocytopenia endocardial Sclerosis, Succinylcholine Sensitivity, Sucrase Absent Radius Syndrome, Thrombocytopenia-Hemangioma Isomaltase Deficiency Congenital. Sucrose-Isomaltose Mal Syndrome, Thrombocytopenia-Absent Radii Syndrome, absorption Congenital. Sucrose Intolerance Congenital, Thrombophilia Hereditary Due to AT III, Thrombotic Sudanophilic Leukodystrophy ADL, Sudanophilic Leukod Thrombocytopenic Purpura, Thromboulcerative Colitis, ystrophy Pelizaeus-Merzbacher Type, Sudanophilic Leu Thromboulcerative Colitis, Thymic Dysplasia with Normal kodystrophy Included, Sudden Infant Death Syndrome, Immunoglobulins, Thymic Agenesis, Thymic Aplasia Sudeck's Atrophy, Sugio-Kajii Syndrome, Summerskill DiGeorge Type, Thymic Hypoplasia Agammaglobulinemias Syndrome, Summit Acrocephalosyndactyly, Summitt's Primary Included, Thymic Hypoplasia DiGeorge Type, Thy AcrocephaloSyndactyly, Summitt Syndrome, Superior mus Congenital Aplasia, Tic Douloureux, Tics, Tinel’s Syn Oblique Tendon Sheath Syndrome, Suprarenal glands, Sup drome, Tolosa Hunt Syndrome, Tonic Spasmodic Torticollis, ravalvular Aortic Stenosis, Supraventricular tachycardia, Tonic Pupil Syndrome, Tooth and Nail Syndrome, Tooth and Surdicardiac Syndrome, Surdocardiac Syndrome, SVT, Nail Syndrome, Torch Infection, TORCH Syndrome, Tor Sweat Gland Abscess, Sweating Gustatory Syndrome, sion Dystonia, Torticollis, Torticollis, Total Lipodystrophy, Sweet Syndrome, Swiss Cheese Cartilage Syndrome, Syn Total anomalous pulmonary venous connection, Touraine's dactylic Oxycephaly, Syndactyly Type I with Microcephaly Aphthosis, Tourette Syndrome, Tourette's disorder, Townes and Mental Retardation, Syndromatic Hepatic Ductular Brocks Syndrome, Townes Syndrome, Toxic Paralytic Ane Hypoplasia, Syringomyelia, Systemic Aleukemic Reticu mia, Toxic Epidermal Necrolysis, Toxopachyosteose Dia loendotheliosis, Systemic Amyloidosis, Systemic Carnitine physaire Tibio-Peroniere, ToXopachyosteose, Deficiency, Systemic Elastorrhexis, Systemic Lupus Erythe Toxoplasmosis Other Agents Rubella Cytomegalovirus Her matosus, Systemic Mast Cell Disease, Systemic Mastocy pes Simplex, Tracheoesophageal Fistula with or without tosis, Systemic-Onset Juvenile Arthritis, Systemic-Onset Esophageal Atresia, Tracheoesophageal Fistula, Transient Juvenile Arthritis, Systemic Sclerosis, Systopic Spleen, neonatal myasthenia gravis, Transitional Atrioventricular T-Lymphocyte Deficiency, Tachyalimentation Hypoglyce Septal Defect, Transposition of the great arteries, Transtele mia, Tachycardia, Takahara syndrome, Takayasu Disease, phonic Monitoring, Transthyretin Methionine-30 Amyloido Takayasu Arteritis, Takayasu Arteritis, Talipes Calcaneus, sis (Type I), Trapezoidocephaly-Multiple Synostosis Syn Talipes Equinovarus, Talipes Equinus, Talipes Varus, Talipes drome, Treacher Collins Syndrome, Treacher Collins Valgus, Tandem Spinal Stenosis, Tangier Disease, Tape Franceschetti Syndrome 1, Trevor Disease, Triatrial Heart, toretinal Degeneration, TAR Syndrome, Tardive Dystonia, Tricho-Dento-Osseous Syndrome, Trichodento Osseous Tardive Muscular Dystrophy, Tardive Dyskinesia, Tardive Syndrome, Trichopoliodystrophy, Trichorhinophalangeal Oral Dyskinesia, Tardive Dyskinesia, Tardive Dystonia, Syndrome, Trichorhinophalangeal Syndrome, Tricuspid Tardy Ulnar Palsy, Target Cell Anemia, Tarsomegaly, Tarui atresia, Trifunctional Protein Deficiency, Trigeminal Neu Disease, TAS Midline Defects Included, TAS Midline ralgia, Triglyceride Storage Disease Impaired Long-Chain Defect, Tay Sachs Disease, Tay Sachs Sphingolipidosis, Tay Fatty Acid Oxidation, Trigonitis, Trigonocephaly, Trigono Sachs Disease, Tay Syndrome Ichthyosis, Tay Sachs Sph cephaly, Trigonocephaly, Trigonocephaly Syndrome, Trigo ingolipidosis, Tay Syndrome Ichthyosis, Taybi Syndrome nocephaly “C” Syndrome, Trimethylaminuria, Tripha Type I, Taybi Syndrome, TCD, TCOF1, TCS, TD, TDO langeal Thumbs-Hypoplastic Distal Phalanges Syndrome, TDO-I. TDO-II, TDO-III, Telangiectasis, Tele Onychodystrophy, Triphalangeal Thumb Syndrome, Triple canthus with Associated Abnormalities, Telecanthus With Symptom Complex of Behcet, Triple X Syndrome, Triplo X Associated Abnormalities, Telecanthus-Hypospadias Syn Syndrome, Triploid Syndrome, Triploidy, Triploidy Syn drome, Temporal Lobe Epilepsy, Temporal Arteritis/Giant drome, Trismus-Pseudocamptodactyly Syndrome, Trisomy, Cell Arteritis, Temporal Arteritis, TEN, Tendon Sheath Trisomy G Syndrome, Trisomy X, Trisomy 6q Partial, Adherence Superior Obliqu, Tension Myalgia, Terminal Trisomy 6q Syndrome Partial, Trisomy 9 Mosaic, Trisomy Deletion of 4q Included, Terminal Deletion of 4q-Included, 9P Syndrome (Partial) Included, Trisomy 11q Partial, Tri Terrian Corneal Dystrophy, Teschler-Nicola/Killian Syn somy 14 Mosaic, Trisomy 14 Mosaicism Syndrome, Tri drome, Tethered Spinal Cord Syndrome, Tethered Cord somy 21 Syndrome, Trisomy 22 Mosaic, Trisomy 22 Mosa Malformation Sequence, Tethered Cord Syndrome, Tethered icism Syndrome, TRPS, TRPS1, TRPS2, TRPS3, True Cervical Spinal Cord Syndrome, Tetrahydrobiopterin Defi Hermaphroditism, True Hermaphroditism, Truncus arterio ciencies, Tetrahydrobiopterin Deficiencies, Tetralogy of Fal sus, Tryptophan Malabsorption, Tryptophan Pyrrolase Defi lot, Tetralogy of Fallot, Tetraphocomelia-Thrombocytopenia ciency, TS, TTP, TTTS, Tuberous Sclerosis, Tubular Ectasia, Syndrome, Tetrasomy Short Arm of Chromosome 9, Tetra Turcot Syndrome, Turner Syndrome, Turner-Kieser Syn somy 9p, Tetrasomy Short Arm of Chromosome 18, Tha drome, Turner Phenotype with Normal Chromosomes lamic Syndrome, Thalamic Pain Syndrome, Thalamic (Karyotype), Turner-Varny Syndrome, Turricephaly, Twin US 2007/0286856 A1 Dec. 13, 2007 36

Twin Transfusion Syndrome, Twin-to-Twin Transfusion lomatosis, Visceral Xantho-Granulomatosis, Visceral Syndrome, Type A, Type B, Type AB, Type O, Type I myopathy-External Opthalmoplegia, Visceromegaly-Um Diabetes, Type I Familial Incomplete Male, Type I Familial bilical Hernia-Macroglossia Syndrome, Visual Amnesia, Incomplete Male Pseudohermaphroditism, Type I Gaucher Vitamin A Deficiency, Vitamin B-1 Deficiency, Vitelline Disease, Type I (PCCA Deficiency). Type I Tyrosinemia, Macular Dystrophy, Vitiligo, Vitiligo, Vitiligo Capitis, Vit Type II Gaucher Disease, Type II Histiocytosis, Type II reoretinal Dystrophy, VKC, VKH Syndrome, VLCAD, (PCCB Deficiency). Type II Tyrosinnemia, Type IIA Distal VLCAD, Vogt Syndrome, Vogt Cephalosyndactyly, Vogt Arthrogryposis Multiplex Congenita, Type III Gaucher Dis Koyanagi Harada Syndrome, Vogt Koyanagi Harada Syn ease, Type III Tyrosinemia, Type III Dentinogenesis Imper drome, Vogt Koyanagi Harada Syndrome, Von Bechterew fecta, Typical Retinoschisis, Tyrosinase Negative Albinism Strumpell Syndrome, Von Eulenburg Paramyotonia Con (Type I), Tyrosinase Positive Albinism (Type II), Tyrosine genita, Von Frey's Syndrome, Von Gierke Disease, Von mia type I acute form, Tyrosinemia type I chronic form, Hippel-Lindau Syndrome, Von Mikulicz. Syndrome, Von Tyrosinosis, UCE, Ulcerative Colitis, Ulcerative Colitis Recklinghausen Disease, Von Willebrandt Disease, VP. Vro Chronic Non-Specific, Ulnar-Mammary Syndrome, Ulnar lik Disease (Type II), VSD, VSD, Vulgaris Type Disorder of Mammary Syndrome of Pallister, Ulnar Nerve Palsy, UMS, Cornification, Vulgaris Type Ichthyosis, W Syndrome, Unclassified FODs, Unconjugated Benign Bilirubinemiav, Waardenburg Syndrome, Waardenburg-Klein Syndrome, Underactivity of Parathyroid, Unilateral Ichthyosiform Waardenburg Syndrome Type I (WS1), Waardenburg Syn Erythroderma with Ipsilateral Malformations Limb, Unilat drome Type II (WS2), Waardenburg Syndrome Type IIA eral Chondromatosis, Unilateral Defect of Pectoralis Muscle (WS2A), Waardenburg Syndrome Type IIB (WS2B), and Syndactyly of the Hand, Unilateral Hemidysplasia Type, Waardenburg Syndrome Type III (WS3), Waardenburg Syn Unilateral Megalencephaly, Unilateral Partial Lipodystro drome Type IV (WS4), Waelsch's Syndrome, WAGR Com phy, Unilateral Renal Agenesis, Unstable Colon, Unverricht plex, WAGR Syndrome, WAGR Syndrome, Waldenstroems Disease, Unverricht-Lundborg Disease, Unverricht-Lund Macroglobulinemia, Waldenstrom's Purpura, Walden borg-Laf Disease, Unverricht Syndrome, Upper Limb-Car strom's Syndrome, Waldmann Disease, Walker-Warburg diovascular Syndrome (Holt-Oram), Upper Motor Neuron Syndrome, Wandering Spleen, Warburg Syndrome, Warm Disease, Upper Airway Apnea, Upper Airway Apnea, Urea Antibody Hemolytic Anemia, Warm Reacting Antibody Cycle Defects or Disorders, Urea Cycle Disorder Arginase Disease, Wartenberg Syndrome, WAS. Water on the Brain, Type, Urea Cycle Disorder Arginino Succinase Type, Urea Watson Syndrome, Watson-Alagille Syndrome, Water Cycle Disorders Carbamyl Phosphate SynthetaseType, Urea house-Friderichsen syndrome, Waxy Disease, WBS, Weaver Cycle Disorder Citrullinemia Type, Urea Cycle Disorders Syndrome, Weaver-Smith Syndrome, Weber-Cockayne Dis N-Acrtyl Glutamate Synthetase Typ, Urea Cycle Disorder ease, Wegener's Granulomatosis, Wegener's Granulomato OTC Type, Urethral Syndrome, Urethro-Oculo-Articular sis, Weil Disease, Weil Syndrome, Weill-Marchesani, Weill Syndrome, Uridine Diphosphate Glucuronosyltransferase Marchesani Syndrome, Weill-Reyes Syndrome, Weismann Severe Def. Type I, Urinary Tract Defects, Urofacial Syn Netter-Stuhl Syndrome, Weissenbacher-Zweymuller drome, Uroporphyrinogen III cosynthase, Urticaria pigmen Syndrome, Wells Syndrome, Wenckebach, Werdnig-Hoff tosa, Usher Syndrome, Usher Type I, Usher Type II, Usher man Disease, Werdnig-Hoffmann Disease, Werdnig-Hoff Type III, Usher Type IV. Uterine Synechiae, Uoporphyrino mann disease, Werdnig-Hoffman Disease, Werdnig-Hoff gen I-synthase, Uveitis, Uveomeningitis Syndrome, V-CJD. man Paralysis, Werlhofs Disease, Werner Syndrome, VACTEL Association, VACTERL Association, VACTERL Wernicke's (C) I Syndrome, Wernicke's aphasia, Wernicke Syndrome, Valgus Calcaneus, Valine Transaminase Defi Korsakoff Syndrome, West Syndrome, Wet Beriberi, ciency, Valinemia, Valproic Acid, Valproate acid exposure, WHCR, Whipple's Disease, Whipple Disease, Whistling Valproic acid exposure, Valproic acid, Van Buren's Disease, face syndrome. Whistling Face-Windmill Vane Hand Syn Van der Hoeve-Habertsma-Waardenburg-Gauldi Syndrome, drome, White-Darier Disease. Whitnall-Norman Syndrome, Variable Onset Immunoglobulin Deficiency Dysgamma Whorled nevoid hypermelanosis, WHS, Wieacker Syn globulinemia, Variant Creutzfeldt-Jakob Disease (V-CJD). drome, Wieacher Syndrome, Wieacker-Wolff Syndrome, Varicella Embryopathy, Variegate Porphyria, Variegate Por Wiedmann-Beckwith Syndrome, Wiedemann-Rauten phyria, Variegate Porphyria, Vascular Birthmarks, Vascular strauch Syndrome, Wildervanck Syndrome, Willebrand Dementia Binswanger's Type, Vascular Erectile Tumor, Juergens Disease, Willi-Prader Syndrome, Williams Syn Vascular Hemophilia, Vascular Malformations, Vascular drome, Williams Syndrome, Williams-Beuren Syndrome, Malformations of the Brain, Vasculitis, Vasomotor Ataxia, Wilms Tumor, Wilms Tumor-Aniridia-Gonadoblastoma Vasopressin-Resistant Diabetes Insipidus, Vasopressin-Sen Mental Retardation Syndrome, Wilms Tumor Aniridia sitive Diabetes Insipidus, VATER Association, Vcf syn Gonadoblastoma Mental Retardation, Wilms Tumor-Aniri drome, Vcfs, Velocardiofacial Syndrome, VeloCardioFacial dia-Genitourinary Anomalies-Mental Retardation Syn Syndrome, Venereal Arthritis, Venous Malformations, Ven drome, Wilms Tumor-Pseudohermaphroditism-Nephropa tricular Fibrillation, Ventricular Septal Defects, Congenital thy, Wilms Tumor and Pseudohermaphroditism, Wilms Ventricular Defects, Ventricular Septal Defect, Ventricular Tumor-Pseuodohermaphroditism-Glomerulopathy, W11 Tachycardia, Venual Malformations, VEOHD, Vermis Apla son's Disease, Winchester Syndrome, Winchester-Grossman sia, Vermis Cerebellar Agenesis, Vernal Keratoconjunctivi Syndrome, Wiskott-Aldrich Syndrome, Wiskott-Aldrich tis, Verruca, Vertebral Anal Tracheoesophageal Esophageal Type Immunodeficiency. Witkop Ectodermal Dysplasias, Radial, Vertebral Ankylosing Hyperostosis, Very Early Witkop Tooth-Nail Syndrome. Wittmaack-Ekbom Syn Onset Huntington's Disease, Very Long Chain Acyl-CoA drome, WM Syndrome, WMS, WMS, WNS, Wohlfart Dehydrogenase (VLCAD) Deficiency, Vestibular Schwan Disease, Wohlfart-Kugelberg-Welander Disease, Wolf Syn noma, Vestibular Schwannoma Neurofibromatosis, Vestibu drome, Wolf-Hirschhorn Chromosome Region (WHCR), locerebellar, Virchow's Oxycephaly, Visceral Xanthogranu Wolf-Hirschhorn Syndrome, Wolff-Parkinson-White Syn US 2007/0286856 A1 Dec. 13, 2007 37 drome, Wolff-Parkinson-White syndrome, Wolff Parkinson Glioma, Brain and CNS Tumors, Breast Cancer, CNS White Syndrome, Wolfram Syndrome, Wolman Disease tumors, Carcinoid Tumors, Cervical Cancer, Childhood (Lysomal Acid Lypase Deficiency), Woody Guthrie's Dis Brain Tumors, Childhood Cancer, Childhood Leukaemia, ease, WPW Syndrome, WPW Syndrome, Writer's Cramp, Childhood Soft Tissue Sarcoma, Chondrosarcoma, Chorio WS, WS, WS, WSS, WWS, Wyburn-Mason Syndrome, carcinoma, Chronic Lymphocytic Leukaemia, Chronic Wyburn-Mason Syndrome, X-Linked Addison's Disease, Myeloid Leukaemia, Colorectal Cancers, Cutaneous T-Cell X-linked Adrenoleukodystrophy (X-ALD), X-linked Adult Lymphoma, Dermatofibrosarcoma-protuberans, Desmoplas Onset Spinobulbar Muscular Atrophy, X-linked Adult Spinal tic-Small-Round-Cell-Tumor, Ductal Carcinoma, Endocrine Muscular Atrophy, X-Linked Agammaglobulinemia with Cancers, Endometrial Cancer, Ependymoma, Esophageal Growth Hormone Deficiency, X-Linked Agammaglobuline Cancer, Ewing's Sarcoma, Extra-Hepatic Bile Duct Cancer, mia, Lymphoproliferate X-Linked Syndrome, X-linked Car Eye Cancer, Eye: Melanoma, Retinoblastoma, Fallopian dio myopathy and Neutropenia, X-Linked Centronuclear Tube cancer, Fanconi Anaemia, Fibrosarcoma, Gall Bladder myopathy, X-linked Copper Deficiency, X-linked Copper Cancer, Gastric Cancer, Gastrointestinal Cancers, Gas Malabsorption, X-Linked Dominant Conradi-Hunermann trointestinal-Carcinoid-Tumor, Genitourinary Cancers, Syndrome, X-Linked Dominant Inheritance Agenesis of Germ Cell Tumors, Gestational-Trophoblastic-Disease, Corpus Callosum, X-Linked Dystonia-parkinsonism, Glioma, Gynaecological Cancers, Haematological Malig X-Linked Ichthyosis, X Linked. Ichthyosis, X-Linked Infan nancies, Hairy Cell Leukaemia, Head and Neck Cancer, tile Agammaglobulinemia, X-Linked Infantile Nectrotizing Hepatocellular Cancer, Hereditary Breast Cancer. Histiocy Encephalopathy, X-linked Juvenile Retinoschisis, X-linked tosis, Hodgkin’s Disease, Human Papillomavirus, Hydatidi Lissencephaly, X-linked Lymphoproliferative Syndrome, form mole, Hypercalcemia, Hypopharynx Cancer, IntraCcu X-linked Mental Retardation-Clasped Thumb Syndrome, lar Melanoma, Islet cell cancer, Kaposi's sarcoma, Kidney X-Linked Mental Retardation with Hypotonia, X-linked Cancer, Langerhans-Cell-Histiocytosis, Laryngeal Cancer, Mental Retardation and Macroorchidism, X-Linked Pro Leiomyosarcoma, Leukaemia, Li-Fraumeni Syndrome, Lip gressive Combined Variable Immunodeficiency, X-Linked Cancer, Liposarcoma, Liver Cancer, Lung Cancer, Lymphe Recessive Conradi-Hunermann Syndrome, X-Linked dema, Lymphoma, Hodgkin’s Lymphoma, Non-Hodgkin’s Recessive Severe Combined Immunodeficiency, X-Linked Lymphoma, Male Breast Cancer, Malignant-Rhabdoid-Tu Recessive Severe Combined Immunodeficiency, X-Linked mor-of-Kidney, Medulloblastoma, Melanoma, Merkel Cell Retinoschisis, X-linked Spondyloepiphyseal Dysplasia, Cancer, Mesothelioma, Metastatic Cancer, Mouth Cancer, Xanthine Oxidase Deficiency (Xanthinuria Deficiency, Multiple Endocrine Neoplasia, Mycosis Fungoides, Myelo Hereditary), Xanthinuria Deficiency, Hereditary (Xanthine dysplastic Syndromes, Myeloma, Myeloproliferative Disor Oxidase Deficiency), Xanthogranulomatosis Generalized, ders, Nasal Cancer, Nasopharyngeal Cancer, Nephroblas Xanthoma Tuberosum, Xeroderma Pigmentosum, Xero toma, Neuroblastoma, Neurofibromatosis, Nijmegen derma Pigmentosum Dominant Type, Xeroderma Pigmen Breakage Syndrome. Non-Melanoma Skin Cancer, Non tosum Type AI XPA Classical Form, Xeroderma Pigmen Small-Cell-Lung-Cancer-(NSCLC), Ocular Cancers, tosum Type B II XPB, Xeroderma Pigmentosum Type E V Oesophageal Cancer, Oral cavity Cancer, Oropharynx Can XPE, Xeroderma Pigmentosum Type C III XPC, Xeroderma cer, Osteosarcoma, Ostomy Ovarian Cancer, Pancreas Can Pigmentosum Type D IV XPD, Xeroderma Pigmentosum cer, Paranasal Cancer, Parathyroid Cancer, Parotid Gland Type F VI XPF, Xeroderma Pigmentosum Type G VII XPG, Cancer, Penile Cancer, Peripheral-Neuroectodermal-Tu Xeroderma Pigmentosum Variant Type XP-V. Xeroderma mors, Pituitary Cancer, Polycythemia vera, Prostate Cancer, Talipes-and Enamel Defect, Xerodermic Idiocy, Rare-cancers-and-associated-disorders, Renal Cell Carci Xerophthalmia, Xerotic Keratitis, XLP, XO Syndrome, XP, noma, Retinoblastoma, Rhabdomyosarcoma, Rothmund XX Male Syndrome, Sex Reversal, XXXXX Syndrome, Thomson Syndrome, Salivary Gland Cancer, Sarcoma, XXY Syndrome, XYY Syndrome, XYY Chromosome Pat Schwannoma, Sezary syndrome, Skin Cancer, Small Cell tern, Yellow Mutant Albinism, Yellow Nail Syndrome, YKL, Lung Cancer (SCLC), Small Intestine Cancer, Soft Tissue Young Female Arteritis, Yunis-Varon Syndrome, YY Syn Sarcoma, Spinal Cord Tumors, Squamous-Cell-Carcinoma drome, Z-E Syndrome, Z- and -Protease Inhibitor Defi (skin), Stomach Cancer, Synovial sarcoma, Testicular Can ciency, Zellweger Syndrome, Zellweger syndrome, Zell cer, Thymus Cancer, Thyroid Cancer, Transitional-Cell weger cerebro-hepato-renal syndrome, ZES, Ziehen Cancer-(bladder), Transitional-Cell-Cancer-(renal-pelvis-/- Oppenheim Disease (Torsion Dystonia), Zimmermann ureter), Trophoblastic Cancer, Urethral Cancer, Urinary Laband Syndrome, Zinc Deficiency Congenital, Zinsser System Cancer, Uroplakins, Uterine sarcoma, Uterus Can Cole-Engman Syndrome, ZLS, Zollinger-Ellison Syndrome. cer, Vaginal Cancer, Vulva Cancer, Waldenstrom's-Macro globulinemia, Wilms Tumor. 0138. As used herein a "cancer refers to a group of diseases and disorders that are characterized by uncontrolled 0.139. The compounds of the invention can be utilized in cellular growth (e.g. formation of tumor) without any dif pharmaceutical compositions by adding an effective amount ferentiation of those cells into specialized and different cells. of a compound to a suitable pharmaceutically acceptable Cancers which can be treated using the methods of the diluent or carrier. Use of the compounds and methods of the present invention include, without being limited to, ABL1 invention may also be useful prophylactically. protooncogene, AIDS Related Cancers, Acoustic Neuroma, 0140 AS is known in the art, a nucleoside is a base-sugar Acute Lymphocytic Leukaemia, Acute Myeloid Leukaemia, combination. The base portion of the nucleoside is normally Adenocystic carcinoma, Adrenocortical Cancer, Agnogenic a heterocyclic base. The two most common classes of Such myeloid metaplasia, Alopecia, Alveolar soft-part sarcoma, heterocyclic bases are the purines and the pyrimidines. Anal cancer, Angiosarcoma, Aplastic Anaemia, Astrocy Nucleotides are nucleosides that further include a phosphate toma, Ataxia-telangiectasia, Basal Cell Carcinoma (Skin), group covalently linked to the Sugar portion of the nucleo Bladder Cancer, Bone Cancers, Bowel cancer, Brain Stem side. For those nucleosides that include a pentofuranosyl US 2007/0286856 A1 Dec. 13, 2007

Sugar, the phosphate group can be linked to either the 2',3' backbones; sulfide, sulfoxide and sulfone backbones; for or 5’ hydroxyl moiety of the Sugar. In forming oligonucle macetyl and thioformacetyl backbones; methylene for otides, the phosphate groups covalently link adjacent macetyl and thioformacetyl backbones; riboacetyl back nucleosides to one another to form a linear polymeric bones; alkene containing backbones; Sulfamate backbones; compound. In turn, the respective ends of this linear poly methyleneimino and methylenehydrazino backbones; Sul meric compound can be further joined to form a circular fonate and Sulfonamide backbones; amide backbones; and compound, however, linear compounds are generally pre others having mixed N, O, S and CH2 component parts. ferred. In addition, linear compounds may have internal nucleotide complementarity and may therefore fold in a 0145 Representative United States patents that teach the manner as to produce a fully or partially double-stranded preparation of the above oligonucleosides include, but are compound. Within oligonucleotides, the phosphate groups not limited to, U.S. Pat. Nos. 5,034,506; 5,166,315; 5,185, are commonly referred to as forming the internucleoside 444; 5,214,134: 5,216,141, 5,235,033: 5,264,562: 5,264, backbone of the oligonucleotide. The normal linkage or 564; 5,405,938; 5.434,257; 5,466,677; 5,470,967: 5489, backbone of RNA and DNA is a 3' to 5' phosphodiester 677: 5,541,307: 5,561.225; 5,596,086; 5,602,240; 5,610, linkage. 289; 5,602,240; 5,608,046; 5,610,289; 5,618,704: 5,623, 070; 5,663,312:5,633,360; 5,677,437; 5,792,608; 5,646.269 0141 Specific examples of preferred antisense or sense and 5,677,439. compounds useful in this invention include oligonucleotides containing modified backbones or non-natural internucleo 0146 In other preferred oligonucleotide mimetics, both side linkages. As defined in this specification, oligonucle the Sugar and the internucleoside linkage (i.e. the backbone), otides having modified backbones include those that retain of the nucleotide units are replaced with novel groups. The a phosphorus atom in the backbone and those that do not nucleotide units are maintained for hybridization with an have a phosphorus atom in the backbone. For the purposes appropriate target nucleic acid. One Such compound, an of this specification, and as sometimes referenced in the art, oligonucleotide mimetic that has been shown to have excel modified oligonucleotides that do not have a phosphorus lent hybridization properties, is referred to as a peptide atom in their internucleoside backbone can also be consid nucleic acid (PNA). In PNA compounds, the sugar-back ered to be oligonucleosides. bone of an oligonucleotide is replaced with an amide con taining backbone, in particular an aminoethylglycine back 0142 Preferred modified oligonucleotide backbones con bone. The nucleotides are retained and are bound directly or taining a phosphorus atom therein include, for example, indirectly to aza nitrogen atoms of the amide portion of the phosphorothioates, chiral phosphorothioates, phospho backbone. Representative United States patents that teach rodithioates, phosphotriesters, aminoalkylphosphotriesters, the preparation of PNA compounds include, but are not methyl and other alkyl phosphonates including 3'-alkylene limited to, U.S. Pat. Nos. 5,539,082; 5,714,331; and 5,719, phosphonates, 5'-alkylene phosphonates and chiral phospho 262. Further teaching of PNA compounds can be found in nates, phosphinates, phosphoramidates including 3'-amino Nielsen et al., Science 254: 1497-1500, 1991. phosphoramidate and aminoalkylphosphoramidates, thiono phosphoramidates, thionoalkylphosphonates, thionoalky 0147 Preferred embodiments of the present invention are lphosphotriesters, selenophosphates and boranophosphates oligonucleotides with phosphorothioate backbones and oli having normal 3'-5' linkages. 2'-5' linked analogs of these, gonucleosides with heteroatom backbones, and in particular and those having inverted polarity wherein one or more CH NH-O CH , —CH N(CH)—O CH internucleotide linkages is a 3' to 3',5' to 5' or 2 to 2 linkage. known as a methylene (methylimino) or MMI backbone). Preferred oligonucleotides having inverted polarity com —CH2—O N(CH)—CH2—, —CH N(CH)— prise a single 3' to 3' linkage at the 3'-most internucleotide N(CH)—CH2— and —O N(CH)—CH2—CH2— linkage i.e. a single inverted nucleoside residue which may wherein the native phosphodiester backbone is represented be a basic (the nucleotide is missing or has a hydroxyl group as —O P O—CH of the above referenced U.S. Pat. in place thereof). Various salts, mixed salts and free acid No. 5,489,677, and the amide backbones of the above forms are also included. referenced U.S. Pat. No. 5,602.240. Also preferred are oligonucleotides having morpholino backbone structures of 0143 Representative United States patents that teach the the above-referenced U.S. Pat. No. 5,034,506. preparation of the above phosphorus-containing linkages include, but are not limited to, U.S. Pat. Nos. 3,687,808; 0.148 Modified oligonucleotides may also contain one or 4,469,863; 4,476,301: 5,023,243; 5,177, 196; 5,188,897; more substituted sugar moieties. Preferred oligonucleotides 5,264,423: 5,276,019; 5,278.302: 5,286,717: 5,321,131; comprise one of the following at the 2' position: OH: F: O-, 5,399,676; 5,405,939; 5.453,496; 5,455,233; 5,466,677; S-, or N-alkyl; O-, S-, or N-alkenyl; O-, S- or N-alkynyl; or 5,476,925; 5,519,126; 5,536,821; 5,541,306; 5,550,111; O-alkyl-O-alkyl, wherein the alkyl, alkenyl and alkynyl may 5,563,253: 5,571,799; 5,587,361; 5,194.599; 5,565,555; be substituted or unsubstituted C to Co alkyl or C to Co 5,527,899; 5,721218: 5,672,697 and 5,625,050. alkenyl and alkynyl. Particularly preferred are O(CH), O CH, O(CH), OCH, O(CH), NH, O(CH2)CH, 0144 Preferred modified oligonucleotide backbones that O(CH), ONH2, and O(CH), ON(CH), CH, where n do not include a phosphorus atom therein have backbones and m are from 1 to about 10. Other preferred oligonucle that are formed by short chain alkyl or cycloalkyl inter otides comprise one of the following at the 2' position: C to nucleoside linkages, mixed heteroatom and alkyl or Co lower alkyl, Substituted lower alkyl, alkenyl, alkynyl, cycloalkyl internucleoside linkages, or one or more short alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH, OCN, chain heteroatomic or heterocyclic internucleoside linkages. Cl, Br, CN, CF, OCF, SOCH, SOCH, ONO., NO, N, These include those having morpholino linkages (formed in NH, heterocycloalkyl, heterocycloalkaryl, aminoalky part from the Sugar portion of a nucleoside); siloxane lamino, polyalkylamino, Substituted silyl, an RNA cleaving US 2007/0286856 A1 Dec. 13, 2007 39 group, a reporter group, an intercalator, a group for improv nucleotides include tricyclic pyrimidines Such as phenox ing the pharmacokinetic properties of an oligonucleotide, or azine cytidine(1H-pyrimido5,4-b1,4)benzoxazin-2(3H)- a group for improving the pharmacodynamic properties of one), phenothiazine cytidine(1H-pyrimido5,4-b1,4)ben an oligonucleotide, and other Substituents having similar Zothiazin-2(3H)-one), G-clamps such as a Substituted properties. A preferred modification includes 2'-methoxy phenoxazine cytidine (e.g. 9-(2-aminoethoxy)-H-pyrimido ethoxy(2'-O-CHCHOCH, also known as 2'-O-(2-meth 5,4-b1,4)benzoxazin-2(3H)-one), carbazole cytidine (2H oxyethyl) or 2'-MOE) (Martin et al., Helv. Chim. Acta, 78: pyrimido4,5-bindol-2-one), pyridoindole cytidine(H-py 486-504, 1995) i.e., an alkoxyalkoxy group. A further pre rido3'2':45pyrrolo2,3-dipyrimidin-2-one). Modified ferred modification includes 2'-dimethylaminooxyethoxy, nucleotides may also include those in which the purine or i.e., a O(CH)ON(CH) group, also known as 2'-DMAOE, pyrimidine base is replaced with other heterocycles, for as described in examples hereinbelow, and 2'-dimethylami example 7-deaza-adenine, 7-deazaguanosine, 2-aminopyri noethoxyethoxy (also known in the art as 2'-O-dimethyl dine and 2-pyridone. Further nucleotides include those dis amino-ethoxy-ethyl or 2-DMAEOE), i.e. 2'-O-CH closed in U.S. Pat. No. 3,687,808, those disclosed in The O—CH N(CH), also described in examples Concise Encyclopedia Of Polymer Science And Engineer hereinbelow. ing, pages 858-859, Kroschwitz, J. I., ed. John Wiley & 0149 Other preferred modifications include 2'-meth Sons, 1990, those disclosed by Englisch et al., Angewandte oxy(2'-O CH), 2-aminopropoxy(2'-OCH2CHCH-NH), Chemie, International Edition, 30: 613, 1991, and those 2'-allyl (2-CH-CH=CH-), 2'-O-allyl (2'-O CH disclosed by Sanghvi, Y. S., Chapter 15, Antisense Research CH=CH-) and 2'-fluoro (2'-F). The 2'-modification may be and Applicalions, pages 289-302, Crooke, S.T. and Lebleu, in the arabino (up) position or ribo (down) position. A B., ed., CRC Press, 1993. Certain of these nucleotides are preferred 2'-arabino modification is 2'-F. Similar modifica particularly useful for increasing the binding affinity of the tions may also be made at other positions on the oligonucle compounds of the invention. These include 5-substituted otide, particularly the 3' position of the sugar on the 3' pyrimidines, 6-azapyrimidines and N-2, N-6 and O-6 sub terminal nucleotide or in 2'-5' linked oligonucleotides and stituted purines, including 2-aminopropyladenine, 5-propy the 5' position of 5' terminal nucleotide. Oligonucleotides nyluracil and 5-propynylcytosine. 5-methylcytosine Substi may also have Sugar mimetics such as cyclobutyl moieties in tutions have been shown to increase nucleic acid duplex place of the pentofuranosyl Sugar. Representative United stability by 0.6-1.2° C. and are presently preferred base States patents that teach the preparation of such modified substitutions, even more particularly when combined with Sugar structures include, but are not limited to, U.S. Pat. 2'-O-methoxyethyl Sugar modifications. Nos. 4,981,957; 5,118,800; 5,319,080; 5,359,044: 5,393, 0152 Representative United States patents that teach the 878; 5,446,137; 5,466,786; 5,514,785: 5,519,134: 5,567, preparation of certain of the above noted modified nucle 811; 5,576.427: 5,591,722; 5,597,909; 5,610,300; 5,627, otides as well as other modified nucleotides include, but are 053: 5,639,873; 5,646,265; 5,658,873; 5,670,633; 5,792, not limited to, the above noted U.S. Pat. No. 3,687,808, as 747; and 5,700,920. well as U.S. Pat. Nos. 4,845,205; 5,130,302; 5,134,066: 5,175,273; 5,367,066; 5,432,272; 5.457,187; 5.459,255; 0150. A further preferred modification of the sugar 5,484,908: 5,502,177; 5,525,711; 5,552,540: 5,587,469; includes Locked Nucleic Acids (LNAs) in which the 2'-hy 5,594,121, 5,596,091; 5,614,617; 5,645,985; 5,830,653; droxyl group is linked to the 3' or 4 carbon atom of the sugar 5,763,588; 6,005,096; and 5,681,941. ring, thereby forming a bicyclic Sugar moiety. The linkage is 0153. Another modification of the oligonucleotides of the preferably a methylene (-CH2—), group bridging the 2' invention involves chemically linking to the oligonucleotide oxygen atom and the 4' carbon atom wherein n is 1 or 2. one or more moieties or conjugates which enhance the LNAs and preparation thereof are described in WO activity, cellular distribution or cellular uptake of the oligo 98/393.52 and WO 99/14226. nucleotide. These moieties or conjugates can include con 0151 Oligonucleotides may also include nucleotide jugate groups covalently bound to functional groups such as (often referred to in the art simply as “base') modifications primary or secondary hydroxyl groups. Conjugate groups of or substitutions. As used herein, “unmodified’ or “natural the invention include intercalators, reporter molecules, nucleotides include the purine bases adenine (A) and gua polyamines, polyamides, polyethylene glycols, polyethers, nine (G), and the pyrimidine bases thymine (T), cytosine (C) groups that enhance the pharmacodynamic properties of and uracil (U). Modified nucleotides include other synthetic oligomers, and groups that enhance the pharmacokinetic and natural nucleotides such as 5-methylcytosine (5-me-C), properties of oligomers. Typical conjugate groups include 5-hydroxymethyl cytosine, Xanthine, hypoxanthine, 2-ami cholesterols, lipids, phospholipids, biotin, phenazine, folate, noadenine, 6-methyl and other alkyl derivatives of adenine phenanthridine, anthraquinone, acridine, fluoresceins, and guanine, 2-propyl and other alkyl derivatives of adenine rhodamines, coumarins, and dyes. Groups that enhance the and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, pharmacodynamic properties, in the context of this inven 5-halouracil and cytosine, 5-propynyl ( C=C CH-) uracil tion, include groups that improve uptake, enhance resistance and cytosine and other alkynyl derivatives of pyrimidine to degradation, and/or strengthen sequence-specific hybrid bases, 6-aZouracil, cytosine and thymine, 5-uracil (pseudou ization with the target nucleic acid. Groups that enhance the racil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, pharmacokinetic properties, in the context of this invention, 8-hydroxyl and other 8-Substituted adenines and guanines, include groups that improve uptake, distribution, metabo 5-halo particularly 5-bromo, 5-trifluoromethyl and other lism or excretion of the compounds of the present invention. 5-substituted uracils and cytosines, 7-methylguanine and Representative conjugate groups are disclosed in Interna 7-methyladenine, 2-F-adenine, 2-amino-adenine, 8-azagua tional Patent Application PCT/US92/09196, filed Oct. 23, nine and 8-azaadenine, 7-deazaguanine and 7-deazaadenine 1992, and U.S. Pat. No. 6,287,860, the entire disclosure of and 3-deazaguanine and 3-deazaadenine. Further modified which are incorporated herein by reference. Conjugate moi US 2007/0286856 A1 Dec. 13, 2007 40 eties include but are not limited to lipid moieties such as a RNA target can be routinely detected by gel electrophoresis cholesterol moiety, cholic acid, a thioether, e.g., hexyl-S- and, if necessary, associated nucleic acid hybridization tech tritylthiol, a thiocholesterol, an aliphatic chain, e.g., dode niques known in the art. candiol or undecyl residues, a phospholipid, e.g., di-hexa 0157 Chimeric antisense or sense compounds of the decyl-rac-glycerol or triethylammonium 1,2-di-O- invention may be formed as composite structures of two or hexadecyl-rac-glycero-3-H-phosphonate, a polyamine or a more oligonucleotides, modified oligonucleotides, oligo polyethylene glycol chain, or adamantane acetic acid, a nucleosides and/or oligonucleotide mimetics as described palmityl moiety, or an octadecylamine or hexylamino-car above. Such compounds have also been referred to in the art bonyl-oxycholesterol moiety. Oligonucleotides of the inven as hybrids or gapmers. Representative United States patents tion may also be conjugated to active drug Substances, for that teach the preparation of such hybrid structures include, example, aspirin, warfarin, phenylbutaZone, ibuprofen, but are not limited to, U.S. Pat. Nos. 5,013,830; 5,149,797; Suprofen, fenbufen, ketoprofen, (S)-(+)-pranoprofen, car 5,220,007: 5,256,775; 5,366,878; 5,403,711; 5,491,133; profen, dansylsarcosine, 2,3,5-triiodobenzoic acid, flufe 5,565,350; 5,623,065; 5,652,355; 5,652,356; and 5,700,922. namic acid, folinic acid, a benzothiadiazide, chlorothiazide, 0158. The compounds of the invention may also be a diazepine, indomethicin, a barbiturate, a cephalosporin, a admixed, encapsulated, conjugated or otherwise associated Sulfa drug, an antidiabetic, an antibacterial or an antibiotic. with other molecules, molecule structures or mixtures of 0154 Representative United States patents that teach the compounds, as for example, liposomes, receptor-targeted preparation of Such oligonucleotide conjugates include, but molecules, oral, rectal, topical or other formulations, for assisting in uptake, distribution and/or absorption. Repre are not limited to, U.S. Pat. Nos. 4,828,979; 4,948,882; sentative United States patents that teach the preparation of 5,218,105: 5,525,465; 5,541,313; 5,545,730; 5,552,538; Such uptake, distribution and/or absorption-assisting formu 5,578,717, 5,580,731: 5,580,731: 5,591584; 5,109,124; lations include, but are not limited to, U.S. Pat. Nos. 5,118,802; 5,138,045; 5,414,077; 5,486,603: 5,512,439; 5,108,921; 5,354,844; 5,416,016; 5,459,127: 5,521,291; 5,578,718; 5,608,046; 4,587,044; 4,605,735; 4,667,025; 5,543,158: 5,547,932; 5,583,020; 5,591,721: 4,426,330; 4,762,779; 4,789,737; 4,824,941; 4,835,263; 4,876,335; 4,534,899; 5,013,556; 5,108,921; 5,213,804: 5,227,170; 4,904,582: 4,958,013; 5,082,830; 5,112,963: 5,214,136; 5,264.221; 5,356,633; 5,395,619; 5,416,016; 5,417,978: 5,082,830; 5,112,963: 5,214,136; 5,245,022: 5,254,469; 5,462,854; 5,469,854: 5,512.295: 5,527,528: 5,534,259; 5,258,506; 5,262,536; 5,272,250; 5,292,873; 5,317,098: 5,543,152: 5,556,948: 5,580,575; and 5,595,756, each of 5,371,241, 5,391,723; 5,416.203, 5,451,463: 5,510,475; which is herein incorporated by reference. 5,512,667: 5,514,785; 5,565,552; 5,567,810: 5,574,142: 0159. The antisense or sense compounds of the invention 5,585,481: 5,587,371; 5,595,726; 5,597.696; 5,599,923; encompass any pharmaceutically acceptable salts, esters, or 5,599.928 and 5,688,941, certain of which are commonly salts of Such esters, or any other compound which, upon owned with the instant application, and each of which is administration to an animal, including a human, is capable herein incorporated by reference. of providing (directly or indirectly) the biologically active 0155. It is not necessary for all positions in a given metabolite or residue thereof. Accordingly, for example, the compound to be uniformly modified, and in fact more than disclosure is also drawn to prodrugs and pharmaceutically one of the aforementioned modifications may be incorpo acceptable salts of the compounds of the invention, phar rated in a single compound or even at a single nucleoside maceutically acceptable salts of Such prodrugs, and other within an oligonucleotide. bioeduivalents. 0156 The present invention also includes antisense or 0.160 The term “prodrug indicates a therapeutic agent sense compounds which are chimeric compounds. "Chi that is prepared in an inactive form that is converted to an meric' antisense compounds or "chimeras, in the context of active form (i.e., drug) within the body or cells thereof by the this invention, are antisense or sense compounds, particu action of endogenous enzymes or other chemicals and/or larly oligonucleotides, which contain two or more chemi conditions. In particular, prodrug versions of the oligonucle cally distinct regions, each made up of at least one monomer otides of the invention are prepared as SATE (S-acetyl-2- unit, i.e., a nucleotide in the case of an oligonucleotide thioethyl) phosphate derivatives according to the methods compound. These oligonucleotides typically contain at least disclosed in WO93/24510 to Gosselin et al., published Dec. one region wherein the oligonucleotide is modified so as to 9, 1993 or in WO94/26764 and U.S. Pat. No. 5,770,713 to confer upon the oligonucleotide increased resistance to Imbach et al. nuclease degradation, increased cellular uptake, increased 0.161 The term “pharmaceutically acceptable salts' stability and/or increased binding affinity for the target refers to physiologically and pharmaceutically acceptable nucleic acid. An additional region of the oligonucleotide salts of the compounds of the invention: i.e., salts that retain may serve as a Substrate for enzymes capable of cleaving the desired biological activity of the parent compound and RNA:DNA or RNA:RNA hybrids. By way of example, do not impart undesired toxicological effects thereto. For RNAse H is a cellular endonuclease which cleaves the RNA oligonucleotides, preferred examples of pharmaceutically strand of an RNA:DNA duplex. Activation of RNase H, therefore, results in cleavage of the RNA target, thereby acceptable salts and their uses are further described in U.S. greatly enhancing the efficiency of oligonucleotide-medi Pat. No. 6,287,860. ated inhibition of gene expression. The cleavage of 0162 The present invention also includes pharmaceutical RNA:RNA hybrids can, in like fashion, be accomplished compositions and formulations which include the antisense through the actions of endoribonucleases, such as RNAsell or sense compounds or interactive compounds of the present which cleaves both cellular and viral RNA. Cleavage of the invention. The pharmaceutical compositions of the present US 2007/0286856 A1 Dec. 13, 2007

