DOCSLIB.ORG

J. Gen. Appl. Microbiol

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
J. Gen. Appl. Microbiol Supplementary Table 1. Primers used in this study. # Primer name Sequence 1 HglEA KO 5’ Fw ACTAGTGGATCCCCCGTGTAACAGC 2 HglEA KO 5’ Rv GAATTCCTGCAGCCCGGGATTAGCAGACATAGGACA 3 HglEA KO 3’ Fw TCGACCTCGAGGGGGAACGTCCCACGCC 4 HglEA KO 3’ Rv GCGAATTGGGTACCGAAGCAGGACGAAC 5 HglE2 KO 5’ Fw ACTAGTGGATCCCCCGATCAAAAACGTACC 6 HglE2 KO 5’ Rv GAATTCCTGCAGCCCGGGTGTATCCATGTTCCTTTTGTC 7 HglE2 KO 3’ Fw TACCGTCGACCTCGAAGAACTGGCGGAAAAG 8 HglE2 KO 3’ Rv CGGGCCCCCCCTCGACCTTTTGTGGTATAGCC 9 all1643 KO 5’ Fw ACTAGTGGATCCCCCTTATCAGGAGGGGA 10 all1643 KO 5’ Rv GAATTCCTGCAGCCCACCATGAACGCTATG 11 all1643 KO 3’ Fw TACCGTCGACCTCGAGCCTTGGGAGTCGAA 12 all1643 KO 3’ Rv CGGGCCCCCCCTCGAAGGCATAAGGGCCAG 13 hglE2 Fw ATGTCTGCTAATCCCATGGATACACAACAAAAGACCC 14 hglE2 Rv GAATTCCTGCAGCCCGAGGATTCGGAGCCA 15 PpsbA Fw CCTCGAGGGGGGGCCGATCTCAATGAATATTGGTTGAC 16 PpsbA Rv GTGTATCCATGCGAAACGATCCTCA 17 DGD2 Fw TTCGCATGGATACACAACAAAAGACC 18 DGD2 Rv ATTGGGTACCGGGCCGTAAAGCTCGCAC 19 rnpB-RTFw CCAGTTCCGCTATCAGAGAG 20 rnpB-RTRv GAGGAGAGAGTTGGTGGTAAG 21 HglE2 seq Fw1 GCCCAGAAACAATCAAGC 22 HglE2 seq Rv1 GTGTCGGGGTATATTCTTC 23 spec-mid-Fw GCGAGGGCTTTACTAAGCTG 24 hglE-RTFw CCGTAGTCAACCAAGTTG 25 hglE-RTRv TATACTGACTGGCTGCCA 26 Km dw GGGATCTCATGCTGGAG 27 all1643 mid AACCCCATTATCGCCTC 0.1 Out group (PfaA, Shewanella sp. BR-2) type I polyketide synthase [Scytonema millei] Outgroup (PfaA) hypothetical protein QH73_010865 [Scytonema millei VB511283] SDR family NAD(P)-dependent oxidoreductase [Leptolyngbya sp. IPPAS B-1204] acyltransferase domain-containing protein [Leptolyngbya sp. IPPAS B-1204] type I polyketide synthase [[Leptolyngbya] sp. JSC-1] acyltransferase domain-containing protein [Calothrix sp. NIES-3974] MULTISPECIES: acyltransferase domain-containing protein [unclassified Calothrix] acyltransferase domain-containing protein [Calothrix desertica] type I polyketide synthase [Calothrix sp. PCC 7103] acyltransferase domain-containing protein [Calothrix sp. HK-06] polyketide synthase phosphopantetheine-binding HglE [Calothrix sp. NIES-4101] acyltransferase domain-containing protein [Calothrix elsteri] acyltransferase domain-containing protein [Calothrix parietina] polyketide synthase [Nostoc sp. MBR 210] acyltransferase domain-containing protein [Nostoc cycadae] acyltransferase domain-containing protein [Anabaenopsis circularis] beta-ketoacyl synthase [Nostoc sp. HK-01] acyltransferase domain-containing protein [Nostoc sp. PCC 7107] heterocyst glycolipid synthase [Nostoc sp. PCC 7120] acyltransferase domain-containing protein [Trichormus variabilis] type I polyketide synthase [Nostoc sp. PCC 7120] acyltransferase domain-containing protein [Trichormus variabilis] acyltransferase domain-containing protein [Nostoc sp. NIES-2111] acyltransferase domain-containing protein [Nostoc sp. NIES-3756] acyltransferase domain-containing protein [Anabaena sp. 4-3] acyltransferase domain-containing protein [Anabaena sp. CA = ATCC 33047] acyltransferase domain-containing protein [Nostoc sp. PCC 7524] acyltransferase domain-containing protein [Nostoc sp. CENA543] acyltransferase domain-containing protein [Nodularia sp. (in: Bacteria)] acyltransferase domain-containing protein [Nodularia spumigena] heterocyst glycolipid synthase [Nodularia spumigena CCY9414] acyltransferase domain-containing protein [Nodularia spumigena] acyltransferase domain-containing protein [Nodularia spumigena] polyketide synthase [Nostoc minutum NIES-26] acyltransferase domain-containing protein [Nostoc sp. NIES-4103] acyltransferase domain-containing protein [Calothrix brevissima] acyltransferase domain-containing protein [Calothrix sp. NIES-2098] putative acyl carrier protein [Tolypothrix sp. PCC 7601] acyltransferase domain-containing protein [Microchaete