Physiological Roles of Mycothiol in Detoxification and Tolerance to Multiple Poisonous Chemicals in Corynebacterium Glutamicum

Arch Microbiol (2013) 195:419–429 DOI 10.1007/s00203-013-0889-3

ORIGINAL PAPER

Physiological roles of mycothiol in detoxification and tolerance to multiple poisonous chemicals in Corynebacterium glutamicum

Ying‑Bao Liu · Ming‑Xiu Long · Ya‑Jie Yin · Mei‑Ru Si · Lei Zhang · Zhi‑Qiang Lu · Yao Wang · Xi‑Hui Shen

Received: 15 December 2012 / Revised: 31 March 2013 / Accepted: 5 April 2013 / Published online: 25 April 2013 © Springer-Verlag Berlin Heidelberg 2013

Abstract Mycothiol (MSH) plays important roles in withstanding oxidative stress induced by various oxidants maintaining cytosolic redox homeostasis and in adapting in C. glutamicum. This study greatly expanded our current to reactive oxygen species in the high-(G C)-content knowledge on the physiological functions of mycothiol in + Gram-positive Actinobacteria. However, its physiologi- C. glutamicum and could be applied to improve the robust- cal roles are ill defined compared to glutathione, the func- ness of this scientifically and commercially important spe- tional analog of MSH in Gram-negative bacteria and most cies in the future. eukaryotes. In this research, we explored the impact of intracellular MSH on cellular physiology by using MSH- Keywords Corynebacterium glutamicum · Mycothiol · deficient mutants in the model organismCorynebacterium Oxidative stress · Detoxification glutamicum. We found that intracellular MSH contributes significantly to resistance to alkylating agents, glyphosate, ethanol, antibiotics, heavy metals and aromatic com- Introduction pounds. In addition, intracellular MSH is beneficial for Mycothiol (MSH), chemically 1-D-myo-inosityl-2-(N- acetyl-L-cysteinyl)amido-2-deoxy-α-D-glucopyranoside, Communicated by Shuang-Jiang Liu. is the dominant low molecular weight thiol (LMWT) restricted to the high-(G C)-content Gram-positive Act- Ying-Bao Liu and Ming-Xiu Long contributed equally to this work. + inobacteria, a very large and geographically diverse phy- Y.-B. Liu · M.-R. Si · L. Zhang · Y. Wang · X.-H. Shen (*) logenetic clade in the eubacteria, and has been regarded State Key Laboratory of Crop Stress Biology for Arid Areas as a functional equivalent of glutathione found in many and College of Life Sciences, Northwest A&F University, Gram-negative bacteria and most eukaryotes (Jothivasan Yangling 712100, Shaanxi, People’s Republic of China e-mail: [email protected] and Hamilton 2008; Newton et al. 2008). Structurally, mycothiol is an N-acetyl-Cys derivative of the pseudodisac- M.-X. Long charide of myo-inositol and N-glucosamine (Misset et al. College of Animal Science and Technology, Northwest A&F 1997). Mycothiol biosynthetic pathway consists of five University, Yangling 712100, Shaanxi, People’s Republic of China enzymatic steps including a glycosyltransferase (MshA), a phosphatase (MshA2), a deacetylase (MshB), an ATP- Y.-J. Yin dependent ligase (MshC) and an acetyltransferase (MshD) Environmental Microbiology and Ecology Research Center, (Koledin et al. 2002; Newton et al. 2003, 2006; Sareen Chongqing Institute of Green and Intelligent Technology, Chinese Academy of Sciences, Chongqing 401122, et al. 2002). Like glutathione, mycothiol plays major roles People’s Republic of China in protecting the cell against oxidative stress and detoxification of exogenous toxic agents. In mycobacteria where Z.-Q. Lu MSH has been most intensively studied, MSH-deficient College of Plant Protection, Northwest A&F University, Yangling 712100, Shaanxi, mutants exhibit increased sensitivity to oxidative stress, People’s Republic of China alkylating agents and a wide range of antibiotics such as

