DOCSLIB.ORG

EPS8L1 (NM 017729) Human Untagged Clone – SC320420

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
EPS8L1 (NM 017729) Human Untagged Clone – SC320420 OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC320420 EPS8L1 (NM_017729) Human Untagged Clone Product data: Product Type: Expression Plasmids Product Name: EPS8L1 (NM_017729) Human Untagged Clone Tag: Tag Free Symbol: EPS8L1 Synonyms: DRC3; EPS8R1; PP10566 Vector: pCMV6-AC (PS100020) E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: Neomycin This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 3 EPS8L1 (NM_017729) Human Untagged Clone – SC320420 Fully Sequenced ORF: >OriGene sequence for NM_017729.2 AAGTTCTGGAAGGCAGTGGGGTTTGAGATTGGACCCAGGGTCAAGATAGAACATGAAGGT GGGATGAGGACATGAACAGAACATGGCCAAGAAGGATCTGGGGGAGCAGCCAGGACGAGG CGGAGCTGATCCGAGAGGACATCCAGGGGGCTCTGCACAATTACCGCTCGGGCCGCGGGG AGCGCAGGGCGGCGGCGCTCAGGGCCACGCAGGAGGAGTTGCAGCGCGACCGCTCGCCCG CCGCTGAGACCCCGCCCCTGCAGCGCCGCCCGTCAGTCCGCGCAGTGATCAGCACCGTAG AGCGGGGCGCGGGCCGCGGACGACCCCAGGCGAAGCCCATTCCCGAGGCAGAGGAGGCGC AGAGGCCTGAGCCGGTGGGGACCTCGAGCAACGCTGACTCGGCCTCCCCGGACCTGGGTC CCCGGGGTCCTGACCTGGCGGTTCTGCAGGCGGAGCGGGAAGTGGACATCCTGAACCACG TGTTCGACGACGTAGAGAGCTTTGTATCGAGGCTGCAGAAGTCGGCGGAGGCGGCCAGGG TGCTGGAGCACCGGGAACGCGGCCGCAGGAGCCGGCGCCGGGCGGCTGGGGAGGGCTTGC TGACGCTGCGGGCCAAGCCGCCCTCGGAGGCCGAGTACACCGACGTGCTGCAGAAGATCA AGTACGCCTTCAGCCTGCTGGCCCGGCTGCGCGGCAACATCGCCGACCCCTCCTCTCCGG AGCTGTTGCACTTCCTTTTCGGGCCTCTGCAGATGATTGTGAACACGTCGGGGGGGCCGG AGTTCGCGAGCAGTGTGCGGCGGCCGCATCTGACATCGGATGCCGTGGCGCTGCTGCGGG ACAACGTCACTCCACGTGAAAACGAGCTCTGGACCTCGCTGGGGGACTCGTGGACCCGCC CCGGGCTGGAGCTGTCCCCGGAGGAGGGACCCCCATACAGACCCGAGTTCTTCAGCGGCT GGGAGCCGCCGGTCACTGACCCGCAGAGCCGCGCCTGGGAGGACCCAGTTGAGAAACAGC TACAGCACGAGCGGAGGCGCCGGCAGCAAAGCGCCCCCCAGGTCGCTGTCAATGGTCACC GAGACTTGGAGCCAGAATCTGAGCCTCAGCTGGAGTCAGAGACAGCAGGAAAATGGGTCC TGTGTAATTATGACTTCCAGGCCCGCAACAGCAGTGAGCTGTCGGTCAAGCAGCGGGACG TACTGGAGGTCCTGGATGACAGTCGTAAGTGGTGGAAGGTTCGGGACCCAGCGGGGCAGG AGGGATATGTGCCCTACAACATCCTGACACCCTACCCCGGACCCCGGCTGCACCACAGCC AAAGCCCTGCCCGCAGCCTGAACAGCACTCCTCCTCCACCACCAGCCCCAGCCCCGGCCC CACCTCCAGCTCTGGCTCGGCCCCGCTGGGACAGGCCCCGCTGGGACAGCTGCGATAGCC TCAACGGCTTGGACCCCAGCGAGAAGGAGAAATTCTCCCAGATGCTCATCGTCAACGAGG AACTGCAGGCGCGCCTGGCCCAGGGCCGCTCGGGACCGAGCCGCGCAGTCCCAGGGCCCC GCGCCCCGGAACCGCAGCTCAGCCCGGGCTCGGACGCCTCCGAGGTCCGCGCCTGGCTGC AGGCCAAGGGCTTTAGCTCCGGGACCGTGGACGCGCTGGGTGTGCTGACCGGGGCGCAGC TTTTCTCGCTGCAGAAGGAGGAGCTGCGGGCGGTGAGCCCCGAGGAGGGGGCACGTGTGT ACAGCCAGGTCACCGTGCAGCGCTCGCTGCTGGAGGACAAAGAGAAAGTGTCAGAGCTGG AGGCAGTGATGGAGAAGCAAAAGAAGAAGGTGGAAGGCGAGGTGGAAATGGAGGTCATTT GACCTGCCAGGCGCCCTTCGCAAAGAGTGACGAGGCCCCGTGGGAGAACGGACTCCTCAG ACTCTCCCCAATAGCGGAAGTCGATTTTTTGAAGGATGGCCAATTTGCTCCGGCCCTGGT TTTCCCCCATCCCGGTGGACAGACTTAACGATCCTTGCTGCAGTCCCTCCGGAGAGGATT TGGACTGGCTGGGAGTGGGGAGGGCGTGGAGACAGTTTACGGAAAGCGCTAGCAGACCCC CGAGAGGGTGCAGTGGAGCCCTGAGCATTGTAATATGCGGCCCAGCCTATAAACAGCCTC CGTGCTTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA Restriction Sites: Please inquire ACCN: NM_017729 OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. This product is to be used for laboratory only. Not for diagnostic or therapeutic use. ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 2 / 3 EPS8L1 (NM_017729) Human Untagged Clone – SC320420 RefSeq: NM_017729.2, NP_060199.2 RefSeq Size: 2221 bp RefSeq ORF: 1791 bp Locus ID: 54869 UniProt ID: Q8TE68 Protein Families: Druggable Genome Gene Summary: This gene encodes a protein that is related to epidermal growth factor receptor pathway substrate 8 (EPS8), a substrate for the epidermal growth factor receptor. The function of this protein is unknown. At least two alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) differs in the 5' UTR and contains an alternate in-frame segment in the 5' coding region compared to variant 1. It encodes a shorter isoform (b) with a different N-terminus compared to isoform a. This product is to be used for laboratory only. Not for diagnostic or therapeutic use. ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 3 / 3.
Load more

Recommended publications
  • Replace This with the Actual Title Using All Caps
    UNDERSTANDING THE GENETICS UNDERLYING MASTITIS USING A MULTI-PRONGED APPROACH A Dissertation Presented to the Faculty of the Graduate School of Cornell University In Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy by Asha Marie Miles December 2019 © 2019 Asha Marie Miles UNDERSTANDING THE GENETICS UNDERLYING MASTITIS USING A MULTI-PRONGED APPROACH Asha Marie Miles, Ph. D. Cornell University 2019 This dissertation addresses deficiencies in the existing genetic characterization of mastitis due to granddaughter study designs and selection strategies based primarily on lactation average somatic cell score (SCS). Composite milk samples were collected across 6 sampling periods representing key lactation stages: 0-1 day in milk (DIM), 3- 5 DIM, 10-14 DIM, 50-60 DIM, 90-110 DIM, and 210-230 DIM. Cows were scored for front and rear teat length, width, end shape, and placement, fore udder attachment, udder cleft, udder depth, rear udder height, and rear udder width. Independent multivariable logistic regression models were used to generate odds ratios for elevated SCC (≥ 200,000 cells/ml) and farm-diagnosed clinical mastitis. Within our study cohort, loose fore udder attachment, flat teat ends, low rear udder height, and wide rear teats were associated with increased odds of mastitis. Principal component analysis was performed on these traits to create a single new phenotype describing mastitis susceptibility based on these high-risk phenotypes. Cows (N = 471) were genotyped on the Illumina BovineHD 777K SNP chip and considering all 14 traits of interest, a total of 56 genome-wide associations (GWA) were performed and 28 significantly associated quantitative trait loci (QTL) were identified.
