DOCSLIB.ORG

Clinical Insights Into Mitochondrial Neurodevelopmental and Neurodegenerative Disorders: Their Biosignatures from Mass Spectrometry-Based Metabolomics

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Clinical Insights Into Mitochondrial Neurodevelopmental and Neurodegenerative Disorders: Their Biosignatures from Mass Spectrometry-Based Metabolomics H OH metabolites OH Review Clinical Insights into Mitochondrial Neurodevelopmental and Neurodegenerative Disorders: Their Biosignatures from Mass Spectrometry-Based Metabolomics Haorong Li 1 , Martine Uittenbogaard 2, Ling Hao 1,* and Anne Chiaramello 2,* 1 Department of Chemistry, George Washington University, Science and Engineering Hall 4000, 800 22nd St., NW, Washington, DC 20052, USA; [email protected] 2 Department of Anatomy and Cell Biology, School of Medicine and Health Sciences, George Washington University, 2300 I Street N.W. Ross Hall 111, Washington, DC 20037, USA; [email protected] * Correspondence: [email protected] (L.H.); [email protected] (A.C.); Tel.: +202-994-4492 (L.H.) Abstract: Mitochondria are dynamic multitask organelles that function as hubs for many metabolic pathways. They produce most ATP via the oxidative phosphorylation pathway, a critical pathway that the brain relies on its energy need associated with its numerous functions, such as synaptic homeostasis and plasticity. Therefore, mitochondrial dysfunction is a prevalent pathological hallmark of many neurodevelopmental and neurodegenerative disorders resulting in altered neurometabolic coupling. With the advent of mass spectrometry (MS) technology, MS-based metabolomics provides an emerging mechanistic understanding of their global and dynamic metabolic signatures. In this review, we discuss the pathogenetic causes of mitochondrial metabolic disorders and the recent MS-based metabolomic advances on their metabolomic remodeling. We conclude by exploring the Citation: Li, H.; Uittenbogaard, M.; MS-based metabolomic functional insights into their biosignatures to improve diagnostic platforms, Hao, L.; Chiaramello, A. Clinical stratify patients, and design novel targeted therapeutic strategies. Insights into Mitochondrial Neurodevelopmental and Keywords: mitochondrial genetics; neurometabolic coupling; mitochondrial neurodevelopmental Neurodegenerative Disorders: Their disorders; secondary mitochondrial neurodegenerative diseases; mass spectrometry; metabolomics Biosignatures from Mass Spectrometry-Based Metabolomics. Metabolites 2021, 11, 233. https:// doi.org/10.3390/metabo11040233 1. Introduction Academic Editor: Amedeo Lonardo 1.1. Mitochondria Function as Metabolic Nodes Mitochondria are ubiquitous double membraned multitask organelles where energy is Received: 23 January 2021 generated through aerobic respiration. Mitochondria produce the majority of ATP required Accepted: 7 April 2021 for cellular functions via the oxidative phosphorylation (OXPHOS) pathway, a process Published: 10 April 2021 involving a flow of electrons through a series of multisubunit OXPHOS complexes, also known as the electron transfer chain (ETC) (Figure1). Publisher’s Note: MDPI stays neutral OXPHOS is interlinked with the tricarboxylic acid (TCA) cycle that produces the with regard to jurisdictional claims in reducing equivalents, NADH and FADH2, to feed electrons to complex I (NADH dehy- published maps and institutional affil- drogenase) and complex II (succinate dehydrogenase) of the ETC, respectively (Figure1 ). iations. Electrons are then transferred to complex III (ubiquinol cytochrome c oxidoreductase) via ubiquinone, the reduced form of coenzyme Q (CoQ), and subsequently to complex IV (cytochrome c oxidoreductase) via the electron carrier cytochrome c where O2 functions as an electron acceptor to produce water in the presence of hydrogen. The flow of electrons Copyright: © 2021 by the authors. through the ETC is coupled with the proton motor force formed by complexes I, III, and IV. Licensee MDPI, Basel, Switzerland. This gradient of protons is converted by complex V (ATP synthase) into chemical energy This article is an open access article for ATP synthesis using ADP and inorganic phosphate. Acetyl-CoA occupies a central distributed under the terms and and pivotal position as a key metabolic intermediate for mitochondrial energy metabolism. conditions of the Creative Commons It is generated by several pathways: (1) oxidation of pyruvate generated during glycol- Attribution (CC BY) license (https:// ysis; (2) fatty acid oxidation; and (3) oxidative degradation