invention may be administered in any number of ways are unilamellar or multilamellar vesicles which have a depending upon whether local or systemic treatment is membrane formed from a lipophilic material and an aqueous desired and upon the area to be treated. Administration may interior that contains the composition to be delivered. Cat be topical (including ophthalmic and to mucous membranes ionic liposomes are positively charged liposomes which are including vaginal and rectal delivery), pulmonary, e.g., by believed to interact with negatively charged DNA molecules inhalation or insufflation of powders or aerosols, including to form a stable complex. Liposomes that are pH-sensitive by nebulizer; intratracheal, intranasal, epidermal and trans or negatively-charged are believed to entrap DNA rather dermal), oral or parenteral. Parenteral administration than complex with it. Both cationic and noncationic lipo includes intravenous, intraarterial, Subcutaneous, intraperi somes have been used to deliver DNA to cells. toneal or intramuscular injection or infusion; or intracranial, 0168 Liposomes also include “sterically stabilized' lipo e.g., intrathecal or intraventricular, administration. The com Somes, a term which, as used herein, refers to liposomes pounds may be modified for oral administration. For comprising one or more specialized lipids that, when incor example, oligonucleotides with at least one 2'-O-methoxy porated into liposomes, result in enhanced circulation life ethyl modification are useful for oral administration. Phar times relative to liposomes lacking Such specialized lipids. maceutical compositions and formulations for topical Examples of sterically stabilized liposomes are those in administration may include transdermal patches, ointments, which part of the vesicle-forming lipid portion of the lipo lotions, creams, gels, drops, Suppositories, sprays, liquids Some comprises one or more glycolipids or is derivatized and powders. Conventional pharmaceutical carriers, aque with one or more hydrophilic polymers, such as a polyeth ous, powder or oily bases, thickeners and the like may be ylene glycol (PEG) moiety. Liposomes and their uses are necessary or desirable. Coated condoms, gloves and the like further described in U.S. Pat. No. 6,287,860, which is may also be useful. incorporated herein in its entirety. 0163 The pharmaceutical formulations of the present invention, which may conveniently be presented in unit 0169. The pharmaceutical formulations and composi dosage form, may be prepared according to conventional tions of the present invention may also include Surfactants. techniques well known in the pharmaceutical industry. Such The use of Surfactants in drug products, formulations and in techniques include the step of bringing into association the emulsions is well known in the art. Surfactants and their uses active ingredients with the pharmaceutical carrier(s) or are further described in U.S. Pat. No. 6,287,860. excipient(s). In general, the formulations are prepared by 0170 In one embodiment, the present invention employs uniformly and intimately bringing into association the active various penetration enhancers to effect the efficient delivery ingredients with liquid carriers or finely divided solid car of nucleic acids, particularly oligonucleotides. In addition to riers or both, and then, if necessary, shaping the product. aiding the diffusion of non-lipophilic drugs across cell 0164. The compositions of the present invention may be membranes, penetration enhancers also enhance the perme formulated into any of many possible dosage forms such as, ability of lipophilic drugs. Penetration enhancers may be but not limited to, tablets, capsules, gel capsules, liquid classified as belonging to one of five broad categories, i.e., syrups, soft gels, Suppositories, and enemas. The composi Surfactants, fatty acids, bile salts, chelating agents, and tions of the present invention may also be formulated as non-chelating non-surfactants. Penetration enhancers and Suspensions in aqueous, non-aqueous or mixed media. their uses are further described in U.S. Pat. No. 6,287,860. Aqueous Suspensions may further contain Substances which 0171 One of skill in the art will recognize that formu increase the viscosity of the Suspension including, for lations are routinely designed according to their intended example, sodium carboxymethylcellulose, Sorbitol and/or use, i.e. route of administration. dextran. The Suspension may also contain stabilizers. 0172 Preferred formulations for topical administration 0165 Pharmaceutical compositions of the present inven include those in which the oligonucleotides of the invention tion include, but are not limited to, Solutions, emulsions, are in admixture with a topical delivery agent Such as lipids, foams and liposome-containing formulations. The pharma liposomes, fatty acids, fatty acid esters, steroids, chelating ceutical compositions and formulations of the present inven agents and Surfactants. Preferred lipids and liposomes tion may comprise one or more penetration enhancers, include neutral (e.g. dioleoylphosphatidyl DOPE ethanola carriers, excipients or other active or inactive ingredients. mine, dimyristoylphosphatidyl choline DMPC, distearoly phosphatidyl choline) negative (e.g. dimyristoylphosphati 0166 Emulsions are typically heterogenous systems of dyl glycerol DMPG) and cationic (e.g. one liquid dispersed in another in the form of droplets dioleoyltetramethylaminopropyl DOTAP and dioleoylphos usually exceeding 0.1 um in diameter. Emulsions may contain additional components in addition to the dispersed phatidyl ethanolamine DOTMA). phases, and the active drug which may be present as a 0173 For topical or other administration, oligonucle Solution in either the aqueous phase, oily phase or itself as otides of the invention may be encapsulated within lipo a separate phase. Microemulsions are included as an Somes or may form complexes thereto, in particular to embodiment of the present invention. Emulsions and their cationic liposomes. Alternatively, oligonucleotides or inter uses are well known in the art and are further described in active molecules (e.g. antibodies) may be complexed to U.S. Pat. No. 6,287,860, which is incorporated herein in its lipids, in particular to cationic lipids. Preferred fatty acids entirety. and esters, pharmaceutically acceptable salts thereof, and 0167 Formulations of the present invention include lipo their uses are further described in U.S. Pat. No. 6,281,860. Somal formulations. As used in the present invention, the 0.174 Compositions and formulations for oral adminis term "liposome” means a vesicle composed of amphiphilic tration include powders or granules, microparticulates, lipids arranged in a spherical bilayer or bilayers. Liposomes nanoparticulates, Suspensions or Solutions in water or non US 2007/0286856 A1 Dec. 13, 2007 42 aqueous media, capsules, gel capsules, Sachets, tablets or 0177. In another related embodiment, compositions of minitablets. Thickeners, flavoring agents, diluents, emulsi the invention may contain one or more antisense or sense fiers, dispersing aids or binders may be desirable. Preferred compounds, or one or more interactive molecules such as oral formulations are those in which oligonucleotides of the antibodies targeted to a first nucleic acid target or protein invention are administered in conjunction with one or more and one or more additional compounds targeted to a second penetration enhancers surfactants and chelators. Preferred nucleic acid target or protein. Alternatively, compositions of Surfactants include fatty acids and/or esters or salts thereof, the Subject invention may contain two or more antisense or bile acids and/or salts thereof. Preferred bile acids/salts and sense compounds or tow or more interactive compounds fatty acids and their uses are further described in U.S. Pat. targeted to different regions of the same nucleic acid target No. 6,287,860, which is incorporated herein in its entirety. or protein. Also preferred are combinations of penetration enhancers, 0.178 The formulation of therapeutic compositions and for example, fatty acids/salts in combination with bile acids/ their subsequent administration (dosing) is within the skill of salts. A particularly preferred combination is the Sodium salt those in the art. Dosing is dependent on severity and of lauric acid, capric acid and UDCA. Further penetration responsiveness of the disease state to be treated, with the enhancers include polyoxyethylene-9-lauryl ether, polyoxy course of treatment lasting from several days to several ethylene-20-cetyl ether. Oligonucleotides or antibodies or months, or until a cure is effected or a diminution of the other interactive molecules of the invention may be deliv disease state is achieved. Optimal dosing schedules can be ered orally, in granular form including sprayed dried par calculated from measurements of drug accumulation in the body of the patient. Persons of ordinary skill can easily ticles, or complexed to form micro or nanoparticles. Oligo determine optimum dosages, dosing methodologies and nucleotide complexing agents and their uses are further repetition rates. Optimum dosages may vary depending on described in U.S. Pat. No. 6,287,860. the relative potency of individual compounds, and can 0175 Compositions and formulations for parenteral, generally be estimated based on ECss found to be effective intrathecal or intraventricular administration may include in in vitro and in vivo animal models. In general, dosage is sterile aqueous Solutions which may also contain buffers, from 0.01 ug to 100 g per kg of body weight, and may be diluents and other suitable additives such as, but not limited given once or more daily, weekly, monthly or yearly, or even to, penetration enhancers, carrier compounds and other once every 2 to 20 years. Persons of ordinary skill in the art pharmaceutically acceptable carriers or excipients. can easily estimate repetition rates for dosing based on measured residence times and concentrations of the drug in 0176 Certain embodiments of the present invention pro bodily fluids or tissues. Following successful treatment, it vide pharmaceutical compositions containing one or more may be desirable to have the patient undergo maintenance oligomeric compounds and one or more other chemothera therapy to prevent the recurrence of the disease state, peutic agents. Examples of Such chemotherapeutic agents wherein the compound is administered in maintenance include but are not limited to cancer chemotherapeutic drugs doses, ranging from 0.01 ug to 100g per kg of body weight, Such as daunorubicin, daunomycin, dactinomycin, doxoru once or more daily, to once every 20 years. Examples of bicin, epirubicin, idarubicin, esorubicin, bleomycin, mafos effective amounts include 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, famide, ifosfamide, cytosine arabinoside, bis-chloroethylni 0.07, 0.08, 0.09, 0.1, 0.2,0.3, 0.4,0.5,0.6,0.7, 0.8, 0.9, 1.0, troSurea, buSulfan, mitomycin C, actinomycin D, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, mithramycin, prednisone, hydroxyprogesterone, testoster 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, one, tamoxifen, dacarbazine, procarbazine, hexameth 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, ylmelamine, pentamethylmelamine, mitoxantrone, amsa 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, crine, chlorambucil, methylcyclohexylnitroSurea, nitrogen 68, 69, 70, 71, 72, 73,74, 75, 76, 77, 78, 79, 80, 81, 82, 83, mustards, melphalan, cyclophosphamide, 6-mercaptopurine, 84, 85, 86, 87, 88, 89,90,91, 92,93, 94, 95, 96, 97,98, 99 6-thioguanine, cytarabine, 5-azacytidine, hydroxyurea, and 100 g/kg body weight. deoxycoformycin, 4-hydroxyperoxycyclophosphoramide, 0179 The present invention is further described by the 5-fluorouracil (5-FU), 5-fluorodeoxyuridine (5-FUdR), following non-limiting Examples. methotrexate (MTX), colchicine, taxol. Vincristine, vinblas tine, etoposide (VP-16), trimetrexate, irinotecan, topotecan, EXAMPLE 1. gemcitabine, teniposide, cisplatin and diethylstilbestrol (DES). When used with the compounds of the invention, Cell Line Such chemotherapeutic agents may be used individually 0180. The MDA-MB 231 human breast cancer cell line (e.g., 5-FU and oligonucleotide), sequentially (e.g., 5-FU was obtained from American tissue culture collection (Rock and oligonucleotide for a period of time followed by MTX ville, USA) and cultivated at 37° C. in 100% (v/v) air, and and oligonucleotide), or in combination with one or more maintained in Leibovitz L-15 Medium (Sigma, St Louis, other such chemotherapeutic agents (e.g., 5-FU, MTX and Mo., USA), supplemented with 10% foetal calf serum (CSL, oligonucleotide, or 5-FU, radiotherapy and oligonucleotide). Melbourne, Australia) and antibiotic/antimycotic reagents Anti-inflammatory drugs, including but not limited to non (Sigma, St Louis, Mo., USA). steroidal anti-inflammatory drugs and corticosteroids, and antiviral drugs, including but not limited to ribivirin, Vidara EXAMPLE 2 bine, acyclovir and ganciclovir, may also be combined in compositions of the invention. Combinations of antisense or Isolation of the cDNA for Human HAS2 and sense compounds and other non-antisense drugs are also Construction of an Antisense Expression Vector within the scope of this invention. Two or more combined 0181. The cDNA for human HAS2 was generated by compounds may be used together or sequentially. designing gene specific primers from the published sequence US 2007/0286856 A1 Dec. 13, 2007

of Watanabe and Yamaguchi (1996; Genbank accession no. CCCAAAAG 3' (SEQ ID NO:7); HAS1 probe, 5' AAC U54804) and consisted of the following primers: sense CTCTTGCAGCAGTTTCTTGAGGCC 3' (SEQ ID NO:8); 5'>GAGCTGAACAAGATGCATTGTGAGAGC (SEQ ID HAS2 sense, 5' CAGTCCTGGCTTCGAGCAG3' (SEQ ID NO: 1) and antisense 5"GACATGGTGCTTGATGTAT NO:9), HAS2 antisense, 5' TTGGGAGAAAAGTCTTTG GATCTTCCAT (SEQID NO:2). Total RNA harvested from GCT 3' (SEQ ID NO:10); HAS2 probe, 5' CCATTGAAC exponentially dividing human dermal fibroblasts was used CAG-AGACTTGAAACAGCCC 3' (SEQ ID NO:11): as the template for RT-PCR to generate a 1.7 kb cloNA HAS3 sense, 5' TTGCACTGTGGTCGTCAACTT 3' (SEQ fragment of HAS2, which was cloned directly into pGEM-T ID NO:12), HAS3 antisense, 5' GTCGAGGTCAAACGT vector (Promega Corporation, Madisom, USA). The cDNA TGTGAG 3' (SEQ ID NO:13), HAS3 probe, 5' TCAAAT for HAS2 was subsequently subcloned into the pCI-Neo CAAAAACAGGCAGGTACAGGTAGTGG 3' (SEQ ID expression vector (Promega Corporation, Madisom, USA) NO:14); GAPDH sense, 5' AAGGTGAAGGTCGGAGT and isolated clones containing the insert in the antisense CAAC 3' (SEQ ID NO:15), GAPDH antisense, 5' GAGT orientation were identified by restriction endonuclease map TAAAA-GCAGCCCTGGTG 3' (SEQ ID NO:16), GAPDH ping and automated sequencing. probe, 5' TTTGGTCGTATTGGGCGCCTGG3' (SEQ ID NO:17). For HAS internal probes the reporter dye 6-car EXAMPLE 3 boxylfluorescein (6-FAM) and quencher 6-carboxytetram ethyl rhodamine (TAMRA) were labelled at the 5' and 3' Transfection of Human ASHAS2 and Mock into respectively. For GAPDH internal probes the reporter MDA-MB 231 Human Breast Cancer Cells 6-FAM was substituted with VICTM (Applied Biosystems 0182. The ASHAS2-pCl-Neo construct and pCl-neo vec California, USA). The PCR reaction was performed in a tor were transfected into human MDA-MB 231 breast cells final Volume of 30 u, and consisted of 1xTaqman reaction using Lipofectamine plus reagent (Gibco life technologies, mix, 6 uM of HAS forward and reverse primer, 1.5 M of probe, 1 uM of each GAPDH primer and 500 nM of GAPDH USA) according to the manufactures instructions. Prior to probe. PCR amplification was by denaturation for 10 min commencing studies transfected cells were selected for at utes at 95°C. followed by annealing for 2 minutes at 50° C. least one month in the presence of 500 g/mL G418 anti followed by 40 cycles of 15 seconds at 95°C. and 1 minute biotic. Transfected cells were selected for at least one month at 60° C. Thermocycling and fluorescence measurement in the presence of 500 ug/mL G418 antibiotic. Resistant were performed in a ABI Prism 7700 sequence detection colonies were then harvested and established as stable cell system (Applied Biosystems, California, USA). To allow lines. comparison between samples the relative hyaluronan Syn EXAMPLE 4 thase signals were normalised with internal GAPDH control measurementS. Detecting the Incorporation of the Stable Transfection into the Genome EXAMPLE 6 0183 PCR on purified genomic DNA isolated from Characterization of Hyaluronidase Gene Expression ASHAS2-pCINeo transfectants was performed to confirm the incorporation of the antisense construct into the genome. 0185. To determine the state of hyaluronidase gene In brief, a gene specific primer for pCINeo: 5'-GCACA expression for HYAL1, 2 and 3. RT-PCR was performed on GATGCGTAAGGAG-3' (SEQ ID NO:3) was used in com total RNA extracted from experimental cells harvested at 80 bination with two specific HAS2 primers of the following and 100% confluency. The gene specific primer sets were sequence: GSP2 sense 5'-GCTGTGTACATGAC designed from sequences retrieved from GenBank and con CTCGCGCTTGCCGCC-3' (SEQ ID NO:4) and GSP4 sisted of: HYAL1 (GenBank accession no. NM007312) sense, 5'-GGCGGGAAGTAAACTCGAC-3' (SEQ ID sense, 5'-GCACAGGGAAGTCACAGATGTATGTGC-3' NO:5). When used in the following combination; pCIneo/ (SEQ ID NO:18): HYAL1 antisense, 5'-CCACTGGT GSP2 and pCIneo/GSP4 expected size products of 1443 and CACGTTCAGGATGAAG-3 (SEQ ID NO:19); HYAL2 2223 bp were amplified respectively. (GenBank accession no. NM003773) sense 5'-GATGTG TATCGCC-GGTTATCACGCC-3' (SEQ ID NO:20): EXAMPLE 5 HYAL2 antisense 5'-CGTAGACTGGGAG-TGCATGGT TGGC-3' (SEQ ID NO:21); HYAL3 (GenBank accession Quantification of mRNA for HAS1, 2 and 3 no. NM003549) sense, 5'-GCACTGATGGAGGATACGCT GCG-3' (SEQ ID NO:22); HYAL3 antisense, 5'-GCTGGT 0184 Real time PCR was used to quantitate the relative GACTG-CAGGCCATCGCTGC-3' (SEQ ID NO:23). mRNA levels of HAS1, HAS2, and HAS3 in parental, mock Amplified sequences were visualised by agarose gel elec and ASHAS2 transfected cells using gene specific primers trophoresis containing ethidium bromide and identity con and an internal oligonucleotide probe. In brief, total RNA firmed by automated DNA sequencing. was purified from experimental cells using Rineasy (Qaigen, Melbourne, Australia) which was then used to generate EXAMPLE 7 single stranded cDNA by incubating 2 ug RNA with 0.5 ug/uL random primers and Superscript reverse trancriptase. Cell Proliferation Assay For quantitative real time PCR gene specific primers for each HAS isoform and an internal oligonucleotide probe 0186 Parental, mock and ASHAS2 transfectants were were used. In brief, the primers consisted of the following: harvested at approximately 80% confluency and seeded in to HAS1, sense, 5' CCTGCATCAGCGGTCCTCTA 3 (SEQ 24-well plates at differing cell densities, ranging from 5x10 ID NO:6); HAS1 antisense, 5' GCCGGTCA-TC cells to 9x10" cells/well. The rate of cell growth was then US 2007/0286856 A1 Dec. 13, 2007 44 followed for 24, 48, 72, and 96 hours after plating. All cell EXAMPLE 11 counts were determined using an automated Coulter counter. Particle Exclusion Assay and Cell Morphology EXAMPLE 8 0190. The HA-dependent pericellular matrix was visua Immunohistochemistry lised aroundbreast cancer cells from control and transfected cultures by the exclusion of fixed human erythrocytes 0187 To allow immunodetection and comparison described by Clarris & Fraser (1968). Morphological dif between parental, mock and ASHAS2-pCNeo transfected ferences as well as the particle exclusion assay in the control MDA-MB-231 cells specific antibodies to HAS2 and Hyal2 and transfected MDA-MB 231 cells were photographed on were kindly gifted from Dr Paraskevi Heldin and Dr Robert a Nikon Optiflot inverted phase contrast microscope (Nikon Stem respectively. Anti-human CD44 Clone DF 1485 was Company, Japan) 24 h and 60 h after plating. purchased from DAKO (Denmark) and used according to manufacturers instructions. Cells were seeded into 8-well EXAMPLE 12 chamber slides at a density of 2x10 cells/well and grown for a further 24 hours at 37° C. The cells were fixed in Effect of the HA Production Histochoice for 15 minutes before blocking heterophile 0191) Cells were seeded at 2.5x10/cells in 25 cm cul proteins by incubation in PBS containing 10% FCS. The ture flasks and incubated at 37° C. for 24 h, 48 h, 72 h, 96 primary antibodies were diluted to (cite concentration NOT h, 120 h and 144 h. At each time points cells were dilution) in antibody diluent (PBS containing 1% human trypsinized and counted using an automated coulter counter. serum and 1% FCS) then incubated on slides for 60 min at HA concentration in the harvested culture medium was room temperature. Endogenous peroxidase activity was determined using a hyaluronic acid binding protein (HABP) blocked by immersion of slides in 0.3% HO in methanol for 20 min prior to incubation with a peroxidase-conjugated assay, with the standards and reaction buffer provided Cor rabbit anti-sheep secondary antiserum for 60 min at RT. The genix Inc (Colorado, USA). immunocomplexes were visualised by applying 3.3'-Diami EXAMPLE 13 nobenzidene substrate (Sigma Fast DAB) for 5-10 minutes, then counterstained with haematoxylin, dehydrated and Size Exclusion Chromatography to Determine MW mounted. of HA Synthesized EXAMPLE 9 0.192 Cells were seeded at 7.5x10 cells in 75 cm culture flasks and grown for 24 h in complete medium Supple Cell Cycle Analysis by Flow Cytometry mented with 5 uCi of D-6-H-Glucosamine hydrochloride. 0188 The transfected and control cells were seeded at a. To determine the MW of H-HA in the medium, samples 2x10 cells/25 cm flask in the presence of 2 mM thymidine were Subjected to size exclusion chromatography on a and grown until 50% confluent. Cells were washed then Sephacryl S-1000 SF. In brief, gel column (1.6 mx90 m) returned to normal culture medium and harvested, by were packed according to manufactures instructions, equili trypsinisation, at the following time points; Oh, 4 h, 8 h, 12 brated and eluted with phosphate buffer containing 0.2% h, 16 h, 20 h, 24 h, 28 h, 32 h, and 36 h then fixed in 95% (v/v) TX-100. The molecular weight of HA in the culture ethanol for 2 hat 4°C. Cells were pretreated with 100 ug/mL medium was calculated using linear regression of K versus RNAase (Sigma) and 50 ug/ml propidium iodide (, Sigma) HA of known molecular weights ranging from >1.67x107. for 30 minutes at 37° C. before determining the cell cycle K=0 to 4.4x10, K=1. Fraction range of column S-1000 stage in a FACS-CaliburTM analytical instrument (Becton 7x10-1.7x107 Da. Dickinson, San Jose, Calif.). EXAMPLE 1.4 EXAMPLE 10 Mammary Fat Pad Inoculation of MDA-MB 231 Migration Assay Cells 0189 The Boyden chamber chemoinvasion assay was 0193 Parental, mock and ASHAS2 transfected cells were performed as described previously (Thompson et al., 1992). harvested in the logarithmic growth phase by Scraping. Cells Matrigel (50 kg) was dried onto polycarbonate filters (12 um were resuspended to a final density of 2x10 cells in L-15 pore, PVP free, Nucleopore, Pleasanton, Calif.) and then medium supplemented with 0.1% glucose +/- Matrigel reconstituted at 37° C. Normal growth media (L-15 (v/v WHAT IS THE PERCENTAGE2) then immediately medium) containing 0.1% bovine serum albumin (Miles injected into the mammary fat pad of 5 weeks old female Biochemicals, Kankakee, Ill.) was used as the chemo attrac CBA nude mice (n=11 does each treatment group consist of tant. Cells were harvested in the logarithmic growth phaseby 11). Tumor growth was recorded twice weekly by measuring trypsinisation, washed twice with serum-free L-15 medium three perpendicular diameters (d1,d2, d3). Tumor volume containing 0.1% bovine serum albumin then seeded at was then calculated using the formula: (1/6)7L (d1 d2d3). On 300,000 cells/11 ml chamber and 70,000 cells/0.2 ml cham the day 84 mice were humanely killed and liver, kidneys, ber. Each experiment was performed in triplicate. Chambers brain and lungs removed at autopsy and stored at -20° C. were incubated in a humidified incubator at 37° C. for 6 For histological examination half of the primary tumor was hours. To determine the population of cells which had fixed in 4% formaldehyde and embedded in paraffin, then 5 traversed the matrigel, the filters were stained with Diff um sections from this tissue was examined by H&E staining. Quik (American Scientific Products, McGaw PK., Ill.) then The remaining portion of the tumor was frozen at -20° C. counted. until further analysis. US 2007/0286856 A1 Dec. 13, 2007