1 3 420 Arch Microbiol (2013) 195:419–429 erythromycin, vancomycin, azithromycin, penicillin G and industry and bioremediation area for engineering of robust rifampin (Buchmeier and Fahey 2006; Rawat et al. 2002, C. glutamicum strains in the future. 2007). In Streptomyces coelicolor, MSH appears to detoxify a variety of endogenously generated antibiotics and reactive intermediates by converting them to S-conjugates Materials and methods of mycothiol as evidenced by the isolation of mercapturic acids from fermentation broths (Carney et al. 1997). In Bacterial strains and growth conditions Amycolatopsis methanolica and Rhodococcus erythropolis, mycothiol detoxifies formaldehyde by acting as a cofac- Bacterial strains and plasmids used in this study are listed tor for a formaldehyde dehydrogenase, later identified as in Table 1. C. glutamicum and Escherichia coli strains nitrosomycothiol reductase (Eggeling and Sahm 1985; van were cultured in Luria–Bertani (LB) broth aerobically on Ophem et al. 1992; Vogt et al. 2003). However, although a rotary shaker (180 rpm) or on LB plates at 30 and 37 °C, substantial progress has been made in MSH researches in respectively. For generation of mutants and maintenance the last decade, information about the physiological roles of C. glutamicum, brain–heart broth with 0.5 M sorbitol of MSH is still largely lacking when compared to GSH, medium was used. When needed, antibiotics were used at 1 which greatly hampered the understanding of the protec- the following concentrations: chloramphenicol, 20 μg ml− 1 tion mechanisms of MSH in depth. for E. coli and 10 μg ml− for C. glutamicum; kanamycin, 1 1 For this reason, we intensively investigated the physi- 50 μg ml− for E. coli and 25 μg ml− for C. glutamicum; 1 ological functions of MSH by using Corynebacterium nalidixic acid, 30 μg ml− for C. glutamicum. glutamicum as a model organism. C. glutamicum, a soil bacterium of the actinomycetes family widely used for DNA manipulation the industrial production of amino acids and nucleotides, is also one of the most arsenic-resistant microorganisms General DNA manipulations, transformations and aga- described to date (Ordóñez et al. 2005), and its robust abil- rose gel electrophoresis were carried out by using stand- ity to metabolize aromatic compounds has been reported ard molecular techniques. DNA restriction enzymes, ligase previously (Lee et al. 2010; Shen et al. 2005a, b). Feng and DNA polymerase were used as recommended by the et al. (2006) found that mycothiol-deficient mutants lost manufacturer’s instructions (TaKaRa, Dalian, China). The the ability to assimilate several aromatic compounds such total genomic DNA of C. glutamicum was isolated accord- as gentisate and 3-hydroxybenzoate. This interesting ing to the procedure of Tauch et al. (1995). Plasmid DNA discovery led to the identification of a novel mycothiol- was isolated with the plasmid DNA miniprep spin columns dependent maleylpyruvate isomerase which linked the bio- (TIANGEN, Beijing, China), and DNA fragments were synthesis of mycothiol to gentisate and 3-hydroxybenzoate purified from agarose gels by using the EasyPure Quick degradation. More recently, Ordóñez et al. (2009) identi- Gel Extraction Kit (TransGen Biotech, Beijing, China). fied two novel mycothiol-dependent arsenate reductases C. glutamicum were transformed by electroporation from C. glutamicum, which depend for their function on according to the method of Tauch et al. (2002). DNA mycothiol as well as on mycoredoxin. With MSH biosyn- sequencing and primer synthesis were carried out by Inv- thesis pathway mutants, these authors discovered a clear itrogen (Shanghai, China). Primers used in this study are link between the production of mycothiol and the level listed in Table 1. of arsenate resistance (Ordóñez et al. 2009). Reports on MSH-dependent bioremediation open an exciting new area Genetic disruption and complementation in C. glutamicum of MSH research, implicating that MSH may get involved in many unknown physiological processes which remain The plasmid pK18mobsacBΔcopRS used to construct to be uncovered. ΔcopRS deletion mutant of C. glutamicum RES167 was In this study, by using MSH-deficient mutants, we not generated using the gene SOEing method described by only find that intracellular MSH plays important roles in Horton et al. (1989). In the first round of PCR, the 1110- detoxification of alkylating agents, oxidants, antibiotics bp upstream PCR product and 956-bp downstream PCR and aromatic compounds in C. glutamicum, but also dis- product of copRS were amplified using primer pair cover that MSH has clear physiological roles in resistance DcopRF/DcopRR and DcopSF/DcopSR, respectively. The to glyphosate, ethanol and multiple heavy metals, which resulting PCR products were used as template in the second greatly broaden the scope of mycothiol action. In addition, round of PCR with DcopRF and DcopSR as primers. The our insights into the versatile protective roles of MSH in final PCR product was digested with BamHI/EcoRI and C. glutamicum could be applied to the fermentation ligated into similarly digested pK18mobsacB resulting in

1 3 Arch Microbiol (2013) 195:419–429 421

Table 1 Bacterial strains, plasmids and primers used in this study Strain or plasmid Relevant characteristic(s) Source or reference

Strains E.coli JM109 recA1 supE44 endA1 hsdR17 gyrA96 relA1 thi Δ(lac-proAB) Stratagene F′(traD36 proABlacIq lacΔZM15) C. glutamicum RES167 Restriction-deficient mutant of ATCC13032,Δ (cglIM-cglIR-cglIIR) Tauch et al. (2002) RES167ΔmshB mshB deleted in RES167 Feng et al. (2006) RES167ΔmshC mshC deleted in RES167 Feng et al. (2006) RES167ΔmshD mshD deleted in RES167 Feng et al. (2006) RES167ΔcopRS copRS deleted in RES167 This study RES167ΔcopRSΔmshC copRSmshC deleted in RES167 This study RES167ΔcopRSΔmshD copRSmshD deleted in RES167 This study

RES167ΔmshC+ RES167ΔmshC containing pXMJ19-mshC This study

RES167ΔmshD+ RES167ΔmshD containing pXMJ19-mshD This study Plasmids pK18mobsacB Suicide plasmid carrying sacB for selecting double crossover Schäfer et al. (1994) in C. glutamicum, Kmr pK18mobsacBΔcopRS Construct used for in-frame deletion of copRS This study q pXMJ19 Shuttle vector (Ptac lacI pBL1 oriVC. glutamicum pK18 oriVE. coli) Jakoby et al. (1999) pXMJ19-mshC mshC cloned into pXMJ19 for complementation This study pXMJ19-mshD mshD cloned into pXMJ19 for complementation This study Primers This study DcopRF CGCGGATCCCTTCTCGGCCTCATCGGGCAG(BamHI) This study DcopRR GACCTCGGCAGCGATCCGTATC This study DcopSF GATACGGATCGCTGCCGAGGTCGCGGTCAGCCATAGACCCCAG This study DcopSR CAAGAATTCCCGTCCTCGGTGGTGGAGAAC(EcoRI) This study mshCF ACGTCTAGAAAAGGAGGAAACCCATGCAATCTTGGC(XbaI) This study mshCR AGCGGTACCAATGGTCATGAGATGTATTG (KpnI) This study mshDF ACTGTCGACAAAGGAGGAGGGACATGAATACTTCC(SalI) This study mshDR GCATCTAGATTACTTTTCGTAAACTACGTGGC (XbaI) This study Underlined sites indicate restriction enzyme cutting sites added for cloning. Letters in italics denote the annealing regions for gene SOEing PCR. The ribosome binding sites are given in boldface plasmid pK18mobsacBΔcopRS. To construct the ΔcopRS C. glutamicum genome. The PCR product of mshC was in-frame deletion mutant, plasmid pK18mobsacBΔcopRS digested with XbaI/KpnI and inserted into the similar sites was transformed into C. glutamicum RES167 by elec- of pXMJ19 resulting in plasmid pXMJ19-mshC. PCR prod- troporation and chromosomal integration was selected uct of mshD was digested with SalI/XbaI and inserted into by plating on LB agar plates supplemented with kanamy- the similar site of pXMJ19 resulting in plasmid pXMJ19- cin. The C. glutamicum RES167ΔcopRS deletion mutant mshD. To complement the mshC and mshD mutants, com- was subsequently screened on LB agar plates contain- plementary plasmids pXMJ19-mshC and pXMJ19-mshD ing 10 % sucrose and confirmed by PCR and sequenc- were introduced into respective mutants by electropora- ing as previously described (Shen et al. 2005b). The tion and induced by addition of 0.2 mM isopropyl-β-D- RES167ΔcopRSΔmshC and RES167ΔcopRSΔmshD thiogalactopyranoside (IPTG) to the culture broth. double mutant were constructed similarly by electroporat- ing plasmid pK18mobsacBΔcopRS into C. glutamicum Oxidants and alkylating agents susceptibility test RES167ΔmshC and RES167ΔmshD, respectively.

