DOCSLIB.ORG

Redalyc.True Branched Nostocalean Cyanobacteria from Tropical

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Redalyc.True Branched Nostocalean Cyanobacteria from Tropical Revista de Biología Tropical ISSN: 0034-7744 [email protected] Universidad de Costa Rica Costa Rica Ferreira, Viviani; Branco, Luis Henrique Z.; Kaštovský, Jan True branched nostocalean cyanobacteria from tropical aerophytic habitats and molecular assessment of two species from field samples Revista de Biología Tropical, vol. 61, núm. 1, marzo, 2013, pp. 455-466 Universidad de Costa Rica San Pedro de Montes de Oca, Costa Rica Available in: http://www.redalyc.org/articulo.oa?id=44925650034 How to cite Complete issue Scientific Information System More information about this article Network of Scientific Journals from Latin America, the Caribbean, Spain and Portugal Journal's homepage in redalyc.org Non-profit academic project, developed under the open access initiative True branched nostocalean cyanobacteria from tropical aerophytic habitats and molecular assessment of two species from field samples Viviani Ferreira1, Luis Henrique Z. Branco1,2 & Jan Kaštovský3 1. Microbiology Graduation Program, UNESP-São Paulo State University, IBILCE, São José do Rio Preto, SP, Brazil; [email protected] 2. UNESP-São Paulo State University, IBILCE, Department of Zoology and Botany, R. Cristóvão Colombo, 2265, BR-15054-000, São José do Rio Preto, SP, Brazil; [email protected] 3. University of South Bohemia, Department of Botany, Branišovská, 31a, 370 05, České Budějovice, Czech Republic; [email protected] Received 13-II-2012. Corrected 10-VIII-2012. Accepted 11-IX-2012. Abstract: Aerophytic cyanobacteria are commonly found growing on rocks, tree trunks and soil, but the diversity of these organisms is still poorly known. This complex group is very problematic considering the taxonomic arrangement and species circumscription, especially when taking into account tropical populations. In this work, 20 samples of aerophytic cyanobacteria from 15 distinct sampling sites were collected along a tropical rainforest area at the São Paulo State (Brazil). Samples were dried at room temperature after the col- lection, and once in the laboratory, they were rehydrated and analyzed. The taxonomic study resulted in the record and description of nine species of true-branched cyanobacteria pertaining to the genera Spelaeopogon (one specie), Hapalosiphon (two species) and Stigonema (six species). The similarity of the flora found when compared to surveys conducted in other geographical regions was relatively low. These differences could be addressed to ecological conditions of the habitats, to the extension of the area surveyed or even to taxonomic misinterpretations. The molecular assessment of 16S rDNA on the basis of field material was successful for two morphospecies, Hapalosiphon sp. and Stigonema ocellatum; however, their relationships with other populations and species revealed to be uncertain. The results of the floristic survey and of the molecular approach evidenced the fragile delimitation of some genera and species in the true branched group of cyanobacteria. Rev. Biol. Trop. 61 (1): 455-466. Epub 2013 March 01. Key words: 16S rDNA, Brazil, Nostocales, diversity, “Stigonematales”, tropical rainforest, taxonomy. True branched nostocalean cyanobacteria structure, true branching type, heterocyte posi- (formerly Stigonematales) are the most evolved tion and reproduction strategies. prokaryotes regarding thallus organization The classification system proposed by and cell differentiation (Golubić 1976). These Hoffmann et al. (2005) to Cyanobacteria organisms are common in terrestrial habitats merged the former Nostocales and Stigone- and the inner taxonomy is problematic, espe- matales into Nostocales, after several studies cially when tropical populations are included. have pointed out that branching type has no Anagnostidis & Komárek (1990) classified the phylogenetic value for distinguishing orders. true branching cyanobacteria in the order Sti- The presence of heterocytes, however, sup- gonematales with eight families and 48 genera. ports phylogeny and indicates the monophyly The order was characterized by the occurrence of the group (Seo & Yokota 2003, Gugger & of true branched filaments and heterocytes and Hoffmann 2004). Further contributions to the the below order taxa were defined by filament classification of cyanobacteria (Komárek 2006, Rev. Biol. Trop. (Int. J. Trop. Biol. ISSN-0034-7744) Vol. 61 (1): 455-466, March 2013 455 2010) have supported the systematic arrange- Pulvinularia suecica, respectively) occurring ment proposed by Hoffmann et al. (2005) for in Brazilian territory. this group of organisms. This paper aims to improve the taxonomic The taxonomy of cyanobacteria is now knowledge of an ecologically and evolutionary based on polyphasic approach including mor- important group of organisms and to describe phological characters (e.g., cell division and morphological and habitat data of species pre- polarity, branching type and thallus morpholo- sent in a tropical region. In addition, the mole- gy), molecular data, ultrastructural arrangement cular assessment from field samples constitutes (mainly thylakoids) and ecological parameters, a complementary objective in order to improve which are combined to define groups. How- the characterization of the populations found. ever, the developmental biology of the true branched cyanobacteria is still in the early MATERIALS AND METHODS stages of knowledge (Finsinger et al. 2008). The problems related to the artificial cultiva- Detailed information on sampling area, tion of most of true branched cyanobacteria as well as on collection, preservation and cha- samples (e.g. environmental exigencies not racterization of sites, samples and taxonomic totally understood, slow growth and low com- study are described in Branco et al. (2009). petitive ability under artificial conditions prior Briefly, samples of true branched cyanobacte- to isolation) difficult the assessment of mor- ria were collected in the rainforest region along phological variability and molecular sequenc- the Northern littoral area of the São Paulo State ing by the most common and regular methods. (Table 1). Visible growths of cyanobacteria Taxonomic studies on true branched cya- on soil, tree trunks and rocky substrates were nobacteria are not abundant. The few papers randomly collected with spatula or penknife. devoted to the knowledge of these organisms The samples were stored in paper bags and include just some genera (e.g., Capsosira, dried at room temperature (usually for 24 to 48h). For each collection (sometimes diffe- Chlorogloeopsis, Fischerella, Nostochopsis, rent samples-coded SAMA-were taken from Stigonema and Westiellopsis) with reduced the same site), data about global position and number of species, mainly about populations altitude (GPS Garmin, eTrex Summit), air and from temperate regions, and, in fact, this is plant-mass temperature (as close as possible considered not sufficient to solve the evolution- to the growths) (digital thermometer with a ary history of the true branched cyanobacteria 11cm long metal probe), air and plant-mass (Tomitani 2004). humidity (ThermoHygrometer Hana Instru- Some of the most extensive surveys of ments, HI8564), total and relative irradiance tropical aerophytic cyanobacteria that include (Li-Cor Quantameter, with spherical sensor– true branched taxa are those of Gardner (1927), the relative values are a relation between the Kufferath (1929), Golubić (1967), Hoffmann absolute value measured as close as possible (1986), Sarthou et al. (1995), Büdel et al. to the mass by the absolute value measured at (1994, 1997, 2002), Couté et al. (1999), Pat- an open area) and substratum pH (Merck pH tanaik & Adhikary (2002) and Kaštovský et strips-pH was measured through a solution al. (2011). Surveys of the Brazilian flora of with distilled/deionized water and a sample of true branched cyanobacteria (including those the substratum) of collection sites and samples from freshwater habitats) are very scarce and were recorded. practically restricted to the papers of Silva & In the laboratory, samples were rehy- Sant’Anna (1991, 1996). The contributions of drated and then examined under stereoscope Branco & Necchi-Júnior (1999) and Branco (Olympus SZX7) and light (Olympus BX-50) et al. (2010) focused single true branched microscopes and microphotographs were taken freshwater species (Doliocatella formosa and by using a digital camera (Olympus DP71) 456 Rev. Biol. Trop. (Int. J. Trop. Biol. ISSN-0034-7744) Vol. 61 (1): 455-466, March 2013 TABLE 1 Global position and altitude of the collection sites and their respective samples Site Sample Latitude (S) Longitude (W) Altitude (m) 01 SAMA 01 23º35’51” 46º10’08” 800 02 SAMA 02 23º41’07” 46º05’52” 791 03 SAMA 04 