of the amino acids, leucine, creativecommons.org/licenses/by/ isoleucine, and tryptophan (Figure1)[ 1,2]. This convergence of pathways highlights the 4.0/). Metabolites 2021, 11, 233. https://doi.org/10.3390/metabo11040233 https://www.mdpi.com/journal/metabolites Metabolites 2021, 11, 233 2 of 24 concept of mitochondria operating as hubs for additional biochemical pathways, such as Metabolites 2021, 11, x heme biosynthesis, nucleotide biosynthesis (pyrimidines and purines), steroid hormone2 of 25 biosynthesis, calcium homeostasis, innate immunity, and cell death programming [3,4]. FigureFigure 1.1.The The mitochondrialmitochondrial oxidativeoxidative phosphorylationphosphorylation (OXPHOS)(OXPHOS) enzymaticenzymatic machinerymachinery andand keykey metabolic pathways. The mitochondrion is illustrated with its outer mitochondrial membrane, inner metabolic pathways. The mitochondrion is illustrated with its outer mitochondrial membrane, inner mitochondrial membrane, and mitochondrial matrix (yellow) along with the tricarboxylic acid mitochondrial membrane, and mitochondrial matrix (yellow) along with the tricarboxylic acid (TCA) (TCA) cycle and the fatty acid beta-oxidation with their functional link via acetyl-CoA. The reducing cycleagents, and NADH the fatty and acid FADH2, beta-oxidation produced with by their the functionaltricarboxylic link acid via acetyl-CoA.(TCA) cycle Theand reducing fatty acid agents, beta- NADHoxidation, and are FADH2, indicated produced along by thewith tricarboxylic their two acidpoints (TCA) of cycleentryand in fattythe acidOXPHOS beta-oxidation, pathway. areMagnification indicated along of the with OXPHOS their two enzymatic points of machinery entry in the with OXPHOS electrons pathway. transfer Magnification via the two-electron of the OXPHOScarriers, coenzyme enzymatic Q10 machinery (Q) and with cytochrome electrons c transfer(c), is shown via the below. two-electron The electron carriers, donor, coenzyme succinate, Q10 a (Q)product and cytochrome of the TCA c (c),cycle, is shown is also below. indicated The electronacting donor,at the succinate,level of complex a product II. ofFinally, the TCA protons cycle, istranslocated also indicated from acting complexes at the level I, III, of and complex IV into II. the Finally, intermembrane protons translocated space (orange) from are complexes shown along I, III, andwith IV protons into the being intermembrane transferred spaceback into (orange) the mitochondrial are shown along matrix with via protons complex being V, transferredresulting in back ATP synthesis from ADP and inorganic phosphate (Pi). into the mitochondrial matrix via complex V, resulting in ATP synthesis from ADP and inorganic phosphate (Pi). OXPHOS is interlinked with the tricarboxylic acid (TCA) cycle that produces the 1.2.reducing Mitochondrial equivalents, Inheritance NADH and FADH2, to feed electrons to complex I (NADH dehydrogenase)Mitochondria and originate complex from II a(succinate symbiotic dehydrogenase) event during which of the an ETC, archaebacterium respectively engulfed(Figure a1). proteobacterium Electrons are resemblingthen transferred a modern-day to complex rod-negative III (ubiquinol bacterium cytochrome with aerobic c metabolismoxidoreductase) capacity via viaubiquinone, an ETC encoded the reduced by its own form genome. of coenzyme This event Q occurred (CoQ), onceand 1.5subsequently billion years to ago complex and led toIV the (cytochrome modern-day c eukaryotic oxidoreductase) cells with via mitochondria the electron retaining carrier theircytochrome own circular c where genome O2 functions of limited as an size electron (about acceptor 16,569 bp)to produce and coding water capacity, in the presence after a phenomenonof hydrogen. calledThe flow reductive of electrons evolution. through The the mitochondrial ETC is coupled genome with contains the proton 37 genesmotor encodingforce formed 2 mitochondrial by complexesribosomal I, III, and IV. RNAs This (mt-rRNAs),gradient of protons 22 mitochondrial is converted tRNAs by complex (mt- tRNAs)V (ATP and synthase) 13 proteins, into allchemical of them energy required for subunits ATP synthesis of the OXPHOS using ADP complexes and inorganic I, III, IV, andphosphate. V. Thus, theAcetyl-CoA nuclear genome occupies is a a required central major and contributorpivotal position to mitochondrial as a key functionsmetabolic viaintermediate 1158 nuclear-encoded for mitochondrial proteins energy [5–7]. metabolism. It is generated by several pathways: 1) oxidationThe human of