DOCSLIB.ORG

A Novel Potentially Causative Variant of NDUFAF7 Revealed by Mutation Screening in a Chinese Family with Pathologic Myopia

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
A Novel Potentially Causative Variant of NDUFAF7 Revealed by Mutation Screening in a Chinese Family with Pathologic Myopia Genetics A Novel Potentially Causative Variant of NDUFAF7 Revealed by Mutation Screening in a Chinese Family With Pathologic Myopia Baojiang Wang,1,2 Yongli Liu,3 Shiguo Chen,1,2 Yunmiao Wu,1,2 Sheng Lin,1,2 Yongheng Duan,1,2 Kaifeng Zheng,1,2 Linghua Zhang,1 Xueying Gu,1 Wenxu Hong,1 Hao Shao,1 Xuchun Zeng,1 Bi Sun,3 and Shan Duan1,2 1Laboratory of Medical Genetics, Shenzhen Research Institute of Population and Family Planning, Shenzhen, China 2Shenzhen Center for Birth Defect Research and Prevention, Shenzhen, China 3Department of Ophthalmology, The People’s Hospital of Wenshan Prefecture, Wenshan Zhuang-Miao Autonomous Prefecture, China Correspondence: Shan Duan, Labo- PURPOSE. Pathologic myopia described as myopia accompanied by severe deformation of the ratory of Medical Genetics, Shenz- eye besides excessive elongation of eye, is usually a genetic heterogeneous disorder hen Research Institute of Population characterized by extreme, familial, early-onset vision loss. However, the exact pathogenesis of and Family Planning, 4009# Xinzhou pathologic myopia remains unclear. In this study, we screened a Han Chinese family with Road, Futian District, Shenzhen City, pathologic myopia to identify the causative mutation and explore the possible pathogenic 518040, China; [email protected]. mechanism based on evaluation of the biological functions of the mutation. Submitted: October 18, 2016 METHODS. We identified the mutations in a family with pathologic myopia by single nucleotide Accepted: July 10, 2017 polymorphism array combined with short tandem repeat microsatellite marker analysis and exome sequencing. Mutations were validated among family members by direct Sanger Citation: Wang B, Liu Y, Chen S, et al. A novel potentially causative variant of sequencing. The subcellular localization of the protein variant was investigated by NDUFAF7 revealed by mutation immunofluorescence, and the stability of the mutant protein was determined by screening in a Chinese family with immunoblotting. Intracellular levels of adenosine triphosphate and reactive oxygen species pathologic myopia. Invest Ophthal- and complex I activity were measured by traditional biochemical methods to determine the mol Vis Sci. 2017;58:4182–4192. DOI: functional role of the disease-associated mutation. 10.1167/iovs.16-20941 RESULTS. The novel missense mutation: c.798C>G (p.Asp266Glu) in NDUFAF7, cosegregated with the disease and the resulting amino acid substitution affected a highly conserved residue in its protein. The mutation D266E in NDUFAF7 impaired complex I activity, which resulted in decreased ATP levels in cultured cells. CONCLUSIONS. We propose that the heterozygous mutation (c.798C>G) in NDUFAF7 may contribute to the pathogenesis of pathologic myopia, possibly by interfering with the phototransduction cascade. Mitochondrial dysfunction during eye development may lead to pathologic myopia. Keywords: pathologic myopia, NDUFAF7, causative mutation igh myopia is an extreme form of myopia, usually defined mental factors, such as higher level of education, spending H by an ocular axial length >26 mm or a refractive error < more time on near-work, less time on outdoor activities, and À6.00 diopters (D). High myopia is a leading cause of blindness increasing urbanization have been known to be associated with worldwide, with a relatively high prevalence of 1% to 5% in PM.16–19 The complex nature of PM means that its etiology Asian countries, and as high as 4.1% in China.1–4 remains unclear. High myopia can be complicated by pathology in 8% of high In this