EXAMPLE 1.5 time HAS expression between transfected and parental cells the level of each mRNA quantitated was normalised with DNA Extraction from Soft Organs and respective internal GAPDH controls. The endogenous level Quantification of Metastasis of MDA-MD 231 of HAS2 mRNA expression in parental cells is shown in 0194 Quantitative Alu PCR was used to detect metastasis FIG. 1a, which was slightly decreased in the mock trans of MDA-MD 231 from the primary tumor to other organs fectants. In contrast, mRNA expression in ASHAS2 trans collected at autopsy. In brief, DNA was extracted by griding fected cells was increased 3- to 4-fold and 8- to 9-fold when samples under liquid nitrogen and resuspending in a DNA compared with parental and mock transfectants cells respec lysis buffer. DNA was then purified using standard phenol tively (FIG. 1a). Moderate HAS3 expression was also chloroform methodology followed by ethanol precipitation detected and was comparable in parental mock and antisense and reconstition in TE buffer. The purified DNA was transfected cells FIG. 1b. Consistant throughout this study adjusted to a final concentration of 10 ng/ul in TE buffer was the expression of HAS 1 in antisense transfectants which pH7.2, aliquoted and stored at -20° C. until analysis. To could not be detected in both parental cells and mock remove exogenous human DNA contamination the reaction transfectants (FIG. 1b). mix was treated with 17 U/ml nuclease S7 (Roche) in the 0.197 Both parental and mock transfected control cul presence of 1 mM CaCl at 37° C. for 24 hours prior to PCR. tures stained positive for the HA receptor CD44 and Hyal-2. Quantitative Alu PCR was then performed on purified The staining for CD44 in both controls was most evident in gemomic DNA samples (10 ng) in a GeneAmp 5700 the plasma membrane with areas of intense focal membrane Sequence Detection System (Applied Biosystems, Austra staining (FIG. 1 panel E). No CD44 epitope reactivity could lia). In brief, each sample was tested in duplicate in a final be detected in ASHAS2 transfectants (FIG. 1 panel F). reaction volume of 25 uL consisting of 0.625 U Taq DNA Similar observation were recorded for the reactivity with polymerase (Roche: Mannheim, Germany), 10 mM Tris Hyal-2 antibody where control cultures stained positively, HCl pH 8.3, 1.5 mM MgCl, 50 mM KC1, 200 uM dNTPs, which localised to the plasma membrane and also appeared 8% DMSO, 1 lug/ml 6-carboxy-X-rhodamine (Molecular as cytoplasmic vesicles whereas no reactivity could be Probes; Eugene, Oreg. USA), 1 in 40000 dilution of SYBR detected in ASHAS2 transfectants. These results indicate Green I (Molecular Probes) and 100 nM of each Alu primer. that perturbation of functional CD44 and Hyal2, as observed Following an initial denaturation incubation at 95°C. for 2 in ASHAS2 transfectants, alter the catabolism of HA cul minutes, amplification occurred over 40 cycles, which con minating in a significant increase in the amount HA in the sisted of denaturation at 95° C. for 5 seconds, annealing at culture medium. 65°C. for 60 seconds, and extension at 75°C. for 15 seconds during which the intensity of fluorescence was measured. A EXAMPLE 1.8 dissociation curve was then generated from 60° C. to 95°C. On each 96-well reaction plate, a standard curve was pre Characteristics of MDA MB 231 pared by serially diluting human DNA into mouse DNA which permitted the quantification of the tissue burden of 0198 Breast Cancer Cell in a Tumor Xenograft Model human tumor cells in the mouse organs removed at autopsy. Interestingly, antisense inhibition of HAS2 profoundly altered the expression of Hyal-1,2 and 3 in MDA-MD 231. EXAMPLE 16 Hyal-3 could not be detected in both parental or mock transfectants, which both expressed comparable levels of Transfection of AntiSense HAS2 in MDA-MB 231 mRNA for Hyal-1 and to a much greater extent Hyal-2, Transfected Cells which was also comparable between these two controls (FIG. 2). In contrast, inhibition of HAS2 expression resulted 0.195 Incorporation of the antisense HAS2-pCINeo con in the down regulation of Hyal-2 mRNA to the point where struct into the genome of MDA-MB 231 was confirmed by it was not detectable even after 35 cycles of PCR. Hyal-1 PCR analysis on highly purified DNA extracted from the expression in antisense transfectants was moderately transfected cells. When used in the following combination; increased when compared with both parental and mock pCIneo? GSP2 and pCIneo/GSP4 expected size products of controls and Hyal-3 was also detected in the antisense 1443 and 2223 bp were reproducibly amplified from stable transfectants. Thus by preventing the production of a func clones harbouring the antisense HAS2 construct. Genomic tional HAS2 protein in the MDA-MD) 231 cell line, Hyal-2 DNA isolated from parental and mock transfected tested gene expression has been down regulated concomitant to the negative. upregulation of HAS 1 and Hyal3, genes that are not EXAMPLE 17 normally expressed in this cell line. 0199 Immunohistochemistry with a specific HAS2 anti Transfection with Antisense HAS2 Alters body was used to determine the extent of cell surface Expression Profiles of HAS and Hyaluronidase reactivity. Whereas both parental and mock transfected cells Genes in MDA-MB 231 stained positively for HAS2 protein (FIG. 1, panel B), which localised mostly to the plasma membrane, efficient blockage 0196) Endogenous levels of mRNA for HAS2 in parental of translation in the antisense HAS2 transfectants was cells were quantitated using real time PCR and compared evidenced by the lack of immunoreactivity with the HAS2 with the values obtained from mock and antisense HAS2 antibody (FIG. 1 panel C). transfected cells. Concomitant to these experiments, HAS1 and HAS3 mRNA levels were also quantitated using real 0200. The molecular mass of HA synthesised by parental, time PCR with HYAL1, 2 and 3 expression characterised by mock and antisense transfected cells was determined by standard RT-PCR methodology. To allow comparison of real Sephacyl S-1000 size exclusion chromatography. The paren US 2007/0286856 A1 Dec. 13, 2007 46 tal cell line synthesised three distinct molecular weights of ASHAS2 transfectants displayed a lag period of approxi HA estimated to be 3000 kDa, 40,000 and 100,000 Da mately 24 hours to reach similar densities to that observed respectively which reflects the products of the HAS isoforms in control cultures at all Subsequent time points where cell expressed in the parental cell line, notably HAS2 and 3. number was enumerated (FIG. 4). Confluency in ASHAS2 Antisense HAS2 transfectants synthesised HA which was cultures occurred at approximately 96- to 120 hours of cell eluted in the void volume that corresponds to a molecular growth after seeding compared with 72 hours in both control weight >1.67x10'. Another fraction corresponding to a Mw cultures. These observations therefore highlight the impor of 100,000 Da was also detected in the medium from tance of the co-ordinated expression of a functional HAS2 in antisense transfectants but the percentage of radioactive cell proliferation. precursor incorporation was much less than that observed in 0204 Concomitant to these observations flow cytometric the parental cell line (FIG. 2). These elution profiles were analysis was also performed on parental, mock and shown to be 100% susceptible to digestion with Streptomy ASHAS2 transfectants to determine relative DNA content at ces hyaluronidase. defined time points after plating at Sub-confluent densities 0201 Antisense inhibition of HAS2 results in altered (FIG. 5). The percentage of the ASHAS2 transfected cells in hyaluronan metabolism. Due to the altered HAS and HYAL the cell cycle phases Go/G, S and G/M 28 hours after gene expression in ASHAS2 MDA-MB 231 transfectants plating were 80%, 0% and 9% respectively (FIG. 5). In the amount of hyaluronan in cell contact culture medium contrast the corresponding figures in the parental cells for was quantitated using an enzyme linked protein assay spe cell cycle phases Go/G, S and G/M were 4%, 75% and cific for HA. HA production was quantitated from samples 15% respectively (FIG. 5). These results are consistent with collected in triplicate at the same time points established in the observation in the lag period of 24 hours in the the proliferation assay. The data collected was graphed as proliferation assay where antisense inhibition induced a HA synthesised (picogram per cell: pg/cell/day). Cell con transient delay of entry into S-phase by approximately 24 tact medium from antisense HAS2-MDA-MB 231 transfec hours (FIG. 5) thereby reinforcing the importance of HAS2 tants contained a significantly greater amount of hyaluronan expression during cellular proliferation in cultures of MBA when compared with either parental cells of mock transfec MD-231. tants (FIG. 3). On average ASHAS2 cultures synthesised 6.79 pg of HA/cell/day over the duration of the experiment 0205 The ability for cancer cells to migrate is a funda with one noticeable exception at 48 hours where synthesis mental characteristic in highly metastatic cancer cells. To was increased to 12 pg/cell/day. In contrast parental and characterise the highly invasive characteristics of MDA mock transfectants synthesised approximately 1.1 and 1.4 MB-231 the chemoinvasion assay using the Boyden cham pgHA/cell/day respectively over the duration of the experi ber was used. Migratory rates were then compared between ment. The exclusion of fixed erythrocytes was used to parental, mock and ASHAS2 transfected MDA MB-231. indirectly visualise the HA pericellular matrix in the Both parental and mock transfectants displayed typical ASHAS2 transfectants which was then compared with that migratory behaviour with 100% of cell population invading observed in the parental or mock transfectants. In these the matrigel onto the underlying filter (FIG. 6). In contrast, experiments there was no evidence to Suggest any gross stable transfectants harbouring antisense HAS2 resulted in difference in the thickness of the pericellular matrix, which 93% inhibition of migration when compared with either was comparable to that observed in control cultures (FIG. controls tested (FIG. 6). 3b). EXAMPLE 20 0202 Throughout the experiments the morphology of the antisense transfected cells were compared with control cells. HAS2 Inhibition Totally Inhibits the Growth and The ASHAS2 transfectants were readily distinguishable by Progression of Primary and Secondary Breast their morphology which was akin to cells undergoing mito Cancer sis and/or migration, that is, Small rounded cells that were loosely adhered to the growth surface. Consistent through 0206 To examine the effects of antisense inhibition of out these observations was the decrease in cell number in HAS2 on tumor growth, parental, mock and ASHAS2 transfectants inoculated into the mammary fat pad of nude ASHAS2 transfectants when compared with control cul mice. Primary tumor growth was followed over a 12 week tures. period following implantation after which the extent of EXAMPLE 19 metastasis to other organs detected using Alu PCR. Mice inoculated with parental or mock transfected MDAMB 231 HAS2 Inhibition Decreases Breast Cancer Cell readily established primary tumors which were comparable Proliferation and Migration in Vitro in growth over the duration of the 12 week experiment (FIG. 7). In contrast, however, mice inoculated with ASHAS2 0203 To compare the effect of antisense inhibition of transfectants did not establish primary tumors (FIG. 7). In HAS2 during active cell growth, parental, mock and other experiments Matrigel was also included in the inocu ASHAS2 transfected cells were seeded at identical sub lation medium used to ensure viability of injected ASHAS2 confluent densities and at defined times were harvested and transfectants. Again, no primary tumor could be detected the total cell countestimated using a Coulter counter. In both over the duration of the 12 week experiment (data not control cultures a doubling of cell number every 24 hours shown). As assessed by Alu PCR, metastasis was most was observed until the 72 hour sample point where cultures prevalent in brain, and lung but was also detected in kidneys reached confluency (FIG. 4). In contrast stable transfectants and the liver in Samples prepared from mice injected with harbouring ASHAS2 cell growth was profoundly affected by either parental or mock transfectant MDA-MD 231 cells the lack of a functional HAS2 protein. Specifically, (FIG. 7b). Despite the reported sensitivity of this assay, US 2007/0286856 A1 Dec. 13, 2007 47 which is able to detect 1 human cell/1x10" mouse cells, no 6-FAM was substituted with VICTM (Applied Biosystems, metastasis could be found in the aforementioned organs in Foster City, Calif., USA). The PCR reaction was performed mice that were injected with ASHAS2 transfectants (FIG. 7) in a final volume of 30 ul and consisted of 1xTaqman were determined to find any metastasis to Soft organs, reaction mix, 6 uM of HAS forward and reverse primer, 1.5 however, there were no detectable metastases with the uM of probe, 1 uM of each GAPDH primer and 500 nM of HAS2 antisense and significantly high levels of metastasis GAPDH probe. PCR amplification was performed by dena were found in the brain and lung compared to the kidney and turation for 10 min at 95°C. followed by annealing for 2 min liver in the parental mice groups (FIG. 7b). at 50° C. followed by 40 cycles of 15 seconds at 95°C. and 1 min at 60° C. Thermocycling and fluorescence measure EXAMPLE 21 ment were performed in an ABI Prism 7700 sequence detection system (Applied Biosystems). Relative quantita Over-Expression of HAS2, HYAL2 and CD44 tion was performed by normalizing threshold cycle (Ct) Correlates with the Invasiveness of Breast Cancer values of each sample gene with Ct values of the GAPDH. ACt corresponds to the difference between the Ct of the HAS Culture of Human Breast Cancer Cells genes of interest and the Ct of the GAPDH. Data are 0207 Aneuploid human breast adenocarcinoma cell presented as fold-change difference relative to parental lines, MDA-MB-231, MDA-MB-435, MDA-MB-468, (arbitrarily set to 100) calculated according to the formula MDA-MB453, MDA-MB-361, T47D, MCF-7A, BT-549, describing relative PCR quantitation 2-ACS-AC-PPH). ZR-75-1 and HS578T were obtained from the American Characterisation of Hyaluronidase Gene Expression Tissue Culture Collection, Rockville, USA. All cell culture propagation reagents were obtained from Sigma, St Louis, 0209 To determine the hyaluronidase gene expression Mo., USA. Cell lines, MDA-MB-231, MDA-MB-435, for HYAL-1, 2 and 3, RT-PCR was performed on total RNA MDA-MB-468, MDA-MB453 and MDA-MB-361 were extracted from cells in both the exponential and growth routinely grown and Subcultured as a monolayer in 175 cm2 arrested phases. The gene specific primer sets were designed culture flasks in Leibovitz L-15 Medium supplemented with from sequences retrieved from GenBank (refer Table 2). 10% fetal calf serum (FCS) at 37° C. in 100% (v/v) air. The Amplified sequences were visualised by agarose gel elec ZR-75-1 cell line was grown in RPMI Medium supple trophoresis containing ethidium bromide and their identity mented with 10% FCS, 2 mM L-glutamine, 1.5 g/L sodium confirmed by automated DNA sequencing. To quantitate the bicarb, 4.5 g/L glucose, 10 mM HEPES, 1 mM sodium relative abundance of each PCR product, ethidium bromide pyruvate at 37° C. in humidity controlled incubator in 5% stained agarose gels containing amplified fragments were (v/v) CO. The T47D cell line was maintained in a humidi subjected to densitometric analysis using ProXpressTM fied incubator at 37° C. in 5% CO, in RPMI supplemented Imager (Perkin Elmer, Boston, Mass., USA) and the data with 10% FCS, 4.5 g/L of glucose, 10 mM HEPES, 1 mM analysed using Phoretix 1D software (Phoretic International, sodium pyruvate, 7.1 ug/ml of insulin. BT-549 cell line was Newcastle, UK). maintained in a humidified incubator at 37° C. in 5% CO in RPMI supplemented with 10% FCS and 0.8 ug/ml of Quantitation of the Synthesis and Catabolism of Liberated insulin. His378T cell line was cultivated in a humidified and Cell-Associated Hyaluronan incubator at 37° C. in 5% CO, in DMEM supplemented with 0210 Triplicate cultures of the human breast cancer cell 10% FCS and 10 g/ml of insulin. MCF-7 cell line was lines were seeded at 7.5x10 cells/75 cm culture flask and cultivated in a humidified incubator at 37°C. in 5% CO in were grown with 400 ug/ml of dextran sulphate (500 kDa M. MEM supplemented with 10% FCS, 1 mM sodium pyruvate and 17% sulphur-substituted; Pharmacia Fine Chemicals, and 10 ug/ml of insulin. All cell cultures were routinely Uppsala, Sweden) as a means of inhibiting endogenous maintained in media containing antibiotic/antimycotic hyaluronidase activity and enabling the characterisation of reagents. hyaluronidase digestion products (Udabage et al., 2004). Cultures were grown for 24h during which time cell cultures Quantification of mRNA for HAS1, 2 and 3 reached 85% confluence and then for a further 24 h until 0208 Real time and comparative reverse transcriptase growth arrest was observed. At the conclusion of the incu PCR were used respectively to quantitate the relative mRNA bation period, cells were harvested by trypsinization and levels of the HA synthases (HAS 1-3) in the ten human breast counted using a Coulter counter. Media was used for quan cancer cell lines by using gene specific primers and an titation of the liberated HA. Cell-associated extracellular HA internal oligonucleotide probe (Table 2). RNA was extracted was obtained by centrifugation of the cell/trypsin fraction at from triplicate cultures of cells grown to both exponential 400 g. in a Beckman TJ-6 centrifuge where the Supernatant and plateau phase using RNeasy Mini Kits (QIAGEN, was quantitated for HA. Intracellular HA concentration was Basel, Switzerland). In brief, total RNA was purified from determined by treating the cell pellet as follows: the cell exponentially growing cells using TRI-reagent (Sigma) pellet was lysed under hypotonic conditions by resuspend which was used to generate single stranded cDNA by ing in 10 mM HEPES pH 7.2 followed by disruption in a incubating 2 g RNA with 0.5 g/ul random primers and Dounce homogeniser using 20 strokes every 15 min. Cell SuperScript reverse trancriptase (Invitrogen, Carlsbad, Calif., lysis was confirmed by Giemsa stain and examination by USA). For quantitative real time PCR gene specific primers light microscopy. To dissociate the HA from binding pro for each HAS isoform and an internal oligonucleotide probe teins, the cell lysate was heated to 37° C. with 0.5% v?v were used. For HAS internal probes the reporter dye 6-car Triton X-114 in 10 mM HEPES buffer pH 7.2 (Prehm, boxylfluorescein (6-FAM) and quencher 6-carboxytetram 1990). The HA/detergent micelles were centrifuged at 1500 ethyl rhodamine (TAMRA) was labelled at the 5' and 3' g for 5 min and the upper aqueous phase was analysed for respectively. For GAPDH internal probes the reporter HA. The individual analyses of the intra and extracellular US 2007/0286856 A1 Dec. 13, 2007 48

HA fractions were not within the detection limits of the HA 20 ml/h. Molecular weight estimations were calculated ELISA (>50 ng/ml), therefore the extracellular and intrac using calibration data for HA in Sephacryl S-1000 and ellular fractions were pooled and characterised for HA Superose 12 data generated from commercially purchased concentrations. HA fractions of high monodispersity ranging from 10k to 0211 Hyaluronan production was quantitated using an 5000 kDa (CPN, Czech Republic and Pharmacia). To deter enzyme-linked HA binding protein assay (Corgenix Inc. mine the percentage incorporation D-6-Hlglucosamine Colorado, USA). The assay was performed as directed by hydrochloride into Ha macromolecules, the non-dialysable manufacturer's instructions. In brief, duplicate 100 ul of (molecules >5 kDa) dpm was subjected to digestion by 10 samples and the HA standards (0 ng/ml, 50 ng/ml, 100 TRU of Streptomyces hyaluronidase at pH 6, 37° C. for 24 ng/ml, 200 ng/ml, 500 ng/ml and 800 ng/ml) were aliquoted h. Digested material was Subjected to chromatography in into a 96 well plate coated with HA binding protein (HABP), both Sephacryl S-1000 and Superose 12 where profiles were incubated for 60 minutes at room temperature (RT) followed compared to equivalent undigested sample. Any H) mate by four washes with PBS. One hundred ul of HABP con rial not digested by hyaluronidase was excluded from the jugated to horse-radish peroxidase was added and incubated chromatography profiles. For the calculation of column at for 30 minutes at RT. After further PBS washes the recoveries, counts in each fraction were taken as significant reaction was visualised with 100 ul of 3,3',5,5'-tetramethyl when >3 S.D. above the mean background dpm, with the benzidine (TMB) after a 30 min, RT incubation. The reac background determined taking an equal number of sample tion was sopped with 100 ul of 0.36N sulfuric acid and read points before and after V and V, where the average number at 450 nm (650 nm reference) in a BioRad 350 microplate taken was 20. reader. Growth media that had not been exposed to cells was Evaluation of Breast Cancer Cell Line Invasiveness: Boyden used to determine the endogenous HA background, this Chamber Migration Assay figure was subtracted from all results. 0214) Invasion Assays were Performed Using Modified Visualisation of the Hyaluronan Gylcocalyx Boyden Chambers with Polycarbonate Nucleopore mem 0212. The HA-dependent pericellular matrix was visua brane (Corning, Corning, N.Y., USA). Pre-coated filters (6.5 lised around the breast cancer cells by the addition of fixed mm in diameter, 12 um pore-size, Matrigel 100 Lig/cm) human erythrocytes as described by Clarris & Fraser (1968). were rehydrated with 100 ul of Leibovitz L-15 media In brief, human erythrocytes were fixed overnight in 1.5% supplemented with 0.1% w/v. BSA (Sigma). Exponentially v/v formaldehyde in PBS at RT and were then washed growing cells were harvested with trypsin/EDTA (Sigma), exhaustively in PBS. In the last wash sodium azide was washed twice with serum-free growth medium containing added to a final concentration of 0.1% V/v and the cells 0.1% w/v. BSAthen added to the top chamber (3x10 cells/1 stored at 4°C. Breast cancer monolayers were washed twice ml chamber). Normal growth media containing 10% V/v in PBS, 37° C. and then incubated with 5 ml PBS to which FCS was used as the chemo attractant. After incubation for 50 ul of fixed erythrocytes (~10 cells/ml) was added. The 6 h at 37° C., non-invaded cells on the upper surface of the particles were allowed to settle for 15-30 min after which the filter were wiped with a cotton Swab, and migrated cells on HA-dependent pericellular matrix was recorded by photog the lower surface of the filter were fixed and stained with raphy on a Nikon Optiflot inverted phase contrast micro Diff-Quick kit. Invasiveness was determined by counting scope. The specificity of this method was demonstrated by cells in five microscopic fields per well, and the extent of incubation of the breast cancer cultures with Streptomyces invasion was expressed as an average number of cells per hyaluronidase, where cells were covered with 10 units/ml of microscopic field. Each experiment was performed in trip hyaluronidase followed by incubation at 37° C. for 15-30 licate on two separate days where data is represented as % min. Monolayers were washed twice in PBS, 37° C. and of migrating cells compared to the parental cell line. covered with a 5 ml suspension of fixed erythrocytes as previously described. The particles were allowed to settle for Quantitation of Hyaluronan Receptors, RHAMM and CD44 15-30 min, observed and photographed as described above. 0215 Cell extracts were obtained by hypotonic lysis of exponentially growing cells in 10 mM HEPES pH 7.2 Characterisation of the Molecular Weight of Hyaluronan followed by disruption in a Dounce homogeniser using 20 Produced by Human Breast Cancer Cells strokes every 15 minutes. Cell lysis was confirmed by 0213 Cells were seeded at 7.5x10 cells/75 cm culture Giemsa stain of cell lysate and examination by light micros flask and were grown for 24 h in growth media containing copy. Cell lysate preparations were denatured at 65° C. for 400 ug/ml DS and 250 uCi D-6-Hlglucosamine hydro 5 min and loaded (15-30 ug of protein per lane) onto a 10% chloride (Perkin Elmer, Boston, Mass., USA). At the con polyacrylamide gel. Electrophoresis was performed on a clusion of the 24 h incubation period, the media was Bio-Rad minigel apparatus. Proteins were transferred to removed and exhaustively dialysed (Mr exclusion of 6 kDa) nitrocellulose membranes and blocked for 1 h with Tris against 10 mM Tris-HC1/0.15M sodium chloride/0.02% buffered saline containing 5% nonfat dry milk and 0.1% sodium azide pH 7.4 at 4°C. The dialysate and dialysis fluid Tween-20. Membranes were then washed and probed with were chromatographically analysed for the identification of the appropriate antibody diluted in Tris-buffered saline con HHA and its degradation products. HHA of >5 kD was taining 5% bovine serum albumin (for polyclonal antibod Subjected to size exclusion chromatography in a Sephacryl ies) or 5% nonfat dry milk (for monoclonal antibodies). The S-1000 gel eluted in 0.15M NaCl/phosphate pH 7.25 which antibodies used for detection were 50 lug of CD44s mono contained 19 mM NaH2PO4, 38 mM NaHPO and 94 mM clonal antibody (Hybridoma Bank, USA) or 25ug RHAMM NaCl at 13.6 ml/h. The dialysis fluid (molecules <5 kD) was (kindly donated by R. Savani, University of Pennsylvania Subjected to size exclusion chromatography in a Superose 12 School of Medicine, USA). The secondary antibodies used gel eluted in the above-mentioned buffer at an elution rate of were anti-rabbit IgG (New England Bio-labs) and rabbit US 2007/0286856 A1 Dec. 13, 2007 49 anti-rat IgG (Bio-Rad), which were conjugated with horse which had undergone both exponential proliferation and radish peroxidase. Immunoreactive bands were detected by growth arrest demonstrated that 80-98% of the H glu enhanced chemiluminescence, and the sizes of proteins were cosamine was incorporated into HHA, with the remaining estimated using prestained molecular weight standards. Hdpm identified as a pronase digestible macromolecule Immunoreactive bands were quantified by densitometry. of approximately 50 kDa (See Table 4). All graphs repre analysis using ProXpressTM Imager (Perkin Elmer, Boston, sented in FIGS. 8A-H have had any peaks associated with Mass., USA) and the data analysed using Phoretix 1D Streptomyces hyaluronidase resistant material removed from software (Phoretic International, Newcastle, UK). the profile. The least invasive cell line, MDA-MB 453 which only expressed HAS3 liberated monodisperse HA of 10000 Highly Invasive Breast Cancer Cells Preferentially Express kDa, while the equivalent sample from cells grown without HAS2 inhibition of the endogenous hyaluronidase (DxS culture) 0216) Endogenous levels of mRNA for the various HA exhibited depolymerisation of 22% of the liberated HA, into synthase isoforms were quantitated in 10 different human a 60 kDa to 600 kDa with 78% degraded to 30 kDa (FIG. breast cancer cell lines using real time PCR and comparative 8A). The most invasive cell lines, BT-549 and Hss78T RT-PCR (see Table 3). HAS1 mRNA was not detected in any which both primarily expressed HAS2 and a very low of the ten breast cancer cell lines. HAS2 mRNA was expression of HAS3, both liberated large quantities of 10 detected in all the breast cancer cell lines which demon 000 kDa HA which in the presence of active hyaluronidases, strated an invasiveness of >80% where the highly invasive was rapidly degraded into the HA fragments of 10, 20 and BT-549 and Hss78T cell lines expressed up to 205 times 40 kDa (FIGS. 8E & G). The MDA MB-231 which more HAS2 mRNA than the non-invasive MDA-MB 453 expressed moderate levels of HAS2 and very low levels of cell line. Negligible differences in HAS2 mRNA were HAS3, produced a polydisperse HA which had several peaks observed between exponentially growing and growth with the modal Mr of 600 to 10 000 kDa and Smaller arrested cells. All cell lines expressed low levels of HAS3 fractions at 60 and 200 kDa, while after exposure to endog mRNA, but it was interesting to note that in cells with a low enous degradation processes these macromolecules were invasive potential (<26%) no HAS3 mRNA was detected in degraded to 20, 40 and 500 kDa (FIG. 8B). growth arrested cells, while in the highly invasive cell lines the transcription of this gene continued. The expression of 0219 Analysis of the cell-associated HA demonstrated HAS3 in all breast cancer cell lines, more particularly in the that when the normal HA degradation processes were inhib less invasive cell lines Suggests that this HAS isoform is ited by dextran sulphate a very high Mr HA could be primarily responsible for the synthesis of basal levels of HA detected as well as oligomers of intermediate Mr. ranging production necessary for normal cell function and HAS2 is from 20 to 200 kDa. When the hyaluronidase and other required for the rapid synthesis of large quantities of HA potential degradative processes were inhibited by dextran required for cancer invasion. sulphate only small fragments of HA ranging from 10 to 70 kDa were found associated with the cell fraction (Table 5). The Glycocalyx in Exponentially Growing Breast Cancer Increased Expression of Hyal-1 and Hyal-2 Induces Inva Cells is Generated by HAS2 siveness in Human Breast Cancer Cell Lines 0217. Utilising the HA quantitation and particle exclu sion assay it was possible to uniquely demonstrate that when 0220 Utilising competitive reverse transcription poly breast cancer cells are in exponential growth phase any merase chain reaction (RT-PCR), Hyal-1, 2 and 3 was cell-associated HA is only detected in cells expressing detected in varying quantities in all cell lines, while PH-20 HAS2 (Table 3). In the exponentially growing, less invasive was not detected using these amplification conditions. When breast cancer phenotype which preferentially expressed comparing the expression of Hyal-1 and Hyal-2 expression HAS3, none of the synthesised HA was retained as part of in the less invasive cell lines (s30% of a cell population the glycocalyx, the retention of the HA into the pericellular demonstrating migration) the mRNA for both of the matrix only occurred after the cells have reached growth enzymes were of approximate equal expression. As cells arrest. This finding is contrary to studies in other cell types became more invasive the expression of both the Hyal-1 and where it was suggested that HAS3 expression resulted in the Hyal-2 mRNA increased where Hyal-2 was often expressed retention of a pericellular matrix (Itano et al., 1999a; Liu et at levels of 5-7 fold higher than the Hyal-1 mRNA. In the al., 1996). During senescence, in general, the quantity of HA least invasive cell lines the transcription of Hyal-1 and 2 was liberated into the media by HAS3 expressing cell lines inhibited during senescence, while in the highly invasive significantly, in some cases total inhibition of HA liberation cell lines the level of mRNA expression was maintained or was observed, followed by the retention of the HA in the slightly increased during growth arrest. cell-associated fraction. During senescence, highly invasive The Cellular Turnover of Hyaluronan Decreases with cell lines released 40-60% less HA into the extracellular Increased Cellular Invasion environment, but retained 2-22 fold more HA in the peri cellular matrix. The quantitation of the cell-associated HA 0221) As seen in Table 4, as the invasive potential of the was substantiated by the red cell exclusion assay which only breast cancer cell increased the turnover rate of liberated HA demonstrated the presence of a pericellular coat in the decreased, indicating that highly invasive cells may require exponentially growing MDA-MB 231, BT-549 and Hss78T an extracellular environment rich in HA or that the degra cell lines. dative pathways of the cells had reached the maximum functioning capacity. This study has uniquely identified the HAS 2 and HAS3 Liberate High Molecular Hyaluronan expression of Hyal-3 in breast cancer where there is an which is Rapidly Depolymerised inverse relationship between cell invasiveness and Hyal-3 0218 Chromatographic characterisation of the liberated expression. The identification of Hyal-3 in breast cancer HA (tStreptomyces hyaluronidase digestion) from cells cells was unexpected as this gene has been reported in US 2007/0286856 A1 Dec. 13, 2007 50 mammalian testis and bone marrow (Csoka et al., 2001), but siveness however there did appear to be an inverse relation as yet has to demonstrate activity in standard hyaluronidase ship between CD44 and RHAMM expression (FIGS. 9A & assays (Stern, 2003). B). With the exception of the moderately invasive cell line, High Levels of CD44 Epitope Correlates with Increased Cell MDA-MB 468 there was a proportional relationship Invasiveness, Elevated HAS2, Hyal-1 and Hyal-2 Expres between HAS2, Hyal-1 Hyal-2, CD44 and breast cancer cell sion invasiveness (Tables 3 & 4). When examining the catabolic 0222 Quantitation of the RHAMM receptor did not potential of a breast cancer cell; the higher the CD44 and exhibit a strong correlation with any particular HAS isoform Hyal-2 expression, the greater the cells ability to degrade or the prevalent expression of hyaluronidase or cell inva large quantities of HA (Table 4).

TABLE 2 Gene Sense Primer Reverse Primer Hybridisation Probe HAS1 5' CCTGCATCAGCGGTCCCTA 3" 5' GCCGGTCA-TCCCCAAAAG 3' 5' AACCTCTTGCAGCAGTTTCTGAGGC (SEQ ID NO: 27) (SEQ ID NO:34) C 3' (SEQ ID NO: 41)

HAS2 5' CAGTCCTGGCTTCGAGCAG 3' 5' TTGGGAGAAAAGTCTTTGGCT 3' 5' CCATTGAACCAGAGACTTGAAACAG (SEQ ID NO: 28) (SEQ ID NO:35) CCC 3'; (SEQ ID NO: 42)

HAS3 5' TTGCACTGTGGTCGTCAACTT 3' 5' GTCGAGGTCAAACGTTGTGAG 3' 5' TCAAATCAAAAACAGGCAGGTACAG (SEQ ID NO : 29) (SEQ ID NO:36) GTAGTGG 3' (SEQ ID NO : 43)

GAPDH 5' AAGGTGAAGGTCGGAGTCAAC 3' 5' GAGTTAAAA-GCAGCCCTGGTG 3' 5' TTTGGTCGTATTGGGCGCCTGG 3' (SEQ ID NO:30) (SEQ ID NO:37) (SEQ ID NO:44) Hyal-1 5' GCACAGGGAAGTCACAGATGTATGTGC 3' 5" CCACTGGTCACGTTCAGGATGAAG-3' (SEQ ID NO. 31) (SEQ ID NO:38) Hyal-2 5' GATGTGTATCGCC-GGTTATCACGCC 3' 5' CGTAGACTGGGAGTGCATGGTTGGC 3'; (SEQ ID NO:32) (SEQ ID NO:39) Hyal-35' GCACTGATGGAGGATACGCTGCG 3' 5' GCTGGTGACTGCAGGCCATCGCTGC 3' (SEQ ID NO:33) (SEQ ID NO: 40)

0223)

TABLE 3

Hyaluronan Production Invasive Potential CD44 Hyaluronan Synthase Expression* (fg/cell/24 h)

(% of Expression HAS2 HAS3 Liberated Cell-associated

Breast Cancer migratory (densitometry EXP. PLAT. EXP. PLAT. EXP. PLAT. EXP. PLAT. Cell Line cells) unitsug protein) Phase Phase Phase Phase Phase Phase Phase Phase

MDA-MB-453 1 O O O 1 O 594 139 O 64 MDA-MB-361 2 O O O 1 O 255 46 O 8O MDA-MB-468 23 1.9 O O 3 O 616 O O 38 ZRL-75-1 26 O O O O.S O 637 627 O 26 T47D 26 O.1 O O 2 O 1523 O O 71 MCF-7A 31 O.1 O O 1 1 1623 313 O 64 MDA-MB-435 48 O.9 O O O.S O.S 376 92 O 44 MDA-MB-231 8O 1.1 14 16 1 1 6450 1137 250 351 BT-549 92 1.5 92 91 8 8 13087 5278 125 2793 HSS78T 1OO 3.6 208 205 O.2 O.2 12711 4567 52 102

*HAS expression as determined by real time RT-PCR where figures are expressed as the fold difference a percentage of the least invasive cell line MDA-MB 453 0 indicates where gene or hyaluronan was not detected US 2007/0286856 A1 Dec. 13, 2007

0224

TABLE 4 Invasive Potential CD44 Hyaluronidase Gene Expression* (% of Expression Hyal-1 Hyal-2 Hyal-3 Breast Cancer migratory (densitometry EXP, PLAT. EXP, PLAT. EXP, PLAT. Cell Line cells) units/ug protein) Phase Phase Phase Phase Phase Phase

MDA-ME-453 1 O 1 O 1 O 1 1 MDA-ME-361 2 O 1 O 1 O 5 2 MDA-ME-468 23 1.9 5 O 5 O 10 10 ZRL-75-1 28 O 10 O 11 O 14 O T47D 26 O.1 16 O 17 O 5 30 MCF-7A 31 O.1 5 O 5 O 25 5 MDA-ME-435 48 O.9 14 16 103 105 75 76 MDA-ME-231 8O 1.1 30 30 155 158 35 O BT-549 92 1.5 28 30 18O 192 5 O HSS78T 1OO 3.6 29 35 2O1 205 O O Hyaluronan Turnover (fg/cell/24 h)

Liberated Cell-associated

Breast Cancer EXP. PLAT. EXP. PLAT. Cell Line Phase Phase Phase Phase MDA-MB-453 594 (100%) 139 (100%) O 6 (9%) MDA-MB-361 255 (100%) 46 (100%) O 44 (55%) MDA-MB-468 616 (100%) O O 6 (16%) ZRL-75-1 594 (93%) 367 (59%) O 0.8 (3%) T47D 1308 (86%) O O 17 (24%) MCF-7A 1623 (100%) 313 (100%) O 35 (30%) MDA-MB-435 376 (100%) 92 (100%) O 19 (43%) MDA-MB-231 2020 (31%) 880 (77%) O 46 (13%) BT-549 1476 (11%) 914 (17%) 81 (49%) 1405 (50%) HSS78T 2990 (24%) 1756 (38%) 34 (65%) 41 (40%) * Hyal expression as determined by RT-PCR and digitisation of bands where figures fold difference in expression when compared to the least invasive cell line MDA-MB 453 0 indicates where gene or hyaluronan is not detected () Figures in brackets represent the % of HA which is degraded/cell/24h

0225)

TABLE 5

Invasive Characterisation of liberated HA Potential M, of HA (% of HAS Gene Hyal Gene degradation Breast Cancer migratory Expression Expression Modal M, products Cell Line cells) HAS2 HAS3 Hyal-1 Hyal-2 Hyal-3 (kDa) % of HA (kDa) % of HA

MDA-ME-453 1 O 1 1 1 1 1OOOO 100 25 67 70 11 800 3 3OOO 7 6000 12 MDA-ME3 231 8O 14 1 30 155 35 60 36 2O 37 2OO 36 40 41 600 to 10 OOO 28 500 22 BT-549 92 92 8 28 18O 5 10 OOO 100 10 66 2O 11 40 HSS78T 1OO 208 O.2 29 2O1 O 10 OOO 100 10 9 2O 28 40 41 US 2007/0286856 A1 Dec. 13, 2007 52

TABLE 5-continued Characterisation of cell-associated HA M, of HA degradation Breast Cancer Modal Mr products Cell Line (kDa) % of HA (kDa) % of HA

MDA-MB-453 60 23 10 22 1OO 24 2O 78 10 OOO 53 MDA-MB 231 2OO 39 2O 23 500 38 40 33 660 23 70 44 BT-549 2O 21 10 9 60 41 2O 26 10 OOO 38 40 46 60 8 10 OOO 100 10 27 2O 36 "HAS expression as determined by real time RT-PCR where figures are expressed as the fold difference a percentage of the least invasive cell line MDA-MB 453 Hyal expression as determined by RT-PCR and digitisation of bands where figures fold difference in expression when compared to the least invasive cell line MDA-MB 453