To complement the mshC and mshD mutants, primer Oxidants (H2O2 and diamide) and alkylating agents pairs, mshCF/mshCR and mshDF/mshDR, were used (iodoacetamide, chlorodinitrobenzene, methylglyoxal and to amplify intact mshC and mshD gene fragments from monobromobimane) susceptibility were tested by disk

1 3 422 Arch Microbiol (2013) 195:419–429 diffusion assays (Rawat et al. 2002, 2007) performed as Results follows: A paper disk containing proper doses was placed on each LB plate containing lawns of C. glutamicum MSH‑deficient mutants are more sensitive to alkylating RES167 (wild type), mutants (ΔmshC and ΔmshD) and agents and oxidants complementary strains (ΔmshC+ and ΔmshD+) and incubated at 30 °C until the clear zone was fully formed. Statis- To address the question whether MSH takes part in detoxi- tical analysis was carried out with Student’s t test. fication of alkylating agents and oxidants in C. glutamicum, disk assays were performed to test the sensitivity Antibiotic sensitivity assay of wild type, MSH-deficient mutants (ΔmshB, ΔmshC and ΔmshD) and corresponding complementary strains Antibiotic sensitivity was tested by an agar dilution method (ΔmshC+ and ΔmshD+) to various alkylating agents and (Park and Roe 2008) with minor modifications. The wild oxidants. To thiol alkylating agents (iodoacetamide, chlo- type (WT), MSH-deficient mutants and complementary rodinitrobenzene and monobromobimane), all mutants strains were cultured to an OD600 of 1.8 and spotted (10 μl) showed significantly larger (from 2.0 to 6.5 mm) zones of in serial tenfold dilutions onto LB plates containing proper inhibition compared with those of the WT cells (P < 0.05) antibiotic concentrations. The plates were incubated at (Table 2). And all mutants were also significantly more 30 °C for 2 days and then photographed. sensitive to methylglyoxal, another toxin which is endogenously produced during cellular metabolism. For the

Bacteria growth in aromatic compounds oxidant H2O2, all MSH-deficient mutants examined had significantly larger zones of inhibition compared with Growth curves were measured by determining optical den- those of the WT cells (Table 2). All mutants were also sig- sity at 600 nm or by counting CFU/ml. Overnight cultures nificantly more sensitive to another oxidant, diamide, than of C. glutamicum RES167 wild type, mutants and com- wild type with the exception of ΔmshB, which is still able plementary strains were diluted in 1:100 in fresh mineral to produce MSH in a very low level (Feng et al. 2006). To salts medium supplemented with different aromatic com- confirm that the susceptibility to alkylating and oxidating pounds as sole source of carbon and energy (Shen et al. agents is attributed to the absence of MSH, complementa- 2005a). Cultures were incubated at 30 °C with agitation at tion experiments were performed. ΔmshC and ΔmshD, 180 rpm. Appropriate volumes of the culture were asepti- two mutants that completely lost the ability to synthe- cally withdrawn for determining the OD600 value or the sis MSH (Feng et al. 2006), were complemented with the colony-forming units (CFUs) at indicated time points. The corresponding genes. As shown in Table 2, ΔmshC+ and colony-forming units were determined by using serial dilu- ΔmshD+, the corresponding complementary strains con- tions in triplicate on LB agar plates. After 36 h, the num- taining the C. glutamicum mshC and mshD genes provided bers of colonies were counted and the log10 CFU/ml was by plasmid pXMJ19 in trans, respectively, fully or at least calculated to obtain the growth curve. partially complemented the growth defect of the MSH-deficient mutants under various alkylating agents and oxidants Heavy metal, glyphosate and ethanol stress stress. However, there was no marked sensitivity differ- ence observed between the MSH-deficient mutants and the Heavy metal and pesticide stress experiments were per- wild type for the reductant DTT. Collectively, these results formed according to Helbig et al. (2008) with minor modi- indicate that MSH is required for alkylating agents and oxi- fications as follows: Overnight cultures of C. glutamicum dants resistance in C. glutamicum. RES167 wild type, mutants and complementary strains were diluted in 1:100 in fresh LB medium with differ- MSH‑deficient mutants are more sensitive to antibiotics ent concentrations of various heavy metals or glyphosate and cultivated for over 24 h with shaking at 30 °C. Cel- We next examined the sensitivity of C. glutamicum wild lular growth was monitored by determining optical density type (WT), MSH-deficient mutants (ΔmshC and ΔmshD) at 600 nm. To observe the sensitivity of C. glutamicum and corresponding complementary strains (ΔmshC+ and strains to ethanol, the ethanol was added in LB media that ΔmshD+) to multiple antibiotics including erythromycin, contains cells of late exponential stage to make final con- streptomycin, spectinomycin, neomycin and gentamycin by centrations 10 and 15 % (v/v) in test tubes. After incuba- an agar dilution method. As shown in Fig. 1a, both MSH- tion at 30 °C and 180 rpm for 2 h, the survival rates of deficient mutants are more sensitive to erythromycin than cells were calculated by dividing the number of CFU of the wild type at the concentration of 6 μg/ml. Sensitivity stressed cells by the number of CFU of cells before stress of MSH-deficient mutants to erythromycin has also been exposure. reported in Mycobacterium smegmatis previously (Rawat

1 3 Arch Microbiol (2013) 195:419–429 423

Table 2 Sensitivity of MSH-deficient mutants to alkylating agents and oxidants Zone of clearing (diameter [mm]) of various strainsa