study, we aimed to screen the causative mutation myopia in that there might be other genetic variants that play a from a Han Chinese family with pathologic myopia and eval- role in this process compared to high myopia without 5–8 uated its biological functions. We demonstrated that one mu- pathology. Pathologic myopia (PM) generally causes irrevers- tation in NDUFAF7 might be responsible for the development of ible visual impairment, which involves not only elongation of myopia. Our study establishes a connection between mitochon- the eye, but also characteristic pathologic changes in the retina, dria defect and pathologic myopia. The results of this study may choroid, and sclera, such as posterior sclera staphyloma, provide valuable insights for the further treatment of PM. macular degeneration, lacquer cracks, and chorioretinal atro- phy.9 Pathologic myopia is highly heritable, and genetic linkage studies have identified over 20 loci for PM, with autosomal MATERIALS AND METHODS dominant, autosomal recessive, or X-linked recessive modes of 10–13 inheritance. More than 70 genes related to refractive Patients variation have been screened out by association studies.14 Furthermore, recent studies have indicated that environment is A Han Chinese family with PM was recruited from the another factor influencing the growth of the eye.15 Environ- department of ophthalmology at the People’s Hospital of Copyright 2017 The Authors iovs.arvojournals.org j ISSN: 1552-5783 4182 This work is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License. Downloaded from iovs.arvojournals.org on 10/02/2019 Causative Mutation Identified in a Pathologic Myopia Family IOVS j August 2017 j Vol. 58 j No. 10 j 4183 Wenshan prefecture, Yunnan Province. All patients provided Phylogenetic Sequence Analysis informed consent. The study was approved by the Shenzhen Research Institute of Population and Family Planning Review NDUFAF7 amino acid sequences across species were extracted Board and adhered to the tenets of the Declaration of Helsinki. from the National Center for Biotechnology Information The diagnosis of PM was based on progressive loss of Homologene database and aligned using the multiple align- peripheral vision, age-related decrease in visual acuity, and ment application in the DNAMAN tool (version 7). Phyloge- waxy pale discs. Medical and ophthalmic histories were netic analysis was performed using the neighbor-joining procedure. obtained, and ophthalmologic examinations were carried out. None of the family members had any history of other ocular or systemic abnormalities. A total of 50 healthy Han Chinese DNA Constructs individuals who were unrelated to each other or to the patients As previously reported, NDUFAF7 has two transcripts of 1.3 were recruited as controls. All the patients in the family were and 1.0 kb, respectively.21 Here, we focused our studies on the female, and we therefore enrolled more female control long isoform. The cDNA for full-length NDUFAF7 (NM_144736) individuals (2:1, female:male). The age of the controls ranged was amplified by reverse transcription-PCR from a sample of from 50 to 65.4 years (mean 52.9 6 2.7 years), and the average human brain total RNA (636530; Clontech, Mountain View, CA, axial length for the right eye (OD) was 23.11 6 0.72 mm. All USA) using the forward and reverse primers 50-ATGAGTG controls originated from the same geographical area as the TACTGCTGAGGTCAG-30 and 50-CTGCCAAGCAAGTTCAC patients. TAAAC-30, respectively. The PCR product was purified and cloned into the pcDNA3.1 vector (Invitrogen, Carlsbad, CA, Genome-wide Genetic Analysis Based on Single- USA). Disease-associated mutation was introduced using a site- Nucleotide Polymorphism (SNP) and Short directed mutagenesis kit (Q5, E0552S; New England Biolabs, Ipswich, MA, USA). The accuracy of the clones was verified by Tandem Repeat (STR) Genotyping