EXAMPLE 22 cells were selected in the presence of 500 ug/ml G418 antibiotic (Promega). Stable cell lines were established by Antisense-Medicated Suppression of Hyaluronan harvesting and pooling of antibiotic-resistant colonies. Con Synthase 2 Inhibits the Tumor Genesis and firmation of the stable incorporation of the antisense HAS2 Progression of Breast construct into the genome was performed using PCR on purified genomic DNA. In brief, a gene specific primer for Cell Culture. pC1-neo: 5'-GCACAGATGCGTAAGGAG-3 (SEQ ID 0226 Aneuploid human breast adenocarcinoma cell line NO:47) was used in combination with two specific HAS2 MDA-MB 231 (American Tissue Culture Collection, Rock primers of the following sequence: GSP2 sense 5'-GCTGT ville, Md., USA) was selected based on the expression of GTACATGACCTCGCGCTTGCCGCC-3' (SEQID NO:48) HAS2. Cells were propagated in monolayer culture in Lei and GSP4 sense, 5'-GGCGGGAAGTAAACTCGAC bovitz L-15 Medium (Sigma, St Louis, Mo., USA), supple 3'(SEQ ID NO:49). When used in the following combina mented with supplemented with 10% FCS, 100 units/ml tion; pCl-neo/GSP2 and pCl-neo/GSP4, expected size prod penicillin and 100 mg/ml Streptomycin. ucts of 1443 bp and 2223 bp were amplified respectively. The products of PCR were identified by restriction endonu Construction of Antisense Expression Vector. clease mapping and automated sequencing. 0227. The cDNA open reading frame for human HAS2 was generated by designing gene specific primers from the Quantification of mRNA for HAS1, 2 and 3. published sequence of Watanabe and Yamaguchi and con 0229 Real time PCR using gene specific primers and an sisted of the following primers: sense, 5'-GAGCTGAA internal oligonucleotide probe was used to quantitate the CAAGATGCATTGTGAGAGC-3' (SEQ ID NO:45) and relative mRNA levels of HAS1, HAS2, and HAS3 in antisense, 5'-GACATGGTGCTTGATGTATGATCTTC parental, mock and ASHAS2 transfected cells (Table 2). In CAT-3' (SEQ ID NO:46). Total RNA harvested from expo brief, total RNA was purified from exponentially growing nentially dividing human dermal fibroblasts was used as the cells using TRI-reagent (Sigma). The total RNA was used to template for RT-PCR, generating a 1.7 kb cDNA fragment of generate single stranded cDNA by incubating 2 ug RNA HAS52, which was cloned directly into pGEM-T vector with 0.5 ug/ul random primers and SuperScript reverse (Promega, Madison, USA). The cDNA for HAS2 was sub trancriptase (Invitrogen, Carlsbad, Calif., USA). For quan sequently subcloned into the pCl-neo expression vector titative real time PCR gene specific primers for each HAS (Promega) and isolated clones containing the insert in the isoform and an internal oligonucleotide probe were used. antisense orientation (ASHAS2 construct) were identified For HAS internal probes the reporter dye 6-carboxylfluo by restriction endonuclease mapping and automated rescein (6-FAM) and quencher 6-carboxytetramethyl sequencing. rhodamine (TAMRA) was labelled at the 5' and 3' respec tively. For GAPDH internal probes the reporter 6-FAM was Transfection and Validation of MDA-MB 231 Human substituted with VICTM (Applied Biosystems, Foster City, Breast Cancer Cells with ASHAS2 and Mock Constructs. Calif., USA). The PCR reaction was performed in a final 0228. The ASHAS2-pCl-Neo construct and mock control Volume of 30 ul and consisted of 1xTaqman reaction mix, 6 (pCl-neo vector without insert) were transfected into human uM of HAS forward and reverse primer, 1.5 uM of probe, 1 MDA-MB 231 breast cancer cells using Lipofectamine plus uM of each GAPDH primer and 500 nM of GAPDH probe. reagent (Gibco Life Technologies, Melbourne, Victoria, PCR amplification was performed by denaturation for 10 Australia) according to the manufacturers instructions. For min at 95° C. followed by annealing for 2 min at 50° C. at least one month, prior to commencing studies, transfected followed by 40 cycles of 15 seconds at 95°C. and 1 min at US 2007/0286856 A1 Dec. 13, 2007

60° C. Thermocycling and fluorescence measurement were Cell Cycle Analysis by Flow Cytometry. performed in an ABI Prism 7700 sequence detection system (0233 The transfected and control cells were seeded at (Applied Biosystems). Relative quantitation was performed 2x10 cells/25 cm and grown with 2 mM thymidine until by normalizing threshold cycle (Ct) values of each sample 50% confluent. After reaching 50% confluence, cells were gene with Ct values of the GAPDH. ACt corresponds to the grown in thymidine-free culture medium. Cells were har difference between the Ct of the HAS genes of interest and vested, by trypsinisation at 0, 4, 8, 12, 16, 20, 24, 28, 32, and the Ct of the GAPDH. Data are presented as fold-change 36 h followed by fixation in 95% ethanol for 2 h at 4° C. difference relative to parental (arbitrarily set to 100) calcu Cells were pre-treated with RNAase (100 ug/ml) (Sigma) lated according 9 the formula describing relative PCR and 50 lug/ml propidium iodide (Sigma) for 30 min at 37°C. quantitation 2-A"A" before determining the stage of cell cycle stage using a FACS-CaliburTM analytical instrument (Becton Dickinson, Characterization of Hyaluronidase Gene Expression. San Jose, Calif., USA). 0230. To determine the hyaluronidase gene expression 0234 Cell migration assay. Invasion assays were per for HYAL1, 2 and 3, RT-PCR was performed on total RNA formed using modified Boyden chambers with polycarbon extracted from cells in both the exponential and growth ate Nucleopore membranes (Corning, Corning, N.Y., USA). arrested phases. The gene specific primer sets were designed Pre-coated filters (6.5 mm in diameter, 12 um pore-size, from sequences retrieved from GenBank (refer Table 2). Matrigel 100 ug/cm) were rehydrated with 100 ul of Amplified sequences were visualised by agarose gel elec Leibovitz L-15 media supplemented with 0.1% w/v. BSA trophoresis containing ethidium bromide and their identity (Sigma). Exponentially growing cells were harvested with confirmed by automated DNA sequencing. To quantitate the trypsin/EDTA (Sigma). Before addition to the top chamber relative abundance of each PCR product, ethidium bromide of the Boyden apparatus, 3x10 cells/1 ml chamber were stained agarose gels containing amplified fragments were washed twice with serum-free growth medium containing subjected to densitometric analysis using ProXpressTM 0.1% w/v. BSA. Normal growth media containing 10% V/v Imager (Perkin Elmer, Boston, Mass., USA) and the data FCS was used as the chemo attractant. After incubation for analysed using Phoretix 1D software (Phoretic International, 6 h at 37° C., non-invaded cells on the upper surface of the Newcastle, UK). filter were wiped with a cotton Swab, and migrated cells on Cell Proliferation Assay. the lower surface of the filter were fixed and stained with Diff-Quick kit. Invasiveness was determined by counting 0231 Exponentially growing, parental, mock and cells in five microscopic fields per well, and the extent of ASHAS2 transfectants were plated into 24-well plates (2.5 invasion was expressed as an average number of cells per cm/well) at cell densities, ranging from 5x10 to 9x10' microscopic field. Each experiment was performed in trip cells/well. The effect of HAS2 inhibition on cell prolifera licate on two separate days where data is represented as % tion was studied for 24, 48, 72, 96, 120 and 144 h. After the of migrating cells compared to the parental cell line. defined growth period, cells were detached using 0.25% w/v. trypsin and cell number determined using a Coulter counter Particle Exclusion Assay and Cell Morphology. (Beckman, Coulter, Australia). 0235. The HA-dependent pericellular matrix was visua lised aroundbreast cancer cells from control and transfected Immunohistochemical Identification of Hyaluronan Syn cultures by the exclusion of fixed human erythrocytes as thase, Hyaluronidases and CD44 previously described by Clarris and Fraser. Morphological 0232) The comparative effect of HAS2 inhibition on the differences as well as the particle exclusion assay in the expression of HA synthase, hyaluronidase and HA receptors control and transfected MDA-MB 231 cells were photo was performed on parental, mock and ASHAS2 transfected graphed on a Nikon Optiflot inverted phase contrast micro MDA-MB 231 cells. Eight-well chamber slides were plated scope (Nikon) 24 and 60 h after plating. at a density of 2x10 cells/well and cells were attached for 24 h. Cells were fixed in Histochoice (Sigma) for 15 min Quantitation of Liberated HA. then washed 3x5 min in PBS. Heterophile proteins were 0236 Triplicate cultures of parental, mock transfected blocked by incubation with 10% FCS for 10 min, followed and ASHAS2 human breast cancer MDA-MB 231 cells were by a PBS rinse. The antisera or antibodies were against seeded at 2.5x10 cells/25 cm and incubated for 24, 48,72, CD44H (DAKO, Copenhagen, Denmark) HYAL1, HYAL2, 96, 120 and 144 h. At the conclusion of the incubation (kindly donated by R. Stern, University of San Francisco, period, cells were harvested by trypsinisation and counted USA), HAS2 (kindly donated by P. Heldin, Ludwig Institute using a Coulter counter. Media was used for quantitation of for Cancer Research, Uppsala, Sweden) were diluted in PBS liberated HA. The liberated HA was quantitated using an containing 1% human serum/1% FCS where detection anti enzyme-linked HA binding protein assay (HABP) (Corgenix bodies were applied for 60 min at 25° C. Endogenous Inc., Westminster, Colo., USA). The assay was performed peroxidase activity was blocked by immersion in 0.3% according to the manufacturers instructions. In brief dupli HO, in methanol for 20 min. Following an additional PBS cate 100 ul of samples and the HA standards (0.50, 100, 200, wash, Swine anti rabbit or rat anti mouse peroxidase-conju 500 and 800 ng/ml) were aliquoted into a 96 well plate gated secondary antiserum (DAKO) was applied for 60 min coated with HABP, and incubated at room temperature (RT) at RT, followed by 3x5 min washes in PBS. Epitope was for 60 min. Samples were washed four times with PBS. One visualised with Sigma Fast DAB (3,3'-diaminobenzidine, hundred ul of HABP conjugated to horse-radish peroxidase Sigma) after application for 5-10 min at RT. Slides were was added and incubated at RT for 30 min. After additional washed in tap water for 10 min, counterstained with hae PBS washes, the reaction was visualised with 100 ul of matoxylin, dehydrated and mounted. 3.3',5,5'-tetramethylbenzidine (TMB) after a 30 min, RT US 2007/0286856 A1 Dec. 13, 2007 54 incubation. The reaction was stopped with 100 ul of 0.36N (50 mg/kg) and xylazine (5 mg/kg). The MDA-MB 231 cells sulphuric acid and read at 450 nm (650 nm reference) in a Were prepared as previously described and resuspended to BioRad 350 microplate reader. Growth media which had not 1x10 cells/0.1 ml. The cell suspension was drawn into a 1 been exposed to cells was used to determine the endogenous ml syringe fitted with a 25-gauge needle and 0.1 ml injected HA levels. Endogenous HA levels were subtracted from all into the left ventrical. Mice were laid on a heated pad for HA estimation results. recovery before returning to the cages. Periodically, radio Characterization of Hyaluronan Molecular Weight Using graphic analysis for bone osteolysis was performed. For this, Size Exclusion Chromatography. mice were anaesthetised (as previously described) and 0237 Cells were seeded at 7.5x10 cells/75 cm culture X-rayed in a prone position against the X-Omat film (East flask and were grown for 24 h in growth media containing man Kodak Co., Rochester, N.Y., USA) and exposed with 250 uCi D-6-Hlglucosamine hydrochloride (Perkin X-rays of 35 kV for 30 sec using a Cabinet X-ray system Elmer). At the conclusion of the 24h incubation period, the Faxitron Series, Hewlett-Packard Co. (Model MX20 with a media was removed and exhaustively dialysed (M, exclu 20 um focal source: Faxitron X-ray Corp., Illinois, USA). sion of 6 kDa) against 10 mM Tris-HCl/0.15M sodium Animal health and survival rate was observed until their chloride/0.02% sodium azide pH 7.4 at 4°C. The dialysate euthanasia due to one of the following medical reasons; and dialysis fluid were chromatographically analysed for the severe weights lose, hyperventilation, paralysis, or bone identification of HHA and its degradation products. H fracture. Collected organs: liver, kidneys, brain and lungs HA of >5 kD was subjected to size exclusion chromatogra were removed and stored at -20° C. until Alu PCR analysis phy in a Sephacryl S-1000 gel eluted in 0.15M NaCl/ was performed. To determine the median survival time a phosphate pH 7.25 which contained 19 mM NaH2PO 38 Survival curve was plotted using Prism stats program mM NaHPO and 94 mM NaCl at 13.6 ml/h. The dialysis (Kaplan-Meier Survival) with the days elapsed following fluid (molecules <5 kDa) was subjected to size exclusion intracardiac inoculations. P value was calculated for the chromatography in a Superose 12 gel eluted in the above comparison of the Survival curves. mentioned buffer at an elution rate of 20 ml/h. Molecular weight estimations were calculated using calibration data for Alu PCR Quantification of Metastasis. HA in Sephacryl S-1000 and Superose 12, where data was generated from varying MW of HA ranging from 800 Da to 0240 Quantitative Alu PCR was used to detect metastasis 10,000 kDa (CPN, Czech Republic and Pharmacia). To of MDA-MB 231 from the primary tumour to secondary ensure that the D-6-Hlglucosamine hydrochloride was organs. In brief, DNA was extracted by grinding samples used as a sole precursor for HA production, the non under liquid nitrogen and resuspending in a DNA lysis dialysable (molecules >5 kDa) Dpm was subjected to diges buffer (100 mM NaCl, 20 mM Tris-HCl pH 8.0, 20 mM tion by 10 TRU of Streptomyces hyaluronidase (Calbio EDTA pH 8.0, 0.4% (v/v) SDS). DNA was purified using chem, Germany) at pH 6, 37° C. for 24 h. Digested material phenol-chloroform methodology followed by ethanol pre was subjected to chromatography in both Sephacryl S-1000 cipitation and reconstitution in TE buffer. The purified DNA and Superose 12 where profiles were compared to equivalent was adjusted to a final concentration of 10 ng/ul in TE buffer undigested samples. pH7.2, aliquoted and stored at -20° C. until analysis. To remove exogenous human DNA contamination the reaction Generation of Mammary Fat Subcutaneous Tumours. mix, prior to addition of primers, was treated with 17 U/ml 0238 Animal studies were conducted with full ethical nuclease S7 (Roche Diagnostics, Germany) in the presence approval from the relevant institutional ethics committee, of 1 mM CaCl at 37° C. for 24 h prior to PCR. Nuclease S7 and in accordance with the Australian National Health and was then inactivated at 90° C. for 30 min following the Medical Research Councils guidelines for the care and use addition of 4 mM EGTA. Quantitative Alu PCR was then of laboratory animals. Five-week-old CBA nude mice performed on purified genomic DNA samples (10 ng) in a (Walter and Eliza Hall, Melbourne, Victoria, Australia) were Gene Amp 5700 Sequence Detection System (Applied Bio randomly divided into three groups (n=11/group) for the systems). Each sample was tested in duplicate in a final generation of parental, mock and ASHAS2 tumours. Cells reaction volume of 25 ul consisting of 0.625 U Taq DNA were harvested in the logarithmic growth phase by Scraping, polymerase (Roche: Mannheim, Germany), 10 mM Tris resuspended to a final density of 2x10 cells in L-15 medium HCl pH 8.3, 1.5 mM MgCl, 50 mM KC1, 200 uM dNTPs, supplemented with 0.1% glucose +5 mg/ml Matrigel fol 8% DMSO, 1 lug/ml 6-carboxy-X-rhodamine (Molecular lowed by immediate injected into the mammary fat. Tumour Probes; Eugene, Oreg. USA), 1 in 40000 dilution of SYBR growth was recorded twice weekly by measuring three Green I (Molecular Probes) and 100 nM of each Alu primer perpendicular diameters (d1,d2, d3). Tumour volume was (Alu sense 5'-GTGAAACCCCGTCTCTACTAAAAATA then calculated using the formula: (1/6)7L (d1 d2d3). On day CAAA-3' (SEQ ID NO:50); Alu antisence 5'-GC 84 after initiation of the tumours mice were humanely killed. GATCTCGGCTCACTGCAA-3' (SEQID NO:51). Follow The liver, kidneys, brain and lungs removed at autopsy and ing initial denaturation incubation at 95° C. for 2 min, stored at -20°C. until Alu PCR analysis was performed. For amplification occurred over 40 cycles, which consisted of pathological assessment half of the primary tumour was denaturation at 95°C. for 5 seconds, annealing at 65° C. for fixed in 4% formaldehyde and embedded in paraffin, 5 um 60 seconds, and extension at 75° C. for 15 seconds during sections were examined after hematoxylin and eosin stain which the intensity of fluorescence was measured. A disso 1ng. ciation curve was then generated from 60° C. to 95°C. On each 96-well reaction plate, a standard curve was prepared Intracardiac Inoculation of Breast Cancer Cells. by serially diluting human DNA into mouse DNA that 0239 Before intracardiac tumour inoculation mice were permitted the quantification of the tissue burden of human anaesthetised with an intraperitoneal mixture of ketamine tumour cells in the mouse organs removed at autopsy. US 2007/0286856 A1 Dec. 13, 2007

Conformation of Antisense HAS2 Stable Transfection in The staining for CD44 in both controls was most evident in MDA-MB 231 Cells the plasma membrane with areas of intense focal membrane 0241 Incorporation of the antisense HAS2-pCl-neo con staining. struct into the genome of MDA-MB 231 was confirmed by Antisense Inhibition of HAS2 Alters Hyaluronan Metabo PCR analysis of highly purified genomic DNA extracted lism from transfected cells. When used in the following combi nation; pCl-neo/GSP2 and pCl-neo/GSP4 expected size 0245. Due to the altered HAS and HYAL expression in products of 1443 bp and 2223 bp were reproducibly ampli ASHAS2 MDA-MB 231 transfectants the amount of liber fied from stable clones harbouring the antisense HAS2 ated HA was quantitated. ASHAS2 MDA-MB 231 transfec construct. Genomic DNA isolated from parental and mock tants liberated significantly greater quantities of HA when transfected tested negative. compared with either the parental cell line or mock trans fectants (FIG. 13). Over the duration of the experiment, Transfection of MDA-MB 231 Breast Cancer Cells with ASHAS2 cultures synthesised an average of 6.94 pg Antisense HAS2 Reduces HAS mRNA and Totally Inhibits HA/cell/day with one noticeable exception at 24 h after the Expression of the HAS2 Protein plating, where synthesis was increased to approximately 0242 Endogenous levels of mRNA for HAS2 in parental 15.4 pg/cell/day, in contrast to parental and mock transfec cells were quantitated using real time RT-PCR and compared tants that synthesised approximately 2 and 1.6 pgHA/cell/ with the values obtained from mock and antisense HAS2 day, respectively. transfectants. Concomitant to these experiments, HAS1 and Antisense Inhibition of HAS2 Did not Affect Cell-Associ HAS3 mRNA levels were also quantitated using real time ated Hyaluronan PCR with HYAL1, 2 and 3 expression characterised by standard RT-PCR methodology. To allow comparison of real 0246 The exclusion of fixed erythrocytes was used to time HAS expression between transfected and parental cells indirectly visualise the HA pericellular matrix. When com the level of each mRNA quantitated was normalised with pared with parental and mock transfectants, the inhibition of respective to their internal GAPDH controls. When com HAS2 did not result in any gross difference in the thickness paring the endogenous level of HAS2 mRNA expression in of the HA pericellular matrix and subsequent cell-associated parental cells and transfectants, there were no observed HA. differences between the parental and mock-transfected cell Modulation of HAS2 Expression Alters the Molecular lines. In contrast, mRNA expression in ASHAS2 stable Weight of Hyaluronan Produced by MDA-MB 231 Breast transfected cells was decreased by 50% when compared Cancer Cells with parental and mock transfectants respectively (p=0.008) (FIG. 10A). Moderate HAS3 expression was also detected 0247 Media removed from the ASHAS2 MDA-MB 231 and was comparable in parental, mock and antisense trans transfectants was highly viscous when compared to control fected cells, where HAS1 could not be detected in any of the cell lines. Digestion of the media with Streptomyces hyalu treatment groups (data not shown). Immunohistochemical ronidase demonstrated that >98% the H glucosamine had detection of HAS2 with isoform-specific monoclonal anti been incorporated into H HA, with the remaining 2% of body demonstrated that stable transfection with ASHAS2 Hdpm was associated with Pronase digestible macromol resulted in the effective blocking of translation of the HAS2 ecules of -50 kDa. All figures represent data where this protein (FIG. 10B). Whereas both parental and mock trans reactivity been removed. The MW of HA synthesised by fected cells exhibited a high degree of HAS2 expression as parental, mock and antisense transfected cells was deter indicated by positive epitope staining (FIG. 10C). mined by Sephacryl S-1000 size exclusion chromatography. The parental cell line synthesised three distinct MW of HA Inhibition of HAS2 Alters Hyaluronidase Expression which were estimated to be 100, 400 and 3000 kDa poten 0243 Antisense inhibition of HAS2 significantly altered tially reflecting the synthetic products of the prevalently the expression of HYAL1, 2 and 3 (FIG. 11). HYAL3 could expressed HAS isoforms, HAS2 and 3 respectively (FIG. not be detected in either parental or mock transfectants, but 14). In contrast, antisense HAS2 transfectants synthesised the inhibition of HAS2 resulted in the expression of HYAL3 HA corresponding to a MW of >10,000 kDa where a minor (FIG. 11). Inhibition of HAS2 expression, however, resulted fraction (5.2%) corresponding to a molecular weight 100 in the down regulation of gene expression for HYAL2 kDa was also detected. mRNA to the point where it was not detectable even after 35 cycles of PCR. This observation is reinforced by the lack of HAS2 Inhibition Decreases Breast Cancer Cell Proliferation immunoreactivity of ASHAS2 MDA-MB 231 stable trans and Arrests the Cell Cycle in Go/G fectants with the HYAL2 antibody where staining localised 0248 Comparison of the effect of antisense inhibition of to the plasma membrane and also appeared as cytoplasmic HAS2 on cell proliferation and the progression of cell cycle vesicles. HYAL1 expression in antisense transfectants was during periods of active cell growth demonstrated that in moderately up regulated when compared with both parental both parental and mock-transfected cells, a doubling of cell and mock controls. These observations were consistent from number occurred every 24 h where plateau growth phase total RNA extracted from either sub-confluent or confluent was reached at 72 h (FIG. 15A). In ASHAS2 stable trans cultures. fectants the lack of a functional HAS2 altered cell prolif eration by exhibiting a lag period of approximately 24 h. CD44 was Down-Regulated by the Inhibition of HAS2 reaching growth arrest by 96 to 120 h (FIG. 15A). Con 0244. The expression of the HA receptor, CD44 was comitant to these observations flow cytometric analysis was down regulated in the ASHAS2 cells (FIG. 12A) when also performed on parental, mock and ASHAS2 transfec compared with parental and mock transfectants (FIG. 12B). tants to determine relative DNA content at defined time US 2007/0286856 A1 Dec. 13, 2007 56 points after plating at Sub-confluent densities. The percent synthesised by Solid phase amino acid synthesis and purified age of the ASHAS2 transfected cells in the cell cycle phases by reverse-phase high-pressure chromatography. The pep Go/G, S and G/M20 h after plating were 79%, 4% and 5% tides were determined to be 99.9% pure as shown by mass as seen FIGS. 15B, C and D respectively. In contrast the spectrometry. The production, purification, conjugation to corresponding figures in the parental cell line for the cell diphtheria toxoid (DT), and purity testing of the peptides cycle phases, G/G, S and G/M were approximately 10%, were performed by Chiron Mimitopes (Melbourne, Austra 84% and 13% respectively (FIGS. 15B, C and D). Mock lia). The sequence of each immunising peptide is shown in transfectants were comparable to the parental cell line. In Table 7. contrast, antisense inhibition of HAS2 caused a transient delay (approximately 24 h) of entry into S phase (FIG.15C). TABLE 7 These results are consistent with the observation in the 24h lag period in growth rate observed in the proliferation assay. Characteristics of the immunising peptides used to raise polyclonal antibodies to HA Suppression of HAS2 Reduces the Migration of Human synthase: Breast Cancer Hypothesised 0249 Migration of the breast cancer cells was amelio species cross rated by the inhibition of HAS2 as indicated by the inability Immunising reactivity of the ASHAS2 transfectants to migrate across a Matrigel peplide Amino acid sequence mouse human membrane (FIG.16). Comparison of cellular migratory rates demonstrated that both the parental and mock transfectants HAS 418 AARGPLDAATCRALLYPRARW -We --we displayed typical invasive phenotypes with 100% of the cell (SEQ ID NO: 24) populations permeating the Matrigel, in contrast, only 7% of 49->58 Cys 94->103 the HAS2 stable transfectants maintained the ability to HAS419 GGLWRSWAHEA -We --we (SEQ IDNO: 25) invade the Matrigel membrane. 480-> 490 HAS2 Inhibition Totally Inhibits the Initiation and Progres sion of Primary Breast Cancer in Vivo HAS 421 GAYREWEAEDPGRLAWE --we --we (SEQ ID NO: 26) 0250 Mice intradermally inoculated with parental or 14.6->162 mock-transfected MDA-MB 231 readily established pri mary tumours that were comparable in growth over the duration of the 12-week experiment (FIG. 17A). In contrast, 0253 HAS immunising peptides 418 and 419 were however, mice inoculated with ASHAS2 transfectants did selected on areas of heterogeneity between species indicat not establish primary tumours (FIG. 17A). To ensure that the ing that they would be human-specific, while HAS421 was lack of tumour growth was not a result of a poor cell viability homologous to both mouse and human. of the cell inoculum, in one set of experiments, Matrigel was also included in the inoculation medium. Again, no primary 0254 Border Leicester Merino cross-bred sheep were tumour could be detected over the duration of the 12-week injected intramuscularly at two sites with the peptides (0.2- experiment. When quantitating the spread of the primary 0.5 mg) dissolved in complete Freund's adjuvant and again cancer, the highly sensitive Alu PCR assay demonstrated two weeks later in incomplete Freud’s adjuvant. At day 35, that metastasis in animals inoculated with parental and the sheep were bled, and the serum separated by centrifu mock-transfected was most prevalent in brain and lung, but gation, and stored at -20°C. All serum collected was tested was also detected in kidneys and liver transfectants. Mice with an enzyme-linked immunosorbent assay for antibodies injected with MDA-MB 231 ASHAS2 did not exhibit specific for the peptide and carrier protein. The immunising metastasis to any organs (FIG. 17B). peptide was coupled to thiopropyl-Sepharose 6B gel (Amer sham Pharmacia Biotech, Uppsala, Sweden) by cyanogen Modulation of HAS2 Inhibited the Formation of Secondary bromide activation and the specific antibodies were Tumours and Increased Animal Survival extracted from the polyclonal sheep HAS antiserum by 0251 When quantitating the metastasis of the breast affinity chromatography. In brief 5 mL of serum was mixed cancer after intracardiac inoculation, animals inoculated with 3 mL of PBS and mixed with affinity/ligand resin for 1 with parental and mock-transfected demonstrated prevalent hour at room temperature, followed by three washes of 5 mL spread of the cancer to the brain, liver, kidneys, lung and PBS. The antibodies were eluted in 0.1M glycine pH2.8 and bone while mice injected with MDA-MB 231 ASHAS2 did were immediately neutralised to pH7.2 by the addition of not exhibit metastasis to any organs (FIG. 18A). Bone O.1M NaOH. lesions were observed in several mice from the control 0255 HAS polyclonal antibodies were then concentrated groups while ASHAS2 inoculated mice did not present with in an Amicon cell concentrator fitted with a YM30 Diaflo any bone lesions. Mice inoculated with parental or mock filter. The protein concentration of each affinity purified transfected MDA-MB 231 cells demonstrated a significantly antibody was determined by the BCA assay (Pierce, U.S.A). shorter survival period, 72 days and 77 days when compared The sterility of the antibodies used in immunohistochemis to the ASHAS2 animals which had a mean survival time of try or immunoblotting was assured by the addition of 0.1% 124 days (p=0.0001) (FIG. 18B). w/v sodium azide, before storage at -20° C. in aliquots. EXAMPLE 23 Antibodies intended for addition to cell cultures was stored Production of HAS Antiserum at -20° C. without azide. 0252) On the basis of the predicted amino acid sequence 0256 Those skilled in the art will appreciate that the for hHAS1, three shortantigenic peptides were designed and invention described herein is susceptible to variations and US 2007/0286856 A1 Dec. 13, 2007 57 modifications other than those specifically described. It is to 0284 Itano et al., Cancer Res. 59, 2499-2504, 1999 be understood that the invention includes all such variations and modifications. The invention also includes al steps, 0285 Itano et al., Proc. Natl. Acad. Sci. 99,3609-3614, features, compositions and compounds referred to or indi 2002 cated in this specification individually or collectively, and 0286 Johnson et al., “Peptide Turn Mimetics” in Bio any and all combinations of any two or more steps or technology and Pharmacy features. 0287 Jones et al., Nature 321:522-525, 1986 BIBLIOGRAPHY 0288 Jungblut et al., Electrophoresis: 20, 2100-2110, 0257 Altschul et al., J. Mol. Biol. 215, 430-410, 1990 1999 0258 Antibodies: A Laboratory Manual, Harlow and 0289 Jurecic and Belmont, Curr. Opin. Microbiol. 3, Lane (eds.), Cold Spring Harbor Laboratory Press, Cold 3.16-321, 2000 Spring Harbor, N.Y., (1988) 0290 Kabat et al. in Sequences of Proteins of Immuno 0259 Banerji et al., J. Cell Biol. 144, 789-801, 1999 logical Interest, 5th Ed., US Dept. of Health and Human Services, PHS, NIH, NIH Publication No. 91-3242, 1991 0260 Bird, Science 242: 423, 1988 0291 Kennet et al. (eds.), Monoclonal Antibodies, 0261 Bourguignon et al., Biol. Chem. 272, 27913 Hybridomas: A New Dimension in Biological Analyses, 27918, 1997 Kennet et al. (eds.), Plenum Press, New York (1980); and 0262 Brazma and Vilo, FEBS Lett. 480, 17-24, 2000 Antibodies: A Laboratory Manual, Harlow and Lane (eds.), Cold Spring Harbor Laboratory Press, Cold Spring 0263 Camenisch et al., J. Clin. Invest. 106, 349-360, Harbor, N.Y., (1988). 2OOO 0292 Knudson and Knudson, FASEB. 7: pp. 1233-1241, 0264 Caulli et al., J. Cell Biochem. Suppl.: 31, 286-296. 1993 1998 0293 Knudson and Knudson, The hyaluronan receptor, 0265 Celis et al., FEBS Lett. 480, 2-16, 2000 CD44, 1999 0266 Clackson et al., Nature 352:624–628, 1991 0294 Knudson et al., The role and regulation of tumor 0267 Clarris et al. On the pericellular Zone of some associated hyaluronan. In: The Biology of Hyaluronan. mammalian cells in vitro. Exp Cell Res 49:181-193, 1968 (Editors. Evered, D. & Whelan, J) Ciba foundation sym posium 143.J Wiley and Sons, Chichester: pp. 150-169, 0268 Csoka et al., The six hyaluronidase-like genes in 1989 the human and mouse genomes. Matrix Biol 20: 499-508. 2001 0295) Kohler et al., Nature 256:495 (1975) 0269 Culty et al., J. Cell Physiol. 160,275-286, 1994 0296) Kojima et al., Cancer Res. 35, 542-547, 1975 0270) Elbashir et al., Nature: 411, 494-498, 2001 0297) Kortt et al., Protein Engineering 10: 423, 1997 0271) Elbashire et al., Genes Dev. 15, 188-120, 2001 0298) Kosaki et al., Cancer Res. 59, 1141-1145, 1999 0272 Entwistle et al., J. Cell. Biochem. 61, 569-577, 0299) Larricket al., Bio/Technology 7: 934, 1989 1996 0300 Larson et al., Cytometry: 41, 203-208, 2000 0273) Erickson et al., Science 249: 527-533, 1990 0301) Larsson et al., J. Biotechnol. 80, 143-157, 2000 0274) Fire et al., Nature. 391, 806-811, 1998 0302) Laurent and Fraser, Hval. FASEB.J. 6, 2397-2404, 0275 Fries et al., Virchows. Archiv. 424: 7-12, 1994 1992 0276 Fuchs et al., Anal. Biochem. 286, 91-98, 2000 0303 Laurent and Killander, J. Chromatogr. 14, pp. 317-330, 1964 0277 Going and Gusterson, Eur: J. Cancer. 35, 1895 1904, 1999 0304) Liu et al., Proc. Natl. Acad. Sci. USA 84: 3439, 1987 0278 Gunthert et al., Cell. 65, pp. 13-24, 1991 0305 Liu et al., Cancer Res. 61, 5207-5214, 2001 0279 Guo and Kempheus, Cell: 81, 611-620, 1995 Madden et al., Drug Disc. Today: 5, 415-423, 2000 0280 Hodgson (Bio/Technology 9: 19-21, 1991) 0306 0307 Marks et al., J. Mol. Biol. 222:581-597, 1991 0281 Huston et al., Proc. Natl. Acad. Sci. USA 85: 5879, 1988 0308) Mathew and Dorfman, Physiol. Rev. 35, 381-402, 1955 0282 Itano et al., Biochem. Biophys. Res. Comm. 222, 816-821, 1996 0309 McKee, et al., J. Biol. Chem. 272, 8013-8018, 1997 0283 Itano et al., Three isoforms of mammalian hyalu roman synthases have distinct enzymatic properties. J Biol 0310 Montgomery et al., Proc. Natl. Acad. Sci, USA: 95, Chem 274: 25085-25092, 1999 15502-15507, 1998 US 2007/0286856 A1 Dec. 13, 2007 58

0311) Morrison et al., Proc. Natl. Acad. Sci. USA 0334). Sy et al., J. Exp. Med. 174, pp. 859-866, 1991 81:6851-6855, 1984 0335 Tabara et al., Sci. 282, 430-431, 1998 0312 Munder et al. (Appl. Microbiol. Biotechnol. 52(3): 311-320, 1999 0336 Tester et al., Clin. & Exp. Metast.: 0, 1-7, 2002 0313 Ng and Schwartz, J. Biol. Chem. 264, 11776 0337 Thompson et al., J. Cell Physiol. 150, 534-544, 11783, 1989 1992 0314. Oksala et al., J. Histochem. Cytochem.: 43, 125 0338 Tijsterman et al., Science: 295, 694-697, 2002 135, 1995 0339 Timmons and Fire, Nature: 395, 854, 1998 0315 Pauli and Knudson, Human Path. 19, 628-639, Timmons et al., Gene: 263, 103-112, 2001 1988 0340 0341 Tool, B., Glycosaminogloans in morphogenesis. 0316 Pezzuto et al., Eds. Chapman and Hall, New York, In: Cell Biology of the extracellular matrix. (Editor. Hay, 1993 E. D.) Plenum Press, New York: pp. 259-294, 1981 0317 Philipson and Schwartz, J. Biol. Chem.: 259, pp. 0342 Toole, B. P. Current Opin. in Cell Biol. 2, 839 5017-5023, 1984 844, 1990 0318) Philipson et al., Biochem. 24, 7899-7906, 1985 0343 Toole, B. P. J. Inter. Med: 242, 35-40, 1997 0319 Prashar and Weissman, Meth-Enzymol. 303, 258 0344 Turley and Torrance, Exp. Cell. Res. 161, 17-28, 272, 1999 1985 0320 Prehm, P and Mausolf, Biochem. J. 235, 887-889, 1986 0345 Tuschl et al., Genes Dev. 13, 3191-3197, 1999 0321) Prehm, P. Biochem. J.: 220, pp. 597-600, 1984 0346 U.S. Pat. No. 4,816,567 0322 Prehm P. Release of hyaluronate from eukaryotic 0347 U.S. Pat. No. 4,946,778 cells. Biochem J 267: 185-189, 1990 0348 Udabage et al., Inhibition of hyaluronan degrada 0323 Presta, Curr: Op. Struct. Biol. 2:593-596, 1992 tion by dextran sulphate facilitates characterisation of hyaluronan synthesis: an in vitro and in Vivo study 0324 Reichmann et al., Nature 332:323-329, 1988 Glycoconjugate J (in Press), 2004 0325 Rilla et al., J. cell Sci. 115, 3633-3643, 2002 0349 Victor et al., J. Cancer. 82, 77-83, 1999 0326) Shyjan et al., J. Biol. Chem.: 271, pp. 23395 23399, 1996 0350 Ward et al., Nature 334: 544, 1989 0327 Simpson et al., American J. Path... 161, pp. 849 0351 Watanabe and Yamaguchi, J. Biol. Chem.: 271, 857, 2002 22945-22948, 1996 0328 Spicer and McDonald, J. Biol. Chem. 273, 1923 0352 Weissmann and Meyer, J. Am. Chem. Soc. 76, pp. 1932, 1998 1753, 1954 0329 Spicer and Nguyen, Biochem. Soc. Trans. 27. 0353 Wells, Methods Enzymol. 202: 2699-2705, 1991 109-115, 1999 0354) Winter and Harris, TIPS 14: 139, 1993 0330 Spicer et al., Genomics.: 41, 493-497, 1997 0355) Young et al., Nat. Biotechnol. 16(10): 946-950, 0331 Spicer et al., J. Biol. Chem. 272, 8957-8961, 1997 1998 0332 Stern R, Devising a pathway for hyaluronan 0356) Xing et al., Oral Diseases: 4, 241-247, 1998 catabolism: are we there yet? Glycobiology 13:105R 115R, 2003 0357 Zhang and Madden, Genome Res. 7,649-656, 1997 0333 Sutcliffe et al., Proc. Natl. Acad. Sci. USA.: 97. 1976-1981, 2000 0358) Zhang et al., Cancer Res. 55, 428-433, 1995