Wild-type ΔmshB ΔmshC ΔmshD ΔmshC+ ΔmshD+

Alkylating agents(μmol) Iodoacetamide (0.2) 30.3 0.3 32.3 0.6** 34.8 1** 35.3 0.1** 32.0 0.5* 30.7 0.2** ± ± ± ± ± ± CDNB (1.0) 12.0 0.5 16.0 0.4** 17.7 0.5** 14.5 0.7* 13.0 0.2** 13.7 0.1** ± ± ± ± ± ± Methylglyoxal (2.0) 40.0 0.2 45.5 1** 46.5 0.3** 42.3 0.3* 38.5 0.3** 37.5 0** ± ± ± ± ± ± mBBr (0.22) 14.2 0.3 19.0 0** 19.0 0.2** 18.3 0.7** 16.3 0.2* 13.8 0.1** ± ± ± ± ± ± Oxidants(μmol) H O (2.0) 14.5 1 23.5 0.3** 18.2 0** 18.5 0** 15.0 0.4** 12.8 0.2** 2 2 ± ± ± ± ± ± Diamide (20) 20.0 0 20.7 0.1 24.5 0.1** 24.0 0.1** 23.1 0.5* 21.5 0.2* ± ± ± ± ± ± Reductant (μmol) DTT(10) 19.0 0 19.5 0.2 19 0 19.5 0.3 18.5 0 19 0.2 ± ± ± ± ± ± CDNB chlorodinitrobenzene, mBBr monobromobimane * P 0.05 or ** P 0.01 versus wild type for the mutants and versus corresponding mutants for the complementary strains ≤ ≤ a The values are mean SD for three independent determinations ±

Fig. 1 Sensitivity of the MSH- deficient mutants to antibiotics. Serially diluted cultures from the wild-type strain, MSH- deficient mutants and complementary strains were spotted on LB plates containing different antibiotics at indicated concentrations and incubated at 30 °C for 2 days

et al. 2002, 2007). There also appeared a marked differ- mshC/mshD is strongly linked to the sensitivity increase of ence of sensitivity of the MSH-deficient mutants to the the mutant (Fig. 1b–e). The only exception is neomycin, aminoglycoside class of antibiotics, streptomycin (0.5 μg/ to which the ΔmshD mutant showed very less sensitivity ml), spectinomycin (24 μg/ml), neomycin (0.09 μg/ml) compared to that of the ΔmshC mutant (Fig. 1c). No dif- and gentamycin (0.16 μg/ml), as compared to the wild ference was shown in the sensitivity to penicillin between type. For all five antibiotics, the sensitivity of the mutants MSH-deficient mutants and the wild-type strain (Fig. 1f), was rescued by complementarily overexpressing corre- as was consistent with previous observations in M. smeg- sponding gene, mshC or mshD, indicating that the lack of matis (Rawat et al. 2007).

1 3 424 Arch Microbiol (2013) 195:419–429

MSH and glyphosate toxicity et al. 2010). Since MSH acts as a functional analog of glutathione, we hypothesized that MSH may contribute to the As previous studies have shown that GSH is involved in protection of ethanol stress in C. glutamicum. The role of glyphosate detoxification in multiple eukaryotes (Ahsan MSH in protecting C. glutamicum against ethanol stress et al. 2008; Gehin et al. 2006; Romero et al. 2011), we were was assessed by comparing the viability of the MSH-defi- prompted to examine whether MSH plays a role in protecting cient mutants (ΔmshC and ΔmshD) with that of the wild- the soil bacterium C. glutamicum from glyphosate. To evalu- type strain, following exposure to 10 and 15 % ethanol. In ate the potential protective function of MSH, we assessed the both concentrations, the MSH-deficient mutants Δ( mshC growth of C. glutamicum wild type, ΔmshC and ΔmshC+ and ΔmshD) showed decreased viability than the wild-type cells in LB in the presence of glyphosate. The ΔmshC mutant strain. The survival rates of ΔmshC decreased by 18 and showed significant decrease in glyphosate resistance com- 12 %, and the ΔmshD mutant decreased by 40 and 25 %, pared to that of the wild type between the concentration of compared to the WT strain grown in 10 or 15 % ethanol, 2.4 and 4.8 mM, with the growth yield decreased around 15– respectively. However, the growth defects were com- 30 % over that of the WT strain. The growth defect was par- pletely restored in the complementary strains ΔmshC+ and tially restored in the complementary strain ΔmshC+ which ΔmshD+ (Fig. 3). These data suggest that MSH contrib- was supplied with the mshC gene in trans on the plasmid utes to survival of C. glutamicum cells under ethanol stress pXMJ19 (Fig. 2a). Similar results were observed by using the condition. MSH-deficient mutant ΔmshD and its complementary strain ΔmshD+ (Fig. 2b). Thus, MSH appears to be required for MSH and heavy metal stress protection of C. glutamicum against glyphosate toxicity. Recently, Helbig et al. (2008) reported that GSH is MSH and ethanol stress involved in Cr(VI), Zn(II), Cd(II) and Cu(II) homeostasis and resistance in E. coli. To determine whether MSH A recent study has shown that glutathione plays an impor- also plays a direct role in protecting C. glutamicum from tant role in protecting yeast from ethanol stress (Saharan heavy metals, the wild type, the MSH-deficient mutants

Fig. 2 Effects of deletion of mshC (a) and mshD (b) genes on centrations of glyphosate and cultivated for over 18 h with shaking glyphosate resistance. Overnight cultures of C. glutamicum RES167 at 30 °C. Mean values with standard deviations (error bars) from at wild type (WT), MSH-deficient mutants and complementary strains least three repeats are shown were diluted in 1:100 in fresh LB medium containing different con-

Fig. 3 Effects of deletion of mshC (a) and mshD (b) genes on ethanol resistance. Mean values with standard deviations (error bars) from at least three repeats are shown. ** P 0.01 ≤

1 3 Arch Microbiol (2013) 195:419–429 425

Fig. 4 Effects of deletion of mshC and mshD genes on heavy metal recorded. f Dose–response curves were recorded for the ΔcopRS resistance. a–e Dose–response curves for the C. glutamicum wild mutant, ΔcopRSΔmshC and ΔcopRSΔmshD double mutants over type (WT), MSH-deficient mutants and complementary strains over 16 h at 30 °C in LB medium containing increasing concentrations of 16 h at 30 °C in LB medium containing increasing concentrations CuSO4. Mean values with standard deviations (error bars) from at of CdCl2 (a), CoCl2 (b), ZnSO4 (c), MnCl2 (d) and K2CrO4 (e) were least three repeats are shown

