DOCSLIB.ORG

The Role of the PRMT5–SND1 Axis in Hepatocellular Carcinoma

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
The Role of the PRMT5–SND1 Axis in Hepatocellular Carcinoma epigenomes Review The Role of the PRMT5–SND1 Axis in Hepatocellular Carcinoma Tanner Wright 1,2, Yalong Wang 1 and Mark T. Bedford 1,* 1 Department of Epigenetics and Molecular Carcinogenesis, The University of Texas MD Anderson Cancer Center, Smithville, TX 78957, USA; [email protected] (T.W.); [email protected] (Y.W.) 2 Graduate Program in Genetics & Epigenetics, UTHealth Graduate School of Biomedical Sciences, The University of Texas MD Anderson Cancer Center, Houston, TX 77030, USA * Correspondence: [email protected] Abstract: Arginine methylation is an essential post-translational modification (PTM) deposited by protein arginine methyltransferases (PRMTs) and recognized by Tudor domain-containing proteins. Of the nine mammalian PRMTs, PRMT5 is the primary enzyme responsible for the deposition of symmetric arginine methylation marks in cells. The staphylococcal nuclease and Tudor domain- containing 1 (SND1) effector protein is a key reader of the marks deposited by PRMT5. Both PRMT5 and SND1 are broadly expressed and their deregulation is reported to be associated with a range of disease phenotypes, including cancer. Hepatocellular carcinoma (HCC) is an example of a cancer type that often displays elevated PRMT5 and SND1 levels, and there is evidence that hyperactivation of this axis is oncogenic. Importantly, this pathway can be tempered with small-molecule inhibitors that target PRMT5, offering a therapeutic node for cancer, such as HCC, that display high PRMT5–SND1 axis activity. Here we summarize the known activities of this writer–reader pair, with a focus on their biological roles in HCC. This will help establish a foundation for treating HCC with PRMT5 inhibitors and also identify potential biomarkers that could predict sensitivity to this type of therapy. Keywords: arginine methylation; PRMT5; SND1; Tudor-SN; p100; HCC Citation: Wright, T.; Wang, Y.; Bedford, M.T. The Role of the PRMT5–SND1 Axis in Hepatocellular 1. Introduction Carcinoma. Epigenomes 2021, 5, 2. https://doi.org/10.3390/ Signal transduction is the process by which information is relayed through a cell. epigenomes5010002 Extracellular signals, such as growth factors or contact points with other cells, stimu- late receptors on the cell surface to initiate this process by converting one stimulus (lig- Received: 13 December 2020 and binding) into another (phosphorylation). This signal initiation event is then propelled Accepted: 3 January 2021 through the cytoplasm and into the nucleus using a series of sequential PTM events that Published: 5 January 2021 rely on “reader” proteins, or effector molecules, to dock onto a specific PTM and then promote the deposition of a new PTM downstream, which in turn is read and relayed Publisher’s Note: MDPI stays neu- by another effector. There is a vast array of different PTMs including, but not limited to, tral with regard to jurisdictional clai- phosphorylation, acetylation, ubiquitination and methylation, which can all be read by ms in published maps and institutio- specialized protein domains in effector molecules [1]. These globular domain types include nal affiliations. SH2s (phosphor-tyrosine readers), FHAs/14-3-3s/BRCTs (phosphor-serine/threonine read- ers), Bromo/YEATS domains (acetyl-lysine readers), UBA/UIM/GAT/CUE domains (ubiquitinated-lysine readers), Chromo/PHD/Tudor/BAH domains (methylated-lysine readers), and Tudors (methylated-arginine readers). In this review, we will focus on just Copyright: © 2021 by the authors. Li- censee MDPI, Basel, Switzerland. one single thread in this hairball of signaling networks: the PRMT5–SND1 axis. This article is an open access article Arginine residues are frequently methylated post-translationally, and these modifi- distributed under the terms and con- cations come in one of three flavors: monomethylarginine (MMA), asymmetric dimethy- ditions of the Creative Commons At- larginine (ADMA), or symmetric dimethylarginine (SDMA) (Figure1). These methyl-mark tribution (CC BY) license (https:// additions occur at the peripheral omega nitrogen of arginine guanidine moieties and creativecommons.org/licenses/by/ are commonly seen at glycine- and arginine-rich (GAR) motifs. Protein arginine methyl- 