diplosiphon] MULTISPECIES: acyltransferase domain-containing protein [Nostocales] acyltransferase domain-containing protein [Nostoc sp. RF31YmG] acyltransferase domain-containing protein [Nostoc sp. 106C] acyltransferase domain-containing protein [Nostoc sp. T09] acyltransferase domain-containing protein [Calothrix sp. NIES-2100] acyltransferase domain-containing protein [Fortiea contorta] acyltransferase domain-containing protein [Calothrix sp. PCC 7507] polyketide-type polyunsaturated fatty acid synthase PfaA [Cylindrospermum sp. NIES-4074] acyltransferase domain-containing protein [Cylindrospermum stagnale] acyltransferase domain-containing protein [Anabaena sp. PCC 7108] polyketide-type polyunsaturated fatty acid synthase PfaA [Anabaena cylindrica PCC 7122] acyltransferase domain-containing protein [Anabaena cylindrica] polyketide-type polyunsaturated fatty acid synthase PfaA [Anabaena cylindrica PCC 7122] acyltransferase domain-containing protein [Anabaena cylindrica] acyltransferase domain-containing protein [Trichormus variabilis] hypothetical protein DSM107003_24070 [Trichormus variabilis SAG 1403-4b] acyltransferase domain-containing protein [Trichormus sp. NMC-1] acyltransferase domain-containing protein [Trichormus azollae] acyltransferase domain-containing protein [Nostocales cyanobacterium] acyltransferase domain-containing protein [Sphaerospermopsis reniformis] polyketide-type polyunsaturated fatty acid synthase PfaA [Sphaerospermopsis reniformis] polyketide-type polyunsaturated fatty acid synthase PfaA [Sphaerospermopsis kisseleviana NIES-73] acyltransferase domain-containing protein [Sphaerospermopsis kisseleviana] acyltransferase domain-containing protein [Cylindrospermopsis raciborskii] acyltransferase domain-containing protein [Cylindrospermopsis raciborskii] acyltransferase domain-containing protein [Cylindrospermopsis raciborskii] acyltransferase domain-containing protein [Cylindrospermopsis raciborskii] acyltransferase domain-containing protein [Cylindrospermopsis raciborskii] acyltransferase domain-containing protein [Cylindrospermopsis raciborskii] acyltransferase domain-containing protein [Cylindrospermopsis sp. CR12] acyltransferase domain-containing protein [Cylindrospermopsis raciborskii] acyltransferase domain-containing protein [Cylindrospermopsis raciborskii] acyltransferase domain-containing protein [Nostocales cyanobacterium] acyltransferase domain-containing protein [Nostocales cyanobacterium] acyltransferase domain-containing protein [Dolichospermum sp. UHCC 0315A] acyltransferase domain-containing protein [Anabaena sp. 90] Sub-tree containing HglE polyketide synthase [Anabaena sp. AL09] A polyketide synthase [Anabaena sp. LE011-02] polyketide synthase [Anabaena sp. MDT14b] acyltransferase domain-containing protein [Dolichospermum compactum] acyltransferase domain-containing protein [Anabaena sp. WA102] polyketide synthase [Anabaena sp. AL93] acyltransferase domain-containing protein [Aphanizomenon flos-aquae] polyketide synthase [Anabaena sp. WA113] polyketide synthase [Aphanizomenon flos-aquae WA102] polyketide synthase [Aphanizomenon flos-aquae LD13] TPA: polyketide synthase [Anabaena sp. UBA12330] polyketide synthase [Aphanizomenon flos-aquae MDT14a] acyltransferase domain-containing protein [Dolichospermum planctonicum] acyltransferase domain-containing protein [Dolichospermum circinale] acyltransferase domain-containing protein [Dolichospermum circinale] polyketide synthase [Anabaena sp. CRKS33] acyltransferase domain-containing protein [Nostoc sphaeroides] acyltransferase domain-containing protein [Nostoc sp. 'Peltigera membranacea cyanobiont' 232] polyketide synthase [Nostoc punctiforme NIES-2108] acyltransferase domain-containing protein [Nostoc sp. ATCC 53789] acyltransferase domain-containing protein [Nostoc sp. 