(ΔmshC and ΔmshD) and corresponding complementary led to a significant decrease in copper resistance (Fig. 4f). strains (ΔmshC+ and ΔmshD+) were tested for growth in Thus, MSH seemed to be important for copper resistance LB medium containing various concentrations of heavy in C. glutamicum when the cells were unable to detoxify metals. In the presence of Cd(II), both mutants were less cytoplasmic copper by the CopRS-regulated detoxification metal resistant than the wild-type strain, and the pheno- genes. Collectively, these results confirmed the assump- type could be complemented by a plasmid harboring the tion that MSH is involved in heavy metal resistance in mshC or mshD gene, respectively (Fig. 4a). A markedly C. glutamicum. inhibited growth to the ΔmshC but not the ΔmshD mutant was also observed for other heavy metal ions including MSH is necessary to naphthalene and resorcinol Zn(II), Co(II), Mn(II) and Cr(VI) (Fig. 4b–e), implying that degradation other thiol derivatives produced in the mshD mutant may substitute for MSH function in these cases as proposed in Previously, we found that MSH synthesis is essential for M. smegmatis (Newton et al.2005). However, there was no degradation of mono-cyclic aromatic compounds, genti- effect of the MSH-deficient mutants on resistance to Pb(II), sate and 3-hydroxybenzoate, by acting as a cofactor for a Fe(II) or Cu(II), either in dose–response experiments per- MSH-dependent maleylpyruvate isomerase, one of the key formed with LB medium or in time-dependent growth enzymes in the gentisate ring-cleavage pathway in C. glu- experiments (data not shown). tamicum (Shen et al. 2005b). To further test whether MSH A recent study suggested that the two-component signal is involved in the degradation of other aromatic compounds transduction system CopRS is the key regulatory system in C. glutamicum, growth curves of C. glutamicum wild for copper ion resistance in C. glutamicum (Schelder et al. type, MSH-deficient mutants and corresponding comple- 2011). The CopRS signal transduction system composed mentary strains were determined in mineral salts medium of the histidine kinase CopS and the response regulator supplemented with different aromatic compounds as the CopR, which senses extracytoplasmic copper ion concen- sole source of carbon and energy. As shown in Fig. 5, the trations and induces the expression of multiple genes capa- growth of MSH-deficient mutants on naphthalene and ble of diminishing copper stress. The deletion of copRS resorcinol was significantly impaired, but the growth on led to decreased copper resistance, as expected. In a copRS 4-cresol, 4-hydroxybenzoate, vanillin and ferulate was not mutant background, the further deletion of mshC or mshD affected (data not shown). Complementation of the ΔmshC

1 3 426 Arch Microbiol (2013) 195:419–429

Fig. 5 Growth of C. glutamicum RES167 wild type (WT), MSH-deficient mutants and complementary strains in mineral salts medium with naphthalene (4 mM, a and c) and resorcinol (12 mM, b and d) as sole carbon and energy source. Mean values with standard deviations (error bars) from at least three repeats are shown

and ΔmshD mutants with mshC and mshD, respectively, Accumulating evidence has indicated that GSH provides completely or partially restored the growth on resorcinol protection against deleterious metal-mediated free radical and naphthalene (Fig. 5). Based on these results, it is clear attacks in both eukaryotes and Gram-negative bacteria. In that MSH synthesis is important to the detoxification of Saccharomyces cerevisiae, cadmium is an oxidative stress naphthalene and resorcinol in C. glutamicum. inducer and GSH is essential for full cadmium resistance (Gharieb and Gadd 2004). In E. coli, GSH was reported to be involved in Cr(VI), Zn(II), Cd(II) and Cu(II) homeosta- Discussion sis and resistance (Helbig et al. 2008). In contrast, little is known about the role of MSH in interplay of heavy metals As the major nonenzymatic antioxidants in living cells, in Gram-positive bacteria, except the fact that MSH influ- low molecular weight thiols GSH and MSH are important ences arsenite resistance by making a MSH-S-conjugate for the survival of organisms under various environmental catalyzed by the mycothiol-dependent arsenate reductases stresses by its roles in antioxidant defense and detoxifica- in C. glutamicum (Ordóñez et al. 2009; Villadangos et al. tion (Jothivasan and Hamilton 2008; Jozefczak et al. 2012; 2011). In addition, a recent proteome analysis of the cad- Newton et al. 2008; Zhang and Forman 2012). While the mium response in C. glutamicum identified the significant versatile physiological functions of GSH, the main LMWT upregulation of a mycothiol disulfide reductase (NCgl1928, in eukaryotes and Gram-negative bacteria have been exten- formerly annotated as a putative glutathione reductase) as sively studied, little is known about the physiological role well as some other antioxidative enzymes such as thiore- of MSH, the dominant LMWT in the high-(G C)-content doxin reductase and superoxide dismutase (Fanous et al. + Gram-positive Actinobacteria. In this study, we utilized 2008), implicating that MSH may also be involved in cad- MSH-deficient mutants and their corresponding comple- mium resistance in C. glutamicum. In this study, by using mentation strains to investigate the physiological functions MSH-deficient mutants, we further confirmed that MSH of MSH in the model organism C. glutamicum. Our findings plays important roles in resistance to a broad range of met- confirmed that MSH in C. glutamicum also plays important als such as Cr(VI), Zn(II), Cd(II), Co(II) and Mn(II). How- roles in detoxification of alkylating agents, oxidants and ever, no resistance to copper was observed in msh mutants antibiotics and has a clear physiological role in resistance to initially. Interestingly, the further deletion of mshC or ethanol, glyphosate and multiple heavy metals. mshD in a ΔcopRS mutant background led to a significant