4.0/). transferases (PRMTs) are the family of nine closely-related enzymes which deposit all Epigenomes 2021, 5, 2. https://doi.org/10.3390/epigenomes5010002 https://www.mdpi.com/journal/epigenomes Epigenomes 2021, 5, x 2 of 23 Epigenomes 2021, 5, 2 2 of 22 and are commonly seen at glycine- and arginine-rich (GAR) motifs. Protein arginine me- thyltransferases (PRMTs) are the family of nine closely-related enzymes which deposit all threethree of these of these marks marks [2]. [There2]. There is a istenth a tenth arginine arginine methyltra methyltransferasensferase called called NDUF NDUFAF7,AF7, whichwhich is not is nota member a member of PRMT of PRMT family, family, and andseems seems to be to a be dedicated a dedicated mitocho mitochondrialndrial en- en- zymezyme [3]. [PRMT13]. PRMT1 is the is primary the primary Type Type I PRMT I PRMT,, which which deposit depositss the themajority majority of ADMA of ADMA marksmarks.. Other Other Type Type I PRMTs I PRMTs include include PRMT2, PRMT2, PRMT3, PRMT3, PRMT4/CARM1, PRMT4/CARM1, PRMT6 PRMT6 and and PRMT8.PRMT8. PRMT7 PRMT7 is capable is capable of depositing of depositing only only MMA MMA marks, marks, and andit is itreferred is referred to as to a asType a Type III enzyme.III enzyme. That That leaves leaves the Type the Type II enzymes, II enzymes, which which deposit deposit SDMA SDMA marks. marks. PRMT9 PRMT9 has hasjust just one oneknown known substrate substrate (SAP145) (SAP145) [4], and [4], andNDUFAF7 NDUFAF7 is also is alsodedicated dedicated to just to justone onemitochon- mitochon- drialdrial substrate substrate (NDUFS2) (NDUFS2) [3]. All [3]. the All remaining the remaining proteins proteins marked marked with with SDMA SDMA are thought are thought to beto PRMT5 be PRMT5 substrates. substrates. Arginine Arginine methylation methylation is a isrelatively a relatively abundant abundant PTM PTM and andover over the the yearsyears,, a number a number of studies of studies have have reported reported similar similar rations rations of the of different the different types types of arginine of arginine methylationmethylation in both in both tissue tissue and andcell celllines lines [5–7 []5, –which7], which generally generally breaks breaks down down to 15 to00 1500:3:2:1:3:2:1 for Argininefor Arginine:ADMA:SDMA:MMA.:ADMA:SDMA:MMA. So, approximately So, approximately 0.6% 0.6% of all of arginine all arginine residues residues found found in proteinsin proteins are arginine are arginine methylated. methylated. FigureFigure 1. The 1. ThePRMTs, PRMTs, the marks the marks they they deposit, deposit, and andthe effectors the effectors of those of those marks. marks. PRMT5 PRMT5 and andPRMT9 PRMT9 deposit deposit the SDMA the SDMA mark,mark, in “green”. in “green”. PRMT1 PRMT1-4,-4, 6 and 6 and 8 all 8 deposit all deposit the the ADMA, ADMA, in in“blue”. “blue”. Methyl Methyl groups groups are are highlighted highlighted in in “red”. “red”. The The effec- effectors, tors, or readers, of the methyl marks are Tudor domain-containing proteins. or readers, of the methyl marks are Tudor domain-containing proteins. TudorTudor domain domainss are the are only the onlyglobular globular folds foldsknown known to bind to methylated bind methylated arginine arginine motifs mo- [8]. tifsThis [8 domain]. This domain type was type first was identified first identified in the in Drosophila the Drosophila melanogaster melanogaster TudorTudor protein protein whichwhich contains contains repeating repeating domains domains thatthat are present are present in a innumber a number of other of other proteins proteins in many in many differentdifferent species species [9] [.9 A]. Adetailed detailed understanding understanding of howhow TudorTudor domains domains interact interact with with SDMA SDMAmotifs motifs was was first first gleaned gleaned from from biochemistry biochemistry and and structure structure studies studies involving involving the humanthe humansurvival survival motor motor neuron neuron (SMN) (SMN) protein protein [10,11 [10,11], which], which is mutated is mutated in spinal in spinal muscular muscular atrophy atrophysyndrome. syndrome. All inAll all, in all, eight eight Tudor Tudor domain-containing domain-containing proteins proteins have have been been reported reported to be to bemethyl-arginine methyl-arginine readers. readers. The The vast vast majority majority of methyl-arginineof