    [Show full text]
  • Effects and Mechanisms of Eps8 on the Biological Behaviour of Malignant Tumours (Review)
    824 ONCOLOGY REPORTS 45: 824-834, 2021 Effects and mechanisms of Eps8 on the biological behaviour of malignant tumours (Review) KAILI LUO1, LEI ZHANG2, YUAN LIAO1, HONGYU ZHOU1, HONGYING YANG2, MIN LUO1 and CHEN QING1 1School of Pharmaceutical Sciences and Yunnan Key Laboratory of Pharmacology for Natural Products, Kunming Medical University, Kunming, Yunnan 650500; 2Department of Gynecology, Yunnan Tumor Hospital and The Third Affiliated Hospital of Kunming Medical University; Kunming, Yunnan 650118, P.R. China Received August 29, 2020; Accepted December 9, 2020 DOI: 10.3892/or.2021.7927 Abstract. Epidermal growth factor receptor pathway substrate 8 1. Introduction (Eps8) was initially identified as the substrate for the kinase activity of EGFR, improving the responsiveness of EGF, which Malignant tumours are uncontrolled cell proliferation diseases is involved in cell mitosis, differentiation and other physiological caused by oncogenes and ultimately lead to organ and body functions. Numerous studies over the last decade have demon- dysfunction (1). In recent decades, great progress has been strated that Eps8 is overexpressed in most ubiquitous malignant made in the study of genes and signalling pathways in tumours and subsequently binds with its receptor to activate tumorigenesis. Eps8 was identified by Fazioli et al in NIH-3T3 multiple signalling pathways. Eps8 not only participates in the murine fibroblasts via an approach that allows direct cloning regulation of malignant phenotypes, such as tumour proliferation, of intracellular substrates for receptor tyrosine kinases (RTKs) invasion, metastasis and drug resistance, but is also related to that was designed to study the EGFR signalling pathway. Eps8 the clinicopathological characteristics and prognosis of patients.
    [Show full text]
  • Human Induced Pluripotent Stem Cell–Derived Podocytes Mature Into Vascularized Glomeruli Upon Experimental Transplantation
    BASIC RESEARCH www.jasn.org Human Induced Pluripotent Stem Cell–Derived Podocytes Mature into Vascularized Glomeruli upon Experimental Transplantation † Sazia Sharmin,* Atsuhiro Taguchi,* Yusuke Kaku,* Yasuhiro Yoshimura,* Tomoko Ohmori,* ‡ † ‡ Tetsushi Sakuma, Masashi Mukoyama, Takashi Yamamoto, Hidetake Kurihara,§ and | Ryuichi Nishinakamura* *Department of Kidney Development, Institute of Molecular Embryology and Genetics, and †Department of Nephrology, Faculty of Life Sciences, Kumamoto University, Kumamoto, Japan; ‡Department of Mathematical and Life Sciences, Graduate School of Science, Hiroshima University, Hiroshima, Japan; §Division of Anatomy, Juntendo University School of Medicine, Tokyo, Japan; and |Japan Science and Technology Agency, CREST, Kumamoto, Japan ABSTRACT Glomerular podocytes express proteins, such as nephrin, that constitute the slit diaphragm, thereby contributing to the filtration process in the kidney. Glomerular development has been analyzed mainly in mice, whereas analysis of human kidney development has been minimal because of limited access to embryonic kidneys. We previously reported the induction of three-dimensional primordial glomeruli from human induced pluripotent stem (iPS) cells. Here, using transcription activator–like effector nuclease-mediated homologous recombination, we generated human iPS cell lines that express green fluorescent protein (GFP) in the NPHS1 locus, which encodes nephrin, and we show that GFP expression facilitated accurate visualization of nephrin-positive podocyte formation in
    [Show full text]
  • EPS8L1 293T Cell Transient Overexpression Lysate(Denatured)
    Produktinformation Diagnostik & molekulare Diagnostik Laborgeräte & Service Zellkultur & Verbrauchsmaterial Forschungsprodukte & Biochemikalien Weitere Information auf den folgenden Seiten! See the following pages for more information! Lieferung & Zahlungsart Lieferung: frei Haus Bestellung auf Rechnung SZABO-SCANDIC Lieferung: € 10,- HandelsgmbH & Co KG Erstbestellung Vorauskassa Quellenstraße 110, A-1100 Wien T. +43(0)1 489 3961-0 Zuschläge F. +43(0)1 489 3961-7 [email protected] • Mindermengenzuschlag www.szabo-scandic.com • Trockeneiszuschlag • Gefahrgutzuschlag linkedin.com/company/szaboscandic • Expressversand facebook.com/szaboscandic EPS8L1 293T Cell Transient Overexpression Lysate(Denatured) Catalog # : H00054869-T01 規格 : [ 100 uL ] List All Specification Application Image Transfected 293T Western Blot Cell Line: Plasmid: pCMV-EPS8L1 full-length Host: Human Theoretical MW 60.72 (kDa): Quality Control Transient overexpression