Sanger sequencing. We created C-terminal tagged constructs Blood samples were collected and genomic DNA was extracted using PCR primers incorporating a FLAG tag downstream of by using a blood kit (NucleoSpin; Macherey-Nagel, Duren,¨ NDUFAF7 (primers available upon request). Germany). Six DNA samples from family members (proband, her two parents, her daughter, and her two siblings) were Cell Culture and Immunoblotting genotyped using a commercial SNP array (Human Mapping 250K SNP GeneChip Sty Array; Affymetrix, Santa Clara, CA, Human retinal pigment epithelium (ARPE)-19 (eye); 293T USA). SNP genotypes were obtained following the Affymetrix (kidney); and E6E7 (cervical) cells were grown at 378Cinan GeneChip Mapping protocol. The 262,270 SNPs were searched atmosphere of 5% CO2 in high-glucose Dulbecco’s modified Eagle medium (DMEM) supplemented with 10% fetal bovine for regions containing ‡10 consecutive SNPs and segregating serum (10099–141; Gibco, Grant Island, NY, USA). DNA in all patients. To clarify the boundaries of regions, we construct was transiently transfected into cells using transfec- performed STR microsatellite marker analysis in family tion reagent (Lipofectamine 2000; Life Technologies, Carlsbad, members based on SNP haplotype identified core regions, CA, USA) in growth medium in a six-well plate according to the using a commercial mapping set (ABI PRISM Linkage Mapping manufacturer’s instructions. After incubation for a further 48 Sets v2.5 kit; Applied Biosystems, Inc., Foster City, CA, USA). hours, the cells were harvested and lysed with radio immuno- The STR markers were amplified by PCR using standard precipitation assay buffer for 30 minutes on ice. Whole-cell protocols. The PCR products were electrophoresed using a 16- proteins (20 lg) were separated by SDS-PAGE and immuno- capillary genetic analyzer (ABI 3130XL; Applied Biosystems, blotted with 1 lg/mL of rabbit polyclonal FLAG (F7425; Sigma- Inc.). Genotyping data were analyzed using commercial Aldrich Corp., St. Louis, MO, USA) and rabbit monoclonal software (GeneMapper
Load more

Recommended publications
  • Molecular Mechanism of ACAD9 in Mitochondrial Respiratory Complex 1 Assembly
    bioRxiv preprint doi: https://doi.org/10.1101/2021.01.07.425795; this version posted January 9, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Molecular mechanism of ACAD9 in mitochondrial respiratory complex 1 assembly Chuanwu Xia1, Baoying Lou1, Zhuji Fu1, Al-Walid Mohsen2, Jerry Vockley2, and Jung-Ja P. Kim1 1Department of Biochemistry, Medical College of Wisconsin, Milwaukee, Wisconsin, 53226, USA 2Department of Pediatrics, University of Pittsburgh School of Medicine, University of Pittsburgh, Children’s Hospital of Pittsburgh of UPMC, Pittsburgh, PA 15224, USA Abstract ACAD9 belongs to the acyl-CoA dehydrogenase family, which catalyzes the α-β dehydrogenation of fatty acyl-CoA thioesters. Thus, it is involved in fatty acid β-oxidation (FAO). However, it is now known that the primary function of ACAD9 is as an essential chaperone for mitochondrial respiratory complex 1 assembly. ACAD9 interacts with ECSIT and NDUFAF1, forming the mitochondrial complex 1 assembly (MCIA) complex. Although the role of MCIA in the complex 1 assembly pathway is well studied, little is known about the molecular mechanism of the interactions among these three assembly factors. Our current studies reveal that when ECSIT interacts with ACAD9, the flavoenzyme loses the FAD cofactor and consequently loses its FAO activity, demonstrating that the two roles of ACAD9 are not compatible. ACAD9 binds to the carboxy-terminal half (C-ECSIT), and NDUFAF1 binds to the amino-terminal half of ECSIT. Although the binary complex of ACAD9 with ECSIT or with C-ECSIT is unstable and aggregates easily, the ternary complex of ACAD9-ECSIT-NDUFAF1 (i.e., the MCIA complex) is soluble and extremely stable.
