Multilocus Sequence Analysis of Root Nodule Bacteria Associated with Lupinus Spp

Home , Sphaerophysa salsula

Advances in Microbiology, 2017, 7, 790-812 http://www.scirp.org/journal/aim ISSN Online: 2165-3410 ISSN Print: 2165-3402

Multilocus Sequence Analysis of Root Nodule Bacteria Associated with Lupinus spp. and Glycine max

Dilshan H. Beligala, Helen J. Michaels, Michael Devries, Vipaporn Phuntumart*

Department of Biological Sciences, Bowling Green State University, Bowling Green, OH, USA

How to cite this paper: Beligala, D.H., Abstract Michaels, H.J., Devries, M. and Phuntu- mart, V. (2017) Multilocus Sequence Anal- Lupinus is known to form endophytic associations with both nodulating and ysis of Root Nodule Bacteria Associated non-nodulating bacteria. In this study, multilocus sequence analysis (MLSA) with Lupinus spp. and Glycine max. Ad- was used to analyze phylogenetic relationships among root nodule bacteria vances in Microbiology, 7, 790-812. associated with Lupinus and soybean. Out of 17bacterial strains analyzed, 13 https://doi.org/10.4236/aim.2017.711063 strains isolated from root nodules of Lupinus spp. were obtained from the Na- Received: October 27, 2017 tional Rhizobium Germplasm Resource Collection, USDA. Additionally, two Accepted: November 27, 2017 strains of root-nodule bacteria isolated each from native Lupinus and domes- Published: November 30, 2017 tic soybean were examined. Sequences of the 16S rRNA gene and three

Copyright © 2017 by authors and housekeeping genes (atpD, dnaK and glnII) were used. All the reference genes Scientific Research Publishing Inc. were retrieved from the existing complete genome sequences only. The clus- This work is licensed under the Creative tering of 12 of the strains was consistent among single and concatenated gene Commons Attribution International trees, but not USDA strains 3044, 3048, 3504, 3715, and 3060. According to License (CC BY 4.0). the concatenated phylogeny, we suggest that USDA 3040, 3042, 3044, 3048, http://creativecommons.org/licenses/by/4.0/ Open Access 3051, 3060, 3504, 3709 and 3715 are Bradyrhizobium, USDA 3063 and 3717 are Mesorhizobium, USDA 3043 is Burkholderia and USDA 3057a is Micro- virga. The two strains isolated from native lupines in this study are Burkhol- deria and Rhizobium, whereas the two from domestic soybean are Bradyrhi- zobium. This study emphasizes the robustness of MLSA, the diversity of bacterial species that are capable of nodulating lupine and the substantial capabil- ity of Burkholderia spp. to colonize lupine root nodules.

Keywords Multilocus Sequence Analysis, Nodule Bacteria, Phylogeny, Lupinus, Burkholderia

1. Introduction

The plant family Fabaceae or Leguminosae is considered the third largest family

DOI: 10.4236/aim.2017.711063 Nov. 30, 2017 790 Advances in Microbiology

D. H. Beligala et al.

of flowering plants and is well known for its important ecological function in fixing atmospheric nitrogen. It is comprised of three subfamilies Caesalpinioi- deae, Mimosoideae and Faboideae. Within the Genisteae tribe of the legume subfamily Faboideae, the genus Lupinus or lupine encompasses more than 280 species of annual herbs and perennial herbaceous and woody shrubs distributed mainly in South and Western North America, the Andes, the Mediterranean regions and Africa [1]. Because of this ability to establish symbiotic associations with bacteria that can fix atmospheric nitrogen in root nodules, members of the genus Lupinus thrive in nutrient poor soils. The rhizobial requirement of Lupi- nus has been thought to be somewhat specific, with literature indicating that lupines are mainly nodulated by soil bacteria classified in the genus Bradyrhizo- bium, although some other rhizobial and endophytic genera nodulating lupines have been identified as Mesorhizobium, Rhizobium, Microvirga, Paenibacillus, Micromonospora, Bosea, Ochrobactrum and Cohnella [2]-[14]. In addition, members of the genus Burkholderia (in class Betaproteobacteria) are known as endophytic bacteria in lupine [15] and considered the major inhabitants of white lupine cluster roots [16]. Previously, the 16S rRNA gene sequence was most commonly used in bacterial phylogenetic studies because of its slow mutation rate due to functional importance. The 16S rRNA sequence is genus specific and hence provides genus identification in more than 90% of the cases [17] [18]. However, there are some drawbacks associated with the use of 16S rRNA gene sequences such as the presence of mosaicism in the 16S rRNA gene due to horizontal gene transfer and recombination events, the presence of multiple copies of the rRNA operon and the low resolution of closely related species [2]. Multilocus sequence analysis (MLSA), which combines analysis of several conserved housekeeping genes [19], provides improved discriminatory power over the use of single locus sequence and thus, it has been increasingly used in phylogenetic analysis of prokaryotes [20] [21] [22] [23] [24]. For the genus Bradyrhizobium, a database for the taxonomic and phylogenetic identification using MLSA is available online at http://mlsa.cnpso.embrapa.br [25]. In this study, we analyzed 17 bacterial strains, of which 13 had been isolated from root nodules of Lupinus spp. from different geographic locations at various times (kindly provided by the National Rhizobium Germplasm Resource Collec- tion, USDA). Additionally, two samples each from root nodules of native Sundi- al lupine (Lupinus perennis) and domestic soybean (Glycine max) were isolated from plants grown in OH, USA. We applied MLSA to assess the genetic diversity and phylogenetic relationships of these strains using sequence analysis of the 16S rRNA gene and three conserved housekeeping genes (atpD, dnaK and glnII). These housekeeping genes have been widely used in phylogenetic analyses due to their sequence and functional conservation. Additionally, there are a large number of sequences available in the databases. The atpD gene encodes the beta subunit of ATP synthase that produces ATP from ADP in the presence of a pro-

DOI: 10.4236/aim.2017.711063 791 Advances in Microbiology

D. H. Beligala et al.

ton gradient across the membrane [26] [27]. The dnaK gene encodes the DnaK protein, which functions as a molecular chaperone responsible for various cellu- lar processes, such as folding of nascent polypeptides, assembly and disassembly of protein complexes, protein degradation and membrane translocation of se- creted proteins [2] [4]. The glnII gene encodes glutamine synthetase II which catalyzes the condensation of glutamate and ammonia to form glutamine [21] [28] [29] [30]. Our study is distinct because all the reference gene sequences were extracted from the existing complete genomes that are available via the In- tegrated Microbial Genomes database [31]. The phylogenetic tree based on the concatenated sequences comparing the 17 strains with 30 reference strains sug- gests that MLSA provides improved taxonomic relationships of these bacterial strains.

2. Materials and Methods 2.1. Bacterial Strains

A total of 17 strains from at least ten geographic locations were examined in this study (Table 1), including USA, Yugoslavia and Brazil; 13 strains were obtained from the National Rhizobium Germplasm Resource Collection, USDA. Two strains each were isolated from nodules of locally grown (Bowling Green, OH,

Table 1. Bacterial strains.

Strain Host Origin, collected time Suggested identification

USDA 3040 L. albus FL, USA, 1940 Bradyrhizobium

USDA 3042 L. albus Yugoslavia, 1955 Bradyrhizobium

USDA 3051 L. angustifolius GA, USA, 1946 Bradyrhizobium

USDA 3063 L. densiflorus CA, USA, 1962 bMesorhizobium

USDA 3044 L. luteus FL, USA, 1946 Bradyrhizobium

USDA 3048 L. luteus Brazil, 1959 Bradyrhizobium

USDA 3504 L. mutabilis Unknown Bradyrhizobium

USDA 3715 L. nanus CA, USA, 1922 Bradyrhizobium

USDA 3043 L. perennis MD, USA, 1941 bBurkholderia

USDA 3709 L. polyphyllus aNitragin, unknown location, 1945 Bradyrhizobium

USDA 3057a L. subcarnosus aNitragin, FL, USA, 1946 bMicrovirga

USDA 3717 L. succulentus CA, USA, 1973 Mesorhizobium

USDA 3060 L. spp aNitragin, unknown Bradyrhizobium

Kitty Todd Nature Preserve, Swanton, L_OO L. perennis Burkholderia OH, 2014 (this study)

L_3D52 L. perennis Bowling Green, OH, 2014 (this study) Rhizobium

SB_J Glycine max Bowling Green, OH, 2014 (this study) Bradyrhizobium

SB_5 Glycine max Bowling Green, OH, 2014 (this study) Bradyrhizobium

aSeed company; bPreviously reported as Bradyrhizobium.