cell lysate was tested with Anti-EPS8L1 Testing: antibody (H00054869-B01) by Western Blots. SDS-PAGE Gel EPS8L1 transfected lysate. Western Blot Lane 1: EPS8L1 transfected lysate ( 60.72 KDa) Lane 2: Non-transfected lysate. Storage Buffer: 1X Sample Buffer (50 mM Tris-HCl, 2% SDS, 10% glycerol, 300 mM 2- mercaptoethanol, 0.01% Bromophenol blue) Storage Store at -80°C. Aliquot to avoid repeated freezing and thawing. Instruction: MSDS: Download Applications Page 1 of 2 2016/5/23 Western Blot Gene Information Entrez GeneID: 54869 GeneBank NM_139204.1 Accession#: Protein NP_631943.1 Accession#: Gene Name: EPS8L1 Gene Alias: DRC3,EPS8R1,FLJ20258,MGC23164,MGC4642,PP10566 Gene EPS8-like 1 Description: Gene Ontology: Hyperlink Gene Summary: This gene encodes a protein that is related to epidermal growth factor receptor pathway substrate 8 (EPS8), a substrate for the epidermal growth factor receptor. The function of this protein is unknown.
    [Show full text]
  • Dissertation Thesis Phd Dysregulated Trophoblast-Specific Gene
    Dysregulated trophoblast-specific gene expression mediated by retroviral regulatory sequences contributes to preeclampsia (PE) Dissertation zur Erlangung des akademischen Grades Doctor of Philosophy (PhD) im Fach Biologie eingereicht an der Lebenswissenschaftlichen Fakultät der Humboldt-Universität zu Berlin von Master of Science Rabia Anwar Präsident der Humboldt-Universität zu Berlin Prof. Dr.-Ing. Dr. Sabine Kunst Dekan der der Lebenswissenschaftlichen Fakultät Prof. Dr. Bernhard Grimm Gutachter: 1. Prof. Dr. Ana Pombo 2. Prof. Dr. Kai Schmidt-Ott 3. Dr. Zsuzsanna Izsvák Tag der mündlichen Prüfung: 30th September 2020 i Content Content Summary ................................................................................................................................... 1 Zusammenfassung .................................................................................................................... 3 1. Background and Introduction......................................................................................... 5 1.1. Preeclampsia (PE) ............................................................................................................. 5 1.2. Healthy pregnancy ............................................................................................................ 6 1.2.1. Placenta development in a healthy pregnancy ................................................................. 6 1.2.2. Placenta tissue composition ............................................................................................
    [Show full text]
  • Identification of Core Genes Involved in the Progression of Cervical
    International Journal of Molecular Sciences Article Identification of Core Genes Involved in the Progression of Cervical Cancer Using an Integrative mRNA Analysis Marina Dudea-Simon 1, Dan Mihu 1, Alexandru Irimie 2,3, Roxana Cojocneanu 4, Schuyler S. Korban 5, Radu Oprean 6, Cornelia Braicu 4,* and Ioana Berindan-Neagoe 4,7 1 2nd Obstetrics and Gynecology Department, “Iuliu Hatieganu” University of Medicine and Pharmacy, 400012 Cluj-Napoca, Romania; [email protected] (M.D.-S.); [email protected] (D.M.) 2 Department of Surgery, “Prof. Dr. Ion Chiricuta” Oncology Institute, 400015 Cluj-Napoca, Romania; [email protected] 3 Department of Surgical Oncology and Gynecological Oncology, Iuliu Hatieganu University of Medicine and Pharmacy, 400012 Cluj-Napoca, Romania 4 Research Center for Functional Genomics, Biomedicine and Translational Medicine, Iuliu Hatieganu University of Medicine and Pharmacy, 23 Marinescu Street, 400337 Cluj-Napoca, Romania; [email protected] (R.C.); [email protected] (I.B.-N.) 5 Department of Natural and Environmental Sciences, University of Illinois at Urbana-Champaign, Urbana, IL 61801, USA; [email protected] 6 Analytical Chemistry Department, Iuliu Hatieganu University of Medicine and Pharmacy, 4, Louis Pasteur Street, 400349 Cluj-Napoca, Romania; [email protected] 7 Department of Functional Genomics and Experimental Pathology, “Prof. Dr. Ion Chiricu¸tă” Oncology Institute, 34-36 Republicii Street, 400015 Cluj-Napoca, Romania * Correspondence: [email protected] Received: 5 September 2020; Accepted: 1 October 2020; Published: 3 October 2020 Abstract: In spite of being a preventable disease, cervical cancer (CC) remains at high incidence, and it has a significant mortality rate. Although hijacking of the host cellular pathway is fundamental for developing a better understanding of the human papillomavirus (HPV) pathogenesis, a major obstacle is identifying the central molecular targets involved in HPV-driven CC.