SEQUENCE LISTING

<160> NUMBER OF SEQ ID NOS : 51

<21 Oc SEQ ID NO 1 <211 LENGTH 27 <212> TYPE DNA <213> ORGANISM: Artificial Sequence <22O > FEATURE OTHER INFORMATION: Sense primer for human HAS2 US 2007/0286856 A1 Dec. 13, 2007 59

-continued

<400 SEQUENCE: 1 gagctgaaca agatgcattg tdagagc 27

<210> SEQ ID NO 2 &2 11s LENGTH 29 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: Antisense primer for human HAS2 <400 SEQUENCE: 2 gacatggtgc titgatgtatg atctitccat 29

<210> SEQ ID NO 3 &2 11s LENGTH 18 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: Primer for PCINed

<400 SEQUENCE: 3 gCacagatgc gta aggag 18

<210> SEQ ID NO 4 &2 11s LENGTH 29 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: Sense primer for GSP2 <400 SEQUENCE: 4 gctgttgtaca tacct cqcg cittgcc.gc.c 29

<210 SEQ ID NO 5 &2 11s LENGTH 19 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: Sense primer for GSP 4 <400 SEQUENCE: 5 ggcgggaagt aaactC gaC 19

<210> SEQ ID NO 6 &2 11s LENGTH 2.0 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: Sense primer for HAS1 <400 SEQUENCE: 6 cctgcatcag cqgtoctota 20

<210 SEQ ID NO 7 &2 11s LENGTH 18 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: Antiense primer for HAS1 <400 SEQUENCE: 7 gcc.ggtocatc cccaaaag 18 US 2007/0286856 A1 Dec. 13, 2007 60

-continued

<210 SEQ ID NO 8 &2 11s LENGTH 27 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: Sense primer for HAS2 <400 SEQUENCE: 8 aaccitcttgc agcagtttct to aggcc 27

<210 SEQ ID NO 9 &2 11s LENGTH 19 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: Sense primer for HAS2 <400 SEQUENCE: 9 cagtcc togc titc gag cag 19

<210> SEQ ID NO 10 <211& LENGTH 21 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: Antisense primer for HAS2 <400 SEQUENCE: 10 ttgg gaga aa agtc.tttggc t 21

<210> SEQ ID NO 11 &2 11s LENGTH 2.8 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: Sense primer for HAS2 <400 SEQUENCE: 11 ccattgaacc agagacittga aac agccc 28

<210> SEQ ID NO 12 <211& LENGTH 21 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: Sense primer for HAS3 <400 SEQUENCE: 12 ttgcactgtg gtcgtoaact t 21

<210> SEQ ID NO 13 <211& LENGTH 21 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: Antisense primer for HAS3 <400 SEQUENCE: 13 gtogaggtoa aac gttgttga g 21

<210> SEQ ID NO 14 &2 11s LENGTH 32 US 2007/0286856 A1 Dec. 13, 2007 61

-continued

&212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: Sense primer for HAS3 <400 SEQUENCE: 14 toaaatcaaa aac agg cagg tacagg tagt gg 32

<210 SEQ ID NO 15 <211& LENGTH 21 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OOTHER INFORMATION: Sense primer for GAPDH <400 SEQUENCE: 15 alaggtgaagg toggagtcaa C 21

<210> SEQ ID NO 16 <211& LENGTH 21 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: Antisense primer for GAPDH <400 SEQUENCE: 16 gagittaaaag cagocctggt g 21

<210 SEQ ID NO 17 <211& LENGTH 22 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: Sense primer for GAPDH <400 SEQUENCE: 17 tittggtogta ttggg.cgcct gg 22

<210> SEQ ID NO 18 &2 11s LENGTH 27 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: Sense primer for HYAL1 <400 SEQUENCE: 18 gcacagggaa gtcacagatg tatgtgc 27

<210 SEQ ID NO 19 <211& LENGTH 24 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: Antisense primer for HYAL1 <400 SEQUENCE: 19 ccactggtoa cqttcaggat gaag 24

<210> SEQ ID NO 20 &2 11s LENGTH 25 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: Sense primer for HYAL2 US 2007/0286856 A1 Dec. 13, 2007 62

-continued

<400 SEQUENCE: 20 gatgttgttatc gcc.ggittatc acgcc 25

<210> SEQ ID NO 21 &2 11s LENGTH 25 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: Antisense primer for HYAL2 <400 SEQUENCE: 21 Cgtag actgg gagtgcatgg ttggC 25

<210> SEQ ID NO 22 &2 11s LENGTH 23 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: Sense primer for HYAL3 <400 SEQUENCE: 22 gCactgatgg aggatacgct gcg 23

<210> SEQ ID NO 23 &2 11s LENGTH 25 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: Antisense primer for HYAL3 <400 SEQUENCE: 23 gctggtgact gcaggc catc gctgc 25

<210> SEQ ID NO 24 <211& LENGTH 21 &212> TYPE PRT <213> ORGANISM: human

<400 SEQUENCE: 24 Ala Ala Arg Gly Pro Leu Asp Ala Ala Thr Cys Arg Ala Lieu Lleu Tyr 1 5 10 15 Pro Arg Ala Arg Val 2O

<210> SEQ ID NO 25 <211& LENGTH: 11 &212> TYPE PRT <213> ORGANISM: human

<400 SEQUENCE: 25 Gly Gly Lieu Val Arg Ser Val Ala His Glu Ala 1 5 10

<210> SEQ ID NO 26 &2 11s LENGTH 17 &212> TYPE PRT <213> ORGANISM: human

<400 SEQUENCE: 26 Gly Ala Tyr Arg Glu Val Glu Ala Glu Asp Pro Gly Arg Lieu Ala Wal 1 5 10 15 US 2007/0286856 A1 Dec. 13, 2007 63

-continued

Glu

<210 SEQ ID NO 27 &2 11s LENGTH 2.0 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: Sense primer for HAS1 <400 SEQUENCE: 27 cctgcatcag cqgtoctota 20

<210> SEQ ID NO 28 &2 11s LENGTH 19 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: Sense primer for HAS2 <400 SEQUENCE: 28 cagtcc togc titc gag cag 19

<210 SEQ ID NO 29 <211& LENGTH 21 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: Sense primer for HAS3 <400 SEQUENCE: 29 ttgcactgtg gtcgtoaact t 21

<210 SEQ ID NO 30 <211& LENGTH 21 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: Sense primer GAPDH <400 SEQUENCE: 30 alaggtgaagg toggagtcaa C 21

<210> SEQ ID NO 31 &2 11s LENGTH 27 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: Sense primer for HYAL1 <400 SEQUENCE: 31 gcacagggaa gtcacagatg tatgtgc 27

<210> SEQ ID NO 32 &2 11s LENGTH 27 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: Sense primer for HYAL2 <400 SEQUENCE: 32 gcacagggaa gtcacagatg tatgtgc 27

<210 SEQ ID NO 33 US 2007/0286856 A1 Dec. 13, 2007 64

-continued

&2 11s LENGTH 27 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: Sense primer for HYAL3 <400 SEQUENCE: 33 gcacagggaa gtcacagatg tatgtgc 27

<210> SEQ ID NO 34 &2 11s LENGTH 18 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: Antisense primer for HAS1 <400 SEQUENCE: 34 gcc.ggtocatc cccaaaag 18

<210 SEQ ID NO 35 <211& LENGTH 21 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: Antisense primer for HAS2 <400 SEQUENCE: 35 ttgg gagaaa agtctttggC t 21

<210 SEQ ID NO 36 <211& LENGTH 21 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: Antisense primer for HAS3 <400 SEQUENCE: 36 gtogaggtoa aac gttgttga g 21

<210 SEQ ID NO 37 <211& LENGTH 21 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: Antisense primer for GAPDH <400 SEQUENCE: 37 gagittaaaag cagocctggt g 21

<210 SEQ ID NO 38 <211& LENGTH 24 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: Antisense primer for HYAL1 <400 SEQUENCE: 38 ccactggtoa cqttcaggat gaag 24

<210 SEQ ID NO 39 &2 11s LENGTH 25 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE US 2007/0286856 A1 Dec. 13, 2007 65

-continued <223> OTHER INFORMATION: Antisense primer for HYAL2 <400 SEQUENCE: 39

Cgtag actgg gagtgcatgg ttggC 25

<210> SEQ ID NO 40 &2 11s LENGTH 25 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: Antisense primer for HYAL3 <400 SEQUENCE: 40 gctggtgact gcaggc catc gctgc 25

<210> SEQ ID NO 41 &2 11s LENGTH 27 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: Hybridisation probe for HAS1 <400 SEQUENCE: 41 aaccitcttgc agcagtttct to aggcc 27

<210> SEQ ID NO 42 &2 11s LENGTH 2.8 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: Hybridisation probe for HAS2 <400 SEQUENCE: 42 ccattgaacc agagacittga aac agccc 28

<210> SEQ ID NO 43 &2 11s LENGTH 32 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: Hybridisation probe for HAS3 <400 SEQUENCE: 43 toaaatcaaa aac agg cagg tacagg tagt gg 32

<210> SEQ ID NO 44 <211& LENGTH 22 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: Hybridisation probe for GAPDH <400 SEQUENCE: 44 tittggtogta ttggg.cgcct gg 22

<210> SEQ ID NO 45 &2 11s LENGTH 27 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: Sense primer for HAS2 <400 SEQUENCE: 45 US 2007/0286856 A1 Dec. 13, 2007 66

-continued gagctgaaca agatgcattg tdagagc 27

<210> SEQ ID NO 46 &2 11s LENGTH 29 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: Antisense primer for HAS2 <400 SEQUENCE: 46 gacatggtgc titgatgtatg atctitccat 29

<210> SEQ ID NO 47 &2 11s LENGTH 18 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: Primer for pCL-neo <400 SEQUENCE: 47 gCacagatgc gta aggag 18

<210> SEQ ID NO 48 &2 11s LENGTH 29 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: GSP2 sense primer <400 SEQUENCE: 48 gctgttgtaca tacct cqcg cittgcc.gc.c 29

<210 SEQ ID NO 49 &2 11s LENGTH 19 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: GSP4 sense primer

<400 SEQUENCE: 49 ggcgggaagt aaactC gaC 19

<210 SEQ ID NO 50 &2 11s LENGTH 30 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: Alu sense primer

<400 SEQUENCE: 50 gtgaaaccoc gtc.tctacta aaaatacaaa 30

<210 SEQ ID NO 51 &2 11s LENGTH 2.0 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: Alu antisense primer

<400 SEQUENCE: 51 gc gatctogg citcactgcaa. 20 US 2007/0286856 A1 Dec. 13, 2007 67

1. An isolated compound which reduces the level of 13. The isolated compound of claim 12 wherein the hyaluronan synthase (HAS) activity wherein said compound interactive molecule is a monoclonal antibody or an antigen specifically targets an amino acid sequence selected from binding fragment thereof. SEQ ID NOS:24, 25 or 26 within an HAS or a sequence 14. The isolated compound of claim 1 or 2 wherein the containing one or more conservative amino acid substitu compound is a small molecule capable of interacting, bind tions of SEQ ID NOS:24, 25 or 26, or a nucleic acid ing or otherwise associating with HAS to reduce the activity molecule encoding SEQ, ID NOS:24, 25 or 26 or encoding or function of HAS. a sequence containing one or more conservative amino acid 15. The isolated compound of claim 1 or 2 when used in substitutions of SEQ ID NOS:24, 25 or 26. the treatment of cancer, a hyperproliferative condition or an 2. The isolated compound of claim 1 wherein the HAS is inflammatory condition. selected from HAS1, HAS2 and HAS3. 16. A pharmaceutical composition comprising a com 3. The isolated compound of claim 1 wherein the com pound of any one of claims 1 to 14 and or more pharma pound is a nucleic acid molecule. ceutically acceptable carriers and/or diluents. 4. The isolated compound of claim 3 wherein the nucleic 17. A method for the treatment or prophylaxis of a acid molecule is an anti-sense nucleic molecule. condition in a Subject, said method comprising administer 5. The isolated compound of claim 3 wherein the nucleic ing to said Subject, an effective amount of a compound acid molecule is a sense nucleic acid molecule. according to any one of claims 1 to 14 for reducing the level 6. The isolated compound of claim 1 or 2 or 3 wherein the and/or activity of HAS. nucleic acid molecule in an oligonucleotide or chemically 18. The method of claim 17 wherein the subject is a modified form thereof which is sense to the coding strand of human. an HAS-encoding nucleotide sequence. 19. The method of claim 17 or 18 wherein the condition 7. The isolated compound of claim 5 wherein the chemi is selected from A-Beta-Lipoproteinemia, A-V. A Beta-2- cally modified form comprises a chemically modified back Microglobulin Amyloidosis, A-T, A1 AD. A1AT, Aagenaes, bone or a non-natural internucleoside linkage. Aarskog syndrome, Aarskog-Scott Syndrome, Aase-Smith 8. The isolated compound of claim 6 wherein the modified syndrome, Aase Syndrome. AAT. Abderhalden-Kaufmann backbone is selected from phosphorothioates, chiral phos Lignac Syndrome, Abdominal Muscle Deficiency Syn phorothioates, phosphorodithioates, phosphotriesters, ami drome, Abdominal Wall Defect, Abdominal Epilepsy, noalkylphosphotriesters, methyl and other alkyl phospho Abdominal Migraine, Abductor Spasmodic Dysphonia, nates including 3'-alkylene phosphonates, 5'-alkylene Abductor Spastic Dysphonia, Abercrombie Syndrome, ble phosphonates and chiral phosphonates, phosphinates, phos pharon-Macrostomia Syndrome, ABS, Absence of HPRT, phoramidates including 3'-amino phosphoramidate and ami Absence of Corpus Callosum Schinzel Typ, Absence Defect noalkylphosphoramidates, thionophosphoramidates, thion of Limbs Scalp and Skull, Absence of Menstruation Primar, oalkylphosphonates, thionoalkylphosphotriesters, Absence of HGPRT, Absorptive Hyperoxaluriaor Enteric, Selenophosphates and boranophosphates having normal 3'-5' Abt-Letterer-Siwe Disease, ACADL, ACADM Deficiency, ACADM, ACADS, Acanthocytosis-Neurologic Disorder, linkages. 2'-5' linked analogs of these, and those having Acanthocytosis, Acantholysis Bullosa, Acanthosis Nigri inverted polarity wherein one or more internucleotide link cans, Acanthosis Bullosa, Acanthosis Nigricans With Insulin ages is a 3' to 3',5' to 5' or 2 to 2 linkage. Resistance Type A, Acanthosis Nigricans With Insulin 9. The isolated compound of claim 6 wherein the modified Resistance Type B, Acanthotic Nevus, Acatalasemia, Acata backbone comprises backbones that are formed by short lasia, ACC. Accessory Atrioventricular Pathways. Acces chain alkyl or cycloalkyl internucleoside linkages, mixed sory Atrioventricular Pathways, Acephaly, ACF with Car heteroatom and alkyl or cycloalkyl internucleoside linkages, diac Defects, Achalasia, Achard-Thiers Syndrome, or one or more short chain heteroatomic or heterocyclic ACHARD (Marfan variant), Achard's syndrome, Acholuric internucleoside linkages. Jaundice, Achondrogenesis, Achondrogenesis Type IV. 10. The isolated compound of claim 8 wherein the het Achondrogenesis Type III, Achondroplasia, Achondroplasia eratomic or heterocyclic internucleoside linkage is selected Tarda, Achondroplastic Dwarfism, Achoo Syndrome, Ach from those having morpholino linkages (formed in part from romat, Achromatope, Achromatopic, Achromatopsia, Ach the Sugar portion of a nucleoside); siloxane backbones; romic Nevi, Acid Ceramidase Deficiency, Acid Maltase sulfide, sulfoxide and sulfone backbones; formacetyl and Deficiency, Acid Maltase Deficiency, Acid Beta-glucosidase thioformacetyl backbones; methylene formacetyl and thio Deficiency, Acidemia Methylmalonic, Acidemia Propionic, formacetyl backbones; riboacetyl backbones; alkene con Acidemia with Episodic Ataxia and Weakness, Acidosis, taining backbones; Sulfamate backbones; methyleneimino Aclasis Tarsoepiphyseal, ACM, Acoustic Neurilemoma, and methylenehydrazino backbones; Sulfonate and Sulfona Acoustic Neuroma, ACPS with Leg Hypoplasia, ACPS II, mide backbones; amide backbones; and others having mixed ACPS IV, ACPS III, Acquired Aphasia with Convulsive N, O, S and CH component parts. Disorder. Acquired Brown Syndrome. Acquired Epileptic 11. The isolated compound of claim 1 or 2 wherein the Aphasia, Acquired Factor XIII Deficiency, Acquired Form compound is an interactive molecule capable of binding or of ACC (caused by infection while still in womb). Acquired otherwise associating with HAS to reduce HAS function or Hyperoxaluria, Acquired Hypogammaglobulinemia, activity. Acquired Immunodeficiency Syndrome (AIDS), Acquired 12. The isolated compound of claim 11 wherein the Iron Overload, Acquired Lipodystrophy, Acquired Partial interactive molecule is an antibody selected form a mono Lipodystrophy, Acquired Wandering Spleen, ACR, Acral clonal antibody, polyclonal antibody, and antigen-binding Dysostosis with Facial and Genital Abnormalities, Acro fragment, a humanized antibody and a deimmunized anti Renal, Acrocallosal Syndrome Schinzel Type, Acrocepha body. losyndactyly, AcrocephaloSyndactyly Type I, Acrocephalo US 2007/0286856 A1 Dec. 13, 2007

Syndactyly Type I Subtype I, Acrocephalopolysyndactyly Anemia, Adult Polycystic Kidney Disease, Adult Onset Type II, Acrocephalopolysyndactyly Type III, Acrocepha Medullary Cystic Disease, Adynlosuccinate Lyase Defi lopolysyndactyly Type IV. Acrocephalosyndactyly V (ACS5 ciency. AE, AEC Syndrome, AFD, AFD, Afibrinogenemia, or ACS V) Subtype I, Acrocephaly Skull Asymmetry and African Siderosis, AGA, Aganglionic Megacolon, Age Mild Syndactyly, Acrocephaly, Acrochondrohyperplasia, Related Macular Degeneration, Agenesis of Commissura Acrodermatitis Enteropathica, Acrodysostosis, Acrodystro Magna Cerebri, Agenesis of Corpus Callosum, Agenesis of phic Neuropathy, Acrodystrophic Neuropathy, Acrofacial Corpus Callosum-Infantile Spasms-Ocular Anomalies, Dysostosis Nager Type, Acrofacial Dysostosis Nager Type, Agenesis of Corpus Callosum and Chorioretinal Abnormal Acrofacial Dysostosis Postaxial Type, Acrofacial Dysostosis ity, Agenesis of Corpus Callosum-Chorioretinitis Abnormal Type Genee-Wiedep, Acrogeria Familial, Acromegaly, ity, Aggressive mastocytosis, Agnosis Primary, AGR Triad, Acromelalgia Hereditary, Acromesomelic Dysplasia, AGU, Agyria, Agyria-pachygria-band spectrum, AHC, Acromesomelic Dwarfism, Acromicric Skeletal Dysplasia, AHD, AHDS, AHF Deficiency, AHG Deficiency, AHO, Acromicric Dysplasia, Acroosteolysis with Osteoporosis Ahumada Del Castillo, Aicardi Syndrome, Aicardi Syn and Changes in Skull and Mandible, Acroosteolysis, Acro drome, AIED, AIMP, AIP, AIS, AIS, Akinetic Seizure, paresthesia, ACS I, ACS Type II, ACS Type III, ACS, ACS3, ALA-D Porphyria, Alactasia, Alactasia, Alagile Syndrome, ACTH Deficiency, Action Myoclonus, Acute Brachial Neu Aland Island Eye Disease (X-Linked), Alaninuria, Albers ritis Syndrome, Acute Brachial Radiculitis Syndrome, Acute Schonberg Disease, Albinism, Albinism, Albinismus, Albi Cerebral Gaucher Disease, Acute Cholangitis, Acute Dis noidism, Albright Hereditary Osteodystrophy, Alcaptonuria, seminated Encephalomyeloradiculopathy, Acute Dissemi Alcaptonuria, Alcohol-Related Birth Defects, Alcoholic nated Histiocytosis-X, Acute Hemorrhagic Polioencephali Embryopathy, Ald, ALD, ALD, Aldosterone, Aldosteronism tis, Acute Idiopathic Polyneuritis, Acute Immune-Mediation With Normal Blood Pressure, Aldrich Syndrome, Alex Polyneuritis, Acute Infantile Pelizaeus-Merzbacher Brain ander's Disease, Alexanders Disease, Algodystrophy, Algo Sclerosis, Acute Intermittant Porphyria, Acute Porphyrias, neurodystrophy, Alkaptonuria, Alkaptonuric Ochronosis, Acute Sarcoidosis, Acute Shoulder Neuritis, Acute Toxic Alkyl DHAP synthase deficiency, Allan-Herndon-Dudley Epidermolysis, Acyl-CoA Dehydrogenase Deficiency Long Syndrome, Allan-Herndon Syndrome, Allan-Herndon-Dud Chain, Acyl-CoA Dehydrogenase Deficiency Short-Chain, ley Mental Retardation, Allergic Granulomatous Antitis, Acyl-CoA Dihydroxyacetone Acyltransferase, Acyl-coen Allergic Granulomatous Angiitis of Cronkhite-Canada, Alo Zyme A Oxidase Deficiency, ADA, ADA Deficiency, Adam bar Holoprosencephaly, Alopecia Areata, Alopecia Areata, Complex, Adamantiades-Behcet’s Syndrome, Adamanti Alopecia Celsi, Alopecia Cicatrisata, Alopecia Circum noma, Adams Oliver Syndrome, Adaptive Colitis, ADD scripta, Alopecia-Poliosis-Uveitis-Vitiligo-Deafness-Cuta combined type, ADD, Addison Disease with Cerebral Scle neous-Uveo-O, Alopecia Seminuniversalis, Alopecia Tota rosis. Addison's Anemia, Addison's Anemia, Addison's lis, Alopecia Universalis, Alpers Disease, Alpers Disease, Disease. Addison's Disease. Addison's Disease, Addison Alpers Diffuse Degeneration of Cerebral Gray Matter with Biermer Anemia, Addison-Biermer Anemia, Addison Hepatic Cirrhosis, Alpers Progressive Infantile Poliodystro Schilder Disease, Addisonian Pernicious Anemia, Addiso phy, Alpha-1-Antitrypsin Deficiency, Alpha-1 4 Glucosidase nian Pernicious Anemia, Adducted Thumbs-Mental Deficiency, Alpha-1 4 Glucosidase Deficiency, Alpha-Ga Retardation, Adductor Spasmodic Dysphonia, Adductor lactosidase A Deficiency, Alpha-Galactosidase B Deficiency, Spastic Dysphonia, Adenoma Associated Virilism of Older Alpha-1 4 Glucosidase Deficiency, Alpha High-Density Women, Adenomatosis of the Colon and Rectum, Adenoma Lipoprotein Deficiency, Alpha-L-Fucosidase Deficiency tous polyposis of the Colon, Adenomatous Polyposis Famil Fucosidosis Type 3, Alpha-GalNAc Deficiency Schindler ial, Adenosine Deaminase Deficiency, Adenosine Deami Type, Alpha-1 4 Glucosidase Deficiency, Alpha-L-Fucosi nase Deficiency, Adenylosuccinase deficiency, ADHD dase Deficiency Fucosidosis Type 3. Alphalipoproteinemia, predominantly hyperactive-impulsive type, ADHD pre Alpha Mannosidosis, Alpha-N-Acetylgalactosaminidase dominantly inattentive type, ADHD, Adhesive Arachnoidi Deficiency Schindler Type, Alpha-NAGADeficiency Schin tis, Adie Syndrome, Adie's Syndrome, Adie's Tonic Pupil, dler Type, Alpha-Neuraminidase Deficiency, Alpha-Thalas Adie's Pupil, Adipogenital Retinitis Pigmentosa Polydac semia/mental retardation syndrome non-deletion type, tyly, Adipogenital-Retinitis Pigmentosa Syndrome, Adiposa Alphalipoproteinemia, Alport Syndrome, ALS, Alstroems Dolorosa, Adiposis Dolorosa, Adiposogenital Dystrophy, Syndrome, Alstroem, Alstrom Syndrome. Alternating Adolescent Cystinosis, ADPKD, Adrenal Cortex Adenoma, Hemiplegia Syndrome. Alternating Hemiplegia of Child Adrenal Disease, Adrenal Hyperfunction resulting from hood, Alzheimer's Disease, Amaurotic Familial Idiocy, Pituitary ACTH Excess, Adrenal Hypoplasia, Adrenal Insuf Amaurotic Familial Idiocy, Amaurotic Familial Idiocy ficiency, Adrenal Neoplasm, Adrenal Virilism, Adrenal Vir Adult, Amaurotic Familial Infantile Idiocy, Amaurotic ilism, Adreno-Retinitis Pigmentosa-Polydactyly Syndrome, Familial Infantile Idiocy, Ambiguous Genitalia, AMC, Adrenocortical Insufficiency, Adrenocortical Hypofunction, AMD, Ameloblastoma, Amelogenesis Imperfecta, Amenor Adrenocorticotropic Hormone Deficiency Isolated, Adreno rhea-Galactorrhea Nonpuerperal, Amenorrhea-Galactor genital Syndrome, Adrenogenital Syndrome, Adrenoleukod rhea-FSH Decrease Syndrome, Amenorrhea, Amino Acid yStrophy, Adrenomyeloneuropathy, Adreno-Retinitis Pig Disorders, Aminoaciduria-Osteomalacia-Hyperphospha mentosa-Polydactyly Syndrome, Adult Cystinosis, Adult turia Syndrome, AMN, AMN, Amniocentesis, Amniocente Dermatomyositis, Adult Hypophosphatasia, Adult Macula sis, Amniotic Bands, Amniotic Band Syndrome, Amniotic Lutea Retinae Degeneration, Adult Onset ALD, Adult-Onset Band Disruption Complex, Amniotic Band Sequence, Amni Ceroidosis, Adult Onset Medullary Cystic Disease. Adult otic Rupture Sequence, Amputation Congenital, AMS, Onset Pernicious Anemia, Adult Onset Pernicious Anemia, Amsterdam Dwarf Syndrome de Lange, Amylo-1 6-Glu Adult Onset Schindler Disease, Adult-Onset Subacute cosidase Deficiency, Amyloid Arthropathy of Chronic Necrotizing Encephalomyelopathy, Adult Onset Pernicious Hemodialysis, Amyloid Corneal Dystrophy, Amyloid Poly US 2007/0286856 A1 Dec. 13, 2007 69 neuropathy, Amyloidosis, Amyloidosis of Familial Mediter Argininosuccinic Acid Lyase-ASL, Argininosuccinic Acid ranean Fever, Amylopectinosis, Amyoplasia Congenita, Synthetase Deficiency, Argininosuccinic Aciduria, Argonz Amyotrophic Lateral Sclerosis, Amyotrophic Lateral Scle Del Castillo Syndrome, Arhinencephaly, Armenian Syn rosis, Amyotrophic Lateral Sclerosis-Polyglucosan Bodies, drome, Arnold-Chiari Malformation, Arnold-Chiari Syn AN, AN 1, AN 2, Anal Atresia, Anal Membrane, Anal Rectal drome, ARPKD, Arrhythmic Myoclonus, Arrhythmogenic Malformations, Anal Rectal Malformations, Anal Stenosis, Right Ventricular Dysplasia, Arteriohepatic Dysplasia, Arte Analine 60 Amyloidosis, Analphalipoproteinemia, Analrec riovenous Malformation, Arteriovenous Malformation, tal, Analrectal, Analrectal, Anaplastic Astrocytoma, Ander Arteriovenous Malformation of the Brain, Arteritis Giant sen Disease, Anderson-Fabry Disease, Andersen Glyco Cell, Arthritis, Arthritis Urethritica, Arthro-Dento-Osteod genosis, Anderson-Warburg Syndrome, Andre Syndrome, ysplasia, Arthro-Opthalmopathy, Arthrochalasis Multiplex Andre Syndrome Type II, Androgen Insensitivity, Androgen Congenita, Arthrogryposis Multiplex Congenita, Arthrogry Insensitivity Syndrome Partial, Androgen Insensitivity Syn posis Multiplex Congenita, Distal, Type IIA, ARVD, Aryl drome, Androgen Insensitivity Syndrome Partial, Andro sulfatase-B Deficiency, AS, AS, AS, AS, ASA Deficiency, genic Steroids, Anemia Autoimmune Hemolytic, Anemia Ascending Paralysis, ASD, Atrioseptal Defects, ASH, Ash Blackfan Diamond, Anemia, Congenital, Triphalangeal ermans Syndrome, Ashkenazi Type Amyloidosis, ASL Defi Thumb. Syndrome, Anemia Hemolytic Cold Antibody, Ane ciency, Aspartylglucosaminuria, Aspartylglycosaminuria, mia Hemolytic Cold Antibody, Anemia Hemolytic with Asperger's Syndrome, Asperger's Type Autism, Asphyxiat PGK Deficiency, Anemia Pernicious, Anencephaly, Angel ing Thoracic Dysplasia, Asplenia Syndrome, ASS Defi man Syndrome, Angio-Osteohypertrophy Syndrome, ciency, Asthma, Astrocytoma Grade I (Benign), Astrocy Angiofollicular Lymph Node Hyperplasia, Angiohemo toma Grade II (Benign), Asymmetric Crying Facies with philia, Angiokeratoma Corporis, Angiokeratoma Corporis Cardiac Defects, Asymmetrical septal hypertrophy, Asymp Diffusum, Angiokeratoma Diffuse, Angiomatosis Retina, tomatic Callosal Agenesis, AT, AT III Deficiency, AT III Angiomatous Lymphoid, Angioneurotic Edema Hereditary, Variant IA, AT III Variant Ib, AT3, Ataxia, Ataxia Telang Anhidrotic Ectodermal Dysplasia, Anhidrotic X-Linked iectasia, Ataxia Telangiectasia, Ataxia with Lactic Acidosis Ectodermal Dysplasias, Aniridia, Aniridia-Ambiguous Type II, Ataxia Cerebral Palsy, Ataxiadynamia, Ataxiophe Genitalia-Mental Retardation, Aniridia Associated with mia, ATD, Athetoid Cerebral Palsy, Atopic Eczema, Atresia Mental Retardation, Aniridia-Cerebellar Ataxia-Mental of Esophagus with or without Tracheoesophageal Fistula, Deficiency, Aniridia Partial-Cerebellar Ataxia-Mental Retar Atrial Septal Defects, Atrial Septal Defect Primum, Atrial dation, Aniridia Partial-Cerebellar Ataxia-Oligophrenia, and Septal and Small Ventricular Septal Defect, Atrial Aniridia Type I, Aniridia Type II, Aniridia-Wilms Tumor Flutter, Atrial Fibrillation, Atriodigital Dysplasia, Atriosep Association, Aniridia-Wilms Tumor-Gonadoblastoma, tal Defects, Atrioventricular Block, Atrioventricular Canal Ankyloblepharon-Ectodermal Defects-Cleft Lip/Palate, Defect, Atrioventricular Septal Defect, Atrioventricular Sep Ankylosing Spondylitis, Ankylosing Spondylitis, Annular tal Defect, Atrophia Bulborum Hereditaria, Atrophic Beri groves, Anodontia, Anodontia, Anodontia Vera, Anomalous beri, Atrophy Olivopontocerebellar, Attention Deficit Dis Trichromasy, Anomalous Dysplasia of Dentin, Coronal Den order, Attention Deficit Hyperactivity Disorder, Attentuated tin Dysplasia, Anomic Aphasia, Anophthalmia, Anorectal, Adenomatous Polyposis Coli, Atypical Amyloidosis, Atypi Anorectal Malformations, Anosmia, Anterior Bowing of the cal Hyperphenylalaninemia, Atypical Hyperphenylalanine Legs with Dwarfism, Anterior Membrane Corneal Dystro mia, Auditory Canal Atresia, Auriculotemporal Syndrome, phy, Anti-Convulsant Syndrome, Anti-Epstein-Barr Virus Autism, Autism Asperger's Type, Autism Dementia Ataxia Nuclear Antigen (EBNA) Antibody Deficiency, Antibody and Loss of Purposeful Hand Use, Autism Infantile Autism, Deficiency, Antibody Deficiency with near normal Immu Autoimmune Addison's Disease, Autoimmune Hemolytic noglobulins, Antihemophilic Factor Deficiency, Antihemo Anemia, Autoimmune Hemolytic Anemia, Autoimmune philic Globulin Deficiency, Antiphospholipid Syndrome, Hemolytic Anemia, Autoimmune Hemolytic Anemia, Antiphospholipid Syndrome, Antiphospholipid Antibody Autoimmune Hepatitis, Autoimmune-Polyendocrinopathy Syndrome, Antithrombin III Deficiency, Antithrombin III Candidias, Autoimmune Polyglandular Disease Type I. Deficiency Classical (Type I), Antitrypsin Deficiency, Ant Autosomal Dominant Albinism, Autosomal Dominant Com ley-Bixler Syndrome, Antoni’s Palsy, Anxietas Tibialis, pelling Helioophthalmic Outburst Syndrome, Autosomal Aorta Arch Syndrome, Aortic and Mitral Atresia with Hypo Dominant Desmin Distal myopathy with Late Onset, Auto plasic Left Heart Syndrome, Aortic Stenosis, Aortic Steno somal Dominant EDS, Autosomal Dominant Emery-Dre sis, Aparoschisis, APC, APECED Syndrome, Apert Syn ifuss Muscular Dystrophy, Autosomal Dominant Keratoco drome, Aperts, Aphasia, Aplasia AXialis Extracorticales nus, Autosomal Dominant Pelizaeus-Merzbacher Brain Congenital, Aplasia Cutis Congenita, Aplasia Cutis Con Sclerosis, Autosomal Dominant Polycystic Kidney Disease, genita with Terminal Transverse Limb Defects, Aplastic Autosomal Dominant Spinocerebellar Degeneration, Auto Anemia, Aplastic Anemia with Congenital Anomalies, Somal Recessive Agammaglobulinemia, Autosomal Reces APLS, Apnea, Appalachian Type Amyloidosis, Apple Peel sive Centronuclear myopathy, Autosomal Recessive Con Syndrome, Apraxia, Apraxia, Apraxia Buccofacial, Apraxia radi-Hunermann Syndrome, Autosomal Recessive EDS, Constructional, Apraxia Ideational, Apraxia Ideokinetic, Autosomal Recessive Emery-Dreifuss Muscular Dystrophy, Apraxia Ideomotor, Apraxia Motor, Apraxia Oculomotor, Autosomal Recessive Forms of Ocular Albinism, Autosomal APS, Arachnitis, Arachnodactyly Contractural Beals Type, Recessive Inheritance Agenesis of Corpus Callosum, Auto Arachnodactyly, Arachnoid Cysts, Arachnoiditis Ossificans, somal Recessive Keratoconus, Autosomal Recessive Poly Arachnoiditis, Aran-Duchenne, Aran-Duchenne Muscular cystic Kidney Disease, Autosomal Recessive Severe Com Atrophy, Aregenerative Anemia, Arginase Deficiency, bined Immunodeficiency, AV, AV, AVM, AVSD, AWTA, Argininemia, Arginino Succinase Deficiency, Argininosuc Axilla Abscess, Axonal Neuropathy Giant, Azorean Neuro cinase Deficiency, Argininosuccinate Lyase Deficiency, logic Disease, B-K Mole Syndrome, Babinski-Froelich Syn US 2007/0286856 A1 Dec. 13, 2007 70 drome. BADS, Baillarger's Syndrome, Balkan Disease, Bonnet-Dechaume-Blanc Syndrome, Bonnevie-Ulrich Syn Baller-Gerold Syndrome, Ballooning Mitral Valve, Balo drome, Book Syndrome, BOR Syndrome, BOR.J. Borjeson Disease Concentric Sclerosis, Baltic Myoclonus Epilepsy, Syndrome, Borjeson-Forssman-Lehmann Syndrome, Bannayan-Zonana syndrome (BZS), Bannayan-Riley-Ru Bowen Syndrome, Bowen-Conradi Syndrome, Bowen-Con valcaba syndrome, Banti’s Disease, Bardet-Biedl Syn radi Hutterite, Bowen-Conradi Type Hutterite Syndrome, drome, Bare Lymphocyte Syndrome, Barlow's syndrome, Bowman's Layer, BPEI, BPES, Brachial Neuritis, Brachial Barraquer-Simons Disease, Barrett Esophagus, Barrett Neuritis Syndrome, Brachial Plexus Neuritis, Brachial Ulcer, Barth Syndrome, Barth syndrome, Bartter's Syn Plexus-Neuropathy, Brachiocephalic Ischemia, Brachmann drome, Basal Cell Nevus Syndrome, Basedow Disease, de Lange Syndrome, Brachycephaly, Brachycephaly, Bra Bassen-Kornzweig Syndrome, Batten Disease, Batten chymorphic Type Congenital, Bradycardia, Brain Tumors, Mayou Syndrome, Batten-Spielmeyer-Vogt's Disease, Bat Brain Tumors Benign, Brain Tumors Malignant, Branched ten Turner Syndrome, Batten Turner Type Congenital Chain Alpha-Ketoacid Dehydrogenase Deficiency, myopathy, Batten-Vogt Syndrome, BBB Syndrome, BBB Branched Chain Ketonuria I, Brancher Deficiency, Bran Syndrome (Opitz), BBB Syndrome, BBBG Syndrome, chio-Oculo-Facial Syndrome, Branchio-Oto-Renal Dyspla BCKD Deficiency, BD, BDLS, BE, Beals Syndrome, Beals sia, Branchio-Oto-Renal Syndrome, Branchiooculofacial Syndrome, Beals-Hecht Syndrome, Bean Syndrome, BEB, Syndrome, Branchiootic Syndrome, Brandt Syndrome, BEB, Bechterew Syndrome. Becker Disease, Becker Mus Brandywine Type Dentinogenesis Imperfecta, Brandywine cular Dystrophy, Becker Muscular Dystrophy, Becker type Dentinogenesis Imperfecta, Breast Cancer, BRIC Syn Nevus, Beckwith Wiedemann Syndrome. Beckwith-Syn drome, Brittle Bone Disease, Broad Beta Disease, Broad drome, Begnez-Cesar's Syndrome, Behcet’s syndrome, Thumb Syndrome, Broad Thumbs and Great Toes Charac Behcet’s Disease, Behcet’s Disease, Behr 1, Behr 2, Bell's teristic Facies and Mental Retardation, Broad Thumb-Hal Palsy, Benign Acanthosis Nigricans, Benign Astrocytoma, lux, Broca's Aphasia, Brocq-Duhring Disease, Bronze Dia Benign Cranial Nerve Tumors, Benign Cystinosis, Benign betes, Bronze Schilder's Disease, Brown Albinism, Brown Essential Blepharospasm, Benign Essential Tremor, Benign Enamel Hereditary, Brown-Sequard Syndrome, Brown Syn Familial Hematuria, Benign Focal Amyotrophy, Benign drome, BRRS, Brueghel Syndrome, Bruton’s Agamma Focal Amyotrophy of ALS, Benign Hydrocephalus, Benign globulinemia Common, BS, BSS, Buchanan’s Syndrome, Hypermobility Syndrome, Benign Keratosis Nigricans, Budd's Syndrome, Budd-Chiari Syndrome, Buerger-Gruetz Benign Paroxysmal Peritonitis, Benign Recurrent Hema Syndrome, Bulbospinal Muscular Atrophy-X-linked, Bull turia, Benign Recurrent Intrahepatic Cholestasis, Benign dog Syndrome, Bullosa Hereditaria, Bullous CIE, Bullous Spinal Muscular Atrophy with Hypertrophy of the Calves, CIE, Bullous Congenital Ichthyosiform Erythroderma, Benign Symmetrical Lipomatosis, Benign Tumors of the Bullous Ichthyosis, Bullous Pemphigoid, Burkitt's Lym Central Nervous System, Berardinelli-Seip Syndrome, phoma, Burkitt's Lymphoma African type, Burkitt's Lym Berger's Disease, Beriberi, Berman Syndrome, Bernard phoma Non-african type, BWS, Byler's Disease, C Syn Horner Syndrome, Bernard-Soulier Syndrome, Besnier Pru drome, C1 Esterase Inhibitor Dysfunction Type II rigo, Best Disease, Beta-Alanine-Pyruvate Aminotrans Angioedema, C1-INH, C1 Esterase Inhibitor Deficiency ferase, Beta-Galactosidase Deficiency Morquio Syndrome, Type I Angioedema, C1 NH, Cacchi-Ricci Disease, CAD, Beta-Glucuronidase Deficiency, Beta Oxidation Defects, CADASIL, CAH, CAH, Calcaneal Valgus, Calcaneovalgus, Beta-oxidation Defects, Beta Thalassemia Major, Beta Calcium Pyrophosphate Dihydrate Deposits, Callosal Agen Thalassemia Minor, Betalipoprotein Deficiency, Bethlem esis and Ocular Abnormalities, Calves-Hypertrophy of Spi myopathy, Beuren Syndrome, BH4. Deficiency, BH4. Defi nal Muscular Atrophy, Campomelic Dysplasia, Campomelic ciency, Biber-Haab-Dimmer Corneal Dystrophy, Bicuspid Dwarfism, Campomelic Syndrome, Camptodactyly-Cleft Aortic Valve, Bicuspid Aortic Valve, Biedl-Bardet, Bifid Palate-Clubfoot, Camptodactyly-Limited Jaw Excursion, Cranium, Bifunctional Enzyme Deficiency, Bilateral Acous Camptomelic Dwarfism, Camptomelic Syndrome, Camp tic Neurofibromatosis, Bilateral Acoustic Neuroma, Bilat tomelic Syndrome Long-Limb Type, Camurati-Engelmann eral Right-Sidedness Sequence, Bilateral Renal Agenesis, Disease, Camurati-Engelmann Disease, Canada-Cronkhite Bilateral Temporal Lobe Disorder, Bilious Attacks, Bilirubin Disease, Canavan disease, Canavan's Disease Included, Glucuronosyltransferase Deficiency Type I, Binder Syn Canavan's Leukodystrophy, Cancer, Cancer Family Syn drome, Binswanger's Disease, Binswanger's Encephalopa drome Lynch Type, Cantrell Syndrome, Cantrell-Haller thy, Biotinidase deficiency, Bird-Headed Dwarfism Seckel Ravich Syndrome, Cantrell Pentalogy, Carbamyl Phosphate Type, Birth Defects, Birthmark, Bitemporal Forceps Marks Synthetase Deficiency, Carbohydrate Deficient Glycopro Syndrome, Biventricular Fibrosis, Bjornstad Syndrome, tein Syndrome, Carbohydrate-Deficient Glycoprotein Syn B-K Mole Syndrome, Black Locks-Albinism-Deafness of drome Type Ia, Carbohydrate-Induced Hyperlipemia, Car Sensoneural Type (BADS), Blackfan-Diamond Anemia, bohydrate Intolerance of Glucose Galactose, Carbon Blennorrheal Idiopathic Arthritis, Blepharophimosis, Ptosis, Dioxide Acidosis, Carboxylase Deficiency Multiple, Car Epicanthus Inversus Syndrome, Blepharospasm, Ble diac-Limb Syndrome, Cardio-auditory Syndrome, Cardio pharospasm, Blepharospasm Benign Essential, Ble auditory Syndrome of Jervell and Lange-Nielsen, Cardio pharospasm Oromandibular Dystonia, Blessig Cysts, BLFS, cutaneous Syndrome, Cardio-facial-cutaneous syndrome, Blindness, Bloch-Siemens Incontinentia Pigmenti Melano Cardiofacial Syndrome Cayler Type, Cardiomegalia Glyco blastosis Cutis Linearis, Bloch-Siemens-Sulzberger Syn genica Diffusa, Cardiomegalia Glycogenica Diffusa, Cardi drome, Bloch-Sulzberger Syndrome, Blood types, Blood omyopathic Lentiginosis, Cardiomyopathy, Cardiomyopa type A, Blood type B, Blood type AB, Blood type O, Bloom thy, Cardio myopathy Associated with Desmin Storage Syndrome, Bloom-Torre-Mackacek Syndrome, Blue Rubber myopathy, Cardiomyopathy Due to Desmin Defect, Cardio Bleb Nevus, Blue Baby, Blue Diaper Syndrome, BMD, myopathy-Neutropenia Syndrome, Cardio myopathy-Neu BOD, BOFS, Bone Tumor-Epidermoid Cyst-Polyposis, tropenia Syndrome, Cardio myopathy-Neutropenia Syn US 2007/0286856 A1 Dec. 13, 2007

