Mitochondrial OXPHOS Biogenesis: Co-Regulation of Protein Synthesis, Import, and Assembly Pathways
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
COX10 (NM 001303) Human Untagged Clone Product Data
OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC119292 COX10 (NM_001303) Human Untagged Clone Product data: Product Type: Expression Plasmids Product Name: COX10 (NM_001303) Human Untagged Clone Tag: Tag Free Symbol: COX10 Synonyms: MC4DN3 Vector: pCMV6-XL5 E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: None Fully Sequenced ORF: >NCBI ORF sequence for NM_001303, the custom clone sequence may differ by one or more nucleotides ATGGCCGCATCTCCGCACACTCTCTCCTCACGCCTCCTGACAGGTTGCGTAGGAGGCTCTGTCTGGTATC TTGAAAGAAGAACTATACAGGACTCCCCTCACAAGTTCTTACATCTTCTCAGGAATGTCAATAAGCAGTG GATTACATTTCAGCACTTTAGCTTCCTCAAACGCATGTATGTCACACAGCTGAACAGAAGCCACAACCAG CAAGTAAGACCCAAGCCAGAACCAGTAGCATCTCCTTTCCTTGAAAAAACATCTTCAGGTCAAGCCAAAG CAGAAATATATGAGATGAGACCTCTCTCACCGCCCAGCCTATCTTTGTCCAGAAAGCCAAATGAAAAGGA ATTGATAGAACTAGAGCCAGACTCAGTAATTGAAGACTCAATAGATGTAGGGAAAGAGACAAAAGAGGAA AAGCGGTGGAAAGAGATGAAGCTGCAAGTGTATGATTTGCCAGGAATTTTGGCTCGACTATCCAAAATCA AACTCACAGCTCTGGTTGTAAGTACCACTGCAGCTGGATTTGCATTGGCTCCGGGCCCTTTTGACTGGCC CTGTTTCCTGCTTACTTCTGTTGGGACAGGCCTTGCATCCTGTGCTGCCAACTCCATCAATCAGTTTTTT GAGGTGCCATTTGACTCAAACATGAATAGGACAAAGAACAGACCGCTGGTTCGTGGACAGATCAGCCCAT TGCTAGCTGTGTCCTTTGCCACTTGTTGTGCTGTTCCGGGAGTTGCCATTCTGACCTTGGGGGTGAATCC ACTCACAGGAGCCCTGGGGCTCTTCAACATTTTCCTGTATACCTGCTGCTACACACCACTGAAAAGGATC AGCATTGCCAACACATGGGTCGGAGCTGTGGTTGGGGCCATCCCGCCTGTCATGGGCTGGACAGCGGCCA CGGGCAGCCTCGATGCTGGCGCATTTCTCCTGGGAGGAATCCTCTACTCCTGGCAGTTTCCTCATTTCAA -
NDUFAF1 Antibody
Efficient Professional Protein and Antibody Platforms NDUFAF1 Antibody Basic information: Catalog No.: UPA63763 Source: Rabbit Size: 50ul/100ul Clonality: monoclonal Concentration: 1mg/ml Isotype: Rabbit IgG Purification: Protein A purified. Useful Information: WB:1:1000 ICC:1:50-1:200 Applications: IHC:1:50-1:200 FC:1:50-1:100 Reactivity: Human Specificity: This antibody recognizes NDUFAF1 protein. Immunogen: Synthetic peptide within C terminal human NDUFAF1. This gene encodes a complex I assembly factor protein. Complex I (NADH-ubiquinone oxidoreductase) catalyzes the transfer of electrons from NADH to ubiquinone (coenzyme Q) in the first step of the mitochondrial respiratory chain, resulting in the translocation of protons across the inner mitochondrial membrane. The encoded protein is required for assembly of complex I, and mutations in this gene are a cause of mitochondrial complex I deficiency. Alternatively spliced transcript variants have been observed for Description: this gene, and a pseudogene of this gene is located on the long arm of chromosome 19. Part of the mitochondrial complex I assembly (MCIA) com- plex. The complex comprises at least TMEM126B, NDUFAF1, ECSIT, and ACAD9. Interacts with ECSIT. Interacts with ACAD9. At early stages of com- plex I assembly, it is found in intermediate subcomplexes that contain dif- ferent subunits including NDUFB6, NDUFA6, NDUFA9, NDUFS3, NDUFS7, ND1, ND2 and ND3 Uniprot: Q9Y375 Human BiowMW: 38 kDa Buffer: 1*TBS (pH7.4), 1%BSA, 50%Glycerol. Preservative: 0.05% Sodium Azide. Storage: Store at 4°C short term and -20°C long term. Avoid freeze-thaw cycles. Note: For research use only, not for use in diagnostic procedure. -
Molecular Mechanism of ACAD9 in Mitochondrial Respiratory Complex 1 Assembly