23º41’09” 46º05’52” 787 04 SAMA 10 23º46’21” 45º57’14” 22 05 SAMA 13 23º46’14” 45º43’14” 55 08 SAMA 22 23º36’10” 45º26’43” 183 09 SAMA 09 23º30’34” 45°07’56” 0 10 SAMA 23, SAMA 24 23º35’16” 45º26’57” 600 13 SAMA 33 23º32’56” 45º14’47” 23 14 SAMA 34, SAMA 35, SAMA 36, SAMA 37 23º29’39” 45º08’38” 66 15 SAMA 38 23º23’06” 45º07’19” 122 18 SAMA 45 23º22’37” 45º07’07” 309 19 SAMA 48, SAMA 49 23º24’50” 45º01’43” 77 21 SAMA 53 23º10’52” 44º50’00” 1 239 22 SAMA 54 23º09’54” 44º50’21” 1 460 coupled to the light microscope. Specimens hydrolysis (Birnboim & Doly 1979) and ampli- were studied according to their taxonomic fied with “DYEnamic ET Terminator Cycle features and were identified based on specific Sequencing” Kit (Amersham Biosciences, Pis- literature on cyanobacteria. The classification cataway, NJ, EUA). M13F and SP6R vector system
Load more

Recommended publications
  • DOMAIN Bacteria PHYLUM Cyanobacteria
    DOMAIN Bacteria PHYLUM Cyanobacteria D Bacteria Cyanobacteria P C Chroobacteria Hormogoneae Cyanobacteria O Chroococcales Oscillatoriales Nostocales Stigonematales Sub I Sub III Sub IV F Homoeotrichaceae Chamaesiphonaceae Ammatoideaceae Microchaetaceae Borzinemataceae Family I Family I Family I Chroococcaceae Borziaceae Nostocaceae Capsosiraceae Dermocarpellaceae Gomontiellaceae Rivulariaceae Chlorogloeopsaceae Entophysalidaceae Oscillatoriaceae Scytonemataceae Fischerellaceae Gloeobacteraceae Phormidiaceae Loriellaceae Hydrococcaceae Pseudanabaenaceae Mastigocladaceae Hyellaceae Schizotrichaceae Nostochopsaceae Merismopediaceae Stigonemataceae Microsystaceae Synechococcaceae Xenococcaceae S-F Homoeotrichoideae Note: Families shown in green color above have breakout charts G Cyanocomperia Dactylococcopsis Prochlorothrix Cyanospira Prochlorococcus Prochloron S Amphithrix Cyanocomperia africana Desmonema Ercegovicia Halomicronema Halospirulina Leptobasis Lichen Palaeopleurocapsa Phormidiochaete Physactis Key to Vertical Axis Planktotricoides D=Domain; P=Phylum; C=Class; O=Order; F=Family Polychlamydum S-F=Sub-Family; G=Genus; S=Species; S-S=Sub-Species Pulvinaria Schmidlea Sphaerocavum Taxa are from the Taxonomicon, using Systema Natura 2000 . Triochocoleus http://www.taxonomy.nl/Taxonomicon/TaxonTree.aspx?id=71022 S-S Desmonema wrangelii Palaeopleurocapsa wopfnerii Pulvinaria suecica Key Genera D Bacteria Cyanobacteria P C Chroobacteria Hormogoneae Cyanobacteria O Chroococcales Oscillatoriales Nostocales Stigonematales Sub I Sub III Sub
    [Show full text]
  • Identification and Characterization of Novel Filament-Forming Proteins In
    www.nature.com/scientificreports OPEN Identifcation and characterization of novel flament-forming proteins in cyanobacteria Benjamin L. Springstein 1,4*, Christian Woehle1,5, Julia Weissenbach1,6, Andreas O. Helbig2, Tal Dagan 1 & Karina Stucken3* Filament-forming proteins in bacteria function in stabilization and localization of proteinaceous complexes and replicons; hence they are instrumental for myriad cellular processes such as cell division and growth. Here we present two novel flament-forming proteins in cyanobacteria. Surveying cyanobacterial genomes for coiled-coil-rich proteins (CCRPs) that are predicted as putative flament-forming proteins, we observed a higher proportion of CCRPs in flamentous cyanobacteria in comparison to unicellular cyanobacteria. Using our predictions, we identifed nine protein families with putative intermediate flament (IF) properties. Polymerization assays revealed four proteins that formed polymers in vitro and three proteins that formed polymers in vivo. Fm7001 from Fischerella muscicola PCC 7414 polymerized in vitro and formed flaments in vivo in several organisms. Additionally, we identifed a tetratricopeptide repeat protein - All4981 - in Anabaena sp. PCC 7120 that polymerized into flaments in vitro and in vivo. All4981 interacts with known cytoskeletal proteins and is indispensable for Anabaena viability. Although it did not form flaments in vitro, Syc2039 from Synechococcus elongatus PCC 7942 assembled into flaments in vivo and a Δsyc2039 mutant was characterized by an impaired cytokinesis. Our results expand the repertoire of known prokaryotic flament-forming CCRPs and demonstrate that cyanobacterial CCRPs are involved in cell morphology, motility, cytokinesis and colony integrity. Species in the phylum Cyanobacteria present a wide morphological diversity, ranging from unicellular to mul- ticellular organisms.
