J. Gen. Appl. Microbiol

J. Gen. Appl. Microbiol

Supplementary Table 1. Primers used in this study. # Primer name Sequence 1 HglEA KO 5’ Fw ACTAGTGGATCCCCCGTGTAACAGC 2 HglEA KO 5’ Rv GAATTCCTGCAGCCCGGGATTAGCAGACATAGGACA 3 HglEA KO 3’ Fw TCGACCTCGAGGGGGAACGTCCCACGCC 4 HglEA KO 3’ Rv GCGAATTGGGTACCGAAGCAGGACGAAC 5 HglE2 KO 5’ Fw ACTAGTGGATCCCCCGATCAAAAACGTACC 6 HglE2 KO 5’ Rv GAATTCCTGCAGCCCGGGTGTATCCATGTTCCTTTTGTC 7 HglE2 KO 3’ Fw TACCGTCGACCTCGAAGAACTGGCGGAAAAG 8 HglE2 KO 3’ Rv CGGGCCCCCCCTCGACCTTTTGTGGTATAGCC 9 all1643 KO 5’ Fw ACTAGTGGATCCCCCTTATCAGGAGGGGA 10 all1643 KO 5’ Rv GAATTCCTGCAGCCCACCATGAACGCTATG 11 all1643 KO 3’ Fw TACCGTCGACCTCGAGCCTTGGGAGTCGAA 12 all1643 KO 3’ Rv CGGGCCCCCCCTCGAAGGCATAAGGGCCAG 13 hglE2 Fw ATGTCTGCTAATCCCATGGATACACAACAAAAGACCC 14 hglE2 Rv GAATTCCTGCAGCCCGAGGATTCGGAGCCA 15 PpsbA Fw CCTCGAGGGGGGGCCGATCTCAATGAATATTGGTTGAC 16 PpsbA Rv GTGTATCCATGCGAAACGATCCTCA 17 DGD2 Fw TTCGCATGGATACACAACAAAAGACC 18 DGD2 Rv ATTGGGTACCGGGCCGTAAAGCTCGCAC 19 rnpB-RTFw CCAGTTCCGCTATCAGAGAG 20 rnpB-RTRv GAGGAGAGAGTTGGTGGTAAG 21 HglE2 seq Fw1 GCCCAGAAACAATCAAGC 22 HglE2 seq Rv1 GTGTCGGGGTATATTCTTC 23 spec-mid-Fw GCGAGGGCTTTACTAAGCTG 24 hglE-RTFw CCGTAGTCAACCAAGTTG 25 hglE-RTRv TATACTGACTGGCTGCCA 26 Km dw GGGATCTCATGCTGGAG 27 all1643 mid AACCCCATTATCGCCTC 0.1 Out group (PfaA, Shewanella sp. BR-2) type I polyketide synthase [Scytonema millei] Outgroup (PfaA) hypothetical protein QH73_010865 [Scytonema millei VB511283] SDR family NAD(P)-dependent oxidoreductase [Leptolyngbya sp. IPPAS B-1204] acyltransferase domain-containing protein [Leptolyngbya sp. IPPAS B-1204] type I polyketide synthase [[Leptolyngbya] sp. JSC-1] acyltransferase domain-containing protein [Calothrix sp. NIES-3974] MULTISPECIES: acyltransferase domain-containing protein [unclassified Calothrix] acyltransferase domain-containing protein [Calothrix desertica] type I polyketide synthase [Calothrix sp. PCC 7103] acyltransferase domain-containing protein [Calothrix sp. HK-06] polyketide synthase phosphopantetheine-binding HglE [Calothrix sp. NIES-4101] acyltransferase domain-containing protein [Calothrix elsteri] acyltransferase domain-containing protein [Calothrix parietina] polyketide synthase [Nostoc sp. MBR 210] acyltransferase domain-containing protein [Nostoc cycadae] acyltransferase domain-containing protein [Anabaenopsis circularis] beta-ketoacyl synthase [Nostoc sp. HK-01] acyltransferase domain-containing protein [Nostoc sp. PCC 7107] heterocyst glycolipid synthase [Nostoc sp. PCC 7120] acyltransferase domain-containing protein [Trichormus variabilis] type I polyketide synthase [Nostoc sp. PCC 7120] acyltransferase domain-containing protein [Trichormus variabilis] acyltransferase domain-containing protein [Nostoc sp. NIES-2111] acyltransferase domain-containing protein [Nostoc sp. NIES-3756] acyltransferase domain-containing protein [Anabaena sp. 4-3] acyltransferase domain-containing protein [Anabaena sp. CA = ATCC 33047] acyltransferase domain-containing protein [Nostoc sp. PCC 7524] acyltransferase domain-containing protein [Nostoc sp. CENA543] acyltransferase domain-containing protein [Nodularia sp. (in: Bacteria)] acyltransferase domain-containing protein [Nodularia spumigena] heterocyst glycolipid synthase [Nodularia spumigena CCY9414] acyltransferase domain-containing protein [Nodularia spumigena] acyltransferase domain-containing protein [Nodularia spumigena] polyketide synthase [Nostoc minutum NIES-26] acyltransferase domain-containing protein [Nostoc sp. NIES-4103] acyltransferase domain-containing protein [Calothrix brevissima] acyltransferase domain-containing protein [Calothrix sp. NIES-2098] putative acyl carrier protein [Tolypothrix sp. PCC 7601] acyltransferase domain-containing protein [Microchaete diplosiphon] MULTISPECIES: acyltransferase domain-containing protein [Nostocales] acyltransferase domain-containing protein [Nostoc sp. RF31YmG] acyltransferase domain-containing protein [Nostoc sp. 106C] acyltransferase domain-containing protein [Nostoc sp. T09] acyltransferase domain-containing protein [Calothrix sp. NIES-2100] acyltransferase domain-containing protein [Fortiea contorta] acyltransferase domain-containing protein [Calothrix sp. PCC 7507] polyketide-type polyunsaturated fatty acid synthase PfaA [Cylindrospermum sp. NIES-4074] acyltransferase domain-containing protein [Cylindrospermum stagnale] acyltransferase domain-containing protein [Anabaena sp. PCC 7108] polyketide-type polyunsaturated fatty acid synthase PfaA [Anabaena cylindrica PCC 7122] acyltransferase domain-containing protein [Anabaena cylindrica] polyketide-type polyunsaturated fatty acid synthase PfaA [Anabaena cylindrica PCC 7122] acyltransferase domain-containing protein [Anabaena cylindrica] acyltransferase domain-containing protein [Trichormus variabilis] hypothetical protein DSM107003_24070 [Trichormus variabilis SAG 1403-4b] acyltransferase domain-containing protein [Trichormus sp. NMC-1] acyltransferase domain-containing protein [Trichormus azollae] acyltransferase domain-containing protein [Nostocales cyanobacterium] acyltransferase domain-containing protein [Sphaerospermopsis reniformis] polyketide-type polyunsaturated fatty acid synthase PfaA [Sphaerospermopsis reniformis] polyketide-type polyunsaturated fatty acid synthase PfaA [Sphaerospermopsis kisseleviana NIES-73] acyltransferase domain-containing protein [Sphaerospermopsis kisseleviana] acyltransferase domain-containing protein [Cylindrospermopsis raciborskii] acyltransferase domain-containing protein [Cylindrospermopsis raciborskii] acyltransferase domain-containing protein [Cylindrospermopsis raciborskii] acyltransferase domain-containing protein [Cylindrospermopsis raciborskii] acyltransferase domain-containing protein [Cylindrospermopsis raciborskii] acyltransferase domain-containing protein [Cylindrospermopsis raciborskii] acyltransferase domain-containing protein [Cylindrospermopsis sp. CR12] acyltransferase domain-containing protein [Cylindrospermopsis raciborskii] acyltransferase domain-containing protein [Cylindrospermopsis raciborskii] acyltransferase domain-containing protein [Nostocales cyanobacterium] acyltransferase domain-containing protein [Nostocales cyanobacterium] acyltransferase domain-containing protein [Dolichospermum sp. UHCC 0315A] acyltransferase domain-containing protein [Anabaena sp. 90] Sub-tree containing HglE polyketide synthase [Anabaena sp. AL09] A polyketide synthase [Anabaena sp. LE011-02] polyketide synthase [Anabaena sp. MDT14b] acyltransferase domain-containing protein [Dolichospermum compactum] acyltransferase domain-containing protein [Anabaena sp. WA102] polyketide synthase [Anabaena sp. AL93] acyltransferase domain-containing protein [Aphanizomenon flos-aquae] polyketide synthase [Anabaena sp. WA113] polyketide synthase [Aphanizomenon flos-aquae WA102] polyketide synthase [Aphanizomenon flos-aquae LD13] TPA: polyketide synthase [Anabaena sp. UBA12330] polyketide synthase [Aphanizomenon flos-aquae MDT14a] acyltransferase domain-containing protein [Dolichospermum planctonicum] acyltransferase domain-containing protein [Dolichospermum circinale] acyltransferase domain-containing protein [Dolichospermum circinale] polyketide synthase [Anabaena sp. CRKS33] acyltransferase domain-containing protein [Nostoc sphaeroides] acyltransferase domain-containing protein [Nostoc sp. 