bioRxiv preprint doi: https://doi.org/10.1101/2021.01.07.425795; this version posted January 9, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Molecular mechanism of ACAD9 in mitochondrial respiratory complex 1 assembly Chuanwu Xia1, Baoying Lou1, Zhuji Fu1, Al-Walid Mohsen2, Jerry Vockley2, and Jung-Ja P. Kim1 1Department of Biochemistry, Medical College of Wisconsin, Milwaukee, Wisconsin, 53226, USA 2Department of Pediatrics, University of Pittsburgh School of Medicine, University of Pittsburgh, Children’s Hospital of Pittsburgh of UPMC, Pittsburgh, PA 15224, USA Abstract ACAD9 belongs to the acyl-CoA dehydrogenase family, which catalyzes the α-β dehydrogenation of fatty acyl-CoA thioesters. Thus, it is involved in fatty acid β-oxidation (FAO). However, it is now known that the primary function of ACAD9 is as an essential chaperone for mitochondrial respiratory complex 1 assembly. ACAD9 interacts with ECSIT and NDUFAF1, forming the mitochondrial complex 1 assembly (MCIA) complex. Although the role of MCIA in the complex 1 assembly pathway is well studied, little is known about the molecular mechanism of the interactions among these three assembly factors. Our current studies reveal that when ECSIT interacts with ACAD9, the flavoenzyme loses the FAD cofactor and consequently loses its FAO activity, demonstrating that the two roles of ACAD9 are not compatible. ACAD9 binds to the carboxy-terminal half (C-ECSIT), and NDUFAF1 binds to the amino-terminal half of ECSIT. Although the binary complex of ACAD9 with ECSIT or with C-ECSIT is unstable and aggregates easily, the ternary complex of ACAD9-ECSIT-NDUFAF1 (i.e., the MCIA complex) is soluble and extremely stable. -
Establishing the Pathogenicity of Novel Mitochondrial DNA Sequence Variations: a Cell and Molecular Biology Approach
Mafalda Rita Avó Bacalhau Establishing the Pathogenicity of Novel Mitochondrial DNA Sequence Variations: a Cell and Molecular Biology Approach Tese de doutoramento do Programa de Doutoramento em Ciências da Saúde, ramo de Ciências Biomédicas, orientada pela Professora Doutora Maria Manuela Monteiro Grazina e co-orientada pelo Professor Doutor Henrique Manuel Paixão dos Santos Girão e pela Professora Doutora Lee-Jun C. Wong e apresentada à Faculdade de Medicina da Universidade de Coimbra Julho 2017 Faculty of Medicine Establishing the pathogenicity of novel mitochondrial DNA sequence variations: a cell and molecular biology approach Mafalda Rita Avó Bacalhau Tese de doutoramento do programa em Ciências da Saúde, ramo de Ciências Biomédicas, realizada sob a orientação científica da Professora Doutora Maria Manuela Monteiro Grazina; e co-orientação do Professor Doutor Henrique Manuel Paixão dos Santos Girão e da Professora Doutora Lee-Jun C. Wong, apresentada à Faculdade de Medicina da Universidade de Coimbra. Julho, 2017 Copyright© Mafalda Bacalhau e Manuela Grazina, 2017 Esta cópia da tese é fornecida na condição de que quem a consulta reconhece que os direitos de autor são pertença do autor da tese e do orientador científico e que nenhuma citação ou informação obtida a partir dela pode ser publicada sem a referência apropriada e autorização. This copy of the thesis has been supplied on the condition that anyone who consults it recognizes that its copyright belongs to its author and scientific supervisor and that no quotation from the -
Prioritization of Variants Detected by Next Generation Sequencing According to the Mutation Tolerance and Mutational Architecture of the Corresponding Genes
International Journal of Molecular Sciences Review Prioritization of Variants Detected by Next Generation Sequencing According to the Mutation Tolerance and Mutational Architecture of the Corresponding Genes Iria Roca, Ana Fernández-Marmiesse, Sofía Gouveia, Marta Segovia and María L. Couce * Unit of Diagnosis and Treatment of Congenital Metabolic Diseases, Department of Pediatrics, Hospital Clínico Universitario de Santiago de Compostela, 15706 Santiago de Compostela, Spain; [email protected] (I.R.); [email protected] (A.F.