    [Show full text]
  • Predictive Modeling of Microcystin Concentrations in Drinking Water Treatment Systems Of
    Predictive Modeling of Microcystin Concentrations in Drinking Water Treatment Systems of Ohio and their Potential Health Effects Thesis Presented in Partial Fulfillment of the Requirements for the Degree Master of Science in the Graduate School of The Ohio State University By: Traven A. Wood, B.S. Graduate Program in Public Health The Ohio State University 2019 Thesis Committee: Mark H. Weir (Adviser) Jiyoung Lee Allison MacKay Copyright by Traven Aldin Wood 2019 Abstract Cyanobacteria present significant public health and engineering challenges due to their expansive growth and potential synthesis of microcystins in surface waters that are used as a drinking water source. Eutrophication of surface waters coupled with favorable climatic conditions can create ideal growth environments for these organisms to develop what is known as a cyanobacterial harmful algal bloom (cHAB). Development of methods to predict the presence and impact of microcystins in drinking water treatment systems is a complex process due to system uncertainties. This research developed two predictive models, first to estimate microcystin concentrations at a water treatment intake, second, to estimate the risks of finished water detections after treatment and resultant health effects to consumers. The first model uses qPCR data to adjust phycocyanin measurements to improve predictive linear regression relationships. Cyanobacterial 16S rRNA and mcy genes provide a quantitative means of measuring and detecting potentially toxic genera/speciess of a cHAB. Phycocyanin is a preferred predictive tool because it can be measured in real-time, but the drawback is that it cannot distinguish between toxic genera/speciess of a bloom. Therefore, it was hypothesized that genus specific ratios using qPCR data could be used to adjust phycocyanin measurements, making them more specific to the proportion of the bloom that is producing toxin.
    [Show full text]
  • Aetokthonos Hydrillicola Gen. Et Sp. Nov.: Epiphytic Cyanobacteria on Invasive Aquatic Plants Implicated in Avian Vacuolar Myelinopathy
    Phytotaxa 181 (5): 243–260 ISSN 1179-3155 (print edition) www.mapress.com/phytotaxa/ PHYTOTAXA Copyright © 2014 Magnolia Press Article ISSN 1179-3163 (online edition) http://dx.doi.org/10.11646/phytotaxa.181.5.1 Aetokthonos hydrillicola gen. et sp. nov.: Epiphytic cyanobacteria on invasive aquatic plants implicated in Avian Vacuolar Myelinopathy SUSAN B. WILDE1*, JEFFREY R. JOHANSEN2,3, H. DAYTON WILDE4, PENG JIANG4, BRADLEY A. BARTELME1 & REBECCA S. HAYNIE5 1Warnell School of Forestry and Natural Resources. University of Georgia, Athens, GA 30602. 2Department of Biology, John Carroll University, University Heights, OH 44118. 3Department of Botany, Faculty of Science, University of South Bohemia, 31 Branišovská, 370 05 České Budějovice, Czech Republic. 4Department of Horticulture, University of Georgia, Athens, GA 30602. 5SePRO Corporation, 11550 North Meridian Street, Suite 600, Carmel, IN 46032. *Corresponding author ([email protected]) Abstract Research into the taxonomy of a novel cyanobacterial epiphyte in locations where birds, most notably Bald eagle and Ameri- can coots, are dying from a neurologic disease (Avian Vacuolar Myelinopathy—AVM) has been ongoing since 2001. Field investigations revealed that all sites where birds were dying had extensive invasive aquatic vegetation with dense colonies of an unknown cyanobacterial species growing on the underside of leaves. Morphological evaluation indicated that this was a true-branching, heterocystous taxon falling within the former order Stigonematales. However, 16S rRNA gene sequence demonstrated that it did not match closely with any described genus or species. More recent sequence analysis of the 16S rRNA gene and associated ITS region from additional true branching species resulted in a unique phylogenetic placement distant from the other clades of true-branching cyanobacteria.