    [Show full text]
  • NDUFAF7 (NM 001083946) Human Untagged Clone – SC316187 | Origene
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC316187 NDUFAF7 (NM_001083946) Human Untagged Clone Product data: Product Type: Expression Plasmids Product Name: NDUFAF7 (NM_001083946) Human Untagged Clone Tag: Tag Free Symbol: NDUFAF7 Synonyms: C2orf56; MidA; PRO1853 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin Fully Sequenced ORF: >NCBI ORF sequence for NM_001083946, the custom clone sequence may differ by one or more nucleotides ATGAGTGTACTGCTGAGGTCAGGTTTGGGGCCGTTGTGTGCCGTGGCGCGCGCAGCCATTCCTTTTATTT GGAGAGGGAAATACTTCAGCTCCGGGAATGAGCCTGCAGAAAACCCGGTGACGCCGATGCTGCGGCATCT TATGTACAAAATAAAGTCTACTGGTCCCATCACTGTGGCCGAGTACATGAAGGAGGTGTTGACTAATCCA GCCAAGCTACTAGGTATATGGTTCATTAGTGAATGGATGGCCACTGGAAAAAGCACAGCTTTCCAGCTGG TGGAACTGGGCCCAGGTAGGGGAACCCTCGTGGGAGATATTTTGAGGGTGTTCACTCAACTTGGATCTGT GCTGAAAAATTGTGACATTTCAGTACATCTGGTAGAGAAAACACCACAGGGATGGCGAGAAGTATTTGTT GACATTGATCCACAGGTTTCTGATAAACTGAGGTTTGTTTTGGCACCTTCTGCCACCCCAGCAGAAGCCT TCATACAACATGACGAAACAAGGGATCATGTTGAAGTGTGTCCTGATGCTGGTGTTATCATCGAGGAACT TTCTCAACGCATTGCATTAACTGGAGGTGCTGCACTGGTTGCTGATTATGGTCATGATGGAACAAAGACA GATACCTTCAGAGGGTTTTGCGACCACAAGCTTCATGATGTCTTAATTGCCCCAGGAACAGCAGATCTAA CAGCTGATGTGGACTTCAGTTATTTGCGAAGAATGGCACAGGGAAAAGTAGCCTCTCTGGGCCCAATAAA ACAACACACATTTTTAAAAAATATGGGTATTGATGTCCGGCTGAAGGTTCTTTTAGATAAATCAAATGAG CCATCAGTGAGGCAGCAGTTACTTCAAGGATATGATATGTTAATGAATCCAAAGAAGATGGGAGAGAGAT
    [Show full text]
  • Systems Biology of Mitochondrial Dysfunction
    From the DEPARTMENT OF MOLECULAR MEDICINE AND SURGERY Karolinska Institutet, Stockholm, Sweden SYSTEMS BIOLOGY OF MITOCHONDRIAL DYSFUNCTION Florian A. Schober Stockholm 2021 All previously published papers were reproduced with permission from the publisher. Published by Karolinska Institutet Printed by Universitetsservice US­AB, 2021 © 2021 Florian A. Schober ISBN 978­91­8016­166­4 Cover illustration: The digital mitochondria, a puzzle. ASCII code (outer membrane) and ASCII code at 700 ppm mass tolerance, charge +1, carbamidomethylation (C) as fixed, methylation (KR) and oxidation (M) as variable modifications, 6% missing values (inner membrane). SYSTEMS BIOLOGY OF MITOCHONDRIAL DYSFUNCTION THESIS FOR DOCTORAL DEGREE (Ph.D.) By Florian A. Schober The thesis will be defended in public online and at Biomedicum in the Ragnar Granit lecture hall, Karolinska Institutet, Solnavägen 9, on May 7, 2021 at 9:00. Principal Supervisor: Opponent: Dr. Anna Wredenberg Dr. Christian Frezza Karolinska Institutet Cambridge University Department of Medical Biochemistry MRC Cancer Unit and Biophysics Division of Molecular Metabolism Examination Board: Prof. Maria Ankacrona Co­supervisors: Karolinska Institutet Dr. Christoph Freyer Department of Neurobiology, Care Sciences Karolinska Institutet and Society Department of Medical Biochemistry Division of Neurogeriatrics and Biophysics Division of Molecular Metabolism Dr. Bianca Habermann Aix­Marseille Université Prof. Anna Wedell Institut de Biologie du Développement Karolinska Institutet de Marseille Department of Molecular Medicine Computational Biology Team and Surgery Division of Inborn Errors of Metabolism Prof. Roman Zubarev Karolinska Institutet Department of Medical Biochemistry and Biophysics Division of Physiological Chemistry I The scientist does not study nature because it is useful to do so. He studies it because he takes pleasure in it, and he takes pleasure in it because it is beautiful.