methyl-arginine readers readers recognize recognize SDMA SDMAmotifs, motifs, including including SMN, SMN, SPF30, SPF30 and, and SND1, SND1, which which are ubiquitouslyare ubiquitously expressed, expressed, and TDRD1,and TDRD1,TDRD2, TDRD TDRD6,2, TDRD6, and TDRD9,and TDRD9, which which are all are germ all germ cell-specific cell-specific proteins. proteins TDRD3. TDRD3 is currently is the only known ADMA motif effector protein that is also ubiquitously expressed (Figure1 ). PRMT5 has emerged as an important player in HCC [12], the fourth leading cause of cancer mortality in the world [13]. This link to HCC is strengthened by the fact that Epigenomes 2021, 5, x. https://doi.org/10.3390/xxxxx www.mdpi.com/journal/epigenomes Epigenomes 2021, 5, x 3 of 23 currently the only known ADMA motif effector protein that is also ubiquitously expressed Epigenomes 2021, 5, 2 (Figure 1). 3 of 22 PRMT5 has emerged as an important player in
Load more

Recommended publications
  • Gene Symbol Gene Description ACVR1B Activin a Receptor, Type IB
    Table S1. Kinase clones included in human kinase cDNA library for yeast two-hybrid screening Gene Symbol Gene Description ACVR1B activin A receptor, type IB ADCK2 aarF domain containing kinase 2 ADCK4 aarF domain containing kinase 4 AGK multiple substrate lipid kinase;MULK AK1 adenylate kinase 1 AK3 adenylate kinase 3 like 1 AK3L1 adenylate kinase 3 ALDH18A1 aldehyde dehydrogenase 18 family, member A1;ALDH18A1 ALK anaplastic lymphoma kinase (Ki-1) ALPK1 alpha-kinase 1 ALPK2 alpha-kinase 2 AMHR2 anti-Mullerian hormone receptor, type II ARAF v-raf murine sarcoma 3611 viral oncogene homolog 1 ARSG arylsulfatase G;ARSG AURKB aurora kinase B AURKC aurora kinase C BCKDK branched chain alpha-ketoacid dehydrogenase kinase BMPR1A bone morphogenetic protein receptor, type IA BMPR2 bone morphogenetic protein receptor, type II (serine/threonine kinase) BRAF v-raf murine sarcoma viral oncogene homolog B1 BRD3 bromodomain containing 3 BRD4 bromodomain containing 4 BTK Bruton agammaglobulinemia tyrosine kinase BUB1 BUB1 budding uninhibited by benzimidazoles 1 homolog (yeast) BUB1B BUB1 budding uninhibited by benzimidazoles 1 homolog beta (yeast) C9orf98 chromosome 9 open reading frame 98;C9orf98 CABC1 chaperone, ABC1 activity of bc1 complex like (S. pombe) CALM1 calmodulin 1 (phosphorylase kinase, delta) CALM2 calmodulin 2 (phosphorylase kinase, delta) CALM3 calmodulin 3 (phosphorylase kinase, delta) CAMK1 calcium/calmodulin-dependent protein kinase I CAMK2A calcium/calmodulin-dependent protein kinase (CaM kinase) II alpha CAMK2B calcium/calmodulin-dependent
    [Show full text]
  • Molecular Mechanism of ACAD9 in Mitochondrial Respiratory Complex 1 Assembly
    bioRxiv preprint doi: https://doi.org/10.1101/2021.01.07.425795; this version posted January 9, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Molecular mechanism of ACAD9 in mitochondrial respiratory complex 1 assembly Chuanwu Xia1, Baoying Lou1, Zhuji Fu1, Al-Walid Mohsen2, Jerry Vockley2, and Jung-Ja P. Kim1 1Department of Biochemistry, Medical College of Wisconsin, Milwaukee, Wisconsin, 53226, USA 2Department of Pediatrics, University of Pittsburgh School of Medicine, University of Pittsburgh, Children’s Hospital of Pittsburgh of UPMC, Pittsburgh, PA 15224, USA Abstract ACAD9 belongs to the acyl-CoA dehydrogenase family, which catalyzes the α-β dehydrogenation of fatty acyl-CoA thioesters. Thus, it is involved in fatty acid β-oxidation (FAO). However, it is now known that the primary function of ACAD9 is as an essential chaperone for mitochondrial respiratory complex 1 assembly. ACAD9 interacts with ECSIT and NDUFAF1, forming the mitochondrial complex 1 assembly (MCIA) complex. Although the role of MCIA in the complex 1 assembly pathway is well studied, little is known about the molecular mechanism of the interactions among these three assembly factors. Our current studies reveal that when ECSIT interacts with ACAD9, the flavoenzyme loses the FAD cofactor and consequently loses its FAO activity, demonstrating that the two roles of ACAD9 are not compatible. ACAD9 binds to the carboxy-terminal half (C-ECSIT), and NDUFAF1 binds to the amino-terminal half of ECSIT. Although the binary complex of ACAD9 with ECSIT or with C-ECSIT is unstable and aggregates easily, the ternary complex of ACAD9-ECSIT-NDUFAF1 (i.e., the MCIA complex) is soluble and extremely stable.