    [Show full text]
  • (Cyanobacterial Genera) 2014, Using a Polyphasic Approach
    Preslia 86: 295–335, 2014 295 Taxonomic classification of cyanoprokaryotes (cyanobacterial genera) 2014, using a polyphasic approach Taxonomické hodnocení cyanoprokaryot (cyanobakteriální rody) v roce 2014 podle polyfázického přístupu Jiří K o m á r e k1,2,JanKaštovský2, Jan M a r e š1,2 & Jeffrey R. J o h a n s e n2,3 1Institute of Botany, Academy of Sciences of the Czech Republic, Dukelská 135, CZ-37982 Třeboň, Czech Republic, e-mail: [email protected]; 2Department of Botany, Faculty of Science, University of South Bohemia, Branišovská 31, CZ-370 05 České Budějovice, Czech Republic; 3Department of Biology, John Carroll University, University Heights, Cleveland, OH 44118, USA Komárek J., Kaštovský J., Mareš J. & Johansen J. R. (2014): Taxonomic classification of cyanoprokaryotes (cyanobacterial genera) 2014, using a polyphasic approach. – Preslia 86: 295–335. The whole classification of cyanobacteria (species, genera, families, orders) has undergone exten- sive restructuring and revision in recent years with the advent of phylogenetic analyses based on molecular sequence data. Several recent revisionary and monographic works initiated a revision and it is anticipated there will be further changes in the future. However, with the completion of the monographic series on the Cyanobacteria in Süsswasserflora von Mitteleuropa, and the recent flurry of taxonomic papers describing new genera, it seems expedient that a summary of the modern taxonomic system for cyanobacteria should be published. In this review, we present the status of all currently used families of cyanobacteria, review the results of molecular taxonomic studies, descriptions and characteristics of new orders and new families and the elevation of a few subfamilies to family level.
    [Show full text]
  • NOSTOCALES, CYANOBACTERIA): CONVERGENT EVOLUTION RESULTING in a CRYPTIC GENUS Sergey Shalygin John Carroll University, [email protected]
    John Carroll University Carroll Collected Masters Theses Theses, Essays, and Senior Honors Projects Winter 2016 CYANOMARGARITA GEN. NOV. (NOSTOCALES, CYANOBACTERIA): CONVERGENT EVOLUTION RESULTING IN A CRYPTIC GENUS Sergey Shalygin John Carroll University, [email protected] Follow this and additional works at: http://collected.jcu.edu/masterstheses Part of the Biology Commons Recommended Citation Shalygin, Sergey, "CYANOMARGARITA GEN. NOV. (NOSTOCALES, CYANOBACTERIA): CONVERGENT EVOLUTION RESULTING IN A CRYPTIC GENUS" (2016). Masters Theses. 21. http://collected.jcu.edu/masterstheses/21 This Thesis is brought to you for free and open access by the Theses, Essays, and Senior Honors Projects at Carroll Collected. It has been accepted for inclusion in Masters Theses by an authorized administrator of Carroll Collected. For more information, please contact [email protected]. CYANOMARGARITA GEN. NOV. (NOSTOCALES, CYANOBACTERIA): CONVERGENT EVOLUTION RESULTING IN A CRYPTIC GENUS A Thesis Submitted to the Office of Graduate Studies College of Arts & Sciences of John Carroll University In Partial Fulfillment of the Requirements For the Degree of Master of Science By Sergei Shalygin 2016 The thesis of Sergei Shalygin is hereby accepted: ., µ_ fJo., t fvt8fl'_ 7 <>U, Reader - C · opher A. Sheil Date M,UJf� Reader - Michael P. Martin Date I 2 - z ,, Reader - Nicole Pietrasiak Date ---1-1 - z z - <ot<e Date I certify that this is the copy or the original document \I - 22- �{ {) Author - Sergei Shalygin Date ACKNOWLEDGEMENTS I thank John Carroll University for salary support, supplies and use of laboratory facilities, and supportive faculty and staff in the Biology Department. Additionally, I am grateful to all lab mates from the Johansen laboratory for useful discussion of the work.