DOI: 10.4236/aim.2017.711063 792 Advances in Microbiology

D. H. Beligala et al.

USA) Lupinus perennis and Glycine max. The USDA strains had been collected between 1922-73, while the nodules from native lupine and domestic soybean were collected in October 2014 and July 2014, respectively. To isolate bacteria from root nodules, the collected nodules were surface sterilized by the method described by Deng [32], with some modifications. Briefly, the nodules were washed with sterile distilled water three times for 30 sec, soaked in 10% Clorox for 30 sec, followed by rinsing with distilled water for 30 sec, then with 70% ethanol for 10 min, after which they were rinsed three times with sterile distilled water. A sterile glass rod was used to crush root nodules from each sample followed by streaking the suspension onto modified arabinose gluconate medium [33] with a sterile inoculating loop. The cultures were incubated at 30˚C. Initial verification was conducted by colony morphology and Gram stain. All the strains were maintained at 4˚C for temporary storage and in 20% glycerol at −80˚C for long term storage.

2.2. DNA Extraction, PCR and Sequencing

Total genomic DNA of bacterial strains was extracted using ZR Fungal/Bacterial DNA MiniPrep™ kit (Zymo research, CA) following the manufacturer’s recom- mendations. The 16S rRNA gene and housekeeping genes (atpD, dnaK and glnII) were amplified using primers and PCR conditions [2] [3] [9] [21] [34] [35] listed in Table 2. The PCR products were purified using the Qiagen MinE- lute PCR Purification kit (QIAGEN, Germany) and were quantified using a Na- noDrop 2000 spectrophotometer (Thermo Fisher Scientific, PA). Sequencing of the PCR amplicons was conducted by DNA Analysis LLC (Cincinnati, OH).

2.3. Phylogenetic Analyses

Multiple nucleotide sequence alignments were generated using MUSCLE version 3.5 [36]. The sequences of three housekeeping genes atpD, dnaK and glnII were concatenated using Sequence Matrix version 1.0 [37]. The phylogenies of each gene and the concatenated sequences were constructed by the maximum-likelihood method using MEGA version 6.06 [38], with default parameters. Statistical support for tree nodes was determined by bootstrap analysis of 1000 replicates. We used MEGA version 6.06 for identification of conserved, variable and parsimony informative regions of consensus sequences (Table 3). For phylogenetic analyses, the sequences encoding 16S rRNA and three housekeeping genes of 30 reference strains representing Bradyrhizobium, Burk- holderia, Mesorhizobium, Microvirga, Rhizobium and Rhodopseudomonas genera were extracted from the existing complete genomes available via the Inte- grated Microbial Genomes database of the Joint Genome Institute (http://img.jgi.doe.gov) [31] and the GenBank database of the NCBI (http://www.ncbi.nlm.nih.gov) [39]. Sequences of Campylobacter jejuni NCTC 11168 and Helicobacter pylori OK113 were used as outgroups. Accession information of all the sequences used in this study is listed in Table 4.

DOI: 10.4236/aim.2017.711063 793 Advances in Microbiology

D. H. Beligala et al.

Table 2. Primers and PCR conditions.

PCR annealing Length of PCR Gene Primer Sequence (5’-3’) Reference temperature (˚C) amplicon (bp)

16S rRNA fD1 AGAGTTTGATCCTGGCTCAG 55 1485 [3]

rD1 CTTAAGGAGGTGATCCAGCC

atpD TSatpDf TCTGGTCCGYGGCCAGGAAG 58 595 [3]

TSatpDr CGACACTTCCGARCCSGCCTG

MVatpDfa GGCCGCATYATGAACGTSAT 52 526 This study

MVatpDra GGGTGAAGCGGAAGATGTTG

atpD-Fb TCGGCGCCGTCGTSGAC 54 1315 [35]

atpD-Rb RGCTTCCGGCAGRTKRTCGTA

dnaK BRdnaKf TTCGACATCGACGCSAACGG 58 474 [21]

BRdnaKr GCCTGCTGCKTGTACATGGC

BUdnaKfd GTSTAYGAYCTSGGCGGCGG 58 900 [34]

BUdnaKrd GAASGTSACYTCGATCTGCGG

dnaK forwarda GAGATCGGCGACGGCGTGTTC 56 746 [9]

dnaK reversea GATGCGGATCTGSTGCTCCTTG

TSdnaK3e AAGGAGCAGCAGATCCGCATCCA 58 330 [2]

TSdnaK2e GTACATGGCCTCGCCGAGCTTCA

dnaK-RS-Fc CACSACGATCCCGACSAA 54 650 [35]

dnaK-RS-Rc TCGTAGTCGGCRTCGACSAC

glnII TSglnIIf AAGCTCGAGTACATCTGGCTCGACGG 57 647 [3]

TSglnIIr SGAGCCGTTCCAGTCGGTGTCG

MVglnIIfa GGAYTCCAACGATCAGCTYT 52 528 This study

MVglnIIra TGBGCGAGRATCTTGGTGTA

Primers used for: aUSDA 3057a, bL_3D52, cUSDA 3043 and L_3D52, dL_OO, eUSDA 3063, USDA 3715 and USDA 3717.

Table 3. Sequence information. 17 (16S rRNA, dnaK), 15 (glnII) and 14 (atpD) strains were analyzed, together with 30 reference strains.

Strains Nucleotides (%) Locus Total* Frequency T/C/A/G (%) analyzed (n) Conserved Variable Parsimony-informative

16S rRNA 47 688 (39.6) 918 (52.9) 612 (35.2) 1289.1/1734 19.9/23.6/24.5/32

atpD 44 676 (41.5) 939 (57.7) 704 (43.2) 1175.5/1627 16.9/33.1/19.4/30.6

dnaK 47 836 (39.8) 1165 (55.5) 935 (44.5) 1372/2099 14.4/30.8/23.3/31.5

glnII 45 401 (24) 1190 (71.3) 1031 (61.8) 957.1/1667 17.9/32.3/20.5/29.3

Concatenated housekeeping 47 1913 (35.4) 3294 (61) 2670 (49.5) 3388.8/5393 16.2/32/21.3/30.6

*Mean number of nucleotides amplified/number of sites analyzed, including gaps.

DOI: 10.4236/aim.2017.711063 794 Advances in Microbiology

D. H. Beligala et al.

Table 4. Accession numbers of sequences of the reference strains.

Accession no./Integrated Microbial Genomes database Gene ID Species Strain 16S rRNA atpD glnII dnaK

Bradyrhizobium diazoefficiens USDA 110 NR_074322.1a NC_004463.1a NC_004463.1a NC_004463.1a

Bradyrhizobium daqingense CGMCC 1.10947 2596849087b 2596843584b 2596844579b 2596843831b

Bradyrhizobium elkanii WSM1741 2513694649b 2513695301b 2513692556b 2513695064b

Bradyrhizobium yuanmingense CGMCC 1.3531 2596918164b 2596919055b 2596920471b 2596918860b

Bradyrhizobium huanghuaihaiense CGMCC 1.10948 2596982279b 2596975684b 2596979525b 2596975428b

Bradyrhizobium japonicum USDA 6 2511997030b 2511995921b 2513662812b 2511996162b

Mesorhizobium loti MAFF303099 2596918164b 637076488b 637073590b NC_002678.2a

Mesorhizobium ciceri WSM1271 NC_014923a 649871049b 649873526b 649870594b

Mesorhizobium australicum WSM2073 2509394613b 2509394154b 2509397135b 2509393630b

Mesorhizobium metallidurans STM 2683 2601505225b 2601504724b 2601506641b 2601504159b

Mesorhizobium opportunistum WSM2075 2503199683b 2503199217b 2503202630b 2503198743b