    [Show full text]
  • NDUFAF7 (NM 001083946) Human Untagged Clone – SC316187 | Origene
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC316187 NDUFAF7 (NM_001083946) Human Untagged Clone Product data: Product Type: Expression Plasmids Product Name: NDUFAF7 (NM_001083946) Human Untagged Clone Tag: Tag Free Symbol: NDUFAF7 Synonyms: C2orf56; MidA; PRO1853 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin Fully Sequenced ORF: >NCBI ORF sequence for NM_001083946, the custom clone sequence may differ by one or more nucleotides ATGAGTGTACTGCTGAGGTCAGGTTTGGGGCCGTTGTGTGCCGTGGCGCGCGCAGCCATTCCTTTTATTT GGAGAGGGAAATACTTCAGCTCCGGGAATGAGCCTGCAGAAAACCCGGTGACGCCGATGCTGCGGCATCT TATGTACAAAATAAAGTCTACTGGTCCCATCACTGTGGCCGAGTACATGAAGGAGGTGTTGACTAATCCA GCCAAGCTACTAGGTATATGGTTCATTAGTGAATGGATGGCCACTGGAAAAAGCACAGCTTTCCAGCTGG TGGAACTGGGCCCAGGTAGGGGAACCCTCGTGGGAGATATTTTGAGGGTGTTCACTCAACTTGGATCTGT GCTGAAAAATTGTGACATTTCAGTACATCTGGTAGAGAAAACACCACAGGGATGGCGAGAAGTATTTGTT GACATTGATCCACAGGTTTCTGATAAACTGAGGTTTGTTTTGGCACCTTCTGCCACCCCAGCAGAAGCCT TCATACAACATGACGAAACAAGGGATCATGTTGAAGTGTGTCCTGATGCTGGTGTTATCATCGAGGAACT TTCTCAACGCATTGCATTAACTGGAGGTGCTGCACTGGTTGCTGATTATGGTCATGATGGAACAAAGACA GATACCTTCAGAGGGTTTTGCGACCACAAGCTTCATGATGTCTTAATTGCCCCAGGAACAGCAGATCTAA CAGCTGATGTGGACTTCAGTTATTTGCGAAGAATGGCACAGGGAAAAGTAGCCTCTCTGGGCCCAATAAA ACAACACACATTTTTAAAAAATATGGGTATTGATGTCCGGCTGAAGGTTCTTTTAGATAAATCAAATGAG CCATCAGTGAGGCAGCAGTTACTTCAAGGATATGATATGTTAATGAATCCAAAGAAGATGGGAGAGAGAT
    [Show full text]
  • The Ire1a-XBP1 Pathway Promotes T Helper Cell Differentiation by Resolving Secretory Stress and Accelerating Proliferation
    bioRxiv preprint doi: https://doi.org/10.1101/235010; this version posted December 15, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. The IRE1a-XBP1 pathway promotes T helper cell differentiation by resolving secretory stress and accelerating proliferation Jhuma Pramanik1, Xi Chen1, Gozde Kar1,2, Tomás Gomes1, Johan Henriksson1, Zhichao Miao1,2, Kedar Natarajan1, Andrew N. J. McKenzie3, Bidesh Mahata1,2*, Sarah A. Teichmann1,2,4* 1. Wellcome Trust Sanger Institute, Wellcome Genome Campus, Hinxton, Cambridge, CB10 1SA, United Kingdom 2. EMBL-European Bioinformatics Institute, Wellcome Genome Campus, Hinxton, Cambridge, CB10 1SD, United Kingdom 3. MRC Laboratory of Molecular Biology, Cambridge Biomedical Campus, Francis Crick Avenue, Cambridge CB2 OQH, United Kingdom 4. Theory of Condensed Matter, Cavendish Laboratory, 19 JJ Thomson Ave, Cambridge CB3 0HE, United Kingdom. *To whom correspondence should be addressed: [email protected] and [email protected] Keywords: Th2 lymphocyte, XBP1, Genome wide XBP1 occupancy, Th2 lymphocyte proliferation, ChIP-seq, RNA-seq, Th2 transcriptome Summary The IRE1a-XBP1 pathway, a conserved adaptive mediator of the unfolded protein response, is indispensable for the development of secretory cells. It maintains endoplasmic reticulum homeostasis by facilitating protein folding and enhancing secretory capacity of the cells. Its role in immune cells is emerging. It is involved in dendritic cell, plasma cell and eosinophil development and differentiation. Using genome-wide approaches, integrating ChIPmentation and mRNA-sequencing data, we have elucidated the regulatory circuitry governed by the IRE1a-XBP1 pathway in type-2 T helper cells (Th2).