'Peltigera membranacea cyanobiont' 210A] acyltransferase domain-containing protein [Nostoc sp. KVJ20] acyltransferase domain-containing protein [Nostoc punctiforme] polyketide synthase phosphopantetheine-binding HglE [Nostoc punctiforme PCC 73102] acyltransferase domain-containing protein [Nostoc sp. 'Peltigera membranacea cyanobiont' N6] HglE [Nostoc sp. 'Peltigera membranacea cyanobiont'] acyltransferase domain-containing protein [Nostoc sp. 'Peltigera membranacea cyanobiont' 213] acyltransferase domain-containing protein [Nostoc sp. 'Lobaria pulmonaria (5183) cyanobiont'] acyltransferase domain-containing protein [Nostoc flagelliforme] Acyl carrier protein [Nostoc flagelliforme CCNUN1] acyltransferase domain-containing protein [Nostoc commune] acyltransferase domain-containing protein [Nostoc calcicola] acyltransferase domain-containing protein [Nostoc linckia] acyltransferase domain-containing protein [Nostoc linckia] polyketide synthase [Hassallia byssoidea VB512170] acyltransferase domain-containing protein [[Scytonema hofmanni] UTEX B 1581] acyltransferase domain-containing protein [Tolypothrix sp. NIES-4075] type I polyketide synthase [Scytonema hofmannii] acyltransferase domain-containing protein [Tolypothrix campylonemoides] acyltransferase domain-containing protein [Scytonema sp. HK-05] acyltransferase domain-containing protein [Scytonema sp. NIES-4073] type I polyketide synthase [Mastigocladopsis repens] acyltransferase domain-containing protein [Scytonema tolypothrichoides] polyketide synthase [Fischerella thermalis WC527] acyltransferase domain-containing protein [Fischerella muscicola] acyltransferase domain-containing protein [Mastigocladus laminosus] acyltransferase domain-containing protein [Mastigocladus laminosus] acyltransferase domain-containing protein [Westiellopsis prolifica] acyltransferase domain-containing protein [Fischerella sp. PCC 9339] acyltransferase domain-containing protein [Fischerella sp. PCC 9431] acyltransferase domain-containing protein [Hapalosiphon sp. MRB220] acyltransferase domain-containing
Load more

Recommended publications
  • DOMAIN Bacteria PHYLUM Cyanobacteria
    DOMAIN Bacteria PHYLUM Cyanobacteria D Bacteria Cyanobacteria P C Chroobacteria Hormogoneae Cyanobacteria O Chroococcales Oscillatoriales Nostocales Stigonematales Sub I Sub III Sub IV F Homoeotrichaceae Chamaesiphonaceae Ammatoideaceae Microchaetaceae Borzinemataceae Family I Family I Family I Chroococcaceae Borziaceae Nostocaceae Capsosiraceae Dermocarpellaceae Gomontiellaceae Rivulariaceae Chlorogloeopsaceae Entophysalidaceae Oscillatoriaceae Scytonemataceae Fischerellaceae Gloeobacteraceae Phormidiaceae Loriellaceae Hydrococcaceae Pseudanabaenaceae Mastigocladaceae Hyellaceae Schizotrichaceae Nostochopsaceae Merismopediaceae Stigonemataceae Microsystaceae Synechococcaceae Xenococcaceae S-F Homoeotrichoideae Note: Families shown in green color above have breakout charts G Cyanocomperia Dactylococcopsis Prochlorothrix Cyanospira Prochlorococcus Prochloron S Amphithrix Cyanocomperia africana Desmonema Ercegovicia Halomicronema Halospirulina Leptobasis Lichen Palaeopleurocapsa Phormidiochaete Physactis Key to Vertical Axis Planktotricoides D=Domain; P=Phylum; C=Class; O=Order; F=Family Polychlamydum S-F=Sub-Family; G=Genus; S=Species; S-S=Sub-Species Pulvinaria Schmidlea Sphaerocavum Taxa are from the Taxonomicon, using Systema Natura 2000 . Triochocoleus http://www.taxonomy.nl/Taxonomicon/TaxonTree.aspx?id=71022 S-S Desmonema wrangelii Palaeopleurocapsa wopfnerii Pulvinaria suecica Key Genera D Bacteria Cyanobacteria P C Chroobacteria Hormogoneae Cyanobacteria O Chroococcales Oscillatoriales Nostocales Stigonematales Sub I Sub III Sub
    [Show full text]
  • Identification and Characterization of Novel Filament-Forming Proteins In