1 3 Arch Microbiol (2013) 195:419–429 427 decrease in copper resistance (Fig. 4f). Thus, in this case, compounds may require specific enzymes to promote acti- the copRS-regulated genes complemented the absence vation of the toxin or to catalyze its reaction with MSH of MSH and their detoxification activities were sufficient (Rawat et al. 2002). It is well known that the GSH-depend- to prevent the copper toxicity in C. glutamicum. A simi- ent detoxification system utilizes glutathione-S-transferases lar phenomenon has also been observed in E. coli (Helbig (GST) to conjugate the GSH to a toxin through the sulfur et al. 2008). The absence of GSH in E. coli had no effect group of GSH, forming an S-conjugate. Then, the S-con- on copper resistance in wild-type cells, but the absence of jugate is excreted into the medium by a specific transport GSH in the copA gene (encoding a P-type ATPase efflux system (Jozefczak et al. 2012; Zhang and Forman 2012). system for Cu+) disrupted background clearly decreased As parallel to GSH chemistry, MSH-S-toxin conjugates copper resistance (Helbig et al. 2008). Interestingly, dif- formed with reactive xenobiotics have been identified in ferent effects on resistance to Zn(II), Co(II), Mn(II) and mycobacteria and presumably in other MSH-containing Cr(VI) were observed for the ΔmshC and ΔmshD mutants actinomycetes. The conjugation reaction was proposed to (Fig. 4b–e). However, these results are consistent with an be mediated by a GST-like enzyme (e.g., MSH-S-trans- early report that N-formyl-Cys-GlcN-Ins and N-succinyl- ferase) that uses MSH as a co-substrate. A mycothiol Cys-GlcN-Ins, two novel thiols that produced in mshD S-transferase (MST) belonging to the DinB superfamily mutated M. smegmatis, may function as a substitute for has recently been identified in theM. smegmatis and Myco- MSH in this MSH-deficient mutant (Newton et al. 2005). bacterium tuberculosis (Newton et al. 2011). Although the It is possible that the novel thiols produced in the mshD role of MST in detoxification has not been reported, MSH- mutant may sufficient to cope with some of the heavy metal S-conjugate amidase (Mca), another enzyme that plays an stress in C. glutamicum. important role in MSH-dependent detoxification, has pre- One of the main protective roles of MSH against toxins viously been identified in Mycobacteria and Streptomy- is correlated with its ability to scavenge free radicals. A cete (Newton et al. 2000; Park and Roe 2008). The Mca great numbers of researches have presented that the expo- catalyzes the cleavage of an amide bond of the S-conjugate sure of microorganisms to various stresses such as heavy to yield a mercapturic acid derivative, AcCys-R, and glu- metals, antibiotics, xenobiotics, acid or salt stress can cosaminylinositol, GlcN-Ins, which is recycled back to increase the production of reactive oxygen species (ROS) mycothiol. Several MSH conjugates of antibiotics have and then induce oxidative stress. Kohanski et al. (2007) been identified as Mca substrates (Newton et al. 2000). reported that bactericidal antibiotics stimulate the forma- Thus, it is not surprising to speculate that MSH may also tion of ROS, such as the highly toxic hydroxyl radicals be involved in metal ions and glyphosate detoxification (OH ), in Gram-negative and Gram-positive bacteria, which by forming MSH-S-toxin conjugates. Indeed, arsenic has · ultimately contributes to cell death. Disruption of metal recently been reported to make a MSH-S-conjugate by the ion homeostasis also leads to oxidative stress, in which catalyzing of the mycothiol-dependent arsenate reductases the increased generation of reactive oxygen and nitrogen that mechanistically function as MSH-S-transferases in C. species causes DNA damage, lipid peroxidation, protein glutamicum (Ordóñez et al. 2009; Villadangos et al. 2011). modification and other effects (Jomova and Valko2011 ; The third protective mechanism of MSH in xenobiot- Valko et al. 2005). Induction of oxidative stress by glypho- ics detoxification is functioning as cofactors for meta- sate and ethanol has also been reported in plants, animals bolic enzymes. This was supported by the identification and microorganisms (Ahsan et al. 2008; Gehin et al. 2006; of the MSH-dependent formaldehyde dehydrogenase in R. Saharan et al. 2010; Romero et al. 2011). Microorganisms erythropolis and A. methanolica, and the MSH-dependent employ a battery of enzymatic and nonenzymatic antioxi- arsenate reductase in C. glutamicum, which are involved dants to cope with continuous ROS production. GSH is a in detoxification of formaldehyde and arsenate, respec- key nonenzymatic antioxidant with a significant function in tively (Eggeling and Sahm 1985; Ordóñez et al. 2009; van ROS scavenging by donating a reducing electron directly Ophem et al. 1992). MSH was also reported to be essential to ROS (Jozefczak et al. 2012; Zhang and Forman 2012). for degradation of mono-cyclic aromatic compounds gen- Similarly, as the main nonenzymatic antioxidant in C. tisate and 3-hydroxybenzoate by acting as a cofactor for a glutamicum, MSH may also provide defense against vari- MSH-dependent maleylpyruvate isomerase, one of the key ous toxins by its ability to scavenge free radicals. Further enzymes in the gentisate ring-cleavage pathway in C. glu- experimental investigations are needed to assess the free tamicum (Shen et al. 2005b; Feng et al. 2006). In this study, radicals scavenging capacity of MSH in the future. we further found that MSH synthesis was also impor- The second protective mechanism of MSH is the for- tant for the degradation of naphthalene and resorcinol in mation of S-conjugate for direct detoxification of alkylat- C. glutamicum (Fig. 5). Naphthalene is catabolized through ing agents, antibiotics and xenobiotics. Highly reactive cis naphthalene dihydrodiol, salicylaldehyde and salicy- toxins may react directly with MSH, whereas less reactive late. The latter is converted into either catechol, which is