    [Show full text]
  • Symphyonema Bifilamentata Sp. Nov., the Right Fischerella
    microorganisms Article Symphyonema bifilamentata sp. nov., the Right Fischerella ambigua 108b: Half a Decade of Research on Taxonomy and Bioactive Compounds in New Light Patrick Jung 1,* , Paul M. D’Agostino 2 , Burkhard Büdel 3 and Michael Lakatos 1 1 Applied Logistics and Polymer Sciences, University of Applied Sciences Kaiserslautern, Carl-Schurz-Str. 10-16, 66953 Pirmasens, Germany; [email protected] 2 Faculty of Chemistry and Food Chemistry, Technical University of Dresden, Chair of Technical Biochemistry, Bergstraße 66, 01069 Dresden, Germany; [email protected] 3 Biology Institute, University of Kaiserslautern, Erwin-Schrödinger Str. 52, 67663 Kaiserslautern, Germany; [email protected] * Correspondence: [email protected] Abstract: Since 1965 a cyanobacterial strain termed ‘Fischerella ambigua 108b’ was the object of several studies investigating its potential as a resource for new bioactive compounds in several European institutes. Over decades these investigations uncovered several unique small molecules and their respective biosynthetic pathways, including the polychlorinated triphenyls of the ambigol family and the tjipanazoles. However, the true taxonomic character of the producing strain remained concealed until now. Applying a polyphasic approach considering the phylogenetic position based on the 16S rRNA and the protein coding gene rbcLX, secondary structures and morphological features, we Citation: Jung, P.; D’Agostino, P.M.; present the strain ‘Fischerella ambigua 108b’ as Symphyonema bifilamentata sp. nov. 97.28. Although Büdel, B.; Lakatos, M. Symphyonema there is the type species (holotype) S. sinense C.-C. Jao 1944 there is no authentic living strain or bifilamentata sp. nov., the Right material for genetic analyses for the genus Symphyonema available.
    [Show full text]
  • Biogeography of Terrestrial Cyanobacteria from Antarctic Ice-Free Areas
    Annals of Glaciology 51(56) 2010 1 Biogeography of terrestrial cyanobacteria from Antarctic ice-free areas Z. NAMSARAEV,1,2 M.J. MANO,1 R. FERNANDEZ,1 Annick WILMOTTE1 1Center for Protein Engineering, University of LieÁge, B-4000 LieÁge, Belgium E-mail: [email protected] 2Winogradsky Institute of Microbiology, Russian Academy of Sciences, 117312 Moscow, Russia ABSTRACT. Cyanobacteria inhabit the Antarctic continent and have even been observed in the most southerly ice-free areas of Antarctica (86±878 S). The highest molecular diversity of cyanobacterial communities was found in the areas located between 708 S and 808 S. Further south and further north from this zone, the diversity abruptly decreased. Seventy-nine per cent (33 of 42 operational taxonomic units) of Antarctic terrestrial cyanobacteria have a cosmopolitan distribution. Analysis of the sampling efforts shows that only three regions (southern Victoria Land, the Sùr Rondane Mountains and Alexander Island) have been particularly well studied, while other areas did not receive enough attention. Although cyanobacteria possess a capacity for long-range transport, regional populations in Antarctic ice-free areas seem to exist. The cyanobacterial communities of the three most intensively studied regions, separated from each other by a distance of 3000±3400 km, had a low degree of similarity with each other. Further development of microbial biogeography demands a standardized approach. For this purpose, as a minimal standard, we suggest using the sequence of cyanobacterial 16S rRNA gene between Escherichia coli positions 405±780. INTRODUCTION species, genus and even family level is observed in Antarctic Ice-free areas of Antarctica cover a tiny proportion (0.34%) biota and it seems unlikely that such levels of endemism could have evolved after the last glaciation 18 000 years of the continent.