    [Show full text]
  • SND1, a Component of RNA-Induced Silencing Complex, Is Up-Regulated in Human Colon Cancers and Implicated in Early Stage Colon Carcinogenesis
    Research Article SND1, a Component of RNA-Induced Silencing Complex, Is Up-regulated in Human Colon Cancers and Implicated in Early Stage Colon Carcinogenesis Naoto Tsuchiya, Masako Ochiai, Katsuhiko Nakashima, Tsuneyuki Ubagai, Takashi Sugimura, and Hitoshi Nakagama Biochemistry Division, National Cancer Center Research Institute, 5-1-1 Tsukiji, Chuo-ku, Tokyo, Japan Abstract transcription factors is well known to be a causative event involved Colon cancers have been shown to develop after accumulation in malignant transformation, for example, with functional inacti- vation or intragenic mutation of p53 (3), and gene amplification or of multiple genetic and epigenetic alterations with changes in global gene expression profiles, contributing to the establish- overexpression of c-myc (4). ment of widely diverse phenotypes. Transcriptional and Recently, posttranscriptional regulation, especially translational posttranscriptional regulation of gene expression by small control, of gene expression has become a major interest in the field of cancer research, because accumulating evidence strongly RNA species, such as the small interfering RNA and microRNA suggests its biological relevance for cancer development and and the RNA-induced silencing complex (RISC), is currently drawing major interest with regard to cancer development. progression (5). Some oncogenes and tumor suppressor genes, including c-myc (6), Mdm-2(7), and p53 (8), have been shown to be SND1, also called Tudor-SN and p100 and recently reported to regulated at the translational level. Overexpression of the transla- be a component of RISC, is among the list of highly expressed tion initiation factor eIF4E promotes malignant transformation of genes in human colon cancers. In the present study, we normal fibroblasts (9) and cooperates with c-Myc to drive B-cell showed remarkable up-regulation of SND1 mRNA in human lymphomatogenesis in eIF4E transgenic mice (10).
    [Show full text]
  • Insights Into SND1 Oncogene Promoter Regulation
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Archivo Digital para la Docencia y la Investigación REVIEW published: 11 December 2018 doi: 10.3389/fonc.2018.00606 Insights Into SND1 Oncogene Promoter Regulation Begoña Ochoa, Yolanda Chico and María José Martínez* Department of Physiology, Faculty of Medicine and Nursing, University of the Basque Country UPV/EHU, Leioa, Spain The staphylococcal nuclease and Tudor domain containing 1 gene (SND1), also known as Tudor-SN, TSN or p100, encodes an evolutionarily conserved protein with invariant domain composition. SND1 contains four repeated staphylococcal nuclease domains and a single Tudor domain, which confer it endonuclease activity and extraordinary capacity for interacting with nucleic acids, individual proteins and protein complexes. Originally described as a transcriptional coactivator, SND1 plays fundamental roles in the regulation of gene expression, including RNA splicing, interference, stability, and editing, as well as in the regulation of protein and lipid homeostasis. Recently, SND1 has gained attention as a potential disease biomarker due to its positive correlation with cancer progression and metastatic spread. Such functional diversity of SND1 marks this gene as interesting for further analysis in relation with the multiple levels of regulation of SND1 protein production. In this review, we summarize the SND1 genomic region Edited by: and promoter architecture, the set of transcription factors that can bind the proximal Markus A. N. Hartl, promoter, and the evidence supporting transactivation of SND1 promoter by a number of University of Innsbruck, Austria signal transduction pathways operating in different cell types and conditions. Unraveling Reviewed by: John Strouboulis, the mechanisms responsible for SND1 promoter regulation is of utmost interest to King’s College London, decipher the SND1 contribution in the realm of both normal and abnormal physiology.