Rhodopseudomonas palustris DX-1 649839171b 649837789b 649841704b 649837619b

Rhizobium tropici CIAT_899 NR_102511.1a 2524421805b 2524419063b 2524418614b

Rhizobium multihospitium HAMBI 2975 2616551835b 2616557675b 2616553289b 2616551680b

Rhizobium giardinii H152T 2514002513b 2513998581b 2513996665b 2514001597b

Rhizobium alamii YR540 2585227592b 2585223835b 2585221953b 2585223201b

Rhizobium loessense CGMCC 1.3401 2596901882b 2596899519b 2596896711b 2596896745b

Rhizobium mongolense USDA 1844 2513930752b 2513928522b 2513924297b 2513924262b

Rhizobium mesoamericanum STM3625 2537420238b 2537420370b 2537421941b 2537416751b

Rhizobium etli CFN 42 640437097b 640440878b 640440115b 640437182b

Rhizobium leguminosarum CCGE 510 2530650189b 2530647440b 2530646549b 2530648392b

Rhizobium rhizogenes CF262 2587978724b 2530647440b 2587979059b 2587978481b

Burkholderia phymatum STM815 NR_074668.1a 642594831b 642593265b 642594287b

Burkholderia mimosarum NBRC 106338 2600796967b 2600790698b 2600791842b 2600789814b

Burkholderia tuberum STM678 2512348064b 2512346960b 2512345484b 2512347522b

Burkholderia xenovorans LB400 2607186426b 637949601b 2607184451b 637945690b

Burkholderia pseudomallei K96243 640705518b 637569407b 637568300b 637568821b

Microvirga lupini Lut6 2508725373b 2508734351b 2508728833b 2508727620b

Microvirga lotononidis WSM3557 2509076004b 2509079259b 2509075706b 2509077502b

Microvirga guangxiensis CGMCC 1.7666 2596960782b 2596957129b 2596959864b 2596957490b

Campylobacter jejuni NCTC 11168 2608345134b 2608345210b 2608345793b 2608345849b

Helicobacter pylori OK113 2598008753b 2598009033b 2598009653b 2598010026b aGene sequences from NCBI GenBank database. bGene sequences from Integrated Microbial Genomes database, United States Department of Energy.

DOI: 10.4236/aim.2017.711063 795 Advances in Microbiology

D. H. Beligala et al.

3. Results 3.1. Phylogeny Based on the 16S rRNA Sequence

PCR amplification of the 16S rRNA gene yielded a single amplicon for each strain ranging in size from 880 bp to 1600 bp. The estimated mean frequencies of T, C, A, and G nucleotides within this region were 19.9%, 23.6%, 24.5%, and 32%, respectively, as shown in Table 3. The consensus 16S rRNA sequence of all 47 strains spanned 1734 positions, out of which 688 were conserved, 918 were variable and 612 were parsimony-informative. A position was considered parsimony-informative if it contained at least two types of nucleotides, and at least two of them occurred with a minimum frequency of two. The phylogenetic tree constructed with 16S rRNA gene sequences was fairly well resolved and split the strains into two clades: one large group and one relatively smaller group (Groups I and II, Figure 1). Group I, with a bootstrap support of 98%, was further divided into two subgroups that clustered strains primarily belonging to the genera of Bradyrhizobium and Microvirga (clades 1 and 2), or Mesorhizobium and Rhizobium genera (clades 3 and 4) with 96%, 38%, 87%, and 94% bootstrap support, respectively. USDA strains 3040, 3709, 3042 and 3051 together with SB_J (soybean) and SB_5 (soybean) were clustered with Bradyrhizobium, whereas USDA strains 3057a, 3048, 3060, 3715 and 3044 were placed with Microvirga. USDA strains 3717 and 3063 were grouped with Mesor- hizobium whereas L_3D52 (lupine) was grouped with Rhizobium. The second smaller group of the 16S rRNA gene tree contained a subgroup with 99% bootstrap support, comprised of five reference strains of Burkholderia, USDA 3504, USDA 3043 and L_OO (lupine).

3.2. Phylogenies Based on Housekeeping Gene Sequences

The three housekeeping genes selected for this study are highly conserved among bacteria of the order Rhizobiales. The mean lengths of the fragments of atpD, dnaK, and glnII genes used in phylogenetic analysis were 1175 bp, 1372 bp, and 957 bp, respectively (Table 3). When sequence conservation at the DNA level was considered, the lowest level of conservation (24%) was observed with glnII, while sequence conservation of atpD and dnaK genes was 41.5% and 39.8%, respectively. In general, the maximum-likelihood phylogenetic trees of the housekeeping genes (Figures 2-4) were similar to that of the 16S rRNA gene. While most of the clustering pattern was consistent among the single gene trees, there were some exceptions. These exceptions include USDA strains 3044, 3048, 3715 and 3060, which grouped with Microvirga in the 16S rRNA gene tree, but clustered with Bradyrhizobium in all three housekeeping gene trees as shown in Figures 2-4. Furthermore, USDA strain 3504, which was grouped closer to Burkholderia in the 16S rRNA gene tree, was clustered with Rhizobium in the glnII gene tree (Figure 4) but with Bradyrhizobium in the atpD and dnaK gene trees (Figure 2 and Figure 3).

DOI: 10.4236/aim.2017.711063 796 Advances in Microbiology

D. H. Beligala et al.

Figure 1. Maximum-likelihood phylogenetic tree showing the relationships of 49 strains based on the 16S rRNA gene sequences. Strains examined in the present study are shown in boldface. Clades I and II correspond to the two main groups identified and Arabic numbers represent the subclades. Bootstrap values ≥ 50% (1000 replicates) are given at the branching points. The scale bar indicates the number of substitutions per site. Campylobacter jejuni NCTC 11168 and Helicobacter pylori OK 113 were used as outgroups. Phylogenetic analyses were conducted using MEGA version 6.06.

DOI: 10.4236/aim.2017.711063 797 Advances in Microbiology

D. H. Beligala et al.

Figure 2. Maximum-likelihood phylogenetic trees showing the relationships of 46 strains based on the atpD gene sequences. Strains examined in the present study are shown in boldface. Clades I and II correspond to the two main groups identified and Arabic numbers represent the subclades. Bootstrap values ≥ 50% (1000 replicates) are given at the branching points. The scale bar indicates the number of substitutions per site. Campylobacter jejuni NCTC 11168 and Helicobacter pylori OK 113 were used as outgroups. Phylogenetic analyses were conducted using MEGA version 6.06.

DOI: 10.4236/aim.2017.711063 798 Advances in Microbiology

D. H. Beligala et al.

Figure 3. Maximum-likelihood phylogenetic trees showing the relationships of 49 strains based on the dnaK gene sequences. Strains examined in the present study are shown in boldface. Clades I and II correspond to the two main groups identified and Arabic numbers represent the subclades. Bootstrap values ≥ 50% (1000 replicates) are given at the branching points. The scale bar indicates the number of substitutions per site. Campylobacter jejuni NCTC 11168 and Helicobacter pylori OK 113 were used as outgroups. Phylogenetic analyses were conducted using MEGA version 6.06.

DOI: 10.4236/aim.2017.711063 799 Advances in Microbiology

D. H. Beligala et al.

Figure 4. Maximum-likelihood phylogenetic trees showing the relationships of 47 strains based on the glnII gene sequences. Strains examined in the present study are shown in boldface. Clades I and II correspond to the two main groups identified and Arabic numbers represent the subclades. Bootstrap values ≥ 50% (1000 replicates) are given at the branching points. The scale bar indicates the number of substitutions per site. Campylobacter jejuni NCTC 11168 and Helicobacter pylori OK 113 were used as outgroups. Phylogenetic analyses were conducted using MEGA version 6.06.