    www.nature.com/scientificreports OPEN Identifcation and characterization of novel flament-forming proteins in cyanobacteria Benjamin L. Springstein 1,4*, Christian Woehle1,5, Julia Weissenbach1,6, Andreas O. Helbig2, Tal Dagan 1 & Karina Stucken3* Filament-forming proteins in bacteria function in stabilization and localization of proteinaceous complexes and replicons; hence they are instrumental for myriad cellular processes such as cell division and growth. Here we present two novel flament-forming proteins in cyanobacteria. Surveying cyanobacterial genomes for coiled-coil-rich proteins (CCRPs) that are predicted as putative flament-forming proteins, we observed a higher proportion of CCRPs in flamentous cyanobacteria in comparison to unicellular cyanobacteria. Using our predictions, we identifed nine protein families with putative intermediate flament (IF) properties. Polymerization assays revealed four proteins that formed polymers in vitro and three proteins that formed polymers in vivo. Fm7001 from Fischerella muscicola PCC 7414 polymerized in vitro and formed flaments in vivo in several organisms. Additionally, we identifed a tetratricopeptide repeat protein - All4981 - in Anabaena sp. PCC 7120 that polymerized into flaments in vitro and in vivo. All4981 interacts with known cytoskeletal proteins and is indispensable for Anabaena viability. Although it did not form flaments in vitro, Syc2039 from Synechococcus elongatus PCC 7942 assembled into flaments in vivo and a Δsyc2039 mutant was characterized by an impaired cytokinesis. Our results expand the repertoire of known prokaryotic flament-forming CCRPs and demonstrate that cyanobacterial CCRPs are involved in cell morphology, motility, cytokinesis and colony integrity. Species in the phylum Cyanobacteria present a wide morphological diversity, ranging from unicellular to mul- ticellular organisms.
    [Show full text]
  • Appendices Physico-Chemical
    http://researchcommons.waikato.ac.nz/ Research Commons at the University of Waikato Copyright Statement: The digital copy of this thesis is protected by the Copyright Act 1994 (New Zealand). The thesis may be consulted by you, provided you comply with the provisions of the Act and the following conditions of use: Any use you make of these documents or images must be for research or private study purposes only, and you may not make them available to any other person. Authors control the copyright of their thesis. You will recognise the author’s right to be identified as the author of the thesis, and due acknowledgement will be made to the author where appropriate. You will obtain the author’s permission before publishing any material from the thesis. An Investigation of Microbial Communities Across Two Extreme Geothermal Gradients on Mt. Erebus, Victoria Land, Antarctica A thesis submitted in partial fulfilment of the requirements for the degree of Master’s Degree of Science at The University of Waikato by Emily Smith Year of submission 2021 Abstract The geothermal fumaroles present on Mt. Erebus, Antarctica, are home to numerous unique and possibly endemic bacteria. The isolated nature of Mt. Erebus provides an opportunity to closely examine how geothermal physico-chemistry drives microbial community composition and structure. This study aimed at determining the effect of physico-chemical drivers on microbial community composition and structure along extreme thermal and geochemical gradients at two sites on Mt. Erebus: Tramway Ridge and Western Crater. Microbial community structure and physico-chemical soil characteristics were assessed via metabarcoding (16S rRNA) and geochemistry (temperature, pH, total carbon (TC), total nitrogen (TN) and ICP-MS elemental analysis along a thermal gradient 10 °C–64 °C), which also defined a geochemical gradient.