drome Lethal Infantile Cardio myopathy, Cardiopathic Charcot's Disease, Charcot-Marie-Tooth, Charcot-Marie Amyloidosis, Cardiospasm, Cardocardiac Syndrome, Car Tooth Disease, Charcot-Marie-Tooth Disease Variant, Char nitine-Acylcarnitine Translocase Deficiency, Carnitine Defi cot-Marie-Tooth-Roussy-Levy Disease, CHARGE Associa ciency and Disorders, Carnitine Deficiency Primary, Car tion, Charge Syndrome, CHARGE Syndrome, Chaunds nitine Deficiency Secondary, Carnitine Deficiency Ectodermal Dysplasias, Chediak-Higashi Syndrome, Che Secondary to MCAD Deficiency, Carnitine Deficiency Syn diak-Higashi Syndrome, Chediak-Steinbrinck-Higashi Syn drome, Carnitine Palmitoyl Transferase I & II (CPT I & II). drome, Cheilitis Granulomatosa, Cheiloschisis, Chemke Carnitine Palmitoyltransferase Deficiency, Carnitine Palmi Syndrome, Cheney Syndrome, Cherry Red Spot and Myo toyltransferase Deficiency Type 1, Carnitine Palmitoyltrans clonus Syndrome, CHF, CHH, CHH, Chiari’s Disease, ferase Deficiency Type 2 benign classical muscular form Chiari Malformation I, Chiari Malformation, Chiari Type I included severe infantile form included, Carnitine Transport (Chiari Malformation I), Chiari Type II (Chiari Malforma Defect (Primary Carnitine Deficiency), Carnosinase Defi tion II), Chiari I Syndrome, Chiari-Budd Syndrome, Chiari ciency, Carnosinemia, Caroli Disease, Carpenter syndrome, Frommel Syndrome, Chiari Malformation II, CHILD Syn Carpenters, Cartilage-Hair Hypoplasia, Cartilage-Hair drome, CHILD Ichthyosis Syndrome, CHILD Syndrome Hypoplasia, Castleman's Disease, Castleman's Disease Ichthyosis, Childhood Adrenoleukodystrophy, Childhood Hyaline Vascular Type, Castleman's Disease Plasma Cell Dermatomyositis, Childhood-onset Dystonia, Childhood Type, Castleman Tumor, Cat Eye Syndrome, Cat's Cry Cyclic Vomiting, Childhood Giant Axonal Neuropathy, Syndrome, Catalayse deficiency, Cataract-Dental Syn Childhood Hypophasphatasia, Childhood Muscular Dystro drome, Cataract X-Linked with Hutchinsonian Teeth, Cat phy, CHN, Cholestasis, Cholestasis Hereditary Norwegian echolamine hormones, Catel-Manzke Syndrome, Catel Type, Cholestasis Intrahepatic, Cholestasis Neonatal, Manzke Type Palatodigital Syndrome, Caudal Dysplasia, Cholestasis of Oral Contraceptive Users, Cholestasis with Caudal Dysplasia Sequence, Caudal Regression Syndrome, Peripheral Pulmonary Stenosis, Cholestasis of Pregnancy, Causalgia Syndrome Major, Cavernomas, Cavernous Cholesterol Desmolase Deficiency, Cholesterol Desmolase Angioma, Cavernous Hemangioma, Cavernous Lymphan Deficiency, Chondrodysplasia Punctata, Chondrodystrophia gioma, Cavernous Malformations, Cayler Syndrome, Calcificans Congenita, Chondrodystrophia Fetalis, Chon Cazenave's Vitiligo, CBGD, CBGD, CBPS, CBPS, CCA, drodystrophic Myotonia, Chondrodystrophy, Chondrodys CCD, CCD, CCHS, CCM Syndrome, CCMS, CCO, CD, trophy with Clubfeet, Chondrodystrophy Epiphyseal, Chon CDG1a, CDG1A, CDGS Type Ia, CDGS Type Ia, CDGS, drodystrophy Hyperplastic Form, Chondroectodermal CDI, CdILS, Celiac Disease, Celiac sprue, Celiac Sprue Dysplasias, Chondrogenesis Imperfecta, Chondrohystro Dermatitis, Cellelar Immunodeficiency with Purine Nucleo phia, Chondroosteodystrophy, Choreoacanthocytosis, side Phosphorylase Deficiency, Celsus' Vitiligo, Central Chorionic Villi Sampling, Chorioretinal Anomalies, Chori Apnea, Central Core Disease, Central Core Disease, Central oretinal Anomalies with ACC, Chorireninal Coloboma-Jou Diabetes Insipidus, Central Form Neurofibromatosis, Cen bert Syndrome, Choroidal Sclerosis, Choroideremia, tral Hypoventilation, Central Sleep Apnea, Centrifugal Chotzen Syndrome, Chotzen Syndrome, Christ-Siemens Lipodystrophy, Centronuclear myopathy, CEP, Cephalocele, Touraine Syndrome, Christ-Siemans-Touraine Syndrome, Cephalothoracic Lipodystrophy, Ceramide Trihexosidase Christmas Disease, Christmas Tree Syndrome, Chromosome Deficiency, Cerebellar Agenesis, Cerebellar Aplasia, Cer 3 Deletion of Distal 3p, Chromosome 3 Distal 3p Mono ebellar Hemiagenesis, Cerebellar Hypoplasia, Cerebellar somy, Chromosome 3-Distal 3q2 Duplication, Chromosome Vermis Aplasia, Cerebellar Vermis Agenesis-Hypernea-Epi 3-Distal 3q2 Trisomy, Chromosome 3 Monosomy 3p2. sodic Eye Moves-Ataxia-Retardation, Cerebellar Syndrome, Chromosome 3q Partial Duplication Syndrome, Chromo Cerebellarparenchymal Disorder IV. Cerebellomedullary some 3q, Partial Trisomy Syndrome, Chromosome 3-Tri Malformation Syndrome, Cerebellomedullary Malforma Somy 3q2, Chromosome 4 Deletion 4q31-qter Syndrome, tion Syndrome, Cerebello-Oculocutaneous Telangiectasia, Chromosome 4 Deletion 4q32-qter Syndrome, Chromosome Cerebelloparenchymal Disorder IV Familial, Cerebellopon 4 Deletion 4q33-qter Syndrome, Chromosome 4 Long Arm tine Angle Tumor, Cerebral Arachnoiditis, Cerebral Auto Deletion, Chromosome 4 Long Arm Deletion, Chromosome somal Dominant Arteriopathy with Subcortical Infarcts and 4 Monosomy 4q, Chromosome 4-Monosomy 4q, Chromo Leukodystrophy, Cerebral Beriberi, Cerebral Diplegia, some 4 Monosomy Distal 4q, Chromosome 4 Partial Dele Cerebral Gigantism, Cerebral Malformations Vascular, tion 4p, Chromosome 4, Partial Deletion of the Short Arm, Cerebral Palsy, Cerebro-Oculorenal Dystrophy, Cerebro Chromosome 4 Partial Monosomy of Distal 4q, Chromo Oculo-Facio-Skeletal Syndrome, Cerebrocostomandibular some 4 Partial Monosomy 4p, Chromosome 4 Partial Tri syndrome, Cerebrohepatorenal Syndrome, Cerebromacular Somy 4 (q25-qter), Chromosome 4 Partial Trisomy 4 (q26 or Degeneration, Cerebromacular Degeneration, Cerebromus q27-qter), Chromosome 4 Partial Trisomy 4 (q31 or cular Dystrophy Fukuyama Type, Cerebroocular Dysgen 32-qter), Chromosome 4 Partial Trisomy 4p, Chromosome 4 esis, Cerebroocular Dysplasia-Muscular Dystrophy Syn Partial Trisomies 4q2 and 4q3, Chromosome 4 Partial Tri drome, Cerebrooculofacioskeletal Syndrome, Somy Distal 4, Chromosome 4 Ring, Chromosome 4 4q Cerebroretinal Arteriovenous Aneurysm, Cerebroside Lipi Terminal Deletion Syndrome, Chromosome 4q-Syndrome, dosis, Cerebrosidosis, Cerebrotendinous Xanthomatosis, Chromosome 4q-Syndrome, Chromosome 4 Trisomy 4, Cerebrovascular Ferrocalcinosis, Ceroid-Lipofuscinosis Chromosome 4 Trisomy 4p, Chromosome 4 XY/47 XXY Adult form, Cervical Dystonia, Cervical Dystonia, Cervico (Mosiac), Chromosome 5 Monosomy 5p, Chromosome 5, Oculo-Acoustic Syndrome, Cervical Spinal Stenosis, Cer Partial Deletion of the Short Arm Syndrome, Chromosome vical Vertebral Fusion, CES, CF, CFC syndrome, CFIDS, 5 Trisomy 5p, Chromosome 5 Trisomy 5p Complete (5-p11 CFND, CGD, CGF, CGF, Chalasodermia Generalized, Cha pter), Chromosome 5 Trisomy 5p Partial (5p13 or 14-pter), narin Dorfman Disease, Chanarin Dorfman Syndrome, Cha Chromosome 5p-Syndrome, Chromosome 6 Partial Trisomy narin Dorfman Ichthyosis Syndrome, Chandler's Syndrome, 6q, Chromosome 6 Ring, Chromosome 6 Trisomy 6q2. US 2007/0286856 A1 Dec. 13, 2007 72

Chromosome 7 Monosomy 7p2, Chromosome 7 Partial Pigmentary, Cirrhosis, Cistinuria, Citrulinemia, CJD. Clas Deletion of Short Arm (7p2-), Chromosome 7 Terminal 7p sic Schindler Disease, Classic Type Pfeiffer Syndrome, Deletion del (7) (p21-p22), Chromosome 8 Monosomy Classical Maple Syrup Urine Disease, Classical Hemophilia, 8p2, Chromosome 8 Monosomy 8p21-pter, Chromosome 8 Classical Form Cockayne Syndrome Type I (Type A), Clas Partial Deletion (short arm), Chromosome 8 Partial Mono sical Leigh's Disease, Classical Phenylketonuria, Classical somy 8p2, Chromosome 9 Complete Trisomy 9P, Chromo X-Linked Pelizaeus-Merzbacher Brain Sclerosis, CLE, Cleft some 9 Partial Deletion of Short Arm, Chromosome 9 Partial Lip/Palate Mucous Cysts Lower Lip PP Digital and Genital Monosomy 9p, Chromosome 9 Partial Monosomy 9p2. Anomalies, Cleft Lip-Palate Blepharophimosis Lagopthal Chromosome 9 Partial Monosomy 9p22-pter, Chromosome mos and Hypertelorism, Cleft Lip/Palate with Abnormal 9 Partial Trisomy 9P Included, Chromosome 9 Ring, Chro Thumbs and Microcephaly, Cleft palate-joint contractures mosome 9 Tetrasomy 9p, Chromosome 9 Tetrasomy 9p dandy walker malformations, Cleft Palate and Cleft Lip, Mosaicism, Chromosome 9 Trisomy 9p. (Multiple Variants), Cleidocranial Dysplasia w/Micrognathia, Absent Thumbs, Chromosome 9 Trisomy 9 (pter-p21 to q32) Included, Chro & Distal Aphalangia, Cleidocranial Dysostosis, Cleidocra mosome 9 Trisomy Mosaic, Chromosome 9 Trisomy nial Dysplasia, Click murmur syndrome, CLN1, Clonic Mosaic, Chromosome 10 Distal Trisomy 10q, Chromosome Spasmodic, Cloustons Syndrome, Clubfoot, CMDI, CMM, 10 Monosomy, Chromosome 10 Monosomy 10p, Chromo CMT, CMTC, CMTX, COA Syndrome, Coarctation of the some 10, Partial Deletion (short arm), Chromosome 10, aorta, Coarctation of the aorta, Coats Disease, Cobblestone 10p-Partial, Chromosome 10 Partial Trisomy 10q24-qter, dysplasia, Cochin Jewish Disorder, Cockayne Syndrome, Chromosome 10 Trisomy 10q2, Partial Monosomy of Long COD-MD Syndrome, COD, Coffin Lowry Syndrome, Coffin Arm of Chromosome 11, Chromosome 11 Partial Mono Syndrome, Coffin Siris Syndrome, COFS Syndrome, Cogan somy 11q, Chromosome 11 Partial Trisomy, Chromosome Corneal Dystrophy, Cogan Reese Syndrome, Cohen Syn 11 Partial Trisomy 11q13-qter, Chromosome 11 Partial drome, Cold Agglutinin Disease, Cold Antibody Disease, Trisomy 11q21-qter, Chromosome 11 Partial Trisomy Cold Antibody Disease, Cold Antibody Hemolytic Anemia, 11q23-qter, Chromosome 11q, Partial Trisomy, Chromo Cold Agglutinin Disease, Cold Agglutinin Disease, Colitis some 12 Isochromosome 12p Mosaic, Chromosome 13 Ulcerative, Colitis Gravis, Colitis Gravis, Colitis Ulcerative Partial Monosomy 13q, Chromosome 13, Partial Monosomy Chronic Non-Specific Ulcerative Colitis, Collodion Baby, of the Long Arm, Chromosome 14 Ring, Chromosome 14 Coloboma Heart Defects Atresia of the Choanae Retardation Trisomy, Chromosome 15 Distal Trisomy 15q, Chromosome of Growth and Development Genital and Urinary Anomalies r15, Chromosome 15 Ring, Chromosome 15 Trisomy 15q2, and Ear Anomalies, Coloboma, Coloboma, Colonic Neuro Chromosome 15q Partial Duplication Syndrome, Chromo sis, Color blindness, Color blindness, Colour blindness, some 17 Interstitial Deletion 17p, Chromosome 18 Long Colour blindness, Colpocephaly, Columnar-Like Esopha Arm Deletion Syndrome, Chromosome 18 Monosomy 18p. gus, Combined Cone-Rod Degeneration, Combined Immu Chromosome 18 Monosomy 18Q, Chromosome 18 Ring, nodeficiency with Immunoglobulins, Combined Mesoecto Chromosome 18 Tetrasomy 18p, Chromosome 18q-Syn dermal Dysplasia, Common Variable drome, Chromosome 21 Mosaic 21 Syndrome, Chromo Hypogammaglobulinemia, Common Variable Immunodefi Some 21 Ring, Chromosome 21 Translocation 21 Syndrome, ciency, Common Ventricle, Communicating Hydrocephalus, Chromosome 22 Inverted Duplication (22pter-22q11), Complete Absense of Hypoxanthine-Guanine Phosphoribo Chromosome 22 Partial Trisomy (22pter-22q11), Chromo syltran?ferase, Complete Atrioventricular Septal Defect, some 22 Ring, Chromosome 22 Trisomy Mosaic, Chromo Complement Component 1 Inhibitor Deficiency, Comple some 48 XXYY. Chromosome 48 XXXY. Chromosome r15, ment Component C1 Regulatory Component Deficiency, Chromosomal Triplication, Chromosome Triplication, Complete Heart Block, Complex Carbohydrate Intolerance, Chromosome Triploidy Syndrome, Chromosome X, Chro Complex Regional Pain Syndrome, Complex V ATP Syn mosome XXY. Chronic Acholuric Jaundice, Chronic Adhe thase Deficiency, Complex I, Complex I NADH dehydro sive Arachnoiditis, Chronic Adrenocortical Insufficiency, genase deficiency, Complex II, Complex II Succinate dehy Chronic Cavernositis, Chronic Congenital Aregenerative drogenase deficiency, Complex III, Complex III Anemia, Chronic Dysphagocytosis, Chronic Familial Ubiquinone-cytochrome c oxidoreductase deficiency, Com Granulomatosis, Chronic Familial Icterus, Chronic Fatigue plex IV, Complex IV Cytochrome c oxidase deficiency, Immune Dysfunction Syndrome (CFIDS), Chronic Granu Complex IV Deficiency, Complex V. Cone-Rod Degenera lomatous Disease, Chronic Guillain-Barre Syndrome, tion, Cone-Rod Degeneration Progressive, Cone Dystrophy, Chronic Idiopathic Jaundice, Chronic Idiopathic Polyneuri Cone-Rod Dystrophy, Confluent Reticular Papillomatosis, tis (CIP), Chronic Inflammatory Demyelinating Polyneur Congenital with low PK Kinetics, Congenital Absence of opathy, Chronic Inflammatory. Demyelinating Polyradicu Abdominal Muscles, Congenital Absence of the Thymus loneuropathy, Chronic Motor Tic, Chronic Mucocutaneous and Parathyroids, Congenital Achromia, Congenital Addi Candidiasis, Chronic Multiple Tics, Chronic Non-Specific son's Disease, Congenital Adrenal Hyperplasia, Congenital Ulcerative Colitis, Chronic Non-Specific Ulcerative Colitis, Adreneal Hyperplasia, Congenital Afibrinogenemia, Con Chronic Obliterative Cholangitis, Chronic Peptic Ulcer and genital Alveolar HypoVentilation, Congenital Anemia of Esophagitis Syndrome, Chronic Progressive Chorea, Newborn, Congenital Bilateral Persylvian Syndrome, Con Chronic Progressive External Opthalmoplegia Syndrome, genital Brown Syndrome, Congenital Cardiovascular Chronic Progressive External Opthalmoplegia and myopa Defects, Congenital Central Hypoventilation Syndrome, thy, Chronic Progressive External Opthalmoplegia with Congenital Cerebral Palsy, Congenital Cervical Synostosis, Ragged Red Fibers, Chronic Relapsing Polyneuropathy, Congenital Clasped Thumb with Mental Retardation, Con Chronic Sarcoidosis, Chronic Spasmodic Dysphonia, genital Contractural Arachnodactyly, Congenital Contrac Chronic Vomiting in Childhood, CHS, Churg-Strauss Syn tures Multiple with Arachnodactyly, Congenital Cyanosis, drome, Cicatricial Pemphigoid, CIP, Cirrhosis Congenital Congenital Defect of the Skull and Scalp, Congenital Dila US 2007/0286856 A1 Dec. 13, 2007