DOI: 10.4236/aim.2017.711063 800 Advances in Microbiology

D. H. Beligala et al.

3.3. Phylogeny Based on Concatenated atpD, dnaK and glnII Sequences

When the three housekeeping genes, atpD, dnaK and glnII, were used to gener- ate a concatenated phylogenetic tree, a consensus sequence of 3388 bp was pro- duced; of the 5393 positions analyzed, 35.4% was conserved, 61% variable and 49.5% parsimony-informative. The calculated mean frequencies of T, C, A, and G nucleotides were 16.2%, 32%, 21.3%, and 30.6%, respectively (Table 3). Two groups were resolved in the concatenated tree; one large group and one relatively smaller group (Figure 5) as found in the 16s rRNA tree. Both groups had a bootstrap support of 84%. The larger group contained four subgroups, each of which included reference strains of Bradyrhizobium, Microvirga, Me- sorhizobium, and Rhizobium genera with 87%, 100%, 97%, and 100% bootstrap support, respectively. USDA strains 3040, 3709, 3042, 3044, 3048, 3060, 3504, 3715 and 3051 from Lupinus together with SB_J and SB_5 from Glycine max were placed with Bradyrhizobium, whereas only USDA strain 3057a grouped with Microvirga. USDA strains 3717 and 3063 were placed with Mesorhizobium whereas L_3D52 was included in the subgroup containing Rhizobium. The second smaller group of the concatenated gene tree comprised five reference strains of Burkholderia, USDA 3043 and L_OO (Figure 5). When the grouping patterns were compared, the concatenated gene tree was more like the trees generated from each of the single housekeeping genes (Figures 2-4) than to the one generated from 16S rRNA gene (Figure 1). The clustering of most strains was consistent with the single gene trees and the concatenated gene tree with few exceptions. For example, the USDA 3504 strain grouped with Burkholderia when only the 16S rRNA gene was used, and with Rhizobium in glnII gene analyses; however, it was classified with Bradyrhizo- bium both when atpD alone and concatenated sequences were used. Other exceptions include strains USDA 3044, 3048, 3715 and 3060 that were grouped with Microvirga in the 16S rRNA gene tree, but with Rhizobium when glnII was analyzed. These strains clustered with Bradyrhizobium in the atpD, dnaK and concatenated trees.

4. Discussion

DNA sequence analysis of evolutionarily stable marker genes is commonly used for the identification and classification of bacterial species [40]. The past two decades, microbiologists have primarily relied on 16S rRNA gene sequences for bacterial classification because of conservation of its ribosomal operon size, nucleotide sequence and secondary structure within a bacterial species [41]. However, drawbacks associated with the use of 16S rRNA gene sequences have limited its applicability for bacterial phylogenetic analyses [23]. Recent studies suggest the possibility of occurrence of horizontal gene transfer and recombination events within the 16S rRNA gene [42] [43], including reports of horizontal gene transfers and mosaic-like structures within the 16S rRNA gene in bacterial

DOI: 10.4236/aim.2017.711063 801 Advances in Microbiology

D. H. Beligala et al.

Figure 5. Maximum-likelihood phylogenetic tree showing the relationships of 49 strains based on the concatenated sequences of atpD, dnaK and glnII genes. Strains examined in the present study are shown in boldface. Clades I and II correspond to the two main groups identified and Arabic numbers represent the subclades. Bootstrap values ≥ 50% (1000 replicates) are given at the branching points. The scale bar indicates the number of substitutions per site. Campylobacter jejuni NCTC 11168 and Helicobac- ter pylori OK 113 were used as outgroups. Phylogenetic analyses were conducted using MEGA version 6.06.

DOI: 10.4236/aim.2017.711063 802 Advances in Microbiology

D. H. Beligala et al.

genera such as Rhizobium, Aeromonas, Bradyrhizobium, Streptococcus and Ac- tinomycetes [44] [45] [46] [47]. It has been also reported that the polymorphic nucleotide distribution pattern within the 16S rRNA sequence is highly variable among different species. This could lead to phylogenies that are inconsistent with other genes as evident in causing uncertain phylogenetic placement of Rhi- zobium galegae [48]. Therefore, phylogenetic analysis of rhizobial species based on the analysis of partial 16S rRNA gene sequences may lead to distorted phylogenies and misidentification, because it may represent only a part of the mosaic- like structure [22] [23]. The presence of multiple copies of the rRNA operon and intra-genomic heterogeneity is another factor that makes 16S rRNA gene an imperfect choice for phylogenetic analysis. The copy number of the rRNA genes can vary from one to 15 within a single bacterial genome [49]. Although these multiple copies are mostly identical or nearly identical, there are reports of divergent copies within a single genome [50]. When Rhizobia are considered, the slow growing Bradyrhi- zobium strains have only a single copy of 16S rRNA gene, whereas the faster growing Rhizobium spp. possess three copies [51]. Copy number variations and potential of horizontal gene transfer events limit the use of 16S rRNA gene sequence in taxonomy as well as in MLSA [52]. In addition, high degree of conservation and sequence similarity among the species of the genus Bradyrhizo- bium have been reported [53]. All these facts signify that the 16S rRNA sequence is an inferior candidate for phylogenetic inference of rhizobia and emphasize the importance of employing alternative, multi-locus strategies. For MLSA, we selected a set of housekeeping genes based on the sequence variability among the particular species of bacteria. The housekeeping genes atpD, dnaJ, dnaK, gap, glnA, glnII, gltA, gyrB, pnp, recA, rpoA, rpoB and thrC have been used in MLSA of rhizobial species [52]. It is also important to determine the number of housekeeping genes that should be used for MLSA. In general, three or more housekeeping genes have been commonly used in MLSA approach for the inference of phylogenetic relationships of rhizobia [2] [3] [20] [54]-[64]. In this study, we used three housekeeping genes, atpD, dnaK and glnII, to achieve a good resolution. Since concatenated sequences can yield more accurate phylogenetic trees than consensus of separate gene phylogenies even for sequences with different substitution patterns [65], concatenated sequences of the three housekeeping genes were used in phylogenetic analysis. Out of the 13 USDA strains, 10 strains (USDA 3040, 3042, 3043, 3044, 3048, 3051, 3057a, 3060, 3063 and 3709) have been previously reported as Bradyrhizo- bium [66] [67] [68], USDA 3717 has been classified as Mesorhizobium [2], while USDA 3504 and 3715 have not been previously studied. Our MLSA research showed that seven strains (USDA 3040, 3042, 3044, 3048, 3051, 3060, and 3709) are Bradyrhizobium, confirming the previous reports. The strain USDA 3051, previously identified as Rhizobium lupini, was recently reclassified by Peix [69] as Bradyrhizobium lupini based on MLSA of 16S rRNA, recA and glnII gene se-

DOI: 10.4236/aim.2017.711063 803 Advances in Microbiology

D. H. Beligala et al.

quences. Consistent with the latter report, we identified USDA 3051 as Bradyr- hizobium. We used the same approach to analyze two of the same marker genes (16S rRNA and glnII) with two additional housekeeping genes (dnaK and atpD) to support this classification. According to the topologies of both 16S rRNA and concatenated gene phylogenies (Figure 1 and Figure 5), the strains USDA 3043, 3057a, and 3063 grouped with Burkholderia, Microvirga, and Mesorhizobium, respectively. Thus, we recommend to reclassify these three strains, which were previously reported as Bradyrhizobium [68]. The USDA 3717 was classified as Mesorhizobium in this study, in agreement with previous identification [2]. To our knowledge, this is the first study to identify USDA 3504 and 3715 and we propose to classify them as Bradyrhizobium (Table 1). Of the strains obtained from locally grown plants (OH, USA), the two soybean strains (SB_J and SB_5), were identified as Bradyrhizobium, whereas the new lupine strains, L_OO and L_3D52 were identified as Burkholderia and Rhizo- bium, respectively. These identifications are consistent among all trees obtained from 16S rRNA, single housekeeping and concatenated gene phylogenies. No relationships between the geographical origins and the patterns of gene sequences were apparent in this study, most likely due to this small sample and its limited geographic origins. Although members of the genus Burkholderia are reported as endophytes of lupines [15] [16], there is a lack of evidence about them forming nodules. How- ever, some species of Burkholderia such as B. phymatum, B. tuberum, B. viet- namiensis and B. cepacia are known to effectively nodulate certain other important legumes including common bean and fix nitrogen [6] [15] [70]-[75]. These nodulating Burkholderia species contain nod and nif genes that are very similar to those of alphaproteobacteria, suggesting a common origin [76]. In this MLSA study, the two strains USDA 3043 and L_OO, both of which were isolated from L. perennis, were identified as Burkholderia. The sequences of atpD and glnII genes of USDA 3043 and L_OO could not be amplified after several attempts using primers specific for rhizobial species listed in Table 2. Since both these strains were identified as Burkholderia with the 16S rRNA and dnaK gene phylogenies, we developed Burkholderia-specific primers for the glnII gene. For the atpD gene, primers specific for Burkholderia by Estrada-De Los Santos [77] were employed. In addition, the atpD gene of the strain SB_J, which was identified as Bradyrhizobium in all the other trees, could not be amplified. There is compelling evidence of intragenic recombination in the atpD gene, which might be the underlying reason behind the inability to am- plify this gene in USDA 3043, L_OO and SB_J even when using genus-specific primers [54] [78] [79] [80]. Furthermore, it has been recommended that the atpD gene should be used with caution in studying the phylogeny of bacteria belonging to the genus Bradyrhizobium [21]. Among the single housekeeping gene trees and the concatenated gene tree, the evidence producing a phylogeny that was incongruent with others was the glnII