    [Show full text]
  • Riok1 (BC002158) Mouse Tagged ORF Clone – MR204785 | Origene
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for MR204785 Riok1 (BC002158) Mouse Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: Riok1 (BC002158) Mouse Tagged ORF Clone Tag: Myc-DDK Symbol: Riok1 Synonyms: 3110046C13Rik, Ad034, MGC7300 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin ORF Nucleotide >MR204785 ORF sequence Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGTGAGGACGTGGGCAGAGAAGGAGATGAGGAATTTGTGCAGGCTAAAAACAGCAAACATACCATGTC CAGAACCAATCAGGCTAAGAAGTCATGTTCTTCTCATGGGCTTCATTGGCAAGGATGACATGCCAGCCCC ACTTTTGAAAAATGTCCAGCTGTCAGAGTCCAAGGCACGGGAGTTGTACCTGCAGGTCATTCAGTACATG AGGAAAATGTATCAGGATGCTAGACTTGTCCACGCGGATCTCAGTGAATTCAACATGCTGTACCATGGTG GAGATGTTTACATCATTGATGTTTCTCAGTCTGTGGAGCATGACCACCCACATGCATTGGAGTTCTTGAG AAAAGACTGTACCAATGTCAATGATTTCTTTTCCAAGCATGCTGTTGCAGTGATGACCGTGCGGGAGCTC TTCGACTTCGTCACAGATCCCTCCATCACTGCTGACAACATGGATGCTTACCTGGAAAAGGCTATGGAAA TAGCATCCCAGAGGACCAAGGAAGAAAAGACTAGCCAAGATCATGTGGATGAAGAGGTGTTCAAACAAGC ATATATTCCCAGAACCTTAAACGAAGTAAAGAATTATGAGAGAGATGTGGACATCATGATGAGGTTAAAG GAAGAAGACATGGCTTTGAACACTCAGCAAGACAACATTCTATACCAGACTGTCATGGGATTGAAAAAAG ATTTGTCAGGAGTCCAGAAGGTCCCCGCGCTCCTAGAAAGTGAAGTTAAGGAAGAGACTTGTTTTGGTTC AGACGATGCTGGGGGCTCTGAGTGCTCCGACACAGTCTCTGAAGAGCAGGAAGATCAAGCCGGATGCAGA AACCATATTGCTGACCCCGACGTTGATAAAAAGGAAAGAAAAAAGATGGTCAAGGAAGCCCAGAGAGAGA
    [Show full text]
  • Systems Biology of Mitochondrial Dysfunction
    From the DEPARTMENT OF MOLECULAR MEDICINE AND SURGERY Karolinska Institutet, Stockholm, Sweden SYSTEMS BIOLOGY OF MITOCHONDRIAL DYSFUNCTION Florian A. Schober Stockholm 2021 All previously published papers were reproduced with permission from the publisher. Published by Karolinska Institutet Printed by Universitetsservice US­AB, 2021 © 2021 Florian A. Schober ISBN 978­91­8016­166­4 Cover illustration: The digital mitochondria, a puzzle. ASCII code (outer membrane) and ASCII code at 700 ppm mass tolerance, charge +1, carbamidomethylation (C) as fixed, methylation (KR) and oxidation (M) as variable modifications, 6% missing values (inner membrane). SYSTEMS BIOLOGY OF MITOCHONDRIAL DYSFUNCTION THESIS FOR DOCTORAL DEGREE (Ph.D.) By Florian A. Schober The thesis will be defended in public online and at Biomedicum in the Ragnar Granit lecture hall, Karolinska Institutet, Solnavägen 9, on May 7, 2021 at 9:00. Principal Supervisor: Opponent: Dr. Anna Wredenberg Dr. Christian Frezza Karolinska Institutet Cambridge University Department of Medical Biochemistry MRC Cancer Unit and Biophysics Division of Molecular Metabolism Examination Board: Prof. Maria Ankacrona Co­supervisors: Karolinska Institutet Dr. Christoph Freyer Department of Neurobiology, Care Sciences Karolinska Institutet and Society Department of Medical Biochemistry Division of Neurogeriatrics and Biophysics Division of Molecular Metabolism Dr. Bianca Habermann Aix­Marseille Université Prof. Anna Wedell Institut de Biologie du Développement Karolinska Institutet de Marseille Department of Molecular Medicine Computational Biology Team and Surgery Division of Inborn Errors of Metabolism Prof. Roman Zubarev Karolinska Institutet Department of Medical Biochemistry and Biophysics Division of Physiological Chemistry I The scientist does not study nature because it is useful to do so. He studies it because he takes pleasure in it, and he takes pleasure in it because it is beautiful.