mitochondrialpyruvate generated genome during has an glycolysis; overall uniparental 2) fatty acid inheritance, oxidation; with and the 3) maternaloxidative genome degradation being of the the only amino one acids, passed leuc onine, to progeny isoleucine, [8]. and However, tryptophan several (Figure species, 1) such[1,2]. asThis Drosophila, convergence mouse of pathways and sheep, highlight exhibits the leakage concept of of the mitochondria paternal mitochondrial operating as genomehubs for [9 –additional12]. Following biochemical fertilization pathways, of the human such oocyte,as heme the biosynthesis, paternal mitochondrial nucleotide genomebiosynthesis is eliminated (pyrimidines via elusive and mechanisms. purines), Recentsteroid studies hormone have providedbiosynthesis, several calcium break- throughshomeostasis, in
Load more

Recommended publications
  • Molecular Mechanism of ACAD9 in Mitochondrial Respiratory Complex 1 Assembly
    bioRxiv preprint doi: https://doi.org/10.1101/2021.01.07.425795; this version posted January 9, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Molecular mechanism of ACAD9 in mitochondrial respiratory complex 1 assembly Chuanwu Xia1, Baoying Lou1, Zhuji Fu1, Al-Walid Mohsen2, Jerry Vockley2, and Jung-Ja P. Kim1 1Department of Biochemistry, Medical College of Wisconsin, Milwaukee, Wisconsin, 53226, USA 2Department of Pediatrics, University of Pittsburgh School of Medicine, University of Pittsburgh, Children’s Hospital of Pittsburgh of UPMC, Pittsburgh, PA 15224, USA Abstract ACAD9 belongs to the acyl-CoA dehydrogenase family, which catalyzes the α-β dehydrogenation of fatty acyl-CoA thioesters. Thus, it is involved in fatty acid β-oxidation (FAO). However, it is now known that the primary function of ACAD9 is as an essential chaperone for mitochondrial respiratory complex 1 assembly. ACAD9 interacts with ECSIT and NDUFAF1, forming the mitochondrial complex 1 assembly (MCIA) complex. Although the role of MCIA in the complex 1 assembly pathway is well studied, little is known about the molecular mechanism of the interactions among these three assembly factors. Our current studies reveal that when ECSIT interacts with ACAD9, the flavoenzyme loses the FAD cofactor and consequently loses its FAO activity, demonstrating that the two roles of ACAD9 are not compatible. ACAD9 binds to the carboxy-terminal half (C-ECSIT), and NDUFAF1 binds to the amino-terminal half of ECSIT. Although the binary complex of ACAD9 with ECSIT or with C-ECSIT is unstable and aggregates easily, the ternary complex of ACAD9-ECSIT-NDUFAF1 (i.e., the MCIA complex) is soluble and extremely stable.
    [Show full text]
  • LRRK2 at the Crossroad of Aging and Parkinson's Disease
    G C A T T A C G G C A T genes Review LRRK2 at the Crossroad of Aging and Parkinson’s Disease Eun-Mi Hur 1 and Byoung Dae Lee 2,3,* 1 Department of Neuroscience, College of Veterinary Medicine, Research Institute for Veterinary Science and BK21 Four Future Veterinary Medicine Leading Education & Research Center, Seoul National University, Seoul 08826, Korea; [email protected] 2 Department of Physiology, Kyung Hee University School of Medicine, Seoul 02447, Korea 3 Department of Neuroscience, Kyung Hee University, Seoul 02447, Korea * Correspondence: [email protected]; Tel.: +82-2-961-9381 Abstract: Parkinson’s disease (PD) is a heterogeneous neurodegenerative disease characterized by the progressive loss of dopaminergic neurons in the substantia nigra pars compacta and the widespread occurrence of proteinaceous inclusions known as Lewy bodies and Lewy neurites. The etiology of PD is still far from clear, but aging has been considered as the highest risk factor influencing the clinical presentations and the progression of PD. Accumulating evidence suggests that aging and PD induce common changes in multiple cellular functions, including redox imbalance, mitochondria dysfunction, and impaired proteostasis. Age-dependent deteriorations in cellular dysfunction may predispose individuals to PD, and cellular damages caused by genetic and/or environmental risk factors of PD may be exaggerated by aging. Mutations in the LRRK2 gene cause late-onset, autosomal dominant PD and comprise the most common genetic causes of both familial and sporadic PD. LRRK2-linked PD patients show clinical and pathological features indistinguishable from idiopathic PD patients. Here, we review cellular dysfunctions shared by aging and PD-associated LRRK2 mutations and discuss how the interplay between the two might play a role in PD pathologies.