-M.); sofi[email protected] (S.G.); [email protected] (M.S.) * Correspondence: [email protected]; Tel.: +34-981-950-102 Received: 3 April 2018; Accepted: 23 May 2018; Published: 27 May 2018 Abstract: The biggest challenge geneticists face when applying next-generation sequencing technology to the diagnosis of rare diseases is determining which rare variants, from the dozens or hundreds detected, are potentially implicated in the patient’s phenotype. Thus, variant prioritization is an essential step in the process of rare disease diagnosis. In addition to conducting the usual in-silico analyses to predict variant pathogenicity (based on nucleotide/amino-acid conservation and the differences between the physicochemical features of the amino-acid change), three important concepts should be borne in mind. The first is the “mutation tolerance” of the genes in which variants are located. This describes the susceptibility of a given gene to any functional mutation and depends on the strength of purifying selection acting against it. The second is the “mutational architecture” of each gene. This describes the type and location of mutations previously identified in the gene, and their association with different phenotypes or degrees of severity. -
A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated. -
A Genetic Dissection of Mitochondrial Respiratory Chain Biogenesis
A GENETIC DISSECTION OF MITOCHONDRIAL RESPIRATORY CHAIN BIOGENESIS An Undergraduate Research Scholars Thesis by AARON GRIFFIN, SARAH THERIAULT, SHRISHIV TIMBALIA Submitted to Honors and Undergraduate Research Texas A&M University in partial fulfillment of the requirements for the designation as an UNDERGRADUATE RESEARCH SCHOLAR Approved by Research Advisor: Dr. Vishal Gohil May 2014 Major: Biochemistry, Genetics Biochemistry Biochemistry TABLE OF CONTENTS Page ABSTRACT .....................................................................................................................................1 CHAPTER I INTRODUCTION ...............................................................................................................3 II MATERIALS AND METHODS .........................................................................................7 Yeast strains, plasmids, and culture conditions .......................................................7 Yeast growth measurements ..................................................................................10 Yeast oxygen consumption and mitochondrial isolation .......................................11 SDS-PAGE and Western blotting ..........................................................................11 Sporulation, tetrad dissection, and genotyping ......................................................12 High-throughput phenotypic analysis of yeast strains ...........................................15 III RESULTS ..........................................................................................................................16 -
Inborn Errors of Metabolism Test Requisition
LABORATORY OF GENETICS AND GENOMICS Mailing Address: For local courier service and/or inquiries, please contact 513-636-4474 • Fax: 513-636-4373 3333 Burnet Avenue, Room R1042 www.cincinnatichildrens.org/moleculargenetics • Email: [email protected] Cincinnati, OH 45229 INBORN ERRORS OF METABOLISM TEST REQUISITION All Information Must Be Completed Before Sample Can Be Processed PATIENT INFORMATION ETHNIC/RACIAL BACKGROUND (Choose All) Patient Name: ___________________ , ___________________ , ________ European American (White) African-American (Black) Last First MI Native American or Alaskan Asian-American Address: ____________________________________________________ Pacific Islander Ashkenazi Jewish ancestry ____________________________________________________ Latino-Hispanic _____________________________________________ Home Phone: ________________________________________________ (specify country/region of origin) MR# __________________ Date of Birth ________ / ________ / _______ Other ____________________________________________________ (specify country/region of origin) Gender: Male Female BILLING INFORMATION (Choose ONE method of payment) o REFERRING INSTITUTION o COMMERCIAL INSURANCE* Insurance can only be billed if requested at the time of service. Institution: ____________________________________________________ Policy Holder Name: _____________________________________________ Address: _____________________________________________________ Gender: ________________ Date of Birth ________ / ________ / _______ -