    [Show full text]
  • NDUFAF7 (NM 144736) Human Untagged Clone – SC319491
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC319491 NDUFAF7 (NM_144736) Human Untagged Clone Product data: Product Type: Expression Plasmids Product Name: NDUFAF7 (NM_144736) Human Untagged Clone Tag: Tag Free Symbol: NDUFAF7 Synonyms: C2orf56; MidA; PRO1853 Vector: pCMV6-AC (PS100020) E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: Neomycin Fully Sequenced ORF: >OriGene sequence for NM_144736.3 CCCAGCTCCTGGCGGAGCGAGCTAGCCTGCGAATTTCAGCATGAGTGTACTGCTGAGGTC AGGTTTGGGGCCGTTGTGTGCCGTGGCGCGCGCAGCCATTCCTTTTATTTGGAGAGGGAA ATACTTCAGCTCCGGGAATGAGCCTGCAGAAAACCCGGTGACGCCGATGCTGCGGCATCT TATGTACAAAATAAAGTCTACTGGTCCCATCACTGTGGCCGAGTACATGAAGGAGGTGTT GACTAATCCAGCCAAGGGTTATTATGTGTACCGTGACATGCTAGGCGAAAAAGGAGATTT CATTACTTCACCTGAAATAAGTCAAATCTTTGGGGAGCTACTAGGTATATGGTTCATTAG TGAATGGATGGCCACTGGAAAAAGCACAGCTTTCCAGCTGGTGGAACTGGGCCCAGGTAG GGGAACCCTCGTGGGAGATATTTTGAGGGTGTTCACTCAACTTGGATCTGTGCTGAAAAA TTGTGACATTTCAGTACATCTGGTAGAGGTAAGCCAAAAATTAAGTGAGATTCAAGCATT GACACTGACTAAAGAGAAGGTCCCGTTAGAGCGAAATGCTGGATCCCCAGTGTATATGAA AGGTGTCACTAAGTCTGGGATTCCAATTTCCTGGTACCGAGATCTGCACGATGTTCCAAA AGGGTACAGCTTTTATCTTGCACATGAATTTTTTGATGTTCTTCCTGTGCATAAATTTCA GAAAACACCACAGGGATGGCGAGAAGTATTTGTTGACATTGATCCACAGGTTTCTGATAA ACTGAGGTTTGTTTTGGCACCTTCTGCCACCCCAGCAGAAGCCTTCATACAACATGACGA AACAAGGGATCATGTTGAAGTGTGTCCTGATGCTGGTGTTATCATCGAGGAACTTTCTCA ACGCATTGCATTAACTGGAGGTGCTGCACTGGTTGCTGATTATGGTCATGATGGAACAAA GACAGATACCTTCAGAGGGTTTTGCGACCACAAGCTTCATGATGTCTTAATTGCCCCAGG
    [Show full text]
  • Identification of Novel Mitochondrial and Mitochondrial Related Genetic Loci Associated with Exercise Response in the Gene SMART
    bioRxiv preprint doi: https://doi.org/10.1101/2020.02.20.957340; this version posted February 20, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. 1 Identification of novel mitochondrial and mitochondrial related genetic loci 2 associated with exercise response in the Gene SMART study 3 NR Harvey1, 2, S Voisin3, RA Lea.2, X Yan3, MC Benton2, ID Papadimitriou3, M Jacques3, LM Haupt.2, KJ 4 Ashton1, N Eynon#3 and LR Griffiths#2 5 6 1 Health Sciences and Medicine faculty, Bond University, Robina, QLD 4226 7 2 Genomics Research Centre, School of Biomedical Sciences, Institute of Health and Biomedical Innovation, 8 Queensland University of Technology, Brisbane, QLD 4059 9 3 Institute for Health and Sport (IHES), Victoria University, Footscray, VIC 3011 10 #Co-senior author: Lyn Griffiths and Nir Eynon 11 *Corresponding author: Prof. Lyn R. Griffiths, Genomics Research Centre, Institute of Health and Biomedical 12 Innovation, Queensland University of Technology, Brisbane QLD, Australia 13 E-mail: [email protected] 14 15 NH: 0000-0003-2035-8475, SV: 0000-0002-4074-7083, XY: 0000-0001-8547-4210, MB: 0000-0003-3442- 16 965X, IP: 0000-0001-5032-9937, LH: 0000-0002-7735-8110, KA: 0000-0001-6106-3425, NE: 0000-0003- 17 4046-8276, LG: 0000-0002-6774-5475 18 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.02.20.957340; this version posted February 20, 2020.