tation of Intrahepatic Bile Duct, Congenital Dysmyelinating loidosis, Corneal Clouding-Cutis Laxa-Mental Retardation, Neuropathy, Congenital Dysphagocytosis, Congenital Dys Corneal Dystrophy, Cornelia de Lange Syndrome, Coronal plastic Angiectasia, Congenital Erythropoietic Porphyria, Dentine Dysplasia, Coronary Artery Disease, Coronary Congenital Erythropoietic Porphyria, Congenital Factor Heart Disease, Corpus Callosum Agenesis, Cortical-Basal XIII Deficiency, Congenital Failure of Autonomic Control Ganglionic Degeneration, Corticalis Deformaris, Cortico of Respiration, Congenital Familial Nonhemolytic Jaundice Basal Ganglionic Degeneration (CBGD), Corticobasal Type I, Congenital Familial Protracted Diarrhea, Congenital Degeneration, Corticosterone Methloxidase Deficiency Form Cockayne Syndrome Type II (Type B), Congenital Type I, Corticosterone Methyloxidase Deficiency Type II, Generalized Fibromatosis, Congenital German Measles, Cortisol, Costello Syndrome, Cot Death, COVESDEMSyn Congenital Giant AXonal Neuropathy, Congenital Heart drome, COX, COX Deficiency, COX Deficiency French Block, Congenital Heart Defects, Congenital Hemidysplasia Canadian Type, COX Deficiency Infantile Mitochondrial with Ichthyosis Erythroderma and Limb Defects, Congenital myopathy de Toni-Fanconi-Debre included, COX Defi Hemolytic Jaundice, Congenital Hemolytic Anemia, Con ciency Type Benign Infantile Mitochondrial Mypoathy, CP, genital Hepatic Fibrosis, Congenital Hereditary Corneal CPEO, CPEO with myopathy, CPEO with Ragged-Red Dystrophy, Congenital Hereditary Lymphedema, Congenital Fibers, CPPD Familial Form, CPT Deficiency, CPTD, Cra Hyperchondroplasia, Congenital Hypomyelinating Poly nial Arteritis, Cranial Meningoencephalocele, Cranio-Oro neuropathy, Congenital Hypomyelination Neuropathy, Con Digital Syndrome, Craniocarpotarsal dystrophy, Craniocele, genital Hypomyelination, Congenital Hypomyelination Craniodigital Syndrome-Mental Retardation Scott Type, Neuropathy, Congenital Hypomyelination (Onion Bulb) Craniofacial Dysostosis, Craniofacial Dysostosis-PD Arte Polyneuropathy, Congenital Ichthyosiform Erythroderma, riosus-Hypertrichosis-Hypoplasia of Labia, Craniofrontona Congenital Keratoconus, Congenital Lactic Acidosis, Con sal Dysplasia, Craniometaphyseal Dysplasia, Cranioorodigi genital Lactose Intolerance, Congenital Lipodystrophy, tal Syndrome, Cranioorodigital Syndrome Type II, Congenital Liver Cirrhosis, Congenital Lobar Emphysema, Craniostenosis Crouzon Type, Craniostenosis, Craniosteno Congenital Localized Emphysema, Congenital Macroglos sis, Craniosynostosis-Choanal Atresia-Radial Humeral sia, Congenital Medullary Stenosis, Congenital Megacolon, Synostosis, Craniosynostosis-Hypertrichosis-Facial and Congenital Melanocytic Nevus, Congenital Mesodermal Other Anomalies, Craniosynostosis Midfacial Hypoplasia Dysmorphodystrophy, Congenital Mesodermal Dystrophy, and Foot Abnormalities, Craniosynostosis Primary, Cranio Congenital MicroVillus Atrophy, Congenital Multiple Synostosis-Radial Aplasia Syndrome, Craniosynostosis with Arthrogryposis, Congenital Myotonic Dystrophy, Congeni Radial Defects, Cranium Bifidum, CREST Syndrome, tal Neuropathy caused by Hypomyelination, Congenital CREST Syndrome, Creutzfeldt Jakob Disease, Cri du Chat Pancytopenia, Congenital Pernicious Anemia, Congenital Syndrome, Crib Death, Crigler Najjar Syndrome Type I, Pernicious Anemia due to Defect of Intrinsic Factor, Con Crohn's Disease, Crohn's Disease, Cronkhite-Canada Syn genital Pernicious Anemia due to Defect of Intrinsic Factor, drome, Cross Syndrome, Cross Syndrome, Cross-McKu Congenital Pigmentary Cirrhosis, Congenital Porphyria, sick-Breen Syndrome, Crouzon, Crouzon Syndrome, Crou Congenital Proximal myopathy Associated with Desmin Zon Craniofacial Dysostosis, Cryoglobulinemia Essential Storage myopathy, Congenital Pulmonary Emphysema, Mixed, Cryptopthalmos-Syndactyly Syndrome, Cryp Congenital Pure Red Cell Anemia, Congenital Pure Red Cell torchidism-Dwarfism-Subnormal Mentality, Crystalline Aplasia, Congenital Retinal Blindness, Congenital Retinal Corneal Dystrophy of Schnyder, CS, CSD, CSID, CSO, Cyst, Congenital Retinitis Pigmentosa, Congenital Retin CST Syndrome, Curly Hair-Ankyloblephanon-Nail Dyspla oschisis, Congenital Rod Disease, Congenital Rubella Syn sia, Curschmann-Batten-Steinert Syndrome, Curth Macklin drome, Congenital Scalp Defects with Distal Limb Reduc Type Ichthyosis Hystric, Curth-Macklin Type, Cushings, tion Anomalies, Congenital Sensory Neuropathy, Congenital Cushing Syndrome, Cushing's III, Cutaneous Malignant SMA with arthrogryposis, Congenital Spherocytic Anemia, Melanoma Hereditary, Cutaneous Porphyrias, Cutis Laxa, Congenital Spondyloepiphyseal Dysplasia, Congenital Teth Cutis Laxa, Cutis Laxa-Growth Deficiency Syndrome, Cutis ered Cervical Spinal Cord Syndrome, Congenital Tyrosino Marmorata Telangiectatica Congenita, CVI. CVID, CVS, sis, Congenital Varicella Syndrome, Congenital Vascular CVS, Cyclic vomiting syndrome, Cystic Disease of the Cavernous Malformations, Congenital Vascular Veils in the Renal Medulla, Cystic Disease of the Renal Medulla, Cystic Retina, Congenital Word Blindness, Congenital Wandering Hygroma, Cystic Fibrosis, Cystic Lymphangioma, Cystine Spleen (Pediatric), Congestive Cardio myopathy, Conical Lysine-Arginine-Ornithinuria, Cystine Storage Disease, Cornea, Conjugated Hyperbilirubinemia, Conjunctivitis, Cystinosis, Cystinuria, Cystinuria with Dibasic Aminoaci Conjunctivitis Ligneous, Conjunctivo-Urethro-Synovial duria, Cystinuria Type I, Cystinuria Type II, Cystinuria Type Syndrome, Conn's Syndrome, Connective Tissue Disease, III, Cysts of the Renal Medulla Congenital, Cysts of the Conradi Disease, Conradi Hunermann Syndrome, Constitu Renal Medulla Congenital, Cytochrome COxidase Defi tional Aplastic Anemia, Constitutional Erythroid Hypopla ciency, D.C., Dacryosialoadenopathy, Dacryosialoadeno sia, Constitutional Eczema, Constitutional Liver Dysfunc pathia, Dalpro, Dalton, Daltonism, Danbolt-Cross Syn tion, Constitutional Thrombopathy, Constricting Bands drome, Dancing Eyes-Dancing Feet Syndrome, Dandy Congenital, Constrictive Pericarditis with Dwarfism, Con Walker Syndrome, Dandy-Walker Cyst, Dandy-Walker tinuous Muscle Fiber Activity Syndrome, Contractural Deformity, Dandy Walker Malformation, Danish Cardiac Arachnodactyly, Contractural Arachnodactyly, Contractures Type Amyloidosis (Type III), Darier Disease, Davidson's of Feet Muscle Atrophy and Oculomotor Apraxia, Convul Disease, Davies’ Disease, DBA, DBS, DC, DD, De Barsy sions, Cooley's anemia, Copper Transport Disease, Copro Syndrome, De Barsy-Moens-Diercks Syndrome, de Lange porphyria Porphyria Hepatica, Cor Triatriatum, Cor Tria Syndrome, De Morsier Syndrome, De Santis Cacchione triatum Sinistrum, Cor Triloculare Biatriatum, Cor Syndrome, de Toni-Fanconi Syndrome, Deafness Congeni Biloculare, Cori Disease, Cornea Dystrophy, Corneal Amy tal and Functional Heart Disease, Deafness-Dwarfism-Reti US 2007/0286856 A1 Dec. 13, 2007 74 nal Atrophy, Deafness-Functional Heart Disease, Deafness Type I, Digito-Oto-Palatal Syndrome Type II, Dihydrobiop Onychodystrophy Osteodystrophy and Mental Retardation, terin Synthetase Deficiency, Dihydrobiopterin Synthetase Deafness and Pili Torti Bjornstad Type, Deafness Senso Deficiency, Dihydropteridine Reductase Deficiency, Dihy rineural with Imperforate Anus and Hypoplastic Thumbs, dropteridine Reductase Deficiency, Dihydroxyacetonephos Debrancher Deficiency, Deciduous Skin, Defect of Entero phate synthase, Dilated (Congestive) Cardio myopathy, cyte Intrinsic Factor Receptor, Defect of Enterocyte Intrinsic Dimitri Disease, Diplegia of Cerebral Palsy, Diplo-Y Syn Factor Receptor, Defect in Natural Killer Lymphocytes, drome, Disaccharidase Deficiency, Disaccharide Intolerance Defect of Renal Reabsorption of Carnitine, Deficiency of I, Discoid Lupus, Discoid Lupus Erythematosus, DISH, Glycoprotein Neuraminidase, Deficiency of Mitochondrial Disorder of Cornification, Disorder of Cornification Type I, Respiratory Chain Complex IV. Deficiency of Platelet Gly Disorder of Cornification 4, Disorder of Cornification 6, coprotein Ib. Deficiency of Von Willebrand Factor Receptor, Disorder of Cornification 8, Disorder of Cornification 9 Deficiency of Short-Chain Acyl-CoA Dehydrogenase Netherton's Type, Disorder of Cornification 11 Phytanic (ACADS, Deformity with Mesomelic Dwarfism, Degenera Acid Type, Disorder of Cornification 12 (Neutral Lipid tive Chorea, Degenerative Lumbar Spinal Stenosis, Degos Storage Type), Disorder of Cornification 13, Disorder of Disease, Degos-Kohlmeier Disease, Degos Syndrome, Cornification 14, Disorder of Cornification 14 Trichothiod DEH. Deerine-Roussy Syndrome, Deerine Sottas Disease, ystrophy Type, Disorder of Cornification 15 (Keratitis Deaf Deletion 9p Syndrome Partial, Deletion 11q Syndrome ness Type), Disorder of Cornification 16, Disorder of Corni Partial, Deletion 13q Syndrome Partial, Delleman-Oorthuys fication 18 Erythrokeratodermia Variabilis Type, Disorder of Syndrome, Delleman Syndrome, Dementia with Lobar Atro Cornification 19, Disorder of Cornification 20, Disorder of phy and Neuronal Cytoplasmic Inclusions, Demyelinating Cornification 24, Displaced Spleen, Disseminated Lupus Disease, DeMyer Syndrome, Dentin Dysplasia Coronal, Erythematosus, Disseminated Neurodermatitis, Dissemi Dentin Dysplasia Radicular, Dentin Dysplasia Type I, Den nated Sclerosis, Distal 11q Monosomy, Distal 11q-Syn tin Dysplasia Type II, Dentinogenesis Imperfecta Brandy drome, Distal Arthrogryposis Multiplex Congenita Type wine type, Dentinogenesis Imperfecta Shields Type, Denti IIA, Distal Arthrogryposis Multiplex Congenita Type IIA, nogenesis Imperfecta Shields Type, Dentinogenesis Distal Arthrogryposis Type IIA, Distal Arthrogryposis Type Imperfecta Type III, Dentinogenesis Imperfecta Type III, 2A, Distal Duplication 6q Distal Duplication 10q, Dup Dento-Oculo-Osseous Dysplasia, Dento-Oculo-Osseous (10q) Syndrome, Distal Duplication 15q Distal Monosomy Dysplasia, Dentooculocutaneous Syndrome, Denys-Drash 9p, Distal Trisomy 6q Distal Trisomy 10q Syndrome, Distal Syndrome, Depakene, DepakeneTM exposure, Depakote, Trisomy 11q, Divalproex, DJS, DKC, DLE, DLPIII, DM, Depakote Sprinkle, Depigmentation-Gingival Fibromatosis DMC Syndrome, DMC Disease, DMD, DNS Hereditary, Microphthalmia, Dercum Disease, Dercum Disease, Derma DOC I, DOC2, DOC 4, DOC 6 (Harlequin Type), DOC 8 titis Atopic, Dermatitis Exfoliativa, Dermatitis Herpetifor Curth-Macklin Type, DOC 11 Phytanic Acid Type, DOC 12 mis, Dermatitis Multiformis, Dermatochalasia Generalized, (Neutral Lipid Storage Type), DOC 13, DOC 14, DOC 14 Dermatolysis Generalized, Dermatomegaly, Dermatomyosi Trichothiodystrophy Type, DOC 15 (Keratitis Deafness tis sine myositis, Dermatomyositis, Dermatosparaxis, Der Type), DOC 16, DOC 16 Unilateral Hemidysplasia Type, matostomatitis Stevens Johnson Type, Desbuquois Syn DOC 18, DOC 19, DOC 20, DOC 24, Dohle's Bodies drome, Desmin Storage myopathy, Desquamation of Myelopathy, Dolichospondylic Dysplasia, Dolichostenom Newborn, Deuteranomaly, Deuteranomaly, Developmental elia, Dolichostenomelia Syndrome, Dominant Type Kenny Reading Disorder, Developmental Gerstmann Syndrome, Caffe Syndrome, Dominant Type Myotonia Congenita, Devergie Disease, Devic Disease, Devic Syndrome, Dex Donahue Syndrome, Donath-Landsteiner Hemolytic Ane trocardia-Bronchiectasis and Sinusitis, Dextrocardia with mia, Donath-Landsteiner Syndrome, DOOR Syndrome, Situs Inversus, DGS, DGSX Golabi-Rosen Syndrome DOORS Syndrome, Dopa-responsive Dystonia (DRD), Included, DH, DHAP alkyl transferase deficiency, DHBS Dorfman Chanarin Syndrome, Dowling-Meara Syndrome, Deficiency, DHBS Deficiency, DHOF, DHPR Deficiency, Down Syndrome, DR Syndrome, Drash Syndrome, DRD, DHPR Deficiency, Diabetes Insipidus, Diabetes Insipidus Dreifuss-Emery Type Muscular Dystrophy with Contrac Diabetes Mellitus Optic Atrophy and Deafness, Diabetes tures, Dressler Syndrome, Drifting Spleen, Drug-induced Insipidus Neurohypophyseal, Diabetes Insulin Dependent, Acanthosis Nigricans, Drug-induced Lupus Erythematosus, Diabetes Mellitus, Diabetes Mellitus Addison's Disease Drug-related Adrenal Insufficiency, Drummond's Syn Myxedema, Diabetic Acidosis, Diabetic Bearded Woman drome, Dry Beriberi, Dry Eye, DTD, Duarie's Retraction Syndrome, Diamond-Blackfan Anemia, Diaphragmatic Syndrome, Duane Syndrome, Duane Syndrome Type IA 1B Apnea, Diaphyseal Aclasis, Diastrophic Dwarfism, and 1C, Duane Syndrome Type 2A 2B and 2C, Duane Diastrophic Dysplasia, Diastrophic Nanism Syndrome, Syndrome Type 3A 3B and 3C, Dubin Johnson Syndrome, Dicarboxylic Aminoaciduria, Dicarboxylicaciduria Caused Dubowitz Syndrome, Duchenne, Duchenne Muscular Dys by Defect in Beta-Oxidation of Fatty Acids, Dicarboxyli trophy, Duchenne's Paralysis, Duhring's Disease, Duncan caciduria due to Defect in Beta-Oxidation of Fatty Acids, Disease, Duncan's Disease, Duodenal Atresia, Duodenal Dicarboxylicaciduria due to MCADH Deficiency, Dichro Stenosis, Duodenitis, Duplication 4p Syndrome, Duplica masy, Dicker-Opitz, DIDMOAD. Diencephalic Syndrome, tion 6q Partial, Dupuy's Syndrome, Dupuytren’s Contrac Diencephalic Syndrome of Childhood, Diencephalic Syn ture, Dutch-Kennedy Syndrome, Dwarfism, Dwarfism Cam drome of Emaciation, Dienoyl-CoA Reductase Deficiency, pomelic, Dwarfism Cortical Thickening of the Tubular Diffuse Cerebral Degeneration in Infancy. Diffuse Degen Bones & Transient Hypocalcemia, Dwarfism Levi’s Type, erative Cerebral Disease. Diffuse Idiopathic Skeletal Hyper Dwarfism Metatropic, Dwarfism-Onychodysplasia, Dwarf ostosis, Diffusum-Glycopeptiduria, DiGeorge Syndrome, ism-Pericarditis, Dwarfism with Renal Atrophy and Deaf DiGeorge Syndrome, Digital-Oro-Cranio Syndrome, ness, Dwarfism with Rickets, DWM. Dyggve Melchior Digito-Oto-Palatal Syndrome, Digito-Oto-Palatal Syndrome Clausen Syndrome, Dysautonomia Familial, Dysbetalipo US 2007/0286856 A1 Dec. 13, 2007 proteinemia Familial, Dyschondrodysplasia with Heman fusa, Encephalitis Periaxialis Concentrica, Encephalocele, giomas, Dyschondrosteosis, Dyschromatosis Universalis Encephalofacial Angiomatosis, Encephalopathy, Encephal Hereditaria, Dysencephalia Splanchinocystica, Dyskeratosis otrigeminal Angiomatosis, Enchondromatosis with Multiple Congenita, Dyskeratosis Congenita Autosomal Recessive, Cavernous Hemangiomas, Endemic Polyneuritis, Endocar Dyskeratosis Congenita Scoggins Type, Dyskeratosis Con dial Cushion Defect, Endocardial Cushion Defect, Endocar genita Syndrome, Dyskeratosis Follicularis Vegetans, Dys dial Cushion Defects, Endocardial Dysplasia, Endocardial lexia, Dysmyelogenic Leukodystrophy, Dysmyelogenic Fibroelastosis (EFE), Endogenous Hypertriglyceridemia, Leukodystrophy-Megalobare, Dysphonia Spastica, Dyspla Endolymphatic Hydrops, Endometrial Growths, sia Epiphysialis Punctata, Dysplasia Epiphyseal Endometriosis, Endomyocardial Fibrosis, Endothelial Cor Hemimelica, Dysplasia of Nails With Hypodontia, Dyspla neal Dystrophy Congenital, Endothelial Epithelial Corneal sia Cleidocranial, Dysplasia Fibrous, Dysplasia Gigantism Dystrophy, Endothelium, Engelmann Disease, Enlarged Syndromex-Linked, Dysplasia Osteodental, Dysplastic Tongue, Enterocolitis, Enterocyte Cobalamin Malabsorp Nevus Syndrome, Dysplastic Nevus Syndrome, Dysplastic tion, Eosinophia Syndrome, Eosinophilic Cellulitis, Eosino Nevus Type, Dyssynergia Cerebellaris Myoclonica, Dyssyn philic Fasciitis, Eosinophilic Granuloma, Eosinophilic Syn ergia Esophagus, Dystonia, Dystonia, Dystopia Canthorum, drome, Epidermal Nevus Syndrome, Epidermolysis bullosa, Dystopia Canthorum, Dystrophia Adiposogenitalis, Dystro Epidermolysis Bullosa, Epidermolysis Bullosa Acquisita, phia Endothelialis Cornea, Dystrophia Mesodermalis, Dys Epidermolysis Bullosa Hereditaria, Epidermolysis Bullosa trophic Epidermolysis Bullosa, Dystrophic Epidermolysis Letalias, Epidermolysis Hereditaria Tarda, Epidermolytic Bullosa, Dystrophy, Asphyxiating Thoracic, Dystrophy Hyperkeratosis, Epidermolytic Hyperkeratosis (Bullous Myotonic, E-D Syndrome, Eagle-Barrett Syndrome, Eales CIE), Epilepsia Procursiva, Epilepsy, Epinephrine, Epiphy Retinopathy, Eales Disease, Ear Anomalies-Contractures seal Changes and High Myopia, Epiphyseal Osteochon Dysplasia of Bone with Kyphoscoliosis, Ear Patella Short droma Benign, Epiphysealis Hemimelica Dysplasia, Epi Stature Syndrome, Early Constraint Defects, Early Hyper sodic-Abnormal Eye Movement, Epithelial Basement calcemia Syndrome with Elfin Facie, Early-onset Dystonia, Membrane Corneal Dystrophy, Epithelial Corneal Dystro Eaton Lambert Syndrome, EB. Ebsteins anomaly, EBV phy of Meesmann Juvenile, Epitheliomatosis Multiplex with Susceptibility (EBVS), EBVS, ECD, ECPSG, Ectodermal Nevus, Epithelium, Epival, EPS, Epstein-Barr Virus-In Dysplasias, Ectodermal Dysplasia Anhidrotic with Cleft Lip duced Lymphoproliferative Disease in Males, Erb-Goldflam and Cleft Palate, Ectodermal Dysplasia-Exocrine Pancreatic syndrome, Erdheim Chester Disease, Erythema Multiforme Insufficiency, Ectodermal Dysplasia Rapp-Hodgkin type, Exudativum, Erythema Polymorphe Stevens Johnson Type, Ectodermal and Mesodermal Dysplasia Congenital, Ecto Erythroblastophthisis, Erythroblastosis Fetalis, Erythroblas dermal and Mesodermal Dysplasia with Osseous Involve tosis Neonatorum, Erythroblastotic Anemia of Childhood, ment, Ectodermosis Erosiva Pluriorificialis, Ectopia Lentis, Erythrocyte Phosphoglycerate Kinase Deficiency, Erythro Ectopia Vesicae, Ectopic ACTH Syndrome, Ectopic Adreno genesis Imperfecta, Erythrokeratodermia Progressiva Sym corticotropic Hormone Syndrome, Ectopic Anus, Ectrodac metrica, Erythrokeratodermia Progressiva Symmetrica Ich tilia of the Hand, Ectrodactyly, Ectrodactyly-Ectodermal thyosis, Erythrokeratodermia Variabilis, Dysplasia-Clefting Syndrome, Ectrodactyly Ectodermal Erythrokeratodermia Variabilis, Erythrokeratodermia Vari Dysplasias Clefting Syndrome, Ectrodactyly Ectodermal abilis Type, Erythrokeratolysis Hiemalis, Erythrokeratolysis Dysplasia Cleft Lip/Cleft Palate, Eczema, Eczema-Throm Hiemalis, Erythrokeratolysis Hiemalis, Erythropoietic Por bocytopenia-Immunodeficiency Syndrome, EDA, EDMD, phyrias, Erythropoietic Porphyria, Escobar Syndrome, EDS, EDS Arterial-Ecchymotic Type, EDS Arthrochalasia, Esophageal Atresia, Esophageal Aperistalsis, Esophagitis EDS Classic Severe Form, EDS Dysfibronectinemic, EDS Peptic Ulcer, Esophagus Atresia and/or Tracheoesophageal Gravis Type, EDS Hypermobility, EDS Kyphoscoliotic, Fistula, Essential Familial Hyperlipemia, Essential Fructo EDS Kyphoscoliosis, EDS Mitis Type, EDS Ocular-Scoli Suria, Essential Hematuria, Essential Hemorrhagic Throm otic, EDS Progeroid, EDS Periodontosis, EDS Vascular, bocythemia, Essential Hemorrhagic Thrombocythemia, EEC Syndrome, EFE, EHBA, EHK, Ehlers Danlos Syn Essential Mixed Cryoglobulinemia, Essential Moschowitz drome, Ehlers-Danlos syndrome, Ehlers Danlos IX, Eisen Disease, Essential Thrombocythemia, Essential Thromb menger Complex, Eisenmenger's complex, Eisenmenger ocythemia, Essential Thrombocytopenia, Essential Throm Disease, Eisenmenger Reaction, Eisenmenger Syndrome, bocytosis, Essential Thrombocytosis, Essential Tremor, Eisenmenger Syndrome, Ekbom Syndrome, Ekman-Lob Esterase Inhibitor Deficiency, Estren-Dameshek variant of stein Disease, Ektrodactyly of the Hand, Ektrodactyly of the Fanconi Anemia, Estrogen-related Cholestasis, ET. ET, ETF, Hand, EKV, Elastin fiber disorders, Elastorrhexis General Ethylmalonic Adipicaciduria, Eulenburg Disease, pc, ized, Elastosis Dystrophica Syndrome, Elective Mutism EVCS, Exaggerated Startle Reaction, Exencephaly, Exog (obsolete), Elective Mutism, Electrocardiogram (ECG or enous Hypertriglyceridemia, Exomphalos-Macroglossia-Gi EKG), Electron Transfer Flavoprotein (ETF) Dehydroge gantism Syndrom, Exophthalmic Goiter, Expanded Rubella nase Deficiency: (GAII & MADD), Electrophysiologic Syndrome, Exstrophy of the Bladder, EXT, External Chon study (EPS), Elephant Nails From Birth, Elephantiasis Con dromatosis Syndrome, Extrahepatic Biliary Atresia, genita Angiomatosa, Hemangiectatic Hypertrophy, Elfin Extramedullary Plasmacytoma, Exudative Retinitis, Eye Facies with Hypercalcemia, Ellis-van Creveld Syndrome, Retraction Syndrome, FA1, FAA, Fabry Disease, FAC, Ellis Van Creveld Syndrome, Embryoma Kidney, Embryo FACB, FACD, FACE, FACF, FACG, FACH, Facial Nerve nal Adenomyosarcoma Kidney, Embryonal Carcinosarcoma Palsy, Facial Paralysis, Facial Ectodermal Dysplasias, Facial Kidney, Embryonal Mixed Tumor Kidney, EMC, Emery Ectodermal Dysplasia, Facio-Scapulo-Humeral Dystrophy, Dreyfus Muscular Dystrophy, Emery-Dreifuss Muscular Facio-Auriculo-Vertebral Spectrum, Facio-cardio-cutaneous Dystrophy, Emery-Dreifuss Syndrome, EMF, EMG Syn syndrome, Facio-Fronto-Nasal Dysplasia, Faciocutaneosk drome, Empty Sella Syndrome, Encephalitis Periaxialis Dif eletal Syndrome, Faciodigitogenital syndrome, Faciogenital US 2007/0286856 A1 Dec. 13, 2007 76 dysplasia, Faciogenitopopliteal Syndrome, Faciopala Type II, FG Syndrome, FGDY, FHS, Fibrin Stabilizing toosseous Syndrome, Faciopalatoosseous Syndrome Type Factor Deficiency, Fibrinase Deficiency, Fibrinoid Degen II, Facioscapulohumeral muscular dystrophy, Factitious eration of Astrocytes, Fibrinoid Leukodystrophy, Fibrinoli Hypoglycemia, Factor VIII Deficiency, Factor IX Defi gase Deficiency, Fibroblastoma Perineural, Fibrocystic Dis ciency, Factor IX Deficiency, Factor XI Deficiency, Factor ease of Pancreas, Fibrodysplasia Ossificans Progressiva, XII deficiency, Factor XIII Deficiency, Fahr Disease, Fahr's Fibroelastic Endocarditis, Fibromyalgia, Fibromyalgia-Fi Disease, Failure of Secretion Gastric Intrinsic Factor, Fair bromyositis, Fibromyositis, Fibrosing Cholangitis, Fibrosi bank Disease, Fallots Tetralogy, Familial Acrogeria, Famil tis, Fibrous Ankylosis of Multiple Joints, Fibrous Cavern ial Acrogeria, Familial Acromicria, Familial Acromicria, ositis, Fibrous Dysplasia, Fibrous Plaques of the Penis, Familial Adenomatous Colon Polyposis, Familial Adenoma Fibrous Sclerosis of the Penis, Fickler-Winkler Type, Fiedler tous Polyposis with Extraintestinal Manifestations, Familial Disease, Fifth Digit Syndrome, Filippi Syndrome, Finnish Alobar Holoprosencephaly, Familial Alpha-Lipoprotein Type Amyloidosis (Type V), First Degree Congenital Heart Deficiency, Familial Amyotrophic Chorea with Acanthocy Block, First and Second Branchial Arch Syndrome, Fis tosis, Familial Arrhythmic Myoclonus, Familial Articular cher's Syndrome, Fish Odor Syndrome, Fissured Tongue, Chondrocalcinosis, Familial Atypical Mole-Malignant Flat Adenoma Syndrome, Flatau-Schilder Disease, Flavin Melanoma Syndrome, Familial Broad Beta Disease, Famil Containing Monooxygenase 2, Floating Beta Disease, Float ial Calcium Gout, Familial Calcium Pyrophosphate Arthr ing-Harbor Syndrome, Floating Spleen, Floppy Infant Syn opathy, Familial Chronic Obstructive Lung Disease, Famil drome, Floppy Valve Syndrome, Fluent aphasia, FMD, ial Continuous Skin Peeling, Familial Cutaneous FMF, FMO Adult Liver Form, FMO2, FND, Focal Dermal Amyloidosis, Familial Dysproteinemia, Familial Emphy Dysplasia Syndrome, Focal Dermal Hypoplasia, Focal Der sema, Familial Enteropathy Microvillus, Familial Foveal mato-Phalangeal Dysplasia, Focal Dystonia, Focal Epilepsy, Retinoschisis, Familial Hibernation Syndrome, Familial Focal Facial Dermal Dysplasia Type II, Focal Neuromyo High Cholesterol, Familial Hemochromatosis, Familial tonia, FODH, Folling Syndrome, Fong Disease, FOP, Forbes High Blood Cholesterol, Familial High-Density Lipoprotein Disease, Forbes-Albright Syndrome. Forestier's Disease, Deficiency, Familial High Serum Cholesterol, Familial Forsius-Eriksson Syndrome (X-Linked), Fothergill Disease, Hyperlipidema, Familial Hypoproteinemia with Lym Fountain Syndrome, Foveal Dystrophy Progressive, FPO phangietatic Enteropathy, Familial Jaundice, Familial Juve Syndrome Type II, FPO, Fraccaro Type Achondrogenesis nile Nephronophtisis-Associated Ocular Anomaly, Familial (Type IB), Fragile X syndrome, Franceschetti-Zwalen-Klein Lichen Amyloidosis (Type IX), Familial Lumbar Stenosis, Syndrome, Francois Dyscephaly Syndrome, Francois Familial Lymphedema Praecox, Familial Mediterranean Neetens Speckled Dystrophy, Flecked Corneal Dystrophy, Fever, Familial Multiple Polyposis, Familial Nuchal Bleb, Fraser Syndrome, FRAXA, FRDA, Fredrickson Type I Familial Paroxysmal Polyserositis, Familial Polyposis Coli, Hyperlipoproteinemia, Freeman-Sheldon Syndrome, Freire Familial Primary Pulmonary Hypertension, Familial Renal Maia Syndrome, Frey's Syndrome, Friedreich's Ataxia, Glycosuria, Familial Splenic Anemia, Familial Startle Dis Friedreich's Ataxia, Friedreich's Disease, Friedreich's ease, Familial Visceral Amyloidosis (Type VIII), FAMMM, Tabes, FRNS, Froelich's Syndrome, Frommel-Chiari Syn FANCA, FANCB, FANCC, FANCD, FANCE, Fanconi Pan drome. Frommel-Chiari Syndrome Lactation-Uterus Atro myelopathy, Fanconi Pancytopenia, Fanconi II, Fanconi's phy, Frontodigital Syndrome, Frontofacionasal Dysostosis, Anemia, Fanconi's Anemia Type I, Fanconi's Anemia Frontofacionasal Dysplasia, Frontonasal Dysplasia, Fronto Complementation Group, Fanconi's Anemia Complementa nasal Dysplasia with Coronal Craniosynostosis, Fructose-1- tion Group A, Fanconi's Anemia Complementation Group Phosphate Aldolase Deficiency, Fructosemia, Fructosuria, B. Fanconi's Anemia Complementation Group C, Fanconi's Fryns Syndrome, FSH, FSHD, FSS, Fuchs Dystrophy, Anemia Complementation Group D, Fanconi's Anemia Fucosidosis Type 1, Fucosidosis Type 2, Fucosidosis Type 3. Complementation Group E, Fanconi's Anemia Complemen Fukuhara Syndrome, Fukuyama Disease, Fukuyama Type tation Group G, Fanconi's Anemia Complementation Group Muscular Dystrophy, Fukuyama Type Muscular Dystrophy, H, Fanconi's Anemia Estren-Dameshek Variant, FANF, Fumarylacetoacetase deficiency, Furrowed Tongue, G Syn FANG, FANH, FAP, FAPG, Farber's Disease, Farber's drome, G6PD Deficiency, G6PD, GAI, GAIIB, GA IIA, GA Lipogranulomatosis, FAS, Fasting Hypoglycemia, Fat-In II, GAII & MADD, Galactorrhea-Amenorrhea Syndrome duced Hyperlipemia, Fatal Granulomatous Disease of Child Nonpuerperal, Galactorrhea-Amenorrhea without Preg hood, Fatty Oxidation Disorders, Fatty Liver with Encepha nancy, Galactosamine-6-Sulfatase Deficiency, Galactose-1- lopathy, FAV, FCH, FCMD, FCS Syndrome, FD, FDH, Phosphate Uridyl Transferase Deficiency, Galactosemia, Febrile Mucocutaneous Syndrome Stevens Johnson Type, GALB Deficiency, Galloway-Mowat Syndrome, Galloway Febrile Neutrophilic Dermatosis Acute, Febrile Seizures, Syndrome, GALT Deficiency, Gammaglobulin Deficiency, Feinberg's syndrome, Feissinger-Leroy-Reiter Syndrome, GAN, Ganglioside Neuraminidase Deficiency, Ganglioside Female Pseudo-Turner Syndrome, Femoral Dysgenesis Sialidase Deficiency, Gangliosidosis GM1 Type 1, Gangli Bilateral-Robin Anomaly, Femoral Dysgenesis Bilateral, osidosis GM2 Type 2, Gangliosidosis Beta Hexosaminidase Femoral Facial Syndrome. Femoral Hypoplasia-Unusual B Deficiency, Gardner Syndrome, Gardner Syndrome, Gar Facies Syndrome, Fetal Alcohol Syndrome, Fetal Anti goylism, Garies-Mason Syndrome, Gasser Syndrome, Gas Convulsant Syndrome, Fetal Cystic Hygroma, Fetal Effects tric Intrinsic Factor Failure of Secretion, Enterocyte Cobal of Alcohol, Fetal Effects of Chickenpox, Fetal Effects of amin, Gastrinoma, Gastritis, Gastroesophageal Laceration Thalidomide, Fetal Effects of Varicella Zoster Virus, Fetal Hemorrhage, Gastrointestinal Polyposis and Ectodermal Endomyocardial Fibrosis, Fetal Face Syndrome, Fetal Iritis Changes, Gastroschisis, Gaucher Disease, Gaucher Syndrome, Fetal Transfusion Syndrome, Fetal Valproate Schlagenhaufer, Gayet-Wernicke Syndrome, GBS, GCA, Syndrome, Fetal Valproic Acid Exposure Syndrome, Fetal GCM Syndrome, GCPS, Gee-Herter Disease, Gee-Thaysen Varicella Infection, Fetal Varicella Zoster Syndrome, FFDD Disease, Gehrig's Disease, Gelineau's Syndrome, Genee US 2007/0286856 A1 Dec. 13, 2007 77

Wiedemann Syndrome, Generalized Dystonia, Generalized Protein Deficiency, Growth Hormone Deficiency, Growth Familial Neuromyotonia, Generalized Fibromatosis, Gener Mental Deficiency Syndrome of Myhre. Growth Retarda alized Flexion Epilepsy, Generalized Glycogenosis, Gener tion-Rieger Anomaly, GRS. Gruber Syndrome, GS, GSD6, alized Glycogenosis, Generalized Hyperhidrosis, General GSD8, GTS, Guanosine Triphosphate-Cyclohydrolase Defi ized Lipofuscinosis, Generalized Myasthenia Gravis, ciency, Guanosine Triphosphate-Cyclohydrolase Defi Generalized Myotonia, Generalized Sporadic Neuromyto ciency, Guenther Porphyria, Guerin-Stem Syndrome, Guil nia, Genetic Disorders, Genital Defects, Genital and Urinary lain-Barré, Guillain-Barre Syndrome, Gunther Disease, H Tract Defects, Genital and Urinary Tract Defects, Gerst Disease, H. Gottron’s Syndrome, H. Gottron’s Syndrome, mann Syndrome, Gerstmann Tetrad, GHBP, GHD, GHR, Habit Spasms, HAE, Hageman Factor Deficiency, Hageman Giant Axonal Disease, Giant Axonal Neuropathy, Giant factor, Haim-Munk Syndrome, Hajdu-Cheney Syndrome, Benign Lymphoma, Giant Cell Glioblastoma Astrocytoma, Hajdu Cheney, HAL Deficiency, Hall-Pallister Syndrome, Giant Cell Arteritis, Giant Cell Disease of the Liver, Giant Hallermann-Streiff-Francois syndrome, Hallermann-Streiff Cell Hepatitis, Giant Cell of Newborns Cirrhosis, Giant Cyst Syndrome, Hallervorden-Spatz Disease, Hallervorden-Spatz of the Retina, Giant Lymph Node Hyperplasia, Giant Plate Syndrome, Hallopeau-Siemens Disease, Hallux Duplication let Syndrome Hereditary, Giant Tongue, gic Macular Dys Postaxial Polydactyly and Absence of Corpus Callosum, trophy, Gilbert's Disease, Gilbert Syndrome, Gilbert-Drey Halushi-Behcet’s Syndrome, Hamartoma of the Lymphatics, fus Syndrome, Gilbert-Dreyfus Syndrome, Gilbert Hand-Schueller-Christian Syndrome, HANE, Hanhart Syn Lereboullet Syndrome, Gilford Syndrome, Gilles de la drome, Happy Puppet Syndrome, Harada Syndrome, HARD Tourette's syndrome, Gillespie Syndrome, Gingival Fibro +/-E Syndrome, HARD Syndrome, Hare Lip, Harlequin matosis-Abnormal Fingers Nails Nose Ear Splenomegaly, Fetus, Harlequin Type DOC 6, Harlequin Type Ichthyosis, GLADeficiency, GLA, GLB1, Glioma Retina, Global apha Harlequin Type Ichthyosis, Harley Syndrome, Harrington sia, Globoid Leukodystrophy, Glossoptosis Micrognathia Syndrome, Hart Syndrome, Hartnup Disease, Hartnup Dis and Cleft Palate, Glucocerebrosidase deficiency, Glucocer order, Hartnup Syndrome, Hashimoto's Disease, Hash ebrosidosis, Glucose-6-Phosphate Dehydrogenase Defi imoto-Pritzker Syndrome, Hashimoto's Syndrome, Hash ciency, Glucose-6-Phosphate Tranport Defect, Glucose-6- imoto's Thyroiditis, Hashimoto's Thyroiditis, Hashimoto Phosphate Translocase Deficiency, Glucose-G-Phosphatase Pritzker Syndrome, Hay Well’s Syndrome, Hay-Wells Deficiency, Glucose-Galactose Malabsorption, Glucose-Ga Syndrome of Ectodermal Dysplasia, HCMM, HCP, HCTD, lactose Malabsorption, Glucosyl Ceramide Lipidosis, Glu HD, Heart-Hand Syndrome (Holt-Oram Type), Heart Dis taric Aciduria I. Glutaric Acidemia I. Glutaric Acidemia II, ease, Hecht Syndrome, HED, Heerferdt-Waldenstrom and Glutaric Aciduria II, Glutaric Aciduria Type II, Glutaric Lofgren's Syndromes, Hegglin's Disease, Heinrichsbauer Aciduria Type III, Glutaricacidemia I, Glutaricacidemia II, Syndrome, Hemangiomas, Hemangioma Familial, Heman Glutaricaciduria I, Glutaricaciduria II, Glutaricaciduria Type gioma-Thrombocytopenia Syndrome, Hemangiomatosis IIA, Glutaricaciduria Type IIB, Glutaryl-CoA Dehydroge Chondrodystrophica, Hemangiomatous Branchial Clefts nase Deficiency, Glutaurate-Aspartate Transport Defect, Lip Pseudocleft Syndrome, Hemifacial Microsomia, Gluten-Sensitive Enteropathy, Glycogen Disease of Muscle Hemimegalencephaly, Hemiparesis of Cerebral Palsy, Type VII, Glycogen Storage Disease I, Glycogen Storage Hemiplegia of Cerebral Palsy, Hemisection of the Spinal Disease III, Glycogen Storage Disease IV. Glycogen Storage Cord, Hemochromatosis, Hemochromatosis Syndrome, Disease Type V. Glycogen Storage Disease VI, Glycogen Hemodialysis-Related Amyloidosis, Hemoglobin Lepore Storage Disease VII, Glycogen Storage Disease VIII, Gly Syndromes, Hemolytic Anemia of Newborn, Hemolytic cogen Storage Disease Type II, Glycogen Storage Disease Cold Antibody Anemia, Hemolytic Disease of Newborn, Type II, Glycogenosis, Glycogenosis Type I, Glycogenosis Hemolytic-Uremic Syndrome, Hemolytic-Uremic Syn Type IA, Glycogenosis Type IB, Glycogenosis Type II, drome, Hemophilia, Hemophilia A, Hemophilia B, Hemo Glycogenosis Type II, Glycogenosis Type III, Glycogenosis philia B Factor IX, Hemophilia C, Hemorrhagic Dystrophic Type IV. Glycogenosis Type V. Glycogenosis Type VI, Thrombocytopenia, Hemorrhagica Aleukia, Hemosiderosis, Glycogenosis Type VII, Glycogenosis Type VIII, Glycolic Hepatic Fructokinase Deficiency, Hepatic Phosphorylase Aciduria, Glycolic Aciduria, Glycolipid Lipidosis, GM2 Kinase Deficiency, Hepatic Porphyria, Hepatic Porphyrias, Gangliosidosis Type 1, GM2 Gangliosidosis Type 1, Hepatic Porphyrias, Hepatic Veno-Occlusive Disease, GNPTA, Goitrous Autoimmune Thyroiditis, Goldenhar Hepato-Renal Syndrome, Hepatolenticular Degeneration, Syndrome, Goldenhar-Gorlin Syndrome, Goldscheider's Hepatophosphorylase Deficiency, Hepatorenal Glycogeno Disease, Goltz Syndrome, Goltz-Gorlin Syndrome, Gonadal sis, Hepatorenal Syndrome, Hepatorenal Tyrosinemia, Dysgenesis 45 X, Gonadal Dysgenesis XO, Goniodysgen Hereditary Acromelalgia, Hereditary Alkaptonuria, Heredi esis-Hypodontia, Goodman Syndrome, Goodman, Goodpas tary Amyloidosis, Hereditary Angioedema, Hereditary ture Syndrome, Gordon Syndrome, Gorlin’s Syndrome, Areflexic Dystasia, Heredopathia Atactica Polyneuritifor Gorlin-Chaudhry-Moss Syndrome, Gottron Erythrokerato mis, Hereditary Ataxia, Hereditary Ataxia, Hereditary dermia Congenitalis Progressiva Symmetrica, Gottron’s Ataxia Friedrich's Type, Hereditary Benign Acanthosis Nig Syndrome, Gougerot-Carteaud Syndrome, Grand Mal Epi ricans, Hereditary Cerebellar Ataxia, Hereditary Chorea, lepsy, Granular Type Corneal Dystrophy, Granulomatous Hereditary Chronic Progressive Chorea, Hereditary Connec Arteritis, Granulomatous Colitis, Granulomatous Dermatitis tive Tissue Disorders, Hereditary Coproporphyria, Heredi with Eosinophilia, Granulomatous Ileitis, Graves Disease, tary Coproporphyria Porphyria, Hereditary Cutaneous Graves Hyperthyroidism, Graves Disease, Greig Cepha Malignant Melanoma, Hereditary Deafness-Retinitis Pig lopolysyndactyly Syndrome, Groenouw Type I Corneal mentosa, Heritable Disorder of Zinc Deficiency, Hereditary Dystrophy, Groenouw Type II Corneal Dystrophy, Gron DNS, Hereditary Dystopic Lipidosis, Hereditary Emphy blad-Strandberg Syndrome, Grotton Syndrome, Growth sema, Hereditary Fructose Intolerance, Hereditary Hemor Hormone Receptor Deficiency, Growth Hormone Binding rhagic Telangiectasia, Hereditary Hemorrhagic Telangiecta US 2007/0286856 A1 Dec. 13, 2007 sia Type I, Hereditary Hemorrhagic Telangiectasia Type II, Syndrome, Hutterite Syndrome Bowen-Conradi Type, Hya Hereditary Hemorrhagic Telangiectasia Type III, Hereditary line Panneuropathy, Hydranencephaly, Hydrocephalus, Hyperuricemia and Choreoathetosis Syndrome, Hereditary Hydrocephalus Agyria and Retinal Dysplasia, Hydroceph Leptocytosis Major, Hereditary Leptocytosis Minor, Heredi alus Internal Dandy-Walker Type, Hydrocephalus Noncom tary Lymphedema, Hereditary Lymphedema Tarda, Heredi municating Dandy-Walker Type, Hydrocephaly, Hydro tary Lymphedema Type I, Hereditary Lymphedema Type II, nephrosis With Peculiar Facial Expression, Hydroxylase Hereditary Motor Sensory Neuropathy, Hereditary Motor Deficiency, Hygroma Colli, Hyper-IgE Syndrome, Hyper Sensory Neuropathy I, Hereditary Motor Sensory Neuropa IgM Syndrome, Hyper IgM Syndrome, Hyperaldoster thy Type III, Hereditary Nephritis, Hereditary Nephritis and onism, Hyperaldosteronism With Hypokalemic Alkatosis, Nerve Deafness, Hereditary Nephropathic Amyloidosis, Hyperaldosteronism Without Hypertension, Hyperammone Hereditary Nephropathy and Deafness, Hereditary Nonpoly mia, Hyperammonemia Due to Carbamylphosphate Syn posis Colorectal Cancer, Hereditary Nonpolyposis Colorec thetase Deficiency, Hyperammonemia Due to Ornithine tal Carcinoma, Hereditary Nonspherocytic Hemolytic Ane Transcarbamylase Deficiency, Hyperammonemia Type II, mia, Hereditary Onychoosteodysplasia, Hereditary Optic Hyper-Beta Carnosinemia, Hyperbilirubinemia I, Hyperbi Neuroretinopathy, Hereditary Polyposis Coli, Hereditary lirubinemia II, Hypercalcemia Familial with Nephrocalci Sensory and Autonomic Neuropathy Type I, Hereditary nosis and Indicanuria, Hypercalcemia-Supravalvar Aortic Sensory and Autonomic Neuropathy Type II, Hereditary Stenosis, Hypercalciuric Rickets, Hypercapnic acidosis, Sensory and Autonomic Neuropathy Type III, Hereditary Hypercatabolic Protein-Losing Enteropathy, Hyperchlo Sensory Motor Neuropathy, Hereditary Sensory Neuropathy remic acidosis, Hypercholesterolemia, Hypercholester type I, Hereditary Sensory Neuropathy Type I, Hereditary olemia Type IV. Hyperchylomicronemia, Hypercystinuria, Sensory Neuropathy Type II, Hereditary Sensory Neuropa Hyperekplexia, Hyperextensible joints, Hyperglobulinemic thy Type III, Hereditary Sensory Radicular Neuropathy Type Purpura, Hyperglycinemia with Ketoacidosis and Lactic I, Hereditary Sensory Radicular Neuropathy Type I, Heredi Acidosis Propionic Type, Hyperglycinemia Nonketotic, tary Sensory Radicular Neuropathy Type II, Hereditary Site Hypergonadotropic Hypogonadism, Hyperimmunoglobulin Specific Cancer, Hereditary Spherocytic Hemolytic Anemia, E Syndrome, Hyperimmunoglobulin E-Recurrent Infection Hereditary Spherocytosis, Hereditary Tyrosinemia Type 1, Syndrome, Hyperimmunoglobulinemia E-Staphylococcal, Heritable Connective Tissue Disorders, Herlitz Syndrome, Hyperkalemia, Hyperkinetic Syndrome, Hyperlipemic Hermans-Herzberg Phakomatosis, Hermansky-Pudlak Syn Retinitis, Hyperlipidemia I, Hyperlipidemia IV. Hyperlipo drome, Hermansky-Pudlak Syndrome, Hermaphroditism, proteinemia Type I, Hyperlipoproteinemia Type III, Hyper Herpes Zoster, Herpes Iris Stevens-Johnson Type, Hers lipoproteinemia Type IV. Hyperoxaluria, Hyperphalangy Disease, Heterozygous Beta Thalassemia, Hexoaminidase Clinodactyly of Index Finger with Pierre Robin Syndrome, Alpha-Subunit Deficiency (Variant B), Hexoaminidase Hyperphenylalanemia, Hyperplastic Epidermolysis Bullosa, Alpha-Subunit Deficiency (Variant B), HFA. HFM, HGPS, Hyperpnea, Hyperpotassemia, Hyperprebeta-Lipoproteine HH, HHHO, HHRH, HHT, Hiatal Hernia-Microcephaly mia, Hyperprolinemia Type I, Hyperprolinemia Type II, Nephrosis Galloway Type, Hidradenitis Suppurativa, Hid Hypersplenism, Hypertelorism with Esophageal Abnormali rosadenitis Axillaris, Hidrosadenitis Suppurativa, Hidrotic ties and Hypospadias, Hypertelorism-Hypospadias Syn Ectodermal Dysplasias, HIE Syndrome, High Imperforate drome, Hypertrophic Cardiomyopathy, Hypertrophic Inter Anus, High Potassium, High Scapula, HIM, Hirschsprung's stitial Neuropathy, Hypertrophic Interstitial Neuritis, Disease, Hirschsprung's Disease Acquired, Hirschsprung Hypertrophic Interstitial Radiculoneuropathy, Hypertrophic Disease Polydactyly of Ulnar & Big Toe and VSD, Hirschs Neuropathy of Refsum, Hypertrophic Obstructive Cardio prung Disease with Type D Brachydactyly, Hirsutism, HIS myopathy, Hyperuricemia Choreoathetosis Self-multilation Deficiency. Histidine Ammonia-Lyase (HAL) Deficiency, Syndrome, Hyperuricemia-Oligophrenia, Hypervalinemia, Histidase Deficiency. Histidinemia, Histidinemia, Histiocy Hypocalcified (Hypomineralized) Type, Hypochondrogen tosis, Histiocytosis X, HLHS, HLP Type II, HMG, HMI, esis, Hypochrondroplasia, Hypogammaglobulinemia, HMSN I, HNHA, HOCM, Hodgkin Disease, Hodgkin’s Hypogammaglobulinemia Transient of Infancy, Hypogenital Disease, Hodgkin’s Lymphoma, Hollaender-Simons Dis Dystrophy with Diabetic Tendency, Hypoglossia-Hypodac ease, Holmes-Adie Syndrome, Holocarboxylase Synthetase tylia Syndrome, Hypoglycemia, Hypoglycemia, Exogenous Deficiency, Holoprosencephaly, Holoprosencephaly Malfor Hypoglycemia, Hypoglycemia with Macroglossia, mation Complex, Holoprosencephaly Sequence, Holt-Oram Hypoglycosylation Syndrome Type 1a, Hypoglycosylation Syndrome, Holt-Oram Type Heart-Hand Syndrome, Syndrome Type 1a, Hypogonadism with Anosmia, Hypogo Homocystinemia, Homocystinuria, Homocystinuria, nadotropic Hypogonadism and Anosmia, Hypohidrotic Homogentisic Acid Oxidase Deficiency, Homogentisic Aci Ectodermal Dysplasia, Hypohidrotic Ectodermal Dysplasia dura, Homozygous Alpha-1-Antitrypsin Deficiency, HOOD, Autosomal Dominant type, Hypohidrotic Ectodermal Dys Horner Syndrome, Horton's disease, HOS, HOS1, Houston plasias Autorecessive, Hypokalemia, Hypokalemic Alkalo Harris Type Achrondrogenesis (Type IA), HPS, HRS, HS, sis with Hypercalciuria, Hypokalemic Syndrome, Hypolac HS, HS, HS, HS, HSAN Type I, HSAN Type II, HSAN-III, tasia, Hypomaturation Type (Snow-Capped Teeth), HSMN, HSMN Type III, HSN I, HSN-III, Huebner-Herter Hypomelanosis of Ito, Hypomelia-Hypotrichosis-Facial Disease, Hunner's Patch, Hunner's Ulcer, Hunter Syn Hemangioma Syndrome, Hypomyelination Neuropathy, drome, Hunter Syndrome, Hunter-Thompson Type Acrome Hypoparathyroidism, Hypophosphatasia, Hypophos somelic Dysplasia, Huntington's Chorea, Huntington's Dis phatemic Rickets with Hypercalcemia, Hypopigmentation, ease, Hurler Disease, Hurler Disease, Hurler Syndrome, Hypopigmentation, Hypopigmented macular lesion, Hypo Hurler-Scheie Syndrome, HUS, HUS, Hutchinson-Gilford plasia of the Depressor Anguli Oris Muscle with Cardiac Progeria Syndrome, Hutchinson-Gilford Syndrome, Hutch Defects, Hypoplastic Anemia, Hypoplastic Congenital Ane inson-Weber-Peutz Syndrome, Hutchinson-Weber-Peutz mia, Hypoplastic Chondrodystrophy, Hypoplastic Enamel US 2007/0286856 A1 Dec. 13, 2007 79