DOI: 10.4236/aim.2017.711063 804 Advances in Microbiology

D. H. Beligala et al.

gene tree, in which the sequences from USDA 3504 clustered with Rhizobium. The glnII gene sequence also harbored the greatest variability (71.3%, Table 3). This high genetic heterogeneity could be attributed to genetic recombination within the glnII gene [79]. In addition, the two outgroups used in this study placed close to the cluster of Burkholderia in both 16S rRNA and the glnII gene trees, further suggesting the possibility of genetic recombination (Figure 1 and Figure 4).

5. Conclusion

In conclusion, this study employed MLSA of concatenated housekeeping genes are further authentication for this approach as a more robust method for phylogenetic analysis of rhizobia over the analysis of 16S rRNA gene sequences alone [19] [52]. According to the phylogeny of the concatenated dataset, we propose that USDA strains 3063, 3717, 3043 and 3057a should be considered for reclassification. Also, despite evidence that lupines are mainly nodulated by members of the genus Bradyrhizobium [3], the two strains isolated from lupines in this study were shown to be Burkholderia sp. and Rhizobium sp. However, additional studies are required to confirm symbiotic nodulation, especially of Burkholderia spp., by 1) re-inoculation on lupine, 2) sequencing of symbiosis-essential genes such as nod and nif, and 3) testing nitrogen fixation ability by culturing on a N-free semisolid medium such as BAz medium and an acetylene reduction ac- tivity assay [70] [72].

Acknowledgements

This research was funded in part by the Center for Undergraduate Research Scholarship at Bowling Green State University and by the United States Depart- ment of Agriculture National Institute of Food and Agriculture (USDA-NIFA) Agriculture and Food Research Initiative Oomycete-Soybean CAP (award 2011-68004-30104). We thank Patrick Elia, the National Rhizobium Germplasm Resource Collection, USDA, for providing bacterial strains and a protocol for growing and maintaining the cultures. We are also grateful to Jacob Sublett for assistance with sample collections, Gayathri Beligala for help with maintaining cultures, Madushanka Manathunga for computer technical support, and Drs. Michael E. Geusz and Paul F. Morris for comments that greatly improved the manuscript.

References [1] Duran, D., Rey, L., Sanchez-Canizares, C., Navarro, A., Imperial, J. and Ruiz-Argueso, T. (2013) Genetic Diversity of Indigenous Rhizobial Symbionts of the Lupinus mariae-josephae Endemism from Alkaline-Limed Soils within Its Area of Distribution in Eastern Spain. Systematic and Applied Microbiology, 36, 128-136. https://doi.org/10.1016/j.syapm.2012.10.008 [2] Stępkowski, T., Czaplińska, M., Miedzinska, K. and Moulin, L. (2003) The Variable Part of the dnaK Gene as an Alternative Marker for Phylogenetic Studies of Rhizo-

DOI: 10.4236/aim.2017.711063 805 Advances in Microbiology

D. H. Beligala et al.

bia and Related Alpha Proteobacteria. Systematic and Applied Microbiology, 26, 483-494. https://doi.org/10.1078/072320203770865765 [3] Stepkowski, T., Moulin, L., Krzyzanska, A., McInnes, A., Law, I.J. and Howieson, J. (2005) European Origin of Bradyrhizobium Populations Infecting Lupins and Ser- radella in Soils of Western Australia and South Africa. Applied and Environmental Microbiology, 71, 7041-7052. https://doi.org/10.1128/AEM.71.11.7041-7052.2005 [4] Stepkowski, T., Hughes, C.E., Law, I.J., Markiewicz, L., Gurda, D., Chlebicka, A., et al. (2007) Diversification of Lupine Bradyrhizobium Strains: Evidence from Nodu- lation Gene Trees. Applied and Environmental Microbiology, 73, 3254-3264. https://doi.org/10.1128/AEM.02125-06 [5] Stępkowski, T., Żak, M., Moulin, L., Króliczak, J., Golińska, B., Narożna, D., et al. (2011) Bradyrhizobium canariense and Bradyrhizobium japonicum Are the Two Dominant Rhizobium Species in Root Nodules of Lupin and Serradella Plants Growing in Europe. Systematic and Applied Microbiology, 34, 368-375. https://doi.org/10.1016/j.syapm.2011.03.002 [6] Trujillo, M.E., Willems, A., Abril, A., Planchuelo, A.M., Rivas, R., Ludena, D., et al. (2005) Nodulation of Lupinus albus by Strains of Ochrobactrum lupini sp. nov. Ap- plied and Environmental Microbiology, 71, 1318-1327. https://doi.org/10.1128/AEM.71.3.1318-1327.2005 [7] Trujillo, M.E., Kroppenstedt, R.M., Fernández-Molinero, C., Schumann, P. and Martínez-Molina, E. (2007) Micromonospora lupini sp. nov. and Micromonospora saelicesensis sp. nov., Isolated from Root Nodules of Lupinus angustifolius. Interna- tional Journal of Systematic and Evolutionary Microbiology, 57, 2799-2804. https://doi.org/10.1099/ijs.0.65192-0 [8] Ardley, J.K., Parker, M.A., De Meyer, S., O’Hara, G.W., Reeve, W.G., Yates, R.J., et al. (2010) Species of Microvirga Are Novel Alpha-Proteobacterial Root Nodule Bac- teria That Specifically Nodulate Lotononis angolensis and Lupinus texensis. [9] Ardley, J.K., Parker, M.A., De Meyer, S.E., Trengove, R.D., O’Hara, G.W., Reeve, W.G., et al. (2012) Microvirga lupini sp. nov., Microvirga lotononidis sp. nov. and Microvirga zambiensis sp. nov. Are Alphaproteobacterial Root-Nodule Bacteria That Specifically Nodulate and Fix Nitrogen with Geographically and Taxonomi- cally Separate Legume Hosts. International Journal of Systematic and Evolutionary Microbiology, 62, 2579-2588. https://doi.org/10.1099/ijs.0.035097-0 [10] De Meyer, S.E. and Willems, A. (2012) Multilocus Sequence Analysis of Bosea Spe- cies and Description of Bosea lupini sp. nov., Bosea lathyri sp. nov. and Bosea robi- niae sp. nov., Isolated from Legumes. International Journal of Systematic and Evo- lutionary Microbiology, 62, 2505-2510. https://doi.org/10.1099/ijs.0.035477-0 [11] Flores-Félix, J.D., Carro, L., Ramírez-Bahena, M.-H., Tejedor, C., Igual, J.M., Peix, A., et al. (2014) Cohnella lupini sp. nov., an Endophytic Bacterium Isolated from Root Nodules of Lupinus albus. International Journal of Systematic and Evolutio- nary Microbiology, 64, 83-87. https://doi.org/10.1099/ijs.0.050849-0 [12] Reeve, W., Parker, M., Tian, R., Goodwin, L., Teshima, H., Tapia, R., et al. (2014) Genome Sequence of Microvirga lupini Strain LUT6T, a Novel Lupinus Alphapro- teobacterial Microsymbiont from Texas. Standards in Genomic Sciences, 9, 1159. https://doi.org/10.4056/sigs.5249382 [13] Msaddak, A., Rejili, M., Durán, D., Rey, L., Imperial, J., Palacios, J.M., et al. (2017) Members of Microvirga and Bradyrhizobium Genera Are Native Endosymbiotic Bacteria Nodulating Lupinus luteus in Northern Tunisian Soils. FEMS Microbiolo- gy Ecology, 93, fix068. https://doi.org/10.1093/femsec/fix068