1 3 428 Arch Microbiol (2013) 195:419–429 then degraded by either the meta or the ortho cleavage Belchik SM, Xun L (2011) S-glutathionyl-(chloro)hydroquinone pathways to TCA cycle intermediates (Barnsley 1976), reductases: a new class of glutathione transferases functioning as oxidoreductases. Drug Metab Rev 43:307–316 or gentisate, which is degraded by a different pathway to Buchmeier N, Fahey RC (2006) The mshA gene encoding the glyco- TCA cycle intermediates (Fuenmayor et al. 1998). It was syltransferase of mycothiol biosynthesis is essential in Mycobac- previously reported that GSH is involved in naphthalene terium tuberculosis Erdman. FEMS Microbiol Lett 264:74–79 catabolism by acting as a cofactor for 2-hydroxychromene- Carney JR, Hong ST, Gould SJ (1997) Seongomycin: a new sulfur containing benzo[b]fluorene derived from genes clustered with 2-carboxylic acid (HCCA) isomerase, the fourth enzyme of those for kinamycin biosynthesis. Tetrahedron Lett 38:3139–3142 naphthalene degradation pathway that catalyzes cis–trans Eggeling L, Sahm H (1985) The formaldehyde dehydrogenase of isomerization between HCCA and trans-o-hydroxyben- Rhodococcus erythropolis, a trimeric enzyme requiring a cofactor zylidene pyruvic acid (Thompson et al. 2007). This finding and active with alcohols. Eur J Biochem 150:129–134 Fanous A, Weiss W, Görg A, Jacob F, Parlar H (2008) A proteome suggests that MSH may also acts as a cofactor for HCCA analysis of the cadmium and mercury response in Corynebacte- isomerase in naphthalene degradation in C. glutamicum. rium glutamicum. Proteomics 8:4976–4986 C. glutamicum degrades resorcinol with hydroxyhydroqui- Feng J, Che Y, Milse J, Yin YJ, Liu L, Ruckert C, Shen XH, Qi SW, none as metabolic intermediate (Shen et al. 2005a, 2012). Kalinowski J, Liu SJ (2006) The gene ncgl2918 encodes a novel maleylpyruvate isomerase that needs mycothiol as cofactor Hydroquinones can be readily oxidized to the correspond- and links mycothiol biosynthesis and gentisate assimilation in ing benzoquinones and further react with GSH to form Corynebacterium glutamicum. J Biol Chem 281:10778–10785 GS-hydroquinones. Both benzoquinones and GS-hydroqui- Fuenmayor SL, Wild M, Boyes AL, Williams PA (1998) A gene clus- nones are toxic to the cell, and a new class of glutathione ter encoding steps in conversion of naphthalene to gentisate in Pseudomonas sp. strain U2. J Bacteriol 9:2522–2530 transferase, S-Glutathionyl-hydroquinone reductase (GS- Gehin A, Guyon C, Nicod L (2006) Glyphosate-induced antioxidant HQR), was recently reported to convert GS-hydroquinones imbalance in HaCaT: the protective effect of vitamins C and E. back to hydroquinones, which can be further metabolized, Environ Toxicol Phar 22:27–34 thus minimizing the toxicity of benzoquinones and GS- Gharieb MM, Gadd GM (2004) Role of glutathione in detoxification of metal(loid)s by Saccharomyces cerevisiae. Biometals 17:183–188 hydroquinones (Belchik and Xun 2011). The finding of the Helbig K, Bleuel C, Krauss GJ, Nies DH (2008) Glutathione and GS-HQR implicates the possible existence of a MS-HQR transition-metal homeostasis in Escherichia coli. J Bacteriol in C. glutamicum which remained to be investigated in the 190:5431–5438 future. Horton RM, Hunt HD, Ho SN, Pullen JK, Pease LR (1989) Engineer- ing hybrid genes without the use of restriction enzymes: gene In conclusion, this study showed that intracellu- splicing by overlap extension. Gene 77:61–68 lar MSH plays important roles in the detoxification of Jakoby M, Ngouoto-Nkili CE, Burkovski A (1999) Construction and alkylating agents, antibiotics, glyphosate, ethanol, heavy application of new Corynebacterium glutamicum vectors. Bio- metals and aromatic compounds in C. glutamicum. In technol Techniques 13:437–441 Jomova K, Valko M (2011) Advances in metal-induced oxidative addition, intracellular MSH is also beneficial for with- stress and human disease. Toxicology 283:65–87 standing oxidative stress induced by various oxidants. Jothivasan VK, Hamilton CJ (2008) Mycothiol: synthesis, biosynthe- These data has not only greatly improved our knowledge sis and biological functions of the major low molecular weight of the physiological roles of MSH in Actinobacteria, but thiol in actinomycetes. Nat Prod Rep 25:1091–1117 Jozefczak M, Remans T, Vangronsveld J, Cuypers A (2012) Glu- also paved the way to explore the individual detoxifica- tathione is a key player in metal-induced oxidative stress tion mechanisms involved for each class of toxin, which defenses. Int J Mol Sci 13:3145–3175 could be applied to the fermentation industry and biore- Kohanski MA, Dwyer DJ, Hayete B, Lawrence A, Collins JJ (2007) mediation area for engineering of robust C. glutamicum A common mechanism of cellular death induced by bactericidal antibiotics. Cell 130:797–810 strains in the future. Koledin T, Newton GL, Fahey RC (2002) Identification of the mycothiol synthase gene (mshD) encoding the acetyltransferase pro- Acknowledgments This work was supported by the National ducing mycothiol in actinomycetes. Arch Microbiol 178:331–337 Natural Science Foundation of China (Nos. 31170121, 31170100 Lee SY, Kim BN, Han JH, Chang ST, Choi YW, Kim YH, Min J and 31270078) and the Opening Project of State Key Laboratory of (2010) Treatment of phenol-contaminated soil by Corynebac- Microbial Resource, Institute of Microbiology, Chinese Academy of terium glutamicum and toxicity removal evaluation. J Hazard Sciences (No. SKLMR-20120601). Mater 182:937–940 Misset SM, van Ophem PW, Sakuda S, Duine JA (1997) Myco- thiol, 1-O-(2′-[N-acetyl-L-cysteinyl]amido-2′-deoxy-α-D- glucopyranosyl)-D-myo-inositol, is the factor of NAD/factor- References dependent formaldehyde dehydrogenase. FEBS Lett 409:21–222 Newton GL, Av-Gay Y, Fahey RC (2000) A novel mycothiol-depend- Ahsan N, Lee DG, Lee KW, Alam I, Lee SH, Bahk JD, Lee BH (2008) ent detoxification pathway in mycobacteria involving mycothiol Glyphosate-induced oxidative stress in rice leaves revealed by S-conjugate amidase. Biochemistry 39:10739–10746 proteomic approach. Plant Physiol Biochem 46:1062–1070 Newton GL, Koledin T, Gorovitz B, Rawat M, Fahey RC, Av-Gay Y Barnsley EA (1976) Role and regulation of the ortho and meta path- (2003) The glycosyltransferase gene encoding the enzyme cata- ways of catechol metabolism in pseudomonads metabolizing lyzing the first step of mycothiol biosynthesis (mshA). Bacteriol naphthalene and salicylate. J Bacteriol 125:404–408 185:3476–3479