'Peltigera membranacea cyanobiont' 232] polyketide synthase [Nostoc punctiforme NIES-2108] acyltransferase domain-containing protein [Nostoc sp. ATCC 53789] acyltransferase domain-containing protein [Nostoc sp. 'Peltigera membranacea cyanobiont' 210A] acyltransferase domain-containing protein [Nostoc sp. KVJ20] acyltransferase domain-containing protein [Nostoc punctiforme] polyketide synthase phosphopantetheine-binding HglE [Nostoc punctiforme PCC 73102] acyltransferase domain-containing protein [Nostoc sp. 'Peltigera membranacea cyanobiont' N6] HglE [Nostoc sp. 'Peltigera membranacea cyanobiont'] acyltransferase domain-containing protein [Nostoc sp. 'Peltigera membranacea cyanobiont' 213] acyltransferase domain-containing protein [Nostoc sp. 'Lobaria pulmonaria (5183) cyanobiont'] acyltransferase domain-containing protein [Nostoc flagelliforme] Acyl carrier protein [Nostoc flagelliforme CCNUN1] acyltransferase domain-containing protein [Nostoc commune] acyltransferase domain-containing protein [Nostoc calcicola] acyltransferase domain-containing protein [Nostoc linckia] acyltransferase domain-containing protein [Nostoc linckia] polyketide synthase [Hassallia byssoidea VB512170] acyltransferase domain-containing protein [[Scytonema hofmanni] UTEX B 1581] acyltransferase domain-containing protein [Tolypothrix sp. NIES-4075] type I polyketide synthase [Scytonema hofmannii] acyltransferase domain-containing protein [Tolypothrix campylonemoides] acyltransferase domain-containing protein [Scytonema sp. HK-05] acyltransferase domain-containing protein [Scytonema sp. NIES-4073] type I polyketide synthase [Mastigocladopsis repens] acyltransferase domain-containing protein [Scytonema tolypothrichoides] polyketide synthase [Fischerella thermalis WC527] acyltransferase domain-containing protein [Fischerella muscicola] acyltransferase domain-containing protein [Mastigocladus laminosus] acyltransferase domain-containing protein [Mastigocladus laminosus] acyltransferase domain-containing protein [Westiellopsis prolifica] acyltransferase domain-containing protein [Fischerella sp. PCC 9339] acyltransferase domain-containing protein [Fischerella sp. PCC 9431] acyltransferase domain-containing protein [Hapalosiphon sp. MRB220] acyltransferase domain-containing

View Full Text

Details

  • File Type
    pdf
  • Upload Time
    -
  • Content Languages
    English
  • Upload User
    Anonymous/Not logged-in
  • File Pages
    3 Page
  • File Size
    -

Download

Channel Download Status
Express Download Enable

Copyright

We respect the copyrights and intellectual property rights of all users. All uploaded documents are either original works of the uploader or authorized works of the rightful owners.

  • Not to be reproduced or distributed without explicit permission.
  • Not used for commercial purposes outside of approved use cases.
  • Not used to infringe on the rights of the original creators.
  • If you believe any content infringes your copyright, please contact us immediately.

Support

For help with questions, suggestions, or problems, please contact us