DOI: 10.4236/aim.2017.711063 806 Advances in Microbiology

D. H. Beligala et al.

[14] Carro, L., Flores-Félix, J.D., Ramírez-Bahena, M.-H., García-Fraile, P., Martínez- Hidalgo, P., Igual, J.M., et al. (2014) Paenibacillus lupini sp. nov., Isolated from Nodules of Lupinus albus. International Journal of Systematic and Evolutionary Microbiology, 64, 3028-3033. https://doi.org/10.1099/ijs.0.060830-0 [15] Compant, S., Nowak, J., Coenye, T., Clément, C. and Ait Barka, E. (2008) Diversity and Occurrence of Burkholderia spp. in the Natural Environment. FEMS Microbi- ology Reviews, 32, 607-626. https://doi.org/10.1111/j.1574-6976.2008.00113.x [16] Weisskopf, L., Heller, S. and Eberl, L. (2011) Burkholderia Species Are Major Inha- bitants of White Lupin Cluster Roots. Applied and Environmental Microbiology, 77, 7715-7720. https://doi.org/10.1128/AEM.05845-11 [17] Willems, A. and Collins, M.D. (1993) Phylogenetic Analysis of Rhizobia and Agro- bacteria Based on 16S rRNA Gene Sequences. International Journal of Systematic Bacteriology, 43, 305-313. https://doi.org/10.1099/00207713-43-2-305 [18] Janda, J.M. and Abbott, S.L. (2007) 16S rRNA Gene Sequencing for Bacterial Identi- fication in the Diagnostic Laboratory: Pluses, Perils, and Pitfalls. Journal of Clinical Microbiology, 45, 2761-2764. https://doi.org/10.1128/JCM.01228-07 [19] Gevers, D., Cohan, F.M., Lawrence, J.G., Spratt, B.G., Coenye, T., Feil, E.J., et al. (2005) Re-Evaluating Prokaryotic Species. Nature Reviews Microbiology, 3, 733-739. https://doi.org/10.1038/nrmicro1236 [20] Martens, M., Dawyndt, P., Coopman, R., Gillis, M., De Vos, P. and Willems, A. (2008) Advantages of Multilocus Sequence Analysis for Taxonomic Studies: A Case Study using 10 Housekeeping Genes in the Genus Ensifer (Including Former Sinor- hizobium). International Journal of Systematic and Evolutionary Microbiology, 58, 200-214. https://doi.org/10.1099/ijs.0.65392-0 [21] Menna, P., Barcellos, F.G. and Hungria, M. (2009) Phylogeny and Taxonomy of a Diverse Collection of Bradyrhizobium Strains Based on Multilocus Sequence Anal- ysis of the 16S rRNA Gene, ITS Region and glnII, recA, atpD and dnaK Genes. In- ternational Journal of Systematic and Evolutionary Microbiology, 59, 2934-2950. https://doi.org/10.1099/ijs.0.009779-0 [22] Rivas, R., Martens, M., De Lajudie, P. and Willems, A. (2009) Multilocus Sequence Analysis of the Genus Bradyrhizobium. Systematic and Applied Microbiology, 32, 101-110. https://doi.org/10.1016/j.syapm.2008.12.005 [23] Rajendhran, J. and Gunasekaran, P. (2011) Microbial Phylogeny and Diversity: Small Subunit Ribosomal RNA Sequence Analysis and Beyond. Microbiological Re- search, 166, 99-110. https://doi.org/10.1016/j.micres.2010.02.003 [24] Granada, C.E., Beneduzi, A., Lisboa, B.B., Turchetto-Zolet, A.C., Vargas, L.K. and Passaglia, L.M.P. (2015) Multilocus Sequence Analysis Reveals Taxonomic Differ- ences among Bradyrhizobium sp. Symbionts of Lupinus albescens Plants Growing in Arenized and Non-Arenized Areas. Systematic and Applied Microbiology, 38, 323-329. https://doi.org/10.1016/j.syapm.2015.03.009 [25] Azevedo, H., Lopes, F.M., Silla, P.R. and Hungria, M. (2015) A Database for the Taxonomic and Phylogenetic Identification of the Genus Bradyrhizobium using Multilocus Sequence Analysis. BMC Genomics, 16, S10. https://doi.org/10.1186/1471-2164-16-S5-S10 [26] Gaunt, M.W., Turner, S.L., Rigottier-Gois, L., Lloyd-Macgilp, S.A. and Young, J.P. (2001) Phylogenies of atpD and recA Support the Small Subunit rRNA-Based Clas- sification of Rhizobia. International Journal of Systematic and Evolutionary Micro- biology, 51, 2037-2048. https://doi.org/10.1099/00207713-51-6-2037 [27] Christensen, H., Kuhnert, P., Olsen, J.E. and Bisgaard, M. (2004) Comparative Phy-

DOI: 10.4236/aim.2017.711063 807 Advances in Microbiology

D. H. Beligala et al.

logenies of the Housekeeping Genes atpD, infB and rpoB and the 16S rRNA Gene within the Pasteurellaceae. International Journal of Systematic and Evolutionary Microbiology, 54, 1601-1609. https://doi.org/10.1099/ijs.0.03018-0 [28] Batista, L., Tomasco, I., Lorite, M.J., Sanjuán, J. and Monza, J. (2013) Diversity and Phylogeny of Rhizobial Strains Isolated from Lotus uliginosus Grown in Uruguayan Soils. Applied Soil Ecology, 66, 19-28. https://doi.org/10.1016/j.apsoil.2013.01.009 [29] Chahboune, R., Carro, L., Peix, A., Ramirez-Bahena, M.H., Barrijal, S., Velazquez, E., et al. (2012) Bradyrhizobium rifense sp. nov. Isolated from Effective Nodules of Cytisus villosus Grown in the Moroccan Rif. Systematic and Applied Microbiology, 35, 302-305. https://doi.org/10.1016/j.syapm.2012.06.001 [30] Behrmann, I., Hillemann, D., Puhler, A., Strauch, E. and Wohlleben, W. (1990) Overexpression of a Streptomyces viridochromogenes Gene (glnII) Encoding a Glutamine Synthetase Similar to Those of Eucaryotes Confers Resistance against the Antibiotic Phosphinothricyl-Alanyl-Alanine. Journal of Bacteriology, 172, 5326-5334. https://doi.org/10.1128/jb.172.9.5326-5334.1990 [31] Markowitz, V.M., Chen, I.M., Palaniappan, K., Chu, K., Szeto, E., Grechkin, Y., et al. (2012) IMG: The Integrated Microbial Genomes Database and Comparative Analysis System. Nucleic Acids Research, 40, D115-D122. https://doi.org/10.1093/nar/gkr1044 [32] Deng, Z.S., Zhao, L.F., Kong, Z.Y., Yang, W.Q., Lindstrom, K., Wang, E.T., et al. (2011) Diversity of Endophytic Bacteria within Nodules of the Sphaerophysa salsula in Different Regions of Loess Plateau in China. FEMS Microbiology Ecology, 76, 463-475. https://doi.org/10.1111/j.1574-6941.2011.01063.x [33] Van Berkum, P. (1990) Evidence for a Third Uptake Hydrogenase Phenotype among the Soybean Bradyrhizobia. Applied and Environmental Microbiology, 56, 3835-3841. [34] Nagata, Y., Matsuda, M., Komatsu, H., Imura, Y., Sawada, H., Ohtsubo, Y., et al. (2005) Organization and Localization of the dnaA and dnaK Gene Regions on the Multichromosomal Genome of Burkholderia multivorans ATCC 17616. Journal of Bioscience and Bioengineering, 99, 603-610. https://doi.org/10.1263/jbb.99.603 [35] López-López, A., Rogel, M.A., Ormeno-Orrillo, E., Martínez-Romero, J. and Martínez-Romero, E. (2010) Phaseolus vulgaris Seed-Borne Endophytic Communi- ty with Novel Bacterial Species such as Rhizobium endophyticum sp. nov. Syste- matic and Applied Microbiology, 33, 322-327. https://doi.org/10.1016/j.syapm.2010.07.005 [36] Edgar, R.C. (2004) MUSCLE: Multiple Sequence Alignment with High Accuracy and High Throughput. Nucleic Acids Research, 32, 1792-1797. https://doi.org/10.1093/nar/gkh340 [37] Vaidya, G., Lohman, D.J. and Meier, R. (2011) Sequence Matrix: Concatenation Software for the Fast Assembly of Multi-Gene Datasets with Character Set and Co- don Information. Cladistics, 27, 171-180. https://doi.org/10.1111/j.1096-0031.2010.00329.x [38] Tamura, K., Stecher, G., Peterson, D., Filipski, A. and Kumar, S. (2013) MEGA6: Molecular Evolutionary Genetics Analysis Version 6.0. Molecular Biology and Evo- lution, 30, 2725-2729. https://doi.org/10.1093/molbev/mst197 [39] Benson, D.A., Cavanaugh, M., Clark, K., Karsch-Mizrachi, I., Lipman, D.J., Ostell, J., et al. (2013) GenBank. Nucleic Acids Research, 41, D36-D42. https://doi.org/10.1093/nar/gks1195 [40] Tringe, S.G. and Hugenholtz, P. (2008) A Renaissance for the Pioneering 16S rRNA