    [Show full text]
  • Contribution of Alternative Splicing to Breast Cancer Metastasis
    Meng et al. J Cancer Metastasis Treat 2019;5:21 Journal of Cancer DOI: 10.20517/2394-4722.2018.96 Metastasis and Treatment Review Open Access Contribution of alternative splicing to breast cancer metastasis Xiangbing Meng1,2, Shujie Yang1,2, Jun Zhang2,3, Huimin Yu1,4 1Department of Obstetrics and Gynecology, University of Iowa Carver College of Medicine, Iowa City, IA 52242, USA. 2Holden Comprehensive Cancer Center, University of Iowa Carver College of Medicine, Iowa City, IA 52242, USA. 3Division of Hematology, Oncology and Blood & Marrow Transplantation, Department of Internal Medicine, University of Iowa Carver College of Medicine, Iowa City, IA 52242, USA. 4Department of Pathogenic Biology, Shenzhen University School of medicine, Shenzhen 518060,China. Correspondence to: Dr. Xiangbing Meng, Department of Obstetrics and Gynecology, The University of Iowa, 375 Newton Road, Iowa City, IA 52242, USA. E-mail: [email protected] How to cite this article: Meng X, Yang S, Zhang J, Yu H. Contribution of alternative splicing to breast cancer metastasis. J Cancer Metastasis Treat 2019;5:21. http://dx.doi.org/10.20517/2394-4722.2018.96 Received: 10 Dec 2018 Accepted: 25 Jan 2019 Published: 22 Mar 2019 Science Editor: William P. Schiemann Copy Editor: Cai-Hong Wang Production Editor: Huan-Liang Wu Abstract Alternative splicing is a major contributor to transcriptome and proteome diversity in eukaryotes. Comparing to normal samples, about 30% more alternative splicing events were recently identified in 32 cancer types included in The Cancer Genome Atlas database. Some alternative splicing isoforms and their encoded proteins contribute to specific cancer hallmarks. In this review, we will discuss recent progress regarding the contributions of alternative splicing to breast cancer metastasis.
    [Show full text]
  • MYB Transcription Factors and Its Regulation in Secondary Cell Wall Formation and Lignin Biosynthesis During Xylem Development
    International Journal of Molecular Sciences Review MYB Transcription Factors and Its Regulation in Secondary Cell Wall Formation and Lignin Biosynthesis during Xylem Development Ruixue Xiao 1,2, Chong Zhang 2, Xiaorui Guo 2, Hui Li 1,2 and Hai Lu 1,2,* 1 Beijing Advanced Innovation Center for Tree Breeding by Molecular Design, Beijing Forestry University, Beijing 100083, China; [email protected] (R.X.); [email protected] (H.L.) 2 College of Biological Sciences and Biotechnology, Beijing Forestry University, Beijing 100083, China; [email protected] (C.Z.); [email protected] (X.G.) * Correspondence: [email protected] Abstract: The secondary wall is the main part of wood and is composed of cellulose, xylan, lignin, and small amounts of structural proteins and enzymes. Lignin molecules can interact directly or indirectly with cellulose, xylan and other polysaccharide molecules in the cell wall, increasing the mechanical strength and hydrophobicity of plant cells and tissues and facilitating the long-distance transportation of water in plants. MYBs (v-myb avian myeloblastosis viral oncogene homolog) belong to one of the largest superfamilies of transcription factors, the members of which regulate secondary cell-wall formation by promoting/inhibiting the biosynthesis of lignin, cellulose, and xylan. Among them, MYB46 and MYB83, which comprise the second layer of the main switch of secondary cell-wall biosynthesis, coordinate upstream and downstream secondary wall synthesis-related transcription factors. In addition, MYB transcription factors other than MYB46/83, as well as noncoding RNAs, Citation: Xiao, R.; Zhang, C.; Guo, X.; hormones, and other factors, interact with one another to regulate the biosynthesis of the secondary Li, H.; Lu, H.