    [Show full text]
  • 393LN V 393P 344SQ V 393P Probe Set Entrez Gene
    393LN v 393P 344SQ v 393P Entrez fold fold probe set Gene Gene Symbol Gene cluster Gene Title p-value change p-value change chemokine (C-C motif) ligand 21b /// chemokine (C-C motif) ligand 21a /// chemokine (C-C motif) ligand 21c 1419426_s_at 18829 /// Ccl21b /// Ccl2 1 - up 393 LN only (leucine) 0.0047 9.199837 0.45212 6.847887 nuclear factor of activated T-cells, cytoplasmic, calcineurin- 1447085_s_at 18018 Nfatc1 1 - up 393 LN only dependent 1 0.009048 12.065 0.13718 4.81 RIKEN cDNA 1453647_at 78668 9530059J11Rik1 - up 393 LN only 9530059J11 gene 0.002208 5.482897 0.27642 3.45171 transient receptor potential cation channel, subfamily 1457164_at 277328 Trpa1 1 - up 393 LN only A, member 1 0.000111 9.180344 0.01771 3.048114 regulating synaptic membrane 1422809_at 116838 Rims2 1 - up 393 LN only exocytosis 2 0.001891 8.560424 0.13159 2.980501 glial cell line derived neurotrophic factor family receptor alpha 1433716_x_at 14586 Gfra2 1 - up 393 LN only 2 0.006868 30.88736 0.01066 2.811211 1446936_at --- --- 1 - up 393 LN only --- 0.007695 6.373955 0.11733 2.480287 zinc finger protein 1438742_at 320683 Zfp629 1 - up 393 LN only 629 0.002644 5.231855 0.38124 2.377016 phospholipase A2, 1426019_at 18786 Plaa 1 - up 393 LN only activating protein 0.008657 6.2364 0.12336 2.262117 1445314_at 14009 Etv1 1 - up 393 LN only ets variant gene 1 0.007224 3.643646 0.36434 2.01989 ciliary rootlet coiled- 1427338_at 230872 Crocc 1 - up 393 LN only coil, rootletin 0.002482 7.783242 0.49977 1.794171 expressed sequence 1436585_at 99463 BB182297 1 - up 393
    [Show full text]
  • Evaluation of Proteomic and Transcriptomic Biomarker Discovery
    EVALUATION OF PROTEOMIC AND TRANSCRIPTOMIC BIOMARKER DISCOVERY TECHNOLOGIES IN OVARIAN CANCER. CLARE RITA ELIZABETH COVENEY A thesis submitted in partial fulfilment of the requirements of the Nottingham Trent University for the degree of Doctor of Philosophy October 2016 Copyright Statement “This work is the intellectual property of the author. You may copy up to 5% of this work for private study, or personal, non-commercial research. Any re-use of the information contained within this document should be fully referenced, quoting the author, title, university, degree level and pagination. Queries or requests for any other use, or if a more substantial copy is required, should be directed in the owner(s) of the Intellectual Property Rights.” Acknowledgments This work was funded by The John Lucille van Geest Foundation and undertaken at the John van Geest Cancer Research Centre, at Nottingham Trent University. I would like to extend my foremost gratitude to my supervisory team Professor Graham Ball, Dr David Boocock, Professor Robert Rees for their guidance, knowledge and advice throughout the course of this project. I would also like to show my appreciation of the hard work of Mr Ian Scott, Professor Bob Shaw and Dr Matharoo-Ball, Dr Suman Malhi and later Mr Viren Asher who alongside colleagues at The Nottingham University Medical School and Derby City General Hospital initiated the ovarian serum collection project that lead to this work. I also would like to acknowledge the work of Dr Suha Deen at Queen’s Medical Centre and Professor Andrew Green and Christopher Nolan of the Cancer & Stem Cells Division of the School of Medicine, University of Nottingham for support with the immunohistochemistry.