Onycholysis-Hypohidrosis, Hypoplastic (Hypoplastic-Ex loidosis (Type II), Indolent systemic mastocytosis, Infantile plastic) Type, Hypoplastic Left Heart Syndrome, Acquired Aphasia, Infantile Autosomal Recessive Polycys Hypoplastic Left Heart Syndrome, Hypoplastic-Tripha tic Kidney Disease, Infantile Beriberi, Infantile Cerebral langeal Thumbs, Hypopotassemia Syndrome, Hypospadias Ganglioside, Infantile Cerebral Ganglioside, Infantile Cere Dysphagia Syndrome, Hyposmia, Hypothalamic Hamarto bral Paralysis, Infantile Cystinosis, Infantile Epileptic, blastoma Hypopituitarism Imperforate Anus Polydactyly, Infantile Fanconi Syndrome with Cystinosis, Infantile Finn Hypothalamic Infantilism-Obesity, Hypothyroidism, Hypo ish Type Neuronal Ceroid Lipofuscinosis, Infantile Gaucher tonia-Hypomentia-Hypogonadism-Obesity Syndrome, Disease, Infantile Hypoglycemia, Infantile Hypophasphata Hypoxanthine-Guanine Phosphoribosyltran?ferase Defect sia, Infantile Lobar Emphysema, Infantile Myoclonic (Complete Absense of), I-Cell Disease, Iatrogenic Hypogly Encephalopathy, Infantile Myoclonic Encephalopathy and cemia, IBGC, IBIDS Syndrome, IBM, IBS, IC, I-Cell Dis Polymyoclonia, Infantile Myofibromatosis, Infantile Necro ease, ICD, ICE Syndrome Cogan-Reese Type, Icelandic tizing Encephalopathy, Infantile Neuronal Ceroid Lipofus Type Amyloidosis (Type VI), I-Cell Disease, Ichthyosiform cinosis, Infantile Neuroaxonal Dystrophy, Infantile Onset Erythroderma Corneal Involvement and Deafness, Ichthy Schindler Disease, Infantile Phytanic Acid Storage Disease, osiform Erythroderma Hair Abnormality Growth and Men, Infantile Refsum Disease (IRD), Infantile Sipoidosis GM-2 Ichthyosiform Erythroderma with Leukocyte Vacuolation, Gangliosideosis (Type S), Infantile Sipoidosis GM-2 Gan Ichthyosis, Ichthyosis Congenita, Ichthyosis Congenital gliosideosis (Type S, Infantile Sleep Apnea, Infantile with Trichothiodystrophy, Ichthyosis Hystrix, Ichthyosis Spasms, Infantile Spinal Muscular Atrophy (all types), Hystrix Gravior, Ichthyosis Linearis Circumflexa, Ichthyo Infantile Spinal Muscular Atrophy ALS, Infantile Spinal sis Simplex, Ichthyosis Tay Syndrome, Ichthyosis Vulgaris, Muscular Atrophy Type I, Infantile Type Neuronal Ceroid Ichthyosis Vulgaris, Ichthyotic Neutral Lipid Storage Dis Lipofuscinosis, Infectious Jaundice, Inflammatory Breast ease, Icteric Leptospirosis, Icterohemorrhagic Leptospirosis, Cancer, Inflammatory Linear Nevus Sebaceous Syndrome, Icterus (Chronic Familial), Icterus Gravis Neonatorum, Ict Iniencephaly, Insulin Resistant Acanthosis Nigricans, Insu erus Intermittens Juvenalis, Idiopathic Alveolar Hypoventi lin Lipodystrophy, Insulin dependent Diabetes, Intention lation, Idiopathic Amyloidosis, Idiopathic Arteritis of Taka Myoclonus, Intermediate Cystinosis, Intermediate Maple yasu, Idiopathic Basal Ganglia Calcification (IBGC), Syrup Urine Disease, Intermittent Ataxia with Pyruvate Idiopathic Brachial Plexus Neuropathy, Idiopathic Cervical Dehydrogenase Deficiency, Intermittent Ataxia with Pyru Dystonia, Idiopathic Dilatation of the Pulmonary Artery, vate Dehydrogenase Deficiency, Intermittent Maple Syrup Idiopathic Dilatation of the Pulmonary Artery, Idiopathic Urine Disease, Internal Hydrocephalus, Interstitial Cystitis, Facial Palsy, Idiopathic Familial Hyperlipemia, Idiopathic Interstitial Deletion of 4q Included, Interstitial Deletion of Hypertrophic Subaortic Stenosis, Idiopathic Hypoproteine 4q-Included, Intestinal Lipodystrophy, Intestinal Lipophagic mia, Idiopathic Immunoglobulin Deficiency, Idiopathic Granulomatosis, Intestinal Lymphangiectasia, Intestinal Neonatal Hepatitis, Idiopathic Non-Specific Ulcerative Polyposis I, Intestinal Polyposis II, Intestinal Polyposis II, Colitis, Idiopathic Non-Specific Ulcerative Colitis, Idio Intestinal Polyposis III, Intestinal Polyposis-Cutaneous Pig pathic Peripheral Periphlebitis, Idiopathic Pulmonary Fibro mentation Syndrome, Intestinal Polyposis-Cutaneous Pig sis, Idiopathic Refractory Sideroblastic Anemia, Idiopathic mentation Syndrome, Intestinal Pseudoobstruction with Refractory Sideroblastic Anemia, Idiopathic Renal Hema External Opthalmoplegia, Intracranial Neoplasm, Intracra turia, Idiopathic Steatorrhea, Idiopathic Thrombocythemia, nial Tumors, Intracranial Vascular Malformations, Intrauter Idiopathic Thrombocythemia, Idiopathic Thrombocytopenic ine Dwarfism, Intrauterine Synechiae, Inverted Smile And Purpura, Idiopathic Thrombocytopenia Purpura (ITP), Occult Neuropathic Bladder, Iowa Type Amyloidosis (Type IDPA, IDPA, IgA Nephropathy, IgA Nephropathy, IHSS, IV), IP, IPA, Iridocorneal Endothelial Syndrome, Iridocor Ileitis, Ileocolitis, Illinois Type Amyloidosis, ILS, IM, neal Endothelial (ICE) Syndrome Cogan-Resse Type, Iri IMD2, IMD5, IMD5, Immune Defect due to Absence of dogoniodysgenesis With Somatic Anomalies, Iris Atrophy Thymus, Immune Hemolytic Anemia Paroxysmal Cold, with Corneal Edema and Glaucoma, Iris Nevus Syndrome, Immunodeficiency with Ataxia Telangiectasia, Immunode Iron Overload Anemia, Iron Overload Anemia, Iron Over ficiency Cellular with Abnormal Immunoglobulin Synthesis, load Disease, Irritable Bowel Syndrome, Irritable Colon Immunodeficiency Common Variable Unclassifiable. Immu Syndrome, Isaacs Syndrome, Isaacs-Merten Syndrome, nodeficiency with Hyper-IgM, Immunodeficiency with Leu Ischemic Cardio myopathy, Isolated Lissencephaly kopenia, Immunodeficiency-2, Immunodeficiency-5 Sequence, Isoleucine 33 Amyloidosis, Isovaleric Acid CoA (IMD5). Immunoglobulin Deficiency, Imperforate Anus, Dehydrogenase Deficiency, Isovaleric Acidaemia, Isovaleri Imperforate Anus with Hand Foot and Ear Anomalies, cacidemia, Isovaleryl CoA Carboxylase Deficiency, ITO Imperforate Nasolacrimal Duct and Premature Aging Syn Hypomelanosis, ITO, ITP, ITP, IVA, Ivemark Syndrome, drome, Impotent Neutrophil Syndrome, Inability To Open Iwanoff Cysts, Jackknife Convulsion, Jackson-Weiss Cran Mouth Completely And Short Finger-Flexor, INAD, INAD, iosynostosis, Jackson-Weiss Syndrome, Jacksonian Epi Inborn Error of Urea Synthesis Arginase Type, Inborn Error lepsy, Jacobsen Syndrome, Jadassohn-Lewandowsky Syn of Urea Synthesis Arginino Succinic Type, Inborn Errors of drome, Jaffe-Lichenstein Disease, Jakob's Disease, Jakob Urea Synthesis Carbamyl Phosphate Type, Inborn Error of Creutzfeldt Disease, Janeway I. Janeway Urea Synthesis Citrullinemia Type, Inborn Errors of Urea Dysgammaglobulinemia, Jansen Metaphyseal Dysostosis, Synthesis Glutamate Synthetase Type, INCL, Inclusion Jansen Type Metaphyseal Chondrodysplasia, Jarcho-Levin body myositis, Incomplete Atrioventricular Septal Defect, Syndrome, Jaw-Winking, JBS. JBS. JDMS, Jegher's Syn Incomplete Testicular Feminization, Incomplete Testicular drome, Jegher's Syndrome, Jejunal Atresia, Jeunitis, Feminization, Incontinentia Pigmenti, Incontinentia Pig Jejunoileitis, Jervell and Lange-Nielsen Syndrome, Jeune menti, Incontinenti Pigmenti Achromians, Index Finger Syndrome, JMS, Job Syndrome, Job-Buckley Syndrome, Anomaly with Pierre Robin Syndrome, Indiana Type Amy Johanson-Blizzard Syndrome, John Dalton, Johnson US 2007/0286856 A1 Dec. 13, 2007

Stevens Disease, Jonston's Alopecia, Joseph’s Disease, Paralysis, KWS, L-3-Hydroxy-Acyl-CoA Dehydrogenase Joseph’s Disease Type I, Joseph's Disease Type II, Joseph's (LCHAD) Deficiency, Laband Syndrome, Labhart-Willi Disease Type III, Joubert Syndrome, Joubert-Bolthauser Syndrome, Labyrinthine Syndrome, Labyrinthine Hydrops, Syndrome, JRA, JRA, Juberg Hayward Syndrome, Juberg Lacrimo-Auriculo-Dento-Digital Syndrome, Lactase Iso Marsidi Syndrome, Juberg-Marsidi Mental Retardation Syn lated Intolerance, Lactase Deficiency, Lactation-Uterus drome, Jumping Frenchmen, Jumping Frenchmen of Maine, Atrophy, Lactic Acidosis Leber Hereditary Optic Neuropa Juvenile Arthritis, Juvenile Arthritis, Juvenile Autosomal thy, Lactic and Pyruvate Acidemia with Carbohydrate Sen Recessive Polycystic Kidney Disease, Juvenile Cystinosis, sitivity, Lactic and Pyruvate Acidemia with Episodic Ataxia Juvenile (Childhood) Dermatomyositis (JDMS), Juvenile and Weakness, Lactic and Pyruvate Acidemia with Carbo Diabetes, Juvenile Gaucher Disease, Juvenile Gout Chore hydrate Sensitivity, Lactic and Pyruvate, Lactic acidosis, oathetosis and Mental Retardation Syndrome, Juvenile Lactose Intolerance of Adulthood, Lactose Intolerance, Lac Intestinal Malabsorption of Vit B12, Juvenile Intestinal tose Intolerance of Childhood, Lactose Intolerance, LADD Malabsorption of Vitamin B12, Juvenile Macular Degenera Syndrome, LADD, Lafora Disease Included, Lafora Body tion, Juvenile Pernicious Anemia, Juvenile Retinoschisis, Disease, Laki-Lorand Factor Deficiency, LAM, Lambert Juvenile Rheumatoid Arthritis, Juvenile Rheumatoid Arthri Type Ichthyosis, Lambert-Eaton Syndrome, Lambert-Eaton tis, Juvenile Spinal Muscular Atrophy Included, Juvenile Myasthenic Syndrome, Lamellar Recessive Ichthyosis, Spinal Muscular Atrophy ALS Included, Juvenile Spinal Lamellar Recessive Ichthyosis, Lamellar Ichthyosis, Lamel Muscular Atrophy Type III, Juxta-Articular Adiposis Dolo lar Recessive Ichthyosis, Lancereaux-Mathieu-Weil Spiro rosa, Juxta-Articular Adiposis Dolorosa, Juxtaglomerular chetosis, Landau-Kleffner Syndrome, Landouzy Dejerine Hyperplasia, Kabuki Make-Up Syndrome, Kahler Disease, Muscular Dystrophy, Landry Ascending Paralysis, Langer Kallmann Syndrome, Kanner Syndrome, Kanzaki Disease, Salidino Type Achondrogensis (Type II), Langer Giedion Kaposi Disease (not Kaposi Sarcoma), Kappa Light Chain Syndrome, Langerhans-Cell Granulomatosis, Langerhans Deficiency, Karsch-Neugebauer Syndrome, Karsch-Neuge Cell Histiocytosis (LCH), Large Atrial and Ventricular bauer Syndrome, Kartagener Syndrome-Chronic Sinobron Defect, Laron Dwarfism, Laron Type Pituitary Dwarfism, chial Disease and Dextrocardia, Kartagener Triad, Kasa Larsen Syndrome, Laryngeal Dystonia, Latah (Observed in bach-Merritt Syndrome, Kast Syndrome, Kawasaki Disease, Malaysia), Late Infantile Neuroaxonal Dystrophy, Late Kawasaki Syndrome. KBG Syndrome, KD, Kearns-Sayre Infantile Neuroaxonal Dystrophy, Late Onset Cockayne Disease, Kearns-Sayre Syndrome, Kearns-Sayre Syndrome, Syndrome Type III (Type C), Late-Onset Dystonia, Late Kennedy Disease, Kennedy Syndrome, Kennedy Type Spi Onset Immunoglobulin Deficiency, Late-Onset Immunoglo nal and Bulbar Muscular Atrophy, Kennedy-Stefanis Dis bulin Deficiency, Late Onset Pelizaeus-Merzbacher Brain ease, Kenny Disease, Kenny Syndrome, Kenny Type Tubu Sclerosis, Lattice Corneal Dystrophy, Lattice Dystrophy, lar Stenosis, Kenny-Caffe Syndrome, Kera. Palmoplant. Launois-Bensaude, Launois-Cleret Syndrome, Laurence Con. Pes Planus Ony. Periodon. Arach. Keratitis Ichthyosis Syndrome, Laurence-Moon Syndrome, Laurence-Moon/ Deafness Syndrome, Keratoconus, Keratoconus, Keratoco Bardet-Biedl, Lawrence-Seip Syndrome, LCA, LCAD Defi nus Posticus Circumscriptus, Keratolysis, Keratolysis Exfo ciency, LCAD, LCAD, LCAD, LCADH Deficiency, LCH, liativa Congenita, Keratolytic Winter Erythema, Keratoma LCHAD, LCHAD, LCPD, Le Jeune Syndrome, Leband lacia, Keratosis Follicularis, Keratosis Follicularis Spinulosa Syndrome, Leber's Amaurosis, Leber's Congenital Amau Decalvans, Keratosis Follicularis Spinulosa Decalvans Ich rosis, Congenital Absence of the Rods and Cones, Leber's thyosis, Keratosis Nigricans, Keratosis Palmoplantaris with Congenital Tapetoretinal Degeneration, Leber's Congenital Periodontopathia and Onychogryposis, Keratosis Pal Tapetoretinal Dysplasia, Leber's Disease, Leber's Optic moplantaris Congenital Pes Planus Onychogryposis Period Atrophy, Leber's Optic Neuropathy, Left Ventricular Fibro ontosis Arachnodactyly, Keratosis Palmoplantaris Congeni sis, Leg Ulcer, Legg-Calve-Perthes Disease, Leigh's Dis tal, Pes Planus, Onychogryphosis, Periodontosis, ease, Leigh's Disease, Leigh's Syndrome, Leigh's Syn Arachnodactyly, Acroosteolysis, Keratosis Rubra Figurata, drome (Subacute Necrotizing Encephalomyelopathy), Leigh Keratosis Seborrheica, Ketoacid Decarboxylase Deficiency, Necrotizing Encephalopathy, Lennox-Gastaut Syndrome, Ketoaciduria, Ketotic Glycinemia, Ketotic Glycinemia, Lentigio-Polypose-Digestive Syndrome, Lentigio-Poly KFS, KID Syndrome, Kidney Agenesis, Kidneys Cystic pose-Digestive Syndrome, Lenz, Dysmorphogenetic Syn Retinal Aplasia Joubert Syndrome, Killian Syndrome, Kil drome, Lenz, Dysplasia, Lenz, Microphthalmia Syndrome, lian/Teschler-Nicola Syndrome, Kiloh-Nevin syndrome III, Lenz, Syndrome, LEOPARD Syndrome, Leprechaunism, Kinky Hair Disease, Kinsbourne Syndrome, Kleeb Leprechaunism, Leptomeningeal Angiomatosis, Leptospiral lattschadel Deformity, Kleine-Levin Syndrome, Kleine Jaundice, Leri-Weill Disease, Leri-Weil Dyschondrosteosis, Levin Hibernation Syndrome, Klinefelter, Klippel-Feil Syn Leri-Weil Syndrome, LermoyeZ Syndrome, Leroy Disease, drome, Klippel-Feil Syndrome Type I, Klippel-Feil Lesch Nyhan Syndrome, Lethal Infantile Cardiomyopathy, Syndrome Type II, Klippel-Feil Syndrome Type III, Klippel Lethal Neonatal Dwarfism, Lethal Osteochondrodysplasia, Trenaunay Syndrome, Klippel-Trenaunay-Weber Syn Letterer-Siwe Disease, Leukocytic Anomaly Albinism, Leu drome, Kluver-Bucy Syndrome, KMS, Kniest Dysplasia, kocytic Inclusions with Platelet Abnormality, Leukodystro Kniest Syndrome, Kobner's Disease, Koebberling-Dunni phy, Leukodystrophy with Rosenthal Fibers, Leukoencepha gan Syndrome, Kohlmeier-Degos Disease, Kok Disease, litis Periaxialis Concentric, Levine-Critchley Syndrome, Korsakoff Psychosis, Korsakoff’s Syndrome, Krabbe's Dis Levulosuria, Levy-Hollister Syndrome, LGMD, LGS, ease Included, Krabbe's Leukodystrophy, Kramer Syn LHON, LHON, LIC, Lichen Ruber Acuminatus, Lichen drome, KSS, KSS, KTS, KTW Syndrome, Kufs Disease, Acuminatus, Lichen Amyloidosis, Lichen Planus, Lichen Kugelberg-Welander Disease, Kugelberg-Welander Disease, Psoriasis, Lignac-Debre-Fanconi Syndrome, Lignac-Fan Kugelberg-Welander Syndrome, Kugelberg-Welander Syn coni Syndrome, Ligneous Conjunctivitis, Limb-Girdle Mus drome, Kugelberg-Welander Syndrome, Kussmaul-Landry cular Dystrophy, Limb Girdle Muscular Dystrophy, Limb US 2007/0286856 A1 Dec. 13, 2007

Malformations-Dento-Digital Syndrome, Limit Dextrinosis, die de Tics, Male Malformation of Limbs and Kidneys, Male Linear Nevoid Hypermelanosis, Linear Nevus Sebacous Turner Syndrome, Malignant Acanthosis, Malignant Acan Syndrome, Linear Scleroderma, Linear Sebaceous Nevus thosis Nigricans, Malignant Astrocytoma, Malignant Atro Sequence, Linear Sebaceous Nevus Syndrome, Lingua Fis phic Papulosis, Malignant Fever, Malignant Hyperphenyla Surata, Lingua Plicata, Lingua Scrotalis, Linguofacial Dys laninemia, Malignant Hyperphenylalaninemia, Malignant kinesia, Lip Pseudocleft-hemangiomatous Branchial Cyst Hyperpyrexia, Malignant Hyperthermia, Malignant Mela Syndrome, Lipid Granulomatosis, Lipid Histiocytosis, Lipid noma, Malignant Tumors of the Central Nervous System, Kerasin Type, Lipid Storage Disease, Lipid-Storage myopa Mallory-Weiss Laceration, Mallory-Weiss Tear, Mallory thy Associated with SCAD Deficiency, Lipidosis Ganglio Weiss Syndrome, Mammary Paget’s Disease, Mandibular side Infantile, Lipidosis Ganglioside Infantile, Lipoatrophic Ameloblastoma, Mandibulofacial Dysostosis, Mannosido Diabetes Mellitus, Lipodystrophy, Lipoid Corneal Dystro sis, Map-Dot-Fingerprint Type Corneal Dystrophy, Maple phy, Lipoid Hyperplasia-Male Pseudohermaphroditism, Syrup Urine Disease, Maple Syrup Urine Disease, Marble Lipoid Hyperplasia-Male Pseudohermaphroditism, Lipoma Bones, Marchiafava-Micheli Syndrome, Marcus Gunn Jaw tosis of Pancreas Congenital, Lipomucopolysaccharidosis Winking Syndrome, Marcus Gunn Phenomenon, Marcus Type I, Lipomyelomeningocele, Lipoprotein Lipase Defi Gunn Ptosis with jaw-winking, Marcus Gunn Syndrome, ciency Familial, LIS, LIS1, Lissencephaly 1, Lissencephaly Marcus Gunn (Jaw-Winking) Syndrome, Marcus Gunn Pto Type I, Lissencephaly variants with agenesis of the corpus sis (with jaw-winking), Marden-Walker Syndrome, Marden callosum cerebellar hypoplasia or other anomalies, Little Walker Type Connective Tissue Disorder, Marfan's Abiotro Disease, Liver Phosphorylase Deficiency, LKS, LM Syn phy, Marfan-Achard syndrome, Marfan Syndrome, Marfan drome, Lobar Atrophy, Lobar Atrophy of the Brain, Lobar Syndrome, Marfan's Syndrome I, Marfan's Variant, Marfan Holoprosencephaly, Lobar Tension Emphysema in Infancy, Achard syndrome, Marfanoid Hypermobility Syndrome, Lobstein Disease (Type I), Lobster Claw Deformity, Lobster Marginal Corneal Dystrophy, Marie's Ataxia, Marie's Claw Deformity, Localized Epidermolysis Bullosa, Local Ataxia, Marie Disease, Marie-Sainton Disease, Marie ized Lipodystrophy, Localized Neuritis of the Shoulder Strumpell Disease, Marie-Strumpell Spondylitis, Mari Girdle, Loeffler's Disease, Loeffler Endomyocardial Fibro nesco-Sjogren Syndrome, Marinesco-Sjogren-Gorland Syn sis with Eosinophilia, Loeffler Fibroplastic Parietal drome, Marker X Syndrome, Maroteaux Lamy Syndrome, Endocarditis, Loken Syndrome, Loken-Senior Syndrome, Maroteaux Type Acromesomelic Dysplasia, Marshall's Long-Chain 3-hydroxyacyl-CoA Dehydrogenase Ectodermal Dysplasias With Ocular and Hearing Defects, (LCHAD), Long Chain Acyl CoA Dehydrogenase Defi Marshall-Smith Syndrome, Marshall Syndrome, Marshall ciency, Long-Chain Acyl-CoA Dehydrogenase (ACADL), Type Deafness-Myopia-Cataract-Saddle Nose, Martin-Al Long-Chain Acyl-CoA Dehydrogenase Deficiency, Long bright Syndrome, Martin-Bell Syndrome, Martorell Syn QT Syndrome without Deafness, Lou Gehrig's Disease, Lou drome, MASA Syndrome, Massive Myoclonia, Mast Cell Gehrig's Disease Included, Louis-Bar Syndrome, Low Leukemia, Mastocytosis, Mastocytosis With an Associated Blood Sugar, Low-Density Beta Lipoprotein Deficiency, Hematologic Disorder, Maumenee Corneal Dystrophy, Low Imperforate Anus, Low Potassium Syndrome, Lowe Maxillary Ameloblastoma, Maxillofacial Dysostosis, Max syndrome, Lowe's Syndrome, Lowe-Bickel Syndrome, illonasal Dysplasia, Maxillonasal Dysplasia Binder Type, Lowe-Terry-MacLachlan Syndrome, LS, LS, LTD, Lubs Maxillopalpebral Synkinesis, May-Hegglin Anomaly, Syndrome, Lubs Syndrome, Luft Disease, Lumbar Canal MCAD Deficiency, MCAD, MCAD, MCAD, McArdle Dis Stenosis, Lumbar Spinal Stenosis, Lumbosacral Spinal ease, McCune-Albright, MCD, McKusick Type Metaphy Stenosis, Lundborg-Unverricht Disease, Lundborg-Unver seal Chondrodysplasia, McKusick Type Metaphyseal Chon richt Disease Included, Lupus, Lupus, Lupus Erythemato drodysplasia, MCR, MCTD, Meckel Syndrome, Meckel Sus, Luschka-Magendie Foramina Atresia, Lyell Syndrome, Gruber Syndrome, Median Cleft Face Syndrome, Lyelles Syndrome, Lymphadenoid Goiter, Lymphangiectatic Mediterranean Anemia, Medium-Chain Acyl-CoA dehydro Protein-Losing Enteropathy, Lymphangioleiomatosis, Lym genase (ACADM), Medium Chain Acyl-CoA Dehydroge phangioleimyomatosis, Lymphangiomas, Lymphatic Mal nase (MCAD) Deficiency, Medium-Chain Acyl-CoA Dehy formations, Lynch Syndromes, Lynch Syndrome I, Lynch drogenase Deficiency, Medium Chain Acyl CoA Syndrome II, Lysosomal Alpha-N-Acetylgalactosaminidase Dehydrogenase Deficiency, Medullary Cystic Disease, Med Deficiency Schindler Type, Lysosomal Glycoaminoacid ullary Cystic Disease, Medullary Sponge Kidney, MEF, Storage Disease-Angiokeratoma Corporis Diffusum, Lyso Megaesophagus, Megalencephaly, Megalencephaly with Somal Glucosidase Deficiency, Lysosomal Glucosidase Hyaline Inclusion, Megalencephaly with Hyaline Panneur Deficiency, MAA, Machado Disease, Machado-Joseph Dis opathy, Megaloblastic Anemia, Megaloblastic Anemia of ease, Macrencephaly, Macrocephaly, Macrocephaly Hemi Pregnancy, Megalocornea-Mental Retardation Syndrome, hypertrophy, Macrocephaly with Multiple Lipomas and Meier-Gorlin Syndrome, Meige's Lymphedema, Meige's Hemangiomata, Macrocephaly with Pseudopapilledema and Syndrome, Melanodermic Leukodystrophy, Melanoplakia Multiple Hemangiomata, Macroglobulinemia, Macroglos Intestinal Polyposis, Melanoplakia-Intestinal Polyposis, sia, Macroglossia-Omphalocele-Visceromegaly Syndrome, MELAS Syndrome, MELAS, Melkersson Syndrome, Macrostomia Ablepheron Syndrome, Macrothrombocytope Melnick-Fraser Syndrome, Melnick-Needles Osteodys nia Familial Bernard-Soulier Type, Macula Lutea degenera plasty, Melnick-Needles Syndrome, Membranous Lipodys tion, Macular Amyloidosis, Macular Degeneration, Macular trophy, Mendes Da Costa Syndrome, Meniere Disease, Degeneration Disciform, Macular Degeneration Senile, Méniere's Disease, Meningeal Capillary Angiomatosis, Macular Dystrophy, Macular Type Corneal Dystrophy, Menkes Disease, Menke's Syndrome I, Mental Retardation MAD, MAD, Madelung’s Disease, Maffucci Syndrome, Aphasia Shuffling Gait Adducted Thumbs (MASA), Mental Major Epilepsy, Malabsorption, Malabsorption-Ectodermal Retardation-Deafness-Skeletal Abnormalities-Coarse Face Dysplasia-Nasal Alar Hypoplasia, Maladie de Roger, Mala with Full Lips, Mental Retardation with Hypoplastic 5th