    [Show full text]
  • NDUFAF7 (NM 001083946) Human Untagged Clone – SC316187 | Origene
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC316187 NDUFAF7 (NM_001083946) Human Untagged Clone Product data: Product Type: Expression Plasmids Product Name: NDUFAF7 (NM_001083946) Human Untagged Clone Tag: Tag Free Symbol: NDUFAF7 Synonyms: C2orf56; MidA; PRO1853 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin Fully Sequenced ORF: >NCBI ORF sequence for NM_001083946, the custom clone sequence may differ by one or more nucleotides ATGAGTGTACTGCTGAGGTCAGGTTTGGGGCCGTTGTGTGCCGTGGCGCGCGCAGCCATTCCTTTTATTT GGAGAGGGAAATACTTCAGCTCCGGGAATGAGCCTGCAGAAAACCCGGTGACGCCGATGCTGCGGCATCT TATGTACAAAATAAAGTCTACTGGTCCCATCACTGTGGCCGAGTACATGAAGGAGGTGTTGACTAATCCA GCCAAGCTACTAGGTATATGGTTCATTAGTGAATGGATGGCCACTGGAAAAAGCACAGCTTTCCAGCTGG TGGAACTGGGCCCAGGTAGGGGAACCCTCGTGGGAGATATTTTGAGGGTGTTCACTCAACTTGGATCTGT GCTGAAAAATTGTGACATTTCAGTACATCTGGTAGAGAAAACACCACAGGGATGGCGAGAAGTATTTGTT GACATTGATCCACAGGTTTCTGATAAACTGAGGTTTGTTTTGGCACCTTCTGCCACCCCAGCAGAAGCCT TCATACAACATGACGAAACAAGGGATCATGTTGAAGTGTGTCCTGATGCTGGTGTTATCATCGAGGAACT TTCTCAACGCATTGCATTAACTGGAGGTGCTGCACTGGTTGCTGATTATGGTCATGATGGAACAAAGACA GATACCTTCAGAGGGTTTTGCGACCACAAGCTTCATGATGTCTTAATTGCCCCAGGAACAGCAGATCTAA CAGCTGATGTGGACTTCAGTTATTTGCGAAGAATGGCACAGGGAAAAGTAGCCTCTCTGGGCCCAATAAA ACAACACACATTTTTAAAAAATATGGGTATTGATGTCCGGCTGAAGGTTCTTTTAGATAAATCAAATGAG CCATCAGTGAGGCAGCAGTTACTTCAAGGATATGATATGTTAATGAATCCAAAGAAGATGGGAGAGAGAT
    [Show full text]
  • Pleiotropic Effects for Parkin and LRRK2 in Leprosy Type-1 Reactions and Parkinson’S Disease
    Pleiotropic effects for Parkin and LRRK2 in leprosy type-1 reactions and Parkinson’s disease Vinicius M. Favaa,b,1,2, Yong Zhong Xua,b, Guillaume Lettrec,d, Nguyen Van Thuce, Marianna Orlovaa,b, Vu Hong Thaie, Shao Taof,g, Nathalie Croteauh, Mohamed A. Eldeebi, Emma J. MacDougalli, Geison Cambrij, Ramanuj Lahirik, Linda Adamsk, Edward A. Foni, Jean-François Trempeh, Aurélie Cobatl,m, Alexandre Alcaïsl,m, Laurent Abell,m,n, and Erwin Schurra,b,o,1,2 aProgram in Infectious Diseases and Immunity in Global Health, The Research Institute of the McGill University Health Centre, Montreal, QC, Canada H4A3J1; bMcGill International TB Centre, Montreal, QC, Canada H4A 3J1; cMontreal Heart Institute, Montreal, QC, Canada H1T 1C8; dDepartment of Medicine, Faculty of Medicine, Université de Montréal, Montréal, QC, Canada H3T 1J4; eHospital for Dermato-Venereology, District 3, Ho Chi Minh City, Vietnam; fDivision of Experimental Medicine, Faculty of Medicine, McGill University, Montreal, QC, Canada H3G 2M1; gThe Translational Research in Respiratory Diseases