    [Show full text]
  • Site-Specific Integration of Adeno-Associated Virus Involves Partial Duplication of the Target Locus
    Site-specific integration of adeno-associated virus involves partial duplication of the target locus Els Henckaertsa, Nathalie Dutheila, Nadja Zeltnerb, Steven Kattmanc, Erik Kohlbrennerb, Peter Wardd, Nathalie Cle´ mentb, Patricia Rebollob, Marion Kennedyc, Gordon M. Kellerc, and R. Michael Lindena,b,1 aDepartment of Infectious Diseases, King’s College London School of Medicine, London SE1 9RT, United Kingdom; Departments of bGene and Cell Medicine and dMedicine, Mount Sinai School of Medicine, One Gustave L. Levy Place, New York, NY 10029; and cMcEwen Centre for Regenerative Medicine, University Health Network, Toronto, ON, Canada M5G 1L7 Edited by Kenneth I. Berns, University of Florida College of Medicine, Gainesville, FL, and approved March 9, 2009 (received for review July 21, 2008) A variety of viruses establish latency by integrating their genome identified within AAVS1 (14). The MBS85 protein is thought to be into the host genome. The integration event generally occurs in a involved in the regulation of actin–myosin fiber assembly, and its nonspecific manner, precluding the prediction of functional con- translation initiation start codon is located only 17 nt downstream sequences from resulting disruptions of affected host genes. The of the RBS (14, 15). The AAVS1 locus is also closely linked to the nonpathogenic adeno-associated virus (AAV) is unique in its ability muscle-specific genes TNNT1, encoding slow skeletal muscle tro- to stably integrate in a site-specific manner into the human MBS85 ponin T, and TNNI3, encoding cardiac troponin I (16). gene. To gain a better understanding of the integration mechanism The fact that AAVS1 is located in a highly gene-dense region and and the consequences of MBS85 disruption, we analyzed the that virtually all viral–cellular junctions are found within MBS85 molecular structure of AAV integrants in various latently infected highlights the potential complexity of the integration mechanism human cell lines.
    [Show full text]
  • Identification and Mechanistic Investigation of Recurrent Functional Genomic and Transcriptional Alterations in Advanced Prostat
    Identification and Mechanistic Investigation of Recurrent Functional Genomic and Transcriptional Alterations in Advanced Prostate Cancer Thomas A. White A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy University of Washington 2013 Reading Committee: Peter S. Nelson, Chair Janet L. Stanford Raymond J. Monnat Jay A. Shendure Program Authorized to Offer Degree: Molecular and Cellular Biology ©Copyright 2013 Thomas A. White University of Washington Abstract Identification and Mechanistic Investigation of Recurrent Functional Genomic and Transcriptional Alterations in Advanced Prostate Cancer Thomas A. White Chair of the Supervisory Committee: Peter S. Nelson, MD Novel functionally altered transcripts may be recurrent in prostate cancer (PCa) and may underlie lethal and advanced disease and the neuroendocrine small cell carcinoma (SCC) phenotype. We conducted an RNASeq survey of the LuCaP series of 24 PCa xenograft tumors from 19 men, and validated observations on metastatic tumors and PCa cell lines. Key findings include discovery and validation of 40 novel fusion transcripts including one recurrent chimera, many SCC-specific and castration resistance (CR) -specific novel splice isoforms, new observations on SCC-specific and TMPRSS2-ERG specific differential expression, the allele-specific expression of certain recurrent non- synonymous somatic single nucleotide variants (nsSNVs) previously discovered via exome sequencing of the same tumors, rgw ubiquitous A-to-I RNA editing of base excision repair (BER) gene NEIL1 as well as CDK13, a kinase involved in RNA splicing, and the SCC expression of a previously unannotated long noncoding RNA (lncRNA) at Chr6p22.2. Mechanistic investigation of the novel lncRNA indicates expression is regulated by derepression by master neuroendocrine regulator RE1-silencing transcription factor (REST), and may regulate some genes of axonogenesis and angiogenesis.