    [Show full text]
  • Predictive Modeling of Microcystin Concentrations in Drinking Water Treatment Systems Of
    Predictive Modeling of Microcystin Concentrations in Drinking Water Treatment Systems of Ohio and their Potential Health Effects Thesis Presented in Partial Fulfillment of the Requirements for the Degree Master of Science in the Graduate School of The Ohio State University By: Traven A. Wood, B.S. Graduate Program in Public Health The Ohio State University 2019 Thesis Committee: Mark H. Weir (Adviser) Jiyoung Lee Allison MacKay Copyright by Traven Aldin Wood 2019 Abstract Cyanobacteria present significant public health and engineering challenges due to their expansive growth and potential synthesis of microcystins in surface waters that are used as a drinking water source. Eutrophication of surface waters coupled with favorable climatic conditions can create ideal growth environments for these organisms to develop what is known as a cyanobacterial harmful algal bloom (cHAB). Development of methods to predict the presence and impact of microcystins in drinking water treatment systems is a complex process due to system uncertainties. This research developed two predictive models, first to estimate microcystin concentrations at a water treatment intake, second, to estimate the risks of finished water detections after treatment and resultant health effects to consumers. The first model uses qPCR data to adjust phycocyanin measurements to improve predictive linear regression relationships. Cyanobacterial 16S rRNA and mcy genes provide a quantitative means of measuring and detecting potentially toxic genera/speciess of a cHAB. Phycocyanin is a preferred predictive tool because it can be measured in real-time, but the drawback is that it cannot distinguish between toxic genera/speciess of a bloom. Therefore, it was hypothesized that genus specific ratios using qPCR data could be used to adjust phycocyanin measurements, making them more specific to the proportion of the bloom that is producing toxin.
    [Show full text]
  • Aetokthonos Hydrillicola Gen. Et Sp. Nov.: Epiphytic Cyanobacteria on Invasive Aquatic Plants Implicated in Avian Vacuolar Myelinopathy
    Phytotaxa 181 (5): 243–260 ISSN 1179-3155 (print edition) www.mapress.com/phytotaxa/ PHYTOTAXA Copyright © 2014 Magnolia Press Article ISSN 1179-3163 (online edition) http://dx.doi.org/10.11646/phytotaxa.181.5.1 Aetokthonos hydrillicola gen. et sp. nov.: Epiphytic cyanobacteria on invasive aquatic plants implicated in Avian Vacuolar Myelinopathy SUSAN B. WILDE1*, JEFFREY R. JOHANSEN2,3, H. DAYTON WILDE4, PENG JIANG4, BRADLEY A. BARTELME1 & REBECCA S. HAYNIE5 1Warnell School of Forestry and Natural Resources. University of Georgia, Athens, GA 30602. 2Department of Biology, John Carroll University, University Heights, OH 44118. 3Department of Botany, Faculty of Science, University of South Bohemia, 31 Branišovská, 370 05 České Budějovice, Czech Republic. 4Department of Horticulture, University of Georgia, Athens, GA 30602. 5SePRO Corporation, 11550 North Meridian Street, Suite 600, Carmel, IN 46032. *Corresponding author ([email protected]) Abstract Research into the taxonomy of a novel cyanobacterial epiphyte in locations where birds, most notably Bald eagle and Ameri- can coots, are dying from a neurologic disease (Avian Vacuolar Myelinopathy—AVM) has been ongoing since 2001. Field investigations revealed that all sites where birds were dying had extensive invasive aquatic vegetation with dense colonies of an unknown cyanobacterial species growing on the underside of leaves. Morphological evaluation indicated that this was a true-branching, heterocystous taxon falling within the former order Stigonematales. However, 16S rRNA gene sequence demonstrated that it did not match closely with any described genus or species. More recent sequence analysis of the 16S rRNA gene and associated ITS region from additional true branching species resulted in a unique phylogenetic placement distant from the other clades of true-branching cyanobacteria.