Program, The Research Institute of the McGill University Health Centre, Montreal, QC, Canada H4A 3J1; hCentre for Structural Biology, Department of Pharmacology & Therapeutics, McGill University, Montreal, QC, Canada H3G 1Y6; iMcGill Parkinson Program, Neurodegenerative Diseases Group, Department of Neurology and Neurosurgery, Montreal Neurological Institute, McGill University, Montreal, QC, Canada H3A 2B4; jGraduate Program in Health Sciences, Pontifícia Universidade Católica do Paraná, Curitiba, PR, 80215-901, Brazil; kNational Hansen’s Disease Program, Health Resources and Services Administration, Baton Rouge, LA 70803; lLaboratory of Human Genetics of Infectious Diseases, Necker Branch, Institut National de la Santé et de la Recherche Médicale 1163, 75015 Paris, France; mImagine Institute, Paris Descartes-Sorbonne Paris Cité University, 75015 Paris, France; nSt.
    [Show full text]
  • LRRK2) Inhibitors Using a Crystallographic Surrogate Derived from Checkpoint Kinase 1 (CHK1
    This is a repository copy of Design of Leucine-Rich Repeat Kinase 2 (LRRK2) Inhibitors Using a Crystallographic Surrogate Derived from Checkpoint Kinase 1 (CHK1). White Rose Research Online URL for this paper: https://eprints.whiterose.ac.uk/130583/ Version: Accepted Version Article: Williamson, Douglas S., Smith, Garrick P., Acheson-Dossang, Pamela et al. (20 more authors) (2017) Design of Leucine-Rich Repeat Kinase 2 (LRRK2) Inhibitors Using a Crystallographic Surrogate Derived from Checkpoint Kinase 1 (CHK1). JOURNAL OF MEDICINAL CHEMISTRY. pp. 8945-8962. ISSN 0022-2623 https://doi.org/10.1021/acs.jmedchem.7b01186 Reuse Items deposited in White Rose Research Online are protected by copyright, with all rights reserved unless indicated otherwise. They may be downloaded and/or printed for private study, or other acts as permitted by national copyright laws. The publisher or other rights holders may allow further reproduction and re-use of the full text version. This is indicated by the licence information on the White Rose Research Online record for the item. Takedown If you consider content in White Rose Research Online to be in breach of UK law, please notify us by emailing [email protected] including the URL of the record and the reason for the withdrawal request. [email protected] https://eprints.whiterose.ac.uk/ Design of LRRK2 inhibitors using a CHK1-derived crystallographic surrogate Douglas S. Williamson,†* Garrick P. Smith,‡ Pamela Acheson-Dossang,† Simon T. Bedford,† Victoria Chell,† I-Jen Chen,† Justus C. A. Daechsel,‡ Zoe Daniels,† Laurent David,‡ Pawel Dokurno,† Morten Hentzer,‡ Martin C. Herzig,‡ Roderick E.