    [Show full text]
  • Cyanobacteria) Clade Geitleriaceae Fam
    John Carroll University Carroll Collected Masters Theses Theses, Essays, and Senior Honors Projects Spring 2017 FINALLY, THE MOLECULAR CHARACTERIZATION OF GEITLERIA: RESULTS IN THE FORMATION OF A NEWLY DESCRIBED NOSTOCALES (CYANOBACTERIA) CLADE GEITLERIACEAE FAM. PROV., SP. PROV Jonathan Kilgore John Carroll University, [email protected] Follow this and additional works at: http://collected.jcu.edu/masterstheses Part of the Biology Commons Recommended Citation Kilgore, Jonathan, "FINALLY, THE MOLECULAR CHARACTERIZATION OF GEITLERIA: RESULTS IN THE FORMATION OF A NEWLY DESCRIBED NOSTOCALES (CYANOBACTERIA) CLADE GEITLERIACEAE FAM. PROV., SP. PROV" (2017). Masters Theses. 24. http://collected.jcu.edu/masterstheses/24 This Thesis is brought to you for free and open access by the Theses, Essays, and Senior Honors Projects at Carroll Collected. It has been accepted for inclusion in Masters Theses by an authorized administrator of Carroll Collected. For more information, please contact [email protected]. FINALLY, THE MOLECULAR CHARACTERIZATION OF GEITLERIA: RESULTS IN THE FORMATION OF A NEWLY DESCRIBED NOSTOCALES (CYANOBACTERIA) CLADE GEITLERIACEAE FAM. PROV., SP. PROV. A Thesis Submitted to The Graduate School of John Carroll University in Partial Fulfillment of the Requirements for the Degree of Master of Science By Chase Kilgore 2017 ACKNOWLEDGEMENT This work was completed with support from the project 15-11912S of the Czech Science Foundation. I thank Mike Martin for assistance in the hetC amplification attempts , and also thank the staff at Great Smoky Mountains National Park for allowing research access to the cave in White Oak Sink. First I would like to thank my family, and my mother especially for all the support she has given me throughout my life, personally and professionally.
    [Show full text]
  • Natural Products from Cyanobacteria: Focus on Beneficial Activities
    marine drugs Review Natural Products from Cyanobacteria: Focus on Beneficial Activities Justine Demay 1,2 ,Cécile Bernard 1,* , Anita Reinhardt 2 and Benjamin Marie 1 1 UMR 7245 MCAM, Muséum National d’Histoire Naturelle-CNRS, Paris, 12 rue Buffon, CP 39, 75231 Paris CEDEX 05, France; [email protected] (J.D.); [email protected] (B.M.) 2 Thermes de Balaruc-les-Bains, 1 rue du Mont Saint-Clair BP 45, 34540 Balaruc-Les-Bains, France; [email protected] * Correspondence: [email protected]; Tel.: +33-1-40-79-31-83/95 Received: 15 April 2019; Accepted: 21 May 2019; Published: 30 May 2019 Abstract: Cyanobacteria are photosynthetic microorganisms that colonize diverse environments worldwide, ranging from ocean to freshwaters, soils, and extreme environments. Their adaptation capacities and the diversity of natural products that they synthesize, support cyanobacterial success in colonization of their respective ecological niches. Although cyanobacteria are well-known for their toxin production and their relative deleterious consequences, they also produce a large variety of molecules that exhibit beneficial properties with high potential in various fields (e.g., a synthetic analog of dolastatin 10 is used against Hodgkin’s lymphoma). The present review focuses on the beneficial activities of cyanobacterial molecules described so far. Based on an analysis of 670 papers, it appears that more than 90 genera of cyanobacteria have been observed to produce compounds with potentially beneficial activities in which most of them belong to the orders Oscillatoriales, Nostocales, Chroococcales, and Synechococcales. The rest of the cyanobacterial orders (i.e., Pleurocapsales, Chroococcidiopsales, and Gloeobacterales) remain poorly explored in terms of their molecular diversity and relative bioactivity.