    [Show full text]
  • (Cyanobacterial Genera) 2014, Using a Polyphasic Approach
    Preslia 86: 295–335, 2014 295 Taxonomic classification of cyanoprokaryotes (cyanobacterial genera) 2014, using a polyphasic approach Taxonomické hodnocení cyanoprokaryot (cyanobakteriální rody) v roce 2014 podle polyfázického přístupu Jiří K o m á r e k1,2,JanKaštovský2, Jan M a r e š1,2 & Jeffrey R. J o h a n s e n2,3 1Institute of Botany, Academy of Sciences of the Czech Republic, Dukelská 135, CZ-37982 Třeboň, Czech Republic, e-mail: [email protected]; 2Department of Botany, Faculty of Science, University of South Bohemia, Branišovská 31, CZ-370 05 České Budějovice, Czech Republic; 3Department of Biology, John Carroll University, University Heights, Cleveland, OH 44118, USA Komárek J., Kaštovský J., Mareš J. & Johansen J. R. (2014): Taxonomic classification of cyanoprokaryotes (cyanobacterial genera) 2014, using a polyphasic approach. – Preslia 86: 295–335. The whole classification of cyanobacteria (species, genera, families, orders) has undergone exten- sive restructuring and revision in recent years with the advent of phylogenetic analyses based on molecular sequence data. Several recent revisionary and monographic works initiated a revision and it is anticipated there will be further changes in the future. However, with the completion of the monographic series on the Cyanobacteria in Süsswasserflora von Mitteleuropa, and the recent flurry of taxonomic papers describing new genera, it seems expedient that a summary of the modern taxonomic system for cyanobacteria should be published. In this review, we present the status of all currently used families of cyanobacteria, review the results of molecular taxonomic studies, descriptions and characteristics of new orders and new families and the elevation of a few subfamilies to family level.
    [Show full text]
  • NOSTOCALES, CYANOBACTERIA): CONVERGENT EVOLUTION RESULTING in a CRYPTIC GENUS Sergey Shalygin John Carroll University, [email protected]
    John Carroll University Carroll Collected Masters Theses Theses, Essays, and Senior Honors Projects Winter 2016 CYANOMARGARITA GEN. NOV. (NOSTOCALES, CYANOBACTERIA): CONVERGENT EVOLUTION RESULTING IN A CRYPTIC GENUS Sergey Shalygin John Carroll University, [email protected] Follow this and additional works at: http://collected.jcu.edu/masterstheses Part of the Biology Commons Recommended Citation Shalygin, Sergey, "CYANOMARGARITA GEN. NOV. (NOSTOCALES, CYANOBACTERIA): CONVERGENT EVOLUTION RESULTING IN A CRYPTIC GENUS" (2016). Masters Theses. 21. http://collected.jcu.edu/masterstheses/21 This Thesis is brought to you for free and open access by the Theses, Essays, and Senior Honors Projects at Carroll Collected. It has been accepted for inclusion in Masters Theses by an authorized administrator of Carroll Collected. For more information, please contact [email protected]. CYANOMARGARITA GEN. NOV. (NOSTOCALES, CYANOBACTERIA): CONVERGENT EVOLUTION RESULTING IN A CRYPTIC GENUS A Thesis Submitted to the Office of Graduate Studies College of Arts & Sciences of John Carroll University In Partial Fulfillment of the Requirements For the Degree of Master of Science By Sergei Shalygin 2016 The thesis of Sergei Shalygin is hereby accepted: ., µ_ fJo., t fvt8fl'_ 7 <>U, Reader - C · opher A. Sheil Date M,UJf� Reader - Michael P. Martin Date I 2 - z ,, Reader - Nicole Pietrasiak Date ---1-1 - z z - <ot<e Date I certify that this is the copy or the original document \I - 22- �{ {) Author - Sergei Shalygin Date ACKNOWLEDGEMENTS I thank John Carroll University for salary support, supplies and use of laboratory facilities, and supportive faculty and staff in the Biology Department. Additionally, I am grateful to all lab mates from the Johansen laboratory for useful discussion of the work.
    [Show full text]
  • Symphyonema Bifilamentata Sp. Nov., the Right Fischerella
    microorganisms Article Symphyonema bifilamentata sp. nov., the Right Fischerella ambigua 108b: Half a Decade of Research on Taxonomy and Bioactive Compounds in New Light Patrick Jung 1,* , Paul M. D’Agostino 2 , Burkhard Büdel 3 and Michael Lakatos 1 1 Applied Logistics and Polymer Sciences, University of Applied Sciences Kaiserslautern, Carl-Schurz-Str. 10-16, 66953 Pirmasens, Germany; [email protected] 2 Faculty of Chemistry and Food Chemistry, Technical University of Dresden, Chair of Technical Biochemistry, Bergstraße 66, 01069 Dresden, Germany; [email protected] 3 Biology Institute, University of Kaiserslautern, Erwin-Schrödinger Str. 52, 67663 Kaiserslautern, Germany; [email protected] * Correspondence: [email protected] Abstract: Since 1965 a cyanobacterial strain termed ‘Fischerella ambigua 108b’ was the object of several studies investigating its potential as a resource for new bioactive compounds in several European institutes. Over decades these investigations uncovered several unique small molecules and their respective biosynthetic pathways, including the polychlorinated triphenyls of the ambigol family and the tjipanazoles. However, the true taxonomic character of the producing strain remained concealed until now. Applying a polyphasic approach considering the phylogenetic position based on the 16S rRNA and the protein coding gene rbcLX, secondary structures and morphological features, we Citation: Jung, P.; D’Agostino, P.M.; present the strain ‘Fischerella ambigua 108b’ as Symphyonema bifilamentata sp. nov. 97.28. Although Büdel, B.; Lakatos, M. Symphyonema there is the type species (holotype) S. sinense C.-C. Jao 1944 there is no authentic living strain or bifilamentata sp. nov., the Right material for genetic analyses for the genus Symphyonema available.