    [Show full text]
  • Exome Sequencing Identified a Missense Mutation of EPS8L3 In
    New loci ORIGINAL ARTICLE Exome sequencing identified a missense mutation of EPS8L3 in Marie Unna hereditary hypotrichosis Xin Zhang,1,2 Bi-Rong Guo,1,2 Li-Qiong Cai,1,2 Tao Jiang,3 Liang-Dan Sun,1,2 Yong Cui,1,2 Jing-Chu Hu,3 Jun Zhu,1,2 Gang Chen,2 Xian-Fa Tang,1,2 Guang-Qing Sun,3 Hua-Yang Tang,1,2 Yuan Liu,1,2 Min Li,1,2 Qi-Bin Li,3 Hui Cheng,1,2 Min Gao,1,2 Ping Li,1,2 Xu Yang,3 Xian-Bo Zuo,2 Xiao-Dong Zheng,2 Pei-Guang Wang,1,2 Jian Wang,3 Jun Wang,3 Jian-Jun Liu,2 Sen Yang,1,2 Ying-Rui Li,3 Xue-Jun Zhang1,2 1Department of Dermatology, ABSTRACT papules of head and neck. Individuals with HHS Institute of Dermatology, Background Marie Unna hereditary hypotrichosis typically show normal hair at birth, but hair loss No. 1 Hospital, Anhui Medical University, Hefei, Anhui, China (MUHH) is an autosomal dominant disorder and thinning of the hair shaft start without charac- 2State Key Laboratory characterised by coarse, wiry, twisted hair developed in teristic hair shaft anomalies during early childhood Incubation Base of early childhood and subsequent progressive hair loss. and progress with age. The affected individuals of Dermatology, Ministry of MUHH is a genetically heterogeneous disorder. No gene HHS are affected scalp hair and/or body hair. The National Science and in 1p21.1–1q21.3 region responsible for MUHH has been individuals with localised autosomal recessive Technology, Hefei, Anhui, China fi 3Beijing Genomics Institute- identi ed.
    [Show full text]
  • KRAB Zinc Finger Protein Diversification Drives Mammalian Interindividual Methylation Variability
    KRAB zinc finger protein diversification drives mammalian interindividual methylation variability Tessa M. Bertozzia, Jessica L. Elmera, Todd S. Macfarlanb, and Anne C. Ferguson-Smitha,1 aDepartment of Genetics, University of Cambridge, CB2 3EH Cambridge, United Kingdom; and bThe Eunice Kennedy Shriver National Institute of Child Health and Human Development, The National Institutes of Health, Bethesda, MD 20892 Edited by Peter A. Jones, Van Andel Institute, Grand Rapids, MI, and approved October 28, 2020 (received for review August 19, 2020) Most transposable elements (TEs) in the mouse genome are DNA methylation of the Avy IAP is established early in devel- heavily modified by DNA methylation and repressive histone opment across genetically identical mice and is correlated with a modifications. However, a subset of TEs exhibit variable methyl- spectrum of coat color phenotypes, which in turn display trans- ation levels in genetically identical individuals, and this is associated generational inheritance and environmental sensitivity (11–13). with epigenetically conferred phenotypic differences, environ- Both the distribution and heritability of Avy phenotypes are mental adaptability, and transgenerational epigenetic inheritance. influenced by genetic background (14–16). Therefore, the iden- The evolutionary origins and molecular mechanisms underlying tification and characterization of the responsible modifier genes interindividual epigenetic variability remain unknown. Using a can provide insight into the mechanisms governing the early repertoire of murine variably methylated intracisternal A-particle establishment of stochastic methylation states at mammalian (VM-IAP) epialleles as a model, we demonstrate that variable DNA transposable elements. methylation states at TEs are highly susceptible to genetic back- We recently conducted a genome-wide screen for individual ground effects.
    [Show full text]