    [Show full text]
  • J. Gen. Appl. Microbiol
    Supplementary Table 1. Primers used in this study. # Primer name Sequence 1 HglEA KO 5’ Fw ACTAGTGGATCCCCCGTGTAACAGC 2 HglEA KO 5’ Rv GAATTCCTGCAGCCCGGGATTAGCAGACATAGGACA 3 HglEA KO 3’ Fw TCGACCTCGAGGGGGAACGTCCCACGCC 4 HglEA KO 3’ Rv GCGAATTGGGTACCGAAGCAGGACGAAC 5 HglE2 KO 5’ Fw ACTAGTGGATCCCCCGATCAAAAACGTACC 6 HglE2 KO 5’ Rv GAATTCCTGCAGCCCGGGTGTATCCATGTTCCTTTTGTC 7 HglE2 KO 3’ Fw TACCGTCGACCTCGAAGAACTGGCGGAAAAG 8 HglE2 KO 3’ Rv CGGGCCCCCCCTCGACCTTTTGTGGTATAGCC 9 all1643 KO 5’ Fw ACTAGTGGATCCCCCTTATCAGGAGGGGA 10 all1643 KO 5’ Rv GAATTCCTGCAGCCCACCATGAACGCTATG 11 all1643 KO 3’ Fw TACCGTCGACCTCGAGCCTTGGGAGTCGAA 12 all1643 KO 3’ Rv CGGGCCCCCCCTCGAAGGCATAAGGGCCAG 13 hglE2 Fw ATGTCTGCTAATCCCATGGATACACAACAAAAGACCC 14 hglE2 Rv GAATTCCTGCAGCCCGAGGATTCGGAGCCA 15 PpsbA Fw CCTCGAGGGGGGGCCGATCTCAATGAATATTGGTTGAC 16 PpsbA Rv GTGTATCCATGCGAAACGATCCTCA 17 DGD2 Fw TTCGCATGGATACACAACAAAAGACC 18 DGD2 Rv ATTGGGTACCGGGCCGTAAAGCTCGCAC 19 rnpB-RTFw CCAGTTCCGCTATCAGAGAG 20 rnpB-RTRv GAGGAGAGAGTTGGTGGTAAG 21 HglE2 seq Fw1 GCCCAGAAACAATCAAGC 22 HglE2 seq Rv1 GTGTCGGGGTATATTCTTC 23 spec-mid-Fw GCGAGGGCTTTACTAAGCTG 24 hglE-RTFw CCGTAGTCAACCAAGTTG 25 hglE-RTRv TATACTGACTGGCTGCCA 26 Km dw GGGATCTCATGCTGGAG 27 all1643 mid AACCCCATTATCGCCTC 0.1 Out group (PfaA, Shewanella sp. BR-2) type I polyketide synthase [Scytonema millei] Outgroup (PfaA) hypothetical protein QH73_010865 [Scytonema millei VB511283] SDR family NAD(P)-dependent oxidoreductase [Leptolyngbya sp. IPPAS B-1204] acyltransferase domain-containing protein [Leptolyngbya sp. IPPAS B-1204] type I polyketide
    [Show full text]
  • Toxic Cyanobacteria in Water; a Guide to Their Public Health
    Chapter 3 Introduction to cyanobacteria Leticia Vidal, Andreas Ballot, Sandra M. F. O. Azevedo, Judit Padisák and Martin Welker CONTENTS Introduction 163 3.1 Cell types and cell characteristics 164 3.2 Morphology of multicellular forms 168 3.3 Cyanobacterial pigments and colours 170 3.4 Secondary metabolites and cyanotoxins 171 3.5 Taxonomy of cyanobacteria 172 3.6 Major cyanobacterial groups 178 3.7 Description of common toxigenic and bloom-forming cyanobacterial taxa 179 3.7.1 Filamentous forms with heterocytes 190 3.7.2 Filamentous forms without heterocytes and akinetes 195 3.7.3 Colonial forms 200 Picture credits 203 References 204 INTRODUCTION Cyanobacteria are a very diverse group of prokaryotic organisms that thrive in almost every ecosystem on earth. In contrast to other prokaryotes (bacteria and archaea), they perform oxygenic photosynthesis and possess chlorophyll-a. Their closest relatives are purple bacteria (Woese et al., 1990; Cavalier-Smith, 2002) – and chloroplasts in higher plants (Moore et al., 2019). Photosynthetic activity of cyanobacteria is assumed to have changed the earth’s atmosphere in the Proterozoic Era some 2.4 billion years ago during the so-called Great Oxygenation Event (Hamilton et al., 2016; Garcia-Pichel et al., 2019). Historically, cyanobacteria were considered as plants or plant-like organ- isms and were termed “Schizophyceae”, “Cyanophyta”, “Cyanophyceae” or “blue-green algae”. Since their prokaryotic nature has unambiguously been proven, the term “cyanobacteria” (or occasionally “cyanoprokary- otes”) has been adopted in the scientific literature. A metagenomic study by Soo et al. (2017) revealed that cyanobacteria also comprise groups of 163 164 Toxic Cyanobacteria in Water nonphotosynthetic bacteria and the taxon Oxyphotobacteria is proposed for cyanobacteria in a strict sense.
    [Show full text]