    [Show full text]
  • Spatial Sorting Enables Comprehensive Characterization of Liver Zonation
    ARTICLES https://doi.org/10.1038/s42255-019-0109-9 Spatial sorting enables comprehensive characterization of liver zonation Shani Ben-Moshe1,3, Yonatan Shapira1,3, Andreas E. Moor 1,2, Rita Manco1, Tamar Veg1, Keren Bahar Halpern1 and Shalev Itzkovitz 1* The mammalian liver is composed of repeating hexagonal units termed lobules. Spatially resolved single-cell transcriptomics has revealed that about half of hepatocyte genes are differentially expressed across the lobule, yet technical limitations have impeded reconstructing similar global spatial maps of other hepatocyte features. Here, we show how zonated surface markers can be used to sort hepatocytes from defined lobule zones with high spatial resolution. We apply transcriptomics, microRNA (miRNA) array measurements and mass spectrometry proteomics to reconstruct spatial atlases of multiple zon- ated features. We demonstrate that protein zonation largely overlaps with messenger RNA zonation, with the periportal HNF4α as an exception. We identify zonation of miRNAs, such as miR-122, and inverse zonation of miRNAs and their hepa- tocyte target genes, highlighting potential regulation of gene expression levels through zonated mRNA degradation. Among the targets, we find the pericentral Wingless-related integration site (Wnt) receptors Fzd7 and Fzd8 and the periportal Wnt inhibitors Tcf7l1 and Ctnnbip1. Our approach facilitates reconstructing spatial atlases of multiple cellular features in the liver and other structured tissues. he mammalian liver is a structured organ, consisting of measurements would broaden our understanding of the regulation repeating hexagonally shaped units termed ‘lobules’ (Fig. 1a). of liver zonation and could be used to model liver metabolic func- In mice, each lobule consists of around 9–12 concentric lay- tion more precisely.
    [Show full text]
  • Transcriptomic and Proteomic Landscape of Mitochondrial
    TOOLS AND RESOURCES Transcriptomic and proteomic landscape of mitochondrial dysfunction reveals secondary coenzyme Q deficiency in mammals Inge Ku¨ hl1,2†*, Maria Miranda1†, Ilian Atanassov3, Irina Kuznetsova4,5, Yvonne Hinze3, Arnaud Mourier6, Aleksandra Filipovska4,5, Nils-Go¨ ran Larsson1,7* 1Department of Mitochondrial Biology, Max Planck Institute for Biology of Ageing, Cologne, Germany; 2Department of Cell Biology, Institute of Integrative Biology of the Cell (I2BC) UMR9198, CEA, CNRS, Univ. Paris-Sud, Universite´ Paris-Saclay, Gif- sur-Yvette, France; 3Proteomics Core Facility, Max Planck Institute for Biology of Ageing, Cologne, Germany; 4Harry Perkins Institute of Medical Research, The University of Western Australia, Nedlands, Australia; 5School of Molecular Sciences, The University of Western Australia, Crawley, Australia; 6The Centre National de la Recherche Scientifique, Institut de Biochimie et Ge´ne´tique Cellulaires, Universite´ de Bordeaux, Bordeaux, France; 7Department of Medical Biochemistry and Biophysics, Karolinska Institutet, Stockholm, Sweden Abstract Dysfunction of the oxidative phosphorylation (OXPHOS) system is a major cause of human disease and the cellular consequences are highly complex. Here, we present comparative *For correspondence: analyses of mitochondrial proteomes, cellular transcriptomes and targeted metabolomics of five [email protected] knockout mouse strains deficient in essential factors required for mitochondrial DNA gene (IKu¨ ); expression, leading to OXPHOS dysfunction. Moreover,
    [Show full text]
  • Mitochondrial Structure and Bioenergetics in Normal and Disease Conditions
    International Journal of Molecular Sciences Review Mitochondrial Structure and Bioenergetics in Normal and Disease Conditions Margherita Protasoni 1 and Massimo Zeviani 1,2,* 1 Mitochondrial Biology Unit, The MRC and University of Cambridge, Cambridge CB2 0XY, UK; [email protected] 2 Department of Neurosciences, University of Padova, 35128 Padova, Italy * Correspondence: [email protected] Abstract: Mitochondria are ubiquitous intracellular organelles found in almost all eukaryotes and involved in various aspects of cellular life, with a primary role in energy production. The interest in this organelle has grown stronger with the discovery of their link to various pathologies, including cancer, aging and neurodegenerative diseases. Indeed, dysfunctional mitochondria cannot provide the required energy to tissues with a high-energy demand, such as heart, brain and muscles, leading to a large spectrum of clinical phenotypes. Mitochondrial defects are at the origin of a group of clinically heterogeneous pathologies, called mitochondrial diseases, with an incidence of 1 in 5000 live births. Primary mitochondrial diseases are associated with genetic mutations both in nuclear and mitochondrial DNA (mtDNA), affecting genes involved in every aspect of the organelle function. As a consequence, it is difficult to find a common cause for mitochondrial diseases and, subsequently, to offer a precise clinical definition of the pathology. Moreover, the complexity of this condition makes it challenging to identify possible therapies or drug targets. Keywords: ATP production; biogenesis of the respiratory chain; mitochondrial disease; mi-tochondrial electrochemical gradient; mitochondrial potential; mitochondrial proton pumping; mitochondrial respiratory chain; oxidative phosphorylation; respiratory complex; respiratory supercomplex Citation: Protasoni, M.; Zeviani, M.