Ncomms8214.Pdf
ARTICLE Received 20 Feb 2015 | Accepted 17 Apr 2015 | Published 26 May 2015 DOI: 10.1038/ncomms8214 OPEN Comprehensive survey of condition-specific reproductive isolation reveals genetic incompatibility in yeast Jing Hou1, Anne Friedrich1, Jean-Sebastien Gounot1 & Joseph Schacherer1 Genetic variation within a species could cause negative epistasis leading to reduced hybrid fitness and post-zygotic reproductive isolation. Recent studies in yeasts revealed chromo- somal rearrangements as a major mechanism dampening intraspecific hybrid fertility on rich media. Here, by analysing a large number of Saccharomyces cerevisiae crosses on different culture conditions, we show environment-specific genetic incompatibility segregates readily within yeast and contributes to reproductive isolation. Over 24% (117 out of 481) of cases tested show potential epistasis, among which 6.7% (32 out of 481) are severe, with at least 20% of progeny loss on tested conditions. Based on the segregation patterns, we further characterize a two-locus Dobzhansky–Mu¨ller incompatibility case leading to offspring respiratory deficiency caused by nonsense mutation in a nuclear-encoding mitochondrial gene and tRNA suppressor. We provide evidence that this precise configuration could be adaptive in fluctuating environments, highlighting the role of ecological selection in the onset of genetic incompatibility and reproductive isolation in yeast. 1 Department of Genetics, Genomics and Microbiology, University of Strasbourg/CNRS, UMR7156, 28 rue Goethe, 67083 Strasbourg, France. Correspondence -
Alterations of Genetic Variants and Transcriptomic Features of Response to Tamoxifen in the Breast Cancer Cell Line
Alterations of Genetic Variants and Transcriptomic Features of Response to Tamoxifen in the Breast Cancer Cell Line Mahnaz Nezamivand-Chegini Shiraz University Hamed Kharrati-Koopaee Shiraz University https://orcid.org/0000-0003-2345-6919 seyed taghi Heydari ( [email protected] ) Shiraz University of Medical Sciences https://orcid.org/0000-0001-7711-1137 Hasan Giahi Shiraz University Ali Dehshahri Shiraz University of Medical Sciences Mehdi Dianatpour Shiraz University of Medical Sciences Kamran Bagheri Lankarani Shiraz University of Medical Sciences Research Keywords: Tamoxifen, breast cancer, genetic variants, RNA-seq. Posted Date: August 17th, 2021 DOI: https://doi.org/10.21203/rs.3.rs-783422/v1 License: This work is licensed under a Creative Commons Attribution 4.0 International License. Read Full License Page 1/33 Abstract Background Breast cancer is one of the most important causes of mortality in the world, and Tamoxifen therapy is known as a medication strategy for estrogen receptor-positive breast cancer. In current study, two hypotheses of Tamoxifen consumption in breast cancer cell line (MCF7) were investigated. First, the effect of Tamoxifen on genes expression prole at transcriptome level was evaluated between the control and treated samples. Second, due to the fact that Tamoxifen is known as a mutagenic factor, there may be an association between the alterations of genetic variants and Tamoxifen treatment, which can impact on the drug response. Methods In current study, the whole-transcriptome (RNA-seq) dataset of four investigations (19 samples) were derived from European Bioinformatics Institute (EBI). At transcriptome level, the effect of Tamoxifen was investigated on gene expression prole between control and treatment samples. -