    [Show full text]
  • 1 Cerebrospinal Fluid Neurofilament Light Is Associated with Survival In
    1 Cerebrospinal fluid Neurofilament Light is associated with survival in mitochondrial disease patients Kalliopi Sofou†,a, Pashtun Shahim†, b,c, Már Tuliniusa, Kaj Blennowb,c, Henrik Zetterbergb,c,d,e, Niklas Mattssonf, Niklas Darina aDepartment of Pediatrics, University of Gothenburg, The Queen Silvia’s Children Hospital, Gothenburg, Sweden bInstitute of Neuroscience and Physiology, Department of Psychiatry and Neurochemistry, the Sahlgrenska Academy at University of Gothenburg, Mölndal, Sweden. cClinical Neurochemistry Laboratory, Sahlgrenska University Hospital, Mölndal, Sweden dDepartment of Molecular Neuroscience, UCL Institute of Neurology, Queen Square, London, UK eUK Dementia Research Institute at UCL, London, UK fClinical Memory Research Unit, Lund University, Malmö, Sweden, and Lund University, Skåne University Hospital, Department of Clinical Sciences, Neurology, Lund, Sweden †Equal contributors Correspondence to: Kalliopi Sofou, MD, PhD Department of Pediatrics University of Gothenburg, The Queen Silvia’s Children Hospital SE-416 85 Gothenburg, Sweden Tel: +46 (0) 31 3421000 E-mail: [email protected] Abbreviations Ab42 Amyloid-b42 AD Alzheimer’s disease AUROC Area under the receiver operating-characteristic curve CNS Central nervous system CSF Cerebrospinal fluid DWI Diffusion weighted imaging FLAIR Fluid attenuated inversion recovery GFAp Glial fibrillary acidic protein KSS Kearns-Sayre syndrome LP Lumbar puncture ME Mitochondrial encephalopathy Mitochondrial encephalomyopathy, lactic acidosis and MELAS stroke-like
    [Show full text]
  • ISS National Lab Q1FY19 Report Quarterly Report for the Period October 1 – December 31, 2018
    NASAWATCH.COM ISS National Lab Q1FY19 Report Quarterly Report for the Period October 1 – December 31, 2018 Contents Q1FY19 Metrics ........................................................................................................................................... 2 Key Portfolio Data Charts ............................................................................................................................. 6 Program Successes ...................................................................................................................................... 6 In-Orbit Activities ........................................................................................................................................ 7 Research Solicitations in Progress ................................................................................................................ 7 Appendix .................................................................................................................................................... 8 Authorized for submission to NASA by: _______________________________ Print Name _______________ Signature ________________________________________________________ 1 NASAWATCH.COM NASAWATCH.COM ISS National Lab Q1FY19 Report Q1FY19 Metrics SECURE STRATEGIC FLIGHT PROJECTS: Generate significant, impactful, and measurable demand from customers that recognize value of the ISS National Lab as an innovation platform TARGET ACTUAL Q1 ACTUAL Q2 ACTUAL Q3 ACTUAL Q4 YTD FY19 FY19 ISS National Lab payloads manifested
    [Show full text]
  • Drugs for Orphan Mitochondrial Disease
    Drugs for Orphan Mitochondrial Disease Gino Cortopassi, CEO Ixchel:Mayan goddess of health www.ixchelpharma.com Davis, CA Executive Summary • Ixchel is a clinical stage company focused on developing IXC-109 as therapeutic for mitochondrial diseases: 109 increases mitochondrial activities in cells & mice. • XC-109 is an NCE prodrug of the active moiety Mono-methylfumarate (MMF) upon which a Composition-of-Matter patent has been applied for. • IP: rights to 5 patent families, including composition of matter, method of use, formulation and 2 granted orphan drug designations. • Efficacy: demonstrated efficacy in preclinical mouse models with IXC-109 in Leigh’s Syndrome, Friedreich’s ataxia cardiac defects. • Patient advocacy groups & KOLs: Ixchel developed a 10-year relationship with patient advocacy groups FARA, Ataxia UK, UMDF & MDA, and networks with 8 Key Opinion Leaders in Mitochondrial Research and Mitochondrial Disease clinical development • Proven path and comps – Valuation of other MMF prodrugs: Vumerity/Alkermes 8700, Xenoport/Dr. Reddy’s – Valuation of Reata FA – IXC-109 is pharmacokinetically superior to Biogen’s DMF and Vumerity 2 Ixchel’s pipeline in orphan mitochondrial disease Benefits in Benefits in Patient Cells Target Identified Orphan Mitochondrial: Mouse models POC clinical trial Friedreich’s Ataxia, IXC103 Leigh’s Syndrome, LHON Mitochondrial Myopathy, IXC109 Duchenne’s Muscular Dystrophy 3 Defects of mitochondria are inherited and cause disease Neurodegeneration Friedreich’s ataxia Mitochondrial defect Genetics Leber’s (LHON) Myopathy Leigh Syndrome Muscle Wasting MELAS 4 Friedreich’s Ataxia as mitochondrial disease target for therapy FA as an orphan therapeutic target: § FA is the most prevalent inherited ataxia: ~6000 in North America, 15,000 Europe.