    [Show full text]
  • RNA-Seq and GSEA Identifies Suppression of Ligand-Gated
    www.nature.com/scientificreports OPEN RNA‑seq and GSEA identifes suppression of ligand‑gated chloride efux channels as the major gene pathway contributing to form deprivation myopia Loretta Giummarra Vocale1,4*, Sheila Crewther1, Nina Riddell1, Nathan E. Hall1,2, Melanie Murphy1 & David Crewther1,3 Currently there is no consensus regarding the aetiology of the excessive ocular volume that characterizes high myopia. Thus, we aimed to test whether the gene pathways identifed by gene set enrichment analysis of RNA‑seq transcriptomics refutes the predictions of the Retinal Ion Driven Efux (RIDE) hypothesis when applied to the induction of form‑deprivation myopia (FDM) and subsequent recovery (post‑occluder removal). We found that the induction of profound FDM led to signifcant suppression in the ligand‑gated chloride ion channel transport pathway via suppression of glycine, GABAA and GABAC ionotropic receptors. Post‑occluder removal for short term recovery from FDM of 6 h and 24 h, induced signifcant upregulation of the gene families linked to cone receptor phototransduction, mitochondrial energy, and complement pathways. These fndings support a model of form deprivation myopia as a Cl− ion driven adaptive fuid response to the modulation of the visual signal cascade by form deprivation that in turn afects the resultant ionic environment of the outer and inner retinal tissues, axial and vitreal elongation as predicted by the RIDE model. Occluder removal and return to normal light conditions led to return to more normal upregulation of phototransduction, slowed growth rate, refractive recovery and apparent return towards physiological homeostasis. Myopia (short-sightedness) is the most common visual disorder worldwide and the greatest risk factor for severe ophthalmic diseases in older individuals especially those with high (-5D) refractive errors1.
    [Show full text]
  • Assembly of the Membrane Domain of ATP Synthase in Human Mitochondria
    Assembly of the membrane domain of ATP synthase in human mitochondria Jiuya He1, Holly C. Ford1, Joe Carroll, Corsten Douglas, Evvia Gonzales, Shujing Ding, Ian M. Fearnley and John E. Walker2 Medical Research Council Mitochondrial Biology Unit, University of Cambridge, Cambridge Biomedical Campus, Hills Road, Cambridge CB2 0XY, United Kingdom 1 Equal contributions 2To whom correspondence should be addressed. e-mail: [email protected] Running title: Assembly of ATP synthase The authors declare no conflict of interest Author contributions: J. E. W. designed research and supervised project; J. H., H. C. F., J. C., C. D., E. G., S. D. and I. M. F. performed research; H. C. F., J. H., C. D., J. C., S. D., I. M. F. and J. E. W. analyzed data, and J. E. W. prepared the manuscript. Classification: BIOLOGICAL SCIENCES, Biochemistry Key words: human mitochondria; ATP synthase; assembly; membrane subunits 1 Abstract The ATP synthase in human mitochondria is a membrane bound assembly of 29 proteins of 18 kinds. All but two membrane components are encoded in nuclear genes, synthesized on cytoplasmic ribosomes and imported into the matrix of the organelle. Here, they are assembled into the complex with ATP6 and ATP8, the products of overlapping genes in mitochondrial DNA. Disruption of individual human genes for the nuclear encoded subunits in the membrane portion of the enzyme leads to the formation of intermediate vestigial ATPase complexes that provide a description of the pathway of assembly of the membrane domain. The key intermediate complex consists of the F1-c8 complex inhibited by the ATPase inhibitor protein, IF1, and attached to the peripheral stalk, with subunits e, f and g associated with the membrane domain of the peripheral stalk.