    [Show full text]
  • A Catalogue of Stress Granules' Components
    Catarina Rodrigues Nunes A Catalogue of Stress Granules’ Components: Implications for Neurodegeneration UNIVERSIDADE DO ALGARVE Departamento de Ciências Biomédicas e Medicina 2019 Catarina Rodrigues Nunes A Catalogue of Stress Granules’ Components: Implications for Neurodegeneration Master in Oncobiology – Molecular Mechanisms of Cancer This work was done under the supervision of: Clévio Nóbrega, Ph.D UNIVERSIDADE DO ALGARVE Departamento de Ciências Biomédicas e Medicina 2019 i ii A catalogue of Stress Granules’ Components: Implications for neurodegeneration Declaração de autoria de trabalho Declaro ser a autora deste trabalho, que é original e inédito. Autores e trabalhos consultados estão devidamente citados no texto e constam na listagem de referências incluída. I declare that I am the author of this work, that is original and unpublished. Authors and works consulted are properly cited in the text and included in the list of references. _______________________________ (Catarina Nunes) iii Copyright © 2019 Catarina Nunes A Universidade do Algarve reserva para si o direito, em conformidade com o disposto no Código do Direito de Autor e dos Direitos Conexos, de arquivar, reproduzir e publicar a obra, independentemente do meio utilizado, bem como de a divulgar através de repositórios científicos e de admitir a sua cópia e distribuição para fins meramente educacionais ou de investigação e não comerciais, conquanto seja dado o devido crédito ao autor e editor respetivos. iv Part of the results of this thesis were published in Nunes,C.; Mestre,I.; Marcelo,A. et al. MSGP: the first database of the protein components of the mammalian stress granules. Database (2019) Vol. 2019. (In annex A). v vi ACKNOWLEDGEMENTS A realização desta tese marca o final de uma etapa académica muito especial e que jamais irei esquecer.
    [Show full text]
  • Human RIOK1 / RIO Kinase 1 Protein (His & GST Tag)
    Human RIOK1 / RIO kinase 1 Protein (His & GST Tag) Catalog Number: 14477-H20B General Information SDS-PAGE: Gene Name Synonym: AD034; bA288G3.1; RRP10; 3110046C13Rik; 5430416A05Rik; Ad034 Protein Construction: A DNA sequence encoding the human RIOK1 (Q9BRS2) (Met1-Lys568) was expressed with the N-terminal polyhistidine-tagged GST tag at the N-terminus. Source: Human Expression Host: Baculovirus-Insect Cells QC Testing Purity: > 85 % as determined by SDS-PAGE Bio Activity： Protein Description Kinase activity untested RIOK1, also known as RIO kinase 1, is a member of the RIO family of Endotoxin: atypical serine protein kinases first characterized in yeast. RIOK1 and RIOK2 proteins are present in organisms from Archaea to humans. RIOK1 < 1.0 EU per μg of the protein as determined by the LAL method functios as a new interactor of protein arginine methyltransferase 5 (PRMT5), competes with pICln for binding and modulates PRMT5 complex Stability: composition and substrate specificity. RioK1 and pICln bind to PRMT5 in a Samples are stable for up to twelve months from date of receipt at -70 ℃ mutually exclusive fashion. This results in a PRMT5-WD45/MEP50 core structure that either associates with pICln or RioK1 RIOK1 in distinct Predicted N terminal: Met complexes. RIOK1 functions in analogy to pICln as an adapter protein by recruiting the RNA-binding protein nucleolin to the PRMT5 complex for its Molecular Mass: symmetrical methylation. The recombinant human RIOK1/GST chimera consists of 805 amino acids References and has a calculated molecular mass of 93.4 kDa. The recombinant protein migrates as an approximately 94 kDa band in SDS-PAGE under reducing 1.Widmann B.
    [Show full text]