DOI: 10.4236/aim.2017.711063 808 Advances in Microbiology

D. H. Beligala et al.

Gene. Current Opinion in Microbiology, 11, 442-446. https://doi.org/10.1016/j.mib.2008.09.011 [41] Maidak, B.L., Olsen, G.J., Larsen, N., Overbeek, R., McCaughey, M.J. and Woese, C.R. (1997) The RDP (Ribosomal Database Project). Nucleic Acids Research, 25, 109-111. https://doi.org/10.1093/nar/25.1.109 [42] Teyssier, C., Marchandin, H., Simeon De Buochberg, M., Ramuz, M. and Ju- mas-Bilak, E. (2003) Atypical 16S rRNA Gene Copies in Ochrobactrum interme- dium Strains Reveal a Large Genomic Rearrangement by Recombination between rrn Copies. Journal of Bacteriology, 185, 2901-2909. https://doi.org/10.1128/JB.185.9.2901-2909.2003 [43] Kitahara, K. and Miyazaki, K. (2013) Revisiting Bacterial Phylogeny: Natural and Experimental Evidence for Horizontal Gene Transfer of 16S rRNA. Mobile Genetic Elements, 3, e24210. https://doi.org/10.4161/mge.24210 [44] Eardly, B.D., Wang, F.-S. and Van Berkum, P. (1996) Corresponding 16S rRNA Gene Segments in Rhizobiaceae and Aeromonas Yield Discordant Phylogenies. Plant and Soil, 186, 69-74. https://doi.org/10.1007/BF00035057 [45] Schouls, L.M., Schot, C.S. and Jacobs, J.A. (2003) Horizontal Transfer of Segments of the 16S rRNA Genes between Species of the Streptococcus anginosus Group. Journal of Bacteriology, 185, 7241-7246. https://doi.org/10.1128/JB.185.24.7241-7246.2003 [46] Van Berkum, P., Terefework, Z., Paulin, L., Suomalainen, S., Lindstrom, K. and Eardly, B.D. (2003) Discordant Phylogenies within the rrn Loci of Rhizobia. Journal of Bacteriology, 185, 2988-2998. https://doi.org/10.1128/JB.185.10.2988-2998.2003 [47] Lemaire, B., Van Cauwenberghe, J., Chimphango, S., Stirton, C., Honnay, O., Smets, E., et al. (2015) Recombination and Horizontal Transfer of Nodulation and ACC Deaminase (acdS) Genes within Alpha-and Betaproteobacteria Nodulating Legumes of the Cape Fynbos Biome. FEMS Microbiology Ecology, 91. [48] Eardly, B.D., Nour, S.M., van Berkum, P. and Selander, R.K. (2005) Rhizobial 16S rRNA and dnaK Genes: Mosaicism and the Uncertain Phylogenetic Placement of Rhizobium galegae. Applied and Environmental Microbiology, 71, 1328-1335. https://doi.org/10.1128/AEM.71.3.1328-1335.2005 [49] Klappenbach, J.A., Saxman, P.R., Cole, J.R. and Schmidt, T.M. (2001) rrndb: The Ribosomal RNA Operon Copy Number Database. Nucleic Acids Research, 29, 181-184. https://doi.org/10.1093/nar/29.1.181 [50] Wang, Y., Zhang, Z. and Ramanan, N. (1997) The Actinomycete Thermobispora bispora Contains Two Distinct Types of Transcriptionally Active 16S rRNA Genes. Journal of Bacteriology, 179, 3270-3276. https://doi.org/10.1128/jb.179.10.3270-3276.1997 [51] Kundig, C., Beck, C., Hennecke, H. and Gottfert, M. (1995) A Single rRNA Gene Region in Bradyrhizobium japonicum. Journal of Bacteriology, 177, 5151-5154. https://doi.org/10.1128/jb.177.17.5151-5154.1995 [52] De Bruijn, F.J. (2015) Biological Nitrogen Fixation. In: Principles of Plant-Microbe Interactions, Springer International Publishing, 215-224. [53] Willems, A., Coopman, R. and Gillis, M. (2001) Phylogenetic and DNA-DNA Hy- bridization Analyses of Bradyrhizobium Species. International Journal of Systematic and Evolutionary Microbiology, 51, 111-117. https://doi.org/10.1099/00207713-51-1-111 [54] Vinuesa, P., Silva, C., Werner, D. and Martínez-Romero, E. (2005) Population Ge-

DOI: 10.4236/aim.2017.711063 809 Advances in Microbiology

D. H. Beligala et al.

netics and Phylogenetic Inference in Bacterial Molecular Systematics: The Roles of Migration and Recombination in Bradyrhizobium Species Cohesion and Delinea- tion. Molecular Phylogenetics and Evolution, 34, 29-54. https://doi.org/10.1016/j.ympev.2004.08.020 [55] Vinuesa, P., León-Barrios, M., Silva, C., Willems, A., Jarabo-Lorenzo, A., Pérez- Galdona, R., et al. (2005) Bradyrhizobium canariense sp. nov., an Acid-Tolerant En- dosymbiont That Nodulates Endemic Genistoid Legumes (Papilionoideae: Genisteae) from the Canary Islands, along with Bradyrhizobium japonicum bv. genistearum, Bradyrhizobium genospecies alpha and Bradyrhizobium genospecies Beta. Interna- tional Journal of Systematic and Evolutionary Microbiology, 55, 569-575. https://doi.org/10.1099/ijs.0.63292-0 [56] Chahboune, R., Carro, L., Peix, A., Barrijal, S., Velázquez, E. and Bedmar, E.J. (2011) Bradyrhizobium cytisi sp. nov., Isolated from Effective Nodules of Cytisus villosus. International Journal of Systematic and Evolutionary Microbiology, 61, 2922-2927. https://doi.org/10.1099/ijs.0.027649-0 [57] Kawaguchi, A. (2011) Genetic Diversity of Rhizobium vitis Strains in Japan Based on Multilocus Sequence Analysis of pyrG, recA and rpoD. Journal of General Plant Pathology, 77, 299-303. https://doi.org/10.1007/s10327-011-0333-y [58] Lu, J., Kang, L., He, X. and Xu, D. (2011) Multilocus Sequence Analysis of the Rhi- zobia from Five Woody Legumes in Southern China. African Journal of Microbiol- ogy Research, 5, 5343-5353. [59] Zhang, Y.M., Li Jr, Y., Chen, W.F., Wang, E.T., Sui, X.H., Li, Q.Q., et al. (2012) Bradyrhizobium huanghuaihaiense sp. nov., an Effective Symbiotic Bacterium Iso- lated from Soybean (Glycine max L.) Nodules. International Journal of Systematic and Evolutionary Microbiology, 62, 1951-1957. https://doi.org/10.1099/ijs.0.034546-0 [60] Degefu, T., Wolde-Meskel, E., Liu, B., Cleenwerck, I., Willems, A. and Frostegard, A. (2013) Mesorhizobium shonense sp. nov., Mesorhizobium hawassense sp. nov. and Mesorhizobium abyssinicae sp. nov., Isolated from Root Nodules of Different Agroforestry Legume Trees. International Journal of Systematic and Evolutionary Microbiology, 63, 1746-1753. https://doi.org/10.1099/ijs.0.044032-0 [61] Wang, J.Y., Wang, R., Zhang, Y.M., Liu, H.C., Chen, W.F., Wang, E.T., et al. (2013) Bradyrhizobium daqingense sp. nov., Isolated from Soybean Nodules. International Journal of Systematic and Evolutionary Microbiology, 63, 616-624. https://doi.org/10.1099/ijs.0.034280-0 [62] Xu, K.W., Penttinen, P., Chen, Y.X., Zou, L., Zhou, T., Zhang, X., et al. (2013) Po- lyphasic Characterization of Rhizobia Isolated from Leucaena leucocephala from Panxi, China. World Journal of Microbiology and Biotechnology, 29, 2303-2315. https://doi.org/10.1007/s11274-013-1396-z [63] Delamuta, J.R.M., Ribeiro, R.A., Ormeño-Orrillo, E., Melo, I.S., Martínez-Romero, E. and Hungria, M. (2013) Polyphasic Evidence Supporting the Reclassification of Bradyrhizobium japonicum Group Ia Strains as Bradyrhizobium diazoefficiens sp. nov. International Journal of Systematic and Evolutionary Microbiology, 63, 3342-3351. https://doi.org/10.1099/ijs.0.049130-0 [64] Peeters, C., Zlosnik, J.E.A., Spilker, T., Hird, T.J., LiPuma, J.J. and Vandamme, P. (2013) Burkholderia pseudomultivorans sp. nov., a Novel Burkholderia cepacia Complex Species from Human Respiratory Samples and the Rhizosphere. Syste- matic and Applied Microbiology, 36, 483-489. https://doi.org/10.1016/j.syapm.2013.06.003