    [Show full text]
  • Universidade De São Paulo Centro De Energia Nuclear Na Agricultura
    UNIVERSIDADE DE SÃO PAULO CENTRO DE ENERGIA NUCLEAR NA AGRICULTURA Análise fenotípica, genética e de bioatividade de isolados brasileiros de cianobactérias dos gêneros Fischerella e Hapalosiphon Tânia Keiko Shishido Piracicaba 2009 Tânia Keiko Shishido Análise fenotípica, genética e de bioatividade de isolados brasileiros de cianobactérias dos gêneros Fischerella e Hapalosiphon Dissertação apresentada ao Centro de Energia Nuclear na Agricultura da Universidade de São Paulo, para obtenção do título de Mestre em Ciências. Área de Concentração: Biologia na Agricultura e no Ambiente Orientadora: Profa. Dra. Marli de Fátima Fiore Piracicaba 2009 AUTORIZO A DIVULGAÇÃO TOTAL OU PARCIAL DESTE TRABALHO, POR QUALQUER MEIO CONVENCIONAL OU ELETRÔNICO, PARA FINS DE ESTUDO E PESQUISA, DESDE QUE CITADA A FONTE. Dados Internacionais de Catalogação na Publicação (CIP) Seção Técnica de Biblioteca - CENA/USP Shishido, Tânia Keiko Análise fenotípica, genética e de bioatividade de isolados brasileiros de cianobactérias dos gêneros Fischerella e Hapalosiphon / Tânia Keiko Shishido; orientador Marli de Fátima Fiore. - - Piracicaba, 2009. 134 f.: il. Dissertação (Mestrado – Programa de Pós-Graduação em Ciências. Área de Concentração: Biologia na Agricultura e no Ambiente) – Centro de Energia Nuclear na Agricultura da Universidade de São Paulo. 1. Agentes antimicrobianos 2. Biologia molecular 3. Filogenia 4. Microbiologia 5. Toxicologia ambiental I. Título CDU 575.86+577.127 Aos meus pais, Sonia e Mário, e ao tio Joaquim ( in memoriam ), Pelas oportunidades oferecidas,
    [Show full text]
  • Redalyc.True Branched Nostocalean Cyanobacteria from Tropical
    Revista de Biología Tropical ISSN: 0034-7744 [email protected] Universidad de Costa Rica Costa Rica Ferreira, Viviani; Branco, Luis Henrique Z.; Kaštovský, Jan True branched nostocalean cyanobacteria from tropical aerophytic habitats and molecular assessment of two species from field samples Revista de Biología Tropical, vol. 61, núm. 1, marzo, 2013, pp. 455-466 Universidad de Costa Rica San Pedro de Montes de Oca, Costa Rica Available in: http://www.redalyc.org/articulo.oa?id=44925650034 How to cite Complete issue Scientific Information System More information about this article Network of Scientific Journals from Latin America, the Caribbean, Spain and Portugal Journal's homepage in redalyc.org Non-profit academic project, developed under the open access initiative True branched nostocalean cyanobacteria from tropical aerophytic habitats and molecular assessment of two species from field samples Viviani Ferreira1, Luis Henrique Z. Branco1,2 & Jan Kaštovský3 1. Microbiology Graduation Program, UNESP-São Paulo State University, IBILCE, São José do Rio Preto, SP, Brazil; [email protected] 2. UNESP-São Paulo State University, IBILCE, Department of Zoology and Botany, R. Cristóvão Colombo, 2265, BR-15054-000, São José do Rio Preto, SP, Brazil; [email protected] 3. University of South Bohemia, Department of Botany, Branišovská, 31a, 370 05, České Budějovice, Czech Republic; [email protected] Received 13-II-2012. Corrected 10-VIII-2012. Accepted 11-IX-2012. Abstract: Aerophytic cyanobacteria are commonly found growing on rocks, tree trunks and soil, but the diversity of these organisms is still poorly known. This complex group is very problematic considering the taxonomic arrangement and species circumscription, especially when taking into account tropical populations.