WO 2019/079361 Al 25 April 2019 (25.04.2019) W 1P O PCT
(12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization I International Bureau (10) International Publication Number (43) International Publication Date WO 2019/079361 Al 25 April 2019 (25.04.2019) W 1P O PCT (51) International Patent Classification: CA, CH, CL, CN, CO, CR, CU, CZ, DE, DJ, DK, DM, DO, C12Q 1/68 (2018.01) A61P 31/18 (2006.01) DZ, EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, GT, HN, C12Q 1/70 (2006.01) HR, HU, ID, IL, IN, IR, IS, JO, JP, KE, KG, KH, KN, KP, KR, KW, KZ, LA, LC, LK, LR, LS, LU, LY, MA, MD, ME, (21) International Application Number: MG, MK, MN, MW, MX, MY, MZ, NA, NG, NI, NO, NZ, PCT/US2018/056167 OM, PA, PE, PG, PH, PL, PT, QA, RO, RS, RU, RW, SA, (22) International Filing Date: SC, SD, SE, SG, SK, SL, SM, ST, SV, SY, TH, TJ, TM, TN, 16 October 2018 (16. 10.2018) TR, TT, TZ, UA, UG, US, UZ, VC, VN, ZA, ZM, ZW. (25) Filing Language: English (84) Designated States (unless otherwise indicated, for every kind of regional protection available): ARIPO (BW, GH, (26) Publication Language: English GM, KE, LR, LS, MW, MZ, NA, RW, SD, SL, ST, SZ, TZ, (30) Priority Data: UG, ZM, ZW), Eurasian (AM, AZ, BY, KG, KZ, RU, TJ, 62/573,025 16 October 2017 (16. 10.2017) US TM), European (AL, AT, BE, BG, CH, CY, CZ, DE, DK, EE, ES, FI, FR, GB, GR, HR, HU, ΓΕ , IS, IT, LT, LU, LV, (71) Applicant: MASSACHUSETTS INSTITUTE OF MC, MK, MT, NL, NO, PL, PT, RO, RS, SE, SI, SK, SM, TECHNOLOGY [US/US]; 77 Massachusetts Avenue, TR), OAPI (BF, BJ, CF, CG, CI, CM, GA, GN, GQ, GW, Cambridge, Massachusetts 02139 (US). -
Multivariate Analysis Reveals Genetic Associations of the Resting Default
Multivariate analysis reveals genetic associations of PNAS PLUS the resting default mode network in psychotic bipolar disorder and schizophrenia Shashwath A. Medaa,1, Gualberto Ruañob,c, Andreas Windemuthb, Kasey O’Neila, Clifton Berwisea, Sabra M. Dunna, Leah E. Boccaccioa, Balaji Narayanana, Mohan Kocherlab, Emma Sprootena, Matcheri S. Keshavand, Carol A. Tammingae, John A. Sweeneye, Brett A. Clementzf, Vince D. Calhoung,h,i, and Godfrey D. Pearlsona,h,j aOlin Neuropsychiatry Research Center, Institute of Living at Hartford Hospital, Hartford, CT 06102; bGenomas Inc., Hartford, CT 06102; cGenetics Research Center, Hartford Hospital, Hartford, CT 06102; dDepartment of Psychiatry, Beth Israel Deaconess Hospital, Harvard Medical School, Boston, MA 02215; eDepartment of Psychiatry, University of Texas Southwestern Medical Center, Dallas, TX 75390; fDepartment of Psychology, University of Georgia, Athens, GA 30602; gThe Mind Research Network, Albuquerque, NM 87106; Departments of hPsychiatry and jNeurobiology, Yale University, New Haven, CT 06520; and iDepartment of Electrical and Computer Engineering, The University of New Mexico, Albuquerque, NM 87106 Edited by Robert Desimone, Massachusetts Institute of Technology, Cambridge, MA, and approved April 4, 2014 (received for review July 15, 2013) The brain’s default mode network (DMN) is highly heritable and is Although risk for psychotic illnesses is driven in small part by compromised in a variety of psychiatric disorders. However, ge- highly penetrant, often private mutations such as copy number netic control over the DMN in schizophrenia (SZ) and psychotic variants, substantial risk also is likely conferred by multiple genes bipolar disorder (PBP) is largely unknown. Study subjects (n = of small effect sizes interacting together (7). According to the 1,305) underwent a resting-state functional MRI scan and were “common disease common variant” (CDCV) model, one would analyzed by a two-stage approach.