1 3 Arch Microbiol (2013) 195:419–429 429

Newton GL, Ta P, Fahey RC (2005) A mycothiol synthase mutant Schelder S, Zaade D, Litsanov B, Bott M, Brocker M (2011) The of Mycobacterium smegmatis produces novel thiols and has an two-component signal transduction system CopRS of Corynebac- altered thiol redox status. J Bacteriol 187:7309–7316 terium glutamicum is required for adaptation to copper-excess Newton GL, Ko M, Ta P, Av-Gay Y, Fahey RC (2006) Purification and stress. PLoS ONE 6:e22143 characterization of Mycobacterium tuberculosis 1d-myo-inosityl- Shen XH, Huang Y, Liu SJ (2005a) Genomic analysis and iden- 2-acetamido-2-deoxy-alpha-d- glucopyranoside deacetylase, tification of catabolic pathways for aromatic compounds in MshB, a mycothiol biosynthetic enzyme. Protein Expres Purif Corynebacterium glutamicum. Microbes Environ 20:160–167 47:542–550 Shen XH, Jiang CY, Huang Y, Liu ZP, Liu SJ (2005b) Functional Newton GL, Buchmeier N, Fahey RC (2008) Biosynthesis and func- identification of novel genes involved in the glutathione-inde- tions of mycothiol, the unique protective thiol of Actinobacteria. pendent gentisate pathway in Corynebacterium glutamicum. Appl Microbiol Mol Biol Rev 72:471–494 Environ Microbiol 71:3442–3452 Newton GL, Leung SS, Wakabayashi JI, Rawat M, Fahey RC (2011) Shen XH, Zhou NY, Liu SJ (2012) Degradation and assimilation of The DinB superfamily includes novel mycothiol, bacillithiol, and aromatic compounds by Corynebacterium glutamicum: another glutathione S-transferases. Biochemistry 50:10751–10760 potential for applications for this bacterium? Appl Microbiol Bio- Ordóñez E, Letek M, Valbuena N, Gil JA, Mateos LM (2005) Analy- technol 95:77–89 sis of genes involved in arsenic resistance in Corynebacterium Tauch A, Kassing F, Kalinowski J, Pühler A (1995) The Corynebacte- glutamicum ATCC 13032. Appl Environ Microb 71:6206–6215 rium xerosis composite transposon Tn5432 consists of two identi- Ordóñez E, Van Belle K, Roos G, De Galan S, Letek M, Gil JA, Wyns cal insertion sequences, designated IS1249, flanking the erythro- L, Mateos LM, Messens J (2009) Arsenate reductase, mycothiol, mycin resistance gene ermCX. Plasmid 34:119–131 and mycoredoxin concert thiol/disulfide exchange. J Biol Chem Tauch A, Kirchner O, Löffler B, Götker S, Pühler A, Kalinowski J 284:15107–15116 (2002) Efficient electrotransformation of Corynebacterium diph- Park JH, Roe JH (2008) Mycothiol regulates and is regulated by a theriae with a mini-replicon derived from the Corynebacterium thiol-specific antisigma factor RsrA and σR in Streptomyces coeli- glutamicum plasmid pGA1. Curr Microbiol 45:362–367 color. Mol Microbiol 68:861–870 Thompson LC, Ladner JE, Codreanu SG, Harp J, Gilliland GL, Arm- Rawat M, Newton GL, Ko M, Martinez GJ, Fahey RC, Av-Gay Y strong RN (2007) 2-Hydroxychromene-2-carboxylic acid isomer- (2002) Mycothiol-deficient Mycobacterium smegmatis mutants ase: a kappa class glutathione transferase from Pseudomonas are hypersensitive to alkylating agents, free radicals, and antibiot- putida. Biochemistry 46:6710–6722 ics. Antimicrob Agents Chemother 46:3348–3355 Valko M, Morris H, Cronin MT (2005) Metals, toxicity and oxidative Rawat M, Johnson C, Cadiz V, Av-Gay Y (2007) Comparative analysis stress. Curr Med Chem 12:1161–1208 of mutants in the mycothiol biosynthesis pathway in Mycobacte- Van Ophem PW, van Beeumen J, Duine JA (1992) NAD-linked, rium smegmatis. Biochem Biophys Res Commun 363:71–76 factor-dependent formaldehyde dehydrogenase or trimeric, zinc- Romero DM, Rios de Molina MC, Juarez AB (2011) Oxidative stress containing, long-chain alcohol dehydrogenase from Amycolatop- induced by a commercial glyphosate formulation in a tolerant sis methanolica. Eur J Biochem 206:511–518 strain of Chlorella kessleri. Ecotox Environ Safe 74:741–747 Villadangos AF, Van Belle K, Wahni K, Tamu Dufe V, Freita S, Nur Saharan RK, Kanwal S, Sharma SC (2010) Role of glutathione in eth- H, De Galan S, Gil JA, Collet JF, Mateos LM, Messens J (2011) anol stress tolerance in yeast Pachysolen tannophilus. Biochem Corynebacterium glutamicum survives arsenic stress with arse- Biophys Res Commun 397:307–310 nate reductases coupled to two distinct redox mechanisms. Mol Sareen D, Steffek M, Newton GL, Fahey RC (2002) ATP-depend- Microbiol 82:998–1014 ent l-cysteine:1D-myo-inosityl-2-amino-2-deoxy-alpha-D- Vogt RN, Steenkamp DJ, Zheng R, Blanchard JS (2003) The metab- glucopyranoside ligase, mycothiol biosynthesis enzyme MshC, olism of nitrosothiols in the mycobacteria: identification and is related to class I cysteinyl-tRNA synthetases. Biochemistry characterization of S-nitrosomycothiol reductase. J Biochem 41:6885–6890 374:657–666 Schäfer A, Tauch A, Jager W, Kalinowshi J, Thierbach G, Pühler A Zhang H, Forman HJ (2012) Glutathione synthesis and its role in (1994) Small mobilizable multi-purpose cloning vectors derived redox signaling. Semin Cell Dev Biol 23:722–728 from the Escherichia coli plasmids pK18 and pK19: selection of defined deletions in the chromosome ofCorynebacterium glutamicum. Gene 145:69–73

1 3