    [Show full text]
  • Assembly Factors for the Membrane Arm of Human Complex I
    Assembly factors for the membrane arm of human complex I Byron Andrews, Joe Carroll, Shujing Ding, Ian M. Fearnley, and John E. Walker1 Medical Research Council Mitochondrial Biology Unit, Cambridge CB2 0XY, United Kingdom Contributed by John E. Walker, October 14, 2013 (sent for review September 12, 2013) Mitochondrial respiratory complex I is a product of both the nuclear subunits in a fungal enzyme from Yarrowia lipolytica seem to be and mitochondrial genomes. The integration of seven subunits distributed similarly (12, 13). encoded in mitochondrial DNA into the inner membrane, their asso- The assembly of mitochondrial complex I involves building the ciation with 14 nuclear-encoded membrane subunits, the construc- 44 subunits emanating from two genomes into the two domains of tion of the extrinsic arm from 23 additional nuclear-encoded the complex. The enzyme is put together from preassembled sub- proteins, iron–sulfur clusters, and flavin mononucleotide cofactor complexes, and their subunit compositions have been characterized require the participation of assembly factors. Some are intrinsic to partially (14, 15). Extrinsic assembly factors of unknown function the complex, whereas others participate transiently. The suppres- become associated with subcomplexes that accumulate when as- sion of the expression of the NDUFA11 subunit of complex I dis- sembly and the activity of complex I are impaired by pathogenic rupted the assembly of the complex, and subcomplexes with mutations. Some assembly factor mutations also impair its activ- masses of 550 and 815 kDa accumulated. Eight of the known ex- ity (16). Other pathogenic mutations are found in all of the core trinsic assembly factors plus a hydrophobic protein, C3orf1, were subunits, and in 10 supernumerary subunits (NDUFA1, NDUFA2, associated with the subcomplexes.
    [Show full text]
  • Clinical Insights Into Mitochondrial Neurodevelopmental and Neurodegenerative Disorders: Their Biosignatures from Mass Spectrometry-Based Metabolomics
    H OH metabolites OH Review Clinical Insights into Mitochondrial Neurodevelopmental and Neurodegenerative Disorders: Their Biosignatures from Mass Spectrometry-Based Metabolomics Haorong Li 1 , Martine Uittenbogaard 2, Ling Hao 1,* and Anne Chiaramello 2,* 1 Department of Chemistry, George Washington University, Science and Engineering Hall 4000, 800 22nd St., NW, Washington, DC 20052, USA; [email protected] 2 Department of Anatomy and Cell Biology, School of Medicine and Health Sciences, George Washington University, 2300 I Street N.W. Ross Hall 111, Washington, DC 20037, USA; [email protected] * Correspondence: [email protected] (L.H.); [email protected] (A.C.); Tel.: +202-994-4492 (L.H.) Abstract: Mitochondria are dynamic multitask organelles that function as hubs for many metabolic pathways. They produce most ATP via the oxidative phosphorylation pathway, a critical pathway that the brain relies on its energy need associated with its numerous functions, such as synaptic homeostasis and plasticity. Therefore, mitochondrial dysfunction is a prevalent pathological hallmark of many neurodevelopmental and neurodegenerative disorders resulting in altered neurometabolic coupling. With the advent of mass spectrometry (MS) technology, MS-based metabolomics provides an emerging mechanistic understanding of their global and dynamic metabolic signatures. In this review, we discuss the pathogenetic causes of mitochondrial metabolic disorders and the recent MS-based metabolomic advances on their metabolomic remodeling. We conclude by exploring
    [Show full text]