    [Show full text]
  • Cryptic Diversity of Cyanobacteria
    CRYPTIC DIVERSITY OF CYANOBACTERIA DOCTORAL THESIS FOR A DOCTORAL DEGREE Department of Botany Faculty of Science, Palacký University Olomouc Author MGR. EVA JAHODÁŘOVÁ Supervisor DOC. RNDR. PETR HAŠLER, PH.D. Olomouc 2019 © Eva Jahodářová, Palacký University Olomouc, 2019 You can't even begin to understand biology, you can't understand life, unless you understand what it's all there for, how it arose-and that means evolution. Richard Dawkins ACKNOWLEDGMENTS I owe many thanks to colleagues, advisors, friends, and family: PETR HAŠLER, PETR DVOŘÁK and ALOISIE POULÍČKOVÁ for accepting me into Algological laboratory and taking care of me during my study. I would also like to express my greeting for the opportunity to undertake my doctoral studies with their advice, feedback, inspiration, support, guidance, and total assistance. MATĚJ BOČEK, MARKÉTA LETÁKOVÁ, LUCIE KOBRLOVÁ, MICHAL HRONEŠ, JANA RŮŽIČKOVÁ, MICHAELA ŠVÉCAROVÁ, IVETA HRADILOVÁ, and other members of the botanical and zoological department for their help, advice and support. Foundation NADÁNÍ JOSEFA, MARIE A ZDEŇKY HLÁVKOVÝCH for its financial support during my internship in the Natural History Museum, London. My dear family and my boyfriend MICHAL MOTYKA for everything! DECLARATION I declare that this Ph.D. thesis has been written solely by myself. All the sources quoted in this work are listed in the Reference section. All published results included in this thesis have been approved with the help of mentioned co-authors. In Olomouc 15.5.2019 Mgr. Eva Jahodářová ABSTRACT Cyanobacteria emerged on Earth approximately 3.5 billion years ago. They are the major contributor to global biogeochemical cycles and are ancestors of today's chloroplast of higher plants.
    [Show full text]
  • Biogeography of Terrestrial Cyanobacteria from Antarctic Ice-Free Areas
    Annals of Glaciology 51(56) 2010 1 Biogeography of terrestrial cyanobacteria from Antarctic ice-free areas Z. NAMSARAEV,1,2 M.J. MANO,1 R. FERNANDEZ,1 Annick WILMOTTE1 1Center for Protein Engineering, University of LieÁge, B-4000 LieÁge, Belgium E-mail: [email protected] 2Winogradsky Institute of Microbiology, Russian Academy of Sciences, 117312 Moscow, Russia ABSTRACT. Cyanobacteria inhabit the Antarctic continent and have even been observed in the most southerly ice-free areas of Antarctica (86±878 S). The highest molecular diversity of cyanobacterial communities was found in the areas located between 708 S and 808 S. Further south and further north from this zone, the diversity abruptly decreased. Seventy-nine per cent (33 of 42 operational taxonomic units) of Antarctic terrestrial cyanobacteria have a cosmopolitan distribution. Analysis of the sampling efforts shows that only three regions (southern Victoria Land, the Sùr Rondane Mountains and Alexander Island) have been particularly well studied, while other areas did not receive enough attention. Although cyanobacteria possess a capacity for long-range transport, regional populations in Antarctic ice-free areas seem to exist. The cyanobacterial communities of the three most intensively studied regions, separated from each other by a distance of 3000±3400 km, had a low degree of similarity with each other. Further development of microbial biogeography demands a standardized approach. For this purpose, as a minimal standard, we suggest using the sequence of cyanobacterial 16S rRNA gene between Escherichia coli positions 405±780. INTRODUCTION species, genus and even family level is observed in Antarctic Ice-free areas of Antarctica cover a tiny proportion (0.34%) biota and it seems unlikely that such levels of endemism could have evolved after the last glaciation 18 000 years of the continent.
    [Show full text]