    [Show full text]
  • Genes Implicated in Familial Parkinson's Disease Provide a Dual
    International Journal of Molecular Sciences Review Genes Implicated in Familial Parkinson’s Disease Provide a Dual Picture of Nigral Dopaminergic Neurodegeneration with Mitochondria Taking Center Stage Rafael Franco 1,2,† , Rafael Rivas-Santisteban 1,2,† , Gemma Navarro 2,3,† , Annalisa Pinna 4,*,† and Irene Reyes-Resina 1,†,‡ 1 Department Biochemistry and Molecular Biomedicine, University of Barcelona, 08028 Barcelona, Spain; [email protected] (R.F.); [email protected] (R.R.-S.); [email protected] (I.R.-R.) 2 Centro de Investigación Biomédica en Red Enfermedades Neurodegenerativas (CiberNed), Instituto de Salud Carlos III, 28031 Madrid, Spain; [email protected] 3 Department Biochemistry and Physiology, School of Pharmacy and Food Sciences, University of Barcelona, 08028 Barcelona, Spain 4 National Research Council of Italy (CNR), Neuroscience Institute–Cagliari, Cittadella Universitaria, Blocco A, SP 8, Km 0.700, 09042 Monserrato (CA), Italy * Correspondence: [email protected] † These authors contributed equally to this work. ‡ Current address: RG Neuroplasticity, Leibniz Institute for Neurobiology, Brenneckestr 6, 39118 Magdeburg, Germany. Abstract: The mechanism of nigral dopaminergic neuronal degeneration in Parkinson’s disease (PD) Citation: Franco, R.; Rivas- is unknown. One of the pathological characteristics of the disease is the deposition of α-synuclein Santisteban, R.; Navarro, G.; Pinna, (α-syn) that occurs in the brain from both familial and sporadic PD patients. This paper constitutes a A.; Reyes-Resina, I. Genes Implicated narrative review that takes advantage of information related to genes (SNCA, LRRK2, GBA, UCHL1, in Familial Parkinson’s Disease VPS35, PRKN, PINK1, ATP13A2, PLA2G6, DNAJC6, SYNJ1, DJ-1/PARK7 and FBXO7) involved in Provide a Dual Picture of Nigral familial cases of Parkinson’s disease (PD) to explore their usefulness in deciphering the origin of Dopaminergic Neurodegeneration dopaminergic denervation in many types of PD.
    [Show full text]
  • Systems Biology of Mitochondrial Dysfunction
    From the DEPARTMENT OF MOLECULAR MEDICINE AND SURGERY Karolinska Institutet, Stockholm, Sweden SYSTEMS BIOLOGY OF MITOCHONDRIAL DYSFUNCTION Florian A. Schober Stockholm 2021 All previously published papers were reproduced with permission from the publisher. Published by Karolinska Institutet Printed by Universitetsservice US­AB, 2021 © 2021 Florian A. Schober ISBN 978­91­8016­166­4 Cover illustration: The digital mitochondria, a puzzle. ASCII code (outer membrane) and ASCII code at 700 ppm mass tolerance, charge +1, carbamidomethylation (C) as fixed, methylation (KR) and oxidation (M) as variable modifications, 6% missing values (inner membrane). SYSTEMS BIOLOGY OF MITOCHONDRIAL DYSFUNCTION THESIS FOR DOCTORAL DEGREE (Ph.D.) By Florian A. Schober The thesis will be defended in public online and at Biomedicum in the Ragnar Granit lecture hall, Karolinska Institutet, Solnavägen 9, on May 7, 2021 at 9:00. Principal Supervisor: Opponent: Dr. Anna Wredenberg Dr. Christian Frezza Karolinska Institutet Cambridge University Department of Medical Biochemistry MRC Cancer Unit and Biophysics Division of Molecular Metabolism Examination Board: Prof. Maria Ankacrona Co­supervisors: Karolinska Institutet Dr. Christoph Freyer Department of Neurobiology, Care Sciences Karolinska Institutet and Society Department of Medical Biochemistry Division of Neurogeriatrics and Biophysics Division of Molecular Metabolism Dr. Bianca Habermann Aix­Marseille Université Prof. Anna Wedell Institut de Biologie du Développement Karolinska Institutet de Marseille Department of Molecular Medicine Computational Biology Team and Surgery Division of Inborn Errors of Metabolism Prof. Roman Zubarev Karolinska Institutet Department of Medical Biochemistry and Biophysics Division of Physiological Chemistry I The scientist does not study nature because it is useful to do so. He studies it because he takes pleasure in it, and he takes pleasure in it because it is beautiful.