DOI: 10.4236/aim.2017.711063 810 Advances in Microbiology

D. H. Beligala et al.

[65] Gadagkar, S.R., Rosenberg, M.S. and Kumar, S. (2005) Inferring Species Phylogenies from Multiple Genes: Concatenated Sequence Tree versus Consensus Gene Tree. Journal of Experimental Zoology Part B: Molecular and Developmental Evolution, 304, 64-74. https://doi.org/10.1002/jez.b.21026 [66] Abd-Alla, M.H. (1998) Growth and Siderophore Production in Vitro of Bradyrhi- zobium (Lupin) Strains under Iron Limitation. European Journal of Soil Biology, 34, 99-104. https://doi.org/10.1016/S1164-5563(99)80007-7 [67] Abd-Alla, M.H. (1999) Nodulation and Nitrogen Fixation of Lupinus Species with Bradyrhizobium (lupin) Strains in Iron-Deficient Soil. Biology and Fertility of Soils, 28, 407-415. https://doi.org/10.1007/s003740050513 [68] Robinson, K.O., Beyene, D.A., van Berkum, P., Knight-Mason, R. and Bhardwaj, H.L. (2000) Variability in Plant-Microbe Interaction between Lupinus Lines and Bradyrhizobium Strains. Plant Science, 159, 257-264. https://doi.org/10.1016/S0168-9452(00)00345-9 [69] Peix, A., Ramirez-Bahena, M.H., Flores-Felix, J.D., Alonso de la Vega, P., Rivas, R., Mateos, P.F., et al. (2015) Revision of the Taxonomic Status of the Species Rhizo- bium lupini and Reclassification as Bradyrhizobium lupini comb. nov. International Journal of Systematic and Evolutionary Microbiology, 65, 1213-1219. https://doi.org/10.1099/ijs.0.000082 [70] Estrada-De Los Santos, P., Bustillos-Cristales, R. and Caballero-Mellado, J. (2001) Burkholderia, a Genus Rich in Plant-Associated Nitrogen Fixers with Wide Envi- ronmental and Geographic Distribution. Applied and Environmental Microbiology, 67, 2790-2798. https://doi.org/10.1128/AEM.67.6.2790-2798.2001 [71] Vandamme, P., Goris, J., Chen, W.-M., De Vos, P. and Willems, A. (2002) Burk- holderia tuberum sp. nov. and Burkholderia phymatum sp. nov., Nodulate the Roots of Tropical Legumes. Systematic and Applied Microbiology, 25, 507-512. https://doi.org/10.1078/07232020260517634 [72] Elliott, G.N., Chen, W., Chou, J., Wang, H., Sheu, S., Perin, L., et al. (2007) Burk- holderia phymatum Is a Highly Effective Nitrogen-Fixing Symbiont of Mimosa spp. and Fixes Nitrogen ex Planta. New Phytologist, 173, 168-180. https://doi.org/10.1111/j.1469-8137.2006.01894.x [73] Gyaneshwar, P., Hirsch, A.M., Moulin, L., Chen, W.-M., Elliott, G.N., Bontemps, C., et al. (2011) Legume-Nodulating Betaproteobacteria: Diversity, Host Range, and Future Prospects. Molecular Plant-Microbe Interactions, 24, 1276-1288. https://doi.org/10.1094/MPMI-06-11-0172 [74] Martínez-Aguilar, L., Salazar-Salazar, C., Méndez, R.D., Caballero-Mellado, J., Hirsch, A.M., Vásquez-Murrieta, M.S., et al. (2013) Burkholderia caballeronis sp. nov., a Nitrogen Fixing Species Isolated from Tomato (Lycopersicon esculentum) with the Ability to Effectively Nodulate Phaseolus vulgaris. Antonie van Leeuwen- hoek, 104, 1063-1071. https://doi.org/10.1007/s10482-013-0028-9 [75] Lemaire, B., Van Cauwenberghe, J., Verstraete, B., Chimphango, S., Stirton, C., Honnay, O., et al. (2016) Characterization of the Papilionoid-Burkholderia Interac- tion in the Fynbos Biome: The Diversity and Distribution of Beta-Rhizobia Nodu- lating Podalyria calyptrata (Fabaceae, Podalyrieae). Systematic and Applied Micro- biology, 39, 41-48. https://doi.org/10.1016/j.syapm.2015.09.006 [76] Chen, W.M., Moulin, L., Bontemps, C., Vandamme, P., Bena, G. and Boi- vin-Masson, C. (2003) Legume Symbiotic Nitrogen Fixation by Beta-Proteobacteria Is Widespread in Nature. Journal of Bacteriology, 185, 7266-7272. https://doi.org/10.1128/JB.185.24.7266-7272.2003

DOI: 10.4236/aim.2017.711063 811 Advances in Microbiology

D. H. Beligala et al.

[77] Estrada-De Los Santos, P., Vinuesa, P., Martínez-Aguilar, L., Hirsch, A.M. and Ca- ballero-Mellado, J. (2013) Phylogenetic Analysis of Burkholderia Species by Multi- locus Sequence Analysis. Current Microbiology, 67, 51-60. https://doi.org/10.1007/s00284-013-0330-9 [78] Solca, N.M., Bernasconi, M.V., Valsangiacomo, C., Van Doorn, L.-J. and Piffaretti, J.-C. (2001) Population Genetics of Helicobacter pylori in the Southern Part of Switzerland Analysed by Sequencing of Four Housekeeping Genes (atpD, glnA, scoB and recA), and by vacA, cagA, iceA and IS605 Genotyping. Microbiology, 147, 1693-1707. https://doi.org/10.1099/00221287-147-6-1693 [79] Tian, C.F., Young, J.P.W., Wang, E.T., Tamimi, S.M. and Chen, W.X. (2010) Popu- lation Mixing of Rhizobium leguminosarum bv. viciae Nodulating Vicia faba: The Role of Recombination and Lateral Gene Transfer. FEMS Microbiology Ecology, 73, 563-576. [80] Ridderberg, W., Wang, M. and Norskov-Lauritsen, N. (2012) Multilocus Sequence Analysis of Isolates of Achromobacter from Patients with Cystic Fibrosis Reveals Infecting Species Other than Achromobacter xylosoxidans. Journal of Clinical Mi- crobiology, 50, 2688-2694. https://doi.org/10.1128/JCM.00728-12

DOI: 10.4236/aim.2017.711063 812 Advances in Microbiology