    [Show full text]
  • Mitochondrial Genome Changes and Neurodegenerative Diseases☆
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector Biochimica et Biophysica Acta 1842 (2014) 1198–1207 Contents lists available at ScienceDirect Biochimica et Biophysica Acta journal homepage: www.elsevier.com/locate/bbadis Review Mitochondrial genome changes and neurodegenerative diseases☆ Milena Pinto a,c,CarlosT.Moraesa,b,c,⁎ a Department of Neurology, University of Miami Miller School of Medicine, Miami, FL 33136, USA b Neuroscience Graduate Program, University of Miami Miller School of Medicine, Miami, FL 33136, USA c Department of Cell Biology, University of Miami Miller School of Medicine, Miami, FL 33136, USA article info abstract Article history: Mitochondria are essential organelles within the cell where most of the energy production occurs by the oxida- Received 31 July 2013 tive phosphorylation system (OXPHOS). Critical components of the OXPHOS are encoded by the mitochondrial Received in revised form 6 November 2013 DNA (mtDNA) and therefore, mutations involving this genome can be deleterious to the cell. Post-mitotic tissues, Accepted 8 November 2013 such as muscle and brain, are most sensitive to mtDNA changes, due to their high energy requirements and non- Available online 16 November 2013 proliferative status. It has been proposed that mtDNA biological features and location make it vulnerable to mu- tations, which accumulate over time. However, although the role of mtDNA damage has been conclusively con- Keywords: Mitochondrion nected to neuronal impairment in mitochondrial diseases, its role in age-related neurodegenerative diseases mtDNA remains speculative. Here we review the pathophysiology of mtDNA mutations leading to neurodegeneration Encephalopathy and discuss the insights obtained by studying mouse models of mtDNA dysfunction.
    [Show full text]
  • Defined Neuronal Populations Drive Fatal Phenotype in a Mouse Model
    RESEARCH ARTICLE Defined neuronal populations drive fatal phenotype in a mouse model of Leigh syndrome Irene Bolea1,2†*, Alejandro Gella2,3†, Elisenda Sanz2,4,5†, Patricia Prada-Dacasa2,5, Fabien Menardy2, Angela M Bard4, Pablo Machuca-Ma´ rquez2, Abel Eraso-Pichot2, Guillem Mo` dol-Caballero2,5,6, Xavier Navarro2,5,6, Franck Kalume4,7,8, Albert Quintana1,2,4,5,9‡* 1Center for Developmental Therapeutics, Seattle Children’s Research Institute, Seattle, United States; 2Institut de Neurocie`ncies, Universitat Auto`noma de Barcelona, Bellaterra, Spain; 3Department of Biochemistry and Molecular Biology, Universitat Auto`noma de Barcelona, Bellaterra, Spain; 4Center for Integrative Brain Research, Seattle Children’s Research Institute, Seattle, United States; 5Department of Cell Biology, Physiology and Immunology, Universitat Auto`noma de Barcelona, Bellaterra, Spain; 6Centro de Investigacio´n Biome´dica en Red sobre Enfermedades Neurodegenerativas (CIBERNED), Bellaterra, Spain; 7Department of Neurological Surgery, University of Washington, Seattle, United States; 8Department of Pharmacology, University of Washington, Seattle, United States; 9Department of Pediatrics, University of Washington, Seattle, United States *For correspondence: [email protected] (IB); [email protected] (AQ) Mitochondrial deficits in energy production cause untreatable and fatal pathologies † Abstract These authors contributed known as mitochondrial disease (MD). Central nervous system affectation is critical in Leigh equally to this work Syndrome (LS), a common MD presentation, leading to motor and respiratory deficits, seizures and Present address: ‡Institut de premature death. However, only specific neuronal populations are affected. Furthermore, their Neurocie`ncies, Universitat molecular identity and their contribution to the disease remains unknown. Here, using a mouse Auto`noma de Barcelona, model of LS lacking the mitochondrial complex I subunit Ndufs4, we dissect the critical role of Bellaterra (Barcelona), Spain genetically-defined neuronal populations in LS progression.
    [Show full text]